Você está na página 1de 364

PROVAS

UNICAMP
2015-2020
1ª E 2ª FASE
SEPARADA POR ASSUNTO
E O QUE MAIS CAI
Considerações
importantes
1) Espero que esse material possa ser útil na jornada
da sua aprovação! Deu certo trabalho mas fiz com
dedicação. Estude com mais atenção os assuntos que
mais caem sem negligenciar os outros, na primeira
fase separei as matérias por cores para facilitar a
identificação. As questões da segunda fase eu deixei
a folha original do vestibular caso queira imprimir,
porém coloquei uma capa no início de cada matéria e
assunto para ficar organizado.

2) Qualquer problema que tiver com arquivo fale


comigo (Luciana Oliveira) pelo meu instagram
@lucistudies

3) Não distribua o arquivo para outras pessoas e nem


diga que foi feito por você
Índice
Biologia .............................................................................................. 3
Gabarito .............................................................................................................................. 18

Literatura ......................................................................................... 19
Gabarito .............................................................................................................................. 53

Matemática ..................................................................................... 54
Gabarito .............................................................................................................................. 69

Inglês ................................................................................................ 70
Gabarito .............................................................................................................................. 91

Sociologia......................................................................................... 71
Gabarito ............................................................................................................................. 95

Filosofia........................................................................................... 96
Gabarito .............................................................................................................................. 98

História ............................................................................................ 99
Gabarito ............................................................................................................................ 119

Física .............................................................................................. 120


Gabarito ............................................................................................................................ 141

Geografia ....................................................................................... 121


Gabarito ........................................................................................................................... 168

Química......................................................................................... 169
Gabarito ........................................................................................................................... 186
O que mais cai na 4) Zoologia (7 questões)

5) Fisiologia (5 questões)
primeira fase nos 6) Evolução (5 questões)
últimos cinco anos 7)Genética (5 questões)

8) Citologia (4 questões)

Português e literatura: 9) Código genético (3 questões)

1) Interpretação de texto e leituras 10) Origem da vida, histologia,


obrigatórias (61 questões) classificação dos seres vivos, embriologia,
divisão celular ( 1 questão de cada)
2) Modernismo (15 questões)

3) Naturalismo e Realismo (7 questões)


Sociologia:
4)Romântismo (2 questões)
1) Estado, Poder e Política (4 questões)
5) Barroco e Clacissimo (1 questão de
cada) 2) Movimentos sociais (2 questões)

3) questão racial, gênero e indígena (1


questão)
Matemática:

1) Funções (12 questões)


Filosofia:
2) Geometria Plana (12 questões)
1) Filosofia Política (3 questões)
3) Polinômios ( 7 questões)
2) Etica e moral, filosofia medieval e
4) Matriz ( 7questões) temática (1 questão)
5) Geometria Analítica (6 questões)

6) Probabilidade (5 questões) História:


7) Matemática básica (4 questões) 1) Brasil colônia (8 questões)
8) Números complexos (4 questões) 2) Brasil império (5 questões)
9) Sistemas lineares (4 questões) 3) Idade média (5 questões)
10) Matemática financeira (4 questões) 4) Guerras Mundiais e regimes totalitários
(5 questões)
11) P.A (3 questões)
5) Ditadura Militar (4 questões)
12) Análise Combinatória (2 questões)
6) Conhecimentos gerais (4 questões)
13) Razão e proporção (2 questões)
7) República velha (3 questões)
14) Logaritmo, Conjuntos, Trigonometria,
P.G, Estatística (1 questão de cada) 8) Renascimento (3 questões)

9) Grécia e Roma ( 3 questões)


Biologia: 10) Governos Populistas (2 questões)
1) Botânica e fotossíntese ( 11 questões) 11) Era Vargas ( 2 questões)
2) Doenças causadas por vírus, 12) Guerra Fria ( 2 questões)
protozoários, bactérias (7 questões)

3) Ecologia (7 questões)
Física: Química:

1) Cinemática (11 questões) 1) Propriedades físico-químicas (9


questões)
2) Eletrodinâmica (9 questões)
2) Termoquímica (8 questões)
3) Óptica (7 questões)
3) Estequiometria (6 questões)
4) Calorimetria (7 questões)
4) Equilíbrio químico (5 questões)
5) Dinâmica (6 questões)
5) Inorgânica e Soluções (4 questões de
6) Trabalho e energia (5 questões) cada)
7) Gravitação Universal (4 questões) 6) Propriedades Coligativas (3 questões)
8) Impulso e quantidade de movimento (3 7) Introdução à química, reações
questões) orgânicas, gases (2 questões de cada)
9) Hidroestática (3 questões) 8) Cinética química, Isomeria, Interações,
10) Ondulatória (3 questões) Radioatividade e eletroquímica ( 1 questão
de cada)
11) Gases (2 questões)

12) Termologia (2 questões)

13) MCU, Estática, Física Moderna,


Gaeses (1 questão)

Geografia:

1) Questões ambientais (6 questões)

2) Geografia Regional (6 questões)

3) Clima (6 questões)

4) População, Urbanização, Cartografia (5


questões de cada)

5) Vegetação, Migração e Geologia (4


questões de cada)

6) Hidrografia, Energia, Relevo, África (3


questões de cada)

7) Globalização, Transportes, Indústria (2


questões)

8) Ásia, Geopolítica (1 questão)


Biologia
apenas pelas regiões de atividade A e C, e a
flor conterá apenas sépalas e carpelo
(imagem II). Assinale a alternativa correta.

BOTÂNICA
1) A falta de água enfrentada pelo Sudeste do país tem feito
cada vez mais cidades de São Paulo e de Minas Gerais
adotarem o racionamento, para reduzir o consumo de água,
ou decretarem estado de emergência. Além do
desabastecimento, a seca tem prejudicado também setores
como a agricultura, a indústria, a saúde e o turismo dessas
a) Na presença de genes apenas nas regiões
cidades.
A e C, a flor produzirá pólen.
(Adaptado de http://noticias.uol.com.br/ultimas-noticias/agencia-estado/
2014/07/07/seca-faz-cidades-do-interior-decretarem-emergencia.htm. Acessado em
16/07/2014.)
b)Na presença de genes apenas nas regiões
A e B, a flor dará origem a um fruto.
A situação de seca citada na reportagem é determinada por
mudanças no ciclo hidrológico, em que as plantas têm papel
c)Na ausência de genes na região B, a
determinante, uma vez que representam uma fonte de vapor
autofecundação na flor é possível.
d’água para a atmosfera. Os vasos que conduzem a água das
raízes até as folhas são os
d)Na ausência de genes na região A, a flor
a) floemáticos e a transpiração ocorre pelos estômatos. será menos visitada por polinizadores.
b) floemáticos e a transpiração ocorre pelos tricomas.
c) xilemáticos e a transpiração ocorre pelos tricomas. 4) A concentração de CO2 na atmosfera em
d) xilemáticos e a transpiração ocorre pelos estômatos. uma floresta varia ao longo de um dia e está
intimamente associada com a
fisiologia (fotossíntese e respiração) das
2) De acordo com o cladograma a seguir, é correto afirmar que: espécies presentes. A concentração de CO2
na atmosfera também varia em função da
a) A é Briófita, B é Pteridófita e C é Espermatófita. disponibilidade de água no ambiente.
Considerando o gráfico abaixo, é correto
afirmar que ;

b) C é Espermatófita, D é traqueófita e E é Angiosperma.


c) C possui sementes, D é Espermatófita e E é Angiosperma.
d) B é Briófita, D é traqueófita e E possui sementes.

3) Segundo o modelo que determina a identidade de órgãos


florais, os genes estão arranjados em três regiões
sobrepostas, e cada região compreende dois verticilos
adjacentes. Uma combinação única de genes determina a
a) a fotossíntese das plantas é maior no início
identidade do verticilo (imagem I). Se, por exemplo, a região
e no final
de atividade B é ausente, os verticilos serão especificados

1
do período diurno. mescladas. Plantas mescladas possuem
b) as plantas respiram mais na estação chuvosa. ramos verde-escuro, ramos brancos e ramos
c) na estação seca, há um pico de respiração às 12 variegados. Como mostra a figura a seguir,
horas. todas as células de ramos verde-escuro
d) as plantas fazem mais fotossíntese e respiram menos possuem cloroplastos normais (com clorofila).
na estação chuvosa. Todas as células de ramos brancos possuem
cloroplastos mutantes (sem clorofila). Ramos
variegados contêm células com cloroplastos
5) Em alguns casos, as organelas celulares podem normais, células com cloroplastos mutantes e
transformar-se e perder a funcionalidade, como acontece com células com ambos os tipos de cloroplasto.
os cloroplastos. Em plantas com alta atividade de fotossíntese,
mas com crescimento paralisado e sem drenos ativos (como
flores e frutos), os cloroplastos podem dar origem a

a)protoplastos ― células vegetais desprovidas de parede


celular.

b)amiloplastos ― organelas em que ocorre acúmulo de amido.

c)proplastos ― organelas imaturas que dão origem a


cloroplastos.

d)cromoplastos ― organelas em que ocorre acúmulo de


pigmentos.

Na formação de sementes, os cloroplastos


6) Algumas plantas de ambientes áridos apresentam o
são herdados apenas dos óvulos.A progênie
chamado "metabolismo ácido das crassuláceas", em que há
resultante da fertilização de óvulos de flores
captação do CO2 atmosférico durante a noite, quando os
presentes em um ramo variegado com pólen
estômatos estão abertos. Como resultado, as plantas
proveniente de flores de um ramo verde-
produzem ácidos orgânicos, que posteriormente fornecem
escuro conterá
substrato para a principal enzima fotossintética durante o
período diurno. É correto afirmar que essas plantas
a)apenas plantas com ramos de folhas
a)respiram e fotossintetizam apenas durante o período diurno. brancas.
b)plantas dos três tipos fenotípicos.
b)respiram e fotossintetizam apenas durante o período
c)apenas plantas mescladas.
noturno.
d)apenas plantas com ramos de folhas verde-
c) respiram o dia todo e fotossintetizam apenas durante o escuro.
período diurno.

d)respiram e fotossintetizam o dia todo.


8) A produção de celulose a partir da madeira
vem crescendo no Brasil, tendo atingido um
7) A "maravilha" (Mirabilis jalapa) é uma planta ornamental que volume recorde em 2017, com exportações de
pode apresentar três tipos de fenótipo: plantas com ramos 19,5 milhões de toneladas. As paredes das
verde-escuro, plantas com ramos brancos e plantas células da madeira contêm celulose e lignina,

2
sendo que a primeira é o principal composto de interesse 9) Um grande incêndio consumiu uma floresta
industrial, enquanto a segunda é um composto indesejável, inteira e deixou apenas os troncos das árvores
que precisa ser removido. Geralmente, a remoção da lignina em pé. Algumas plantas conseguiram rebrotar
envolve digestão química com H2S, um reagente altamente e produzir uma folhagem exuberante após
poluente. alguns meses.

As imagens apresentadas a seguir são fotos de microscopia


Considerando a relação entre estrutura e
eletrônica, em mesma escala, do tecido vegetal de dois tipos
função dos tecidos vegetais, as plantas
de madeira, que diferem com relação à parede celular.
mencionadas tiveram um bom desempenho
logo após a queimada por serem dotadas de

a)tecido esclerenquimático desenvolvido,


capaz de promover alta atividade
fotossintética.

b)periderme pluriestratificada, capaz de isolar


termicamente os feixes vasculares.

Cada tipo (I ou II) tem ainda dois subtipos, a ou b. O gráfico a c)aerênquimas, capazes de promover a
seguir mostra dados sobre esses subtipos de madeira difusão interna de gases e o metabolismo das
coletados de plantas cultivadas na mesma área geográfica raízes.
(solo e clima similares).
d)epiderme foliar espessa, com cutícula rica
em ceras capazes de reduzir a temperatura da
planta.

10) Relatório publicado em 2019 alertou que


um número crescente de espécies de animais
polinizadores está ameaçado de extinção em
todo o mundo em decorrência de fatores como
desmatamento, uso indiscriminado de
agrotóxicos e alterações climáticas.
Considerando que as quatro amostras no gráfico provêm de Importantes medidas devem ser adotadas
plantas com o mesmo tempo de desenvolvimento, qual delas para prevenir as consequências econômicas,
seria mais desejável em termos industriais e ambientais a redução na produção de alimentos e o
(tendo em vista a poluição e a extensão de área plantada)? desequilíbrio dos ecossistemas. Entre as
a)Subtipo la. espécies cultivadas no Brasil que dependem
de polinização animal, destacam-se o
b)Subtipo lb. maracujá, a maçã, a acerola e a castanhado-
c)Subtipo lla. brasil.
(Fonte: Marina Wolowski e outros, Relatório temático sobre
d)Subtipo llb. polinização, polinizadores e produção de alimentos no Brasil.
BPBES e REBIPP, 2019. Acessado em 23/05/2019.)

3
Considerando as informações fornecidas no texto e os
conhecimentos sobre botânica e ecologia, é correto afirmar d) a amônia é altamente tóxica e necessita
de um grande volume de água para ser
que a polinização pode ser beneficiada eliminada.
a)por insetos que transportam o pólen da antera para o
estigma nas eudicotiledôneas mencionadas.
3) Recentemente, inúmeros casos de
doping esportivo foram noticiados, como,
b)por pequenos vertebrados que transferem pólen do estigma por exemplo, aqueles envolvendo a
para o estame nas monocotiledôneas mencionadas. delegação russa nos Jogos Olímpicos do
Rio de Janeiro em 2016. Um dos métodos
mais utilizados no exame antidoping é a
c)por insetos que transferem pólen do estigma para o estame coleta e análise da urina de atletas, para
nas eudicotiledôneas mencionadas. verificação da presença de medicamentos
proibidos. O composto furosemida foi banido
pela Agência Mundial Antidoping. Sua
d)por pequenos mamíferos que transportam o pólen da antera principal ação é reduzir a reabsorção de
para o estigma nas monocotiledôneas mencionadas. sódio e cloro a partir da alça do néfron (alça
de Henle) em direção aos vasos sanguíneos
adjacentes.

SISTEMA EXCRETOR Considerando essas informações e os


conhecimentos sobre a fisiologia renal e a
excreção em seres humanos, é correto
1) O hormônio ADH (antidiurético), produzido no hipotálamo e afirmar que a furosemida
armazenado na hipófise, é o principal regulador fisiológico do
equilíbrio hídrico no corpo humano. Assinale a alternativa a)diminui a produção de urina, impedindo
correta. que medicamentos proibidos sejam
a) A redução na ingestão de água aumenta a pressão eliminados nas amostras a serem
osmótica do sangue. O ADH atua nos rins, aumentando a analisadas nos testes antidoping.
reabsorção de água e diminuindo a pressão osmótica do
sangue. b)diminui a produção de amônia, mas
aumenta a eliminação de medicamentos
b) O aumento na ingestão de água aumenta a pressão pelo rim, resultando em diluição das
osmótica do sangue. O ADH atua nos rins, aumentando a amostras analisadas nos testes antidoping.
reabsorção de água e diminuindo a pressão osmótica do
sangue. c)aumenta a produção de urina, resultando
na diminuição da concentração de
c) A redução na ingestão de água diminui a pressão osmótica medicamentos nas amostras, o que dificulta
do sangue. O ADH atua nos rins, aumentando a reabsorção sua detecção nos testes antidoping.
de água e aumentando a pressão osmótica do sangue.
d)aumenta a produção de ureia, o que
d) O aumento na ingestão de água diminui a pressão resulta na diluição das amostras a serem
osmótica do sangue. O ADH atua nos rins, diminuindo a analisadas nos testes antidoping e na
reabsorção de água e aumentando a pressão osmótica do diminuição da concentração dos
sangue. medicamentos.

2) Em relação à forma predominante de excreção dos SISTEMA DIGESTÓRIO


animais, é correto afirmar que

a)peixes são animais amoniotélicos, aves e répteis são 1) O gráfico a seguir representa a variação do
ureotélicos e mamíferos são uricotélicos. índice glicêmico após a ingestão de dois
alimentos (mesma quantidade, pela mesma
b) a ureia é altamente tóxica e insolúvel em água, sendo a pessoa, mas em momentos diferentes). A
principal excreta das aves. linha pontilhada representa o alimento A,
enquanto a linha contínua representa o
c) peixes, exceto os condrictes, são amoniotélicos e aves e alimento B. A análise do gráfico nos permite
répteis adultos são ureotélicos. afirmar corretamente que:

4
d)maior que 4; no exemplo eles ocorreram
durante o período do exame.

EMBRIOLOGIA
1) O estudo do desenvolvimento embrionário
é importante para se entender a evolução dos
animais. Observe as imagens abaixo.

a) O alimento B não afeta a concentração de glicose na


circulação sanguínea.

b)O alimento A não possui carboidratos em sua composição.

c)O alimento B ajuda a emagrecer, pois estimula a liberação


de adrenalina.

d)O alimento A estimula a liberação de insulina na circulação


sanguínea.

2) O refluxo gastroesofágico é o retorno do conteúdo do Assinale a alternativa correta.


estômago para o esôfago, em direção à boca, podendo causar a) O animal A apresenta simetria bilateral e é
dor e inflamação. A pHmetria esofágica de longa duração é celomado.
um dos exames que permitem avaliar essa doença, b) O animal B apresenta simetria radial e é
baseando-se em um resultado como o que é mostrado a celomado.
seguir. c) O animal A apresenta simetria radial e é
acelomado.
d) O animal B apresenta simetria bilateral e é
acelomado.

DOENÇAS

1) Campinas viveu no verão deste ano a maior


epidemia de dengue da sua história e situação
semelhante foi observada em outras cidades
brasileiras. Indique o vetor dessa virose, onde
Dados: O pH normal no esôfago mantém-se em torno de 4 e ele se reproduz e a situação de temperatura
o pH da saliva entre 6,8-7,2. que influencia sua reprodução.

Assim, episódios de refluxo gastroesofágico acontecem a) O vetor do vírus da dengue é o Aedes


quando o valor de pH medido é aegypti. Suas fases imaturas desenvolvem-se
no solo e há diminuição na sua reprodução em
a)menor que 4; no exemplo dado eles ocorreram com maior temperaturas abaixo de 17º C.
frequência durante o dia.
b) O vetor do vírus da dengue é o Culex
b)maior que 4; no exemplo dado eles ocorreram com maior quiquefasciatus. Suas fases imaturas
frequência à noite. desenvolvem-se na água suja e há aumento
na sua reprodução em temperaturas abaixo de
c)menor que 4; no exemplo eles não ocorreram nem durante 17º C.
o dia nem à noite.

5
c) O vetor do vírus da dengue é o Aedes aegypti. Suas fases
imaturas desenvolvem-se na água limpa e há diminuição na
sua reprodução em temperaturas abaixo de 17º C. 5) Em 2016, a Organização Mundial de Saúde
(OMS) apresentou novas diretrizes para o
d) O vetor do vírus da dengue é o Culex quiquefasciatus. Sua tratamento de três doenças sexualmente
reprodução se dá no solo e sofre aumento em temperaturas transmissíveis: sífilis, gonorreia e clamidíase.
abaixo de 17º C. As três doenças citadas são causadas por

a)microrganismos (bactérias ou vírus), que


2) Nos porões dos navios vindos do Oriente no século XIV, passaram dos macacos para o ser humano há
chegavam milhares de ratos à Europa, onde encontravam um muitos anos, levando ao surgimento de
ambiente favorável, dadas as condições precárias de higiene. epidemias e pandemias.
Esses ratos estavam contaminados e suas pulgas transmitiam
um agente etiológico aos homens através da picada. Os ratos b) bactérias, que podem se tornar resistentes
também morriam da doença e, quando isto acontecia, as a antibióticos, se utilizados em excesso ou de
pulgas passavam rapidamente para os humanos, para forma inapropriada, dificultando o tratamento.
obterem seu alimento, o sangue.
c) bactérias, que podem ser tratadas e
Qual é o agente etiológico e qual é o nome popular dessa eliminadas pelo uso diligente de preservativos
doença? (masculinos ou femininos) durante as relações
a) Vírus, peste bubônica. sexuais.
b) Bactéria, peste bubônica.
c) Vírus, leptospirose. d)protozoários, que podem ser tratados e
d) Bactéria, leptospirose. eliminados pelo uso diligente de preservativos
(masculinos ou femininos) durante as relações
sexuais.
3) O sarampo é uma doença infectocontagiosa provocada
pelo Morbilivirus. Em 2015 apareceram vários casos dessa
doença em diversas cidades do Brasil e do mundo. O que faz 6) A malária representa um dos principais
com que esta doença seja extremamente contagiosa e muito problemas de saúde pública no mundo.
comum na infância? Embora a dimensão geográfica da
transmissão esteja encolhendo no Brasil, o
a) O fato de ser transmitida por um vírus para o qual não país ainda registra 42% dos casos da doença
existe vacina. nas Américas. A Fundação Oswaldo Cruz, do
Rio de Janeiro, recentemente desenvolveu um
b) O fato de ser frequentemente transmitida por secreções preparado com alta eficácia antimalárica,
das vias respiratórias, como gotículas eliminadas pelo espirro agora em fase de ensaios clínicos.
ou pela tosse.
(Fontes: “Desafios para eliminação da malária”, Agência Fapesp,
2017; MAÍRA Menezes, “Malária: ensaio clínico aponta alta
c) O fato de ser transmitida apenas por meio de insetos eficácia e ausência de resistência a medicamento”, Portal Fiocruz,
vetores. 2016.)

d) O fato de ser extremamente contagiosa apenas em Levando em conta seus conhecimentos sobre
crianças desnutridas, recém-nascidos e crianças portadoras o ciclo de vida do Plasmodium, assinale a
de imunodeficiências. alternativa que indica um possível mecanismo
de ação do preparado antimalárico.

4) O HPV faz parte do grupo dos caudovírus. As verrugas a)Alterar a morfologia das hemácias dos
genitais causadas pela infecção do vírus foram estudadas mosquitos, diminuindo a taxa de infecção pelo
desde a Antiguidade, porém o vírus só foi descoberto 40 anos parasita.
atrás. Pode-se afirmar corretamente que:
b)Impedir a entrada de parasitas nos linfócitos,
a) A principal forma de se adquirir o HPV é através da ingestão reduzindo a carga de gametócitos circulantes
de alimentos contaminados.
c)Promover a multiplicação de esporozoítos
b)O câncer de colo de útero não pode ser causado pelo vírus no fígado, reduzindo o número de gametócitos.
HPV.
d)Inibir a multiplicação de merozoítos nos
c) O vírus HPV pode permanecer latente por vários anos. eritrócitos, diminuindo a carga de parasitas
circulantes.
d) Não há tratamento nem vacina para o HPV.

6
escolha a alternativa que preenche
7) Graças às campanhas de vacinação, a poliomielite foi corretamente as lacunas no texto a seguir:
considerada erradicada no Brasil: o último caso foi registrado
em 1989. Contudo, o Ministério da Saúde constatou cobertura "O composto (i) pode ser utilizado para
vacinal alarmante (abaixo de 50%) em 312 municípios inibir (ii) ,uma vez que tem estrutura
brasileiros em 2018. A vacinação é a única forma de química muito semelhante a do
prevenção da poliomielite; é uma questão de responsabilidade
(iii) ,sendo, portanto, erroneamente
social contemplada no Programa Nacional de Imunizações do
Ministério da Saúde. reconhecido (iv) .

(Fonte: portalms.saude.gov.br/noticias/agencia-saude/43797-ministerio-da-saude- a)(i) tirosina; (ii) a síntese de proteínas; (iii)


alerta-parabaixas-coberturas-vacinais-para-polio.) nucleotídeo dAMP; (iv) pelo ribossomo como
Assinale a alternativa que caracteriza corretamente a possível precursor na transcrição.
poliomielite.
b)(i) vidarabina; (ii) a replicação do DNA; (iii)
a)É uma doença viral contagiosa, que pode ser transmitida nucleotídeo dAMP; (iv) pela polimerase como
através da ingestão de água ou alimentos contaminados por possível precursor na síntese do DNA.
fezes de doentes.
c) (i) vidarabina; (ii) a síntese de proteínas; (iii)
b)A transmissão do vírus ocorre por meio de vetores ácido úrico; (iv) pelo ribossomo como possível
hematófagos que tenham picado uma pessoa contaminada na precursor na tradução.
fase aguda da doença.
d)(i) tirosina; (ii) a replicação do DNA; (iii)
c)É uma doença bacteriana transmitida por gotículas de saliva nucleotídeo dAMP; (iv) pela transcritase como
ou de sangue de pessoas contaminadas, com alto risco de possível precursor do DNA
contágio.

d)A transmissão da bactéria ocorre por meio de vetores 4) Na construção de tecidos biológicos, as
artrópodes que tenham picado uma pessoa contaminada na células se ancoram em uma rede de microfibras
fase crônica da doença. tridimensional (3D), em uma matriz extracelular.
Interessados em recriar tecidos biológicos em
CITOLOGIA laboratório utilizando técnicas de engenharia
genética e de tecidos, cientistas confirmaram
divisões e ligações celulares nas construções
1) São estruturas encontradas em vegetais: 3D obtidas a partir de proteínas de seda
recombinantes. Ao observarem células
a) parede celular, grana, arquêntero, mitocôndria, DNA. interfásicas e em divisão, formação de actina
b) mitocôndria, vacúolo, tilacoide, vasos, cromossomo. filamentosa e pontos de adesão focal, os
c) mitocôndria, carioteca, axônio, núcleo, estroma. cientistas verificaram que o conjunto de células
d) dendrito, cloroplasto, DNA, endométrio, estômato. e matriz extracelular apresentou viabilidade e
força biomecânica muito semelhantes às da
parede arterial humana.
2) Ao observar uma célula, um pesquisador visualizou uma
(Fonte: https://phys.org/news/2019-04-ecm-like-fibers-bioactive-
estrutura delimitada por uma dupla camada de membrana silk-d.html. Acessado em 20/05/ 2019.)
fosfolipídica, contendo um sistema complexo de
endomembranas repleto de proteínas integrais e periféricas. Considerando as informações referentes ao
Verificou também que, além de conter seu próprio material estudo mencionado, e as relações entre célula
genético, essa estrutura ocorria em abundância em todas as e seu ambiente, é correto afirmar que as
regiões meristemáticas de plantas. Qual seria essa estrutura condições experimentais permitiram
celular?
a)a respiração aeróbica e anaeróbica para
a)Cloroplasto. conservar as trocas gasosas e as fases do ciclo
b)Mitocôndria. celular durante a formação da parede arterial
c)Núcleo. humana.
d)Retículo endoplasmático.
b)a síntese, o transporte e o armazenamento de
macromoléculas no citoplasma para fortalecer
3) Considerando as semelhanças e diferenças entre as a estrutura celular, como na parede arterial
estruturas químicas dos compostos anteriores e seus humana.
conhecimentos sobre os processos bioquímicos da célula,

7
c)a presença de cromossomos alinhados na placa equatorial
das células estacionadas na fase interfásica, tal como na
parede arterial humana.

d)a adesão e a proliferação celular para sustentar o


metabolismo e a funcionalidade semelhantes aos das artérias
humanas.

FOTOSSÍNTESE

1) O crescimento das plantas é afetado pelo balanço entre a


fotossíntese e a respiração. O padrão de resposta desses dois
importantes processos fisiológicos em função da temperatura
é apresentado nos gráficos abaixo, relativos a duas espécies 1) O nitrogênio é um elemento essencial para
de plantas. as plantas, podendo ser obtido do solo ou da
atmosfera. No último caso, verifica-se a
associação entre plantas e bactérias, que irão
captar moléculas de nitrogênio e convertê-las
em compostos nitrogenados usados na
nutrição das plantas. Em contrapartida, as
bactérias se aproveitam dos produtos
oriundos da fotossíntese realizada pelas
plantas. Essa associação é denominada

a) mutualismo. O texto se refere a bactérias do


gênero Rhizobium, que produzem amônio.

b) comensalismo. O texto se refere a bactérias


do gênero Rhizobium, que produzem amônio

c) mutualismo. O texto se refere a bactérias do


gênero Nitrosomona, que produzem proteínas.

Sobre as espécies X e Y, é correto afirmar: d) comensalismo. O texto se refere a bactérias


do gênero Nitrosomona, que produzem
a) A espécie Y não apresenta ganho líquido de carbono a 15oC. proteínas.

b) As duas espécies têm perda líquida de carbono a 45oC.


2) A diversidade de plantas tende a ser maior
c) A espécie Y crescerá menos do que a espécie X a 25oC. em lugares que não sejam nem tão hostis nem
tão hospitaleiros. Em um ambiente onde
d) As duas espécies têm ganho líquido de carbono a 45oC. faltam recursos, poucas espécies de plantas
sobrevivem. Se as condições melhoram, o
número de espécies tende a aumentar. Já
ECOLOGIA quando há abundância de nutrientes, a
tendência se reverte e o ambiente é dominado
por poucas espécies que captam recursos de
forma mais eficaz. O gráfico abaixo mostra a
relação entre a biomassa e a quantidade de
espécies de plantas em uma mesma área.

(Texto e imagem adaptados de


http://revistapesquisa.fapesp.br/ 2015/07/18/estudo-
reabilita-teoria-sobre-diversidade-de-plantas.)

Com base no texto, é correto afirmar que

8
a) espécies mais eficientes na obtenção de recursos d)A biodiversidade observada na África, Ásia
prevalecem quando há abundância de recursos. e América do Sul demanda uso intenso de
defensivos agrícolas.
b) quanto maior a abundância de recursos, maior a
diversidade de espécies.

c) alta produção de biomassa indica necessariamente maior 5) O acidente radioativo na usina de


diversidade de espécies. Chernobyl, na Ucrânia, em 1986, exigiu a
evacuação de mais de 100 mil pessoas em um
d) ambientes hostis são mais limitantes para a diversidade que raio de 30 km. Até hoje, a região é isolada e o
ambientes hospitaleiros. acesso público, restrito. Pouco tempo após o
acidente, muitos estudos indicaram que vários
organismos, entre os quais aranhas e insetos,
3) Em uma pirâmide de energia, as plantas têm importante haviam sofrido efeitos negativos da radiação.
papel na captação e transformação da energia luminosa e são Porém, estudos recentes, utilizando
responsáveis pela produtividade primária líquida. Nessa armadilhas fotográficas e imagens aéreas,
pirâmide, aparecem ainda os herbívoros e os carnívoros, que mostraram que a cidade-fantasma foi ocupada
acumulam energia e determinam assim a produtividade por diversas espécies de plantas e animais,
secundária líquida. Sobre as pirâmides de energia, é correto cuja abundância tem aumentado na região.
afirmar que
(Roland Oliphant, 30 years after Chernobyl disaster, wildlife is
flourishing in radio-active wasteland, The Telegraph, 24/04/2016.)
a)a energia é conservada entre os níveis tróficos.

b) a respiração dos autótrofos é uma fonte de energia para os Assinale a alternativa que fornece uma
heterótrofos. explicação correta para o fenômeno descrito
no texto anterior.
c)a produtividade primária líquida é representada na base da
pirâmide. a)A radiação diminui a taxa fotossintética de
plantas, porém a ação de descontaminação do
d)a excreção é uma fonte de energia para os níveis tróficos ambiente pelo homem permite o retorno de
superiores. populações de plantas e, portanto, dos
organismos que delas se alimentam.

b)A radiação aumenta a taxa de mutação e


4) Pesquisadores analisaram o número de polinizadores, a acelera o metabolismo de plantas,
biodiversidade e o rendimento de cultivos dependentes de favorecendo sua taxa reprodutiva, o que leva
polinizadores (maçã, pepino, caju, café, feijão, algodão e a aumento de suas populações e,
canola, entre outros) em propriedades da África, Ásia e consequentemente, das populações de
América do Sul. Nos países analisados, o rendimento agrícola herbívoros.
cresceu de acordo com a densidade de polinizadores,
indicando que a redução na população de abelhas e outros c)A radiação reduz os tumores de animais e
insetos poderia ser parcialmente responsável pela queda de plantas, aumentando a taxa de sobrevivência
produtividade. desses seres vivos e, consequentemente, o
tamanho de suas populações e das de seus
(Adaptado de http://revistapesquisa.fapesp.br/2016/01/21 /insetoselevam-produtividade-
agricola/)
consumidores.

d)A radiação tem impactos negativos sobre


Os resultados obtidos com a pesquisa relatada acima animais e plantas, porém a ausência de
sugerem que: atividade humana no ambiente contaminado
por radiação favorece o crescimento das
a) A presença de insetos nas lavouras pode ser uma das populações desses organismos.
causas da queda de produtividade e biodiversidade.

b)Práticas agrícolas convencionais, com uso de pesticidas,


favorecem os polinizadores e aumentam a produtividade. 6) Em um estudo, foram avaliadas quatro
amostras encontradas em diferentes locais,
c) A adoção de medidas que ofereçam condições de vida mais representados na figura abaixo.
favoráveis a polinizadores pode resultar em aumento de
produtividade do feijão.

9
a) antenas à esquerda das pernas.
b) pedipalpos à direita do abdome.
c) abdome à esquerda das pernas.
d) abdome à direita dos pedipalpos.

3) “Um poeta chamado Zhu Xi escreveu o


seguinte há cerca de 1200 anos: ‘No topo das
Amostra A: há foraminíferos, algas e dinoflagelados. altas montanhas vejo conchas que me dizem
que antigos lugares de baixa altitude se
Amostra B: há pólen e não existem seres marinhos. elevaram para os céus e moram agora nos
mais elevados picos. Estas conchas dizem-
Amostra C: há grande concentração de plâncton. me também que materiais vivos de animais se
converteram nas mais duras e inertes rochas.’
Amostra D: há grande concentração de bentos. Essas palavras foram durante séculos lidas
como se fossem versos. Mas Zhu Xi não era
Assinale a alternativa que associa corretamente o local de apenas um poeta: era um cientista, aquilo que,
coleta com a característica da amostra. até há pouco se chamava um naturalista.”

a)A amostra A contém seres típicos da plataforma abissal, (Mia Couto,”Rios, Cobras e Camisas de Dormir”, em E se Obama
fosse africano? E outras intervenções. 2.ed. Lisboa: Editorial
onde há menor concentração de sal e não há luz solar. Caminho, 2009, p.58.)

b)A amostra B foi encontrada em plataforma abissal, sendo


que ventos teriam levado pólen até essa área, onde não há O poema citado por Mia Couto faz referência
seres vivos.
a) ao processo de migração de moluscos
c)A amostra C foi retirada da plataforma continental, já que marinhos para topos de montanhas e a sua
contém seres que se movimentam ativamente e vivem entre posterior fossilização.
ambientes terrestre e marinho.
b) ao processo de decomposição de materiais
d) A amostra D contém espécies encontradas no declive vivos que ocorre nas rochas duras e inertes
continental, que se fixam no substrato dos ecossistemas presentes nos topos das montanhas.
aquáticos.
c)à presença de fósseis de moluscos em
montanhas que se formaram em regiões antes
cobertas por água.

REINOS/ ZOOLOGIA d) à existência de fósseis de moluscos que


habitavam topos de montanhas e hoje estão
extintos.
1)O filo Mollusca é o segundo maior do reino animal em
número de espécies. É correto afirmar que os moluscos da
classe Gastropoda
4) Os anfíbios constituem um dos grupos de
a) são exclusivamente marinhos. animais com maior número de espécies
b) possuem conchas, mas não rádula. ameaçadas de extinção. Entre outras razões,
c) são exclusivamente terrestres. isso ocorre porque eles são suscetíveis à
d) possuem pé desenvolvido e rádula. contaminação por substâncias nocivas e à
infecção por fungos. Os anfíbios apresentam
tal suscetibilidade porque têm
2) Antonie van Leeuwenhoek e Robert Hooke trouxeram
contribuições significativas para o desenvolvimento da a)hábitos aquáticos, que os tornam
biologia, usando microscópios ópticos. Leeuwenhoek utilizava suscetíveis a predadores.
microscópios com uma única lente, enquanto Hooke utilizava
microscópios com duas lentes. A figura abaixo retrata o b)pulmões bem desenvolvidos, que acumulam
detalhe de um animal desenhado por Hooke. Considerando impurezas e fungos.
que ele tenha visto o animal na posição em que desenhou,
esse mesmo animal seria visto no microscópio de c)sangue frio, que diminui a atividade de
Leeuwenhoek com enzimas hepáticas.

10
d)pele úmida e permeável, que possibilita a respiração
cutânea.

5) Fósseis do organismo Spriggina(em vista dorsal na


figura a seguir), que viveu há 550 milhões de anos, foram
descobertos nas montanhas de Ediacara, na Austrália. Tais
fósseis estão entre os mais antigos vestígios de seres
multicelulares já encontrados

Assinale a alternativa que descreve


corretamente aspectos zoológicos e
ecológicos referentes a esse animal.
Esse animal primitivo, cuja classificação desafia os a)As minhocas são invertebrados do filo dos
pesquisadores, possui algumas características ainda anelídeos, possuem corpo celomado e
encontradas na maioria dos animais existentes hoje. Esse segmentado, convertem detritos ingeridos em
animal apresenta matéria orgânica e melhoram o arejamento do
solo.
a)simetria bilateral, com eixo ântero-posterior bem definido,
características não encontradas em cnidários, poríferos e b)As cobras-cegas são vertebrados do filo dos
equinodermos. anelíideos, possuem corpo pseudocelomado
e reprodução sexuada, são predadoras de
b)simetria radial, com eixo dorsoventral bem definido, pragas agrícolas e melhoram o arejamento do
características não encontradas em cnidários, moluscos e solo.
equinodermos.
c) As cobras-cegas são invertebrados do filo
c)simetria dorsoventral, com eixo ântero-posterior bem dos cordados, possuem corpo celomado e não
definido, características não encontradas em cordados, segmentado e são capazes de controlar ervas
poríferos e cnidários. daninhas, pois consomem suas raízes.
d)simetria pentarradial, com eixo dorsoventral bem definido, d)As minhocas são invertebrados do filo dos
características não encontradas em cnidários, cordados e anelídeos, possuem pseudoceloma e
equinodermos. reprodução assexuada, são predadoras de
pragas agrícolas e melhoram o arejamento do
solo.
6) Nos quadrinhos a seguir, o personagem Garfield questiona
a relevância ecológica do animal representado à direita.
7) Durante uma visita ao Museu de Zoologia
do Instituto de Biologia da UNICAMP, alunos
do ensino médio puderam observar a
diversidade de formas de vida e a
classificação dos vertebrados.

11
conformação dos dentes sugere o cardápio
possível das espécies, sendo correto afirmar
que

Assinale a alternativa que indica corretamente as


características (i), (ii), (iii) e (iv) apresentadas no cladograma a) dentes de superfície plana revelam uma
acima. dieta herbívora composta predominantemente
de gramíneas e são típicos de onívoros, cujos
crânios são representados nas imagens A e B
a)(i) fase larval e adulta no meio terrestre; (ii) cório e alantoide; acima.
(iii) quatro câmaras cardíacas; (iv) presença de pelos.
b) os incisivos, caninos e molares estreitos
b)(i) respiração cutânea; (ii) quatro câmaras cardíacas; (iii) têm formas diversas, que podem cortar ou
ausência de dentes; (iv) presença de glândulas mamárias. destacar alimentos. O crânio representado na
figura A acima sugere que se trata de um
c)(i) fase larval e adulta no meio aquático; (ii) respiração carnívoro.
pulmonar; (iii) ausência de dentes; (iv) presença de pelos.
c) os incisivos, caninos e molares estreitos
d)(i) respiração cutânea; (ii) cório e alantoide; (iii) três câmaras têm formas diversas, que podem cortar ou
cardíacas; (iv) presença de glândulas mamárias. destacar alimentos. Os caninos para perfurar
ou rasgar, como os representados na imagem
B acima, são típicos de carnívoros.

ORIGEM DA VIDA d) dentes de superfície plana revelam uma


dieta herbívora composta predominantemente
de gramíneas e são típicos de onívoros como
1) Na antiguidade, alguns cientistas e pensadores famosos os felinos, representados na imagem A acima
tinham um conceito curioso sobre a origem da vida e em
alguns casos existiam até receitas para reproduzir esse
processo. Os experimentos de Pasteur foram importantes
para a mudança dos conceitos e hipóteses alternativas para o 2) O cladograma abaixo representa relações
surgimento da vida. Evidências sobre a origem da vida evolutivas entre membros da Superfamília
sugerem que Hominoidea, onde se observa que

a) a composição química da atmosfera influenciou o


surgimento da vida.

b) os coacervados deram origem às moléculas orgânicas.

c)a teoria da abiogênese foi provada pelos experimentos de


Pasteur.

d)o vitalismo é uma das bases da biogênese.

a)homens e gibões (Hylobatidae) não


possuem ancestral comum.
EVOLUÇÃO
b)homens, gorilas (Gorilla) e
1) Ao longo da evolução, as variações e adaptações nos orangotangos (Pongo) pertencem a famílias
dentes dos mamíferos são numerosas e surpreendentes. A diferentes.

12
c)homens, gibões e chimpanzés (Pan) possuem um
ancestral comum.

d)homens, orangotangos (Pongo) e gibões (Hylobatidae) são


primatas pertencentes à mesma família

3) Na vida real não existem animais que são agentes secretos,


mas o ornitorrinco, representado na figura do desenho
Phineas e Ferb, guarda muitos segredos e curiosidades. Esse
animal de aproximadamente 60 cm, que parece uma mistura
de lontra, pato e castor, resultou em um ser único em vários
sentidos.

Um estudo mostrou que na localidade A são


encontradas sete (7) espécies de camarões-
pistola. Na localidade B são encontradas
outras sete (7) espécies, sendo que cada
espécie do local A tem uma espécie-irmã
correspondente no local B (espécies-irmãs
são espécies originadas de um mesmo
ancestral comum recente). É correto afirmar
que

a) o canal do Panamá permitiu que camarões-


a) À semelhança dos mamíferos placentários, a fêmea do pistola migrassem de A para B, adaptando-se
ornitorinco alimenta os filhotes com seu leite, mas coloca ovos. ao novo ambiente, diferenciando-se e
originando novas espécies semelhantes às do
b) Diferentemente dos mamíferos placentários, os lado A.
ornitorrincos não produzem leite para a alimentação dos
filhotes. b) vulcões expeliram substâncias
mutagênicas durante o Terciário, o que
c) À semelhança dos mamíferos placentários, os embriões aumentou a variabilidade genética dos
dos ornitorrincos alimentam-se exclusivamente de vitelo camarão-pistola, originando espécies-irmãs
acumulado no ovo. nas áreas oceânicas A e B.
d) Diferentemente dos mamíferos placentários, os c) o istmo do Panamá interpôs uma barreira
ornitorrincos apresentam autofecundação e produzem ovos. geográfica, formando dois grupos isolados
para cada espécie ancestral, que puderam
então se diferenciar, originando espécies-
irmãs nos oceanos A e B.
4) O mapa a seguir mostra duas áreas oceânicas, A e B.
d) o impacto de um asteroide no final do
Cretáceo levou a uma extinção em massa,
fornecendo as condições para a radiação
adaptativa dos camarões-pistola, com
consequente formação de espécies-irmãs.

5) No ano de 2015, foi descrito o fóssil de um


réptil que viveu há 150 milhões de anos onde
hoje é a região Nordeste do Brasil. Conforme
ilustra a figura a seguir, esse animal apresenta
corpo alongado, com muitas vértebras e

13
costelas, e membros anteriores e posteriores reduzidos (a
seta indica a região ampliada no canto inferior esquerdo). Por
sua anatomia peculiar, um grande debate teve início sobre a
posição que esse animal deveria ocupar na árvore da vida

a)A, B, D e F são diploides.


b)B, C, D e E são formados na telófase I.
c)A, B, D e G são células idênticas quanto ao
seu material genético.
d)B, C, D e I são haploides.

CÓDIGO GENÉTICO
1) A figura a seguir ilustra fragmentos de um
gene presente em espécies identificadas com
os números de 1 a 4 entre parênteses.
Sabe-se que os lagartos (que geralmente têm membros) e as
serpentes (seres ápodes) que vivem atualmente têm um
ancestral comum. CACTTGTAAAACCAGTATAGACCCTAG (1)

Sendo assim, o organismo ilustrado na figura CACTTGTAAAACCAGGATAGACGCTAG(2)

a)não pode pertencer à linhagem evolutiva das serpentes, CACTTGTAAAACCAGTATAGACGCTAG (3)


pois a perda dos membros anteriores e posteriores levaria a CATTTTTAACACCAGGATAGACGCTAT(4)
um prejuízo à vida do animal, e a evolução resulta apenas em
melhoria dos organismos.
Assinale a alternativa correta.
b)não pode pertencer à linhagem evolutiva das serpentes,
pois a evolução é gradual e incapaz de gerar mudanças a)As espécies 1 e 4 são mais próximas entre
drásticas na morfologia de um ser vivo, como a perda de si do que as espécies 1 e 3.
membros anteriores e posteriores.
b)As espécies 2 e 3 são mais próximas entre
c)pode pertencer à linhagem evolutiva das serpentes, sendo si do que as espécies 1 e 3.
que seu ancestral comum com os lagartos possuía membros,
depois perdidos por processos evolutivos, originando as c)As espécies 1 e 3 são mais próximas entre
serpentes ápodas atuais. si do que as espécies 3 e 4.

d)pode ser um fóssil de transição, pois os ancestrais das d) As espécies 2 e 4 são mais próximas entre
serpentes que não utilizavam seus membros com tanta si do que as espécies 1 e 2.
frequência sofreram atrofia desses membros, deixando de
transferir tal característica para seus descendentes.

2) Assinale a alternativa que preenche


corretamente as lacunas nas definições a
DIVISÃO CELULAR seguir.

1) Considerando o esquema a seguir como uma (I) ____________ é o conjunto de toda a


representação simplificada da meiose, indique a alternativa informação genética de um organismo.
correta.
(II) _____________ é um trecho do material
genético que fornece instruções para a
fabricação de um produto gênico.

14
Assinale a alternativa correta.
(III) _____________ é a constituição de alelos que um
a)O tecido adiposo branco produz mais
indivíduo possui em um determinado loco gênico.
energia que o tecido adiposo marrom.
(IV) _____________ é a correspondência que existe entre b)O tecido adiposo marrom não produz ATP,
códons e aminoácidos, relativa a uma sequência codificadora mas produz calor.
no DNA.
c)O tecido adiposo branco não produz ATP,
mas produz calor.
a)(I) Código genético; (II) Alelo; (III) Homozigoto; (IV) Gene.
d)O tecido adiposo branco produz ATP e calor.
b) (I) Genoma; (II) Gene; (III) Genótipo; (IV) Código genético.

c) (I) Código genético; (II) DNA; (III) Genótipo; (IV) tRNA.


GENÉTICA
d)(I) Genoma; (II) Código genético; (III) Homozigoto; (IV) tRNA.
1) Para um determinado caráter, fenótipo
é o conjunto de características que o
3) A descoberta do processo celular de interferência por RNA organismo exibe como fruto de seu
(RNAi) rendeu aos cientistas Andrew Fire e Craig Mello o genótipo. No entanto, no molusco
prêmio Nobel de Fisiologia ou Medicina em 2006. O RNAi hermafrodita Lymnaea peregra, ocorre algo
intercepta e destrói as informações celulares conduzidas pelo diferente. Neste animal, há dois tipos de
RNA dentro da célula antes que sejam processadas em fenótipo da concha (ver figura a seguir),
proteínas. Com os avanços da biotecnologia, foram que não são determinados pelo genótipo
desenvolvidas moléculas sintéticas de do próprio indivíduo. A prole formada pela
RNAi de aplicação tópica, que, pulverizadas nas lavouras, fertilização de óvulos vindos de um parental
conferem proteção agrícola, reduzindo perdas. com genótipos AA ou Aa tem conchas
dextrógiras; já a prole formada pela
Assinale a alternativa que preenche corretamente as lacunas fertilização de óvulos vindos de um parental
nas frases a seguir. aa tem conchas levógiras

O (i) __________ entra em contato com o RNAi pulverizado,


que atua em seu processo celular, impedindo que o (ii)
__________ seja traduzido como proteína. Como o (iii)
__________ está associado a uma função essencial, ao ser
silenciado, ocasiona a morte do organismo.

a)(i) fungo; (ii) códon; (iii) RNAm.


b)i) inseto; (ii) RNAt; (iii) DNA.
c)(i) inseto; (ii) RNAm; (iii) gene.
d)i) fungo; (ii) RNAr; (iii) código genético.
Se óvulos de um molusco Aa forem
fertilizados por espermatozoides de um
molusco aa, as probabilidades de
ocorrência de indivíduos Aa dextrógiros, Aa
TECIDO CONJUNTIVO levógiros, aa dextrógiros e aa levógiros na
prole resultante são, respectivamente,
1) O corpo humano é composto por pelo menos dois tipos de
gordura. A mais comum é o tecido adiposo branco, um tipo a) ¼, ¼, ¼ e ¼
perigoso que se acumula ao redor das vísceras e debaixo da b) ½, 0, 0 e ½.
pele, podendo causar obesidade e desencadear complicações c) ½, 0, ½ e 0.
metabólicas, como o diabetes tipo 2. A outra é o tecido adiposo d) 1, 0, 0 e 0
marrom, que regula a produção de calor e, consequentemente,
a temperatura corporal.

15
2) A prestigiada revista Science elegeu como um dos
principais avanços científicos de 2017 um caso de terapia
gênica em crianças portadoras de atrofia muscular espinhal
do tipo 1, uma doença genética caracterizada pela atrofia
progressiva dos músculos esqueléticos e morte precoce antes
dos 2 anos de idade. A doença é causada por um gene
defeituoso, que deixa de codificar uma proteina essencial para
o funcionamento dos neurônios. No estudo, vírus não
patogênicos que continham uma cópia normal do gene em
questão foram injetados em quinze crianças doentes. As
crianças tratadas sobreviveram além dos 2 anos e
apresentaram melhoras na capacidade de movimento.
a) os fenótipos de II e III são iguais.
(Disponível em https://vis.sciencemag.org/.) b) o fenótipo de X é vermelho.
c) os fenótipos de IX e X são os mesmos dos
pais.
Assinale a alternativa que preenche corretamente as lacunas d) o fenótipo de IV é vermelho.
na frase a seguir.
4) A cidade de Monte Santo, na Bahia, que
Os vírus injetados nas crianças foram capazes de entrou para a história por ter sido
(i) restaurando a produção (ii) que acampamento para as tropas do governo que
passaram, então, a controlar adequadamente lutaram na guerra de Canudos, tem sido palco
de outras batalhas: a identificação, o
(iii) . tratamento e a prevenção de doenças raras
como hipotireoidismo congênito, fenilcetonúria,
a)(i) atingir a medula óssea e introduzir nas células-tronco a osteogênese imperfeita, síndrome de
cópia normal do gene; (ii) de neurônios no cérebro; (iii) a Treacher Collins e mucopolissacaridose tipo 6.
medula espinhal e, portanto, os músculos.
(Adaptado de Carlos Fioravante, “O caminho de pedras
das doenças raras”. Revista Pesquisa Fapesp, São Paulo,
b)(i) atingir a medula espinhal e remover dos neurônios a cópia 222, agosto 2014.)
defeituosa do gene; (ii) de hormônios; (iii) a geração de
impulsos elétricos e os músculos. A incidência em grandes proporções das
doenças citadas acima pode ter sido
favorecida por fatores
c)(i) atingir a medula espinhal e introduzir nos neurônios a
cópia normal do gene; (ii) da proteína essencial à função dos a) migratórios, relacionados à miscigenação
neurônios da medula; (iii) os músculos. da população.

d)(i) atingir a medula óssea e induzir a produção de linfócitos b) ambientais, por contaminações do solo e
da água.
do sangue; (ii) de anticorpos contra o vírus; (iii) a infecção,
c)genéticos, pela alta frequência de
restaurando os movimentos das crianças. casamentos entre parentes.

d)comportamentais, relacionados a atividades


físicas extenuantes decorrentes da guerra.

3) Em uma espécie de planta, o caráter cor da flor tem


codominância e herança mendeliana. O fenótipo vermelho é 5) Uma população de certa espécie é
homozigoto dominante, enquanto a cor branca é característica constituída apenas por três tipos de
do homozigoto recessivo. Considerando o esquema abaixo, é indivíduos diploides, que diferem quanto ao
correto afirmar que: genótipo em um loco. No total, há um
número NAA de indivíduos com genótipo AA,
NAa de indivíduos com genótipo Aa, e Naa
de indivíduos com genótipo
aa.Considerando apenas o loco exposto no
enunciado, a frequência do alelo A nessa
população é igual a

16
SISTEMA RESPIRATÓRIO Considerando os resultados mencionados
acima, assinale a alternativa que relaciona
corretamente o painel da fotomicrografia e os
1) O uso de cigarros eletrônicos é crescente entre jovens. Na dados gráficos do grupo exposto ao cigarro
composição desses cigarros encontramos propilenoglicol, eletrônico.
glicerol, água, nicotina e flavorizantes, que são aquecidos e
vaporizados para inalação. a)II-B.
b)II-C.
c)III-B.
Um estudo foi desenvolvido com animais experimentais d)II-C.
expostos a três fatores distintos: ar ambiente, nicotina e
cigarro eletrônico. Constatou-se que a exposição à nicotina e
ao cigarro eletrônico causa aumento da área de espaço aéreo
alveolar e redução das paredes alveolares, em comparação
com o grupo exposto ao ar ambiente. Adicionalmente, o grupo CLASSIFICAÇÃO DOS SERES
exposto ao cigarro eletrônico apresentou maior redução no VIVOS
número de capilares alveolares, mesmo quando comparado
ao grupo exposto à nicotina. A conclusão indicou um prejuízo 1) As concentrações de arsênio no oceano se
mais significativo para as trocas gasosas e perfusão de alteraram ao longo do tempo geológico. No
sangue pulmonar no grupo exposto ao cigarro eletrônico. período Pré-Cambriano, os oceanos
receberam grandes quantidades de arsênio,
em consequência do intemperismo de
As imagens a seguir são fotomicrografias que representam, minerais continentais de sulfeto de arsênio.
em mesma escala, os alvéolos pulmonares dos animais dos Recentemente foram identificados micro-
grupos estudados, mostrando o espaço aéreo alveolar; as organismos com expressão proteica das
setas representam o número de capilares alveolares. enzimas arsenito oxidase e arsenato redutase
no Oceano Pacífico Norte Oriental, nas zonas
deficientes de oxigênio em regiões pelágicas,
sugerindo que a comunidade microbiológica é
capaz de utilizar arsênio para respiração
celular.

(Fonte: Jaclyn Saunders e outros, PNAS, Washington, v. 116, n.


20, p. 9925-9930, maio 2019.)

Assinale a alternativa que preenche


corretamente as lacunas nas frases a seguir.

Assim como as formas oxidadas de nitrogênio


e enxofre, o arsênio pode ser utilizado como
aceptor (i) __________ na respiração celular
desses micro-organismos nas zonas
deficientes de oxigênio. No período (ii)
O gráfico abaixo mostra dados quantitativos referentes à área __________, surgiram as cianobactérias, os
de espaço aéreo alveolar e à contagem de capilar. primeiros seres fotossintetizantes.

17
a)(i) final de elétrons; (ii) arqueano.

b)(i) intermediário de elétrons; (ii) arqueano. Gabarito


c)(i) final de elétrons; (ii) fanerozoico.
(PS: sempre veja os erros como uma
d)(i) intermediário de elétrons; (ii) fanerozoico. oportunidade de aprendizado. Não fique triste
se errar, você está dando o seu melhor.)

Botânica 1D 2D 3D 4B 5B 6C 7B
8C 9B 10A

Sistema excretor 1A 2 D 3C

Embriologia 1C

Doenças 1C 2B 3B 4C 5B 6D 7A

Citologia 1B 2B 3B 4D

Fotossíntese 1C

Evolução 1B 2C 3A 4C 5C

Cordados 1A

Código genético 1C 2B 3C

Tecido conjuntivo 1D

Ecologia 1A 2A 3C 4C 5D 6D

Origem da vida 1A

Zoologia 1D 2D 3C 4D 5A 6A 7B

Divisão celular 1D

Sistema digestório 1D 2A

Genética 1C 2C 3A 4C 5D

Sistema respiratório 1B

Classificação dos seres vivos 1A

18
Literatura
masculino tradicional - do que seja um
profissional da ciência. E certamente faltam às
mulheres modelos positivos, as grandes
cientistas que lograram conciliar sucesso
profissional com vida pessoal realizada. Para
INTEPRETAÇÃO DE TEXTO quebrar os estereótipos femininos, para que
novas gerações possam se mirar em novos
modelos, é necessário resgatar do
1) Leia o texto abaixo: esquecimento figuras femininas que,
inadvertida ou deliberadamente,
“Boas coisas acontecem para quem espera. As melhores permaneceram ocultas na história da ciência
coisas acontecem para quem se levanta e faz.” (Domínio em nosso país.
público.) (Adaptado de Hildete P. de Melo e Lígia Rodrigues,
Pioneiras da ciência no Brasil. Rio de Janeiro: SBPC,
Considerando o texto acima e a maneira como ele é 2006, p. 3-4.)

estruturado, podemos afirmar que: Indique a alternativa correta. No texto,


a) a informação numérica indica a
a) O uso encadeado de “Boas coisas” e “As melhores coisas” desproporção entre o número de homens e o
possibilita a valorização do primeiro enunciado e a de mulheres presentes no mundo da ciência.
desvalorização do segundo.
b) o último período tem a finalidade de
justificar a publicação do livro Pioneiras da
b)A repetição do termo “coisas” garante que “boas coisas” e
ciência no Brasil, estabelecendo os objetivos
“as melhores coisas” remetem ao mesmo referente.
da obra.
c)Entre as expressões “para quem espera” e “para quem se c) a visão estereotipada de mulher cientista é
levanta e faz” estabelece-se uma relação de temporalidade. exemplificada pelos modelos positivos das
pioneiras brasileiras na ciência, tema da obra.
d)A sequenciação desse texto ocorre por meio da
recorrência de expressões e de estruturas sintáticas. d) as informações sobre o envolvimento das
mulheres nos afazeres domésticos não
constituem argumentos importantes para
justificar a obra.
2) O trecho a seguir foi retirado da apresentação da obra
Pioneiras da ciência no Brasil. O livro traz biografias de
cientistas brasileiras que iniciaram suas carreiras nos anos
1930 e 1940. 3) O trecho a seguir foi retirado da
apresentação da obra Pioneiras da ciência no
Cabe uma reflexão sobre a divisão dos papéis masculino e Brasil. O livro traz biografias de cientistas
feminino dentro da família, para tentar melhor entender por brasileiras que iniciaram suas carreiras nos
que a presença feminina no mundo científico mantém-se anos 1930 e 1940.
minoritária. Constata-se que, no Brasil, ainda cabem às
mulheres, fortemente, as responsabilidades domésticas e de Cabe uma reflexão sobre a divisão dos papéis
masculino e feminino dentro da família, para
socialização das crianças, além dos cuidados com os velhos.
tentar melhor entender por que a presença
Assim, ainda que dividindo o espaço doméstico com
companheiros, as mulheres têm, na maioria dos lares, maior feminina no mundo científico mantém-se
necessidade de articular os papéis familiares e profissionais. minoritária. Constata-se que, no Brasil, ainda
cabem às mulheres, fortemente, as
A ideia de que conciliar vida profissional e familiar representa
uma dificuldade é reforçada pela análise da população responsabilidades domésticas e de
socialização das crianças, além dos cuidados
ocupada feminina com curso superior, feita por estudiosos,
que constata que cerca de 46% dessas mulheres vivem em com os velhos. Assim, ainda que dividindo o
espaço doméstico com companheiros, as
domicílios sem crianças. Como as cientistas são pessoas com
diplomas superiores, elas estão compreendidas nesse mulheres têm, na maioria dos lares, maior
necessidade de articular os papéis familiares
universo. Por outro lado, talvez a sociedade brasileira ainda
e profissionais. A ideia de que conciliar vida
mantenha uma visão estereotipada – calcada num modelo

19
profissional e familiar representa uma dificuldade é reforçada 4) O cartaz a seguir foi usado em uma
pela análise da população ocupada feminina com curso campanha pública para doação de sangue.
superior, feita por estudiosos, que constata que cerca de 46%
dessas mulheres vivem em domicílios sem crianças. Como as
cientistas são pessoas com diplomas superiores, elas estão
compreendidas nesse universo. Por outro lado, talvez a
sociedade brasileira ainda mantenha uma visão estereotipada
– calcada num modelo masculino tradicional - do que seja um
profissional da ciência. E certamente faltam às mulheres
modelos positivos, as grandes cientistas que lograram
conciliar sucesso profissional com vida pessoal realizada.
Para quebrar os estereótipos femininos, para que novas
gerações possam se mirar em novos modelos, é necessário
resgatar do esquecimento figuras femininas que, inadvertida
ou deliberadamente, permaneceram ocultas na história da
ciência em nosso país.
(Adaptado de Hildete P. de Melo e Lígia Rodrigues, Pioneiras da ciência no
Brasil. Rio de Janeiro: SBPC, 2006, p. 3-4.)

Releia o período: “Assim, ainda que dividindo o espaço


doméstico com companheiros, as mulheres têm, na maioria
dos lares, maior necessidade de articular os papéis familiares
e profissionais.” A expressão sublinhada
a) delimita a amostra de lares em que a mulher precisa
articular tarefas profissionais e domésticas. Glossário

b) restringe o universo das mulheres mencionadas no trecho Rolezinho: diminutivo de rolê ou rolé; em
ao das que se dedicam à vida doméstica. linguagem informal, significa “pequeno
passeio”. Recentemente, tem designado
c) informa o local social em que circulavam as mulheres encontros simultâneos de centenas de
referidas no trecho. pessoas em locais como praças, parques
d) destaca o fato de que a maioria das mulheres vive com públicos e shopping centers, organizados via
companheiros internet.

Anonymous riot: rebelião anônima.


Considerando como os sentidos são
produzidos no cartaz e o seu caráter
persuasivo, pode-se afirmar que:

a) As figuras humanas estilizadas,


semelhantes umas às outras, remetem ao
grupo homogêneo das pessoas que podem
ajudar e ser ajudadas.
b) A expressão “rolezinho” remete à meta de
se reunir muitas pessoas, em um só dia, para
doar sangue.

c) O termo “até” indica o limite mínimo de


pessoas a serem beneficiadas a partir da ação
de um só indivíduo.
d) O destaque visual dado à expressão
“ROLEZINHO NO HEMORIO” tem a função de

20
enfatizar a participação individual na campanha.

6) A busca por vida fora da Terra


5) A busca por vida fora da Terra Um sinal eletrônico é emitido pelo Laboratório
Um sinal eletrônico é emitido pelo Laboratório de Propulsão a de Propulsão a Jato (JPL, sigla em inglês) da
Jato (JPL, sigla em inglês) da NASA, em Pasadena, Califórnia, NASA, em Pasadena, Califórnia, e viaja até
e viaja até um robô fixado na parte inferior da camada de gelo um robô fixado na parte inferior da camada de
de 30 centímetros de espessura em um lago do extremo norte gelo de 30 centímetros de espessura em um
do Alasca. O holofote do robô começa a brilhar. “Funcionou!”, lago do extremo norte do Alasca. O holofote
exclama John Leichty, um jovem engenheiro do JPL, que está do robô começa a brilhar. “Funcionou!”,
em uma barraca perto do lago congelado. Embora não pareça exclama John Leichty, um jovem engenheiro
uma grande façanha tecnológica, esse talvez seja o primeiro do JPL, que está em uma barraca perto do
passo para a exploração de uma lua distante. lago congelado. Embora não pareça uma
grande façanha tecnológica, esse talvez seja
Mais de sete mil quilômetros ao sul do Alasca, no México, a o primeiro passo para a exploração de uma lua
geomicrobióloga Penelope Boston caminha por uma água distante.
turva que bate em seus tornozelos, em uma gruta, cerca de
15 metros abaixo da superfície. Como os outros cientistas que Mais de sete mil quilômetros ao sul do Alasca,
a acompanham, Penelope carrega umrespirador pesado, no México, a geomicrobióloga Penelope
além do tanque adicional de ar, de modo que possa sobreviver Boston caminha por uma água turva que bate
em meio ao sulfeto de hidrogênio, monóxido de carbono e em seus tornozelos, em uma gruta, cerca de
outros gases venenosos da caverna. Aos seus pés, a água 15 metros abaixo da superfície. Como os
corrente contém ácido sulfúrico. A lanterna no capacete outros cientistas que a acompanham,
ilumina a gotícula de uma gosma espessa e semitranslúcida Penelope carrega umrespirador pesado, além
que escorre da parede. “Não é incrível?”, exclama. do tanque adicional de ar, de modo que possa
sobreviver em meio ao sulfeto de hidrogênio,
Esses dois locais (um lago congelado no ártico e uma gruta monóxido de carbono e outros gases
nos trópicos) talvez possam fornecer pistas para um dos venenosos da caverna. Aos seus pés, a água
mistérios mais antigos e instigantes: existe vida fora do nosso corrente contém ácido sulfúrico. A lanterna no
planeta? Criaturas em outros mundos, seja em nosso sistema capacete ilumina a gotícula de uma gosma
solar, seja em órbita ao redor de estrelas distantes, poderiam espessa e semitranslúcida que escorre da
muito bem ter de sobreviver em oceanos recobertos de gelo, parede. “Não é incrível?”, exclama.
como os que existem em um dos satélites de Júpiter, ou em
grutas fechadas e repletas de gás, que talvez sejam comuns Esses dois locais (um lago congelado no
em Marte. Portanto, se for possível determinar um ártico e uma gruta nos trópicos) talvez possam
procedimento para isolar e identificar formas de vida em fornecer pistas para um dos mistérios mais
ambientes igualmente extremos aqui na Terra, então antigos e instigantes: existe vida fora do nosso
estaremos mais preparados para empreender a busca pela planeta? Criaturas em outros mundos, seja em
vida em outras partes do Universo. nosso sistema solar, seja em órbita ao redor
de estrelas distantes, poderiam muito bem ter
(Adaptado de Michael D. Lemonick, A busca por vida fora da Terra. National de sobreviver em oceanos recobertos de gelo,
Geographic, jul. 2014, p. 38-40.)
como os que existem em um dos satélites de
A partir da leitura do texto, pode-se afirmar que: Júpiter, ou em grutas fechadas e repletas de
gás, que talvez sejam comuns em Marte.
a) O robô está presente tanto no lago congelado no ártico
Portanto, se for possível determinar um
como na gruta nos trópicos.
procedimento para isolar e identificar formas
b) O jovem engenheiro do JLP e a geomicrobióloga carregam de vida em ambientes igualmente extremos
respiradores para ajudá-los a respirar. aqui na Terra, então estaremos mais
preparados para empreender a busca pela
c) O jovem engenheiro do JLP e a geomicrobióloga estão
vida em outras partes do Universo.
executando suas pesquisas sozinhos.
(Adaptado de Michael D. Lemonick, A busca por vida fora
d) O holofote do robô é ligado a partir de um sinal emitido pelo da Terra. National Geographic, jul. 2014, p. 38-40.)
laboratório JPL.

21
Assinale a alternativa que resume adequadamente o texto. b) destaca a grande receptividade da
demonstração com o exoesqueleto junto ao
a) Estudos sobre formas de vida em ambientes extremos podem
público da Copa, superior à dos filmes
preparar os cientistas para enfrentar a questão da busca pela vida fora
da Terra. produzidos em Hollywood.

b) A partir de uma caverna no Alasca, um robô revela pistas c) aponta a necessidade de maiores
sobre outras formas de vida no nosso sistema solar. investimentos financeiros na geração de
imagens que possam valorizar a importância
c) os trabalhos científicos desenvolvidos em qualquer lugar da de conquistas científicas na mídia.
Terra permitem compreender formas de vida em outros
planetas. d) sugere que os resultados desse feito
científico são muito mais complexos do que as
d) Cientistas, trabalhando em ambientes extremos, imagens veiculadas pela televisão permitiram
desenvolveram procedimentos capazes de detectar vida fora ver.
da terra.

8) Dados numéricos e recursos linguísticos


7) Robótica não é filme de Hollywood', diz Nicolelis sobre colaboram para a construção dos sentidos de
o exoesqueleto. um texto. Leia os títulos de notícias a seguir
Robô comandado por paraplégico foi mostrado na abertura da sobre as vendas do comércio no último Dia
Copa. Equipamento transforma força do pensamento em dos Pais.
movimentos mecânicos. Venda para o Dia dos Pais cresceu 2% em
Em entrevista ao G1, o neurocientista brasileiro Miguel relação ao ano passado.
Nicolelis comentou que inicialmente estava previsto um jovem (Adaptado de O Diário Online, 15/08/2014. Disponível em
paraplégico se levantar da cadeira de rodas, andaralguns http://www.odiarioonline.com.br/noticia/26953/. Acessado
em 20/08/2014.)
passos e dar um chute na bola, que seria o “pontapé inicial”
do Mundial do Brasil. Mas a estratégia foi revista após a Fifa Só 4 em cada 10 brasileiros compraram
informar que o grupo teria 29 segundospara realizar a presentes no Dia dos Pais.
demonstração científica. Na última quinta-feira, o voluntário
(Época São Paulo, 17/08/2014. Disponível
Juliano Pinto, de 29 anos, deu um chute simbólico na bola da emhttp://epoca.globo.com/regional/sp/Consumo.
Copa usando o exoesqueleto. Na transmissão oficial, exibida Acessado em 20/08/2014.)
por emissoras em todo o mundo, a cena durou apenas sete
Podemos afirmar que:
segundos. O neurocientista minimizou as críticas recebidas
após a rápida apresentação na Arena Corinthians: “Tenham a) As informações apresentadas nos títulos
calma, não olhem para isso como se fosse um jogo de futebol. fornecem análises convergentes sobre as
Tem que conhecer tecnicamente e saber o esforço. Robótica vendas.
não é filme de Hollywood, tem limitações que nós conhecemos.
O limite desse trabalho foi alcançado. Os oito pacientes b) A avaliação sobre as vendas expressa no
atingiram um grau de proficiência e controle mental muito altos, segundo título é confirmada pela proporção
e tudo isso será publicado”, garante. apresentada no primeiro título.

(Adaptado de Eduardo Carvalho, ‘Robótica não é filme de Hollywood', diz c) Uma avaliação pessimista das vendas no
Nicolelis sobre o exoesqueleto. Disponível emhttp://g1.globo.com/ciencia-e- Dia dos Pais é apresentada no segundo título.
saude/noticia/2014/06/robotica-nao-e-fil me-de-hollywood-diz-nicolelis-sobre-
o-exoesqueleto.html. Acessado em 18/06/2014.) d) O crescimento de 2% mencionado no
primeiro título garante que as vendas este ano
Considerando a notícia transcrita acima, pode-se dizer que a
foram satisfatórias.
afirmação reproduzida no título (“Robótica não é filme de
Hollywood”).

a) reitera a baixa qualidade técnica das imagens da 9) Em sua versão benigna, a valorização da
demonstração com o exoesqueleto, depreciando a própria malandragem corresponde ao elogio da
realização do experimento com voluntários. criatividade adaptativa e da predominância da
especificidade das circunstâncias e das
relações pessoais sobre a frieza reducionista

22
e generalizante da lei. Em sua versão maximalista e maligna, viaja de país em país. Trabalha loucamente.
porém, a valorização da malandragem equivale à negação Mas ela sempre está disposta e apaixonada
dos princípios elementares de justiça, como a igualdade pelo que faz.
perante a lei, e ao descrédito das instituições democráticas.
Escuta! Quanta mentira! Nenhuma de nós
(Adaptado de Luiz Eduardo Soares, Uma interpretação do Brasil para contextualizar a está apaixonada o tempo todo pelo que faz.
violência, em C. A. Messeder Pereira, Linguagens da violência. Rio de Janeiro: Rocco,
2000, p. 23-46.) Eu, hoje, escrevi esse texto com muito esforço.
Eu, hoje, estou achando que eu escrevo mal e
Considerando as posições expressas no texto em relação à que perdi o jeito para a coisa. Quem nunca?
valorização da malandragem, é correto afirmar que:
Quem nunca muitas vezes?
a)O verbo “equivale” relaciona a valorização da
malandragem à negação da justiça, da igualdade perante a Quem estamos querendo enganar? A gente.
lei e das instituições democráticas. Mas tem vezes, como agora, em que não dá.
Eu queria muito voltar no tempo quando as
b) Entre os pares de termo “benigna/maligna” e redes sociais não existiam só para lembrar
“maximalista/reducionista” estabelece-se no texto uma como era… Às vezes eu acho que, com todas
relação semântica de equivalência. as vantagens da vida em rede…, talvez a
c)O elogio da malandragem reside na valorização da gente se sentisse melhor. Sério. "Estou farto
criatividade adaptativa e da sensibilidade em contraposição à de semideuses. Onde é que há gente nesse
fria aplicação da lei. mundo?", grita o Fernando Pessoa lá do
túmulo.
d) O articulador discursivo “porém” introduz um argumento
(Adaptado de Nina Lemos, disponível em http://revistatpm.
que se contrapõe à proposta de valorização da malandragem. uol.com.br/blogs/berlimmandaavisar/2015/07/13/nunca-conheci-
quemtivesse- sido-tao-feliz-como-nas-redes-sociais.html.)

Considerando os recursos linguísticos e


discursivos presentes na configuração do
texto, é correto afirmar que:

10) Leia com atenção o texto abaixo.


a) “Nunca conheci quem tivesse sido tão feliz
Nunca conheci quem tivesse sido tão feliz como nas redes como nas redes sociais / Eu tenho inveja de
sociais mim no Instagram” é um enunciado que se
espelha nos versos “Nunca conheci quem
(...) Eu tenho inveja de mim no Instagram. tivesse levado porrada / Todos os meus
conhecidos têm sido campeões em tudo”, do
(…) Eu queria ser feliz como eu sou no Instagram. Poema em Linha Reta, de Fernando Pessoa,
por meio do recurso ao paralelismo de
Eu queria ter certeza, como eu tenho no Facebook, sobre as estruturas sintáticas.
minhas posições políticas.
E no Twitter, bem, no Twitter eu não sou tão feliz nem certa e b) No texto de Nina Lemos, alguns recursos
é por isso que de longe essa ganha como rede social de mi linguísticos e discursivos são mobilizados de
corazón. E quanto mais eu me sinto angustiada (quem modo a promover um tipo particular de
nunca?), mais eu entro no instagram e vejo a foto das interação entre o produtor do texto e seus
pessoas superfelizes. E mais angustiada eu fico. Por mais que leitores por meio de diálogos entre
eu saiba que aquela felicidade é de mentira. Outro dia uma personagens, pontuação com funções
editora de moda que faz muito sucesso no Instagram escreveu estilisticamente diversas, um léxico de
em uma legenda: "até que estou bem depois de tomar um natureza coloquial e perguntas retóricas.
stillnox e um rivotril." (!!!!! Gente!) Mas ufa, ela assumiu. Até
então, seus seguidores talvez pudessem achar que ela era c) Baseado no Poema em Linha Reta de
uma super-heroína que nunca tinha levado porrada (nem Fernando Pessoa, o texto de Nina Lemos
conhecido quem tivesse tomado). Ela viaja de um lado para o apresenta argumentos para convencer seus
outro, acorda cedo, mas tem uma decoração linda na mesa, leitores de que ela tem uma vida difícil em

23
relação à de outras pessoas felizes que conhece pelo elaborado pela gestão municipal e também
Instagram, e de que é possível mostrar a essas pessoas que propor a discussão de outras prioridades para
a vida não é tão boa quanto parece. a cidade.

d)O texto de Nina Lemos apresenta uma organização textual


e sintática típica da esfera jornalística, que se caracteriza pelo Para as questões 12 e 13, leia o texto
uso de marcas de oralidade como o recurso a sequências de abaixo.
diálogos (“Quem estamos querendo enganar? A gente.”), o
uso de marcadores discursivos (“bem”, “sério”) e de É possível fazer educação de qualidade sem
enunciados inseridos (“quem nunca?”). escola
É possível fazer educação embaixo de um pé
de manga?
11) A publicidade acima foi divulgada no site da agência
Não só é, como já acontece em 20 cidades
FAMIGLIA no dia 24 de janeiro de 2007, véspera do
brasileiras e
aniversário de São Paulo, no período em que foi proposta a
em Angola, Guiné-Bissau e Moçambique.
campanha “Cidade Limpa”. Na base da foto, em letras bem
Decepcionado com o processo de
pequenas, está escrito: Tomara, mas tomara mesmo, que nos
“ensinagem”, o
próximos aniversários o paulistano comemore uma cidade
antropólogo Tião Rocha pediu demissão do
nova de verdade.
cargo de
professor da UFOP (Universidade Federal de
Ouro Preto) e
criou em 1984 o CPCD (Centro Popular de
Cultura e
Desenvolvimento).
Curvelo, no Sertão mineiro, foi o laboratório da
“escola”
que abandonou mesa, cadeira, lousa e giz, fez
das ruas a
sala de aula e envolveu crianças e familiares
na pedagogia
da roda. “A roda é um lugar da ação e da
reflexão, do ouvir
e do aprender com o outro. Todos são
educadores, porque
Considerando os sentidos produzidos por esse anúncio, é estão preocupados com a aprendizagem. É
correto afirmar: uma
a) As duas perguntas e as duas respostas que configuram o construção coletiva”, explica.
texto do outdoor na publicidade acima pressupõem que os O educador diz que a roda constrói consensos.
paulistanos estão discutindo o número de outdoors e também “Porque
o abandono de muitos dos moradores da cidade. todo processo eletivo é um processo de
exclusão, e tudo
b) O texto escrito em letras pequenas tem a função de exortar que exclui não é educativo. Uma escola que
os paulistanos a refletir sobre as próximas eleições e sobre seleciona não
como fazer para que seja estabelecido um conjunto de educa, porque excluiu alguns. A melhor
prioridades socialmente relevantes para toda a sociedade. pedagogia é
c)A publicidade pretende levar os leitores a perceber que as aquela que leva todos os meninos a
prioridades estabelecidas pela gestão municipal da cidade aprenderem. E todos
não permitem que os paulistanos enxerguem os verdadeiros podem aprender, só que cada um no seu ritmo,
problemas que estão nas ruas de São Paulo. não
podemos uniformizar.”
d) A publicidade, composta de texto verbal e imagem, tem Nesses 30 anos, o educador foi engrossando
como objetivo principal encampar o projeto “Cidade Limpa” seu

24
dicionário de terminologias educacionais, todas calcadas uniformização da aprendizagem.
no saber popular: surgiu a pedagogia do abraço, a
pedagogia do brinquedo, a pedagogia do sabão e até
oficinas de cafuné. Esta última foi provocada depois que 13) Em relação ao trecho “E ainda colocou em
um garoto perguntou: “Tião, como faço para conquistar uso termos
uma moleca?” Foi a deixa para ele colocar questões de como ‘empodimento’, após várias vezes ser
sexualidade na roda. questionado
Para resolver a falência da educação, Tião inventou uma UTI pelas comunidades: ‘Pode [fazer tal coisa],
educacional, em que “mães cuidadoras” fazem “biscoito Tião?’ Seguida
escrevido” e “folia do livro” (biblioteca em forma de festa) para da resposta certeira: ‘Pode, pode tudo’”, é
ajudar na alfabetização. E ainda colocou em uso termos como correto afirmar:
“empodimento”, após várias vezes ser questionado pelas
comunidades: “Pode [fazer tal coisa], Tião?” Seguida da a) A expressão “Seguida da resposta certeira”
resposta certeira: “Pode, pode tudo”. Aos 66 anos, Tião diz indica a
estar convicto de que a escola do futuro não existirá e que ela elipse de uma outra expressão.
será substituída por espaços de aprendizagem com todas as
ferramentas possíveis e necessárias para os estudantes b) A criação da palavra “empodimento” é
aprenderem.“Educação se faz com bons educadores, e o resultado de um
modelo escolar arcaico aprisiona e há décadas dá sinais de processo: sufixação.
falência. Não precisamos de sala, precisamos de gente.Não
precisamos de prédio, precisamos de espaços de aprendizado. c) A repetição do verbo no enunciado “Pode,
Não precisamos de livros, precisamos ter todos os pode tudo”
instrumentos possíveis que levem o menino a exemplifica o estilo reiterativo do texto.
aprender.” Sem pressa, seguindo a Carta da Terra e citando
Ariano Suassuna para dizer que “terceira idade é para fruta: d) O discurso direto presente no trecho tem a
verde, madura e podre”, Tião diz se sentir “privilegiado” de função de dar voz às comunidades
viver o que já viveu e acreditar na utopia de não haver mais
nenhuma criança analfabeta no Brasil. “Isso não é uma
política de governo, nem de terceiro setor, é uma questão 14) Cem anos depois
ética”, pontua.
Vamos passear na floresta
(Qsocial, 09/12/2014. Disponível em http://www.cpcd.org.br/ Enquanto D. Pedro não vem.
portfolio/e_possivel_fazer_educacao_de_qualidade_100_escola/.)
D. Pedro é um rei filósofo,
Que não faz mal a ninguém.
12) A partir da identificação de várias expressões nominais ao
Vamos sair a cavalo,
longo do texto, é correto afirmar que:
Pacíficos, desarmados:
A ordem acima de tudo.
a) As expressões “pedagogia do abraço”, “pedagogia da roda”,
Como convém a um soldado.
“pedagogia do sabão”, “pedagogia do brinquedo”, “oficinas de
Vamos fazer a República,
cafuné” são referências a terminologias educacionais de
Sem barulho, sem litígio,
caráter técnico.
Sem nenhuma guilhotina,
Sem qualquer barrete frígio.
b) As expressões “biscoito escrevido”, “processo de
Vamos, com farda de gala,
ensinagem” e “folia do livro” são neologismos criados por meio
Proclamar os tempos novos,
da manipulação de processos de formação
Mas cautelosos, furtivos,
de palavras.
Para não acordar o povo.
c) A expressão “escola” está entre aspas porque se refere aos
(José Paulo Paes, O melhor poeta da minha rua, em Fernando
espaços de aprendizagem diferentes da escola tradicional de Paixão (sel. e org.), Para gostar de ler. São Paulo: Ática, 2008,
hoje e que não serão encontrados no futuro. p.43.)

d) A expressão “processo eletivo”, compreendida no texto O tom irônico do poema em relação à história
como exclusão social, pressupõe a existência de um do Brasil põe em evidência
projeto educacional que tem por objetivo a

25
a) o modo como a democracia surge no Brasil por interferência Na passagem citada, a personagem Kindzu
do Imperador. recorda os ensinamentos de seu pai diante do
estado desolador em que se encontrava sua
b) a maneira despótica como os republicanos trataram os terra, assolada pela guerra, e reflete sobre a
símbolos nacionais. coerência de suas ações em relação a tais
ensinamentos. Levando em consideração o
c) a postura inconsequente que sempre caracterizou os contexto da narrativa do romance de Mia
governantes do Brasil. Couto, é correto afirmar que:

d) a forma astuciosa como ocorreram os movimentos políticos a)A demanda realizada por Kindzu e que é
no Brasil. relatada em seus cadernos funciona como
uma forma de fuga para a personagem
Muidinga, que se aliena da realidade da
15) Considere que uma das funções da comédia é corrigir os guerra pela leitura dos cadernos, indicando de
costumes ou criticar os valores de uma sociedade em um modo inequívoco a função social da literatura.
período histórico. O cômico em Lisbela e o prisioneiro é
b) A narrativa contida nos cadernos de Kindzu,
a) progressista, porque as ações dramáticas das personagens lida por Muidinga e Tuahir, representa o
afrontam a ordem policial e familiar e revelam a inconsistência universo onírico e se contrapõe à realidade
moral dessa ordem. objetiva das duas personagens, razão pela
qual ambas as narrativas aparecem no livro de
b) liberal, porque visa a restaurar a ordem hierárquica das modo intercalado, sem, necessariamente,
personagens de classe social superior em um mundo marcado haver uma interseção entre elas.
por corrupção moral e religiosa.
c) Segundo a personagem Kindzu, a sua terra,
c) radical, porque Citonho e Lisbela planejam a fuga dos sonâmbula como ele, seria um lugar da
presos, rompendo com o pacto da autoridade policial e com a sobreposição entre sonho e realidade, tal
norma do casamento monogâmico. como ocorre na narrativa que registra em seus
cadernos, em que é impossível o
d)revolucionário, porque Frederico Evandro encarna a figura estabelecimento de uma delimitação entre o
do justiceiro que desmoraliza a autoridade corrupta e os falsos onírico e o real.
sentimentos.
d) O sonho, sugerido pelo termo “sonâmbulo”,
contrapõe-se à realidade da guerra, sugerida
16) Leia o seguinte trecho da obra Terra Sonâmbula, de Mia pela palavra “fogo”; terra sonâmbula seria,
Couto, extraído do Sexto caderno de Kindzu, subintitulado O pois, um lugar em que os limites entre
regresso a Matimati. realidade e sonho aparecem bem delimitados
e no qual as personagens estão condenadas
Lembrei meu pai, sua palavra sempre azeda: agora, somos definitivamente à miséria da guerra.
um povo de mendigos, nem temos onde cair vivos. Era como
se ainda escutasse:
17) Na tira abaixo, o autor retoma um célebre
- Mas você, meu filho, não se meta a mudar os destinos.Afinal, lema retirado do Manifesto Comunista (1848),
eu contrariava suas mandanças. Fossem os naparamas, de Karl Marx e Friedrich Engels: “Operários
fosse o filho de Farida: eu não estava a deixar o tempo quieto. do mundo, uni-vos!”
Talvez, quem sabe, cumprisse o que sempre fora: sonhador
de lembranças, inventor de verdades. Um sonâmbulo
passeando entre o fogo. Um sonâmbulo como a terra em que
nascera. Ou como aquelas fogueiras por entre as quais eu
abria caminho no areal.

(Mia Couto, Terra Sonâmbula. São Paulo: Companhia de Bolso, 2015, p. 104.)

26
Considerando os sentidos produzidos pela tirinha,é correto
afirmar que nela se lê

a)uma apologia ao Manifesto Comunista,atenuada pela


onomatopeia que imita o som (“zzzzzz”) das abelhas.

b)uma paródia do lema do Manifesto Comunista,baseada na


semelhança fonética entre “uni-vos” e “zuni-vos”.

c)uma parábola para explicar o Manifesto Comunistapor meio 19)


da semelhança fonética entre “uni-vos” e “zuni-vos”.

d)uma fábula que recria o lema do Manifesto Comunista, com


base na linguagem onomatopaica das abelhas (“zzzzzz”)

18) Em depoimento, Paulo Freire fala da necessidade de uma


tarefa educativa: “trabalhar no sentido de ajudar os homens e
as mulheres brasileiras a exercer o direito de poder estar de
pé no chão, cavando o chão, fazendo com que o chão produza
melhor é um direito e um dever nosso. A educação é uma das
chaves para abrir essas portas. Eu nunca me esqueço de uma
frase linda que eu ouvi de um educador, camponês de um
grupo de Sem Terra: pela força do nosso trabalho, pela nossa
luta, cortamos o arame farpado do latifúndio e entramos nele,
mas quando nele chegamos, vimos que havia outros arames
farpados, como o arame da nossa ignorância. Então eu Do ponto de vista da norma culta ,é correto
percebi que quanto mais inocentes, tanto melhor somos para afirmar que “coisarˮ é
os donos do mundo. (...)Eu acho que essa é uma tarefa que
não é só política, mas também pedagógica. Não há Reforma a)uma palavra resultante da atribuição do
Agrária sem isso.” sentido conotativo de um verbo qualquer ao
substantivo “coisaˮ
(Adaptado de Roseli SaleteGaldart,Pedagogia do Movimento Sem Terra: escola é mais
que escola. São Paulo: Expressão Popular, 2008, p. 172.)
.b)uma palavra resultante do processo de
sufixação que transforma o substantivo
No excerto adaptado que você leu,há menção a outros
“coisaˮ no verbo “coisarˮ.
arames farpados, como “o arame da nossa ignorância”.Trata-
se de uma figura de linguagem para
c)uma palavra que,graças a seu sentido
universal, pode ser usada em substituição a
a)a conquista do direito às terras e à educação que são
todo e qualquer verbo não lembrado.
negadas a todos os trabalhadores.

d)uma palavra que resulta da transformação


b)a obtenção da chave que abre as portas da educação a
do substantivo “coisaˮ em verbo “coisarˮ,
todos os brasileiros que não têm terras.
reiterando um esquecimento
c)a promoção de uma conquista da educação que tenha como
base a propriedade fundiária.

d)a descoberta de que a luta pela posse da terra pressupõe


também a conquista da educação.

27
20) Assinale a alternativa correta. b) A linguagem exigida, especialmente nas
aulas de língua portuguesa, corresponde a
um modelo próprio das classes dominantes e
das categorias sociais a
elasvinculadas.(Camacho, 1985, p.4.)

c) Não existe nenhuma justificativa ética,


política, pedagógica ou científica para
continuar condenando como erros os usos
linguísticos que estão firmados no
português brasileiro. (Bagno, 2007, p. 161.)

d) Aquele que aprendeu a refletir sobre a


a) A pergunta lançada no último quadrinho (“Você sabe quem linguagem é capaz de compreender uma
inventou o avião?ˮ) remete-nos a Santos Dumont, portanto gramática –que nada mais é do que o
confirma o que se diz no primeiro e segundo quadrinhos. resultado de uma (longa) reflexão sobre
a língua. (Geraldi, 1996, p. 64.
b) A pergunta lançada no último quadrinho (“Você sabe quem
inventou o avião?ˮ) retifica a afirmação do primeiro quadrinho
(“Não há lei que o brasileiro não burle.ˮ).

c) A afirmação do segundo quadrinho (“Há a lei da Gravidade.ˮ) 22) Caligrafia (Arnaldo Antunes)
refere-se a uma lei da física que nenhum brasileiro é capaz de Arte do desenho manual das letras e palavras.
burlar, como se admite no primeiro quadrinho.
Território híbrido entre os códigos verbal e
d) A pergunta lançada no último quadrinho (“Você sabe quem visual.
inventou o avião?ˮ) é retórica, já que não há uma resposta
para ela nem no primeiro nem no segundo quadrinhos. A caligrafia está para a escrita como a voz está
para a fala.
A cor, o comprimento e espessura das linhas,
21) No dia 21 de setembro de 2015, Sérgio Rodrigues, a disposição espacial, a velocidade dos traços
crítico literário, comentou que apontar no título do filme Que da escrita correspondem a timbre, ritmo, tom,
horas ela volta? Um erro de português “revela visão curta cadência, melodia do discurso falado.
sobre como a língua funciona”. E justifica: “O título do filme, Entonação gráfica.
tirado da fala de um personagem, está em registro coloquial.
Que ano você nasceu? Que série você estuda? e frases Assim como a voz apresenta a efetivação
do gênero são familiares a todos os brasileiros, mesmo física do discurso (o ar nos pulmões, a
com alto grau de escolaridade. Será preciso reafirmar a esta vibração das cordas vocais, os movimentos da
altura do século 21 que obras de arte têm liberdade para língua), a caligrafia também está intimamente
transgressões muito maiores? Pretender que uma obra de ligada ao corpo, pois carrega em si os sinais
ficção tenha o mesmo grau de formalidade de um editorial de maior força ou delicadeza, rapidez ou
de jornal ou relatório de firma revela um jeito autoritário de lentidão, brutalidade ou leveza do momento
compreender o funcionamento não só da língua, mas da arte de sua feitura.
também (Adaptado de https://www.arnaldoantunes.com.br. Acessado em
12/07/2016.)
.”(Adaptado do blog Melhor Dizendo. Post completo disponível em
http://www.melhordizendo.com/a-que-horas-ela-volta-em-que-ano-estamos-mesmo/. Em Caligrafia, o autor
Acessado em 08/06/2016.)
a) estabelece uma relação de causa e efeito
Entre os excertos de estudiosos da linguagem
entre caligrafia e voz.
reproduzidos a seguir, assinale aquele que corrobora os
comentários do post. b) sugere uma relação de oposição entre
caligrafia e voz.
a) Numa sociedade estruturada de maneira complexa
a linguagem de um dado grupo social reflete-o tão bem como c) projeta uma relação de gradação entre
suas outras formas de comportamento. (Mattoso Câmara caligrafia e voz.
Jr.,1975, p. 10.)

28
d)apreende uma relação de analogia entre caligrafia e voz. “ – Queres seguir a política? Então? Procura
imitar Bismarck!

Haverá padrão melhor?”


23) “Uma peripécia, uma reviravolta nas circunstâncias, de
uma hora para outra transforma uma sequência rotineira de (Idem, p. 290.)

acontecimentos numa história.” Os fragmentos acima captam um dos traços


(Jerome Bruner, Fabricando histórias. Direito, literatura, vida. São Paulo: Letra e Voz, principais de Caminhos cruzados no que diz
2014, p.15.) respeito à identidade narrativa das
Levando-se em conta a noção acima proposta por Jerome personagens. Considerando o conjunto do
Bruner, qual é a peripécia que ocorre no terceiro ato da romance, tal traço consiste em uma
peça Lisbela e o prisioneiro? a) percepção de que a necessidade de status
a)O disparo de arma de fogo em direção a Frederico na vida social e a produção de desejos
Evandro, realizado por Lisbela, e a descoberta posterior políticos e religiosos nascem da cópia de um
de que as balas do revólver eram de festim. modelo consagrado.

b)O encontro furtivo de Lisbela e Leléu na prisão, que b)afirmação, por meio do narrador, da
torna possível a fuga do casal de amantes e produz o necessidade de protagonistas bem
desenlace do drama. construídos para o êxito da narrativa ficcional.

c)A fuga de Leléu da prisão, que somente foi possível c)recusa dos modelos bem sucedidos na vida
devido às artimanhas de Lisbela ao pedir que seu pai social, pois eles constrangem a imaginação
desse uma corda para o prisioneiro. artística e moral dos romancistas.

d)O retornoheroico de Frederico Evandro à prisão,com o d)representação literária da condição humana,


intuito de salvar Leléu e assassinar o Tenente Guedes. que não necessita de figuras imaginárias para
atribuir sentido à vida religiosa e política.

24) O romance Memórias póstumas de Brás Cubas é


considerado um divisor de águas tanto na obra de Machado 26) Sabe-se que Coração, cabeça e estômago
de Assis quanto na literatura brasileira do século XIX. Indique é uma obra atípica na produção ficcional de
a alternativa em que todas as características mencionadas Camilo Castelo Branco. Em relação a essa
podem ser adequadamente atribuídas ao romance em obra, assinale a alternativa em que todas as
questão. características listadas são corretas.

a)Rejeição dos valores românticos, narrativa linear e fluente a)Inclusão da edição do livro como parte do
de um defunto autor, visão pessimista em relação aos jogo narrativo; sátira da poesia e das
problemas sociais. motivações espirituais; caracterização do
herói como alguém incapaz de amar.
b)Distanciamento do determinismo científico, cultivo do humor
e digressões sobre banalidades, visão reformadora das b)Paródia da vida romântica e natural;
mazelas sociais. espiritualização das necessidades do corpo;
transformação do herói ao longo da narrativa.
c)Abandono das idealizações românticas, uso de técnicas
pouco usuais de narrativa, sugestão implícita de contradições c)Descrição da formação do indivíduo;
sociais. caricatura dos valores e sentimentos
românticos; impossibilidade de adaptação do
d)Crítica do realismo literário, narração iniciada com a morte herói à vida social.
do narrador-personagem, tematização de conflitos sociais.
d) Caricatura das questões relacionadas ao
espírito e à posição social; elogio irônico das
25) “São Francisco botava o dedo nas feridas dos leprosos. motivações fisiológicas; ridicularização do
Mas é que ele era um santo, fazia milagres, e ela é herói.
simplesmente Doralice Leitão Leiria, um ser humano como
qualquer outro.”
(Érico Veríssimo, Caminhos cruzados. São Paulo: Companhia de Bolso, 2016, p.77.)

29
27) Ironia ao natural
(Adaptado de Sírio Possenti, “A questão dos estrangeirismos”, em
Carlos Alberto Faraco, Estrangeirismos: guerras em torno da
É natural, língua. São Paulo: Parábola, 2001, p. 173-174.)
é bom
e quanto mais melhor, Glossário:
como os cogumelos Bug: falha devido ao mau funcionamento em
vermelhos, um programa de informática.
as rãs azuis Computar: contar, incluir.
ou o suco de serpente... Dar load: carregar.
É químico, Lolking: site da Internet sobre o jogo
processado, Ranked: partida que dá pontos ao jogador
é mau, Server: servidor; em informática, é um
como a programa ou um computador que fornece
aspirina, serviços a uma rede de computadores.
um perfume Upar: subir de nível, recarregar.
ou o plástico
da válvula (Adaptado de
http://forums.br.leagueoflegends.com/board/showthread.php?t=1
cardíaca 87120. Acessado em 15/07/2017.)
de um coração...
As alternativas abaixo reproduzem trechos de
(João Paiva, quase poesia quase química. Sociedade Portuguesa de Química, 2012,
p.15. Disponível em www.spq.pt/files/docs/boletim/poesia/quase-poesia-quasequimica-
um fórum de discussão na Internet sobre um
jpaiva2012.pdf. Acessado em 06/07/2016.) jogo eletrônico. Nessa discussão, um jogador
queixa-se por não ter conseguido se conectar
a uma partida e ter perdido pontos. Escolha a
Nesse poema, há alternativa que contém um exemplo do
processo de adaptação de verbos do inglês
a)inversão dos atributos do que seria bom na natureza e do
para o sistema verbal do português, como
que seria ruim nos processados, de modo a, ironicamente,
descreve Sírio Possenti.
ressaltar a importância da química.

b)comparação entre o lado bom dos produtos naturais e o lado a) “Aconteceu logo na manhã deste domingo,
ruim dos produtos processados, de modo a ressaltar, quando iniciei uma ranked.”
efusivamente, o perigo da química.
b) “Ela não deu load e pensei que era um bug
c)demonstração do lado bom dos produtos naturais e o lado
no site.”
ruim dos produtos processados, sem, contudo, realizar uma
crítica em relação à química.
c)“Entrei no lolking para ver se a partida
d)elogio aos produtos naturais, reforçando-se a ideia de estava sendo computada.”
consumirmos mais desses produtos em detrimento de
produtos processados com o auxílio da química. d)“Nem upei meu personagem de tanto
problema no server.”

28) Estrangeirismos são palavras e expressões de outras


línguas usadas correntemente em nosso cotidiano. Sobre o 29) Leia, a seguir, um excerto de “Terrorismo
emprego de palavras estrangeiras no português, o linguista Literário”, um manifesto do escritor Ferréz.
Sírio Possenti comenta:
A capoeira não vem mais, agora reagimos
Tomamos alguns verbos do inglês e os adaptamos a nosso com a palavra, porque pouca coisa mudou,
sistema verbal exclusivamente segundo regras do português. principalmente para nós. A literatura marginal
Se adotarmos start, logo teremos estartar (e todas as suas se faz presente para representar a cultura de
flexões), pois nossa língua não tem sílabas iniciais como st-, um povo composto de minorias, mas em seu
que imediatamente se tornam est-. A forma nunca será startar, todo uma maioria.
nem ostartar ou ustartar, nem estarter ou estartir, nem printer
ou printir, nem atacher ou atachir etc., etc., etc.

30
A Literatura Marginal, sempre é bom frisar, é uma literatura relação de contradição, uma vez que indicam
feita por minorias, sejam elas raciais ou socioeconômicas. sentidos opostos.
Literatura feita à margem dos núcleos centrais do saber e da
grande cultura nacional, isto é, de grande poder aquisitivo. b) uma relação de consequência, já que a
Mas alguns dizem que sua principal característica é a diminuição de um grupo conduz ao aumento
linguagem, é o jeito que falamos, que contamos a história, de outro.
bom, isso fica para os estudiosos.
c)uma relação de contraste, pois reivindicam o
Cansei de ouvir: - “Mas o que cês tão fazendo é separar a aumento de um tipo de presos e a redução de
literatura, a do gueto e a do centro”. E nunca cansarei de outro.
responder: - “O barato já tá separado há muito tempo, foi feito
todo um mundo de teses e de estudos do lado de lá, e do de d)uma relação de complementaridade, porque
cá mal terminamos o ensino dito básico.” remetem a subconjuntos de uma mesma
categoria.
(Adaptado de Ferréz, “Terrorismo literário”, em Ferréz (Org.), Literatura marginal: talentos
da escrita periférica. Rio de Janeiro: Agir, 2005, p. 9,12,13.)

Ferréz defende sua proposta literária como uma 31) Numa entrevista ao jornal El País em 26
de agosto de 2016, o jornalista Caco Barcellos
a) descoberta de que é preciso reagir com a palavra para que comenta uma afirmação sua anterior, feita em
não haja separação entre a grande cultura nacional e a um congresso de jornalistas investigativos, de
literatura feita por minorias. que novos profissionais não deveriam “atuar
como porta-vozes de autoridades”.
b)comprovação de que, sendo as minorias de fato uma
maioria, não faz sentido distinguir duas literaturas, uma do “Tenho o maior encanto e admiração e
centro e outra da periferia. respeito pelo jornalismo de opinião. O que
critiquei lá é quando isso vai para a
c)manifestação de que a literatura marginal tem seu modo reportagem. Não acho legítimo. O repórter tem
próprio de falar e de contar histórias, já reconhecido pelos o dever de ser preciso. Pode ser até analítico,
estudiosos. mas não emitir juízo. Na reportagem de rua,
fico imbuído, inclusive, de melhor informar o
d)constatação de que é preciso reagir com a palavra e meu colega de opinião. Se eu não fizer isso de
mostrar-se nesse lugar marginal como literatura feita por modo preciso e correto, ele vai emitir um juízo
minorias que juntas formam uma maioria. errado sobre aquele universo que estou
retratando. E não só ele, mas também o
30) No contexto deste grafite, as frases “menos presos advogado, o sociólogo, o antropólogo e mais
políticos” e “mais políticos presos” expressam para frente o historiador (...) Por exemplo,
essa matança que a polícia militar provoca no
cotidiano das grandes cidades brasileiras –
a) isso é muito mal reportado pela mídia no seu
uma conjunto. Quem sabe, lá no futuro, o
historiador não passe em branco por esse
momento da história. Não vai poder dizer ‘olha,
os negros pobres do estado mais rico da
federação estão sendo eliminados com a
frequência de três por dia, um a cada oito
horas’. Se o repórter não fizer esse registro
preciso e contundente, a cadeia toda pode
falhar, a começar pelo jornalista de opinião.”

(“Caco Barcelos: ‘Erros históricos nascem da imprecisão


jornalística’ ”. El País. 26/08/2016. Entrevista concedida a Camila
Moraes. Disponível em
https://brasil.elpais.com/brasil/2016/07/19/cultura/1468956578_9
24541.html. Acessado em 13/07/2017.)

31
De acordo com a posição defendida por Caco Barcellos com 33) Em relação ao post adaptado da página do
relação a seus leitores, uma reportagem exige do jornalista Facebook “Caneta Desmanipuladora”, é
correto afirmar que a “desmanipulação”
a) conhecimento preciso do assunto, uma vez que seu (substituição de “já” por “só” e acréscimo de
objetivo é convencer o leitor a concordar com o que escreve “até agora”) explicita a tentativa do jornal de
para evitar que ele cometa erros. levar o leitor a pensar que

b) investigação e precisão no tratamento do assunto, porque


ela vai servir de base a outros artigos, permitindo que o leitor
tire suas próprias conclusões.

c)investigação e precisão na abordagem dos fatos, já que ele


também emite seu juízo sobre o assunto, conduzindo o leitor
a aceitar a história que narra.

d)conhecimento preciso dos fatos tratados, para que, no futuro,


o leitor seja levado a crer que o repórter registrou sua opinião
de forma equilibrada.

32) Considerando os sentidos produzidos pela tirinha, é


correto afirmar que o autor explora o fato de que palavras
como “ontem”, “hoje” e “amanhã”

a) ainda falta muito a ser pago pela


mineradora e há atrasos no pagamento.

b) a Samarco teria pago uma grande parte do


que devia e o prazo provavelmente está sendo
cumprido.

c) a Samarco já quitou o que devia , conforme


valor homologado na justiça.

d) a mineradora não deveria arcar sozinha


a) mudam de sentido dependendo de quem fala. com a despesa da tragédia de Mariana.

b)adquirem sentido no contexto em que são enunciadas.


34) Em maio deste ano, uma festa do 3º ano
c)deslocam-se de um sentido concreto para um abstrato.
do Ensino Médio de uma escola do Rio
devidenciam o sentido fixo dos advérbios de tempo. Grande do Sul propôs aos alunos que se
preparavam para o vestibular uma atividade
chamada “Se nada der certo”. O objetivo era
“trabalhar o cenário de não aprovação no
vestibular”, e como “lidar melhor com essa

32
fase”. Os alunos compareceram à festa “fantasiados” de Entre os recursos comuns aos neologismos de
faxineiros, garis, domésticas, agricultores, entre outras Guimarães Rosa e de James Joyce, estão:
profissões consideradas de pessoas “fracassadas”. O evento
I. Onomatopeia (formação de uma palavra a
teve repercussão nacional e acirrou o debate sobre a
partir de uma reprodução aproximada de um
meritocracia. Para Luis Felipe Miguel, professor de ciência
som natural, utilizando-se os recursos da
política, “o tom de chacota da festa-recreio era óbvio”, e teria
língua); e
sido mais interessante “discutir como se constrói a hierarquia
que define algumas ocupações como subalternas e outras II. Derivação (formação de novas palavras
como superiores; discutir como alguns podem desprezar os pelo acréscimo de prefixos ou sufixos a
saberes incorporados nas práticas dessas profissões palavras já existentes na língua).
(subalternas apenas porque contam com quem as faça por
Os neologismos que aparecem nas opções
eles); discutir como o que realmente ‘deu certo’ para eles foi a
abaixo foram extraídos de obras de
loteria do nascimento, que, na nossa sociedade, determina a
Guimarães Rosa (GR) e James Joyce (JJ).
parte do leão das trajetórias individuais”.
Assinale a opção em que os processos (I) e (II)
(Adaptado de Fernanda Valente, Dia do ’se nada der certo’ acende debate sobre estão presentes:
meritocracia e privilégio. Carta Capital, 06/06/2017. Disponível em
http://justificando.cartacapital.com.br/2017/06/06/dia-do-se-nada-der-certoacende-
debate-sobre-meritocracia-e-privilegio/. Acessado em 08/06/2017.)
a)Quinculinculim (GR, No Urubuquaquá, no
Pinhém) e tattarrattat (JJ, Ulisses).
As alternativas a seguir reproduzem trechos de uma entrevista b)Transtrazer (GR, Grande sertão: veredas) e
do professor Sidney Chalhoub (Unicamp e Harvard) sobre o monoideal (JJ, Ulisses).
mito da meritocracia.
c)Rtststr (JJ, Ulisses) e quinculinculim (GR, No
(Manuel Alves Filho, A meritocracia é um mito que alimenta as desigualdades, diz Sidney Urubuquaquá, no Pinhém).
Chalhoub. Jornal da Unicamp, 07/06/2017.)
d)Tattarrattat (JJ, Ulisses) e inesquecer-se
Assinale aquela que dialoga diretamente com a notícia acima. (GR, Ave, Palavra).

a)É preciso promover a inclusão “e fazer com que o


conhecimento que essas pessoas trarão à Universidade seja 36) “ODORICO
reconhecido e disseminado”.
Eu sei. É um movimento subversivo
procurando me intrigar com a opinião pública
b)Com a adesão da Unicamp ao sistema de cotas, um “novo
e criar problemas à minha administração. Sei,
contingente de alunos colocará em cheque vários hábitos da
sim. É uma conspiração. Eles não queriam o
universidade”.
cemitério. Desde o princípio foram contra. E
agora que o cemitério está pronto caem de
c)“As melhores universidades do mundo (que servem de
pau em cima de mim, me chamam de
referência) adotam a diversidade no ingresso dos estudantes
demagogo, de tudo..”
há bastante tempo”.
(...)
d)“O ideal seria que todos aqueles que tivessem condições
“ODORICO
intelectuais e interesse em entrar na universidade obtivessem
Pois eu quero que depois o senhor soletre
uma vaga”.
esta gazeta de ponta a ponta. Neco Pedreira
o senhor conhece?
35) O brasileiro João Guimarães Rosa e o irlandês James
ZECA
Joyce são autores reverenciados pela inventividade de sua
Conheço não sinhô.
linguagem literária, em que abundam neologismos. Muitas
vezes, por essa razão, Guimarães Rosa e Joyce são citados
ODORICO
como exemplos de autores "praticamente intraduzíveis".
É o dono do jornal. Elemento perigoso. Sua
Mesmo sem ter lido os autores, é possível identificar alguns
primeira missão como delegado é dar uma
dos seus neologismos, pois são baseados em processos de
batida na redação dessa gazeta subversiva e
formação de palavras comuns ao português e ao inglês.
sacudir a marreta em nome da lei e da
democracia...”

33
“Acho que só devemos ler a espécie de livros
(Dias Gomes, O bem amado. 12.ed. Rio de Janeiro: Bertrand Brasil, 2014, p. 40 e 68.)
que nos ferem e trespassam. Um livro tem que
ser como um machado para quebrar o mar de
A peça de Dias Gomes é uma crítica a um momento histórico
gelo do bom senso e do senso comum.”
e político da sociedade brasileira. Odorico Paraguassu tornou-
se um personagem emblemático desse período porque por
(Adaptado de “Franz Kafka, carta a Oscar Pollak, 1904” Disponível
meio dele em https://laboratoriode sensibilidades.wordpress.com. Acessado
em 28/05/2018.)

a) simbolizou-se a defesa da democracia a qualquer custo.


Assinale o excerto que confirma os dois textos
Essa defesa resultou em uma sociedade cindida entre o
anteriores.
respeito à lei e o seu uso particular, temas políticos comuns
aos países latino-americano nos anos de 1970.
a)A leitura é, fundamentalmente, processo
político. Aqueles que formam leitores —
b) representaram-se o atropelo da lei constitucional, a
professores, bibliotecários — desempenham
relativização da liberdade de imprensa e a construção de um
um papel político. (Marisa Lajolo)
inimigo interno que justificasse o arbítrio das decisões do
executivo, próprios aos Anos de Chumbo.
b)Pelo que sabemos, quando há um esforço
real de igualitarização, há aumento sensível
c) explicitaram-se as leis que regiam a vida política e social de
do hábito de leitura, e portanto difusão
uma nação subdesenvolvida da América Latina na década de
crescente das obras. (Antonio Candido)
1970, marcada pela inércia e pela cumplicidade dos cidadãos
com a corrupção sistêmica do país.
c)Ler é abrir janelas, construir pontes que
ligam o que somos com o que tantos outros
d) fez-se a defesa da democracia e do respeito irrestrito à lei
imaginaram, pensaram, escreveram; ler é
constitucional para um projeto de nação brasileira da década
fazer-nos expandidos. (Gilberto Gil)
1970, que enfrentava o espírito demagógico dos políticos
latino-americanos.
d) A leitura é uma forma servil de sonhar. Se
tenho de sonhar, por que não sonhar os meus
próprios sonhos? (Fernando Pessoa)

37)
38) Há dois tipos de palavras: as
proparoxitonas e o resto. As proparoxitonas
são o ápice da cadeia alimentar do léxico.

As palavras mais pernósticas são sempre


proparoxitonas. Para pronunciá-las, há que ter
ânimo, falar com ímpeto - e, despóticas, ainda
exigem acento na sílaba tônica! Sob qualquer
ângulo, a proparoxítona tem mais crédito. É
inequívoca a diferença entre o arruaceiro e o
vândalo. Uma coisa é estar na ponta — outra,
no vértice. Ser artesão não é nada, perto de
ser artífice.

Legal ser eleito Papa, mas bom mesmo é ser


Pontífice.
(Adaptado de Eduardo Affonso, “Há dois tipos de palavras: as
proparoxítonas e o resto”. Disponível em
www.facebook.com/eduardo22affonso/.)

34
Segundo o texto, as proparoxítonas são palavras que

a)garantem sua pronúncia graças à exigência de uma sílaba


tônica.

b)conferem nobreza ao léxico da língua graças à facilidade de


sua pronúncia.

c)revelam mais prestígio em função de seu pouco uso e de


sua dupla acentuação.

d)exibem sempre sua prepotência, além de imporem a


obrigatoriedade da acentuação.

39) Na década de 1950, quando iniciava seu governo,


Juscelino Kubitschek prometeu “50 anos em 5”. Na campanha
do atual governo o slogan ficou assim: “O Brasil voltou, 20 A ressignificação de estrela ocorre porque o
anos em dois”. A 'tradução' não tinha como dar certo; era como verbete apresenta
comparar vinho com água. E mais: havia uma vírgula no meio
do caminho. Na propaganda, apenas uma vírgula impede que a)diversas acepções dessa palavra de modo
a leitura, ao invés de ser positiva e associada ao progressismo amplo, literal e descritivo.
de Juscelino, se transforme numa mensagem de retrocesso: b)cinco definições da palavra relativas à
o Brasil de fato 'voltou' muito nesses últimos dois anos; para realidade e uma definição figurada.
trás.
c)vários contextos de uso que evidenciam o
(Adaptado de Lilia Schwarcz, Havia uma vírgula no meio do caminho. Nexo Jornal,
21/05/2018.) caráter expositivo do gênero verbete.

d)uma entrada formal de dicionário e


Considerando o gênero propaganda institucional e o paralelo
acepções que expressam visões particulares.
histórico traçado pela autora, é correto afirmar que o siogan
do atual governo fracassou porque

a)o uso da vírgula provocou uma leitura negativa do trecho


que alude ao slogan da década de 1950. 41) Uma página do Facebook faz humor com
montagens que combinam capas de livros já
b)a mensagem projetada pelo siogan anterior era mais clara, publicados e memes que circulam nas redes
direta, e não exigia o uso da vírgula. sociais. Uma dessas postagens envolve a
obra de Henry Thoreau, para quem a
c)a alusão ao slogan anterior afasta o público jovem e provoca desobediência civil é uma forma de protesto
a perda de seu poder persuasivo. legítima contra leis ou atos governamentais
considerados injustos pelo cidadão e que
d)o duplo sentido do verbo “voltar” gerou uma mensagem que ponham em risco a democracia.
se afasta daquela projetada pelo slogan anterior.

40) Leia o texto a seguir, publicado no Instagram e em um livro


do @akapoeta João Doederlein.

35
E acima da razão a rima
E acima da rima a nota da canção
Bemol natural sustenida no ar
Viva aquele que se presta a estar ocupação
Salve o compositor popular

(Gilberto de Vasconcelos, Música popular: de olho na fresta. Rio


de Janeiro:Graal, 1977.)

É correto afirmar que, na canção, essa


“linguagem da fresta” transparece

a)na contradição entre “festa” e “fresta”, que


funciona como crítica ao malandro.

b)na repetição de palavras com pronúncia


semelhante para louvar a MPB.

c) na referência à “fresta” como forma de o


compositor se pronunciar.

d)na incoerência da rima entre “festa” e


“imodesta” para prestigiar o compositor.
O efeito de humor aqui se deve ao fato de que a montagem
a)refuta as razões para a desobediência civil com base na
desculpa apresentada pela criança. 43) “Um cego me levou ao pior de mim mesma,
pensou espantada. Sentia-se banida porque
b)antecipa uma possível avaliação negativa da desobediência nenhum pobre beberia água nas suas mãos
sustentada pelo livro. ardentes. Ah! era mais fácil ser um santo que
c)equipara as razões da desobediência civil à justificativa uma pessoa! Por Deus, pois não fora
apresentada pela criança. verdadeira a piedade que sondara no seu
coração as águas mais profundas? Mas era
d)contesta a legitimidade da desobediência civil defendida por uma piedade de leão.”
Thoreau.
(Clarice Lispector, “Amor”, em Laços de família. 20º ed. Rio de
Janeiro: Francisco Alves, 1990, p. 39.)

42) Para driblar a censura imposta pela ditadura militar, Ao caracterizar a personagem Ana, a
compositores de música popular brasileira (MPB) valiam-se do expressão “piedade de leão” reune valores
que Gilberto Vasconcelos chamou de “linguagem da fresta”, opostos, remetendo simultaneamente à
expressão inspirada na canção “Festa imodesta”, de Caetano compaixão e à ferocidade. É correto afirmar
Veloso. que, no conto “Amor”, essa formulação
(...)
a)revela um embate de natureza social, já que
Numa festa imodesta como esta
a pobreza do cego causa náuseas na
Vamos homenagear
personagem.
Todo aquele que nos empresta sua testa
Construindo coisas pra se cantar
b) expressa o dilema cristão da alma pecadora
Tudo aquilo que o malandro pronuncia
diante de sua incapacidade de fazer o bem.
E que o otário silencia
Toda festa que se dá ou não se dá
c)indica um conflito psicológico, uma vez que
Passa pela fresta da cesta e resta a vida.
a personagem não se sente capaz de amar.
Acima do coração que sofre com razão
À razão que volta do coração

36
d) alude a um contraste moral e existencial que provoca na
personagem um sentimento de angústia. (Camilo Castelo Branco, Coração, cabeça e estômago, p. 4.
Disponível em www .dominiopublico.gov.br. Acessado em
20/05/2018.)

44) (...) O excerto anterior apresenta uma síntese


Eu tenho uma ideia. acerca do primeiro dos setes amores da
Eu não tenho a menor ideia. personagem Silvestre da Silva.
Uma frase em cada linha. Um golpe de exercício.
Memórias de Copacabana. Santa Clara as três da tarde. Considere essa experiência amorosa no
Autobiografia. Não, biografia. contexto da primeira parte da narrativa e
Mulher. assinale a alternativa correta.
Papai Noel e os marcianos.
Billy the Kid versus Drácula. a)A mulher é idealizada em cada caso relatado,
Drácula versus Billy the Kid. não havendo espaço para uma ótica realista.
Muito sentimental.
Agora pouco sentimental. b)A experiência amorosa recebe tratamento
Pensa no seu amor de hoje que sempre dura menos que o solene e sublime por parte das personagens.
seu
amor de ontem. c) A personagem masculina se caracteriza
Gertrude: estas são ideias bem comuns. pelo interesse sexual; a feminina, pela
Apresenta a jazz-band. devoção ao marido.
Não, toca blues com ela.
Esta é a minha vida. d)O protagonista da narrativa se frustra em
Atravessa a ponte. sua crença amorosa a cada vez que se
(...) apaixona.
(Ana Cristina Cesar, A teus pés. São Paulo: Companhia das Letras, 2016, p. 9.)

Esse trecho do poema de abertura de A teus pés, de Ana


46) "A noção de programa genético (...)
Cristina Cesar,
desempenhou um papel importante no
lançamento do Projeto Genoma Humano,
a) expressa nostalgia do passado, visto que mobiliza
fazendo com que se acreditasse que a
referências à cultura pop dos anos 1970.
decifração de um genoma, à maneira de um
livro com instruções de um longo programa,
b) requisita a participação do leitor, já que as referências
permitiria decifrar ou compreender toda a
biográficas são fragmentárias.
natureza humana ou, no mínimo, o essencial
dos mecanismos de ocorrência das doenças.
c)exclui a dimensão biográfica, pois se refere a personagens
Em suma, a fisiopatologia poderia ser
imaginários e de ficção.
reduzida à genética, já que toda doença seria
reduzida a um ou diversos erros de
d)tematiza a descrença na poesia, uma vez que a poeta se
programação, isto é, à alteração de um ou
contradiz continuamente.
diversos genes”.

(Edgar Morin, A religação dos saberes: o desafio do século XXI.


45) “Picado pelo ciúme, abriu o ourives seu peito à órfã, Jornadas temáticas idealizadas e dirigidas por Edgar Morin. Rio
de Janeiro: Bertrand Brasil Ltda, 2012, p. 157.)
ofereceu-lhe a mão, e uma pulseira de brilhantes nela, com a
condição de me esquecer. Leontina disse que sim, cuidando
A expressão programa genético, mencionada
que mentia; mas passados oito dias admirou-se de ter dito a
no trecho anterior, é
verdade. Nunca mais soube de mim, nem eu dela; até que, um
ano depois, a criada, que a servia, me contou que a menina
a)uma alegoria, pois sintetiza os mecanismos
casara com o padrinho e que as enteadas, coagidas pelo pai,
moleculares subjacentes ao funcionamento
se tinham ido para o recolhimento do Grilo com uma pequena
dos genes e dos cromossomos no contexto
mesada e a esperança de ficarem pobres. Não sei mais nada
ficcional de um programa de computador.
a respeito da primeira das sete mulheres que amei, em Lisboa.”

37
b)uma analogia, pois diferencia os mecanismos moleculares Água (quase tudo)
subjacentes ao código genético e ao funcionamento dos e cloreto de sódio.
cromossomos dos códigos de um programa de computador.
(António Gedeão, Máquina de fogo. Coimbra: Tipografia da
Atlântida, 1961, p. 187.)
c)uma metáfora, pois iguala toda a informação genética e os
mecanismos moleculares subjacentes ao funcionamento e
Os versos anteriores articulam as linguagens
expressão dos genes com as instruções e os comandos de
literária e científica com questões de ordem
um programa.
ética e política.

d)uma analogia, pois contrasta os mecanismos moleculares


Considerando o contexto de produção e
dos genes nos cromossomos e das doenças causadas por
recepção de “Lágrima de Preta” (anos 1960 e
eles com as linhas de comando de um programa de
1970, em Portugal), o propósito artístico desse
computador.
poema é

a) inadequado quanto à análise social, ao


47) Em 1961, o poeta António Gedeão publica o livro Máquina refutar que haja racismo e preconceito na
de Fogo. Um dos poemas é “Lágrima de Preta”. Musicado por sociedade, e incorreto no aspecto científico,
José Niza, foi gravado por Adriano Correia de Oliveira, em ao descrever as propriedades químicas de
1970, e incluído no seu álbum “Cantaremos”. A canção foi uma lágrima.
censurada pelo governo português.
b) inadequado quanto à análise social, ao
refutar a existência de racismo e preconceito
Lágrima de preta na sociedade, mas correto no aspecto
científico, ao descrever as propriedades
Encontrei uma preta químicas de uma lágrima.
que estava a chorar,
pedi-lhe uma lágrima c) pertinente quanto à análise social, ao
para a analisar. registrar o racismo e a preconceito na
sociedade, e correto no aspecto científico, ao
Recolhi a lágrima descrever as propriedades químicas de uma
com todo o cuidado lágrima.
num tubo de ensaio
bem esterilizado. d) pertinente quanto à análise social, ao
registrar o preconceito e o racismo na
Olhei-a de um lado, sociedade, mas incorreto no aspecto científico,
do outro e de frente: ao descrever as propriedades químicas de
tinha um ar de gota uma lágrima.
muito transparente.

Mandei vir os ácidos,


as bases e os sais,
as drogas usadas 48) Uma cidade viva não é obra de um gênio:
é obra de trabalhadores simples e de suas
em casos que tais. constantes conversas consigo própria. Uma
cidade é um tecido em contínua evolução,
Ensaiei a frio, retocado e reparado para nosso uso, no qual
experimentei ao lume, a ordem emerge através de uma “mão
de todas as vezes invisível” proveniente do desejo das pessoas
deu-me o que é em se relacionar bem com seus vizinhos.
costume: (Adaptado de Roger Scruton, Confissões de um herético. Belo
Horizonte: Âyiné, 2017, p.133.)

Nem sinais de negro,


nem vestígios de ódio.

38
No trecho acima, a figura de linguagem “mão invisível”

a)estabelece uma intertextualidade com a expressão “a mão


invisível do mercado”, de Adam Smith, sendo a cidade a
expressão plena do planejamento.

b)sugere que a organização de uma cidade não se limita ao


planejamento de um gestor, mas diz respeito às relações
éticas construídas no cotidiano.

c)indica a submissão dos moradores de uma cidade aos


interesses ocultos de uma administração que promove, no
espaço urbano, a vida cotidiana.

d)associa-se à gestão pública, que é mantenedora da ordem


e do bem-estar nas relações econômicas de uma cidade.

49) Ao descrever a rotina do protagonista Raimundo Silva, o


narrador da História do Cerco de Lisboa afirma que só
restaram fragmentos dos sonhos noturnos, “imagens
insensatas aonde a luz não chega, indevassáveis até para os
narradores, que as pessoas mal informadas acreditam terem
todos os direitos e disporem de todas as chaves.”

(José Saramago, História do Cerco de Lisboa. São Paulo: Companhia das Letras, 1989,
p.122.)

Com base nesse excerto e relacionando-o ao conjunto do


romance, é correto afirmar que o narrador é
A obra Sobrevivendo no inferno do grupo
a)polifônico, pois, ao considerar todos os pontos de vista das Racionais Mc’s é composta pelas canções e
personagens, relativiza a visão de mundo e respeita a pelo projeto editorial da capa e contracapa do
privacidade delas. CD. Nesse projeto editorial, encontram-se
elementos visuais e verbais que estabelecem
b)observador, pois dissimula sua avaliação política da um jogo de formas e sentidos.
realidade ao se mostrar empático ao mundo das personagens.
Com base na afirmação de Antonio Candido,
c)protagonista, pois, ao fazer parte da própria narrativa, é correto afirmar que a organização desses
assemelha-se às demais personagens e não pode duvidar dos elementos
protocolos necessários para contar a história de Portugal.
a)produz uma simetria entre som e sentido,
d)onisciente, pois simula ser tolerante com a pluralidade de sendo que tal simetria indica que os símbolos
vozes narrativas, mas é a singularidade de seu modo de narrar religiosos são uma resposta à violência.
que produz a coesão e a autonomia da narração.
b)configura um sistema de oposições, uma
vez que imagens e palavras estabelecem
50) As palavras organizadas comunicam sempre alguma tensões materiais e espirituais, constitutivas
coisa, que nos toca porque obedece a certa ordem. Quando do sentido das canções.
recebemos o impacto de uma produção literária, oral ou
escrita, ele é devido à fusão inextricável da mensagem com a c)configura uma sintaxe poética de ordem
sua organização. Em palavras usuais: o conteúdo de uma espiritual. Essa sintaxe espelha o caos e as
obra literária só atua por causa da forma. injustiças vividos na periferia das grandes
cidades.
(Adaptado de Antonio Candido, “O direito à literatura”, em Vários escritos. São Paulo:
Ouro sobre azul e Duas Cidades, 2004, p.178.)

39
d)produz uma lógica poética racional. Essa lógica se explicita b)a impostura dos contemporâneos que são
na vitória do crime sobre a visão de mundo presente nos objeto dos comentários do cronista.
versículos bíblicos transcritos.
c)a antipatia do jornalista no que diz respeito
à busca de identidade dos artistas
51) Para inaugurar é preciso ter um defunto. Mas, por entrevistados.
desgraça, nenhum turista se afoga, nenhuma calamidade se
abate sobre a cidade e os moribundos têm o desplante de d)a sinceridade dos intelectuais que são
ressuscitarem. Na ordem estabelecida por Odorico, o bem vira objeto das crônicas dos jornalistas.
mal e o mal, bem.”

(Anatol Rosenfeld, “A obra de Dias Gomes”, em Teatro de Dias Gomes. Rio de Janeiro:
Civilização Brasileira, 1972, p. xxvii.)
53) O poema abaixo vem impresso na orelha
do livro Psia, de Arnaldo Antunes.
A comicidade de O Bem-amado, de Dias Gomes, deriva em
grande medida da inversão de valores que a peça encena.
Psia é feminino
de psiu;
Considerando os propósitos satíricos da obra, assinale a
que serve para chamar a atenção
alternativa que evidencia tal inversão.
de alguém, ou para pedir
silêncio.
a)A destinação de recursos para a construção de um cemitério
Eu berro as palavras
público confere dignidade aos mortos.
no microfone
da mesma maneira com que
b)A hospitalidade dada aos doentes ilustra o uso do
as desenho, com cuidado,
orçamento em prol do sistema público de saúde.
na página.
Para transformá-las em coisas,
c)A promoção do pistoleiro a delegado de polícia visa à
em vez de substituírem
reinserção social do criminoso.
as coisas.
Calos na língua; de calar.
d)A inauguração do cemitério dá oportunidade a que se
Alguma coisa entre a piscina e a pia.
reverencie a memória do benfeitor da cidade.
Um hiato a menos.

(Arnaldo Antunes, Psia. São Paulo: Iluminuras, 2012.)

52) No livro A cabra vadia: novas confissões, Nelson


Rodrigues inicia a crônica “Os dois namorados” com a
seguinte afirmação: Na orelha do livro, Antunes apresenta ao leitor
seu processo de criação poética.
“há coisas que um grã-fino só confessa num terreno baldio, à
luz de archotes, e na presença apenas de uma cabra vadia.” É correto dizer que o autor se propõe a
Na crônica “Terreno baldio” ele recorre ao mesmo animal para
explicar a ideia que teve de criar “entrevistas imaginárias” a)revelar a primazia da comunicação oral
sobre a escrita das palavras.
“Não podia ser um gabinete, nem uma sala. Lembrei-me,
então, do terreno baldio. Eu e o entrevistado e, no máximo, b)discutir a flexão de gênero, que torna a
uma cabra vadia. Além do valor plástico da figura, a cabra não palavra “psia” um substantivo.
trai. Realmente, nunca se viu uma cabra sair por aí fazendo
inconfidências.” c)defender a conversão das palavras em
(Nelson Rodrigues, A cabra vadia: novas confissões. Rio de Janeiro: Nova Fronteira, coisas, mudando seu estatuto.
2016, p. 52 e160.)

O caráter confessional associado à figura da cabra nas d)explorar o poder de representação da


crônicas tem relação com interjeição exclamativa “psiu!”.
a)a veracidade dos depoimentos que o cronista testemunha
nas entrevistas.

40
54) Texto I adverbiais já não dão mais conta de
Os idiomas e suas regras são coisas vivas, que vão se neutralizar o tsunami de tragédias e violência,
modificando de maneira dinâmica, de acordo com o momento e de amenizar as más notícias para garantir o
em que a sociedade vive. Um exemplo disso é a adoção do “infotenimento”. No jornal, é apresentada
termo “maratonar”, quando os telespectadores podem assistir matéria sobre uma mulher brutalmente
a vários ou a todos os episódios de uma série de uma só vez. espancada, internada com diversas fraturas
Contudo, ao que parece, a plataforma Netflix não quer mais no rosto. Em frente ao hospital, uma repórter
estar associada à “maratona” de séries. A maior razão seria a fala: “mas a boa notícia é que ela saiu da UTI
tendência atual que as gigantes da tecnologia têm seguido e não precisará mais de cirurgia reparadora na
para evitar o consumo excessivo e melhorar a saúde dos face...”. Agora, repórteres repetem a
usuários. expressão “a boa notícia é que...”, buscando
alguma brecha de esperança no “outro lado”
(Adaptado de Claudio Yuge, “Você notou? Netflix parece estar evitando o termo das más notícias.
‘maratonar’.” Disponível em https://www.tecmundo.com.br/ internet/133690-voce-notou-
net flix-pareceevitando-termo-maratonar.htm. Acessado em 01/06/2019.)
(Adaptado de Wilson R. V. Ferreira, Globo adota “a boa notícia é
que...” para tentar se salvar do baixo astral nacional. Disponível
Texto II em https://cinegnose. Blogs pot.com/2019/02/globo-adotaboa-
noticia-e-que-para.html. Acessado em 01/03 /2019.)

Considerando a matéria apresentada no jornal,


o uso da conjunção adversativa seguido da
expressão “a boa notícia é que” permite ao
jornalista

a)apontar a gravidade da notícia e compensá-


la.
b)expor a neutralidade da notícia e reforçá-la.
Embora os dois textos tratem do termo “maratonar” a partir de c)minimizar a relevância da notícia e acentuá-
perspectivas distintas, é possível afirmar que o Texto II retoma la.
aspectos apresentados no Texto I porque d)revelar a importância da notícia e enfatizá-la.

a)esclarece o significado do neologismo “maratonar” como


esforço físico exaustivo, derivado de “maratona”. 56) Leia o texto a seguir e responda à questão.

b)deprecia a definição de “maratona” como ação contínua de O telejornalismo é um dos principais produtos
superação de dificuldades e melhoria da saúde. televisivos. Sejam as notícias boas ou ruins,
ele precisa garantir uma experiência
c)reflete sobre o impacto que a falta de exercícios físicos e a esteticamente agradável para o espectador.
permanência em casa provocam na saúde. Em suma, ser um “infotenimento”, para atrair
d)menospreza o uso do termo “maratonar” relacionado a um prestígio, anunciante e rentabilidade. Porém,
estilo de vida sedentário, antagônico a maratona. a atmosfera pesada do início do ano baixou
nos telejornais: Brumadinho, jovens atletas
mortos no incêndio do CT do Flamengo,
55) Leia o texto a seguir e responda à questão. notícias diárias de feminicídios, de valentões
armados matando em brigas de trânsito e
O telejornalismo é um dos principais produtos televisivos. supermercados. Conjunções adversativas e
Sejam as notícias boas ou ruins, ele precisa garantir uma adjuntos adverbiais já não dão mais conta de
experiência esteticamente agradável para o espectador. Em neutralizar o tsunami de tragédias e violência,
suma, ser um “infotenimento”, para atrair prestígio, anunciante e de amenizar as más notícias para garantir o
e rentabilidade. Porém, a atmosfera pesada do início do ano “infotenimento”. No jornal, é apresentada
baixou nos telejornais: Brumadinho, jovens atletas mortos no matéria sobre uma mulher brutalmente
incêndio do CT do Flamengo, notícias diárias de feminicídios, espancada, internada com diversas fraturas
de valentões armados matando em brigas de trânsito e no rosto. Em frente ao hospital, uma repórter
supermercados. Conjunções adversativas e adjuntos fala: “mas a boa notícia é que ela saiu da UTI

41
e não precisará mais de cirurgia reparadora na face...”. Agora,
repórteres repetem a expressão “a boa notícia é que...”, 58) – Pela milionésima vez, por favor, “se
buscando alguma brecha de esperança no “outro lado” das amostrar” não existe.
más notícias.
Não pega bem usar uma expressão incorreta
(Adaptado de Wilson R. V. Ferreira, Globo adota “a boa notícia é que...” para tentar se
como essa.
salvar do baixo astral nacional. Disponível em https://cinegnose. Blogs
pot.com/2019/02/globo-adotaboa-noticia-e-que-para.html. Acessado em 01/03 /2019.)
– Ora veja, incorreto para mim é o que não faz
sentido, “se amostrar” faz sentido para boa
Para se referir a matérias jornalísticas televisivas que
parte do país.
informam e, ao mesmo tempo, entretêm os espectadores, o
autor cria um neologismo por meio de
– Por que você não usa um sinônimo mais
simples da palavra? Que tal “exibido”? Todo
a)derivação prefixal.
mundo conhece.
b)composição por justaposição.
c)composição por aglutinação.
– Não dá, porque quem se exibe é exibido,
d)derivação imprópria.
quem se amostra é amostrado. Por exemplo:
quando os vendedores de shopping olham
com desprezo para os meninos dos rolezinhos
e moram no mesmo bairro deles, são exibidos.
57) Texto
O que levou Marta, seis vezes a melhor do mundo, a enfrentar
Eles acham que a roupa de vendedor faz
a Austrália de chuteiras pretas? Adianto, não foi o futebol “raiz”.
deles seres superiores. Por outro lado, as
Marta não fechou patrocínio com nenhuma das gigantes do
meninas e os meninos dos rolezinhos vão
mercado esportivo. Não recebeu nenhuma proposta à altura
para os shoppings para se amostrar uns para
do seu futebol. Isso diz muito sobre o machismo no esporte. A
outros, e são, portanto, amostrados. Percebeu
partir disso, a atleta decidiu calçar a luta pela diversidade.
a sutileza da diferença?

– Entendo, mas está errado.

– Como é que está errado se você entende?


Você não aceita a inventividade linguística do
povo. “Amostrar” é verbo torto no manual das
conjugações e “amostrado” é particípio de
(Fonte: https://www.hypeness.com.br/2019/06/chuteira-sem-logo-e-com-simbolo-de- amostra grátis! Captou?
igualdade -de-genero-foi-mais-um-golaco-de-marta/. Acessado em 18/06/2019.)

(Adaptado de Cidinha da Silva, Absurdada. Disponível em


Considerando o tweet e o texto acima, é correto afirmar que a http://notarodape. blogspot. com/ search/label/Cotidiano.
Acessado em 22/05/2019.)
atleta
Considerando que a comparação entre modos
a)enfrentou o time adversário com chuteiras pretas, mesmo
de falar pode ser fonte de preconceito, o
que não tenha sido influenciada pelo futebol “raiz”.
exemplo citado por uma das personagens da
crônica
b)usou chuteiras sem logotipo e luta pela igualdade de gênero
no esporte, mesmo sendo considerada seis vezes a melhor do
a) reforça o preconceito em relação às turmas
mundo.
de jovens de um mesmo bairro, com base nos
significados de “amostrado” e “exibido”.
c)não recebeu patrocínio de nenhuma grande empresa,
embora a chuteira preta sem logotipo simbolize o futebol “raiz”.
b) explicita o preconceito, valendo-se de
“amostrado” e “exibido” para distinguir dois
d)optou por lutar contra o machismo no esporte, embora as
grupos de jovens do mesmo bairro.
propostas de patrocínio não tenham considerado seu valor.

42
c)dissimula o preconceito e reconhece que “se amostrar” é, de a)resgata a temática do cordel, rompendo com
fato, um verbo que não está de acordo com as normas o impasse vivido pelos personagens.
gramaticais.
b) reafirma o dilema dos personagens da peça,
d) refuta o preconceito e confirma o desconhecimento da regra parafraseando os versos iniciais do cordel.
de formação do particípio passado do verbo “se amostrar”.
c)evidencia a tradição popular nordestina,
utilizando a imagem para sofisticar os versos.
59) Texto
Leia os versos iniciais da peça Se correr o bicho pega, se ficar d)confirma a força transformadora da
o bicho come (1966), de Oduvaldo Vianna Filho e Ferreira versificação popular, reproduzindo-a em
Gullar. Em formato de cordel, os versos são cantados por imagens.
todos os atores.

Se corres, bicho te pega, amô. 60) “(...) as palavras tomam significados


Se ficas, ele te come. distintos daqueles utilizados no cotidiano. Por
Ai, que bicho será esse, amô? exemplo, utiliza-se, com frequência, nas aulas
Que tem braço e pé de homem? sobre frações, a frase reduzir ao mesmo
Com a mão direita ele rouba, amô, denominador."
e com a esquerda ele entrega;
janeiro te dá trabalho, amô, (Edi Jussara Candido Lorensatti, Linguagem matemática e Língua
Portuguesa: diálogo necessário na resolução de problemas
dezembro te desemprega; matemáticos. Conjectura: Filosofia e Educação. Caxias do Sul, v.
de dia ele grita "avante”, amô, 14, n. 2, p. 91, maio/ago. 2009.)

de noite ele diz: "não vá":


Será esse bicho um homem, amô, Cada ciência usa uma linguagem própria e
ou muitos homens será? com um grau de precisão terminológica
necessário para o seu exercício.
(Oduvaldo Vianna Filho e Ferreira Gullar, Se correr o bicho pega, se ficar o bicho come.
Rio de Janeiro: Civilização Brasileira, 1966, p. 3.)
Tendo em vista os significados distintos que as
palavras assumem nas situações concretas
Texto
em que são empregadas, o verbo “reduzir”, no
uso cotidiano, significa

a)limitar alguma coisa, ao passo que na


linguagem matemática é sinônimo de restringir.

b)moderar alguma coisa, ao passo que na


linguagem matemática implica aumentar as
relações entre os números.

c)eliminar alguma coisa, ao passo que na


linguagem matemática implica reverter as
relações entre os números.

d)diminuir alguma coisa, ao passo que na


linguagem matemática é sinônimo de
converter.
Observe a charge de Laerte que fez parte da mostra Maio na
Paulista, em 2019.

Considerando a relação entre os textos, conclui-se que a


charge

43
REALISMO E NATURALISMO
d) a resposta de Baleia reduz o menino mais
velho à condição de bicho, privando-o dos
1) Leia o seguinte excerto de Memórias póstumas de Brás
atributos necessários para se tornar homem
Cubas, de Machado de Assis:
Deixa lá dizer Pascal que o homem é um caniço pensante.
Não; é uma errata pensante, isso sim. Cada estação da vida
é uma edição, que corrige a anterior, e que será corrigida 3) Sobre A Cidade e as Serras, de Eça de
também, até a edição definitiva, que o editor dá de graça aos Queirós, é correto afirmar:
vermes. a) A descrição do espaço parisiense no
(Machado de Assis, Memórias póstumas de Brás Cubas. São Paulo: Ateliê
romance retrata exclusivamente o submundo
Editorial, 2001, p.120.)
de uma metrópole do final do século XIX e
revela as contradições do processo de
Na passagem citada, a substituição da máxima pascalina de
urbanização.
que o homem é um caniço pensante pelo enunciado “o homem
é uma errata pensante” significa b)O romance, cuja primeira edição é de 1901,
faz uma apologia da vida urbana e do
a) a realização da contabilidade dos erros acumulados na vida desenvolvimento técnico que marcaram o final
porque, em última instância, não há “edição definitiva”. do século XIX nas grandes cidades europeias.

b) a tomada de consciência do caráter provisório da existência c)No romance, Zé Fernandes é uma


humana, levando à celebração de cada instante vivido. personagem secundária que ganha
importância no desenvolvimento da narrativa,
c) a tomada de consciência do caráter provisório da existência ao apresentar a “seu Príncipe”, Jacinto, a
humana e a percepção de que esta é passível de correção. luxuosa Paris.

d)No romance, é das rendas provenientes de


d) a ausência de sentido em “cada estação da vida”, já que a propriedades agrícolas em Portugal que
morte espera o homem em sua “edição definitiva”. provém o sustento da cara e refinada vida de
Jacinto em Paris.

2) O pequeno sentou-se, acomodou-se nas pernas a cabeça


da cachorra, pôs-se a contar-lhe baixinho uma história. Tinha 4) (...) pediu-me desculpa da alegria, dizendo
um vocabulário quase tão minguado como o do papagaio que que era alegria de pobre que não via, desde
morrera no tempo da seca. Valia-se, pois, de exclamações e muitos anos, uma nota de cinco mil réis.
de gestos, e Baleia respondia com o rabo, com a língua, com
movimentos fáceis de entender. – Pois está em suas mãos ver outras muitas,
(Graciliano Ramos. Vidas secas. Rio de Janeiro: Record, 2012, p. 57.)
disse eu.

Uma definição possível de alteridade é “a capacidade de se


– Sim? acudiu ele, dando um bote pra mim.
colocar no lugar do outro”. No excerto, o menino mais velho,
após ter recebido um cocorote de sinhá Vitória, ao lhe ter feito
– Trabalhando, concluí eu. Fez um gesto de
uma pergunta sobre a palavra “inferno”, conta uma história
desdém; calou-se alguns instantes, depois
para Baleia. Da leitura desse trecho, podemos concluir que
disse-me positivamente que não queria
trabalhar.
a) o narrador tem êxito na construção da alteridade, ao se
colocar no lugar do menino e de Baleia e permitir a relação (Machado de Assis, Memórias póstumas de Brás Cubas.
entre essas duas personagens. São Paulo: Ateliê Editorial, 2001, p.158.)

b) o vocabulário minguado do menino mais velho o impede de


O trecho citado diz respeito ao encontro entre
se relacionar com Baleia, o que demonstra que, sem
Brás Cubas e Quincas Borba, no capítulo 49,
linguagem, não há alteridade entre o homem e o mundo.
e, mais precisamente, apanha o momento em
que Brás dá uma esmola ao amigo.
c) o vocabulário minguado é próprio da infância e não resulta
das condições sociais e materiais adversas das personagens.

44
Considerando o conjunto do romance, é correto afirmar que Não podia chegar à janela sem receber no
essa passagem rosto aquele bafo, quente e sensual, que o
embebedava com o seu fartum de bestas no
a) explicita a desigualdade das classes sociais na primeira
coito.
metade do século XIX e propõe a categoria de trabalho como
fator fundamental para a emancipação do pobre. (Aluísio de Azevedo, O cortiço. 14. ed. São Paulo: Ática, 1983, p.
22.)
b) indica o ponto de vista da personagem Brás Cubas e propõe
a meritocracia como dispositivo pedagógico e moral para a Levando em conta o excerto, bem como o
promoção do ser humano no século XIX. texto integral do romance, é correto afirmar
c) elabora, por meio do narrador, o preconceito da classe que
social a que pertence Brás Cubas em relação à classe média
do século XIX, na qual se insere Quincas Borba. a)o grosseiro rumor, a sexualidade
desregrada e a exalação forte que provinham
d) sugere as posições de classe social das personagens; do cortiço decorriam, segundo Miranda, do
machadianas, mediante um narrador que valoriza o trabalho, abandono daquela população pelo governo.
embora ele mesmo, sendo rico, não trabalhe.
b)os termos “grosseiro rumor”, “animais”,
“bestas no coito”, que fazem referência aos
5) A fim de dar exemplos de sua teoria da “alma exterior”, o moradores do cortiço, funcionam como
narrador-personagem do conto “O espelho”, de Machado de metáforas da vida pulsante dos seus
Assis, refere-se a uma senhora conhecida sua “que muda de habitantes.
alma exterior cinco, seis vezes por ano”.
c)o nivelamento sociológico na obra O Cortiço
E, questionado sobre a identidade dessa mulher, afirma: “Essa se dá não somente entre os moradores da
senhora é parenta do diabo, e tem o mesmo nome: chama-se habitação coletiva e o seu senhorio, mas
Legião...” Considerando o contexto dessa frase no conto, também entre eles e o vizinho Miranda.
pode-se dizer que ela constitui
d)a presença portuguesa, exemplificada nas
a) uma crítica à noção de alma exterior como resultante da personagens João Romão e Miranda, não é
influência do mal. relevante para o desenvolvimento da narrativa
nem para a compreensão do sentido da obra.
b) uma consideração cômica que ressalta o nome inusitado da
senhora.

c) uma condenação do comportamento moral da senhora em 7) No conto “O espelho”, de Machado de Assis,


questão. o esboço de uma nova teoria sobre a dupla
natureza da alma humana é apresentado por
d) uma ironia com a inconstância dos valores sociais Jacobina. A personagem narra a situação em
associados à alma exterior. que se viu sozinha na casa da tia Marcolina.

“As horas batiam de século a século no velho


relógio da sala, cuja pêndula, tic-tac, tic-tac,
6) Durante dois anos o cortiço prosperou de dia para dia, feria-me a alma interior como um piparote
ganhando forças, socando-se de gente. E ao lado o Miranda contínuo da eternidade.”
assustava-se, inquieto com aquela exuberância brutal de vida,
aterrado defronte daquela floresta implacável que lhe crescia Considerando os indicadores da passagem do
junto da casa (...). tempo na citação, é correto afirmar que

À noite e aos domingos ainda mais recrudescia o seu a)o movimento oscilante do pêndulo do relógio
azedume, quando ele, recolhendo-se fatigado do serviço, expressa a duplicidade da alma interior.
deixava-se ficar estendido numa preguiçosa, junto à mesa da
sala de jantar e ouvia, a contragosto, o grosseiro rumor que b)o som do velho relógio da sala materializa
vinha da estalagem numa exalação forte de animais cansados. acusticamente a longevidade da alma interior.

45
A soma da vida é nula.
c)a sonoridade repetitiva do pêndulo intensifica as aflições da
Mas a vida tem tal poder:
alma interior.
na escuridão absoluta,
d)o contínuo batimento das horas sugere o vigor da alma
como líquido, circula.
interior.
Suicídio, riqueza, ciência…

A alma severa se interroga


MODERNISMO
e logo se cala. E não sabe
1) O pequeno sentou-se, acomodou-se nas pernas a cabeça
da cachorra, pôs-se a contar-lhe baixinho uma história. Tinha se é noite, mar ou distância.
um vocabulário quase tão minguado como o do papagaio que Triste farol da Ilha Rasa.
morrera no tempo da seca. Valia-se, pois, de exclamações e
(Idem, p. 71.)
de gestos, e Baleia respondia com o rabo, com a língua, com
movimentos fáceis de entender.
(Graciliano Ramos. Vidas secas. Rio de Janeiro: Record, 2012, p. 57.) Considerando a obra Sentimento do mundo
No romance Vidas secas, a alteridade é construída em seu conjunto e tendo em vista que os
ficcionalmente. Isso porque o narrador primeiros versos transcritos pertencem ao
poema que abre e dá título ao livro de
a) impõe seu ponto de vista sobre a miséria social das Drummond, e que o segundo poema, citado
personagens, desconsiderando a luta dessas personagens integralmente, corresponde ao fechamento do
por uma vida mais digna. volume, é correto afirmar que
b) permite conhecer o ponto de vista de cada uma das a) a oposição de base dos poemas reside nas
personagens e manifesta um juízo crítico sobre o drama da imagens contrapostas de luz e trevas,
miséria social e econômica. manifestando o tema do pessimismo acerca
c) relativiza o universo social das personagens, uma vez que da condição humana.
elas estão privadas da capacidade de comunicação. b) o percurso figurativo dos poemas é
d) analisa os dilemas de todas as personagens e propõe, ao marcado apenas pelas imagens da noite,
final da narrativa, uma solução para o drama da miséria social associadas às ideias de negatividade e de
e econômica. esperança para a humanidade.

c) a unidade de sentido do conjunto dos textos


poéticos reside na clássica oposição entre luz
2) esse amanhecer e trevas, sendo que o percurso figurativo
mais noite que a noite. manifesta o tema da maldade.
(Carlos Drummond de Andrade. Sentimento do mundo. São Paulo: Companhia das
Letras, 2012, p.12.) d) as imagens de luz e trevas significam a luta
eterna entre o bem e o mal, o que se confirma
no verso “Suicídio, riqueza, ciência”, que
Silencioso cubo de treva: sugere o impasse do eu lírico.
um salto, e seria a morte.
Mas é apenas, sob o vento, 3) esse amanhecer
a integração na noite. mais noite que a noite.
Nenhum pensamento de infância,
(Carlos Drummond de Andrade. Sentimento do mundo.
nem saudade nem vão propósito. São Paulo: Companhia das Letras, 2012, p.12.)

Somente a contemplação Silencioso cubo de treva:


de um mundo enorme e parado. um salto, e seria a morte.

46
Mas é apenas, sob o vento,
Valeu a pena? Tudo vale a pena
a integração na noite.

Nenhum pensamento de infância, Se a alma não é pequena.

nem saudade nem vão propósito.


Quem quer passar além do Bojador
Somente a contemplação
Tem que passar além da dor.
de um mundo enorme e parado.

A soma da vida é nula. Deus ao mar o perigo e o abismo deu,

Mas a vida tem tal poder: Mas nele é que espelhou o céu.
na escuridão absoluta,
(Disponível em http://www.jornaldepoesia.jor.br/fpesso03.html.)
como líquido, circula.
No poema, a apóstrofe, uma figura de
Suicídio, riqueza, ciência…
linguagem, indica que o enunciador
A alma severa se interroga
a) convoca o mar a refletir sobre a história das
e logo se cala. E não sabe navegações portuguesas.
se é noite, mar ou distância.
b) apresenta o mar como responsável pelo
Triste farol da Ilha Rasa. sofrimento do povo português.
(Idem, p. 71.)
c) revela ao mar sua crítica às ações
A visão de mundo do eu lírico em Drummond é marcada pela
portuguesas no período das navegações.
ironia e pela dúvida constante, cujo saldo final é negativo e
melancólico (“Triste farol da Ilha Rasa”). Tal perspectiva
d)projeta no mar sua tristeza com as
assemelha-se à do
consequências das conquistas de Portugal.
a) personagem Leonardo, do romance Memórias de um
sargento de milícias.
5) No conto “Amor”, de Clarice Lispector, a
b) personagem Carlos, da obra Viagens na minha terra. percepção da personagem Ana, em relação
ao seu mundo, é alterada de forma
c) narrador do romance O cortiço. significativa pelo seguinte acontecimento:
d) narrador do romance Memórias póstumas de Brás Cubas.
a) os ovos quebrados no embrulho do jornal,
que simbolizam a mudança psicológica da
4) Leia o poema “Mar Português”, de Fernando Pessoa. protagonista no relato ficcional.

b)o cego parado no ponto do bonde, que


MAR PORTUGUÊS modifica a visão da protagonista em relação
aos vínculos familiares.
Ó mar salgado, quanto do teu sal c)o estouro do fogão da cozinha, que significa,
no percurso narrativo, a ruptura psíquica da
São lágrimas de Portugal! protagonista com a opressão da vida
matrimonial.
Por te cruzarmos, quantas mães choraram,
d)a aparição súbita do gato no Jardim
Quantos filhos em vão rezaram! Botânico, que deflagra uma reviravolta afetiva
de Ana com o seu amante.
Quantas noivas ficaram por casar

Para que fosses nosso, ó mar!

47
6) Quanto ao conto Negrinha, de Monteiro Lobato, é correto b) o sentimento do mundo é representado pela
afirmar que: percepção particular sobre a cidade do Rio de
Janeiro, aludida pela metáfora do Morro da
a) O narrador adere à perspectiva de dona Inácia, fazendo
Babilônia.
com que o leitor enxergue a história guiado pela ótica dessa
personagem e se torne cúmplice dos valores éticos c) o tratamento dado ao Morro da Babilônia
apresentados no conto. assemelhase ao que é dado a uma pessoa, o
que caracteriza a figura de estilo denominada
b) O modo como o narrador caracteriza o contexto histórico
paronomásia.
no conto permite concluir que Negrinha é escrava de dona
Inácia e, portanto, está fadada a uma vida de humilhações. d) a referência ao Morro da Babilônia produz,
no percurso figurativo do poema, um oxímoro:
c)A maneira como o narrador comenta as características
a relação entre terror e gentileza no espaço
atribuídas às personagens contrasta com as falas e as ações
urbano.
realizadas por elas, o que caracteriza um modo irônico de
apresentação.

d)O narrador apresenta as falas e pensamentos das 8) Além de escrever Dom Quixote das
personagens de modo objetivo; assim, o leitor fica dispensado crianças, Monteiro Lobato também leva o
de elaborar um juízo crítico sobre as relações de poder entre “cavaleiro errante” para o Sítio do Pica-Pau
as personagens. Amarelo.Lá na varanda Dom Quixote
conversava com Dona Benta sobre as
aventuras, e muito admirado ficou de saber
7) Morro da Babilônia
que sua história andava a correr mundo;
escrita por um tal de Cervantes. Nem quis
À noite, do morro
acreditar; foi preciso que Narizinho lhe
descem vozes que criam o terror
trouxesse a edição de luxo ilustrada por
(terror urbano, cinquenta por cento de cinema,
Gustavo Doré. O fidalgo folheou o livro muito
e o resto que veio de Luanda ou se perdeu na língua
atento às gravuras, que achou ótimas, porém
Geral).
falsas

Quando houve revolução, os soldados – Isso não passa duma mistificação! -


espalharam no morro, protestou ele. – Esta cena aqui, por exemplo.
o quartel pegou fogo, eles não voltaram. Está errada. Eu não espetei este frade, como
Alguns, chumbados, morreram. o desenhista pintou - espetei aquele lá.
O morro ficou mais encantado.
– Isto é inevitável - disse Dona Benta. – Os
historiadores costumam arranjar os fatos do
modo mais cômodo para eles; por isto a
Mas as vozes do morro
História não passa de histórias.
não são propriamente lúgubres.
Há mesmo um cavaquinho bem afinado (Adaptado de Monteiro Lobato, O Picapau Amarelo. São Paulo:
Brasiliense, 2004, p. 18.)
que domina os ruídos da pedra e da folhagem
e desce até nós, modesto e recreativo, Na cena narrada,
como uma gentileza do morro.
(Carlos Drummond de Andrade, Sentimento do mundo. São Paulo: Companhia das
a) Dona Benta mostra a Dom Quixote que a
Letras, 2012, p.19.) história dele não é, de forma alguma, uma
mistificação.
b) Dona Benta convence Dom Quixote de que
No poema “Morro da Babilônia”, de Carlos Drummond de
as gravuras não refletem a História dos fatos.
Andrade,
c) Dona Benta concorda com Dom Quixote e
a) a menção à cidade do Rio de Janeiro é feita de modo
critica o fato de a História ser fruto de
indireto, metonimicamente, pela referência ao Morro da
interesses.
Babilônia.

48
d) Dona Benta opõe-se a Dom Quixote e critica a forma como Louvado seja Oxalá.
a história dele é narrada nos livros. Para sempre seja louvado.”
(Idem, p.164.)

9) No conto “Amor”, de Clarice Lispector, após ver um cego Essas duas cenas de ciúmes concluem dois
mascando chicletes, a personagem passa por uma situação textos diferentes de Jorge de Lima. A primeira
que, segundo o narrador, ela própria chama de “crise”: pertence ao conhecido poema modernista
“Essa negra Fulô”; a segunda, ao poema
“O que chamava de crise viera afinal. E sua marca era o prazer “História”, de Poemas Negros (1947). Em
intenso com que olhava agora as coisas, sofrendo espantada. relação a “Essa negra Fulô”, o poema
O calor se tornara mais abafado, tudo tinha ganho uma força “História”, especificamente, representa
e vozes mais altas.”
(Clarice Lispector, Laços de Família. Rio de Janeiro: Rocco, 2009, p.23.)
a) a reiteração da denúncia das relações de
Essa crise, que transforma a relação da personagem com o poder, muito arraigadas no sistema
mundo e com a família, escravocrata, que colocam no mesmo plano
violências raciais e sexuais.
a) nasce do colapso da vontade de viver da personagem, em
razão do doloroso prazer com que passou a ver as coisas. b) a passagem de uma caracterização da
mulher negra como sedutora para uma
b)revela o conflito vivido pela personagem entre o tipo de vida postura solidária em relação à escrava, que
que havia escolhido e as coisas que passou a desejar. explicita as estratégias compensatórias de
c)constitui, para a personagem, uma alteração no modo de que se vale para sobreviver.
vida que antes a fazia sofrer e do qual agora havia se libertado. c) a permanência de uma visão pitoresca
d)remete à excitação da personagem por ter conseguido sobre a situação da mulher negra nos
harmonizar sua antiga vida com os novos desejos e engenhos de açúcar, que oculta os
sensações. mecanismos de poder que garantiam sua
exploração.

d) a superação da visão idílica da vida na


10) “O Sinhô foi açoitar senzala, graças a uma postura realista e social,
sozinho a negra Fulô. que revela a violência das relações entre
A negra tirou a saia senhores e escravos.
e tirou o cabeção,
de dentro dêle pulou
nuinha a negra Fulô. 11) “Sapo não pula por boniteza, mas porém
Essa negra Fulô! por percisão.”
Essa negra Fulô!
(“Provérbio capiau” citado em epígrafe no conto “A hora e a vez de
Ó Fulô! Ó Fulô! Augusto Matraga”, em João Guimarães Rosa, Sagarana. Rio de
Cadê, cadê teu Sinhô Janeiro: Nova Fronteira, 2015, p.287.)
que Nosso Senhor me mandou?
Ah! Foi você que roubou, Elementos textuais que antecedem a narrativa
foi você, negra Fulô? como, por exemplo, o provérbio citado,
Essa negra Fulô!” funcionam, em alguns autores, como pista
para se entender o sentido das ações
(Jorge de Lima, Poesias Completas, v.1. Rio de Janeiro/Brasília: J.Aguilar e INL, 1974,
p. 121.)
ficcionais. No excerto acima, as ideias de
beleza e necessidade são contrapostas com
A Sinhá mandou arrebentar-lhe os dentes: vistas à produção de um sentido de ordem
Fute, Cafute, Pé-de-pato, Não-sei-que-diga, moral. Considerando-se a jornada heroica de
avança na branca e me vinga. Augusto Matraga, é correto afirmar que a
Exu escangalha ela, amofina ela, narrativa
amuxila ela que eu não tenho defesa de homem,
sou só uma mulher perdida neste mundão.
Neste mundão.

49
a) contradiz o sentido moral do provérbio, uma vez que o
protagonista não é fiel ao seu propósito de mudar os hábitos
antigos.

b)confirma o sentido moral do provérbio, uma vez que o


protagonista realiza uma série de ações para corrigir seu
caráter e reordenar eticamente sua vida.

c)ratifica o sentido moral do provérbio, uma vez que o


protagonista é seduzido pelos encantos da natureza e pelos
prazeres da bebida e do fumo.

d) refuta o sentido moral do provérbio, uma vez que o


protagonista não consegue agir sem as motivações da beleza
física e do afeto femininos.

12) Leia abaixo duas passagens do poema “Olá! Negro”, de


Jorge de Lima.
Nesse poema, nota-se uma técnica de
“A raça que te enforca, enforca-se de tédio, negro! composição que consiste
E és tu que a alegras ainda com os teus jazzes.
a)na disposição arbitrária de anagramas, sem
Com os teus songs, com os teus lundus!”
produzir uma relação de sentido com o título
(...)
do poema.
“Não basta iluminares hoje as noites dos brancos com teus
jazzes. b) na disposição exaustiva de anagramas,
Olá, Negro! O dia está nascendo! sem produzir uma relação de sentido com o
O dia está nascendo ou será a tua gargalhada que vem vindo?” título do poema.

(Jorge de Lima, Poesias completas. v. I, Rio de Janeiro / Brasília: J. Aguilar / INL, 1974,
c) na disposição arbitrária de anagramas, para
p.180-181.) produzir uma relação de sentido com o título
do poema.
Considerando o livro Poemas negros como um todo e a
d)na disposição exaustiva de anagramas,
poética de Jorge de Lima, é correto afirmar que o último verso
para produzir uma relação de sentido com o
citado
título do poema.
a)manifesta o desprezo do negro pela situação decadente da
cultura do branco.
14) “DOROTEA
b)realiza a aproximação entre a alegria do negro e uma ideia O senhor perdeu a cabeça?
de futuro.
DULCINEA
c)remete à vingança do negro contra a violência a que foi Fazer de um cangaceiro um delegado!
submetido pelo branco.

d)funciona como um lamento, já que o nascer do dia não traz DOROTEA


justiça social. Quando a oposição souber!

DULCINEA
Que prato pra Neco Pedreira!
13) O poema abaixo é de autoria do poeta Augusto de
Campos, integrante do movimento concretista. ODORICO

50
E tomara que Neco se sirva bem dele. Tomara que chame
Zeca Diabo de cangaceiro, assassino, quanto mais
xingar,melhor.

DOROTEA
O senhor não acha que se excedeu?

ODORICO
Em política, dona Dorotéa, os finalmentes justificam os não
obstantes.”

(Dias Gomes, O bem-amado. Rio de Janeiro: Bertrand Brasil, 2014. p. 69-70.)

As personagens femininas do excerto anterior discordam da


nomeação de Zeca Diabo feita por Odorico. A ideia de deformação se aplica ao quadro de
Tarsila e ao romance Caminhos cruzados, de
Assinale a alternativa que indica a razão dessa discordância Érico Veríssimo, porque tal procedimento
e a natureza da crítica às práticas políticas brasileiras artístico acentua
presente na peça teatral de Dias Gomes.
a)a crítica do modernismo à violência da
a) Segundo as personagens, Zeca Diabo não possui os escravidão e às desigualdades sociais,
atributos necessários para o cargo. Critica-se uma sociedade presentes no quadro e nas personagens do
que desconsidera a meritocracia. romance, respectivamente.

b) As Práticas políticas são desconhecidas pelas personagens. b)o imaginário da burguesia nacional, pois
A ingenuidade do cidadão e a astúcia necessária dos políticos tanto as protagonistas do romance quanto a
são criticadas na fala delas e de Odorico. imagem da mulher negra retratam os traços
característicos das reformas sociais do Estado
c)Dulcinéa e Dorotéa não simpatizam com Zeca Diabo, o que Novo.
indica que a peça faz uma crítica às relações sociais
presididas por afetos e interesses privados. c)os princípios estéticos do movimento
modernista, pois as duas expressões
d) Dulcinéa e Dorotéa não admitem que alguém fora da lei artísticas apresentam-se como reflexo dos
possa cuidar da ordem da cidade. Criticam-se os atos de um valores da elite cafeeira paulista.
poder executivo que se orienta por um projeto pessoal de
poder. d)a moral implícita da modernidade, pois o
narrador do livro e a representação do corpo
negro criticam o comportamento social das
15) Que dizer das personagens? Creio que têm a força e ao personagens femininas no século XX.
mesmo tempo a fraqueza da caricatura. Mas, pensando
melhor, não poderemos também alegar em defesa do
romancista que a caricatura é uma tendência reconhecida e
aceita da arte moderna, principalmente da pintura? Não
haverá muito de deformação na obra de grandes pintores
como Portinari, Di Cavalcante e Segall – todos eles ROMANTISMO
inconformados com a sociedade em que vivem? 1) Muito me pesa, leitor amigo, se outra coisa
(Adaptado de Erico Verissimo, Prefácio, em Caminhos Cruzados. São Paulo: Companhia esperavas das minhas Viagens, se te falto,
das Letras, 2016, p. 20-21.)
sem o querer, a promessas que julgaste ver
nesse título, mas que eu não fiz decerto.
Querias talvez que te contasse, marco a
marco, as léguas das estradas?

51
(Almeida Garrett, Viagens na minha terra. São Paulo: Ateliê Editorial, 2012, c) denuncia as condições sociais injustas dos
p. 218.)
pobres da sociedade, o que indica o caráter
No trecho acima, o narrador garrettiano admite que traiu as panfletário do romance de Garrett.
expectativas do leitor. Tal fato deveu-se
d)divide o mundo entre ricos e pobres e não
a) à descrição pormenorizada da natureza e dos monumentos leva em consideração que uma vida justa
históricos das cidades portuguesas. depende da riqueza produzida na sociedade.

b) ao caráter linear do relato ficcional, que se fixou nos


detalhes do percurso realizado durante a viagem a Santarém.

c) ao caráter digressivo do relato ficcional, que mesclou vários


gêneros textuais. CLASSICISMO
d) às posições políticas assumidas pelo narrador, que propõe
uma visão conservadora da história de Portugal. 1)Transforma-se o amador na coisa amada,
Por virtude do muito imaginar;
Não tenho, logo, mais que desejar,
2) (...) plantai batatas, ó geração de vapor e de pó de pedra, Pois em mim tenho a parte desejada.
*macadamizai estradas, fazei caminhos de ferro, construí
passarolas de Ícaro, para andar a qual mais depressa, estas Se nela está minha alma transformada,
horas contadas de uma vida toda material, maçuda e grossa Que mais deseja o corpo de alcançar?
como tendes feito esta que Deus nos deu tão diferente do que Em si somente pode descansar,
a que hoje vivemos. Andai, ganha-pães, andai: reduzi tudo a Pois com ele tal alma está liada.
cifras, todas as considerações deste mundo a equações de Mas esta linda e pura semideia,
interesse corporal, comprai, vendei, agiotai. – No fim de tudo Que, como o acidente em seu sujeito,
isto, o que lucrou a espécie humana? Que há mais umas Assim como a alma minha se conforma,
poucas dúzias de homens ricos. E eu pergunto aos
economistas políticos, aos moralistas, se já calcularam o Está no pensamento como ideia;
número de indivíduos que é forçoso condenar à miséria, ao E o vivo e puro amor de que sou feito,
trabalho desproporcionado, à desmoralização, à infâmia, à Como a matéria simples busca a forma.
ignorância crapulosa, à desgraça invencível, à penúria
(Luís de Camões, Lírica: redondilhas e sonetos, Rio de Janeiro:
absoluta, para produzir um rico? Ediouro / São Paulo: Publifolha, 1997, p. 85.)

*Macadamizar: pavimentar. Um dos aspectos mais importantes da lírica de


Camões é a retomada renascentista de ideias
(Almeida Garrett, Viagens na minha terra. São Paulo: Ateliê do filósofo grego Platão. Considerando o
Editorial, 2012, p.77.) soneto citado, pode-se dizer que o chamado
“neoplatonismo” camoniano
Formou Deus o homem, e o pôs num paraíso de delícias;
tornou a formá-lo a sociedade, e o pôs num inferno de tolices. a)é afirmado nos dois primeiros quartetos,
Almeida Garrett, Viagens na minha terra. São Paulo: Ateliê uma vez que a união entre amador e pessoa
Editorial, 2012, p.190.) amada resulta em uma alma única e perfeita.

Vários discursos organizam a estrutura narrativa do romance b)é confirmado nos dois últimos tercetos, uma
Viagens na minha terra, de Almeida Garrett. Isso permite vez que a beleza e a pureza reúnem-se
afirmar que a visão de mundo dessa narrativa finalmente na matéria simples que deseja.
a) compartilha exclusivamente dos valores éticos dos ricos e
é demagógica com a miséria social, marca inconfundível do c)é negado nos dois primeiros quartetos, uma
romance de Garrett. vez que a consequência da união entre
amador e coisa amada é a ausência de desejo.
b) relativiza posições dogmáticas sobre a vida social, cultural
e política, permitindo vários ângulos de observação. d)é contrariado nos dois últimos tercetos, uma
vez que a pureza e a beleza mantêm-se em
harmonia na sua condição de ideia.

52
BARROCO gabarito
1) Sobre as representações históricas da morte no Ocidente, (PS: sempre veja os erros como uma
Philippe Aries e Alcir Pécora comentam: oportunidade de aprendizado. Não fique triste
se errar, você está dando o seu melhor.)
“O moribundo está deitado, cercado por seus amigos e
familiares. Está prestes a executar os ritos que bem Interpretação e obras literárias
conhecemos. (...) Seres sobrenaturais invadiram o quarto e se
1E 2B 3A 4B 5D 6A 7D 8C 9D 10B
comprimem na cabeceira do 'jacente'. A grande reunião que
11C 12D 13A 14D 15A 16C 17B 18D
nos séculos XII e XII tinha lugar no final dos tempos se faz, 19B 20A 21C 22D 23A 24C 25A 26D
então, a partir do século XV, no quarto do enfermo.” 27A 28D 29D 30C 31B 32B 33B 34A
35D 36B 37C 38D 39D 40D 41C 42C
(Philippe Aries, História da morte no Ocidente: da Idade Média aos nossos dias. Rio de
Janeiro: Nova Fronteira, 2012, p. 53.)
43D 44B 45D 46C 47C 48B 49D 50B 51D
52B 53C 54D 55A 56C 57B 58B 59A
60D
“(...) essa espécie de arte de morrer de Vieira se opõe à
tradição das artes moriendi fundadas na preparação para a Naturalismo e Realismo
última prova” que acontece apenas no quarto do moribundo.
Não é mais lá que se decide a salvação ou a condenação do 1C 2A 3D 4D 5D 6B 7C
cristão, mas no exato momento de suas escolhas e ações ao
longo da vida, vale dizer, na resolução adequada a ser tomada Clacissimo 1A
hic et nunc (aqui e agora).
Barroco 1A
(Alcir Pécora, A arte de morrer, segundo Vieira, em Antonio Vieira, Sermões de quarta-
feira de cinza. Campinas, SP: Editora da Unicamp, 2016. p.51.)
Modernismo

1B 2A 3D 4A 5B 6C 7A 8C 9B 10B 11B
Com base nos excertos anteriores e na leitura dos três
12B 13D 14D 15A
Sermões de Quarta-feira de Cinza, assinale a alternativa
correta. Romantismo 1C 2B

a)Em Ariès, a salvação ou danação ocorre no quarto do


moribundo, mas nos sermões de Vieira é a atenção ao
momento presente e a decisão correta que importam para o
cristão
b)A afirmação de Alcir Pécora é válida somente para o
primeiro sermão, pois os dois últimos sermões retomam o
tema do fim dos tempos e da agonia do moribundo para a fé
cristã.

c)Segundo Ariès, o drama da salvação se dá na imagem do


quarto do moribundo. Essa imagem é decisiva para a
compreensão do terceiro sermão.

d)Para Alcir Pécora, o que distingue os sermões de Vieira dos


discursos sobre a morte nesse período é a ênfase do padre
jesuíta na ação futura.

53
Matemática
b)p/1,21.

c)p x 0,80.

d)p x 0,81.
RAZÃO E PROPORÇÃO
3) O gráfico abaixo exibe o lucro líquido (em
milhares de reais) de três pequenas empresas
1) A tabela abaixo informa alguns valores nutricionais para a
A, B e C, nos anos de 2013 e 2014. Com
mesma quantidade de dois alimentos, A e B.
relação ao lucro líquido, podemos afirmar que

Considere duas porções isocalóricas (de mesmo valor


energético) dos alimentos A e B. A razão entre a quantidade
de proteína em A e a quantidade de proteína em B é igual a a)
4.

b) 6.

c) 8.
a) A teve um crescimento maior do que C.
d) 10
b) C teve um crescimento maior do que B.
c) B teve um crescimento igual a A.
d) C teve um crescimento menor do que B.
FINANCEIRA
1) Uma compra no valor de 1.000 reais será paga com uma 4) Dois anos atrás certo carro valia
entrada de 600 reais e uma mensalidade de 420 reais. A taxa 𝑅$ 50.000,00 e atualmente vale 𝑅$ 32.000,00.
de juros aplicada na mensalidade é igual a Supondo que o valor do carro decresça a uma
taxa anual constante, daqui a um ano o valor
a) 2 %.
do carro será igual a
b) 5 %.
a)𝑅$ 25.600,00.
c) 8 %.
b)𝑅$ 24.400,00.
d) 10 %. c)𝑅$ 23.000,00.
d)𝑅$ 18.000,00.

2) Os preços que aparecem no cardápio de um restaurante já


incluem um acréscimo de 10% referente ao total de impostos.
Na conta, o valor a ser pago contém o acréscimo de 10% ANÁLISE COMBINATÓRIA
relativo aos serviços (gorjeta).
1) O número mínimo de pessoas que deve
Se o valor total da conta for p reais, o cliente estará
haver em um grupo para que possamos
desembolsando pelo custo original da refeição, em reais, a
garantir que nele há pelo menos três pessoas
quantia de
nascidas no mesmo dia da semana é igual a
a)p/1,20.

54
a) 21. c)- 15.
d)- 20.
b) 20.

c) 15.
MATRIZ
d) 14.
1) Considere a matriz:

2) Cinco pessoas devem ficar em pé, uma ao lado da outra,


para tirar uma fotografia, sendo que duas delas se recusam a
ficar lado a lado.O número de posições distintas para as cinco
pessoas serem fotografadas juntas é igual a
onde 𝑎 e 𝑏 são números reais. Se 𝐴 2 = 𝐴 e 𝐴
a)48. é invertível, então
b)72.
a) 𝑎 = 1 e 𝑏 = 1.
c)96.
d)120. b) 𝑎 = 1 e 𝑏 = 0.

c) 𝑎 = 0 e 𝑏 = 0.

d) 𝑎 = 0 e 𝑏 = 1.
PROGRESSÃO ARITMÉTICA
1) Se (a1, a2, … , a13 ) é uma progressão aritmética (PA) cuja
soma dos termos é 78, então a7 é igual a 2) Em uma matriz, chamam-se elementos
internos aqueles que não pertencem à
a)6. primeira nem à última linha ou coluna. O
número de elementos internos em uma
b)7.
matriz com 5 linhas e 6 colunas é igual a
c)8. a)12.
d)9. b)15.

c)16.
2) Seja 𝑥 um número real, 0 < 𝑥 < 𝜋/2, tal que a sequência (tan d)20.
𝑥 , sec 𝑥 , 2) é uma progressão aritmética (PA). Então, a razão
dessa PA é igual a

a)1.
3)
b)5/4.

c)4/3.

d)1/3

3) Considere que (a, b, 3, c) é uma progressão aritmética de Podemos afirmar que


números reais, e que a soma de seus elementos é igual a 8.
a) A não é invertível para nenhum valor de x .
O produto dos elementos dessa progressão é igual a
b) A é invertível para um único valor de x .
a)30. c) A é invertível para exatamente dois valores
b)10. de x .

55
d) A é invertível para todos os valores de x . b) 2.
c) 5.
d) 10

4) Sendo a um número real, considere a matriz


7) Sabendo que p é um número real,

considere a matriz e sua


Então, A2017 é igual
transposta Se é singular (não
invertível), então

a)p=0

b) |p|= 1

c) |p|= 2

d) p= 3

SISTEMAS LINEARES
1) Considere o sistema linear nas variáveis 𝑥,
𝑦 e z onde 𝑚 é um número real. Sejam 𝑎 < 𝑏 <
𝑐 números inteiros consecutivos tais que (𝑥, 𝑦,
𝑧) = (𝑎, 𝑏, 𝑐) é uma solução desse sistema. O
valor de 𝑚 é igual a

5) Sejam a e b números reais tais que a matriz


satisfaz a equação A2 = aA + bI, em que I é a matriz identidade a) 3.
de ordem 2. Logo, o produto ab é igual a
b) 2.

a)-2. c) 1.
b)-1. d) 0.
c)1.
d)2
2) Considere o sistema linear nas variáveis
6) Sabendo que a e b são números reais, considere a matriz reais x , y , z e w,
quadrada de ordem 3 .

Se a soma dos elementos em cada linha da matriz A tem


sempre o mesmo valor, então o determinante de A é igual a
Logo, a soma x + y + z + w é igual a

a) 0. a) -2.

56
b) 0.

c) 6.

d) 8

3) Sejam 𝑎 e 𝑏 números reais. Considere, então, os dois


sistemas lineares abaixo, nas variáveis 𝑥, 𝑦 e 𝑧:

Sabendo que esses dois sistemas possuem uma solução em


comum, podemos afirmar corretamente que Então, o gráfico de 𝑦 = 2 𝑓(𝑥 − 1) é dado por

a)𝑎 − 𝑏 = 0. a)

b)𝑎 + 𝑏 = 1.

c)𝑎 − 𝑏 = 2.

d)𝑎 + 𝑏 = 3.

4) Sabendo que 𝑘 é um número real, considere o sistema


linear nas variáveis reais 𝑥 e 𝑦,

É correto afirmar que esse sistema


b)
a)tem solução para todo 𝑘.
b)não tem solução única para nenhum 𝑘.
c)não tem solução se 𝑘 = 1.
d)tem infinitas soluções se 𝑘 ≠ 1.

FUNÇÕES
1) A figura abaixo exibe o gráfico de uma função 𝑦 = 𝑓(𝑥).

57
c) a)

d)

b)

2) Seja 𝑎 um número real. Considere as parábolas de


equações cartesianas 𝑦 = 𝑥2 + 2𝑥 + 2 e 𝑦 = 2𝑥2 + 𝑎𝑥 + 3. Essas
parábolas não se interceptam se e somente se

a) |𝑎| = 2.

b) |𝑎| < 2.

c) |𝑎 − 2| < 2.
c)
d) |𝑎 − 2| ≥ 2.

3) Considere o gráfico da função y fx = ( ) exibido na figura a


seguir.

O gráfico da função inversa 1 y f x( ) − = é dado por

58
d)

O gráfico da função y = A(x) no plano


cartesiano é dado por

a)

4) Considere a função afim f (x) = ax + b definida para todo


número real x , onde a e b são números reais. Sabendo que f
(4) = 2 , podemos afirmar que f ( f (3) + f (5)) é igual a

a) 5.

b)4. b)

c)3.

d)2

5) Considere as funções f(x) = 3x e g(x) = x3 , definidas para


todo número real x. O número de soluções da equação f(g(x))
= g(f(x)) é igual a c)

a)1.

b)2.

c) 3.

d) 4.

d)
6) Considere o quadrado de lado a > 0 exibido na figura abaixo.
Seja A(x) a função que associa a cada 0 ≤ x ≤ a a área da
região indicada pela cor cinza.

59
7) Seja a função ℎ(𝑥) definida para todo número real 𝑥 por Então, k é um número
a)irracional.
b)racional não inteiro.
c)inteiro positivo.
d)inteiro negativo
Então, ℎ(ℎ(ℎ(0))) é igual a
10) Sabendo que 𝑎 é um número real,
a)0. considere a função f(x) = 𝑎x + 2, definida para
b)2. todo número real 𝑥. Se f(f(1)) = 1, então
c)4.
a) 𝑎 = -1.
d)8.
b) 𝑎 = -1/2.

c) 𝑎 = 1/2.
8) Sejam a e b números reais positivos. Considere a função
quadrática f(x) = x(ax + b), definida para todo número real x. d) 𝑎 = 1.
No plano cartesiano, qual figura corresponde ao gráfico de y
= f(x)?

11) Sabendo que α é um número real,


considere a equação quadrática 2x2 + αx + 10
= 0. Se as soluções dessa equação são
números inteiros, o módulo da soma das
soluções é igual a

a)3.
b)4.
c)5.
d)6.

12) Tendo em vista que a e b são números

reais positivos, considere a função

definida para todo número real

x. Logo, é igual a

9) Sejam k e θ números reais tais que sen θ e cos θ são


soluções da equação quadrática 2x2 + x + k = 0.

60
13) Seja a função polinomial do terceiro grau 3) Considere a circunferência de equação
cartesiana 𝑥2 + 𝑦2 = 𝑥 − 𝑦. Qual das equações
definida para todo número real x.
a seguir representa uma reta que divide essa
A figura abaixo exibe o gráfico de no plano cartesiano, em que
circunferência em duas partes iguais?
os pontos A, B e C têm a mesma ordenada.
A distância entre os pontos A e C é igual a
a) 𝑥 + 𝑦 = −1.
b)𝑥 − 𝑦 = −1.
c) 𝑥 − 𝑦 = 1.
d)𝑥 + 𝑦 = 1.

4) No plano cartesiano, sejam 𝐴 a


circunferência de centro na origem e raio 𝑟> 0
a) 2. e 𝑠 a reta de equação 𝑥+ 3𝑦=10. A reta 𝑠
b) 2√2. intercepta a circunferência 𝐴 em dois pontos
c) 3. distintos se e somente se
d) 3√2. a) 𝑟> 2.
b) 𝑟>√5.

GEOMETRIA ANALÍTICA c) 𝑟> 3.


d) 𝑟>√10
1) No plano cartesiano, a equação |𝑥 − 𝑦| = |𝑥 + 𝑦| representa
a) um ponto. 5) No plano cartesiano, considere a
b) uma reta. circunferência de equação x2 + y2 - 4y + 3 = 0
c) um par de retas paralelas. e a parábola de equação 3x2 - y + 1 = 0.
d) um par de retas concorrentes.
Essas duas curvas se interceptam em
a) 1.
b) 2.
a)um ponto.
c) 3.
b)dois pontos.
d) 4.
c)três pontos.
d)quatro pontos.
2) Considere o círculo de equação cartesiana x2+ y2= ax + by ,
onde a e b são números reais não nulos. O número de pontos
6) Sabendo que 𝑐 é um número real,
em que esse círculo intercepta os eixos coordenados é igual
considere, no plano cartesiano, a
a
a) 1 circunferência de equação
Se o centro dessa circunferência pertence à
b) 2
reta de equação então seu raio
c) 3
é igual a
d) 4
a) √2.
b) √3.
c) 2.

61
d) 3

GEOMETRIA PLANA

1) A figura abaixo exibe um retângulo 𝐀𝐁𝐂𝐃 decomposto em a) √2 cm²

quatro quadrados. b) 2 cm²

c) 2√2 cm²

d) 3 cm²

4) Considere o triângulo retângulo 𝐴𝐵𝐷


exibido na figura abaixo, em que 𝐴𝐵 = 2 𝑐𝑚,
𝐵𝐶 = 1 𝑐𝑚 e 𝐶𝐷 = 5 𝑐𝑚. Então, o ângulo 𝜃 é
O valor da razão 𝐀𝐁/ 𝐁𝐂 é igual a
igual a
a) 5/3.

b) 5/2.

c) 4/3.

d) 3/2.

2) A figura a seguir exibe um pentágono com todos os lados


de mesmo comprimento. a)15𝑜.

b)30𝑜.

c)45𝑜
d)60𝑜

5) A figura abaixo exibe um setor circular


dividido em duas regiões de mesma área. A
razão 𝑎 /𝑏 é igual a
A medida do ângulo 𝜃 é igual a

a) 105𝑜 .

b) 120𝑜 .

c) 135𝑜 .
d) 150𝑜 .

3) A figura abaixo exibe um quadrilátero ABCD, onde AB = AD


e BC = CD = 2 cm. A área do quadrilátero ABCD é igual a a) √3+ 1.
b) √2+ 1.

62
c) √3.
d) √2.

6) Considere que o quadrado 𝐴BCD, representado na figura


abaixo, tem lados de comprimento de 1 𝑐m, e que C é o ponto
a) 3𝑡.
médio do segmento 𝐴E Consequentemente, a distância
b) 2√3𝑡.
entre os pontos D e E será igual a
c) 4𝑡.
d) 3√2𝑡.

9) A figura a seguir exibe um pentágono em


que quatro lados consecutivos têm
comprimentos 𝑎, 𝑏, 𝑐 e 𝑑. Se a sequência
(𝑎,𝑏,𝑐,𝑑) é uma progressão geométrica de
razão 𝑞> 1, então tan𝜃 é igual a

a) √3𝑐m
b) 2 𝑐m
c) √5𝑐m
d) √6𝑐m
.
a) 1/𝑞.
7) No triângulo ABC exibido na figura a seguir, AD é a bissetriz b) 𝑞.
do ângulo interno em A, e AD = DB.
c) 𝑞2.

d) √𝑞

10) Considere um paralelepípedo retângulo,


O ângulo interno em A é igual a cujas arestas têm comprimento 6 cm, 8 cm e
10 cm, e um triângulo cujos vértices são os
a)60º. centros (intersecção das diagonais) de três
b)70º. faces de dimensões distintas, como ilustra a
c)80º. figura a seguir.
d)90º.

8) No triângulo 𝐴BC exibido na figura a seguir, 𝑀 é o ponto


médio do lado 𝐴B, e 𝑁 é o ponto médio do lado 𝐴C. Se a área
do triângulo 𝑀BN é igual a 𝑡, então a área do triângulo 𝐴BC é
igual a
O perímetro P desse triângulo é tal que

63
a)2R.
a)P < 14 cm.
b)√3R.
b)14 cm < P < 16 cm.
c)16 cm < P < 18 cm. c)√2R.
d)P > 18 cm. d)R.

11) A figura abaixo exibe o triângulo ABC, em que 2) Um cilindro circular reto, cuja altura é igual
ao diâmetro da base, está inscrito numa esfera.
é uma altura de comprimento h.
A razão entre os volumes da esfera e do
A área do triângulo ABC é igual a cilindro é igual a

a)4√2 / 3.

b) 4 / 3.

c) 3 √2 / 4.

d) √2 .

a) h2
3) Um paralelepípedo retângulo tem faces de
b) √2h2
áreas 2 𝑐𝑚2, 3 𝑐𝑚2 e 4 𝑐𝑚2. O volume desse
c) √3h 2
paralelepípedo é igual a
d) 2h2 a) 2√3 𝑐𝑚3.

b)2√6 𝑐𝑚3.

12) A figura abaixo exibe o triângulo retângulo ABC, em que c)24 𝑐𝑚3.
AB = AM = MC.
d)12 𝑐𝑚3.

4) Se um tetraedro regular e um cubo têm


áreas de superfície iguais, a razão entre o
comprimento das arestas do tetraedro e o
comprimento das arestas do cubo é igual a
Então, tg θ é igual a

a)1/2. c) 1/4
b)1/3. c)1/5.
13)

GEOMETRIA ESPACIAL
1) Um cilindro circular reto, com raio da base e altura iguais a
R, tem a mesma área de superfície total que uma esfera de
raio

64
POLINÔMIOS
1) Considere o polinômio p(x) = x³ − x² + ax − a, onde a é um
número real. Se x = 1 é a única raiz real de p(x), então
podemos afirmar que

a)a < 0.

b)a < 1.

c)a > 0.
O gráfico de y = [f(x)]2 é dado por
d)a > 1.
a)

2) Considere o polinômio cúbico p(x) = x³ + x² − ax − 3 , onde


a é um número real. Sabendo que r e −r são raízes reais de
p(x) , podemos afirmar que p(1) é igual a

a)3.

b)1.
b)
c)-2.

d)-4.

3) Seja f(x) uma função tal que para todo número real x temos
que xf (x - 1) = (x - 3) f(x) + 3. Então, f(1) é igual a

a)0.

b)1.
c)
c)2.

d)3.

4) Considere o polinômio 𝑝(𝑥) = 𝑥𝑛 + 𝑥𝑚 + 1, em que 𝑛 > 𝑚 ≥


1. Se o resto da divisão de 𝑝(𝑥) por 𝑥 + 1 é igual a 3, então

a)𝑛 é par e 𝑚 é par.

b)𝑛 é ímpar e 𝑚 é ímpar. d)


c)𝑛 é par e 𝑚 é ímpar.

d)𝑛 é ímpar e 𝑚 é par.

5) A figura a seguir exibe o gráfico de uma função y = f(x) para


0 ≤ x ≤ 3.

65
6) Sejam p(x) e q(x) polinômios com coeficientes reais. 3) Seja i a unidade imaginária, isto é, i2 =
Dividindo-se p(x) por q(x), obtêm-se quociente e resto iguais a −1. O lugar geométrico dos pontos do plano
cartesiano com coordenadas reais (x, y) tais
x2 + 1. Nessas condições, é correto afirmar que
que (2x + yi)(y + 2xi) = i é uma

a)o grau de p(x) é menor que 5. a)elipse.


b)o grau de q(x) é menor que 3.
b)hipérbole.
c)p(x) tem raízes complexas.
d)q(x) tem raízes reais. c)parábola.

7) Sabendo que a e b são números reais, considere o d)reta.


polinômio cúbico p(x) = x3 + ax2 + x + b.

Se a soma e o produto de duas de suas raízes são iguais a - 4) Sejam 𝑎 e 𝑏 números reais não nulos.
1, então p(1) é igual a Se o número complexo 𝑧=𝑎+𝑏𝑏 é uma
raiz da equação quadrática 𝑥2+𝑏𝑥+𝑎= 0,
a) um ponto. então
b) dois pontos.
c) três pontos. a) |𝑧| = 1/√3.
b) |𝑧| = 1/√5.
d) quatro pontos
c) |𝑧| =√3.
d) |𝑧| =√5

NÚMEROS COMPLEXOS
1) Sejam x e y números reais tais que x + yi = onde i é a MATEMÁTICA BÁSICA
unidade imaginária. O valor de xy é igual a
1) Prazeres, benefícios, malefícios, lucros
cercam o mundo dos refrigerantes.
a)−2.
Recentemente, um grande fabricante nacional
b)−1. anunciou que havia reduzido em 13 mil
toneladas o uso de açúcar na fabricação de
c)1. seus refrigerantes, mas não informou em
quanto tempo isso ocorreu. O rótulo atual de
d)2.
um de seus refrigerantes informa que 200 ml
do produto contêm 21g de açúcar. Utilizando
apenas o açúcar “economizado” pelo referido
2) Considere o número complexo onde a é fabricante seria possível fabricar,
um número real e i é a unidade imaginária, isto é, i2= −1. O aproximadamente,
valor de z2016 é igual a
a) 124 milhões de litros de refrigerante.
a)a2016
b) 2,60 bilhões de litros de refrigerante.
b)1. c) 1.365 milhões de litros de refrigerante.
d) 273 milhões de litros de refrigerante.
c)1+ 2016i .

d) i. 2) Em certa espécie animal a proporção de


nucleotídeos Timina na molécula de DNA é
igual a 𝑡 > 0. Então, a proporção de
nucleotídeos Citosina nesse mesmo DNA é
igual a

66
a)1 − 𝑡. d)3/4.
b)𝑡/2.
c)1 − 𝑡/2. 2) Um dado não tendencioso de seis faces
d)1/2 − 𝑡. será lançado duas vezes. A probabilidade de
que o maior valor obtido nos lançamentos seja
menor do que 3 é igual a
3) Considere três números inteiros cuja soma é um número
ímpar. Entre esses três números, a quantidade de números
ímpares é igual a a)1/3.
b)1/5.
a) 0 ou 1. c)1/7.
b)1 ou 2. d)1/9.
c)2 ou 3.
d) 1 ou 3.
3)Lançando-se determinada moeda
tendenciosa, a probabilidade de sair cara é o
4) A representação decimal de certo número inteiro positivo dobro da probabilidade de sair coroa. Em dois
tem dois algarismos. lançamentos dessa moeda, a probabilidade
Se o triplo da soma desses algarismos é igual ao próprio de sair o mesmo resultado é igual a
número, então o produto dos algarismos é igual a a)1/2
b) 5/9
a)10.
c)2/3
b)12.
d)3/5
c)14.
d)16.
4) O sistema de segurança de um aeroporto
5) Em uma família, cada filha tem o mesmo número de irmãs consiste de duas inspeções. Na primeira delas,
e irmãos, e cada filho tem um número de irmãs igual ao dobro a probabilidade de um passageiro ser
do número de irmãos. inspecionado é de 3/5. Na segunda, a
probabilidade se reduz para 1/4.
O número total de filhos e filhas dessa família é igual a
A probabilidade de um passageiro ser
a)11. inspecionado pelo menos uma vez é igual a

b)9.
a)17/20.
c)7. b)7/10.

d)5. c)3/10.
d)3/20.
PROBABILIDADE
1)Uma moeda balanceada é lançada quatro vezes, obtendose
cara exatamente três vezes. A probabilidade de que as caras 5)Um atleta participa de um torneio composto
tenham saído consecutivamente é igual a por três provas. Em cada prova, a
probabilidade de ele ganhar é de 2/3,
a)1/4.
independentemente do resultado das outras
b) 3/8.
provas. Para vencer o torneio, é preciso
c)/2. ganhar pelo menos duas provas.

67
A probabilidade de o atleta vencer o torneio é igual a TRIGONOMETRIA
a)2/3. 1) Seja x um número real tal que sen x + cos x
b)4/9. = 0,2. Logo, | sen x − cos x| é igual a

c)20/27. a)0,5.
d)16/81. b)0,8.
c)1,1.
d)1,4.

LOGARÍTMO
ESTATÍSTICA
1) A solução da equação na variável real x , logx (x + 6) = 2 ,
é um número
1) A nota final de um curso é dada pela média
aritmética simples entre as notas de duas
a)primo. provas e a de um trabalho. Todas as notas se
b)par. distribuem entre 0 e 10 e a nota final mínima
c)negativo. para aprovação é 7.
Para um aluno ser aprovado, é necessário que
d)irracional
a média aritmética simples entre as notas das
provas seja maior ou igual a
2) a)2,5.
b)5,0.
c)5,5.
PROGRESSÃO GEOMÉTRICA
1) Seja (a,b,c) uma progressão geométrica de números reais
com a ≠ 0 . Definindo s = a + b + c , o menor valor possível
para s / a é igual
a)1/2.
b)2/3.
c)3/4.
d)4/5.

CONJUNTOS
1) Sabe-se que, em um grupo de 10 pessoas, o livro A foi lido
por 5 pessoas e o livro B foi lido por 4 pessoas. Podemos
afirmar corretamente que, nesse grupo,
a) pelo menos uma pessoa leu os dois livros.
b) nenhuma pessoa leu os dois livros.
c) pelo menos uma pessoa não leu nenhum dos dois livros.
d) todas as pessoas leram pelo menos um dos dois livros.

68
gabarito
(PS: sempre veja os erros como uma oportunidade de
aprendizado. Não fique triste se errar, você está dando o seu
melhor.)

Razão e Proporção 1C 2D

Financeira 1B 2B 3B 4A

Análise Combinatória 1C 2B

Progressão Aritmética 1A 2D 3C

Matriz 1B 2A 3D 4B 5A 6D 7B

Sistemas Lineares 1 A 2D 3D 4A

Funções 1 B 2C 3C 4D 5C 6D 7C 8B 9B 10A 11D 12A


13C

Geometria Analítica 1D 2C 3C 4D 5C 6D

Geometria Plana 1A 2B 3B 4C 5B 6C 7C 8C 9A 10C 11A


12B

Geometria Espacial 1D 2D 3B 4C

Polinômios 1C 2D 3B 4A 5C 6C 7D

Números Complexos 1D 2B 3A 4B

Matemática Básica 1A 2D 3D 4C 5C

Probabilidade 1C 2D 3B 4B 5C

Logaritmo 1A

Progressão Geométrica 1A

Conjuntos 1C

Trigonometria 1D

Estatistica 1A

69
INGLÊS Para o menino do cartum é surpreendente que
seus avós

a) já possuam contas nas redes virtuais de


INTEPRETAÇÃO DE TEXTO relacionamento.

1) b) tenham se conhecido nas redes virtuais de


relacionamento.

c) ainda não consigam gerenciar suas


relações sociais nas redes virtuais de
relacionamento.

d) tenham conseguido se conhecer fora das


redes virtuais de relacionamento.

3)

O personagem do cartum

a) considera tão difícil o processo de criação da fórmula


E=mc2 quanto calcular o imposto de renda.

b) compara o processo de criação da fórmula E=mc2 e o


cálculo do imposto de renda.

c) prefere realizar tarefas que lhe cabem como cidadão às


atividades que realiza como físico.
O texto reproduzido no poster acima
d) qualifica como mais fácil calcular o imposto de renda do que corresponde a um verso de uma canção
o processo de criação da fórmula E=mc2 . escrita por John Lennon e gravada pela
banda The Beatles em 1967. Da leitura desse
verso se depreende que viver só é fácil para
2) pessoas

a) alienadas.

b) inteligentes.

c) lúcidas.

d) insanas.

70
4)

6) Feline Intelligence

Dog and cat lovers seem to relish unending


debates over which animal is "smarter." Dog
owners often cap their arguments with the
fact that dogs have the ability to perform
tricks, while cat people counter with the claim
that their pets are too intelligent to perform on
command. In truth, such methods of pet
comparison are useless animal-world
versions of mixing apples and oranges. Dogs
are motivated by a strong need to follow and
Depreende-se dessa troca de mensagens que please their masters in order to receive
praise. The solitary cat answers to no one;
a) a mãe ficou satisfeita com a resposta dada pelo filho à nevertheless, if trainability may not be the
pergunta que ela lhe fez. feline's forte, cleverness and adaptability
b) o filho não entendeu a pergunta feita a ele por sua mãe. certainly are.
c) a mãe não foi capaz de interpretar adequadamente a
(Adaptado de http://www.animalplanet.com/pets/cat-
resposta do seu filho.
intelligence.htm. Acessado em 14/06/2014.)
d) o filho se dispôs a responder à pergunta feita pela mãe
mais tarde.
Segundo o texto,

a) comparar a inteligência de animais tão


diferentes como cães e gatos não faz
5) Tyrannosaurus rex
nenhum sentido.
Tyrannosaurus rex was one of the largest meateating
dinosaurs that ever lived. Fossil evidence shows that T. rex
b) os cachorros são mais inteligentes que os
was about 12 meters long and about 4.6 to 6 meters tall. Its
gatos porque conseguem cumprir ordens de
robust thighs and long, powerful tail helped it move quickly. T.
seus donos.
rex's serrated, conical teeth were used to pierce and grip
flesh, which it then ripped away with its strong neck muscles.
c) donos de gatos reclamam que seus
Its two-fingered forearms could probably seize prey, but they
were too short to reach its mouth animais de estimação não obedecem às suas
ordens.
(Adaptado de http://animals.nationalgeographic.com/animals/
prehistoric/tyrannosaurus-rex/. Acessado em 15/06/2014.) d) se cães e gatos forem bem treinados,
demonstrarão a mesma inteligência e
Segundo o texto, adaptabilidade.

a) fósseis comprovam que um Tyrannosaurus rex podia


alcançar doze metros de altura.

b) apesar de seus braços curtos, um Tyrannosaurus rex era


capaz de levar uma presa a sua boca.

c) os dentes e o pescoço de um Tyrannosaurus rex estavam


adaptados a sua dieta.

d) a cauda vigorosa de um Tyrannosaurus rex impedia-o de


se mover mais agilmente.

71
7) (Adaptado
dehttp://environment.nationalgeographic.com/environme
nt/natural-disasters/earthquake-profile/. Acessado em
22/06/2014.)

De acordo com o texto,

a) maremotos ocorrem quando a energia


acumulada entre placas tectônicas é liberada
de modo abrupto, vindo, então, rapidamente
à superfície.

b) terremotos podem ser imperceptíveis na


superfície, ainda que tenha havido, de fato,
colisão ou deslizamento de placas tectônicas.

c) maremotos, também denominados ondas


sísmicas, ocorrem quando placas tectônicas
colidem ou deslizam.

d) terremotos são mais frequentes na zona


costeira do Oceano Pacífico devido à baixa
incidência de atividades vulcânicas na região.

9)

O cartaz acima critica, de forma irônica,

a) a utilização excessiva de combustíveis que poluem o meio


ambiente.

b) as objeções dos ecologistas ao uso do plástico nas


sociedades contemporâneas.

c) o gasto de dinheiro público para financiar projetos que


poluem o meio ambiente.

d) o uso irresponsável de materiais descartáveis nas


sociedades contemporâneas. Qual das técnicas descritas no infográfico
acima foi utilizada por Gregor Mendel (1822-
1884) em seus experimentos?
8) Earthquakes
a) (1).
Some 80 percent of all the planet's earthquakes occur along b) (2).
the rim of the Pacific Ocean, called the "Ring of Fire" c) (3).
because of the preponderance of volcanic activity there. Most d) (4)
earthquakes occur at fault zones, where tectonic plates –
giant rock slabs that make up the Earth's upper layer – collide
or slide against each other. These impacts are usually
gradual and unnoticeable on the surface; however, immense 10) A tira tematiza a contribuição da atividade
stress can build up between plates. When this stress is humana para a eterioração do meio ambiente.
released quickly, it sends massive vibrations, called seismic Do diálogo apresentado, pode-se depreender
waves, often hundreds of miles through the rock and up to que os ursos já sabiam
the surface.

72
a)
do

aumento do pH dos mares e acabam de constatar o


abaixamento do nível dos mares.

b) da diminuição do pH dos mares e acabam de constatar o


aumento do nível dos mares.

c) do aumento do nível dos mares e acabam de constataro


abaixamento do pH dos mares.

d) da diminuição do nível dos mares e acabam de constatar o


aumento do pH dos mares.
a) derrotar o adversário em um jogo de futebol.
b) vencer o interlocutor em uma discussão.
c) derrotar o adversário na olimpíada de inglês.
11) "If you believe in freedom of speech, you believe in d) ser um bom comunicador.
freedom of speech for views you don’t like. Goebbels was in
favor of freedom of speech for views he liked. So was Stalin. If
you’re in favor of freedom of speech, that means you’re in favor
of freedom of speech precisely for views you despise."
13) The Future of Food
(Noam Chomsky) SCENARIO PLANNING TRAINING
In 2030...
(Fonte:http://noam-chomsky.tumblr.com/post/7223808896/if-youbelieve- in- What will we eat?
freedom-of-speech-you-believe.) Where will our food come from?
Will we all have enough?
O autor do texto Using the global system as a backdrop,
expert scenario
a) despreza os que restringem a liberdade de expressão practitioners will help you apply the
methodology that
b) critica os excessos da liberdade de expressão. systematically imagines multiple futures and
their risks and
c) critica a falta de liberdade de expressão. opportunities
START ONLINE, THEN COME TO STANFORD
d) defende a liberdade de expressão sem restrições. UNIVERSITY
Application deadline AUGUST 3, 2015
Online content opens August 10, 2015
Onsite Immersion at Stanford Sept.28-Oct.1,
2015
12) Na tirinha, Calvin dá dicas sobre como
Apply now at WORLDVIEW.STANFORD.EDU
SPACE LIMITED TO 32 PARTICIPANTS

73
(Adaptado de Stanford Magazine, July/August 2015, p.3.) thinking everyone would be staring at me. But
nobody seemed to notice and then it hit me:
The fact that nobody knew me meant nobody
O texto anuncia um
would judge, which, upon reflection, was what
a) curso on-line e presencial que oferece uma
I was scared of the most. I told myself to let
metodologia para ajudar a definir quais alimentos deverão
go. All along the year, I forced myself into
ser consumidos no futuro.
situations that were uncomfortable for me –
for example, auditioning for a dance piece.
b) curso on-line que oferece uma metodologia para minimizar
Believe it or not, that performance was a
riscos no consumo de alimentos no futuro.
highlight of my freshman year. My advice:
challenge yourself to try something new,
c) curso on-line e presencial que oferece uma
something you couldn’t have done in high
metodologia para construção de cenários futuros sobre
school. – Ria Jagasia, Vanderbilt
consumo de alimentos.
University, ’18.

d) curso presencial que oferece uma metodologia para ajudar (Adaptado de http://www.nytimes.com/2015/08/02/
as pessoas a comerem melhor no futuro. education/edlife/ advice-for-new-students-from-those-
who-know-old-students.html?ref= edlife.)

14) Advice for new students from those who know (old Para lidar com a situação, a estratégia
students) adotada foi deixar de se preocupar e

The first day of college I was a ball of nerves. I remember a) fazer coisas que nunca fez antes.
walking into my first class and running to the first seat I found,
thinking everyone would be staring at me. But nobody b)fazer novos amigos.
seemed to notice and then it hit me: The fact that nobody
knew me meant nobody would judge, which, upon reflection, c)fazer um curso de dança como ouvinte.
was what I was scared of the most. I told myself to let go. All
along the year, I forced myself into situations that were d)abandonar o curso.
uncomfortable for me – for example, auditioning for a dance
piece. Believe it or not, that performance was a highlight of
my freshman year. My advice: challenge yourself to try
something new, something you couldn’t have done in high 16) If apes go extinct, so could entire forests
school. – Ria Jagasia, Vanderbilt University, ’18. Bonobos eat a lot of fruit, and fruit contains
seeds.
(Adaptado de http://www.nytimes.com/2015/08/02/ education/edlife/ advice- Those seeds travel through a bonobo’s
for-new-students-from-those-who-know-old-students.html?ref= edlife.) digestive system
while bonobo itself travels around the forest. A
No primeiro dia de faculdade, Ria ficou muito nervosa
few hours
later, the seeds end up being deposited far
a)por não conhecer ninguém.
from where the
fruits were plucked. And that is where the new
b)por achar que seria julgada pelos colegas.
trees come
from.
c)porque ninguém olhou para ela.
According to a paper recently published, if the
bonobos disappeared, the plants would also
d)porque não sabia dançar
likely go
extinct, for many trees and plants species in
Congo rely
15) Advice for new students from those who know (old
almost exclusively on bonobos for seed
students)
dispersal.
The bonobo has two major functions here.
The first day of college I was a ball of nerves. I remember
First of all,
walking into my first class and running to the first seat I found,

74
many seeds will not germinate well unless they have been Segundo o texto, “Texting walkers” são
“handled” by another species. Stomach acids and intestinal pessoas que
processes make the seed more able to absorb water and later
sprout. Secondly, many seeds will not succeed if they remain a)caminham longas distâncias e usam o
too close to their parental trees. The seeds that fell to the celular para registrar essas distâncias.
ground near their parents did not survive because they were
choked off by the nearby plants. The bonobos eat about 3,5 b) escrevem ou leem mensagens, ou veem
hours every day and travel a mean of 1.2 kilometers from meal vídeos no celular enquanto caminham.
sites before defecating.
c) testam o celular como dispositivo para
(Adaptado de http://blogs.scientificamerican.com/extinction-countdown caminhadas longas.
/if-apes-go-extinct-so-could-entire-forests/.)

d)tropeçam e caem quando usam o celular


Qual é a explicação para o título?
enquanto caminham.
a) Os bonobos se alimentam de plantas e suas fezes ajudam
a adubar florestas. Como andam grandes distâncias,
espalham esse adubo pela floresta.
Para as questões 18 e 19, leia o texto
abaixo.
b) Os bonobos vivem em árvores e suas fezes, que contêm
fungicidas naturais, protegem as árvores dos fungos. Como
andam grandes distâncias, podem proteger florestas inteiras.
We’ve modified our behavior so we can
text and walk
c) Os bonobos se alimentam de frutas com sementes. Seu
sistema digestivo prepara as sementes para a germinação.
Texting – or checking social media or
Como andam grandes distâncias, suas fezes ajudam a
reading/responding to
espalhar as sementes pela floresta.
mail or reading the news or checking the
weather or
d) Os bonobos vivem em árvores e se alimentam de folhas,
watching a video – while walking is a pretty
que se transformam em fungicidas naturais aos serem
common
digeridas. Quando liberados pelas fezes, esses fungicidas
phenomenon. It’s so common that most people
protegem as florestas.
who own a
mobile device have become texting walkers.
Research suggests that these texters adopt
protective
17) We’ve modified our behavior so we can text and walk
measures to minimize the risk of accidents
when walking.
Texting – or checking social media or reading/responding to
They’re less likely to trip because they shorten
mail or reading the news or checking the weather or watching
their step
a video – while walking is a pretty common phenomenon. It’s
length, reduce step frequency, lengthen the
so common that most people who own a mobile device have
time during
become texting walkers. Research suggests that these texters
which both feet are in contact with the ground,
adopt protective measures to minimize the risk of accidents
and increase
when walking. They’re less likely to trip because they shorten
obstacle clearance height. Taken together this
their step length, reduce step frequency, lengthen the time
creates an
during which both feet are in contact with the ground, and
increase obstacle clearance height. Taken together this exaggerated image of walking, but it
creates an exaggerated image of walking, but it apparently apparently slows the
slows the walker enough so that he registers some of what is
happening around him and can compensate for it. walker enough so that he registers some of
what is
(Adaptado de http://blogs.scientificamerican.com/anthropology-inpractice/
happening around him and can compensate
we-ve-modified-our-behavior-so-we-can-text-and-walk/.)
for it.

75
(Adaptadodehttp://blogs.scientificamerican.com/anthropology-inpractice/we- Na língua portuguesa, a ordem dos algarismos
ve-modified-our-behavior-so-we-can-text-and-walk/.)
de acordo com o comentário do “5” seria
a)123456789.
b)529846731.
18) Segundo o texto, “Texting walkers” são pessoas que c)236719458.
d)137648925.

a) caminham longas distâncias e usam o celular para

registrar essas distâncias. 21) Leia os versos iniciais do poema The


White Man’s Burden
b) escrevem ou leem mensagens, ou veem vídeos no

celular enquanto caminham. (O fardo do homem branco).

c) testam o celular como dispositivo para caminhadas longas. Take up the White Man’s burden
d) tropeçam e caem quando usam o celular enquanto Send forth the best ye breed -
caminham Go send your sons to exile
To serve your captives' need
To wait in heavy harness
On fluttered folk and wild-

19) Que mudanças no comportamento dessas pessoas são Your new-caught, sullen peoples,
decorrentes da adaptação à tecnologia apresentada no texto? Half devil and half child (...)
a) Elas diminuem a extensão e a frequência dos passos, (Rudyard Kipling, Rudyard Kipling’s Verse. Disponível em
aumentando o tempo em que os dois pés ficam em contato http://kiplingsociety.co.uk/poems_burden.htm. Acessado em
17/10/2016.)
com o chão; calculam melhor a altura dos obstáculos no
percurso.
O poema de Rudyard Kipling foi escrito em
b) Elas aumentam a extensão dos passos e diminuem sua Londres, em 1898, após a estadia do autor
frequência, para que os dois pés fiquem mais tempo em nos EUA. Considerando-se o contexto do
contato com o chão. imperialismo do século XIX, o poeta expressa
c) Antes de iniciar a caminhada, elas registram, no celular, a
a)a defesa do expansionismo norte-americano,
extensão do trajeto, a frequência dos passos e o tempo em
justificado como um dever moral explicitado no
que os dois pés ficam em contato com o chão.
título “The White Man’s Burden”.
d) Antes de iniciar a caminhada, elas registram, no celular, a
extensão e a altura dos obstáculos do percurso, a frequência b)o olhar caridoso em relação aos povos
dos passos e o tempo em que os dois pés ficam em contato dominados no contexto do imperialismo do
com o chão. século XIX, como se observa no verso “half
devil and half child”.

c)uma crítica à visão da superioridade branca


20)
vigente durante a corrida imperialista do
século XIX, ao enaltecer as características
“folk and wild”.

d)a visão de que as famílias americanas não


devem ser punidas pela política expansionista
dos EUA, como se observa na recomendação
“Go send your sons to exile”.

76
22) a) fez o que era normal para os jovens
japoneses na época, abrindo uma loja de
discos.

b)fez o que era normal para os jovens


japoneses, mas em uma ordem totalmente
diferente.

c)queria viver feliz ouvindo música o dia todo,


sem trabalhar.
A tirinha ironiza uma suposta característica dos ingleses:
d)queria ganhar dinheiro trabalhando só com
música e viver feliz.
a)o apreço pela história das invasões bárbaras.

b)a admiração pela família real.


24) Considerando o nome da figura - “The
c)o valor que atribuem aos seus jardins. Small Talk Thermometer” -, pode-se
depreender que a expressão “small talk” se
d)o cuidado com a preservação de seus edifícios históricos.
refere a

23) The Birth of My Kitchen-Table Fiction

By Haruki Murakami

Most people – most of us who are part of Japanese society –


graduate from school, then find work, then, after some time
has passed, get married. Even I originally intended to follow
that pattern. Yet in reality I married, then started working, then
finally managed to graduate. In other words, the order I chose
was the exact opposite to what was considered normal.

Since I hated the idea of working for a company, I decided to


open my own establishment, a place where people could go to
listen to jazz records, have a coffee, eat snacks and drink. It
was a simple, rather happy-go-lucky kind of idea: running a
business like that would let me relax listening to my favorite
music from morning till night.
a)conversas casuais ou amenas, para
(Adaptado de H. Murakami, Wind and Pimbal – Two Novels. Tradução do japonês para o
inglês de Ted Goossen. London: Penguin Random House, 2015, p.5.)
estabelecer contato ou quebrar o gelo.

b)conversas entre cientistas sobre mudanças


O autor do texto climáticas.

77
c)conversas entre meteorologistas sobre o tempo. infantilism.” Charles and others also cited a
certain artistic banality in massively
d)conversas entre pessoas que não conseguem chegar a um commercial story-telling, while others criticized
consenso Hogwarts, the wizardry academy attended by
Potter, for only rewarding innate talents.

The Anglo-American writer Christopher


25) Ranking Universities by ‘Greenness’
Hitchens, on the other hand, praised J. K.
Rowling for freeing English children’s literature
Universities these days are working hard to improve their from dreams of riches and class and snobbery
sustainability credentials, with efforts that include wind power, and giving us a world of youthful democracy
organic food and competitions to save energy. They are also and diversity. A growing body of evidence
adding courses related to sustainability and energy. But which suggests that reading Rowling’s work, at least
university is the greenest? as a youth, might be a good thing.

Several ranking systems have emerged to offer their take. The (Adaptado de http://www.scientificamerican.com/article/why-
everyone-shouldread-harry-potter/. Acessado em 02/09/2016.)
Princeton Review recently came out with its second annual
green ratings. Fifteen colleges earned the highest possible A leitura do excerto permite concluir
score — including Harvard, Yale and the University of adequadamente que:
California, Berkeley.
a) A série Harry Potter é aprovada por críticos
Another group, the Sustainable Endowment Institute’s literários e grupos religiosos com base nos
GreenReportCard.org, rates colleges on several different mesmos argumentos.
areas of green compliance, such as recycling, student
involvement and green building. Its top grade for overall b)As qualidades literárias de Harry Potter
excellence, an A-, was earned by 15 schools. justificam seu sucesso entre os adultos.
(Adaptado de http://green.blogs.nytimes.com/2009/08/20/ranking-universities-
bygreenness/?_r=0. Acessado em 31/08/2016.) c)A abordagem educacional de Hogwarts
recompensa as habilidades desenvolvidas por
Conforme o texto, universidades norte-americanas estão se meio do esforço pessoal.
empenhando para
d) Para os personagens da série Harry Potter,
a)oferecer mais cursos sobre ecologia. o sonho de ascendência social e poder
financeiro é pouco relevante.
b)melhorar sua posição em um ranking que define as
instituições mais “verdes”.
27) Depreende-se das informações da figura
c)oferecer os melhores cursos sobre preservação ambiental.

d)participar de uma competição que define os campi com


maior área verde.

26) Why Everyone Should Read Harry Potter

September 9, 2014

Harry Potter is the best selling book series of all time. But it’s
had its reproaches. Various Christian groups claimed the
books promoted paganism and witchcraft to children.
Washington Post book critic Ron Charles called the fact that
adults were also hooked on Potter a "bad case of cultural

78
a)38% das jovens engravidam antes dos 18 anos.
29)

b)38% das jovens concluem o ensino médio aos 22 anos.

c)a gravidez na adolescência interfere na vida escolar das


jovens.

d)a gravidez após os 18 anos interfere na vida escolar das


jovens.

28) Roman documents discovered


We often think that the best information from the Roman world
comes from Egypt, where the dryness preserves papyri.
However, in Britain the reverse conditions occur. At Vindolanda
– a Roman fort located two miles behind Hadrian’s Wall – the
humidity preserved wooden writing tablets that were thrown (Adaptado de 16 Traduções hilárias de placas e avisos em
into a bonfire when the fort was evacuated in CE 105. inglês feitos para a copa. Mega Curioso, 07/06/2014.
Disponível em http://www.megacurioso.com.br/copa-do- mundo-
2014/44531-16-traducoes-hilarias-de- placas-e- avisos-em-
These wooden tablets were one of the most important ingles-feitos-para-a-copa.htm. Acessado em 10/07/2017.)
discoveries made in Roman Britain in the 20th century.
They were used not for grand writings but for memoranda and Entre as inadequações no uso do inglês
accounts, so they provide the best insight into life in the Roman observadas nas figuras 1 e 2, podemos citar:
army found anywhere in the world. One of the tablets says:
a) erros no emprego dos tempos verbais em
Octavius to Candidus: “I need money. I have bought 5,000 inglês.
bushels of grain, and unless you send me some money, I shall
lose my deposit and be embarrassed”. b) equívoco quanto à classe gramatical de
(Adaptado de http://www.archaeology.co.uk/specials/the-timeline-ofbritain/vindolanda- certas palavras.
2.htm. Acessado em 28/08/2016.)

c) desconhecimento das diferenças entre


inglês oral e escrito
Os documentos descobertos em Vindolanda

a)são papiros preservados pelo clima seco da região em que d) erros de tradução causados por falsos
foram encontrados. cognatos

b)contêm informações sobre a evacuação do forte no ano 105


da Era Cristã.
30) Elderly flight passenger throws coins into
c)preservam registros de disputas financeiras entre cidadãos engine for ‘luck’, delays take-off for hours
comuns.
China Southern Airlines Flight 380 was held
d) são registros em madeira, com informações preciosas up at the Shanghai Pudong International
sobre a vida no exército romano. Airport after an elderly woman passenger
caused a disruption, according to the airline’s
official WeChat account. An investigation into
the incident is under way.

Passengers boarding the flight reportedly saw


an elderly woman throwing coins at the engine
for “blessings” from the middle of the boarding

79
staircase and alerted the crew. Ground staff said the woman, Os panfletos acima foram distribuídos na
who appeared to be about 80 and had limited mobility, was entrada de uma assembleia de estudantes
accompanied by her husband, daughter and son-in-law. universitários, reunidos para discutir um
pedido de reforma nos banheiros do campus.
The captain was quoted as saying the metal, if sucked up by Assinale a opção correta.
the engine, could have caused serious damage, including
a)O panfleto (A) defende, de maneira irônica,
failure.
a criação de mais banheiros públicos unissex.
The flight was later given a green light and took off at 5.52pm, b)panfleto (B) recomenda bater na porta ou
more than five hours late. It is scheduled to arrive in avisar verbalmente antes de entrar em um
Guangzhou at 8.14pm. banheiro unissex.

(Adaptado de Sarah Zheng, Elderly flight passenger throws coins into engine for ‘luck’, c)O panfleto (A) critica pessoas que se
delays take-off for hours. South China Morning Post, 27/06/2017. Disponível em preocupam excessivamente com questões de
http://www.scmp.com/news/china/society/article/2100242/elderlyflight-passenger-
throws-coins-engine-luck-delays-take. Acessado em 10/07/2017.)
assédio sexual.

d) O panfleto (B) argumenta a favor de


O que é correto afirmar sobre o incidenterelatado na notícia banheiros unissex ao expor um dilema de
anterior? pessoas transgênero.

a) Por causa do incidente, o avião chegou a seu destino com


cinco horas de atraso, às 17h52.
32) ZOMBIE NEUROSCIENCE
b) Segundo o piloto, moedas atiradas na turbina do avião
causaram sérios danos à aeronave. I don’t know if cockroaches dream, but I
c) Uma idosa chinesa, seu marido, sua filha e seu genro quase imagine if they do, jewel wasps feature
provocaram um acidente aéreo. prominently in their nightmares. These small,
solitary tropical wasps are of little concern to
d) A ação de alguns passageiros evitou o risco de um grave us humans; after all, they don’t manipulate our
acidente aéreo. minds so that they can serve us up as willing,
living meals to their newborns, as they do to
unsuspecting cockroaches. The story is simple,
31) if grotesque: the female wasp controls the
minds of the cockroaches she feeds to her
offspring, taking away their sense of fear or will
to escape their fate. What turns a once healthy
cockroach into a mindless zombie it’s venom.
Not just any venom, either: a specific venom
that acts like a drug, targeting the cockroach's
brain.
(Adaptado de Christie Wilcox, Zombie Neuroscience. Scientific
American, New York, v. 315, n. 2, p. 70–73, 2016.)

De acordo com o autor,

a)certas baratas conseguem escapar de


ataques de vespas comportando-se como
zumbis.

b) baratas são capazes de ações predatórias


que mal podemos imaginar.

c)vespas fêmeas de uma certa espécie podem


controlar a mente das baratas.

80
d) uma barata pode inocular um veneno que transforma uma
outra barata em um zumbi.

33) The colour of the dots represents the relative intensity of


therapeutic area research within a specific country across
each row. The size of the dots represents the relative
proportions of research across different countries within a
specific therapeutic area in each column.
(Adaptado de Ajay Gautam, Lily Li e Kumar Srinivasan, Market watch: Therapeutic area
‘heat map’ for emerging markets. Nature Reviews Drug Discovery 14, p. 518, jul. 2015.)

Hitherto I had thought only slavery dreadful;


but the state of a free negro appeared to me
now equally so at least,and in some respects
even worse, for they live in constant alarm for
their liberty; and even this is but nominal, for
they are universally insulted and plundered
without the possibility of redress; for such is
De acordo com o gráfico apresentado, the equity of the West Indian laws, that no free
negro's evidence will be admitted in their
a)doença autoimune é um tema pesquisado intensamente em courts of justice. In this situation is it surprising
todos os países. that slaves, when fairly treated, should prefer
even the misery of slavery to such a mockery
b)a China é o país com o menor mercado potencial para of freedom?
tratamentos médicos, apesar de ser populosa.
(Adaptado de Olaudah Equiano, The Interesting Narrative of the
c) Índia e África do Sul dão importância semelhante às Life of Olaudah Equiano or Gustavus Vassa, the African.
Peterborough, Canada: Broadview Press, 2001, p. 250.)
pesquisas sobre doenças infecciosas.

d)no Brasil, na Rússia e na Índia, a quantidade de doentes de


Segundo o testemunho de Olaudah Equiano,
câncer é aproximadamente a mesma.
a)embora tivessem direitos assegurados no
tribunal, os ex-escravos não podiam requerer
34) Olaudah Equiano's Biography indenizações pelo tempo passado no cativeiro.

Olaudah Equiano (1745 –1797) foi um escritor abolicionista b)os ex-escravos eram, em princípio,
africano do século XVIII que viveu na pele os horrores da protegidos pelas leis das Índias Ocidentais
escravidão nas Américas. Leia o trecho abaixo, retirado da Britânicas, que previam tratamento igualitário
sua autobiografia. aos cidadãos livres.

c)os escravos libertos dispunham de uma


falsa liberdade, pois não gozavam dos

81
mesmos direitos nos tribunais que os cidadãos nascidos livres. 36) Coral reefs are colorful underwater forests
which teem with life and act as a natural
d)muitos ex-escravos preferiam voltar à antiga condição, protective barrier for coastal regions. The
mesmo sob patrões severos, levando em conta a maneira fishes and plants which call them home belong
como viviam depois de libertos. to some of the most diverse ― and fragile ―
ecosystems on the planet. Higher sea
temperatures from global warming have
already caused major coral bleaching events.
35) Should Twitter entertain millions with public arguments? Bleaching occurs when corals respond to the
stress of warmer temperatures by expelling the
Comedian Janey Godley's tweets of a couple's train-bound
colorful algae that live within them. Increased
row raise questions of how to protect our privacy in public
levels of atmospheric carbon dioxide result in
places.
higher levels of CO2 in the water, leading to
ocean acidification, which is also a threat to
coral. As the oceans become more acidic, the
If the troubles of the two travellers had made it on to a
corals' ability to form skeletons through
newspaper first rather than a comedian's Twitter feed, would
calcification is inhibited, causing their growth to
we be so relaxed about loss of privacy? I think perhaps not.
slow. Increasing sea levels caused by melting
Social media has done so much for freedom of expression, it sea ice could also cause problems for some
would be cruel if it actually leads to less social freedom for fear reefs by making them too deep to receive
of having our every misstep, angry word or misbehaviour adequate sunlight, another factor important for
broadcast there for all to see. survival.
(Adaptado de David Banks, Should Twitter entertain millions with public rows? The
(Adaptado de Coral Reefs, The National Wildlife Federation.
Guardian, 13/07/2012. Disponível em
Disponível em https://www.nwf.org/Wildlife/Threats-to-
https://www.theguardian.com/commentisfree/2012/jul/13/twittermillions- public-rows.
Wildlife/Global- Warming/Effects-on-Wildlife-and-Habitat/Coral-
Acessado em 10/07/2017.)
Reefs.aspx. Acessado em 26/07/2017.)

Considerando o texto e seus conhecimentos,


assinale a alternativa correta.

Os recifes de corais estão seriamente


ameaçados pela combinação dos seguintes
fatores:

a) branqueamento das esponjas calcáreas


pela exalação de suas algas simbiontes;
acidificação marinha em virtude da elevação
do nível do mar; e menor taxa fotossintética
pelo aumento do CO2 nos oceanos.

b)bloqueio das conchas dos cnidários pela


expulsão de suas algas parasíticas;
No artigo de opinião acima, o autor acidificação marinha em virtude dos maiores
níveis de CO2 no ar; e maior incidência de luz
a) critica a perda da liberdade de expressão provocada pelo
solar por causa do degelo das calotas polares.
abuso nas mídias sociais por certos usuários.

b) aponta um dilema ético suscitado pelo uso das mídias c) branqueamento dos pólipos de cnidários
sociais, envolvendo dois tipos de liberdade. pela expulsão de suas algas simbiontes;
acidificação marinha em virtude dos maiores
c) diz que a invasão de privacidade por parte de jornais é mais níveis de CO2 no ar; e menor taxa
aceita do que aquela praticada pelo Twitter. fotossintética em razão dos níveis oceânicos
d)argumenta que a liberdade dos cidadãos é um valor mais elevados.
importante do que o direito à privacidade.

82
d)bloqueio das esponjas calcáreas pela aquisição de algas
comensalistas; acidificação marinha em virtude dos maiores Life in the slums, despite its difficulties, has its
níveis de CO2 no ar; e maior incidência de luz solar por causa advantages.“The slums are the one place in
do degelo das calotas polares the city where you have the kind of solidarity
we Indians have in the villages." said a Pataxó
woman who lives in Rio de Janeiro's Maré
Complex.
37) The modern F=ma form of Newton's second law occurs (Adaptado de Associated Press, Indigenous people in Brazil seek
nowhere in any edition of the Principia even though he had out cities, end up in slums, Dailymail, 16/09/2014.)
seen his second law formulated in this way in print during the
interval between the second and third editions in Jacob Assinale a alternativa que indica
Hermann's Phoronomia of 1716. Instead, it has the following corretamente os fenômenos geográficos
formulation in all three editions: A change in (1) ________ is mencionados no texto a respeito das
proportional to the motive (2) ________ impressed and takes populações indígenas.
place along the (3) _________ line in which that force is
(4)________. In the body of the Principia this law is applied a)Migração urbano-rural, segregação
both to (5) _______ cases, in which an instantaneous impulse socioespacial urbana, preservação
such as from impact is effecting the change in motion, and to socioambiental.
cases of (6) _______ action, such as the change in motion in
the continuous deceleration of a body moving in a resisting b)Segregação socioespacial urbana,
medium. Newton thus appears to have intended his second migração rural-urbana, impacto
law to be neutral between discrete forces (that is, what we now socioambiental.
call impulses) and continuous forces.
c)Inclusão socioespacial urbana, impacto
(Adaptado de George Smith,
"Newton's Philosophiae Naturalis Principia Mathematica", em Edward N. Zalta (ed.), The socioambiental, migração urbano-rural.
Stanford Encyclopedia of Philosophy (Winter 2008 Edition). Disponível em
https://plato.stanford.edu/archives/win2008/entries/newton-principia/. Acessado em
24/10/2017.) d)Preservação socioambiental, inclusão
socioespacial urbana, migração rural-urbana
Assinale a alternativa que apresenta a sequência adequada
de palavras que preenchem as lacunas do texto acima, para
que os conceitos utilizados estejam corretos.

a) Motion, force, straight, impressed, discrete, continuous.

b)Force, motion, impressed, straight, discrete, continuous. 39) Touching thermal-paper receipts could
extend BPA retention in the body
c)Motion, force, impressed, straight, continuous, discrete.

d)Force, motion, straight, impressed, continuous, discrete.


38) Indigenous people in Brazil seek out cities, end up in slums

RIO DE JANEIRO — The dancers shake seed-filled maracas


and raise their voices in song, conjuring an ancient spirit that
vibrates above the traffic roaring from a nearby expressway
and the beat of funk music blasting from a neighbor's
loudspeaker.
When people handle receipts printed on
In this Brazilian favela, the indigenous people are struggling to
thermal paper containing the endocrine
keep some of their traditions alive that, besides providing a
disruptor bisphenol A (BPA), the toxic chemical
sense of community, helps them endure the discrimination they
could linger in the body for a E week or more.
face in the city. Forced out of their native lands by deforestation,
Jonathan W. Martin of Stockholm University
miners and farmers, nearly one in four Brazilian Indians
and Jiaying Liu of the University of Alberta
nowadays live in urban areas and an estimated 22,000 of them
asked six male volunteers to handle paper
now call the crowded favelas their home.

83
containing isotopically labeled BPA for five minutes. The Considerando as informações contidas no
volunteers then put on nitrile gloves, wore them for two hours, excerto anterior, qual dos números a seguir é
removed them, and washed their hands with soap. Afterward, um primo de Mersenne?
the researchers measured the labeled BPA and its metabolites
in the volunteers' urine regularly for two days and then once a)23.
again a week later. The study only traced the isotopically b)29.
labeled (deuterated) BPA and its metabolites, so any additional c)31.
BPA exposure from other sources was not monitored. d)37.

(Deirdre Lockwood, Touching thermal-paper receipts could extend BPA retention in the
body. Chemical & Engineering News, 04/09/2017.)
41)
O texto discorre sobre uma pesquisa cujo objetivo foi

a)determinar como o manuseio de papel térmico pode


contaminar uma pessoa com bisfenol A, considerando que a
concentração foi monitorada utilizando-se um BPA em que
átomos de 1H foram substituídos por 2H.

b)analisar de que forma o uso de luvas nitrílicas lavadas com


sabão e contendo BPA deuterado pode contaminar receitas
impressas em papel térmico que contém um disruptor
endócrino.

c)monitorar, durante uma semana ou mais, a cinética de


eliminação de um disruptor endócrino, bisfenol A (BPA), do
corpo humano que foi contaminado pelo uso de luvas nitrílicas.

d)verificar como um papel térmico deteriorado por átomos de


2H poderia contaminar as mãos de uma pessoa, mesmo que O post anterior aponta
ela estivesse usando luvas nitrílicas durante duas horas e
depois as removesse. a)as vantagens da globalização para o
consumidor e os problemas causados pela
imigração.
b)o impacto negativo dos processos
40) Largest prime number discovered: with more than 23m migratórios no modo como as culturas vêm
digits sendo globalizadas.

Known simply as M77232917, the figure is arrived at by c)os efeitos da globalização no nosso
calculating two to the power of 77,232,917 and subtracting one, cotidiano e o preconceito contra imigrantes.
leaving a gargantuan string of 23,249,425 digits. The result is
nearly one million digits longer than the previous record holder d)o consumo excessivo de produtos
discovered in January 2016. The number belongs to a rare estrangeiros no mundo capitalista
group of so-called Mersenne prime numbers, named after the contemporâneo.
17th century French monk Marin Mersenne. Like any prime
number, a Mersenne prime is divisible only by itself and one,
but is derived by multiplying twos together over and over
before taking away one. The previous record-holding number 42) Este cartum foi criado pelo norte-
was the 49th Mersenne prime ever found, making the new one americano Bruce Beattie, em 2011. Nele, o
the 50th. cartunista faz uso da ironia para
(Adaptado de lan Sample, “Largest prime number discovered: with more than 23m digits”.
The Guardian, 04/ 01/2018.)

84
c)sejam ameaçadas, caso se tornem bem-
sucedidas.
d)tenham suas vozes silenciadas pelos
homens.

44) Os dizeres da camiseta

a)justificar a meritocracia como princípio de reconhecimento


de igualdade de oportunidades.

b)identificar a garantia do salário mínimo como condição


suficiente para a proteção da classe trabalhadora.

c)abordar os efeitos da precarização do trabalho nas


sociedades contemporâneas.

d)propor que a empregabilidade leva à recuperação da


economia e à justiça social.

a)brincam com palavras do inglês que têm


grafias e pronúncias semelhantes.
43) We raise girls to cater to the fragile egos of men. We teach
girls do shrink themselves, to make themselves smaller. We b)criam um efeito de humor explorando a
tell girls “You can have ambition, but not too much". “You ambiguidade de certas palavras do inglês.
should aim to be successful, but not too successful, otherwise
you will threaten the man”. (...) We teach girls shame — 'Close c) brincam com o fato de o inglês ser uma
your legs, cover yourself!'. We make them feel as though by língua irracional e incompreensível.
being born female, they're already guilty of something. And so,
girls grow up to be women who cannot see they have desire. d)criam um efeito de humor a partir da
They grow up to be women who silence themselves. They complexidade do sistema ortográfico do inglês.
grow up to be women who cannot say what they truly think.
And they grow up — and this is the worst thing we do to girls
— to be women who tum pretense into an art form. 45) “Yes, Im Italian — but I'm not loud, I
don't gesticulate and I'm not good with
(Adaptado da palestra “We should all be feminists”, 15/07/2009. Disponível em
https://www.youtube.com/watch?v=hg3umXU qWc&t=797s. Acessado em 14/05/2018.)
pizza”

Elena Ferrante
I love my country, but I have no patriotic spirit
and no national pride. What's more, I digest
pizza poorly, I eat very little spaghetti, I don't
O texto anterior reproduz trechos de uma palestra proferida speak in a loud voice, I dont gesticulate, I hate
pela escritora nigeriana Chimamanda Adichie em 2009. all mafias, I don't exclaim “Mamma mia!”
Segundo a autora, o fato de serem criadas para agradar aos National characteristics are simplifications that
homens faz com que as mulheres should be contested. Being Italian, for me,
begins and ends with the fact that I speak and
a)valorizem sua sexualidade ao longo de suas vidas. write in the Italian language.
b)cresçam vendo a dissimulação como algo normal.

85
Put that way it doesn't seem like much, but really it's a lot. A
language is a compendium of the history, geography material b)há quem busque a companhia da morte por
and spiritual life, the vices and virtues, not only of those who falta de amor.
speak it, but also of those who have spoken it through the
centuries. When I say that I'm Italian because I write in Italian, c)a rotina diária a que somos submetidos é
I mean that Im fully Italian in the only way that I'm willing to capaz de pôr fim ao amor.
attribute to myself a nationality. I don't like the other ways,
especially when they become nationalism, chauvinism, and d)é melhor trocar as incertezas do amor por
imperialism. paz de espírito.

(Adaptado de Elena Ferrante, “Yes, I'm Italian — but I'm not loud, | don't gesticulate and
I'm not good with pizza”, The Guardian, 24/02/2018.)

47) Genetic Fortune-Telling


Transcrevem-se, a seguir, versos de canções brasileiras e de
um poema de Vinícius de Moraes. Assinale a alternativa que
melhor exemplifica as afirmações de Elena Ferrante.

a)“Eu me sinto um estrangeiro.” (Engenheiros do Hawaii, “A


revolta dos dândis”.)

b)“Pátria Amada, é pra você esta canção/Desesperada,


canção de desilusão.” (Inocentes, “Pátria amada”.)
One day, babies will get DNA report cards at
c)“Minha pátria é minha língua.” (Caetano Veloso, “Língua”.) birth. These reports will offer predictions about
their chances of suffering a Neart attack or
d)“Se me perguntarem o que é a minha pátria, direi:/ Não sei. cancer, of getting hooked on tobacco, and of
De fato, não sei (...)." (Vinícius de Moraes, “Pátria minha”.) being smarter than average.

Though the new DNA tests offer probabilities,


not diagnoses, they could greatly benefit
46) Love is not all medicine. For example, if women at high risk
for breast cancer got more mammograms and
By Edna St. Vincent Millay those at low risk got fewer, those exams might
Love is not all: It is not meat nor drink catch more real cancers and set off fewer false
Nor slumber nor a roof against the rain; alarms. The trouble is, the predictions are far
Nor yet a floating spar to men that sink from perfect. What if someone with a low risk
And rise and sink and rise and sink again; score for cancer puts off being screened, and
Love cannot fill the thickened lung with breath, then develops cancer anyway? Polygenic
Nor clean the blood, nor set the fractured bone; scores are also controversial because they
Yet many a man is making friends with death can predict any trait, not only diseases. For
Even as I speak, for lack of love alone. instance, they cannow forecast about 10
lt well may be that in a difficult hour, percent of a person's performance on IQ tests.
Pinned down by need and moaning for release, But how will parents and educators use that
Or nagged by want past resolution's power, information?
I might be driven to sell your love for peace,
Or trade the memory of this night for food. (Adaptado de Derek Brahney, Genetic Fortune-Telling. MIT
Technology Review, Março/Abril 2018)

lt may well be. I do not think I would.


De acordo com o texto, um dos riscos do
(Disponível em https://www.poemhunter.com/. Acessado em 28/05/2018.)
prognóstico genético dos indivíduos desde o
nascimento seria o de
De acordo com o poema,
a)por falta de amor, somos derrotados pelas dificuldades da
vida.

86
abaixo faz alusão ao Brexit, isto é, à saída do
a)empresas usarem as informações para não contratar
pessoas que teriam predisposição a certas doenças ou vícios.

b)algumas mulheres descuidarem da prevenção de problemas


de saúde para os quais pareciam não estar predispostas.

c)vernos usarem as informações genéticas para negar a


certos cidadãos o acesso a serviços de saúde pública.
d)pais e educadores passarem a desconsiderar dados sobre
o coeficiente de inteligência de seus filhos ou alunos.

Reino Unido da União Europeia.


38) There are approximately 70 million pet dogs and 74 million
pet cats in the U.S., a country where 20 men and women are Com relação ao exemplo apresentado,
assaulted per minute. In one survey, 71 percent of domestic entende-se que Taylor estava “fazendo o
violence victims reported that their abuser also targeted pets. Brexit” porque
In one study of families under investigation for suspected child
abuse, researchers found that pet abuse had occurred in 88
percent of these families. a)se despediu, mas demorou a ir embora da
festa.
b)saiu “à francesa” da festa, isto é, saiu
discretamente.
c)se despediu, mas anunciou que demoraria a
sair da festa.
d)saiu “à francesa” da festa, isto é, saiu depois
de muito tempo.

(Adaptado de https://www.humanesociety.org/resources/animal-cruelty-facts-and-stats.
Acessado em 11/05/2019.) 40) A tirinha apresentada

O objetivo do texto é destacar a relação entre

a)aumento do número de animais domésticos e de casos de


crueldade contra os animais.

b)violência doméstica e famílias investigadas por crueldade


contra os animais.

c)condenações por abuso infantil e crueldade contra os


animais.

d)casos de violência doméstica e crueldade contra os animais.

39) O site “Urban Dictionary” apresenta definições de palavras


e expressões que, apesar de serem usadas popularmente, a)ironiza uma ideia de liberdade de expressão.
ainda não foram oficialmente dicionarizadas. O exemplo

87
b)critica políticas de imigração do governo dos EUA. 42) A Associação Canadense de Saúde
Mental é uma organização sem fins lucrativos
c)defende uma visão de inglês como língua mundial. que combate o estigma sobre a saúde mental,
promovendo ações em favor de pessoas que
d)desaprova o uso da língua materna de imigrantes nos EUA. sofrem com doenças dessa natureza. O cartaz
abaixo, direcionado à população em geral, foi
publicado no site dessa associação.

41) When 24-year-old fashion blogger Scarlett Dixon posted a O cartaz apresentado tem o intuito de
picture of herself having breakfast, the internet turned nasty.
“The best of days start with a smile and positive thoughts. And
pancakes. And strawberries”, Dixon wrote on her Instagram
feed. The post was reposted on Twitter. “Instagram is a
ridiculous lie factory made to make us all feel inadequate”,
wrote Nathan from Cardiff. His post, which has garnered more
than 111,000 likes (22 times as many as Dixon’s original) and
almost 25,000 retweets, prompted a wave of criticism, with
comments going like “Fakelife!”.

Instagram looks like the friendliest social network imaginable.


But, for a growing number of users – and mental health experts
– the very positivity of Instagram is precisely the problem. The
site encourages its users to present an upbeat, attractive
image that others may find at best misleading and at worse
harmful. Instagram makes you worry that everyone is perfect
– except you. a)motivar a população a parar de reconhecer
os estereótipos negativos associados à saúde
(Adaptado de https://www.theguardian.com/technology/2018/sep/17. Acessado em
19/04/2019).
mental.

O texto anterior apresenta uma crítica b)encorajar empresários a oferecer melhores


condições de emprego a pessoas com
a)a Scarlett Dixon, por propagar uma autoimagem doenças mentais.
excessivamente positiva e irreal.
c)estimular o combate aos estereótipos que
b)ao Instagram, por propiciar postagens que veiculam uma atingem pessoas com doenças mentais.
autoimagem irreal das pessoas.
d)incentivar um tratamento diferenciado a
c)ao post de Scarlett Dixon, por gerar uma onda de pessoas com doenças mentais.
comentários negativos em outras mídias sociais.

d)à exposição excessiva da vida íntima das pessoas no


Instagram e em outras mídias sociais. 43) To me, science is one way of connecting
with the mystery of existence. And if you think
of it that way, the mystery of existence is
something that we have wondered about ever
since people began asking questions about
who we are and where we come from. So while
those questions are now part of scientific

88
research, they are much, much older than science. I’m talking in England, with power to stop publication of
about science as part of a much grander and older sort of any book contrary to the Doctrine of the
questioning about who we are in the big picture of the universe. Church of England.” This was disturbing to
To me, as a theoretical physicist and also someone who Milton, who wrote, “as good almost kill a man
spends time out in the mountains, this sort of questioning offers as kill a good book: [he] who kills a man kills a
a deeply spiritual connection with the world, through my mind reasonable creature; but he who destroys a
and through my body. Einstein would have said the same thing, good book, kills reason itself.”
I think, with his cosmic religious feeling.
(Adaptado de https://www.questia.com/magazine/1P3-
1048971311/milton-s-areopagitica-freed om-of-speech-on-
campus. Acessado em 15/05/2019.)
A relação entre o posicionamento do autor do
texto e o de John Milton na publicação
mencionada é de

a)divergência, pois o autor julga que as ideias


de Milton sobre liberdade de expressão
Marcelo Gleiser, March 20, 2019. parecem ultrapassadas em relação ao que
ocorre hoje nas universidades.
(Adaptado de https://www.scientificamerican.com/article/atheism-is-inconsistent-with-
the-scien tific-method-prizewinning-physicist-says/?redirect=1. Acessado em
15/05/2019.) b)divergência, pois diferentemente de Milton,
o autor critica o fato de haver, nas
Qual das frases abaixo mais se aproxima das palavras de universidades inglesas, apelos para que a
Gleiser reproduzidas acima? censura seja exercida no campus.

a)“O bom da ciência é que ela é verdadeira, quer se acredite c)concordância, pois o autor apoia a mesma
nela ou não.” (Neil deGrasse Tyson) linha de pensamento de Milton quanto às
críticas ao controle da liberdade de imprensa.
b)“Ciência é a única religião da humanidade.” (Arthur Clarke)
d) concordância, pois o autor alinha-se a
c)“Ciência é a chave do nosso futuro.” (Bill Nye) Milton quanto à ideia de que destruir um bom
livro é o mesmo que destruir uma criatura
d)“Ciência não é apenas compatível com espiritualidade; é racional.
uma profunda fonte de espiritualidade.” (Carl Sagan)

45) A peça publicitária

44) John Milton and Freedom of Speech on Campus

By Daniel F. Sullivan
A few years ago, at a seminar meant to help college presidents
think about the issues they face as campus leaders, I read
John Milton's Areopagitica: A speech for the liberty of
unlicensed printing to the parliament of England. Originally
published in 1644, Areopagitica makes a powerful argument
for freedom of speech and against censorship in publishing.
After twenty years as a college president, having experienced
and observed many calls to censor, I've come to believe that
there is not much to know on the topic beyond what Milton
wrote over 350 years ago. Areopagitica was published in
response “to Parliament's ordinance for licensing the press of
June 14, 1643.” The effect of the ordinance against which
Milton wrote “was to give Archbishop Laud, who was also
Chancellor of the University of Oxford, control over every press

89
a)questiona se aquele seria o melhor momento para os pais 47) Antibiotic resistance is possible because
estarem cientes das ameaças fascistas combatidas pelo bacteria are able to exchange genetic material
Macarthismo. Essa política alterou a vida em instituições de through a process known as bacterial
ensino norte-americanas, proibindo a divulgação de temas conjugation. In one experiment, resistance to
ligados à Guerra Fria e às ameaças nucleares, de acordo com tetracycline (a commonly used antibiotic) was
as diretrizes do Comitê de Atividades Antiamericanas. studied in Escherichia coli by introducing a
tetracycline-resistant bacterium to a
b)defende a “injeção” vermelha e comunista nas escolas tetracycline-sensitive strain. The resistant
durante o Macarthismo. Essa política, implementada nos bacterium’s genome contained a protein called
Estados Unidos de 1950 a 1957, e inserida no contexto da an “efflux pump”, a polypeptide that localizes
Guerra Fria, é caracterizada por uma acentuada repressão ao to the cell membrane and expels certain small
comunismo, com a participação direta do FBI. molecules from the cell.

c)denuncia a ameaça da “injeção” vermelha e comunista nas Using fluorescent marking, researchers
escolas na Era McCarthy. Essa política foi marcada pela observed the DNA encoding one specific efflux
instauração de investigações pelo governo e por indústrias pump in between a resistant bacterium and a
privadas norte-americanas contra funcionários públicos e da sensitive bacterium. With live-cell microscopy,
indústria do entretenimento acusados de serem liberais. they tracked the fluorescence to see how the
DNA migrated from one cell to another and
d)defende que já passou da hora de os pais estarem cientes how it was incorporated and expressed in the
da ameaça comunista combatida pelo Macarthismo. Essa recipient bacterium.
política, instaurada no contexto da Guerra Fria, foi marcada
por violações dos direitos individuais e instauração de (Fonte: Sophie Nolivos e outros, Science, Washington, v. 364, n.
6442, p. 778-782, maio 2019.)
inquéritos por parte do Comitê de Atividades Antiamericanas.
Com base no texto e em seus conhecimentos,
assinale a alternativa correta.

46) Nuclear fusion is a reaction in which atomic nuclei merge


a)A fusão transmembrana do genoma que
to form the nucleus of a new atom. The mass of the new atom’s
confere resistência antibiótica é facilitada pela
nucleus is lower than the sum of the merging nuclei’s masses,
presença da tetraciclina.
a difference that is released as energy. This is, for instance,
the reaction that occurs in the Sun. The energy released during
b)A proteína envolvida na resistência
fusion can be calculated by the equation E = Δmc2 , where Δm
antibiótica à tetraciclina é transferida
is the difference between the initial and final masses in the
diretamente por conjugação bacteriana.
reaction, and c is the speed of light. When calculating the
aforementioned energy, nucleus mass can be conveniently
c)O gene da proteína de resistência antibiótica
quantified using the atomic mass unit (u), which is roughly
é transferido através da fusão transmembrana
equivalent to 900 MeV (1 u → 900 MeV). Consider the
na presença de tetraciclina.
hypothetical nuclear fusion reaction 222X + 4Y → 221Z. Note that
the masses of 222X, 4Y, and 221Z are 222 u, 4 u, and 221 u,
d)O DNA codificador da proteína que confere
respectively.
resistência antibiótica à tetraciclina é
transferido por conjugação bacteriana.
The amount of energy released in this reaction is

a)5 MeV.
b)450 MeV.
c)900 MeV.
d)4500 MeV.

90
gabarito
(PS: sempre veja os erros como uma oportunidade de
aprendizado. Não fique triste se errar, você está dando o seu
melhor.)

1B 2D 3A 4C 5C 6A 7D 8B 9A 10C 11D 12B 13C

14B 15A 16C 17B 18B 19A 20B 21A 22C 23B 24A

25B 26D 27C 28D 29B 30D 31D 32C 33C 34C 35B

36C 37A 38B 39A 40C 41C 42C 43B 44D 45C 46B

37D 38D 39A 40A 41B 42C 43C 44C 45D 46D 47D

91
Sociologia
(Adaptado de Lynn Hunt, A invenção dos direitos
humanos: uma história. São Paulo: Companhia das Letras,
2009, p. 19.)

Assinale a alternativa correta.


PODER, ESTADO E POLÍTICA
a) A prática jurídica da igualdade foi expressa
na Declaração de Independência dos EUA e
1) Sinto no meu corpo
assegurada nos países independentes do
A dor que angustia
continente americano após 1776.
A lei ao meu redor
A lei que eu não queria
b) A lei inglesa, ao referir-se aos antigos
Estado violência
direitos, preservava a hierarquia, os privilégios
Estado hipocrisia
exclusivos da nobreza sobre a propriedade e
A lei que não é minha
os castigos corporais como procedimento
A lei que eu não queria
jurídico.
(“Estado Violência”, Charles Gavin, em Titãs, Cabeça Dinossauro, WEA,
1989.) c) No contexto da Revolução Francesa, a
Declaração dos Direitos do Homem e do
A letra dessa música, gravada pelos Titãs, Cidadão significou o fim do Antigo Regime,
ainda que tenham sido mantidos os direitos
a) critica a noção de Estado e sua ausência de controle, tradicionais da nobreza.
aspectos comuns ao liberalismo e ao marxismo.
d) Os direitos do homem, por serem direitos
b) constata que o corpo físico e o corpo político se relacionam dos humanos em relação uns aos outros,
em sociedades de controle. significam que não pode haver privilégios,
nem direitos divinos, mas devem prevalecer
c) critica o autoritarismo policial e o modelo de regulação os princípios da igualdade e universalidade
proposto pelo anarquismo. dos direitos entre os humanos.

d) constata que o Estado autoritário, mesmo com boas leis, é


sabotado pela figura do policial.
3) “Não existem culturas ou civilizações
ilhadas. (...) Quanto mais insistirmos na
separação de culturas e civilizações, mais
2) A igualdade, a universalidade e o caráter natural dos direitos
imprecisos seremos sobre nós mesmos e os
humanos ganharam uma expressão política direta pela
outros. No meu modo de pensar, a noção de
primeira vez na Declaração da Independência americana de
uma civilização isolada é impossível. A
1776 e na Declaração dos Direitos do Homem e do Cidadão
verdadeira questão é se queremos trabalhar
de 1789. Embora se referisse aos “antigos direitos e
para civilizações separadas ou se devemos
liberdades” estabelecidos pela lei inglesa e derivados da
tomar o caminho mais integrador, mas talvez
história inglesa, a Bill of Rights inglesa de 1689 não declarava
mais difícil, que é tentar vê-las como um
a igualdade, a universalidade ou o caráter natural dos direitos.
imenso todo cujos contornos exatos uma
Os direitos são humanos não apenas por se oporem a direitos
pessoa sozinha não consegue captar, mas
divinos ou de animais, mas por serem os direitos de humanos
cuja existência certa podemos intuir e sentir.”
em relação uns aos outros.
(Edward Said, Reflexões sobre o exílio e outros ensaios. São
Paulo: Companhia das Letras, 2002, p. 317.)

92
Sobre o conceito em questão e os contextos referidos pelo entre os donos do poder e os setores sociais
autor, é correto afirmar: tornados subalternos.

a)o processo de globalização provocou a destruição da cultura


dos povos não ocidentais e, por isso, aumentou práticas como
o terrorismo a partir de 2001.
MOVIMENTOS SOCIAIS
b)a ideia de civilização, como imaginada no século XIX,
produziu a emancipação das Américas e o fim da disputa
colonial no mundo. 1)Consideramos estas verdades como
autoevidentes: que todos os homens e
c) o conceito de civilização foi estabelecido na Grécia Antiga
mulheres foram criados iguais; que são
e aperfeiçoado pelas práticas integradoras do imperialismo do dotados pelo Criador de certos direitos
século XIX ocorridas na África. inalienáveis. Entre os direitos inalienáveis
estão a vida, a liberdade e a busca da
d)a lógica de integração de culturas é negada por grupos
felicidade. Para garantir esses direitos, os
radicais e pelos defensores do princípio de que vivemos em governos são instituídos. Os poderes do
um choque de civilizações. governo emanam do consentimento daqueles
que são governados. Qualquer governo que
se torna destrutivo para os direitos
4) "A fúria do tirano, o terrorismo de Estado, a guerra, o
inalienáveis pode ser destituído por aqueles
massacre, o escravismo, o racismo, o fundamentalismo, o
que sofrem. Os que sofrem podem recusar
tribalismo, o nazismo, sempre envolvem alegações racionais,
lealdade e exigir a instituição de um novo
humanitárias, ideais, ao mesmo tempo que se exercem em
governo. E assim tem sido o sofrimento das
formas e técnicas brutais, irracionais, enlouquecidas. Em geral,
mulheres sob este governo. E, por isso, é
a fúria da violência tem algo a ver com a destruição do ‘outro’,
necessário exigir uma mudança.
‘diferente’, ‘estranho’, com o que busca a purificação da
sociedade, o exorcismo de dilemas difíceis, a sublimação do (Adaptado de Elizabeth Cady Stanton, A History of Woman
absurdo embutido nas formas da sociabilidade e nos jogos Suffrage, v. 1. Rochester: Fowler and Wells, 1889, p. 70-71.)

das forças sociais."


Assinale a alternativa correta.
(Octávio Ianni,” A violência na sociedade contemporânea”, em Estudos de Sociologia, O documento acima integra
Araraquara, v. 7, n. 12, p. 8, 2002.)

a)a Declaração de Independência dos


Assinale a alternativa correta. Estados Unidos da América, baseada nos
princípios de Jean-Jacques Rousseau e do
a)Os atos de violência sempre implicam alegações irracionais Pacto Social.
e práticas racionais que transformam os jogos das forças
sociais e as tramas de sociabilidade que envolvem as b)a Declaração da primeira Convenção dos
coletividades. Direitos das Mulheres nos Estados Unidos da
América, que reconhece os princípios liberais
b) A violência nasce como técnica de poder, exercita-se como de John Locke e o direito à propriedade
modo de preservar, ampliar ou conquistar a propriedade, privada, ampliando-os.
adquirindo desdobramentos psicológicos desprezíveis para
agentes e vítimas. c)a Declaração de Independência dos
Estados Unidos da América, baseada nos
c) Os atos de violência não têm excepcional significação, princípios de Thomas Paine, que reconhece
porque mantêm as mesmas formas e técnicas, razões e como direitos inalienáveis a vida, a liberdade
convicções conforme as configurações e os movimentos da e a busca da felicidade.
sociedade.
d)a Declaração da primeira Convenção dos
d) A violência entra como elemento importante da cultura Direitos das Mulheres nos Estados Unidos da
política com a qual se ordenam ou se transformam as relações América, baseada nos princípios de Alexis de

93
Tocqueville, que se opunha à democracia na América. QUESTÃO RACIAL, GÊNERO E
INDÍGENA
2) A foto mostra, da esquerda para a direita, os atletas Peter
1) Alguns pesquisadores falam sobre a
Norman (australiano), John Carlos e Tommie Smith
necessidade de um “letramento racial”, para
(norteamericanos), no pódio dos 200 metros rasos das
“reeducar o indivíduo em uma perspectiva
Olimpíadas de 1968, no México.
antirracista”, baseado em fundamentos como
o reconhecimento de privilégios, do racismo
como um problema social atual, não apenas
legado histórico, e a capacidade de interpretar
as práticas racializadas. Ouvir é sempre a
primeira orientação dada por qualquer
especialista ou ativista. uma escuta atenta,
sincera e empática. Luciana Alves, educadora
da Unifesp, afirma que "Uma das principais
coisas é atenção à linguagem. A gente tem
uma linguagem sexista, racista, homofóbica,
que passa pelas piadas e pelo uso de termos
que a gente já naturalizou. “A coisa tá preta”,
'denegrir”, 'serviço de preto”... Só o fato de
você prestar atenção na linguagem já anuncia
uma postura de reconstrução. Se o outro diz
que tem uma carga negativa e ofensiva,
acredite”.

(Disponível em http://www.gettyimages.co.uk/detail/news-photo/the-americansprinters- (Adaptado de Gente branca: o que os brancos de um país racista


tommie-smith-john-carlos-and-peter-news-photo/186173327#theamerican- sprinters- podem fazer pela igualdade além de não serem racistas. UOL,
tommie-smithjohn-carlos-and-peter-norman-the-pictureid186173327. Acessado em 21/05/2018)
01/08/2017.)
Segundo Luciana Alves, para combater
Considerando a imagem acima e seus conhecimentos acerca
racismo e mudar de postura em relação a ele,
dos Movimentos de Direitos Civis, assinale a alternativa
é fundamental
correta.

a)A fotografia registra o ato de resistência de atletas negros a)ouvir com atenção os discursos e
que defendiam as propostas de Martin Luther King e a ação orientações de especialistas e ativistas.
pacifista como caminho para a constituição da igualdade racial.
b)reconhecer expressões racistas existentes
b)A fotografia registra a manifestação política de três atletas
em práticas naturalizadas.
que defendiam a Nação Islã e a implementação da Ku Klux
Klan em todo o território nacional.
c)passar por um “letramento racial” que
c)A fotografia registra a manifestação de atletas defensores dispense o legado histórico.
dos Panteras Negras e das ações violentas, se necessárias,
para a conquista da igualdade racial. d)prestar atenção às práticas históricas e às
orientações da educadora.
d)A fotografia registra a resistência de atletas e do Comitê
Olímpico Internacional, que combatiam o sistema de
discriminação racial existente nos Estados Unidos da América.

94
gabarito
(PS: sempre veja os erros como uma oportunidade de
aprendizado. Não fique triste se errar, você está dando o seu
melhor.)

Poder, Estado e Política 1B 2D 3D 4D

Movimentos Sociais 1B 2C

Questão racial, gênero e indígena 1B

95
Filosofia
c) em que o amor é o critério principal para a
formação de casais da elite.

d)em que o direito da mulher se sobrepõe ao


interesse político e social.
EMPIRISMO
1) A maneira pela qual adquirimos qualquer conhecimento
constitui suficiente prova de que não é inato. 2) “Muitos políticos veem facilitado seu nefasto
trabalho pela ausência da filosofia. Massas e
(John Locke, Ensaio acerca do entendimento humano. São Paulo: Nova
funcionários são mais fáceis de manipular
Cultural, 1988, p.13.)
quando não pensam, mas tão somente usam
O empirismo, corrente filosófica da qual Locke fazia parte, de uma inteligência de rebanho. É preciso
impedir que os homens se tornem sensatos.
a) afirma que o conhecimento não é inato, pois sua aquisição Mais vale, portanto, que a filosofia seja vista
deriva da experiência. como algo entediante.”
(Karl Jaspers, Introdução ao pensamento filosófico. São Paulo:
Cultrix, 1976, p.140.)
b) é uma forma de ceticismo, pois nega que os conhecimentos
possam ser obtidos. Assinale a alternativa correta.

a)O filósofo lembra que a filosofia tem um


c) aproxima-se do modelo científico cartesiano, ao negar a
existência de ideias inatas. potencial crítico que pode desagradar a
políticos, poderosos e ao senso comum, tal
d) defende que as ideias estão presentes na razão desde o como ocorreu na Grécia em relação a
Sócrates.
nascimento.
b)A filosofia precisa ser entediante para
estimular o pensamento crítico, rigoroso e
formar pessoas sensatas, a partir do ensino de
POLÍTICA lógica, retórica e ética.
c) A ditadura militar no Brasil retirou a
1) Apenas a procriação de filhos legítimos, embora essencial, disciplina de filosofia das escolas por
não justifica a escolha da esposa. As ambições políticas e as considerá-la subversiva, mas atenuou a
necessidades econômicas que as subentendem exercem um medida estimulando os Centros Populares de
papel igualmente poderoso. Como demonstraram inúmeros Cultura (CPC), ligados a entidades estudantis.
estudos, os dirigentes atenienses casam-se entre si, e
geralmente com o parente mais próximo possível, isto é, d)Os políticos e a estrutura escolar não são o
primos coirmãos. É sintomático que os autores antigos que verdadeiro obstáculo ao ensino de filosofia,
nos informam sobre o casamento de homens políticos mas a concepção de que ela é difícil e tediosa,
atenienses omitam os nomes das mulheres desposadas, mas considerando-se que existem mecanismos
nunca o nome do seu pai ou do seu marido precedente. para aproximá-la do senso comum.

(Adaptado de Alain Corbin e outros, História da virilidade, vol. 1. Petrópolis:


Vozes, 2014, p. 62.) MAQUIAVEL
Considerando o texto e a situação da mulher na Atenas
clássica, podemos afirmar que se trata de uma sociedade 1) Quanto seja louvável a um príncipe manter
a fé, aparentar virtudes e viver com
a) na qual o casamento também tem implicações políticas e integridade, não com astúcia, todos o
sociais. compreendem; contudo, observa-se, pela
experiência, em nossos tempos, que houve
b) que, por ser democrática, dá uma atenção especial aos príncipes que fizeram grandes coisas, mas em
direitos da mulher. pouca conta tiveram a palavra dada, e
souberam, pela astúcia, transtornar a cabeça
dos homens, superando, enfim, os que foram

96
leais (...). Um príncipe prudente não pode nem deve guardar FILOSOFIA MEDIEVAL
a palavra dada quando isso se lhe torne prejudicial e quando
as causas que o determinaram cessem de existir.
1) Estamos acostumados a considerar que o
sistema centro/periferia, ao menos no
(Nicolau Maquiavel, O Príncipe. São Paulo: Nova Cultural, 1997, p. 73-85.)
Ocidente, é um eixo essencial da estrutura e
A partir desse excerto da obra, publicada em 1513, é correto do funcionamento no espaço das economias,
afirmar que: das sociedades, das civilizações. O
historiador Fernand Braudel estimou que tal
a)O jogo das aparências e a lógica da força são algumas das sistema só existiu e funcionou plenamente a
principais artimanhas da política moderna explicitadas por partir do século XV. Essa definição não se
Maquiavel aplica à Cristandade Medieval sem
importantes correções. A noção de centro e a
b) A prudência, para ser vista como uma virtude, não depende oposição centro/periferia são menos decisivas
dos resultados, mas de estar de acordo com os princípios da que outros sistemas de orientação espacial. O
fé. principal sistema é o que opõe o baixo ao alto,
quer dizer, o Aqui, esse “mundo” imperfeito e
c)Os princípios e não os resultados é que definem o marcado pelo Pecado Original, ao céu,
julgamento que as pessoas fazem do governante, por isso é morada de Deus.
louvável a integridade do príncipe.
(Adaptado de Jacques Le Goff e Jean-Claude Schmitt,
“Centro/Periferia”, em Dicionário temático do ocidente medieval, v.
d) A questão da manutenção do poder é o principal desafio ao 2. São Paulo: Edusc, 2002, p. 203.)

príncipe e, por isso, ele não precisa cumprir a palavra dada,


desde que autorizado pela Igreja. A partir do texto acima, assinale a alternativa
correta.

a)Usada nas Ciências Humanas para a


ÉTICA E MORAL compreensão de períodos históricos desde a
Antiguidade, a noção de centro/periferia
1) Por que a ética voltou a ser um dos temas mais trabalhados perdura até a atualidade e estrutura o sistema
do pensamento filosófico contemporâneo? Nos anos 1960 a econômico global contemporâneo.
política ocupava esse lugar e muitos cometeram o exagero de
afirmar que tudo era político. b)As noções de baixo e alto têm um sentido
histórico mais preciso para a compreensão da
(José Arthur Gianotti, “Moralidade Pública e Moralidade Privada”, em Adauto Cristandade Medieval do que o sistema
Novaes, Ética. São Paulo: Companhia das Letras, 1992, p. 239.) centro/periferia.

A partir desse fragmento sobre a ética e o pensamento c)O sistema centro/periferia é aplicável ao
filosófico, é correto afirmar que: estudo da Cristandade Medieval, já que os
feudos constituíam o centro da vida
a) O tema foi relevante na obra de Aristóteles e apenas econômica e cultural naquele contexto.
recentemente voltou a ocupar um espaço central na produção
filosófica. d)O sistema centro/periferia aplicado durante
a Era Medieval espelhava o sistema de
b) Os impasses morais e éticos das sociedades orientação baixo e alto, sendo o baixo o
contemporâneas reposicionaram o tema da ética como um mundo do pecado e o alto o mundo da virtude
dos campos mais relevantes para a Filosofia. cristã.

c) O pensamento filosófico abandonou sua postura política


após o desencanto com os sistemas ideológicos que eram
vigentes nos anos 1960.

d) Na atualidade, a ética é uma pauta conservadora, pois nas


sociedades atuais, não há demandas éticas rígidas.

97
TEMÁTICA

1) O texto a seguir, extraído de uma reportagem publicada em


gabarito
um jornal paulista, apresenta conclusões sobre a inclusão de
Filosofia e Sociologia no Ensino Médio, a partir de dados (PS: sempre veja os erros como uma
levantados pelo IPEA (Instituto de Pesquisa Econômica oportunidade de aprendizado. Não fique triste
se errar, você está dando o seu melhor.)
Aplicada).

A inclusão de Filosofia e Sociologia como disciplinas Empirismo 1A


obrigatórias no Ensino Médio em 2009 prejudicou a
aprendizagem de matemática dos jovens brasileiros, Política 1A 2a
principalmente os de baixa renda. A conclusão é de um estudo
inédito que será publicado pelo IPEA. Segundo ele, a Maquiavel 1a
mudança levou as notas de jovens residentes em municípios
Ética e moral 1a
com muito baixo Índice de Desenvolvimento Humano (IDH),
que engloba aspectos da renda, escolaridade e saúde, a cair Filosofia medieval 1B
11,8%, 8,8% e 7,7% em redação, matemática e linguagens
(que inclui português, língua estrangeira e outras linguagens), Temática 1c
respectivamente.

(Adaptado de Érica Fraga, “Filosofia e Sociologia obrigatórias derrubam notas em


Matemática”; em Folha de São Paulo. 16/04/2018.)

A partir das relações históricas entre as disciplinas


mencionadas na reportagem e de uma análise crítica da
conclusão da pesquisa, marque a alternativa correta.

a)Desde as diferentes civilizações da Antiguidade até o


presente, os conhecimentos matemáticos e filosóficos têm se
demonstrado incompatíveis, corroborando as conclusões do
texto. Pitágoras, por exemplo, considerava que o cosmo,
descrito de forma filosófica, era regido por relações
matemáticas.

b)A Filosofia e a Matemática constituem campos de saber


distintos, sendo a lógica uma das possibilidades de interface
entre as duas ciências, distinção que valida as conclusões do
texto. Pascal, por exemplo, estabeleceu as bases da análise
combinatória a partir de argumentos filosóficos.

c)A Filosofia e a Matemática, campos de saber distintos,


dialogam para produzir conhecimento científico, o que não
respalda as conclusões do texto. Descartes, por exemplo,
desenvolveu o plano de coordenadas para representar as
relações entre as coisas do mundo e suas proporções
matemáticas.

d)Desde as diferentes civilizações da Antiguidade até o


presente, os conhecimentos matemáticos rivalizam com os
conhecimentos filosóficos, como demonstra o texto. Na
Academia de Platão, por exemplo, essa disputa era
representada pela frase “Quem não é geômetra, não entre”.

98
História
A partir desse sermão, escrito no sul da atual
França, é correto afirmar que:

a) A Igreja Católica assumia funções


espirituais e deixava à nobreza o cuidado da
IDADE MÉDIA saúde dos camponeses, através de ordens
religiosas e militares.

1) São mais ou menos constantes as queixas dos bispos e dos b)O cristianismo tinha penetrado em todas as
clérigos sobre a manutenção das práticas pagãs no mínimo categorias sociais e era interpretado da
até o século X. Um conjunto de práticas pagãs se mantém mesma forma através da autoridade dos
quase intacto, sem levar em conta festas públicas pagãs como bispos.
a de 1º de janeiro, que sobreviveu durante muito tempo.
c) Práticas consideradas menos ortodoxas por
(Adaptado de Michel Rouche, "Alta Idade Média Ocidental", em Paul Veyne
(org.), História da vida privada: do Império Romano ao ano mil. São Paulo:
Cesário de Arles ainda encontravam espaço
Companhia das Letras, 2009, p.504.) em setores da sociedade e a elite da Igreja
tentava se afirmar como o único acesso ao
Assinale a alternativa correta. sagrado.

a) A crítica à institucionalização da Igreja, com a consolidação d)O avanço do materialismo estava afastando
da hierarquia em torno do papa e dos bispos, teve sua da Igreja os camponeses, que, com isto,
principal manifestação na manutenção de práticas pagãs. deixavam de pagar os dízimos eclesiásticos.

b) As práticas pagãs eram costumes de origem popular


respeitados pelas ordens religiosas, como os beneditinos, 3) “Uma categoria inferior de servidores que
mas criticados pelos bispos e pelo clero tradicional. coexiste nas grandes casas com os
domésticos livres são os escravos. Um
c) A diversidade de práticas religiosas era frequente na Alta recenseamento enumera em Gênova, em
Idade Média, apesar dos esforços institucionais do alto clero 1458, mais de 2 mil. As mulheres estão em
católico em combater as crenças populares e defender a uma proporção esmagadora (97,5%) e 40%
unidade religiosa na Europa. não têm ainda 23 anos. São totalmente
desamparadas; todos na casa a repreendem,
d) A presença do cristianismo não significou o todos batem nela (patrão, mãe, filhos
desaparecimento de todas as práticas religiosas consideradas crescidos) e os testemunhos de processos em
pagãs, pois algumas delas foram toleradas pela Igreja, como que elas comparecem mostram-nas vivendo,
o sabá e as festas populares. frequentemente no temor de pancadas. Em
Gênova e Veneza, a escrava-criada é
essencial no prestígio das nobres e ricas
matronas.
2) Reproduz-se, abaixo, trecho de um sermão do bispo
(Adaptado de Charles De la Roncière, “A vida privada dos
Cesário de Arles (470-542), dirigido a uma paróquia rural. notáveis toscanos no limiar da Renascença”, em Georges
Duby (org.), História da vida privada - da Europa feudal à
“Vede, irmãos, como quem recorre à Igreja em sua doença Renascença, vol 2. São Paulo: Companhia das Letras,
obtém a saúde do corpo e a remissão dos pecados. Se é 1990, p. 235-236.)
possível, pois, encontrar este duplo benefício na Igreja, por
que há infelizes que se empenham em causar mal a si
mesmos, procurando os mais variados sortilégios: recorrendo Sobre o trabalho nas cidades italianas do
a encantadores, a feitiçarias em fontes e árvores, amuletos, período em questão, podemos afirmar
charlatães, videntes e adivinhos?” corretamente que:
(Fonte:http://www.institutosapientia.com.br/siteindex.phpoption=co_content&
view=article&id=1397:sao-cesario-de- arles-sermao-13-parauma- paroquia-
rural&catid=28: outros-artigos&Itemid=285.) a)O declínio da escravidão está ligado ao novo
conceito antropocêntrico do ser humano e a

99
uma nova dignidade da condição feminina no final da Idade
Média. d)A difusão de saberes multiculturais foi uma
das marcas do Império árabe-islâmico, sendo
ele a via de transmissão do sistema numérico
b) O trabalho servil era predominantemente feminino e indiano para o Ocidente e de obras da filosofia
concorria com o trabalho escravo. A escravidão diminuiu com greco-romana para o Oriente.
essa concorrência, desdobrando-se no trabalho livre.

c)Conviviam inúmeras formas de trabalho livre, semilivre e


escravo no universo europeu e a sobreposição não era, em si, 5) O surgimento das primeiras universidades,
contraditória. nos séculos XII e XIII, marca um momento
capital da história do Ocidente medieval. Em
d)O uso do castigo corporal igualava as escravas a outros
relação à época anterior, esse momento
trabalhadores e foi o motivo das rebeliões camponesas do
comportou elementos de continuidade e de
período (jacqueries) e agitações urbanas.
ruptura. Os primeiros devem ser buscados na
localização urbana das universidades, no
conteúdo dos ensinamentos, no papel social
4) Os estudiosos muçulmanos adaptaram a herança recebida dos homens de saber. Já os elementos de
dos povos arabizados. Entre os domínios conquistados pelos ruptura foram inicialmente de ordem
muçulmanos estavam a Mesopotâmia e o antigo Egito, institucional. No âmbito das instituições
civilizações que desde cedo observaram os fenômenos educativas, este sistema era novo e original.
astronômicos. O estudo dos fenômenos naturais no Crescente As comunidades autônomas dos mestres e
Fértil possibilitou a agricultura e perdurou por milênios. Nas dos estudantes eram protegidas pelas mais
costas do Mar Egeu, na região da Jônia, surgiram no século altas autoridades leigas e religiosas daquele
VI a.C. as primeiras explicações dos fenômenos naturais tempo, permitindo tanto progressos no
desvinculadas dos desígnios divinos. E as conquistas de domínio dos métodos intelectuais e em sua
Alexandre permitiram o início do intercâmbio entre o difusão como uma inserção mais eficiente das
conhecimento grego, de um lado, e o dos antigos impérios pessoas de saber na sociedade da época.
egípcio, babilônico e persa, de outro. Além disso, houve trocas
científicas e culturais com os indianos. O império árabe- (Adaptado de J. Verger, Cultura, ensino e sociedade no ocidente
islâmico foi, a partir do século VII, o herdeiro desse legado nos séculos XII e XIII. Bauru: EDUSC, 2001, p.189-190.)

científico multicultural, ao qual os estudiosos muçulmanos


deram seus aportes ao longo da Idade Média. Considerando o texto e seus conhecimentos
sobre o período medieval, assinale a
(Adaptado de Beatriz Bissio, O mundo falava árabe. Rio de Janeiro: Civilização Brasileira, alternativa correta.
2012, p. 200-201.)

a)A Igreja Católica apoiava a estruturação das


universidades medievais, que representavam
Considerando o texto acima sobre o Islã Medieval e seus o avanço das ciências e a superação de
conhecimentos, assinale a alternativa correta. dogmas e das teorias teocêntricas.
b)A organização institucional diferencia as
a)A extensão do território sob domínio islâmico e a liberdade universidades medievais das corporações de
religiosa e cultural implementada nessas áreas aceleraram a ofícios, visto que seu método de estudo estava
construção de novos conhecimentos pautados na cosmologia calcado na escolástica, caracterizando o
ocidental. atraso do mundo medieval.

b)A partir do século VII, o avanço dos exércitos islâmicos c)Uma ruptura trazida pelas universidades
garantiu a expansão do império de forma ditatorial sobre medievais foi o início da atuação dos copistas
antigos núcleos culturais da Índia até as terras gregas do nas bibliotecas, que copiavam
Império Bizantino, chegando à Espanha. sistematicamente a produção de autores
latinos críticos aos dogmas religiosos.
c)Os conhecimentos sobre os fenômenos naturais construídos
pelos mesopotâmicos, egípcios, macedônicos, babilônicos, d)A institucionalização das universidades
persas, entre outros povos, foram ignorados pelo Islã medievais era um dado novo no período;
Medieval, marcado pelo fundamentalismo religioso.

100
essas instituições se caracterizavam pelo apoio das
autoridades de dentro e de fora da Igreja, e pela maior
autonomia e inserção social de seus membros.

PERÍODO COLONIAL

1) Engenheiros, naturalistas, matemáticos e artistas, sob o


mecenato de Nassau, investigaram a natureza e
transformaram a paisagem nordestina. Recife tornou-seuma
a) Trata-se de uma obra baseada em um
das cidades mais importantes da América, com modernas
quadro do gênero da pintura histórica, sendo
pontes e prédios. Além do incentivo à arte, o governo [de
que no trabalho de Pedro Américo o corpo de
Nassau] promulgou leis que eram iguais para todos,
Tiradentes no patíbulo afasta-se da figura do
impedindo injustiças contra os antigos habitantes.
Cristo, exemplo maior de mártir.
(Ronald Raminelli, Invasões Holandesa”, em Ronaldo Vainfas (dir.), Dicionário
do Brasil Colonial. Rio de Janeiro: Objetiva, 2001, p. 315.) b) Utilizando-se das mesmas formas do corpo
esquartejado de Tiradentes pintado por Pedro
As transformações durante o governo de Maurício de Nassau Américo, o autor limita o número de sujeitos
(1637-1645), em Pernambuco, são exemplos de um contexto esquartejados e acentua o tom conservador
em que da aquarela.

a) o mecenato e a aplicação de leis idênticas para holandeses c) A imagem fala sobre seu contexto de
e luso-brasileiros eram uma continuidade do modelo produção na atualidade, utilizando-se do
renascentista, representando um período de modernização da simbolismo de Tiradentes, e procura ampliar a
região. presença de negros como sujeitos sociais nas
lutas coloniais e antiescravistas.
b) houve dinamização da economia açucareira na região, com
a reativação de engenhos e perdão de dívidas dos antigos d) Tiradentes consolidou-se como um mártir
proprietários, impulsionando a remodelação da cidade de nacional no quadro de Pedro Américo, daí a
Recife. necessidade do pintor de retratar seu corpo
esquartejado. A obra de João Teófilo mostra
c) houve a aplicação de princípios mercantilistas para a que os mártires, embora negros, são um tema
obtenção de lucros e a perseguição, por parte dos holandeses do passado.
calvinistas, a judeus, cristãos-novos e católicos.

d) as expedições dos artistas e cientistas tinham o propósito


de retratar a paisagem e identificar potencialidades 3) O documento abaixo foi redigido pelo
econômicas da região, pois o açúcar estava em declínio no governador de Pernambuco, Caetano de Melo
comércio internacional. e Castro, em 18 de agosto de 1694, para
comunicar ao Rei de Portugal a tomada da
Serra da Barriga.
2) A aquarela do artista João Teófilo, aqui reproduzida, dialoga
“ (...) Não me parece dilatar a Vossa
com a pintura de Pedro Américo, “Tiradentes esquartejado” Majestade da gloriosa restauração dos
(1893). Sobre a obra de João Teófilo, publicada na capa de
Palmares, cuja feliz vitória senão avalia por
uma revista em 2015, é possível afirmar que:
menos que a expulsão dos holandeses, e
assim foi festejada por todos estes povos com
seis dias de luminárias. (...) Os negros se
achando de modo poderosos que esperavam
o nosso exército metidos na serra (....), fiando-

101
se na aspereza do sítio, na multidão dos defensores. (...)
Temeu-se muito a ruína destas Capitanias quando à vista de A partir da leitura do texto e de seus
tamanho exército e repetidos socorros como haviam ido para conhecimentos sobre História do Brasil
aquela campanha deixassem de ser vencidos aqueles Colônia, assinale a alternativa correta.
rebeldes pois imbativelmente se lhes unir-se os escravos
todos destes moradores (....)”. a)A principal diferença entre as lavouras
(Décio Freitas, República de Palmares – pesquisa e comentários em documentos
indígenas e a agricultura comercial colonial
históricos do século XVII. Maceió: UFAL, 2004, p. 129.) estava no uso de queimadas pelos europeus,
o que não era praticado pelas populações
Sobre o documento acima e seus significados atuais, é correto
autóctones.
afirmar que

a) foi escrito por uma autoridade da Coroa na colônia e tem b) Comparadas à mandioca cultivada pelos
como principal conteúdo a comemoração da morte de Zumbi indígenas, as novas espécies de mandioca
dos Palmares. A data de 20 de novembro, como referência ao trazidas da Europa eram menos resistentes às
líder do quilombo, tem uma conotação simbólica para a formigas cortadeiras, e por isso mais
população negra em contraponto à visão oficial do 13 de maio susceptíveis à infestação.
de 1888.
c)Os colonizadores introduziram no território
b)o feito da tomada de Palmares, em 1694, pelos exércitos da
colonial novas espécies de mandioca e milho,
Coroa, é entendido como menos glorioso quando comparado
que desequilibraram o sistema agrícola
à expulsão dos holandeses de Pernambuco, em 1654. Os dois
ameríndio, baseado no sistema rotativo de
eventos históricos não têm o mesmo apelo para a formação
plantação.
da sociedade brasileira na atualidade.

c)o texto de Caetano de Melo e Castro indica que Palmares d)A agricultura comercial tendia à
não gerou temor às estruturas coloniais da Capitania de homogeneização da flora nas lavouras da
Pernambuco. A comemoração oficial do Dia da Consciência América Portuguesa, combinando tradições
Negra é uma invenção política do período recente. europeias de plantio com práticas indígenas.

d) o Quilombo de Palmares representou uma ameaça aos


poderes coloniais, já que muitos eram os rebeldes que se
organizavam ou se aliavam ao quilombo. A data é celebrada,
5) A seguir, leia um trecho da petição ao rei de
na atualidade, como símbolo da resistência pelos movimentos
Espanha escrita por Juan Garrido,
negros.
conquistador residente na cidade do México,
em 27 de Setembro de 1538.

4) As plantações de mandioca encontradas pelas saúvas Eu, Juan Garrido, de cor negra, membro desta
cortadeiras nas roças indígenas eram apenas uma entre comunidade [vecino], e residente nesta cidade,
várias outras. Em muitas situações, a composição química trago um relato de como servi à Vossa
das folhas favorecia a escolha de outras plantas e afolhagem Majestade na conquista e pacificação desta
da mandioca era cortada apenas quando as preferidas das Nova Espanha. Desde quando Cortés entrou
saúvas não eram suficientes. Já na agricultura comercial, nela, estive presente em todas as invasões,
machados e foices de ferro permitiam abrir clareiras em uma conquistas e pacificações realizadas no sul do
escala maior, resultando em grande homogeneidade da flora. Pacífico, nas ilhas de Porto Rico e de Cuba.
Nas lavouras de mandioca de finais do século XVII e do início Fiz tudo às minhas custas, sem receber nem
do século XVIII, as folhas da mandioca tornavam-se uma das salário nem repartimiento de índios ou
poucas opções das formigas. Depois de mais algumas qualquer outra coisa. De todas estas formas,
colheitas, a infestação das formigas tornava-se insuportável, durante trinta anos, servi e continuo a servir à
por vezes causando o completo despovoamento humano da Vossa Majestade.
área.
(Traduzido e adaptado de Matthew Restall, Probanza of Juan
Garrido. Black Conquistadors: Armed aAfricans in Early Spanish
America. The Americas, Cambridge, v. 57, n. 2, out. 2000, p. 171.)
(Adaptado de Diogo Cabral, 'O Brasil é um grande formigueiro’: território, ecologia e a
história ambiental da América Portuguesa – parte 2. HALAC - História Ambiental
Latinoamericana y Caribeña. Belo Horizonte, v. IV, n. 1, p. 87-113, set. 2014-fev. 2015.) Assinale a alternativa correta.

102
função da interferência da Coroa, que
a)À presença de negros nos processos de conquista e defendia o uso da língua portuguesa.
colonização das Américas limitou-se à atuação como mão de
obra escravizada em plantações, em serviços domésticos ou
como trabalhadores sem especialização em núcleos urbanos. 7) O que é então o verossímil? Para encurtar:
tudo aquilo em que a confiança é presumida.
b)A presença de afrodescendentes na América espanhola Por exemplo, os juízes nem sempre são
pode ser distribuída nas categorias: escravos, fugitivos ou independentes, os médicos nem sempre
forros, em meio rural e urbano, auxiliares nos processos de capazes, os oradores nem sempre sinceros.
conquista e ainda como conquistadores, proprietários e Mas presumese que o sejam; e, se alguém
vecinos. afirmar o contrário, cabe-lhe o ônus da prova.
Sem esse tipo de presunção, a vida seria
c)À presença de negros nos exércitos de Cortez é um exemplo impossível; e é a própria vida que rejeita o
da ausência de critérios discriminatórios de limpeza de sangue ceticismo.”
no processo de conquista da América espanhola, (Olivier Reboul, Introdução à retórica. São Paulo: Martins Fontes,
1998, p. 97-98.)
diferentemente do que ocorria nas Américas portuguesa e
inglesa.
Considerando o segundo “Sermão da Quarta-
feira de Cinza” (1673), de Antonio Vieira, é
d)A presença de afrodescendentes no mundo espanhol foi
correto afirmar que a presunção de confiança
tardia e concentrou-se no espaço caribenho, onde atuaram
por parte do auditório cristão do século XVII
como parte da mão de obra escravizada, mas também
decorre da
atuaram como conquistadores e vecinos cidadãos.
a)habilidade política do pregador.
b)atenção disciplinada dos ouvintes.
6) Entre os séculos XVII e XVIII, o nheengatu se tornou a
c)crença na salvação e na danação eternas.
língua de comunicação interétnica falada por diversos povos
d)defesa institucional da Igreja Católica feita
da Amazônia. Em 1722, a Coroa exortou os carmelitas e os
pelo clero.
franciscanos a capacitarem seus missionários a falarem esta
língua geral amazônica tão fluentemente como os jesuítas, já
que em 1689 havia determinado seu ensino aos filhos de
8) Na América Portuguesa do século XVI, a
colonos.
política europeia para os indígenas
pressupunha também a existência de uma
(Adaptado de José Bessa Freire, Da “fala boa” ao português na Amazônia brasileira.
Ameríndia, Paris, n. 8, 1983, p.25.) política indígena frente aos europeus, já que
os Tamoios e os Tupiniquins tinham seus
Com base na passagem acima, assinale a alternativa correta. próprios motivos para se aliarem aos
franceses ou aos portugueses.
a)Os jesuítas criaram um dicionário baseado em línguas
indígenas entre os séculos XVI e XIX, que foi amplamente (Adaptado de Manuela Carneiro da Cunha, Introdução a uma
usado na correspondência e na administração colonial nos história indígena. São Paulo: Companhia das Letras/Fapesp, 1992,
p. 18.)
dois lados do Atlântico.

b)O texto permite compreender a necessidade de o Com base no excerto e nos seus
colonizador português conhecer e dominar a língua para conhecimentos sobre os primeiros contatos
poder disciplinar os índios em toda a Amazônia durante o entre europeus e indígenas no Brasil, assinale
período pombalino e no século XIX. a alternativa correta.

c)O aprendizado dessa língua associava-se aos projetos de a)A população ameríndia era heterogênea e
colonização, visando ao controle da mão de obra indígena os conflitos entre diferentes grupos étnicos
pelos agentes coloniais, como missionários, colonos e ajudaram a definir, de acordo com suas
autoridades. próprias lógicas e interesses, a dinâmica dos
seus contatos com os europeus.
d)A experiência do nheengatu desapareceu no processo de
exploração da mão de obra indígena na Amazônia e em

103
b)O fato de Tamoios e Tupiniquins serem grupos aliados 2) O escritor José de Alencar relata como
contribuiu para neutralizar as disputas entre franceses e ocorriam as reuniões do Clube da Maioridade,
portugueses pelo controle do Brasil, pelo papel mediador que realizadas na casa de seu pai em 1840.
os nativos exerciam. Discutia-se nessas ocasiões a antecipação da
maioridade do imperador D. Pedro II, então
c)Os indígenas, agentes de sua história, desde cedo com apenas 14 anos, para que ele pudesse
souberam explorar as rivalidades entre os europeus e mantê- assumir o trono antes do tempo determinado
los afastados dos seus conflitos interétnicos, anulando o pela Constituição. No fim da vida, José de
impacto da presença portuguesa. Alencar rememora os episódios de sua
infância e chega a uma surpreendente
d)As etnias indígenas viviam em harmonia umas com as conclusão: os políticos que frequentavam sua
outras e em equilíbrio com a natureza. Esse quadro foi casa na ocasião iam lá não porque estavam
alterado com a chegada dos europeus, que passaram a pensando no futuro do país, mas apenas para
incentivar os conflitos interétnicos para estabelecer o domínio devorar tabletes e bombons de chocolate.
colonial. Conforme o relato do escritor, os membros do
Clube da Maioridade, discutindo altos
assuntos na sala de sua casa, pareciam
realmente gente séria e preocupada com os
BRASIL IMPÉRIO destinos do Brasil, até que chegava a hora do
chocolate. Para Alencar, a discussão política
no Brasil se resumia a um “devorar de
1) Um elemento importante nos anos de 1820 e 1830 foi o
chocolate”, isto é, cada um defendia apenas
desejo de autonomia literária, tornado mais vivo depois da
seus interesses particulares e nada mais.
Independência. (…) O Romantismo apareceu aos poucos
como caminho favorável à expressão própria da nação recém- (Adaptado de Daniel Pinha Silva, “O império do chocolate”, em
http://www.revistadehistoria.com.br/secao/leituras/o-imperio-do-
fundada, pois fornecia concepções e modelos que permitiam chocolate. Acessado em 01/08/2016.)
afirmar o particularismo, e portanto a identidade, em oposição
à Metrópole (…). Sobre o Golpe da Maioridade e a visão de
José de Alencar a esse respeito, é correto
(Antonio Candido, O Romantismo no Brasil. São Paulo: afirmar que:
Humanitas, 2004, p. 19.) a)O golpe foi uma manobra das elites políticas,
que criaram uma forma de alterar a
Tendo em vista o movimento literário mencionado no trecho Constituição e contemplar os seus interesses
acima, e seu alcance na história do período, é correto afirmar durante o período regencial, fato criticado por
que Alencar ao fazer uma anedota com o
chocolate.
a) o nacionalismo foi impulsionado na literatura com a vinda
da família real, em 1808, quando houve a introdução da b) Ao entregar o poder a um jovem de 14 anos,
imprensa no Rio de Janeiro e os primeiros livros circularam no alegando ser maior de 18, os políticos do
país. Império manifestavam uma ousada visão
política para evitar a influência da Inglaterra
b) o indianismo ocupou um lugar de destaque na afirmação nos assuntos brasileiros, preservando seus
das identidades locais, expressando um viés decadentista e interesses como donos de escravos.
cético quanto à civilização nos trópicos. c)O golpe foi uma resposta dos conservadores
às propostas liberais que pretendiam
c) os autores românticos foram importantes no período por estabelecer a República no país, e Alencar
produzirem uma literatura que expressava aspectos da apontou uma prática política dos
natureza, da história e das sociedades locais. parlamentares que é recorrente na história do
país.
d) a população nativa foi considerada a mais original dentro
do Romantismo e, graças à atuação dos literatos, os d)José de Alencar expressou sua decepção
indígenas passaram a ter direitos políticos que eram vetados com os políticos e, ao registrar sua visão sobre
aos negros. o Clube da Maioridade, o escritor contribuiu
para inibir procedimentos semelhantes

104
durante o Império, assegurando uma transição pacífica e legal
para a República, em 1889.

3) O pastor norte-americano Pat Robertson, dono do canal de


comunicação Christian Broadcasting Network, afirmou que a
tragédia provocada pelo terremoto no Haiti, em janeiro de
2010, foi decorrente do “pacto com o diabo” que setores da
população haitiana teriam feito para que o país se tornasse
independente. Nas palavras do Pastor, "Os haitianos estavam
sob o jugo da França. Eles se uniram e fizeram um pacto com
o diabo. Disseram: 'Serviremos a ti caso nos liberte da
França'".
(Adaptado de Haroldo Ceravolo Sereza, “Pastor americano atribui terremoto a 'pacto com
o Diabo' e provoca protestos; país se libertou da França em 1804”. Uol notícias.
14/01/2010. Disponível em https://noticias.uol.com.br/ especiais/terremoto-
haiti/ultnot/2010/01/14/ult9967u9.jhtm. Acessado em 30/08/2017.) a)A única monarquia americana precisou
afirmar a figura do governante e sua memória
A partir da leitura do texto e de seus conhecimentos, assinale política, recorrendo à imagética da autoridade
a alternativa correta. real francesa do Antigo Regime. Este
mecanismo foi enaltecido pela imprensa do
a) A independência do Haiti foi decisiva para que o Império liberalismo constitucional.
Brasileiro, que projetava a construção de um Estado Nação
reconhecido internacionalmente, reprimisse movimentos b)Debret usou o quadro de Rigaud como
como a Revolta Malês, em Salvador (1835). referência visual e preparou retratos em seu
estúdio no Rio de Janeiro. Isto era importante,
b) A declaração do Pastor é pautada em preconceitos em pois a autoridade monárquica joanina
relação às práticas religiosas dos afrodescendentes no Haiti. assentou-se na liturgia política e no pouco uso
A conquista espiritual, parte dos projetos imperialistas, da violência.
garantiu a eliminação de religiões consideradas pagãs nas
Américas. c)O retrato de D. João não foi pintado para ser
exposto, embora existisse no Rio de Janeiro
c) Colônia francesa nas Antilhas, Saint Domingue tornou-se da época um circuito expositivo de salões de
responsável por 40% da produção mundial de cacau no século belas artes, pinacotecas, museus, onde
XVIII. A mão de obra empregada era majoritariamente escrava, pudesse ser visto. Tais espaços foram
com a exploração de africanos ou de seus descendentes. renomeados na República.

d)O processo de independência do Haiti foi apoiado por outras d)O projeto de europeização da corte do Rio
colônias, interrompendo o projeto imperialista europeu no de Janeiro e a necessidade de afirmar a
Novo Mundo. Após 1804, os EUA conduzem as ações autoridade de D. João VI levaram a uma
imperialistas na América, tornando-se a principal referência política de fomento à imagética do poder
cultural no continente. baseada, aqui, na da monarquia francesa.

4) A partir das fontes visuais reproduzidas e de seus 5) Os números indicam que antes da abolição
conhecimentos, assinale a alternativa correta. de 1888 restavam pouco mais de setecentos
mil escravos no Brasil. Conforme estimativa
do censo de 1872, elaborada pelo IBGE, a
população total do país era de 9.930.478
habitantes. Isso indica que grande parte da
população de cor (pretos e pardos) já havia

105
adquirido a liberdade por seus próprios meios antes da Lei b) a presença de soldados africanos nos
Áurea. conflitos contribuiu para o questionamento do
mito da superioridade do homem branco.
(Adaptado de Wlamyra Albuquerque, A vala comum da ‘raça emancipada’: abolição e
racialização no Brasil, breve comentário. História Social, Campinas, n. 19, p. 99, 2010.)
c) o autor, ao apresentar a fragilidade do
homem branco, instaurou um discurso inverso
Com base no excerto e nos conhecimentos sobre a história
de superioridade dos africanos.
da liberdade no Brasil, assinale a alternativa correta.

d) o autor, ao apresentar o norte da África


a)A maioria da população negra já era liberta antes de 1888,
como parte da França, exaltou o projeto
porque as províncias escravistas do Sudeste, almejando
imperialista francês e suas estratégias de
abrirem-se para a imigração italiana, vinham adotando
integração cultural.
medidas abolicionistas desde o fim do tráfico, em 1850.

b)Em termos globais, o grande percentual da população livre


de cor reflete o peso demográfico da população liberta
2) Era o dia 6 de agosto de 1945. O avião B-
concentrada nas províncias pouco dependentes da
29, Enola Gay, comandado pelo coronel Paul
escravidão, como Santa Catarina e Paraná.
Tibbets, sobrevoou Hiroshima a 9.448 metros
de altitude e, quando osponteiros do relógio
c)A maioria da população africana e seus descendentes já era
indicaram 8h16, bombardeou-a com uma
livre quando a Lei Áurea foi aprovada, porque vinha obtendo
bomba de fissão nuclear de urânio, com 3 m
alforrias através de uma multiplicidade de estratégias, desde
de comprimento e 71,1 centímetros de
o período colonial.
diâmetro e 4,4 toneladas de peso. A bomba foi
detonada a 576 metros do solo. Um colossal
d)O alto número de libertos antes de 1888 reflete o impacto da
cogumelo de fumaça envolveu a região.
abolição dos escravos por parte do Imperador D. Pedro II, pois
Corpos carbonizados jaziam por toda parte.
a família real era a maior proprietária de cativos durante o
Atônitos, sobreviventes vagavam pelos
século XIX, na região do Vale do Paraíba.
escombros à procura de comida, água e
abrigo. Seus corpos estavam dilacerados,
queimados, mutilados. Cerca de 40 minutos
GUERRAS MUNDIAIS E REGIMES após a explosão, caiu uma chuva radioativa.
TOTALITÁRIOS Muitos se banharam e beberam dessa água.
Seus destinos foram selados.
(Adaptado de Sidnei J. Munhoz,“O pior dos fins”. Revista de
1) O relato a seguir é parte da biografia de um homem que História da Biblioteca Nacional,maio 2015)
passou sua infância no atual Mali.
A explosão da bomba mencionada no texto
Em novembro de 1918, a África, como a metrópole, festejou
o fim da Grande Guerra Mundial e a vitória da França e seus a)ocorre a partir da desintegração espontânea
aliados (…). Estávamos orgulhosos do papel desempenhado do núcleo de urânio enriquecido em núcleos
pelos soldados africanos na frente de batalha. (…) Os mais leves, liberando uma enorme quantidade
sobreviventes que voltaram em 1918-1919 foram a causa de de energia. Esse bombardeio significou o
um novo fenômeno social que influiu na evolução da início da corrida armamentista entre EUA e
mentalidade nativa. Estou falando do fim do mito do homem União Soviética
branco como ser invencível e sem defeitos.
.b)ocorre devido à desintegração do núcleo de
(Amadou Hampâté Bâ, Amkoullel, o menino fula. São Paulo: Palas urânio em núcleos mais leves, a partir do
Athena/Casa das Áfricas, 2003, p. 312-313.) bombardeamento com nêutrons, liberando
uma enorme quantidade de energia.Esse
Considerando o relato acima, é correto afirmar que ataque é considerado um símbolo do final da
II Guerra Mundial.
a)a presença dos soldados africanos contribuiu para construir
uma identidade africana sustentada nos princípios bélicos do c)ocorre a partir da combinação de núcleos de
imperialismo europeu. urânio enriquecido com nêutrons, formando

106
núcleos mais pesados e liberando uma enorme quantidade de b)promovida pela aceitação social que
energia. Esse bombardeio foi uma resposta aos ataques do banaliza a democracia em favor do
Japão a Pearl Harbor. capitalismo global.

d)ocorre devido à desintegração do núcleo de urânio em c)dificultada por processos eleitorais que
núcleos mais leves, a partir do bombardeamento com renovam a democracia, inviabilizando os
nêutrons, liberando uma enorme quantidade de energia. Esse fascismos.
ataque causou perplexidade por ser desferido contra um país
que havia permanecido neutro na II Guerra Mundial. d)possibilitada pela aceitação social de
sociedades politicamente fascistas e
socialmente democráticas.
3) “Hitler considerava que a propaganda sempre deveria ser
popular, dirigida às massas, desenvolvida de modo a levar em
conta um nível de compreensão dos mais baixos. (...) O
essencial da propaganda era atingir o coração das grandes 5)
massas, compreender seu mundo maniqueísta, representar
seus sentimentos.”

(Alcir Lenharo, Nazismo: o triunfo da vontade. São Paulo: Ática,1986, p. 47- 48.)

Sobre a propaganda no nazismo, é correto afirmar:

a)o nível elementar da propaganda era contraposto às óperas


e desfiles suntuosos que o regime nazista promovia.

b)a propaganda deveria restringir-se a poucos pontos, como o


enaltecimento da superioridade racial e a defesa da
democracia.

c) a propaganda deveria estimular o ódio das massas contra


grupos específicos, como os judeus, negros, homossexuais e
ciganos.
*si - significa “sim” em italiano.
d) o cinema e a produção artística foram as áreas que
resistiram ao sistema de propaganda do nazismo na Bella Ciao
Alemanha do final da década de 1930.
Querida, adeus

4) Como regime social, o fascismo social pode coexistir com a Esta manhã, eu acordei
democracia política liberal. Em vez de sacrificar a democracia Querida, adeus! Querida, adeus! Querida,
às exigências do capitalismo global, trivializa a democracia até adeus, adeus,
o ponto de não ser necessário sacrificá-la para promover o adeus!
capitalismo. Trata-se, pois, de um fascismo pluralista e, por
isso, de uma forma de fascismo que nunca existiu. Podemos Esta manhã, eu acordei
estar entrando num período em que as sociedades são E encontrei um invasor
politicamente democráticas e socialmente fascistas.
Oh, membro da Resistência, leve-me embora
(Adaptado de Boaventura de Sousa Santos, Epistemologias do Sul. São Paulo: Cortez,
2010, p. 47.) Querida, adeus! Querida, adeus! Querida,
adeus, adeus,
De acordo com o texto e os conhecimentos sobre o assunto, adeus!
a coexistência entre fascismo e democracia é
Oh, membro da Resistência, leve-me embora
a)facilitada por processos eleitorais que dão continuidade a Porque sinto que vou morrer
fascismos que sempre existiram.

107
E se eu morrer como um membro da Resistência DITADURA MILITAR
Querida, adeus! Querida, adeus! Querida, adeus, adeus, 1) O historiador Daniel Aarão Reis tem
adeus! defendido que o regime instaurado em 1964
não seja conhecido apenas como “ditadura
E se eu morrer como um membro da Resistência militar”, mas como “ditadura civil-militar”, pois
Você deve me enterrar contou com a participação civil.
E me enterre no alto da montanha Para exemplificar o envolvimento civil, é
Querida, adeus! Querida, adeus! Querida, adeus, adeus, possível citar
adeus! a)manifestações populares como a “passeata
E me enterre no alto da montanha dos 100 mil”, a campanha pela anistia e as
Sob a sombra de uma bela flor. (...). “Marchas da família com Deus e pela
liberdade”.
A fotografia anterior registra a fachada do Partido Nacional
Fascista de Benito Mussolini em 1934. A música Bella Ciao foi b) a atuação homogênea do clero brasileiro e
um hino cantado contra o fascismo de Mussolini e as tropas da Associação Brasileira de Imprensa (ABI),
nazistas durante a Segunda Guerra Mundial. Em 25 de abril que temiam a instauração do comunismo no
de 2018, quando a Itália celebrou 73 anos de sua libertação país.
do nazifascismo, a canção foi entoada em várias partes do
país. c)a participação da população nas eleições
parlamentares, legitimando as decisões
Sobre os usos da imagem e da música, assinale a alternativa políticas por meio de referendos.
correta.
d)o apoio de empresários, grupos midiáticos,
a)Através de vários mecanismos de propaganda ideológica e políticos civis e classes médias urbanas que
coerção física, os italianos foram forçados a entoar a música davam sustentação aos militares.
Bella Ciao, a fim de demonstrar publicamente sua adesão ao
fascismo. Este caráter umbilical da relação da massa com o
líder aparece retratado na fotografia 2) “O tropicalismo buscava revolucionar a
linguagem e o comportamento na vida
b)Por se tratar de um produto da indústria cultural com forte cotidiana, incorporando-se simultaneamente à
apelo comercial, compreende-se a circulação e o consumo sociedade de massa e aos mecanismos do
desta música em plano global e em várias mídias (shows mercado de produção cultural. Criticava ao
musicais, novelas e séries). Neste sentido, a imagem é um mesmo tempo a ditadura e uma estética de
cartaz caracterizado pela neutralidade política. esquerda acusada de menosprezar a forma
artística. Articulava aspectos modernos e
c)Trata-se de uma música de alcance internacional entoada arcaicos, buscava retomar criticamente a
em várias partes do mundo, em diferentes contextos de tradição brasileira e absorver influências
resistência política contra o fascismo, regime caracterizado estrangeiras de modo ‘antropofágico’.”
pela adesão da massa em relação ao seu líder, como explicita
(Marcelo Ridenti, “Cultura”, em Daniel Aarão Reis (org.),
a fotografia. Modernização, ditadura e democracia: 1964-2010. Rio de Janeiro:
Objetiva, 2014, p. 256.)
d)O gesto que recupera em 2018 esta canção sugere uma
O tropicalismo, no contexto cultural brasileiro
semelhança entre o tempo de antes (do fascismo) e o de hoje,
dos anos 1960 e 1970,
aproximando Silvio Berlusconi de Mussolini, dirigente
retratado na fotografia. Antes, como agora, Bella Ciao exalta a) foi influenciado pelo manifesto
a resistência, identificando-se como uma canção nacionalista. antropofágico e propunha digerir aspectos da
cultura mundial – como a guitarra elétrica e a
televisão – para difundir o ideal de uma
sociedade alinhada com os interesses da
modernização econômica da ditadura.

b)era um movimento que criticava a ditadura,


associada à Jovem Guarda, e a esquerda,

108
identificada com a Bossa Nova, propondo uma leitura sensualidade no Cinema para atender a um
imparcial para a cultura, como se observa na música popular crescente mercado de consumo.
e na dramaturgia do Teatro Oficina.

c) criticava o Cinema Novo e a glamorização da “estética da (Adaptado de Ildembergue Leite de Souza e André Luiz Maranhão
de Souza Leão, A transposição de mitos na intertextualidade entre
fome”, preferindo abrir-se para os movimentos internacionais, Cinema e Publicidade. Intercom, Revista Brasileira de Ciências da
como fizeram o modernismo em relação ao futurismo e a Comunicação, São Paulo, v. 37, n. 2, p. 242-262, dez. 2014.)

vanguarda do grupo do Teatro Opinião.


Sobre a vida cultural no Brasil das décadas de
d)usava referências eruditas e populares, incorporava 1960 e 1970, é correto afirmar que:
aspectos da música pop mesclada a aspectos regionais e
expressava críticas à ditadura e ao patrulhamento praticado a)O período ficou marcado pelo esvaziamento
por alguns fãs das canções de protesto. da cena cultural, com baixo dinamismo nos
campos da produção teatral, musical e
cinematográfica. Apenas os gêneros ligados
3) “Como na Argentina: Os corpos brotam do chão, como na ao erotismo se expandiram, por não serem
Argentina. Corpo não é reciclável. Corpo não é reduzível. Dá considerados transgressores.
para dissolver os corpos em ácido, mas não haveria ácido que
chegasse para os assassinados do século. Valas mais fundas, b)A pornochanchada foi financiada pelo
mais escombros, nada adianta. Sempre sobra um dedo capital estrangeiro no Brasil durante o regime
acusando. O corpo é como o nosso passado, não existe mais militar, pois a indústria cinematográfica, em
e não vai embora. Tentaram largar o corpo no meio do mar e razão dos seus altos custos, passou a ser
não deu certo. O corpo boia. O corpo volta. Tentaram forjar o fomentada sobretudo por empresas norte-
protocolo – foi suicídio, estava fugindo – e o corpo desmentia americanas.
tudo. O corpo incomoda. O corpo faz muito silêncio.
Consciência não é biodegradável. Memórias não apodrecem. c)O gênero pornochanchada pode ser
Ficam os dentes.” considerado um movimento de contracultura
por seu caráter de contestação política,
(Luís Fernando Veríssimo, “Como na Argentina”, em A mãe do Freud. Porto Alegre: através da linguagem chula, e por suas
L&PM Editores, 1985, p. 46.)
estreitas conexões com produtores culturais
ligados à Tropicália.
O texto se refere

d)A explosão dos filmes do ciclo da


a) ao trauma coletivo das políticas repressivas e crimes de
pornochanchada e seu sucesso de público
Estado praticados pelos regimes ditatoriais latino-americanos.
ocorreram em um contexto marcado, de um
lado, pela revolução sexual, e, de outro, pela
b) à memória dos exilados fugidos dos regimes ditatoriais
censura ao conteúdo veiculado no cinema e
latino-americanos da segunda metade do século XX.
na TV.
c) ao movimento dos Montoneros, em busca de seus filhos e
netos desaparecidos no período da ditadura na Argentina.

d) aos julgamentos em andamento contra o clientelismo do


regime peronista praticada na Argentina.

4) A partir da segunda metade da década de 1960, a produção


de um gênero cinematográfico extravagante ganha força no
Brasil: a pornochanchada. Num primeiro momento esta se
mostrou como uma comédia leve, apesar de algumas cenas
de nudez parcial, mas logo evoluiu para o que já era praticado
pelo resto do mundo: a exploração do erotismo e da

109
ERA VARGAS b)As massas, em suas expectativas, alinham-
se às camadas médias, que são ressentidas
por não se tornarem classes dominantes.
1) É correto afirmar que a obra acima reproduzida Surgem, nesse processo, líderes vindos das
camadas médias que manipulam as massas,
destituídas de vontade política.

c)Ocorre uma associação entre as massas


urbanas e o dirigente político carismático que
exerce o papel de liderança. É um fenômeno
de participação política das classes populares
urbanas pouco atingidas pelo
desenvolvimento industrial e pelas migrações.

d) O termo é muito usado para nomear um


fenômeno político comum na América Latina
entre as décadas de 1930 e 1960, sendo
associado aos processos de industrialização,
urbanização e à emergência de líderes
carismáticos.

a) faz menção RENASCIMENTO CULTURAL


a dois aspectos importantes da economia brasileira: a mão de
obra negra na agricultura e o café como produto de exportação.
1) A teoria da perspectiva, iniciada com o
b) expressa a visão política do artista, ao figurar um corpo arquiteto Filippo Bruneleschi (1377-1446),
numa proporcionalidade clássica como forma de enaltecer a utilizou conhecimentos geométricos e
mão de obra negra na economia brasileira. matemáticos na representação artística
c) exalta o homem colonial e as riquezas da terra, produzida na época. A figura a seguir ilustra o
considerando-se que o país possui uma economia agrícola estudo da perspectiva em uma obra desse
diversificada desde aquele período. arquiteto. É correto afirmar que, a partir do
Renascimento, a teoria da perspectiva
d) apresenta uma crítica à destruição da natureza, como se
observa na derrubada de árvores, e uma crítica à manutenção
do trabalho escravo em regiões remotas do país.

2) Muitos intelectuais, boa parte da imprensa e dos meios de


comunicação, e a sociedade em geral usam o termo
populismo para caracterizar uma prática política
contemporânea que relaciona as massas e o governante.

Sobre o populismo, é correto afirmar que:

a) A figura do líder é fundamental no populismo, a exemplo de a) foi aplicada nas artes e na arquitetura, com
Getúlio Vargas e Jânio Quadros, sendo muito forte no Brasil o uso de proporções harmônicas, o que
entre 1930 e 1964. Tal prática requer carisma do líder, a fim privilegiou o domínio técnico e restringiu a
de diminuir a participação das massas e impedir o nacional capacidade criativa dos artistas.
desenvolvimentismo.

110
b) evidencia, em sua aplicação nas artes e na arquitetura, que
as regras geométricas e de proporcionalidade auxiliam a c)Na linhagem dos artistas-arquitetos-
percepção tridimensional e podem ser ensinadas, aprendidas engenheiros renascentistas, Leonardo da
e difundidas. Vinci dedicou-se ao estudo da perspectiva e
c) fez com que a matemática fosse considerada uma arte em especialmente da aritmética, buscando
que apenas pessoas excepcionais poderiam usar geometria e harmonizar as relações entre o homem e Deus
proporções em seus ofícios. no Homem Vitruviano.

d) separou arte e ciência, tornando a matemática uma d)Leitor assíduo da física newtoniana,
ferramenta apenas instrumental, porque essa teoria não Leonardo da Vinci reconhecia que tanto a
reconhece as proporções humanas como base de medida aritmética quanto a geometria poderiam ser
universal. usadas na arte, arquitetura e engenharia. Na
elaboração do desenho do Homem Vitruviano,
ele comprovou esta hipótese.

2) Leia o texto a seguir e observe a figura do Homem


Vitruviano.
3) Em 1516, Thomas Morus criou a ideia de
Ao longo da vida, cada vez mais, Leonardo da Vinci passou a utopia, ao descrever uma ilha imaginária.
perceber que a matemática era a chave para transformar suas Surgia um gênero literário, associado à
observações em teorias. Não existe certeza na ciência em que história, à filosofia e à política. A lógica dessa
a matemática não possa ser aplicada, declarou. ideia levou à construção de critérios
universalmente válidos para cada atividade,
(Adaptado de Walter Isaacson, Leonardo da Vinci. Rio de Janeiro: Intrínseca, 2017, p.
52.) com normas e códigos. Surgiram assim os
tratados sobre o perfeito cortesão, sobre o
perfeito homem do mundo, sobre a cidade
perfeita.

(Adaptado de Carlos Eduardo O. Berriel, “Cidades Utópicas do


Renascimento”. Ciência e Cultura, São Paulo, v. 56, n. 2. abr./jun.
2004.)

Considerando o texto acima e seus


conhecimentos, assinale a alternativa correta.

a)A obra de Morus, escrita na Inglaterra,


baseou-se na experiência de soberanos da
Itália e da Alemanha que construíram novas
cidades no século XV, planejadas
geometricamente.
Assinale a alternativa que expressa adequadamente a
correlação entre o texto e a imagem. b)Grão-chanceler da Inglaterra, Morus
exerceu uma ação humanista em um mundo
a)Figura emblemática do Renascimento, Leonardo da Vinci renascentista de crises e instabilidades
destaca-se pela sua obra pictórica e por seu desenho do contínuas. Neste contexto publicou sua obra
Homem Vitruviano. Para ele, arte e ciência se baseavam nas Utopia.
relações análogas entre homem e natureza preconizadas pela
alquimia. c)A partir do princípio filosófico da utopia,
foram escritos vários tratados renascentistas.
b)O Homem Vitruviano de Leonardo da Vinci condensa uma O Príncipe, de Maquiavel, ilustra a melhor
série de estudos do artista, e mesmo a leitura de uma cópia versão do cortesão atuante no mundo utópico.
manuscrita da obra de Vitrúvio. O desenho sintetiza uma
relação harmônica entre homem e mundo pautada pela d)A ilha da Utopia, perfeitamente
analogia geométrica. racionalizada, marcou o urbanismo

111
renascentista na Europa e no Novo Mundo. O esgotamento c) o uso dos princípios liberais de organização
dessa ideia de utopia ocorreu com a ideia de distopia, no política republicana e a criação imediata de
século XX. exércitos nacionais que lutaram contra as
forças espanholas.

d) a participação de indígenas e camponeses,


EXPANSÃO MARÍTIMA E COMERCIAL determinante para a consolidação do
processo de independência em regiões como
1) Os estudos históricos por muito tempo explicaram as o México, e sua ausência nas ações
relações entre Portugal e Brasil por meio da noção de pacto comandadas por Bolívar.
colonial ou exclusivo comercial. Sobre esse conceito, é correto
afirmar que:

a) Trata-se de uma característica central do sistema colonial


REPÚBLICA VELHA
moderno e um elemento constitutivo das práticas
mercantilistas do Antigo Regime, que considera fundamental
a dinâmica interna da economia colonial. 1) “O Rio civiliza-se!” eis a exclamação que
irrompe de todos os peitos cariocas. Temos a
b) Definia-se por um sistema baseado em dois polos: um Avenida Central, a Avenida Beira Mar (os
centro de decisão, a metrópole, e outro subordinado, a colônia. nossos Campos Elíseos), estátuas em toda a
Esta submetia-se à primeira através de uma série de parte, cafés e confeitarias (…), um
mecanismos político-institucionais. assassinato por dia, um escândalo por
semana, cartomantes, médiuns, automóveis,
c) Em mais de uma ocasião, os colonos reclamaram e foram autobus, autores dramáticos, grandmonde,
insubordinados diante do pacto colonial, ao exigirem sua demi-monde, enfim todos os apetrechos das
presença e atuação nas Cortes dos reis ou ao pedirem a grandes capitais.
presença do Marquês de Pombal na colônia.
(“O Chat Noir”, em Fon-Fon! Nº 41, 1907. Extraído de
www.objdigital.bn.br/acervo_digital/div_periodicos/fonfon/
d) A noção de pacto colonial é um projeto embrionário de fonfon1907.)
Estado que acomodava as tensões surgidas entre os
interesses metropolitanos e coloniais, ao privilegiar as
experiências do “viver em colônia”. A partir do excerto, que se refere ao período
da Belle Époque no Brasil, no início do século
XX, é correto afirmar que:
INDEPENDÊNCIA DAS AMÉRICAS
a) O Rio de Janeiro procurava apagar
aspectos da época do Império e impulsionar a
1) As revoluções de independência na América hispânica
cultura francesa, renegada por D. Pedro II.
foram, ao mesmo tempo, um conflito militar, um processo de
mudança política e uma rebelião popular.
b)A cidade expressava as contradições de um
(Rafael Rojas, Las repúblicas de aire. Buenos Aires: Taurus, 2010, p. 11.) processo de transformações urbanas, sociais
e políticas nas primeiras décadas da
São características dos processos de independência nas ex- República.
colônias espanholas na América:
c) Os costumes franceses eram elementos
a) o descontentamento com o domínio colonial e a agregação incorporados pela sociedade carioca como
de grupos que expressavam a heterogeneidade étnica, sinônimo da modernização republicana obtida
regional, econômica e cultural do continente. pelo tenentismo.

b) o caudilhismo, sob a liderança política criolla, e o discurso d) A modernização representou um processo


revolucionário de uma nova ordem política, que assegurou de exclusão social e cultural, patrocinado pelo
profundas transformações econômicas na América. governo francês, que financiava obras

112
públicas e impunha os produtos franceses à população indicando ter a mesma idade de fundação do
brasileira. regime e a similaridade de suas histórias de
passado colonial ibérico.

d) As duas imagens usam a figura feminina


para representar as três repúblicas,
característica não usual para a representação
2) Compare as duas ilustrações de Angelo Agostini (1843-
artística do ideário republicano, protagonizado
1910) sobre o reconhecimento da República brasileira pela
por lideranças masculinas.
Argentina (fig.1) e pela França (fig.2).

3) Em julho de 1917, convocou-se, em São


Paulo, uma greve geral, com adesão de
45.000 trabalhadores, para pedir aumento
salarial. A greve se estendeu ao Rio de
Janeiro e levou o governo a reforçar o aparato
repressivo e decretar estado de sítio em 1918.
Nos anos de 1917-1919, o Chile registrou o
recrudescimento da agitação sindical.
Mobilizavam se com facilidade 100.000
trabalhadores, como durante as
manifestações contra o custo dos alimentos
em 1918 e 1919. A Argentina foi outro país que
teve um movimento sindical poderoso. Entre
1917 e 1921, o movimento sindical conheceu
seu apogeu. Apenas durante o ano de 1919,
registraram-se 367 greves na capital Buenos
Aires.
(Adaptado de Olivier Dabène, América Latina no século XX. Porto
Alegre: EDIPUCRS, 2003, p. 64-65.)

Considerando o texto acima e seus


conhecimentos sobre o tema, assinale a
alternativa correta.

a)Os movimentos grevistas foram


espontâneos e apartidários nos anos de 1910,
rejeitando a infiltração ideológica das
lideranças sindicais, de maioria marxista e
comunista, pouco mobilizadoras no período.
Assinale a alternativa correta.

a)As alegorias expressam visões diferentes sobre o b) Os movimentos sindicais estavam em


imaginário da República brasileira: na primeira ela é processo de fortalecimento, entre outras
representada com um olhar de proximidade, e, na segunda o razões, pela intensa ruralização dos países
olhar expressa admiração, remetendo à visão corrente do latino-americanos na década de 1900.
gravurista sobre as relações entre Brasil, França e Argentina.
c)O processo de fortalecimento dos
b)O reconhecimento da França traz a confraternização entre movimentos sindicais enfrentou um forte
dois países com tradições políticas muito diferentes, porém aparato repressivo, nos anos de 1920,
unidos pelo constitucionalismo monárquico e posteriormente marcado pela colaboração entre os Estados
pelo ideário republicano. latino-americanos.
c)No reconhecimento da Argentina ao regime republicano
brasileiro, as duas repúblicas ocupam a mesma posição, d) Os movimentos sindicais latino-americanos
apresentavam, em 1917, especificidades em

113
relação aos da Europa quanto às pautas reivindicatórias dos promoviam responsabilidade fiscal e
trabalhadores. diminuição do papel do Estado como motor de
desenvolvimento.

c)São marcos da crise do liberalismo na


IDADE CONTEMPORÂNEA Europa: o colapso das principais democracias,
a ascensão de governos totalitários e
autoritários e a descrença no livre-mercado
1) Desde a queda do império comunista na Europa, nos anos
após a crise de 1929.
1989-1991, assiste-se a uma nova forma de messianismo
político que consiste em impor o regime democrático e os
d)Verificou-se nesse período o colapso das
direitos humanos pela força.
democracias liberais, com a ascensão do
(Adaptado de Tzvetan Todorov, Os inimigos íntimos da democracia. São totalitarismo na Europa, e o aumento das
Paulo: Companhia das Letras, 2012, p. 55.) liberdades econômicas, com a diminuição do
papel do Estado como solução para a crise de
1929.
O quadro descrito pelo texto pode ser analisado

a)como herança das lutas anticoloniais exemplificada na


organização em torno do Estado multiétnico, como ocorreu na
GRÉCIA E ROMA
África do Sul.
1) A imagem acima retrata parte do mosaico
b)como parte da nova ordem mundial sob a liderança dos EUA romano de Nennig, um dos mais bem
e seu poder bélico em regiões como a Síria e o Afeganistão. conservados que se encontram até o
momento no norte da Europa. A composição
c) como o estabelecimento de um princípio que desestabiliza conta com mais de 160 m2 e apresenta como
as lógicas internas de organização, como ocorreu no Iraque e tema cenas próprias de um anfiteatro romano.
na ex-Iugoslávia.

d) como herança da Guerra Fria e como utilização da lógica


militar que inviabiliza a adoção da democracia em regiões
como a Ucrânia.

2) Na Era da Catástrofe (1914-1945), com a Grande


Depressão desencadeada pela crise de 1929, tornava-se
cada vez mais claro que a paz, a estabilidade social, a
economia, as instituições políticas e os valores intelectuais da
sociedade liberal burguesa entraram em decadência ou
colapso.

(Adaptado de E. J. Hobsbawm, Era dos extremos: o breve século XX, 1914-1991. São
Paulo: Companhia das Letras, 1995, p. 112.)

A partir do excerto acima e dos conhecimentos sobre o


período histórico que vai de 1914 a 1945, é correto afirmar: (https://fr.wikipedia.org/wiki/Perl_(Sarre)#/media/File:Retiarius_st
abs_secutor_(color).jpg. Acessado em 12/08/2016.)

a)A crise de 1929 e as guerras mundiais levaram ao colapso


do liberalismo político e econômico na Europa e, ao mesmo
A partir da leitura da imagem e do
tempo, à expansão das democracias liberais em países
conhecimento sobre o período em questão,
africanos e do Oriente Médio.
pode-se afirmar corretamente que a imagem
representa
b)As soluções para a crise de 1929 centraram-se em um
aprofundamento das políticas liberais do New Deal, que

114
a) uma luta entre três gladiadores, prática popular entre um embaixador atrás do outro para
membros da elite romana do século III d. C, que foi criticada acompanhar o imperador onde quer que ele
pelos cristãos. pudesse estar. Poderiam encontrar Adriano às
margens do Nilo ou supervisionando a
b) a popularidade das atividades circenses entre os romanos,
construção da grande muralha que cruzava o
prática de cunho religioso que envolvia os prisioneiros de
norte da Britânia; ajudando a projetar seu
guerra.
templo de Vênus diante do Coliseu; fazendo
c) uma das ações da política do pão e do circo, estratégia da um discurso para soldados na África. O
elite romana que usava cidadãos romanos na arena, para império era governado de onde o imperador
lutarem entre si e, assim, divertir o povo. estivesse.

d) uma luta entre gladiadores, prática que tinha inúmeras (Adaptado de Greg Woolf, Roma. São Paulo: Cultrix, 2017, p. 204.)
funções naquela sociedade, como a diversão, a tentativa de
controle social e a valorização da guerra. A partir da leitura do texto, assinale a
alternativa correta.

a)O Senado, composto por notáveis, fazia


oposição à centralização do poder do
2) Os gregos sentiram paixão pelo humano, por suas
Imperador e garantia a centralidade do
capacidades, por sua energia construtiva. Por isso,
governo em Roma e a democratização das
inventaram a polis: a comunidade cidadã em cujo espaço
decisões governamentais.
artificial, antropocêntrico, não governa a necessidade da
natureza, nem a vontade dos deuses, mas a liberdade dos
b)O Império romano foi marcado pelas
homens, isto é, sua capacidade de raciocinar, de discutir, de
disputas de poder entre o Imperador e o
escolher e de destituir dirigentes, de criar problemas e propor
Senado. Os conflitos entre eles acabaram por
soluções. O nome pelo qual hoje conhecemos essa invenção
resultar na diminuição do poder do Senado no
grega, a mais revolucionária, politicamente falando, que já se
que diz respeito à administração pública.
produziu na história humana, é democracia.
(Adaptado de Fernando Savater, Política para meu filho. São Paulo: Martins Fontes, 1996, c)O Senado, composto por notáveis, apoiava
p. 77.)
a centralização do poder nas mãos do
Assinale a alternativa correta, considerando o texto acima e Imperador. A nova estrutura política do Império
seus conhecimentos sobre a Grécia Antiga. permitia a mobilidade da administração
pública representada pelo Imperador.
a)Para os gregos, a cidade era o espaço do exercício da
liberdade dos homens e da tirania dos deuses.
d)O Império, governado por militares, opunha-
b)Os gregos inventaram a democracia, que tinha então o se às comunidades provinciais. Isso levou ao
mesmo funcionamento do sistema político vigente atualmente desaparecimento do Senado como instituição
no Brasil. responsável pela administração pública.
c)Para os gregos, a liberdade dos homens era exercida na
polis e estava relacionada à capacidade de invenção da
política.
d)A democracia foi uma invenção grega que criou problemas CONHECIMENTOS GERAIS
em função do excesso de liberdade dos homens.
1) A dona de casa entre as classes populares
urbanas é uma personagem maior e
majoritária. A dona de casa não tem muitas
3) Os imperadores romanos que reinaram no século II papas na língua. Muitas vezes é uma rebelde,
administraram um vasto império. Eles se tornaram mais tanto na vida privada quanto na vida pública.
abertamente monárquicos e dinásticos, particularmente fora E não raro paga um alto preço por isso, como
de Roma, onde não precisavam se preocupar com os alvo principal de violências que podem chegar
humores do Senado. Emergiu uma corte itinerante que ao crime “passional”.(Adaptado de Michelle Perrot,
“Figuras e papéis”, em Philippe Ariès (org.),
competia por influência. Comunidades provinciais enviavam

115
A mulher das classes populares nas sociedades urbanas do nada se cria, nada se perde, tudo se
século XIX na Europa transforma”, conhecida como a lei de
conservação das massas.
a)tinha múltiplas funções, como educar os filhos, cuidar da
casa e administrar as finanças, mas vivia restrita ao espaço
c)No século XVIII, as mulheres participavam
doméstico e por isso sua rebeldia era punida com violência.
da produção do conhecimento científico.
b)era responsável pelo trabalho doméstico e muitas vezes Marie Lavoisier registrou e publicou muitos
tinha uma jornada dupla, pelo trabalho externo que realizava dos experimentos feitos pela equipe de seu
em fábricas, pequenos comércios e outros serviços. marido, Antoine Lavoisier, famoso pela frase
“na natureza nada se cria, nada se perde, tudo
c) sofreu estigma e violência por revolucionar os costumes e
se transforma”, conhecida como a lei de
liderar o movimento de conquista do voto feminino.
conservação das massas.
d)contrariava o senso comum de ser cordata e obediente, pois
sua condição social indicava que não tinha referencial de uma d) A Revolução Francesa garantiu às
boa educação. mulheres a cidadania e a participação na
produção do conhecimento científico. Marie
Lavoisier registrou e publicou muitos dos
2) experimentos feitos pela equipe de seu marido,
Antoine Lavoisier, famoso pela frase “na
natureza nada se cria, nada se perde, tudo se
transforma”, conhecida como a lei de
conservação da quantidade de matéria.

3) “...Nas ruas e casas comerciais já se vê as


faixas indicando os nomes dos futuros
deputados. Alguns nomes já são conhecidos.
São reincidentes que já foram preteridos nas
umas. Mas o povo não está interessado nas
eleições, que é o cavalo de Troia que aparece
de quatro em quatro anos.
(Carolina Maria de Jesus, Quarto de despejo. São Paulo: Ática,
2014, p. 43.)

A ilustração anterior, com Marie Lavoisier representada à O trecho anterior faz parte das considerações
direita, foi produzida nas últimas décadas do século XVIII, e políticas que aparecem repetidamente em
mostra uma experiência para entender a fisiologia da Quarto de despejo, de Carolina Maria de
respiração e o papel do oxigênio nela. Considerando o Jesus.
contexto histórico e o seu conhecimento de química, assinale
a alternativa correta. Considerando o conjunto dessas
observações, indique a alternativa que
a)No século XVIII, Marie Lavoisier, como outras mulheres, não resume de modo adequado a posição da
participava da produção do conhecimento científico. Por outro autora sobre a lógica política das eleições.
lado, seu marido, Antoine Lavoisier, ficou famoso pela frase
“na natureza nada se cria, nada se perde, tudo se transforma”, a)Por meio das eleições, políticos de
conhecida como a lei de conservação da quantidade de determinados partidos acabam se
matéria. perpetuando no exercício do poder.

b)A Revolução Francesa favoreceu cientistas e intelectuais b)Os políticos se aproximam do povo e, depois
franceses independentemente de suas posições ideológicas e das eleições, se esquecem dos compromissos
das questões de gênero. É o caso de Marie Lavoisier e de assumidos.
Antoine Lavoisier, este último famoso pela frase “na natureza

116
c)Os políticos preteridos são aqueles que acabam vencendo b)Monarquias confessionais são aquelas
as eleições, por força de sua persistência. unidades políticas nas quais havia a
convivência pacífica de duas ou mais
d)Graças ao desinteresse do povo, os políticos se apropriam confissões religiosas, num mesmo território.
do Estado, contrariando a própria democracia.
c)São consideradas monarquias
confessionais os territórios protestantes que
4) Da perspectiva do senso comum, dizer que uma ideia ou se mostravam mais propícios ao
uma declaração é “ideológica” implica sugerir sua falsidade, o desenvolvimento do capitalismo comercial,
que logicamente leva à conclusão de que seu oposto é a tornando-se, assim, nações enriquecidas.
verdade. Esse binarismo é uma forma de construir visões de
mundo simplistas e manipuláveis, que ocultam interesses d)As monarquias confessionais contavam
sociais.Sobre o conceito de ideologia, é correto afirmar: com a instituição do Tribunal do Santo Ofício
da Inquisição em seu território, uma forma de
a)desde o seu nascimento, ele se mantém inalterado, e tem o controle cultural sobre religiões politeístas.
mesmo significado para as diferentes classes sociais.

b)o aspecto útil do conceito é que ele permite associar ideias


e produtos ao exercício do poder.
GOVERNOS POPULISTAS
c)A neutralidade é a chave de sua definição, já que, entre o
falso e o verdadeiro, está o posicionamento social neutro.
1) Vistas em conjunto, as aspirações ruralistas
d)a tendência é o seu fim como instrumento de análise social, não eram contraditórias ou incompatíveis com
privilegiando a objetividade no tratamento da realidade. o programa desenvolvimentista de Juscelino
Kubitschek. A ideia de incompatibilidade entre
o projeto nacional desenvolvimentista e os
interesses agrários era uma ficção.
ABSOLUTISMO
(Adaptado de Vânia Moreira, “Os Anos JK: industrialização e
modelo oligárquico de desenvolvimento rural”, em Jorge Ferreira
1)Na formação das monarquias confessionais da Época e Lucília Delgado (Orgs.), O Brasil Republicano. v. 3. Rio de
Moderna houve reforço das identidades territoriais, em função Janeiro: Civilização Brasileira, 2003, p. 169-170.)

de critérios de caráter religioso ou confessional.


Considerando a composição do setor rural
Simultaneamente, houve uma progressiva incorporação da
nacional e o programa desenvolvimentista do
Igreja ao corpo do Estado, através de medidas de caráter
governo JK, é correto afirmar que:
patrimonial e jurisdicional que procuravam uma maior sujeição
das estruturas e agentes eclesiásticos ao poder do príncipe.
a)A "Marcha para o Oeste" obteve grande
Na busca pela homogeneização da fé dentro de um território
êxito porque, além dos grandes ruralistas,
político, a Igreja cumpria também papel fundamental na
conseguia atender também aos interesses
formação do Estado moderno por meio de seus mecanismos
dos pequenos posseiros, trabalhadores sem
de disciplinamento social dos comportamentos.
terra e indígenas.
(Adaptado de Frederico Palomo, A Contra-Reforma em Portugal, 1540-1700. Lisboa:
Livros Horizonte, 2006, p.52.) b)O desenvolvimentismo atendia às ambições
da oligarquia rural, em função das políticas de
Considerando o texto acima e seus conhecimentos sobre a modernização da agricultura, permitindo que
Europa Moderna, assinale a alternativa correta. ela se beneficiasse da expansão do mercado
consumidor, um dos desdobramentos da
a)Cada monarquia confessional adotou uma identidade industrialização.
religiosa e medidas repressivas em relação às dissidências
religiosas que poderiam ameaçar tal unidade. c)O Plano de Metas do governo JK fracassou
porque os interesses do agronegócio se
mostraram posteriormente inconciliáveis com

117
as demandas da velha oligarquia rural das regiões Norte e GUERRA FRIA
Centro-Oeste.
1) A propaganda através de inscrições e
d)Os interesses agrários e o projeto de industrialização do
desenhos em muros e paredes é uma parte
nacional-desenvolvimentismo eram compatíveis porque o
integrante da Paris revolucionária de Maio de
Partido Trabalhista Brasileiro era composto principalmente
1968. Ela se tornou uma atividade de massa,
pela oligarquia rural.
parte e parcela do método de autoexpressão
da Revolução.

2) A crise levaria o último governo da ditadura, chefiado pelo (Adaptado de SOLIDARITY, Paris: maio de 68. São Paulo: Conrad,
general João Figueiredo (19/9-85), a tomar medidas drásticas. 2008, p. 15.)
O objetivo inicial era deter a depreciação da moeda nacional,
incentivar as exportações e fazer frente ao aumento do deficit
em conta corrente. Assim, a moeda foi desvalorizada em 30%
no final de 1979. A medida acentuou a desaceleração
econômica, o descontrole inflacionário e o desarranjo nas
contas públicas. Em 1980, a inflação batia a simbólica marca
de 100% ao ano e em 1981 o país entrava em uma recessão.

(Adaptado de Gilberto Marangoni, Anos 1980, década perdida ou ganha? Revista


Desafios do Desenvolvimento, São Paulo, Ano 9, Edição 72, 2012.)

A partir do texto acima e de seus conhecimentos sobre a Nova


República no Brasil, assinale a alternativa correta.
Considerando o texto e a imagem anteriores,
a)A concentração de renda gerada pelo milagre econômico, assinale a alternativa correta sobre o
as bolhas especulativas no mercado financeiro brasileiro, as movimento de Maio de 1968.
flutuações no preço do petróleo e a alta internacional dos juros
ao longo da década de 1970 foram elementos decisivos para a)Influenciado pela política de Estado da
a superação da crise econômica dos anos de 1980. União Soviética, as manifestações de 1968
foram desencadeadas pelos operários
b)No Brasil dos anos de 1980, a desaceleração econômica, o franceses, que exigiam melhores condições
descontrole inflacionário e o desarranjo nas contas públicas de trabalho, por meio das pichações em muros
foram acompanhados pelo silenciamento dos movimentos espalhados pela cidade
pelas Diretas Já e dos direitos civis, sendo essa década
conhecida como a “década perdida”. b)Influenciado pelo contexto cultural da
Guerra Fria, as manifestações de 1968 tinham
c) A crise econômica que se instalou no Brasil a partir de como palavras de ordem a liberdade de
meados dos anos de 1970 gerou pressão sobre o governo expressão política e sexual, como se via nas
militar do General Figueiredo, que, em resposta, aprovou a Lei inscrições nos muros de Paris.
da Anistia e a Lei Orgânica dos Partidos, incentivou o
movimento grevista e garantiu a realização de eleições de c)Influenciado pelos movimentos punk-
forma lenta, gradual e segura. anarquistas ingleses, as manifestações de
1968 na França foram responsáveis pelo
d) A chamada década perdida no Brasil foi marcada por grave enfraquecimento do então presidente Charles
crise econômica, pela transição para o regime democrático, De Gaulle e seu lema aparecia em inscrições
pela gradual normalização das instituições políticas próprias nos muros.
da democracia, pelo fortalecimento dos movimentos sociais e
civis e pela efervescência cultural. d)Influenciado por ideias esquerdistas,
comunistas e anarquistas, as manifestações
de 1968 ficaram restritas às camadas
populares francesas, sendo que as inscrições

118
nos muros das cidades indicavam o grupo social responsável.

gabarito
2) Nas últimas três décadas, vimos o fim de velhas unidades (PS: sempre veja os erros como uma
políticas e a emergência de novas: as unificações da oportunidade de aprendizado. Não fique triste
Alemanha e do Iêmen, a desintegração da Checoslováquia, se errar, você está dando o seu melhor.)
da Iugoslávia e da União Soviética, a secessão de países
como Eritreia, Timor-Leste e Kosovo. Vimos também a
expansão de esforços de integração política e econômica, a Idade Média 1C 2C 3C 4D 5D
absorção de antigos membros do Pacto de Varsóvia na Otan, Colônia 1A 2C 3D 4D 5B 6C 7C 8A
o envolvimento de exércitos nacionais em esforços da ONU
pela manutenção da paz e a mobilização de outros tantos Império 1C 2A 3A 4A 5C
exércitos na tentativa de conter e definir o terrorismo como
Guerras Mundiais e Regimes Totalitários
fenômeno político.
1B 2B 3C 4B 5C
(Adaptado de Sebastião Nascimento, Vinte anos sem muro em Berlim: novas faces da Ditadura Militar 1D 2D 3A 4D
violência política. Revista Brasileira de Ciências Sociais, São Paulo, v.26, n. 77, out. 2011.)
Era Vargas 1A 2D
Sobre esta nova condição histórica e geopolítica internacional,
Renascimento 1B 2B 3B
é correto afirmar:
Expansão Marítima 1 B
a)As décadas que nos separam da queda do Muro de Berlim
e do fim da Guerra Fria representam um período de Independência das Américas 1A
continuidade das formas e demandas políticas no plano República Velha 1B 2A 3D
internacional e de manutenção da cartografia mundial.
Idade Contemporânea 1B 2C
b) A reunificação alemã foi decisiva nesse processo global. Ela Grécia e Roma 1D 2D 3B
fez desaparecer o maior símbolo da Guerra Fria na Europa, a
Alemanha dividida. A queda do Muro de Berlim em 1989 e o Conhecimentos Gerais 1B 2C 3B 4B
11 de setembro de 2001 são marcos desse processo. Absolutismo 1A

c)Após a descolonização nos anos de 1950 e 1960, a Governos Populistas 1B 2D


dessovietização do mundo nos anos de 1990 reforçou o Guerra Fria 1B 2B
imperialismo, compreendido como um sistema de Estados
nacionais iguais sob o direito internacional.

d)Desde 1989, o Estado nacional democrático alcançou todo


o globo com eleições livres, não apenas no Leste Europeu,
mas também nos países orientais. Na retórica política comum,
destaca-se o fenômeno do terrorismo atlântico.

119
Física
d)80 m/s2.

3) Antes de Copérnico, Kepler e Galileu, os


GRAVITAÇÃO UNIVERSAL cosmólogos elaboravam sistemas que
representavam os corpos celestes por meio de
esferas encaixadas umas nas outras,
1) A primeira lei de Kepler demonstrou que os planetas se propostas e desenvolvidas por Eudoxo e
movem em órbitas elípticas e não circulares. A segunda lei Aristóteles, de modo a distinguir os mundos
mostrou que os planetas não se movem a uma velocidade celeste e terrestre. É nesse contexto,
constante. caracterizado pela tese de que o cosmo é
composto de dois mundos distintos (céu e
(Adaptado Marvin Perry, Civilização Ocidental: uma história concisa. São
Paulo: Martins Fontes, 1999, p. 289.)
Terra), e pelo axioma platônico, que deve ser
entendido o conteúdo da carta de Kepler
É correto afirmar que as leis de Kepler (1604). Ele apresenta uma etapa do processo
de rompimento com essa distinção e com o
a) confirmaram as teorias definidas por Copérnico e são axioma platônico. Na carta, Kepler apresenta
exemplos do modelo científico que passou a vigorar a partir os procedimentos para obter as duas
da Alta Idade Média. primeiras leis dos movimentos planetários. A
importância disso é tão grande que a segunda
b)confirmaram as teorias defendidas por Ptolomeu e lei aparece antes da primeira, e a lei das áreas
permitiram a produção das cartas náuticas usadas no período só se torna operante numa órbita elíptica, não
do descobrimento da América. podendo ser aplicada às órbitas circulares
sem produzir discrepâncias com relação aos
c)são a base do modelo planetário geocêntrico e se tornaram dados observacionais de Tycho Brahe.
as premissas cientificas que vigoram até hoje.
(Adaptado de Claudemir Roque Tossato, Os primórdios da
primeira lei dos movimentos planetários na carta de 14 de
d)forneceram subsídios para demonstrar o modelo planetário dezembro de 1604 de Kepler a Mástlin. Scientiae Studia, São
Paulo, v. 1, n. 2, p. 199-201, jun. 2003.)
heliocêntrico e criticar as posições defendidas pela Igreja
naquela época. Considerando o contexto histórico descrito e
as leis físicas apresentadas por Kepler,
assinale a alternativa correta.

2) Recentemente, a agência espacial americana anunciou a a)Copérnico, Kepler e Galileu fazem parte da
descoberta de um planeta a trinta e nove anos-luz da Terra, chamada Revolução Científica que rompe
orbitando uma estrela anã vermelha que faz parte da com leituras especulativas do Universo,
constelação de Cetus. O novo planeta possui dimensões e baseadas em premissas aristotélicas e
massa pouco maiores do que as da Terra e se tornou um dos tomistas, e propõe análises empiristas do
principais candidatos a abrigar vida fora do sistema solar. mundo natural. O conceito de órbitas
Considere este novo planeta esférico com um raio igual a RP circulares para o movimento dos planetas em
= 2RT e massa MP = 8MT, em que RT e MT são o raio e a torno do Sol, em que a distância entre o
massa da Terra, respectivamente. Para planetas esféricos de planeta e o Sol permanece constante durante
massa M e raio R , a aceleração da gravidade na superfície o movimento, foi abandonado por Kepler.

do planeta é dada por , em que G é uma constante b)A Revolução Científica da época Moderna
universal. Assim, considerando a Terra esférica e usando a propõe a ruptura com o ideal divino, sendo,
aceleração da gravidade na sua superfície, o valor da por isso, combatida pela Igreja Católica, que
aceleração da gravidade na superfície do novo planeta será defendia a orquestração divina sobre o mundo
de humano e natural. O conceito de órbitas
circulares para o movimento dos planetas em
a)5 m/s2. torno do Sol, em que a distância entre o
b)20 m/s2. planeta e o Sol é variável durante o movimento,
c)40 m/s2. foi abandonado por Kepler.

120
c) Copérnico, Kepler e Galileu foram perseguidos pela Igreja Os astrônomos estimam que a estrela estaria
Católica do período Moderno, por representarem o situada a uma distância d = 9,0 x 1018 m da
questionamento dos ideais medievais sobre a organização do Terra. Considerando um foguete que se
céu e da Terra e sobre a onipresença divina. O conceito de desloca a uma velocidade v = 1,5 x 104 m/s, o
órbitas circulares para o movimento dos planetas em torno do tempo de viagem do foguete da Terra até essa
Sol, para as quais a distância entre o planeta e o Sol é variável estrela seria de (1 ano ≈ 3,0x107 s)
durante o movimento, foi abandonado por Kepler.
a) 2.000 anos.
d)A Revolução Científica da época Moderna, incentivada pela
Igreja Católica, propõe a manutenção do antropocentrismo b) 300.000 anos.
medieval, associado aos conhecimentos empíricos para a
JIeitura e representação do mundo natural. O conceito de c) 6.000.000 anos.
órbitas circulares para o movimento dos planetas em torno do
Sol, para as quais a distância entre o planeta e o Sol d)20.000.000 anos.
permanece constante durante o movimento, foi abandonado
por Kepler.
2) Recentemente, uma equipe de astrônomos
afirmou ter identificado uma estrela com
dimensões comparáveis às da Terra,
4) As agências espaciais NASA (norte-americana) e ESA composta predominantemente de diamante.
(europeia) desenvolvem um projeto para desviar a trajetória Por ser muito frio, o astro, possivelmente uma
de um asteroide através da colisão com uma sonda estrela anã branca, teria tido o carbono de sua
especialmente enviada para esse fim. A previsão é que a composição cristalizado em forma de um
sonda DART (do inglês, “Teste de Redirecionamento de diamante praticamente do tamanho da Terra.
Asteroides Duplos”) será lançada com a finalidade de se Considerando que a massa e as dimensões
chocar, em 2022, com Didymoon, um pequeno asteroide que dessa estrela são comparáveis às da Terra,
orbita um asteroide maior chamado Didymos. espera-se que a aceleração da gravidade que
atua em corpos próximos à superfície de
O asteroide satélite Didymoon descreve uma órbita circular ambos os astros seja constante e de valor não
em torno do asteroide principal Didymos. O raio da órbita é r muito diferente. Suponha que um corpo
= 1,6 km e o período é T = 12 h. abandonado, a partir do repouso, de uma
altura h = 54 m da superfície da estrela,
Obs.: para a questão, aproxime π = 3,0 sempre que apresente um tempo de queda t = 3,0 s. Desta
necessário. forma, pode-se afirmar que a aceleração da
gravidade na estrela é de
A aceleração centrípeta do satélite vale
a) 8,0 m/s2.
-1 2.
a)8,0 x 10 km/h
b)4,0 x 10-1 km/h2. b)10 m/s2.
c)3,125 x 10-1 km/h2.
d)6,667 x 10-2 km/h2. c) 12 m/s2.

d)18 m/s2.

CINEMÁTICA
3) Considere um computador que armazena
1) Recentemente, uma equipe de astrônomos afirmou ter informações em um disco rígido que gira a
identificado uma estrela com dimensões comparáveis às da uma frequência de 120 Hz. Cada unidade de
Terra, composta predominantemente de diamante. Por ser informação ocupa um comprimento físico de
muito frio, o astro, possivelmente uma estrela anã branca, 0,2 μm na direção do movimento de rotação
teria tido o carbono de sua composição cristalizado em forma do disco. Quantas informações magnéticas
de um diamante praticamente do tamanho da Terra. passam, por segundo, pela cabeça de leitura,

121
se ela estiver posicionada a 3 cm do centro de seu eixo, como a)10 km.
mostra o esquema simplificado apresentado abaixo?
(Considere π ≈ 3.) b)20 km.

c)50 km.

d)100 km.

6) Em 2016 foi batido o recorde de voo


ininterrupto mais longo da história. O avião
Solar Impulse 2, movido a energia solar,
percorreu quase 6480 km em
aproximadamente 5 dias,partindo de Nagoya
no Japão até o Havaí nos Estados Unidos da
América. A velocidade escalar média
desenvolvida pelo avião foi de
a)1,62 x 10⁶ aproximadamente
b) 1,8 x 10⁶
a) 54 km/h.
c) 64,8 x 10⁸ b)15 km/h.
d) 1,08 x 10⁸ c)1296 km/h.
d)198 km/h

4) Drones são veículos voadores não tripulados, controlados


remotamente e guiados por GPS. Uma de suas potenciais
7) O semáforo é um dos recursos utilizados
aplicações é reduzir o tempo da prestação de primeiros
para organizar o tráfego de veículos e de
socorros, levando pequenos equipamentos e instruções ao
pedestres nas grandes cidades. Considere
local do socorro, para que qualquer pessoa administre os
que um carro trafega em um trecho de uma via
primeiros cuidados até a chegada de uma ambulância.
retilínea, em que temos 3 semáforos. O gráfico
Considere um caso em que o drone ambulância se deslocou
abaixo mostra a velocidade do carro, em
9 km em 5 minutos. Nesse caso, o módulo de sua velocidade
função do tempo, ao passar por esse trecho
média é de aproximadamente
em que o carro teve que parar nos três
semáforos. A distância entre o primeiro e o
a)1,4 m/s.
terceiro semáforo é de

b)30 m/s.

c)45 m/s.

d)140 m/s.

5) A demanda por trens de alta velocidade tem crescido em


todo o mundo. Uma preocupação importante no projeto
desses trens é o conforto dos passageiros durante a
aceleração. Sendo assim, considere que, em uma viagem de
trem de alta velocidade, a aceleração experimentada pelos a)330 m.
passageiros foi limitada a amax = 0,09g, onde g=10 m/s2 é a b)440 m.
aceleração da gravidade. Se o trem acelera a partir do c)150 m.
repouso com aceleração constante igual a amax, a distância d)180 m.
mínima percorrida pelo trem para atingir uma velocidade de
1080 km/h corresponde a

122
8) A microfluídica é uma área de pesquisa que trabalha com a O físico inglês Stephen Hawking (1942-2018),
manipulação precisa de líquidos em canais com dimensões além de suas contribuições importantes para
submilimétricas, chamados de microcanais, possibilitando o a cosmologia, a física teórica e sobre a origem
desenvolvimento de sistemas miniaturizados de análises do universo, nos últimos anos de sua vida
químicas e biológicas. Considere que uma seringa com passou a sugerir estratégias para salvar a raça
êmbolo cilíndrico de diâmetro D = 4 mm seja humana de uma possível extinção, entre elas,
a mudança para outro planeta. Em abril de
usada para injetar um líquido em um microcanal cilíndrico com
2018, uma empresa americana, em
diâmetro de d = 500 μm. Se o êmbolo for movido com uma
colaboração com a Nasa, lançou o satélite
velocidade de V = 4 mm/s, a velocidade v do líquido no
TESS, que analisará cerca de vinte mil
microcanal será de
planetas fora do sistema solar. Esses planetas
orbitam estrelas situadas a menos de
a)256,0 mm/s. trezentos anos-luz da Terra, sendo que um
b)32,0 mm/s. ano-luz é a distância que a luz percorre no
c)62,5 μm/s. vácuo em um ano. Considere um ônibus
d)500,0 μm/s. espacial atual que viaja a uma velocidade
média v = 2,0x104 km/s.
O tempo que esse ônibus levaria para chegar
a um planeta a uma distância de 100 anos-luz
9) Situado na costa peruana, Chankillo, o mais antigo
é igual a (Dado: A velocidade da luz no vácuo
observatório das Américas, é composto por treze torres que
é igual a c = 3,0 x 108 m/s.)
se alinham de norte a sul ao longo de uma colina. Em 21 de
dezembro, quando ocorre o solstício de verão no Hemisfério
a)66 anos.
Sul, o Sol nasce à direita da primeira torre (sul), na extrema
b)100 anos.
direita, a partir de um ponto de observação definido. À medida
c)600 anos.
que os dias passam, a posição em que o Sol nasce se desloca
d)1500 anos.
entre as torres rumo à esquerda (norte). Pode-se calcular o
dia do ano, observando-se qual torre coincide com a posição
do Sol ao amanhecer. Em 21 de junho, solstício de inverno no
Hemisfério Sul, o Sol nasce à esquerda da última torre na
extrema esquerda e, à medida que os dias passam, vai se
movendo rumo à direita, para reiniciar o ciclo no dezembro
11) A volta da França é uma das maiores
seguinte. Sabendo que as torres de Chankillo se posicionam
competições do ciclismo mundial. Num treino,
ao longo de 300 metros no eixo norte-sul, a velocidade escalar
um ciclista entra num circuito reto e horizontal
média com a qual a posição do nascer do Sol se desloca
(movimento em uma dimensão) com
através das torres é de aproximadamente
velocidade constante e positiva. No instante t1,
ele acelera sua bicicleta com uma aceleração
constante e positiva até o instante t2. Entre t2
e ,t3 ele varia sua velocidade com uma
aceleração também constante, porém
negativa. Ao final do percurso, a partir do
instante t3, ele se mantém em movimento
retilíneo uniforme. De acordo com essas
a)0,8 m/dia.
informações, o gráfico que melhor descreve a
b)1,6 m/dia.
velocidade do atleta em função do tempo é
c)25 m/dia.
d)50 m/dia.

10) Na questão, sempre que necessário, use aceleração da


gravidade g = 10 m/s2, aproxime π = 3,0 e 1 atm = 105 Pa.

123
a)

CALORIMETRIA

1) Recentemente, uma equipe de astrônomos


afirmou ter identificado uma estrela com
dimensões comparáveis às da Terra,
composta predominantemente de diamante.
Por ser muito frio, o astro, possivelmente uma
estrela anã branca, teria tido o carbono de sua
composição cristalizado em forma de um
diamante praticamente do tamanho da Terra.

b)
Os cálculos dos pesquisadores sugerem que
a temperatura média dessa estrela é de Ti =
2.700 0C. Considere uma estrela como um
corpo homogêneo de massa M = 6,0 x 1024
kg constituída de um material com calor
específico c = 0,5 kJ/(kg 0C). A quantidade de
calor que deve ser perdida pela estrela para
que ela atinja uma temperatura final de Tf =
700 0C é igual a

a) 24,0 x 1027 kJ.

b)6,0 x 1027 kJ.


c)
c) 8,1 x 1027 kJ.

d) 2,1 x 1027 Kj.

2) Um isolamento térmico eficiente é um


constante desafio a ser superado para que o
homem possa viver em condições extremas
de temperatura. Para isso, o entendimento
completo dos mecanismos de troca de calor é
imprescindível.

Em cada uma das situações descritas a seguir,


você deve reconhecer o processo de troca de
calor envolvido.

I. As prateleiras de uma geladeira doméstica


são grades vazadas, para facilitar fluxo de
energia térmica até o congelador por [...]

II. O único processo de troca de calor que


pode ocorrer no vácuo é por [...].

III. Em uma garrafa térmica, é mantido vácuo


entre as paredes duplas de vidro para evitar
d) que o calor saia ou entre por [....].

124
Na ordem, os processos de troca de calor utilizados para a)convecção,evaporação, radiação, condução
preencher as lacunas corretamente são: e radiação.

a) condução, convecção e radiação. b) convecção, radiação, condução, radiação e


evaporação.
b) condução, radiação e convecção.
c)condução,evaporação, convecção, radiação
c) convecção, condução e radiação. e radiação.

d)convcção, radiação e condução. d) condução,radiação,convecção, evaporação


e radiação.

3) Um conjunto de placas de aquecimento solar eleva a


temperatura da água de um reservatório de 500 litros de 20 oC 5) A depilação a laser é um procedimento de
para 47 oC em algumas horas. Se no lugar das placas solares eliminação dos pelos que tem se tornado
fosse usada uma resistência elétrica, quanta energia elétrica bastante popular na indústria de beleza e no
seria consumida para produzir o mesmo aquecimento? Adote mundo dos esportes. O número de sessões do
1,0 kg/litro para a densidade e 4,0 kJ/(kg∙oC) para o calor procedimento depende, entre outros fatores,
específico da água. Além disso, use 1 kWh = 103 W × 3.600 s da coloração da pele, da área a ser tratada e
= 3,6 × 106 J. da quantidade de pelos nessa área.

a)15 kWh.
Na depilação, o laser age no interior da pele,
b)26 kWh.
produzindo uma lesão térmica que queima a
c)40.000 kWh.
raiz do pelo. Considere uma raiz de pelo de
d)54.000 kWh.
massa m = 2,0 x 10-10 kg inicialmente a uma
temperatura Ti = 36ºC que é aquecida pelo
laser a uma temperatura final Tf = 46ºC.
4) Mesmo em manhãs bem quentes, é comum ver um cão
tomando sol. O pelo do animal esquenta e sua língua do lado
Se o calor específico da raiz é igual a c = 3000
de fora sugere que ele está cansado. O pelo do animal está
J/(kg ºC), o calor absorvido pela raiz do pelo
muito quente, mas mesmo assim o cão permanece ao sol,
durante o aquecimento é igual a
garantindo a produção de vitamina D3. Durante essa
exposição ao sol, ocorrem transferências de energia entre o
a)6,0 x 10-6 J.
cão e o ambiente, por processos indicados por números na
b)6,0 x 10-8 J.
figura abaixo.
c)1,3 x 10-12 J.
d6,0 x 10-13 J.

6) Em 15 de abril de 2019, a Catedral de


Notre-Dame de Paris ardeu em chamas,
atingindo temperaturas de 800 °C. Estima-se
que, na construção da catedral, foram
empregadas pelo menos 300 toneladas de
chumbo. Material usual à época, o chumbo é
um metal pesado com elevado potencial de
(Adaptado de KHAN ACADEMY, Endotherms and ectotherms. Disponível em contaminação em altas temperaturas.
www.khanacademy.org. Acessado em 26/07/17.
Sabendo que o ponto de fusão do chumbo é
Em ordem crescente, os números correspondem, de 327,5 °C e seu ponto de ebulição é de
respectivamente, aos processos de 1750 °C, identifique a curva que pode

125
representar o histórico da temperatura de uma porção de
chumbo presente na catedral ao longo do incêndio, bem como
o fenômeno corretamente relacionado ao potencial de
contaminação.

a)

O potencial de contaminação estaria


associado à evaporação do chumbo em alta
temperatura.

O potencial de contaminação estaria associado à 7) “O sal faz a água ferver mais rápido?” Essa
evaporação do chumbo em alta temperatura é uma pergunta frequente na internet, mas
não tente responder com os argumentos lá
apresentados. Seria muito difícil responder à
pergunta tal como está formulada, pois isso
b)
exigiria o conhecimento de vários parâmetros
termodinâmicos e cinéticos no aquecimento
desses líquidos. Do ponto de vista
termodinâmico, entre tais parâmetros, caberia
analisar os valores de calor específico e de
temperatura de ebulição da solução em
comparação com a água pura.
Considerando massas iguais (água pura e
solução), se apenas esses parâmetros fossem
O potencial de contaminação estaria associado à ebulição do
levados em consideração, a solução ferveria
chumbo em alta temperatura.
mais rapidamente se o seu calor específico
fosse
c)
a)menor que o da água pura, observando-se
ainda que a temperatura de ebulição da
solução é menor.

b)maior que o da água pura, observando-se


ainda que a temperatura de ebulição da
solução é menor.

c)menor que o da água pura, observando-se,


O potencial de contaminação estaria associado à ebulição do no entanto, que a temperatura de ebulição da
chumbo em alta temperatura solução é maior.

d) d)maior que o da água pura, observando-se,


no entanto, que a temperatura de ebulição da
solução é maior.

126
TRABALHO,ENERGIA E POTÊNCIA ao espaço foi lançado do Centro Espacial de
Kourou, na Guiana Francesa. A massa do
Texto para as questões 01 e 02
satélite é constante desde o lançamento até a
entrada em órbita e vale m = 6,0 ×103 kg. O
1) A módulo de sua velocidade orbital é igual a Vor
figura = 3,0 x 103 m/s. Desprezando a velocidade
abaixo inicial do satélite em razão do movimento de
rotação da Terra, o trabalho da força resultante
sobre o satélite para levá-lo até a sua órbita é
igual a
a)2 MJ.
b)18 MJ.
c) 27 GJ.
d)54 GJ.

4) “Gelo combustível” ou “gelo de fogo” é


mostra, de forma simplificada, o sistema de freios a disco de
como são chamados os hidratos de metano
um automóvel. Ao se pressionar o pedal do freio, este empurra
que se formam a temperaturas muito baixas,
o êmbolo de um primeiro pistão que, por sua vez, através do
em condições de pressão elevada. São
óleo do circuito hidráulico, empurra um segundo pistão. O
geralmente encontrados em sedimentos do
segundo pistão pressiona uma pastilha de freio contra um
fundo do mar ou sob a camada de solo
disco metálico preso à roda,
congelada dos polos. A considerável reserva
fazendo com que ela diminua sua velocidade angular.
de gelo combustível no planeta pode se tornar
uma promissora fonte de energia alternativa
Considerando o diâmetro d2 do segundo pistão duas vezes
ao petróleo. Considerando que a combustão
maior que o diâmetro d1 do primeiro, qual a razão entre a força
completa de certa massa de gelo combustível
aplicada ao pedal de freio pelo pé do motorista e a força
libera uma quantidade de energia igual a E =
aplicada à pastilha de freio?
7,2 MJ , é correto afirmar que essa energia é
capaz de manter aceso um painel de LEDs de
a) 1/4.
potência P=2kW por um intervalo de tempo
b) 1/2.
igual a
c) 2.
d) 4. a)1 minuto.

b)144 s.
02) Qual o trabalho executado pela força de atrito entre o pneu c)1 hora.
e o solo para parar um carro de massa m = 1.000 kg,
inicialmente a v = 72 km/h, sabendo que os pneus travamno d)1 dia.
instante da frenagem, deixando de girar, e o carro desliza
durante todo o tempo de frenagem?
5) A depilação a laser é um procedimento de
a) 3,6 x 104 J. eliminação dos pelos que tem se tornado
b) 2,0 x 105 J. bastante popular na indústria de beleza e no
c) 4,0 x 105 J. mundo dos esportes. O número de sessões do
d) 2,6 x 106 J. procedimento depende, entre outros fatores,
da coloração da pele, da área a ser tratada e
da quantidade de pelos nessa área.

3) O primeiro satélite geoestacionário brasileiro foi lançado ao Uma sessão de depilação a laser utiliza pulsos
espaço em 2017 e será utilizado para comunicações de alta potência e curta duração. O tempo total
estratégicas do governo e na ampliação da oferta de da sessão depende da área tratada.
comunicação de banda larga. O foguete que levou o satélite Considere certa situação em que a luz do laser

127
incide perpendicularmente em uma área A = 2 mm2 com uma
intensidade média igual a I = 2,0x104 W/m2.

A energia luminosa que incide nessa área durante um


intervalo de tempo Δt = 3 ms é
igual a

a)1,3 x 10-1 J.
b)1,2 x 10-4 J.
c)3,0 x 107 J.
d)3,0 x 10-13 J.

ELETRODINÂMICA
a) 6 V.
1) Por sua baixa eficiência energética, as lâmpadas
b) 12 V.
incandescentes deixarão de ser comercializadas para uso c) 20 V.
doméstico comum no Brasil. Nessas lâmpadas, apenas 5% da d) 40 V.
energia elétrica consumida é convertida em luz visível, sendo
o restante transformado em calor. Considerando uma lâmpada
incandescente que consome 60 W de potência elétrica, qual a
energia perdida em forma de calor em uma hora de operação?

a)10.800 J.
b)34.200 J.
c)205.200 J. 3) A figura 1 apresentada a seguir representa
a potência elétrica dissipada pelo filamento de
d)216.000 J.
tungstênio de uma lâmpada incandescente
em função da sua resistência elétrica. Já a
figura 2 apresenta a temperatura de operação
do filamento em função de sua resistência
elétrica. Se uma lâmpada em funcionamento
2) Quando as fontes de tensão contínua que alimentam os dissipa 150 W de potência elétrica, a
aparelhos elétricos e eletrônicos são desligadas, elas levam temperatura do filamento da lâmpada é mais
próxima de:
normalmente certo tempo para atingir a tensão de U = 0 V. Um
estudante interessado em estudar tal fenômeno usa um
amperímetro e um relógio para acompanhar o decréscimo da
corrente que circula pelo circuito a seguir em função do tempo,
após a fonte ser desligada em t = 0 s. Usando os valores de
corrente e tempo medidos pelo estudante, pode-se dizer que
a diferença de potencial sobre o resistor R = 0,5 kΩ para t =
400 ms é igual a

128
a) 325 ºC.
b) 1.250 ºC.
c) 3.000 ºC.
d) 3.750 ºC.
5) Um osciloscópio é um instrumento muito útil
no estudo da variação temporal dos sinais
elétricos em circuitos. No caso de um circuito
4) Muitos dispositivos de aquecimento usados em nosso de corrente alternada, a diferença de potencial
cotidiano usam resistores elétricos como fonte de calor. Um (U) e a corrente do circuito (i) variam em
exemplo é o chuveiro elétrico, em que é possível escolher função do tempo.
entre diferentes opções de potência usadas no aquecimento
da água, por exemplo, morno (M), quente (Q) e muito quente
(MQ). Considere um chuveiro que usa a associação de três Considere um circuito com dois resistores R1
resistores, iguais entre si, para oferecer essas três opções de e R2 em série, alimentados por uma fonte de
temperatura. A escolha é feita por uma chave que liga a rede tensão alternada.
elétrica entre o ponto indicado pela letra N e um outro ponto
indicado por M, Q ou MQ, de acordo com a opção de A diferença de potencial nos terminais de
temperatura desejada. O esquema que representa cada resistor observada na tela do
corretamente o circuito equivalente do chuveiro é osciloscópio é representada pelo gráfico
abaixo. Analisando o gráfico, pode-se afirmar
que a amplitude e a frequência da onda que
representa a diferença de potencial nos
terminais do resistor de maior resistência são,
respectivamente, iguais a

129
superfície. Desta forma, se um isolante
topológico for submetido a uma diferença de
potencial U , teremos uma resistência efetiva
na superfície diferente da resistência do seu
volume, como mostra o circuito equivalente da
figura abaixo. Nessa situação, a razão

entre a corrente is que atravessa a


porção condutora na superfície e a corrente iv
que atravessa a porção isolante no interior do
material vale

a) 4 V e 2,5 Hz.
b) 8 V e 2,5 Hz.
c) 4 V e 400 Hz.
d) 8 V e 400 Hz.

6) Tecnologias móveis como celulares e tablets têm tempo de


autonomia limitado pela carga armazenada em suas baterias.
O gráfico abaixo apresenta, de forma simplificada, a corrente
de recarga de uma célula de bateria de íon de lítio, em função
do tempo. Considere uma célula de bateria inicialmente a)0,002.
descarregada e que é carregada seguindo essa curva de b)0,2.
corrente. A sua carga no final da recarga é de c)100,2.
d)500.

8) Drones vêm sendo utilizados por empresas


americanas para monitorar o ambiente
subaquático. Esses drones podem substituir
mergulhadores, sendo capazes de realizar
mergulhos de até cinquenta metros de
profundidade e operar por até duas horas e
meia. Considere um drone que utiliza uma
bateria com carga total q = 900 mAh.
Se o drone operar por um intervalo de tempo
a)3,3 C.
b)11.880 C. igual a Δt = 90 min, a corrente média fornecida
c)1200 C. pela bateria nesse intervalo de tempo será
igual a
d)3.300 C.

a)10maA.
b)600 mA.
7) Nos últimos anos, materiais exóticos conhecidos como
c)1350 mA.
isolantes topológicos se tornaram objeto de intensa
investigação científica em todo o mundo. De forma d)81000 ma.
simplificada, esses materiais se caracterizam por serem
isolantes elétricos no seu interior, mas condutores na sua

130
9) Em analogia com um circuito elétrico, a transpiração foliar
é regulada pelo conjunto de resistências (medidas em
segundos/metro) existentes na rota do vapor d’água entre os
sítios de evaporação próximos à parede celular no interior da
folha e a atmosfera. Simplificadamente, há as resistências dos
espaços intercelulares de ar (reia), as induzidas pela presença
dos estômatos (rest) e da cutícula (rcut) e a promovida pela
massa de ar próxima à superfície das folhas (rcl). O esquema
abaixo representa as resistências mencionadas.

A tabela a seguir apresenta os valores das resistências de


duas espécies de plantas (espécie 1 e espécie 2).
a) 3 rpm.
b) 200 rpm.
c) 720 rpm.
d) 1200 rpm.

ÓPTICA
Tendo em vista os dados apresentados e considerando que a
condutância é o inverso da resistência, assinale a alternativa
1) Espelhos esféricos côncavos são
que indica a espécie com menor transpiração e sua respectiva
comumente utilizados por dentistas porque,
condutância total à difusão do vapor d’água entre os sítios de
dependendo da posição relativa entre objeto e
evaporação e a atmosfera.
imagem, eles permitem visualizar detalhes
precisos dos dentes do paciente. Na figura
a)espécie 1; 48 x 10-4 m/s.
abaixo, pode-se observar esquematicamente
b)espécie 1; 125 x 10-4 m/s.
a imagem formada por um espelho côncavo.
c)espécie 2; 30 x 10-4 m/s.
Fazendo uso de raios notáveis, podemos dizer
d)espécie 2; 200 x 10-4 m/s.
que a flecha que representa o objeto

MOVIMENTO CIRCULAR

1) Anemômetros são instrumentos usados para medir a


velocidade do vento. A sua construção mais conhecida é a
proposta por Robinson em 1846, que consiste em um rotor
com quatro conchas hemisféricas presas por hastes,
conforme figura abaixo. Em um anemômetro de Robinson
ideal, a velocidade do vento é dada pela velocidade linear das
conchas. Um anemômetro em que a distância entre as a) se encontra entre F e V e aponta na direção
conchas e o centro de rotação é r=25 cm, em um dia cuja da imagem.
velocidade do vento é v=18 km/h, teria uma frequência de
rotação de b) se encontra entre F e C e aponta na direção
Se necessário, considere π ≈3. da imagem.

131
c) se encontra entre F e V e aponta na direção oposta à
imagem.

d) se encontra entre F e C e aponta na direção oposta à 4) Em uma animação do Tom e Jerry, o


imagem. camundongo Jerry se assusta ao ver sua
imagem em uma bola de Natal cuja superfície
é refletora, como mostra a reprodução
abaixo. É correto afirmar que o efeito
mostrado na ilustração não ocorre na
2) O Teatro de Luz Negra, típico da República Tcheca, é um
realidade, pois a bola de Natal formaria uma
tipo de representação cênica caracterizada pelo uso do
imagem
cenário escuro com uma iluminação estratégica dos objetos
exibidos. No entanto, o termo Luz Negra é fisicamente
incoerente, pois a coloração negra é justamente a ausência
de luz. A luz branca é a composição de luz com vários
comprimentos de onda e a cor de um corpo é dada pelo
comprimento de onda da luz que ele predominantemente
reflete. Assim, um quadro que apresente as cores azul e
branca quando iluminado pela luz solar, ao ser iluminado por
uma luz monocromática de comprimento de onda
correspondente à cor amarela, apresentará, respectivamente,
uma coloração

a) amarela e branca.
b) negra e amarela. a)virtual ampliada.
c) azul e negra. b) virtual reduzida.
d) totalmente negra. c) real ampliada.
d)real reduzida.

3) Considere que, de forma simplificada, a resolução máxima


de um microscópio óptico é igual ao comprimento de onda da 5) Uma lente de Fresnel é composta por um
luz incidente no objeto a ser observado. Observando a célula conjunto de anéis concêntricos com uma das
representada na figura abaixo, e sabendo que o intervalo de faces plana e a outra inclinada, como mostra
frequências do espectro de luz visível está compreendido a figura (a). Essas lentes, geralmente mais
entre 4,0 x 1014 Hz e 7,5 x 1014 Hz, a menor estrutura celular finas que as convencionais, são usadas
que se poderia observar nesse microscópio de luz seria (Se principalmente para concentrar um feixe
necessário, utilize c = 3×108m/s.) luminoso em determinado ponto, ou para
colimar a luz de uma fonte luminosa,
produzindo um feixe paralelo, como ilustra a
figura (b). Exemplos desta última aplicação
são os faróis de automóveis e os faróis
costeiros. O diagrama da figura (c) mostra um
raio luminoso que passa por um dos anéis de
uma lente de Fresnel de acrílico e sai
paralelamente ao seu eixo. Se sen(θ1) = 0,5 e
sen(θ2) = 0,75, o valor do índice de refração
do acrílico é de

a)o ribossomo.
b)o retículo endoplasmático.
c)a mitocôndria.
d)o cloroplasto.

132
7) A lupa é um instrumento óptico simples
formado por uma única lente convergente. Ela
é usada desde a Antiguidade para observar
pequenos objetos e detalhes de superfícies. A
imagem formada pela lupa é direta e virtual.
Qual figura abaixo representa corretamente o
traçado dos raios luminosos principais
provenientes de um determinado ponto de um
objeto observado por uma lupa?
Nessas figuras, (f) e (f’) representam os
pontos focais, (o) o objeto e (i) a imagem.

a) 1,50.
b) 1,41.
c) 1,25.
d) 0,66

6) As cirurgias corretivas a laser para a visão estão cada vez


mais eficientes. A técnica corretiva mais moderna é baseada
na extração de um pequeno filamento da córnea, modificando
a sua curvatura. No caso de uma cirurgia para correção de
miopia, o procedimento é feito para deixar a córnea mais plana.

Assinale a alternativa que explica corretamente o processo de


correção da miopia.

a)Na miopia, a imagem do ponto remoto se forma antes da


retina e a cirurgia visa a aumentar a distância focal da lente
efetiva do olho.

b)Na miopia, a imagem do ponto remoto se forma depois da


retina e a cirurgia visa a aumentar a distância focal da lente
efetiva do olho.

c)Na miopia, a imagem do ponto remoto se forma depois da


retina e a cirurgia visa a diminuir a distância focal da lente
efetiva do olho.

d)Na miopia, a imagem do ponto remoto se forma antes da


retina e a cirurgia visa a diminuir a distância focal da lente
efetiva do olho.

133
3) Hoje é comum encontrarmos equipamentos
de exercício físico em muitas praças públicas
do Brasil. Esses equipamentos são voltados
para pessoas de todas as idades, mas, em
particular, para pessoas da terceira idade. São
equipamentos exclusivamente mecânicos,
sem uso de partes elétricas, em que o esforço
consiste usualmente em levantar o próprio
peso do praticante. Considere o esquema
abaixo, em que uma pessoa de massa m = 65
kg está parada e com a perna esticada em um
equipamento tipicamente encontrado nessas
praças. O módulo da força 𝐹 ⃗ exercida pela
perna da pessoa em razão de sua massa m é
DINÂMICA

1) Músculos artificiais feitos de nanotubos de carbono


embebidos em cera de parafina podem suportar até duzentas
vezes mais peso que um músculo natural do mesmo tamanho.
Considere uma fibra de músculo artificial de 1 mm de
comprimento, suspensa verticalmente por uma de suas
extremidades e com uma massa de 50 gramas pendurada, em
repouso, em sua outra extremidade. O trabalho realizado pela
fibra sobre a massa, ao se contrair 10%, erguendo a massa
até uma nova posição de repouso, é

Se necessário, utilize g = 10 m/s2 (Se necessário, utilize g = 10 m/s2.)


.a)5 x 10-3 J.
a)1300 N.
b)5 x 10-4J. b)750 N.
c)325 N.
c)5 x 10-5 J.
d)560 N.
d) 5 x 10-6 J.

4) Uma estrela de nêutrons é o objeto


2) Beisebol é um esporte que envolve o arremesso, com a astrofísico mais denso que conhecemos, em
mão, de uma bola de 140 g de massa na direção de outro que uma massa maior que a massa do Sol
jogador que irá rebatê-la com um taco sólido. Considere que, ocupa uma região do espaço de apenas
em um arremesso, o módulo da velocidade da bola chegou a alguns quilômetros de raio. Essas estrelas
162 km/h, imediatamente após deixar a mão do arremessador. realizam um movimento de rotação, emitindo
Sabendo que o tempo de contato entre a bola e a mão do uma grande quantidade de radiação
jogador foi de 0,07 s, o módulo da força média aplicada na eletromagnética a uma frequência bem
bola foi de definida. Quando detectamos uma estrela de
nêutrons através desse feixe de radiação,
a) 324,0 N. damos o nome a esse objeto de Pulsar.
Considere que um Pulsar foi detectado, e que
b) 90,0 N. o total de energia cinética relacionada com
seu movimento de rotação equivale a 2×1042
c) 6,3 N. J. Notou-se que, após um ano, o Pulsar
perdeu 0,1% de sua energia cinética,
d) 11,3 N principalmente em forma de radiação
eletromagnética. A potência irradiada pelo

134
Pulsar vale (Se necessário, utilize a aproximação 1 ano ~
3,6×107 s.)

a)7,2 1046 W.
b)2,0 1039 W.
c)5,6 1031 W.
d)1,8 1042 W.

IMPULSO, COLISÕES E
5) Em junho de 2017 uma intensa onda de calor atingiu os QUANTIDADE DE
EUA, acarretando uma série de cancelamentos de voos do
aeroporto de Phoenix no Arizona. A razão é que o ar
MOVIMENTO
atmosférico se torna muito rarefeito quando a temperatura
sobe muito, o que diminui a força de sustentação da aeronave 1) Tempestades solares são causadas por um
em voo. Essa força, vertical de baixo para cima, está fluxo intenso de partículas de altas energias
associada à diferença de pressão ΔP entre as partes inferior ejetadas pelo Sol durante erupções solares.
e superior do avião. Considere um avião de massa total m = 3 Esses jatos de partículas podem transportar
×105 kg em voo horizontal. Sendo a área efetiva de bilhões de toneladas de gás eletrizado em
sustentação do avião A = 500 m2 , na situação de voo altas velocidades, que podem trazer riscos de
horizontal ΔP vale danos aos satélites em torno da Terra.
Considere que, em uma erupção solar em
a)5x103 N/m2. particular, um conjunto de partículas de massa
b)6x103 N/m2. total mp = 5 kg, deslocando-se com
c)1,5x106 N/m2. velocidade de módulo vp = 2x105 m/s, choca-
d)1,5x108 N/m2. se com um satélite de massa Ms = 95 kg que
se desloca com velocidade de módulo igual a
Vs = 4x103 m/s na mesma direção e em
6) As escadas flutuantes em cascata feitas em concreto sentido contrário ao das partículas. Se a
armado são um elemento arquitetônico arrojado, que confere massa de partículas adere ao satélite após a
leveza a uma estrutura intrinsecamente massiva. Essas colisão, o módulo da velocidade final do
escadas são apoiadas somente na extremidade superior conjunto será de
(normalmente em uma parede) e no chão. O esquema
abaixo mostra as forças aplicadas na escada pela parede a) 102.000 m/s.

e pelo chão além da força peso b) 14.000 m/s.


aplicada pela Terra, todas pertencentes a um plano vertical. c) 6.200 m/s.
d) 3.900 m/s.

2) As agências espaciais NASA (norte-


americana) e ESA (europeia) desenvolvem
um projeto para desviar a trajetória de um
asteroide através da colisão com uma sonda
especialmente enviada para esse fim. A
previsão é que a sonda DART (do inglês,
“Teste de Redirecionamento de Asteroides
Duplos”) será lançada com a finalidade de se
chocar, em 2022, com Didymoon, um pequeno
asteroide que orbita um asteroide maior
Com base nesse esquema, é correto afirmar que chamado Didymos.

135
A massa da sonda DART será de msonda = 300 kg , e ela deverá e assim privado de seu equivalente é um peso
ter a velocidade vsonda = 6 km/s imediatamente antes de atingir adicional suficiente para imergir toda a cabeça,
Didymoon. ao passo que a ajuda casual do menor pedaço
de madeira habilitar-nos-á a elevar a cabeça,
para olhar em derredor”.
Assim, a energia cinética da sonda antes da colisão será igual
a (Edgar Alan Poe, apud João Zanetic, Física e Literatura:
construindo uma ponte entre as duas culturas. 2006, p. 61.
Disponível em http://www.scielo.br/pdf/hcsm/v13s0/03.pdf.
a)1,8 x 103 J. Acessado em 05/07/2016.)

b)5,4 x 103 J.
c)1,8 x 106 J.
A partir do raciocínio científico presente no
d)5,4 x 109 J. excerto acima, é correto afirmar que:

a)A densidade de massa de um corpo humano


3) As agências espaciais NASA (norte-americana) e ESA é aproximadamente igual à da água, e retirar
(europeia) desenvolvem um projeto para desviar a trajetória o braço para fora da água reduziria a força de
empuxo, contrária ao peso do corpo,
de um asteroide através da colisão com uma sonda
contribuindo para seu afundamento.
especialmente enviada para esse fim. A previsão é que a
sonda DART (do inglês, “Teste de Redirecionamento de b)O corpo humano está submetido a uma
Asteroides Duplos”) será lançada com a finalidade de se aceleração gravitacional aproximadamente
chocar, em 2022, com Didymoon, um pequeno asteroide que igual à que atua na porção de água de mesma
orbita um asteroide maior chamado Didymos. massa que o corpo, e retirar o braço para fora
da água reduziria a força de empuxo, contrária
ao peso do corpo, contribuindo para seu
Numa colisão inelástica da sonda DART com o asteroide
afundamento.
Didymoon,
c)A densidade de massa de um corpo humano
a)a energia cinética do conjunto sonda + asteroide é é aproximadamente igual à da água, e retirar
conservada e o momento linear do conjunto também é o braço para fora da água aumentaria a força
conservado. de empuxo, contrária ao peso do corpo,
contribuindo para seu afundamento.
b)a energia cinética do conjunto sonda + asteroide não é
d)O corpo humano está submetido a uma
conservada; já o momento linear do conjunto é conservado. aceleração gravitacional aproximadamente
igual à que atua na porção de água de mesma
c)a energia cinética do conjunto sonda + asteroide é massa que o corpo, e retirar o braço para fora
conservada; já o momento linear do conjunto não é da água aumentaria a força de empuxo,
conservado. contrária ao peso do corpo, contribuindo para
seu afundamento.
d)a energia cinética do conjunto sonda + asteroide não é
conservada e o momento linear do conjunto também não é
conservado. 2) Na questão, sempre que necessário, use
aceleração da gravidade g = 10 m/s2,
aproxime π = 3,0 e 1 atm = 105 Pa.
HIDROESTÁTICA
Em uma pescaria é utilizada uma linha com
1) No conto “O mistério de Maria Rogêt”, de Edgar Alan Poe, boia e anzol. Inicialmente, na posição de
ao procurar esclarecer a verdadeira identidade de um cadáver espera, a linha acima da boia mantém-se
jogado na água, o detetive Dupin, mediante a análise dos fatos frouxa e a boia flutua, ficando com 1/3 do seu
e das informações da imprensa, faz uso do seguinte raciocínio volume submerso (figura 1). Quando o peixe é
científico: fisgado, a boia é puxada, ficando totalmente
submersa e momentaneamente parada;
“ (...) a gravidade específica do corpo humano, em sua simultaneamente, a linha que a une ao anzol
condição natural, é quase igual à massa de água doce que ele fica esticada verticalmente (figura 2). A parte
desloca. (...) É evidente, contudo, que as gravidades do corpo superior da linha, acima da boia, mantém-se
e da massa de água deslocada são muito delicadamente frouxa.
equilibradas, e que uma ninharia pode fazer com que uma
delas predomine. Um braço, por exemplo, erguido fora d'água

136
a)1,4 x 103 Pa.
b)20 x 104 Pa.
c)40 x 104 Pa.
d)7,0 x 104 Pa.

GASES

1) Fazer vácuo significa retirar o ar existente


em um volume fechado. Esse processo é
usado, por exemplo, para conservar alimentos
Nessa situação, quanto vale o módulo da tensão da linha que ditos embalados a vácuo ou para criar
une a boia ao anzol? Despreze as massas da linha e do anzol, ambientes controlados para experimentos
bem como o atrito viscoso com a água. científicos. A figura abaixo representa um
pistão que está sendo usado para fazer vácuo
a)O peso da boia. em uma câmara de volume constante VC = 2,0
b)O dobro do peso da boia.
c)O peso do peixe menos o peso da boia. litros. O pistão, ligado à câmara por uma
d)O peso do peixe menos o dobro do peso da boia. válvula A, aumenta o volume que pode ser
ocupado pelo ar em VP = 0,2 litros. Em
seguida, a válvula A é fechada e o ar que está
dentro do pistão é expulso através de uma
3) Drones vêm sendo utilizados por empresas americanas válvula B, ligada à atmosfera, completando um
para monitorar o ambiente subaquático. Esses drones podem
ciclo de bombeamento. Considere que o ar se
substituir mergulhadores, sendo capazes de realizar
mergulhos de até cinquenta metros de profundidade e operar comporte como um gás ideal e que, durante o
por até duas horas e meia. ciclo completo, a temperatura não variou. Se a
pressão inicial na câmara é de Pi = 33 Pa, a
Frequentemente esses drones são usados para medir a pressão final na câmara após um ciclo de
temperatura da água (T) em função da profundidade (d), a bombeamento será de
partir da superfície (d = 0), como no caso ilustrado no gráfico
a seguir (dados adaptados).

a) 30,0 Pa.
b) 330,0 Pa.
c) 36,3 Pa.
d) 3,3 Pa.

2) Balões de Mylar metalizados são bastante


comuns em festas, sendo comercializados em
Considere que a densidade da água é p = 1000 kg/m3 e lojas e parques. Ascendem na atmosfera
constante para todas as profundidades medidas pelo drone. quando preenchidos com gás hélio e só
murcham definitivamente se apresentarem
Qual é a diferença de pressão hidrostática entre a superfície e
algum vazamento. Imagine que um cliente
uma profundidade para a qual a temperatura da água é T =
19º C? tenha comprado um desses balões e, após
sair da loja, retorna para reclamar, dizendo:

137
“não bastasse a noite fria que está lá fora, ainda tenho que TERMOLOGIA
voltar para trocar o balão com defeito”.

O vendedor da loja, depois de conversar um pouco com o 1) Materiais termoelétricos são aqueles com
cliente, sugere não trocá-lo e afirma que o balão está alto potencial de transformar calor em energia
elétrica. A capacidade de conversão de calor
a) como saiu da loja; garante que estará normal na casa do em eletricidade é quantificada pela grandeza
cliente, pois as moléculas do gás irão aumentar de tamanho,
voltando ao normal num ambiente mais quente.
, que é adimensional e função da
temperatura T e das propriedades do material:
b)como saiu da loja; garante que não há vazamento e que o
resistividade elétrica ρ, condutividade térmica
balão estará normal na casa do cliente, considerando que o
κ, coeficiente Seebeck S . O gráfico a seguir
gás irá se expandir num ambiente mais quente.
mostra ρ em função de T para certo material
termoelétrico. Analisando o gráfico e
c)murcho; propõe enchê-lo com ar, pois o balão é menos
considerando κ = 2,0 W/(m×K) e S = 300 μV/K
permeável ao ar, o que garantirá que ele não irá murchar lá
para esse material, a uma temperatura T = 300
fora e, na casa do cliente, irá se comportar como se estivesse
K , conclui-se que a grandeza F desse material
cheio com hélio.
a essa temperatura vale
d)murcho; propõe enchê-lo novamente com hélio e garante
que o balão não voltará a murchar quando for retirado da loja,
a) 0,003.
mantendo o formato na casa do cliente.
b) 0,6.
c) 0,9.
ESTÁTICA
d) 90

1) A figura abaixo ilustra uma alavanca que gira em torno do


ponto O. Dois triângulos, do mesmo material e de mesma
espessura, estão presos por fios de massa desprezível nos 2) Drones vêm sendo utilizados por empresas
extremos da alavanca. Um triângulo é equilátero; o outro é
retângulo e isósceles, e sua hipotenusa tem o mesmo
comprimento que os lados do triângulo equilátero. Note que,
neste caso, o peso dos objetos é proporcional à sua área.
Conclui-se que, na condição de equilíbrio da alavanca, a razão
das distâncias, i/e, é igual a

americanas para monitorar o ambiente


Sempre que necessário, use aceleração da gravidade g = 10 subaquático. Esses drones podem substituir
m/s2. mergulhadores, sendo capazes de realizar
mergulhos de até cinquenta metros de
a) √3. profundidade e operar por até duas horas e
b) √3/3. meia.
c) 2.
d) 3.

138
Leve em conta ainda os dados mostrados no gráfico anterior, irônica à marginalização do sujeito, reduzido à
referentes à temperatura da água (T) em função da “massa inerte” suspensa.
profundidade (d). Considere um volume cilíndrico de água cuja (Adaptado de Klaus R. Mecke, A imagem da Física na Literatura.
Gazeta de Física, 2004, p. 6-7.)
base tem área ,a face superior está na superfície
a uma temperatura constante e a face inferior está a uma Segundo Mecke, a função literária de algumas
profundidade d a uma temperatura constante como noções da Física, presentes em determinados
mostra a figura a seguir. Na situação estacionária, nas romances, expressa
proximidades da superfície, a temperatura da água decai
linearmente em função de d, de forma que a taxa de a) a falta de liberdade do sujeito nas relações
transferência de calor por unidade de tempo (Φ), por sociais, mas o uso da independência do
condução da face superior para a face inferior, é período do pêndulo simples com a massa do
corpo suspenso, feito por Umberto Eco, está
incorreto.
aproximadamente constante e dada por

b)a revogação parcial das leis da natureza, e


em que é a condutiva térmica da água. o uso da independência do período do
pêndulo simples com a massa do corpo
Assim, a razão é constante para todos os pontos suspenso, feito por Umberto Eco, está correto.
da região de queda linear da temperatura da água mostrados
no gráfico apresentado. c)a concordância quanto ao modo como
representamos a natureza, mas o uso da
Utilizando as temperaturas da água na superfície e na
independência do período do pêndulo simples
profundidade d do gráfico e a fórmula fornecida, conclui-se
com a massa do corpo suspenso, feito por
que, na região de queda linear da temperatura da água em
Umberto Eco, está incorreto.
função de d, Φ é igual a

d)a privação da liberdade do ser humano, e o


uso da independência do período do pêndulo
simples com a massa do corpo suspenso, feito
por Umberto Eco, está correto.

a) 0,03 W. ONDULATÓRIA
b) 0,05 W.
c) 0,40 W. 1) Pesquisas mostram que a curcumina —
d) 1,20 W. substância extraída da cúrcuma — pode ser
usada como fotossensibilizador na terapia
fotodinâmica (TFD). Nessa técnica, se houver
absorção de luz pelo fotossensibilizador, que
está na célula, ocorre reação com o oxigênio
FÍSICA MODERNA
molecular gerando espécies químicas
citotóxicas, que promovem a oxidação de
1) Uma função literária central da fórmula seria simbolizar a lipídios, aminoácidos e proteinas, levando à
violência. A fórmula torna-se metáfora para a violência, para o morte celular. Deste modo, a TFD pode ser
calculismo desumano, para a morte e para a fria mecânica - usada para o tratamento de câncer, lesões
para o golpe de força. Recorde-se também O Pêndulo de pré-malignas, etc. O gráfico a seguir mostra a
Foucault, de Umberto Eco, em que a fórmula do pêndulo intensidade de absorção de luz pela
caracteriza o estrangulamento de um ser humano. Passo a curcumina e a intensidade de emissão de luz
citar: “O período de oscilação, T, é independente da massa do de dois LEDs, um vermelho e um branco, em
corpo suspenso (igualdade de todos os homens perante função do comprimento de onda da luz.
Deus)... Também aqui a fórmula constitui uma referência

139
(Adaptado de hTtp://cepof.ifsc.usp.br/pesquisa/terapia-fotodinamica. Acessado em GHz, e que um telescópio de infravermelho
15/07/2018.)
detecta ondas eletromagnéticas originadas
em corpos do sistema solar na frequência de
finfravermelho = 30THz .
Qual é a razão entre os correspondentes
comprimentos de onda no vácuo,
λrádio/λinfravermelho ?

a)5,0 x 10-5.

b)6,7 x 10-5.
c)2,0 x 104.

d)6,0 x 1012.

Levando em conta o gráfico e os princípios da TFD


apresentados no enunciado, para o uso de curcumina na TFD, MOVIMENTO VERTICAL
1)Existem na natureza forças que podemos
a)somente o LED vermelho seria adequado.
observar em nosso cotidiano. Dentre elas, a
b)somente o LED branco seria adequado.
força gravitacional da Terra e a força elétrica.
c)os dois LEDs seriam adequados.
Num experimento, solta-se uma bola com
d)nenhum dos LEDs seria adequado
carga elétrica positiva, a partir do repouso, de
uma determinada altura, numa região em que
há um campo elétrico dirigido verticalmente
para baixo, e mede-se a velocidade com que
2) A depilação a laser é um procedimento de eliminação dos
ela atinge o chão. O experimento é realizado
pelos que tem se tornado bastante popular na indústria de
primeiramente com uma bola de massa m e
beleza e no mundo dos esportes. O número de sessões do
carga q, e em seguida com uma bola de
procedimento depende, entre outros fatores, da coloração da
massa 2m e mesma carga q.
pele, da área a ser tratada e da quantidade de pelos nessa
área.

Três tipos de laser comumente utilizados para depilação têm


comprimentos de onda λ1 ≈ 760 nm, λ2 ≈ 800 nm e λ3 ≈ 1060
nm, respectivamente.

Se a velocidade da luz vale c = 3,0 x 108 m/s, o laser de maior Desprezando a resistência do ar, é correto
frequência tem uma frequência de aproximadamente afirmar que, ao atingir o chão,

a)39 x 1014 Hz. a)as duas bolas terão a mesma velocidade.


b)2,8 x 105 Hz.
c)2,5 x 1015 Hz. b)a velocidade de cada bola não depende do
d)3,7 x 1012 Hz. campo elétrico.

c)a velocidade da bola de massa m é maior


3) Em 2019 foi divulgada a primeira imagem de um buraco que a velocidade da bola de massa 2m.
negro, obtida pelo uso de vários radiotelescópios. Também
recentemente, uma equipe da NASA propôs a utilização de d)a velocidade da bola de massa m é menor
telescópios de infravermelho para detectar antecipadamente que a velocidade da bola de massa 2m.
asteroides que se aproximam da Terra. Considere que um
radiotelescópio detecta ondas eletromagnéticas provenientes
de objetos celestes distantes na frequência de frádio = 1,5

140
gabarito
(PS: sempre veja os erros como uma oportunidade de
aprendizado. Não fique triste se errar, você está dando o seu
melhor.)

Gravitação universal 1D 2B 3A 4B

Cinemática 1D 2C 3D 4B 5C 6A 7A 8A 9B 10D 11A

Calorimetria 1B 2D 3A 4C 5A 6D 7C

Trabalho e energia 1A 2B 3C 4C 5B

Eletrodinâmica 1C 2A 3C 4A 5D 6B 7D 8B 9B

Óptica 1A 2B 3B 4B 5A 6A 7A

Dinâmica 1C 2B 3C 4C 5B 6A

Impulso 1C 2D 3B

Hidrostática 1A 2B 3D

Movimento circular 1B

Gases 1A 2B

Estática 1A

Termologia 1C 2A

Física moderna 1D

Ondulatória 1B 2A 3C

Movimento vertical 1C

141
Geografia
b) A atual população indígena brasileira
supera, em contingente e em etnias, os
habitantes nativos encontrados no início da
colonização no século XVI.
POPULAÇÃO
c) Enquanto a população indígena do centro-
sul obteve crescimento demográfico, a
1) população habitante da Amazônica
apresentou forte redução de contingente.

d) Verifica-se a tendência de reversão da


curva demográfica, tendo em vista o
crescimento atual da população indígena no
país, sendo que a maior parcela desse
contingente vive em áreas rurais.

3) Frequentemente o terrorismo recorre a


ações de grande impacto. Contudo, seu
objetivo maior é o de influenciar os espíritos;
antes de tudo, ele visa a aterrorizar, e se
distingue da criminalidade. Invocando
reivindicações políticas, de natureza social,
econômica ou religiosa, o terrorismo

a) realiza-se apenas no âmbito internacional


enquanto a criminalidade é marcada pelo
objetivo primeiro do ganho financeiro.
O gráfico acima apresenta as progressões do tamanho da
população e do incremento populacional, por décadas, de
b)realiza-se nacional e internacionalmente,
1750 até a projeção para 2050. A partir de 1990, verifica-se
enquanto a criminalidade é marcada pelo
uma importante mudança de comportamento do incremento.
objetivo primeiro do ganho financeiro.
Contudo, a população continua a crescer porque o incremento
populacional
c)realiza-se apenas no âmbito internacional,
enquanto a criminalidade é marcada
a) continua positivo.
basicamente por objetivos ideológicos.
b) passou a ser negativo.
d)realiza-se nacional e internacionalmente,
enquanto a criminalidade é marcada
c) manteve-se constante.
basicamente por objetivos ideológicos.
d) está em queda.

4) HABITAÇÃO - BRASIL E SÃO PAULO –


2) Considerando as atuais características demográficas da
2015 (em unidades de habitações)
população indígena brasileira, assinale a alternativa correta.

a) Ainda existem etnias indígenas isoladas no interior da


Amazônia, vivendo em grandes aldeias, com predominância
de idosos, e desenvolvendo roças para o autoconsumo.

142
Considerando essa situação geográfica,
indique os países que compõem a região do
TNAC e a atual estratégia adotada pela
população emigrante.

a)Venezuela, Costa Rica, Nicarágua;


pequenos grupos deslocam-se por trens para
fugir da violência dos guias ilegais (coyotes).

b)El Salvador, Honduras, Guatemala; os


emigrantes deslocam-se a pé em grandes
caravanas por ser mais seguro e para se
beneficiarem de apoio mútuo.

c)Cuba, Haiti, República Dominicana;


pequenos grupos deslocam-se em barcos,
por ser mais seguro e para diminuir os custos
da travessia.

d)Belize, Nicarágua, Guatemala; os


emigrantes deslocam-se a pé em grandes
caravanas para diminuir os custos com os
guias ilegais (coyotes).
Com base em seus conhecimentos e nos dados do gráfico,
assinale a alternativa correta.

a)O deficit habitacional no Brasil vem sendo enfrentado com a


construção de novos domicílios, o que tem resolvido GEOPOLÍTICA
satisfatoriamente a questão da moradia.
1) Um país da Europa Ocidental encontra-se
b)Os dados do gráfico confirmam que, em qualquer área do envolvido em discussões internas sobre
território brasileiro, há mais domicílios vagos em condições de separatismo entre as suas duas principais
serem ocupados que deficit habitacional. regiões: Flandres, ao norte, e Valônia, ao
Sul.Qual é esse país?
c)É muito provável que todas as classes sociais moradoras
nas cidades no Brasil sejam igualmente atingidas pelo a)Ucrânia. c) Bélgica
fenômeno urbano de deficit habitacional.
b)Suíça. d) Espanha

d) A correlação entre domicílios vagos e deficit habitacional


explica-se, em grande medida, pela especulação imobiliária,
que mantém imóveis fechados.
2) A Constituição Federal promulgada em
1988 define que a República Federativa
Brasileira compreende a União, os Estados
Federados, o Distrito Federal e os
5) O chamado Triângulo Norte da América Central (TNAC) é
municípios, todos autônomos.
uma das regiões mais violentas do planeta, equiparando-se
às zonas de guerra. Grupos organizados praticam
Das alternativas abaixo, aponte aquela que
diariamente extorsão, perseguição, sequestros,
apresenta corretamente atribuições que são
assassinatos, abuso sexual, entre outros crimes. Em 2018,
de competência exclusiva da União.
sob condições extremas de pobreza e violência, sem
escolha, milhares de pessoas do TNAC abandonaram suas
a) Promover o adequado ordenamento
casas, deslocando-se por perigosas rotas em direção ao
territorial, mediante planejamento e controle
México e aos EUA.

143
do uso, do parcelamento e da ocupação do solo urbano. a) A elevada mecanização da lavoura e as
exigências das leis trabalhistas levam os
b) Explorar os serviços e instalações nucleares e exercer antigos cortadores de cana a serem
monopólio estatal sobre a pesquisa, a lavra e o empregados nos setores de produção no
enriquecimento de minérios nucleares. interior das usinas de álcool e de açúcar.

c) Instituir as regiões metropolitanas, as aglomerações


b) A expansão dos canaviais e o aumento da
urbanas e as microrregiões administrativas constituídas por
produção de álcool e de açúcar permitem que
agrupamentos de municípios limítrofes.
os trabalhadores permaneçam empregados
d) Organizar e prestar, diretamente ou sob regime de durante todo o ano, reduzindo o trabalho
concessão ou permissão, serviços públicos de interesse sazonal.
local, incluído o transporte coletivo.
c) As usinas eliminam os pagamentos dos
trabalhadores por produtividade no corte da
AGRICULTURA cana, e, com isso, os ganhos salariais
passam a ser computados apenas pelos dias
trabalhados.
1) O território brasileiro se caracteriza por uma vasta gama
de usos agrícolas em função de sua sociodiversidade, que d) Os trabalhadores são migrantes sazonais
inclui as populações caiçaras, as geraizeiras, as ribeirinhas e que se deslocam para o trabalho manual nos
as faxinalenses. São características dessas populações: canaviais e retornam para suas antigas
regiões após a colheita, dedicando-se a
a) dedicação à pesca artesanal, agricultura de pousio,
atividades de subsistência.
espaços destinados a usos comuns e cultivo de gêneros
alimentícios voltado para a subsistência e o mercado local.
3) A imagem abaixo mostra a prática de plantio
b) dedicação à pesca predatória, agricultura de pousio, direto na palhada
espaços destinados ao arrendamento e cultivo de cana-de-
açúcar voltado para a produção de biocombustível.

c) dedicação à pesca artesanal, agricultura científica de


precisão, espaços destinados a usos privados e cultivo de
gêneros alimentícios voltado para o mercado local.

d) dedicação à pesca predatória, agricultura equiparável ao


agronegócio, espaços destinados a usos comuns e cultivo de
plantas voltado para a indústria química.

2) A observação do canavial fornece, numa primeira


impressão, a imagem de um mar de cana, um todo
homogêneo no qual se distribuem os trabalhadores. Essa
visão se desfaz quando se analisa o processo de trabalho.
Sobre esta prática, é correto afirmar:
Na medida em que se penetra no interior das relações de
produção, descortina-se um universo submerso, pilar básico
a) É uma prática conservacionista, em que há
de uma estrutura de dominação.
a incorporação dos restos vegetais de uma
(Adaptado de Maria Aparecida de Moraes Silva, Errantes do fim do século. cultura no próximo plantio, procurando
São Paulo: Fundação Editora da Unesp, 1999.) melhorar as características químicas e físicas
A respeito das relações de trabalho nas fazendas de cana- do solo.
de-açúcar em várias regiões do Brasil, é correto afirmar que:

144
b) É uma prática conservacionista, em que há a incorporação a) A organização do espaço geográfico nas
dos restos vegetais de uma cultura no próximo plantio, metrópoles brasileiras caracteriza-se, na
procurando melhorar unicamente as características químicas atualidade, pela tendência à homogeneização
do solo. das formas de habitar, em função da
existência de políticas urbanas e sociais
c) É uma prática conservacionista, em que há a exitosas.
incorporação dos restos vegetais de uma cultura no próximo
plantio, procurando melhorar unicamente as características
b) Os moradores do condomínio fechado e os
físicas do solo.
moradores da favela compartilham áreas
comuns de lazer, fato que expressa o
d) Apesar de diminuir os processos erosivos provocados
enfraquecimento dos conflitos entre as
pelo escoamento superficial da água, a prática não evita o
diferentes classes sociais na metrópole.
uso de queimadas esporádicas e não aumenta a fertilidade
química do solo.
c) A concentração da riqueza permite a uma
pequena parcela da sociedade viver em
URBANIZAÇÃO condomínios fechados de alto padrão, que,
fortificados por aparatos de segurança,
aprofundam a fragmentação do espaço
1) A gestão pública e empresarial mantém relações urbano.
complexas, hierárquicas, de controle entre centros urbanos,
propagando decisões, definindo relações e destinando
investimentos. d) A favela é um espaço monofuncional,
exclusivamente residencial, desprovido de
(Adaptado de Regiões de Influência das cidades – 2007. IBGE. Disponível serviços urbanos básicos como energia
em www.mma.gov.br/estrutura/PZEE_/arquiv os/regra_28.pdf.)
elétrica, água, saneamento, limpeza e,
portanto, equilibradamente coeso à malha
Segundo o IBGE, os três principais centros de gestão
urbana.
empresarial que exercem acentuado comando sobre o
conjunto do território brasileiro são, em ordem de
importância, 3) O processo contemporâneo de
metropolização do espaço e a grande
metamorfose que vem ocorrendo em algumas
a) Brasília, São Paulo, Rio de Janeiro.
metrópoles têm significado mudanças
territoriais expressivas. Há intensificação e
b) Rio de Janeiro, São Paulo, Brasília.
multiplicidade de fluxos de pessoas,
mercadorias e informações, bem como
c) São Paulo, Rio de Janeiro, Brasília.
crescimento do número de cidades
conurbadas, onde não se distingue muito bem,
d) Brasília, Rio de Janeiro, São Paulo.
na continuidade da imensa área construída, o
limite municipal de cada uma delas. Tanto em
São Paulo, por exemplo, como na Cidade do
2) Considerando a imagem, assinale a alternativa correta.
México, em Buenos Aires ou em Santiago,
vamos encontrar a manifestação desse
momento mais avançado da urbanização.

(Adaptado de Sandra Lencioni, A metamorfose de São


Paulo: o anúncio de um novo mundo de aglomerações
difusas. Revista Paranaense de Desenvolvimento,
Curitiba, n.120, p. 133-148, jan./jun., 2011.)

Tendo em vista a metrópole contemporânea, é


correto afirmar que se trata de uma

145
a) única aglomeração, mas dispersa e fragmentada, onde (Oswald de Andrade, Pau Brasil. São Paulo: Globo, 2003,
p.159.)
fluxos imateriais regem um conjunto diferenciado de lugares.

b) única aglomeração, pois é compacta e coesa, onde fluxos


A imagem e o poema revelam a dinâmica do
imateriais regem um conjunto diferenciado de lugares.
espaço na
cidade de São Paulo na primeira metade do
c) metrópole compacta e coesa, organizada exclusivamente
século XX.Qual alternativa abaixo formula
por uma estrutura hierárquica de fluxos imateriais.
corretamente essa dinâmica?
d) metrópole dispersa e fragmentada, organizada
a) Trata-se da ascensão de um moderno
exclusivamente por uma estrutura hierárquica de fluxos
mundo urbano, onde coexistiam
materiais.
harmonicamente diferentes temporalidades,
funções urbanas, sistemas técnicos e formas
de trabalho, viabilizando-se, desse modo, a
coesão entre o espaço da cidade e o tecido
social.
4)

b) Trata-se de um espaço agrário e


acomodado, num período em que a
urbanização não tinha se estabelecido, mas
que abrigava em seu interstício alguns vetores
da modernização industrial.

c) Trata-se de um espaço onde coexistiam


distintas temporalidades: uma atrelada ao
ritmo lento de um passado agrário e, outra,
atrelada ao ritmo acelerado que caracteriza a
modernidade urbana.

d) Trata-se de uma paisagem urbana e uma


divisão do trabalho típicas do período colonial,
pois a metropolização é um processo
desencadeado a partir da segunda metade do
século XX.

5)

Pobre alimária
O cavalo e a carroça
Estavam atravancados no trilho
E como o motorneiro se impacientasse
Porque levava os advogados para os escritórios
Desatravancaram o veículo
E o animal disparou
Mas o lesto carroceiro
Trepou na boleia
E castigou o fugitivo atrelado
Com um grandioso chicote

146
Santa Catarina exemplifica um fenômeno nacional: a criação
de Regiões Metropolitanas (RMs). Considerando a aplicação
desse instrumento de planejamento territorial no Estado em
questão, assinale a alternativa correta.

a)Está em curso a formação de uma cidade-região no Estado,


impulsionando profundas transformações na rede urbana, o
que justificou a criação das onze RMs para viabilizar o
planejamento e a gestão territorial.

b)O real processo de metropolização em Santa Catarina,


dinamizado nas últimas décadas, não abrange a totalidade do
Estado, permitindo concluir que a criação das onze RMs
obedeceu a critérios mais políticos do que técnicos.

c)O adensamento populacional, com a formação de grandes


cidades conurbadas em todas as regiões do Estado, levou ao
diagnóstico de que há um processo generalizado de
metropolização e justificou a criação das onze RMs.

d) Em função de intensa urbanização regional foi criada a RM


de Florianópolis nos anos 1970; já as demais RMs somente
se justificaram a partir das mudanças demográficas e
econômicas da década passada.

CARTOGRAFIA

1) PROJEÇÕES
a) A, cônica; B, azimutal; C, cilíndrica.
A representação de uma esfera num plano estabelece um b) A, cilíndrica; B, cônica; C, azimutal.
desafio técnico resolvido a partir de distintas formas de c) A, azimutal; B, cilíndrica; C, cônica.
projeção, cada uma delas adequada a um objetivo. Faça a d) A, cilíndrica; B, azimutal; C, cônica
correspondência entre cada um dos mapas e sua correta
projeção.

2) A imagem abaixo corresponde a um


fragmento de uma carta topográfica em escala
1:50.000. Considere que a distância entre A e
B é de 3,5 cm.

A partir dessas informações, é correto afirmar


que:

a) O rio corre em direção sudeste, sendo sua


margem esquerda a de maior declividade.
Apresenta um comprimento total de 17.500
metros.

147
b) O rio corre em direção sudoeste, sendo a margem direita a base nessas informações e considerando que
de maior declividade. Apresenta um comprimento total de o continente europeu adota, neste período do
1.750 quilômetros. ano, o horário de verão, que adianta os
relógios em uma hora, indique o dia e a hora
c) O rio corre em direção sudeste, sendo sua margem em que os dois amigos chegaram ao
esquerda a de maior declividade. Apresenta um comprimento Aeroporto Internacional Domodedovo em
total de 1.750 metros. Moscou
a)11 de junho, às 13 horas.
d) O rio corre em direção sudoeste, sendo sua margem
b)11 de junho, às 16 horas.
esquerda a de maior declividade. Apresenta um comprimento
c)11 de junho, às 17 horas.
total de 175 metros.
d)10 de junho, às 16 horas.

5) As coordenadas geográficas são um


3) A figura a seguir exibe uma representação estilizada do sistema de linhas imaginárias traçadas sobre
mapa do Estado de São Paulo. As linhas pontilhadas o globo terrestre ou um mapa. Através da
horizontais e verticais indicam intervalos iguais de longitude e interseção de um meridiano com um paralelo,
latitude, e o ponto preto representa a cidade de Campinas. podemos localizar cada ponto da superfície da
Terra. Como a Terra apresenta uma superfície
quase esférica, é possível determinar dois
pontos diametralmente opostos, denominados
antípodas. Apenas algumas cidades
brasileiras têm uma cidade antípoda, como
Coari (AM) e Pontes e Lacerda (MT).

Assinale a alternativa que indica duas cidades


antípodas.

a)Pontes e Lacerda (Brasil) – 15º latitude S e


60º longitude W; Candelária (Filipinas) – 15º
latitude N e 60º longitude E.
Considere que o Estado de São Paulo está, aproximadamente,
entre as latitudes 20𝑜 e 25𝑜 Sul e entre as longitudes 44𝑜 e b)Coari (Brasil) – 4º latitude S e 63° longitude
54𝑜 Oeste. A partir da representação acima, conclui-se que W; Temon (Malásia) – 4º latitude N e 63º
Campinas se localiza entre longitude E.

a)as latitudes 24𝑜 e 25𝑜 Sul. c)Coari (Brasil) – 4º latitude S e 63° longitude
b)as latitudes 21𝑜 e 22𝑜 Sul. W; Temon (Malásia) – 4º latitude N e 117º
c)as longitudes 46𝑜 e 48𝑜 Oeste. longitude E.
d)as longitudes 50𝑜 e 52𝑜 Oeste.
d)Pontes e Lacerda (Brasil) – 15º latitude S e
60º longitude W; Candelária (Filipinas) – 75º
latitude N e 120º longitude E.
4) Dois amigos planejaram assistir à abertura da Copa do
Mundo em Moscou. Eles partiram no dia 10 de junho de 2018
CLIMA
do Aeroporto Presidente Juscelino Kubitschek (Brasília),
situado a 45º de longitude Oeste, às 16 horas, com destino ao
Aeroporto de Heathrow (Londres), situado a 0º de longitude. 1) Em algumas localidades do Estado de
O voo teve duração de 10 horas. Os dois amigos esperaram Santa Catarina, costuma-se registrar neve
por três horas para partirem em direção ao Aeroporto durante o período de inverno, caso de São
Internacional Domodedovo (Moscou), situado a 60º de Joaquim e de outros municípios da região
longitude Leste, e o segundo voo durou quatro horas.Com serrana. Qual das alternativas abaixo associa

148
corretamente dois fatores geográficos que favorecem a que paralisou por 30 horas o principal porto do
ocorrência do fenômeno na região indicada? país, inundou vias e causou transtornos para
a mobilidade urbana, o funcionamento de
a) Altitudes acima de 1.000 metros; latitude entre 23º S e 66° empresas e do comércio.. As ressacas
S resultam

a) das dinâmicas das massas de ar formadas


b) Altitudes abaixo de 1.000 metros; latitude entre 66° S e 90°
nas áreas oceânicas, sempre no verão; são
S.
causadas por diferença de pressão
atmosférica de áreas de baixa pressão nos
c) Altitudes acima de 1.000 metros; latitude entre 23° N e 66°
oceanos para áreas de alta pressão nos
N.
continentes.
d) Altitudes abaixo de 1.000 metros; latitude entre 66° N e 90°
b) do contato de massas de ar com
N.
características termodinâmicas semelhantes,
formando sistemas de circulação frontais;
quanto menor a umidade do sistema, maior é
a instabilidade atmosférica.
2) A figura a seguir exibe a imagem de um ciclone.

c)da ação dos sistemas de ciclones


extratropicais, especialmente no inverno; o
deslocamento de grandes volumes de água
decorre da diferença de pressão atmosférica,
que produz ventos intensos.

d) da ação de ciclones tropicais formados no


Atlântico Sul, sempre nos meses de inverno;
nesta estação do ano são menores as
diferenças de temperatura entre o polo sul e o
equador.

4)

É correto afirmar que o ciclone em questão

a)ocorreu no Hemisfério Sul e corresponde a uma área de alta


pressão atmosférica.

b)pode ocorrer em qualquer hemisfério, independentemente


da pressão atmosférica.

c)ocorreu no Hemisfério Norte, em zonas tropicais e de baixa


pressão atmosférica.

d)ocorreu no Hemisfério Sul e corresponde a uma área de


baixa pressão atmosférica.
O climograma acima refere-se a uma região

3) Conforme foi noticiado na mídia, no dia 21 de agosto de


2016, a cidade de Santos (SP) foi atingida por uma ressaca

149
a)subtropical, onde as temperaturas mais altas estão Considerando que houve redução de smog na
concentradas no verão e as precipitações estão concentradas cidade de São Paulo durante a greve dos
no outono. caminhoneiros e levando em conta as
condições climáticas descritas no gráfico,
b)polar, onde as temperaturas mais baixas estão infere-se que ocorreu maior redução do
concentradas no inverno e as precipitações estão bem
distribuídas ao longo do ano. a) smog fotoquímico, que ocorre em presença
de luz, é comum nos dias mais quentes e
c) tropical, onde as altas temperaturas estão bem distribuídas secos, e tem sua origem nos gases liberados
ao longo de todo o ano e as precipitações estão concentradas pelos automóveis, cuja composição contém
no verão. dióxido de enxofre e material particulado.

d) temperada, onde as temperaturas médias mantêm-se ao b) smog fotoquímico, que ocorre em presença
longo de todo o ano e as precipitações estão concentradas no de luz, é comum nos dias mais frios e uÚmidos,
inverno. e tem sua origem nos gases liberados pela
atividade industrial, cuja composição contém
dióxido de nitrogênio e hidrocarbonetos não
queimados.
5) O termo smog se forma pela junção das palavras smoke
(fumo) e fog (neblina). Ele designa o resultado da mistura de c)smog industrial, que acompanha a inversão
um processo natural (a neblina) com os fumos produzidos pela térmica, é comum nos dias mais quentes e
atividade industrial e queima de combustíveis fósseis, secos, e tem sua origem nos gases liberados
originando um tipo de nevoeiro que pode ser altamente tóxico. pelos automóveis, cuja composição contém
Esse fenômeno afeta principalmente as metrópoles, como dióxido de nitrogênio e hidrocarbonetos não
São Paulo, detentora de 30% da frota de automóveis no Brasil. queimados.
Um fato interessante ocorreu em 2018, com a greve dos
caminhoneiros: a poluição caiu pela metade, segundo a d)smog industrial, que acompanha a inversão
Cetesb. Com a falta de combustíveis, houve menor circulação térmica, é comum nos dias mais frios e umidos,
de carros na capital; além disso, a greve teve impacto na e tem sua origem nos gases liberados pela
produção industrial, pela falta de insumos e de pessoal. atividade industrial, cuja composição contém
Especialistas esperam que essa situação atípica na cidade dióxido de enxofre e material particulado.
leve à criação de políticas públicas voltadas à diminuição da
poluição atmosférica.

Médias de Umidade Relativa e Temperatura ASPECTOS AMBIENTAIS

1) No mês de julho de 2014, uma chuva de


granizo em uma praia do rio Ob, na cidade de
Novosibirsk, na Sibéria, produziu duas vítimas
fatais. Esse tipo de evento atmosférico é
relativamente raro em latitudes médias e altas,
sendo sua ocorrência mais frequente em
regiões equatoriais, onde há maior incidência
de formação de nuvem do tipo cumulonimbus.

A ocorrência do mencionado fenômeno está


associada

a) ao fenômeno do “El Niño”, que produz mais


evaporação da água de rios, mares e canais,
afetando também as regiões temperadas e
polares.

150
b) a uma anomalia das condições atmosféricas locais, a)são medidas deliberativas e os países
resultante da influência dos ventos quentes vindos do sul da signatários pagarão multas pelo
Rússia. descumprimento das metas; os EUA não
c) ao período de verão, estação em que ocorre mais aceitam o papel da ONU na função de agente
frequentemente o aumento da temperatura média e maior fiscalizador.
evaporação da água.
b)são medidas propositivas e os países
d) ao deslocamento de nuvens da Europa mediterrânea, de signatários deverão definir metas para os
clima quente e úmido, produzindo chuvas torrenciais nas próximos anos; os EUA não concordam com o
regiões polares. controle externo sobre suas fontes poluidoras.

c)são medidas restritivas e os países


signatários sofrerão punições políticas e
2)“Rios caudalosos, florestas impenetráveis, tribos indígenas
econômicas se não atingirem as metas; os
desconhecidas e histórias de animais gigantes que se
EUA não aprovam a presença da Rússia no
alimentam de seres humanos. Um cenário assustador para a
acordo.
maioria, mas perfeito para aventureiros em busca de fama e
riqueza no final do século XIX e início do XX. Foi nessa época
d)são medidas normativas e os países
que a Amazônia recebeu milhares de trabalhadores para a
signatários deverão definir as estratégias a
indústria de extração da borracha e para a construção de uma
serem adotadas; os EUA não aceitam assumir
ferrovia de quase 400 quilômetros, que escoaria essa
as mesmas responsabilidades da Índia, o
produção cortando os rios Madeira e Mamoré, a oeste do atual
maior poluidor do planeta.
estado de Rondônia.”
(Cristina Romanelli, “A ferro e sangue”. Disponível em
http://www.revistadehistoria.com.br/secao/artigos-revista/a-ferro-e-sangue. Acessado
em 05/08/2016.)
4) Assinale a alternativa correta sobre a
A construção da Estrada de Ferro Madeira-Mamoré presença de agrotóxicos e de sementes
transgênicas na agricultura brasileira.
a) era um símbolo de progresso que contrastava com um surto
de febre amarela, pois a floresta, com suas características a)O uso de agrotóxicos e sementes
físicas, era um habitat propício para o mosquito do gênero transgênicas associa-se à busca de maior
Aedes. produtividade, sobretudo em áreas de
fronteira agrícola.
b) era um evidente desperdício de recursos, pois as condições
sanitárias da região eram precárias, e contribuiu para um b)As sementes transgênicas e o uso de
grande surto de cólera, comprometendo o plano de ocupar a agrotóxicos adequados ampliaram o interesse
fronteira territorial com a Bolívia. de países da União Europeia pelos produtos
c) era uma propaganda da pujança brasileira em contraponto agrícolas brasileiros.
aos vizinhos bolivianos e um surto de dengue ocorreu pela
presença de imigrantes que não tinham imunidade contra o c)O uso de agrotóxicos no Brasil reduziu a
mosquito do gênero Aedes. necessidade de aproveitamento das
sementes transgênicas nos cultivos agrícolas
d) foi bem sucedida, apesar de um surto de malária trazido de grãos no país.
pelos imigrantes oriundos do Nordeste e que dizimou a
população indígena da região. d) Por ser signatário de acordos internacionais,
o Brasil reduziu o uso de agrotóxicos e
sementes transgênicas em áreas próximas a
mananciais.
3) Em junho de 2017, o governo dos Estados Unidos da
América (EUA) se retirou do “Acordo de Paris”, assinado em
2015 por 195 países. Sobre as medidas previstas no Acordo
5) Altas concentrações de metais pesados
para a redução da emissão de gases do efeito estufa, e o
foram encontradas nas águas de inúmeras
motivo da saída dos Estados Unidos do referido acordo, é
bacias hidrográficas brasileiras. Esses
correto afirmar que

151
poluentes podem rapidamente se acumular em seres vivos. b)O acidente de Tchernóbil é um marco do
Por exemplo, peixes podem absorver metais pesados da água desmantelamento da URSS. O acidente gerou
e pela ingestão de alimentos, retendo-os em seu tecido danos ambientais e humanos que não foram
muscular. solucionados até hoje, uma vez que os
elementos lançados ao ambiente têm tempos
(Adaptado de Daniel P. de Lima e outros, Contaminação por metais pesados em peixes de meia-vida longos.
e água da bacia do rio Cassiporé, Estado do Amapá, Brasil. Acta Amazonica, Manaus,
45, pp. 405-414, 2015.)
c) O acidente de Tchernóbil é um marco do
Assinale a alternativa correta. fortalecimento da URSS. Ele gerou danos
ambientais e humanos que não foram
a) Metais pesados, como o urânio, são encontrados em solucionados até hoje, uma vez que os
maiores concentrações em herbívoros longevos ou do meio elementos lançados ao ambiente têm tempos
da teia alimentar, como tartarugas marinhas e peixes de fundo de meia-vida longos.
de rio.
d)A construção da Central Elétrica Atômica de
b) Metais pesados, como o mercúrio, são encontrados em Tchernóbil ocorreu em um contexto de
maiores concentrações em carnívoros do meio da teia expansão das relações da URSS com a
alimentar, como aves de rapina e peixes predatórios. Coreia do Norte e a China. Tendo em vista que
os elementos lançados ao ambiente têm
c) Metais pesados, como o ferro, são encontrados em maiores tempos de meia-vida curtos, novas
concentrações em herbívoros e carnívoros do topo da teia tecnologias químicas conseguiram sanar os
alimentar, como aves de rapina e peixes predatórios. danos ambientais e humanos gerados pelo
acidente.
d) Metais pesados, como o chumbo, são encontrados em
maiores concentrações em predadores longevos ou do topo
da teia alimentar, como aves de rapina e peixes predatórios.
VEGETAÇÃO

6) A catástrofe de Tchernóbil (1986) foi o mais grave desastre 1) As restingas podem ser definidas como
tecnológico do século XX. As explosões lançaram na depósitos arenosos produzidos por processos
atmosfera diversos elementos radioativos. Hoje, uma em cada de dinâmica costeira atual (fortes correntes de
cinco pessoas nas fronteiras da Bielorússia vive em território deriva litorânea, podendo interagir com
contaminado. Em consequência da ação constante de correntes de maré e fluxos fluviais), formando
pequenas doses de radiação, a cada ano, cresce no país o feições alongadas, paralelas ou transversais à
número de doentes de câncer, de deficientes mentais, de linha da costa. Podem apresentar
pessoas com disfunções neuropsicológicas e com mutações retrabalhamentos locais associados a
genéticas. processos eólicos e fluviais. Quando estáveis,
as restingas dão forma às “planícies de
(Adaptado de Svetlana Aleksiévitch, Vozes de Tchernóbil. São Paulo: Companhia das restinga”, com desenvolvimento de vegetação
Letras, 1997, p.10.)
herbácea e arbustiva e até arbórea. As
restingas são áreas sujeitas a processos
erosivos desencadeados, entre outros fatores,
A partir do documento acima e de seus conhecimentos, pela dinâmica da circulação costeira, pela
assinale a alternativa correta.
elevação do nível relativo do mar e pela
urbanização.
a)A construção da Central Elétrica Atômica de Tchernóbil
ocorreu em um momento de embate da URSS com o mundo (Adaptado de Célia Regina G. Souza e outros, Restinga:
ocidental capitalista. Tendo em vista que os elementos conceitos e emprego do termo no Brasil e implicações na
lançados ao ambiente têm tempos de meiavida curtos, novas legislação ambiental. São Paulo: Instituto Geológico,
2008.)
tecnologias químicas conseguiram sanar os danos ambientais
e humanos gerados pelo acidente.
É correto afirmar que as restingas existentes
ao longo da faixa litorânea brasileira são áreas

152
a) pouco sobrecarregadas dos ecossistemas costeiros, devido
ao modo como ocorreu a ocupação humana, com o processo
de urbanização.

b) onde a cobertura vegetal ocorre em mosaicos,


encontrando-se em praias, cordões arenosos, dunas,
depressões, serras e planaltos, sem apresentar diferenças
fisionômicas importantes.

c) suscetíveis à erosão costeira causada, entre outros fatores,


por amplas zonas de transporte de sedimentos, elevação do
nível relativo do mar e urbanização acelerada.

d) onde o solo arenoso não apresenta dificuldade para a


retenção de água e o acesso a nutrientes necessários ao
desenvolvimento da cobertura vegetal herbácea em praias e Considere a figura anterior e assinale a
dunas. alternativa correta.

a)As florestas têm um aumento na diversidade


2) A zona costeira brasileira abriga diversos ecossistemas de de suas espécies à medida que a precipitação
elevada relevância ambiental. Destacam-se, entre muitos aumenta e as temperaturas apresentam
outros, os manguezais. A respeito desse ecossistema costeiro, declínio.
é correto afirmar que são
b)Os desertos e as savanas ocorrem em todos
a) áreas de extensões aquáticas dispostas em paralelo ao os continentes, em áreas com temperaturas
litoral e isoladas por cordões litorâneos; mantêm comunicação elevadas e baixo volume de precipitação.
por canais com as águas fluviais e marinhas, possibilitando a
deposição e circulação de sedimentos originados dos dois c)A taiga apresenta espécies arbóreas de
ambientes e dos ventos. maior porte em razão da umidade proveniente
das baixas pressões de médias latitudes do
b)unidades geomorfológicas arenosas formadas pela ação Hemisfério Norte.
permanente dos ventos, apresentando pouca ou nenhuma
cobertura vegetal e variação de acúmulo de sedimentos d)As savanas e as florestas de monções
podem contribuir para a recarga dos lençóis freáticos. dependem da sazonalidade climática:
c)áreas de planície arenosa de origem marinha de grande invernos frios e chuvosos, verões quentes e
fragilidade ambiental; apresentam variação de cobertura secos.
vegetal em diferentes estágios sucessionais e variação de
topografia do terreno; contêm zonas inundáveis e não
inundáveis.

d)ambientes de transição, ecótonos, entre áreas marinhas e


terrestres, ricos em sedimentos constituídos de matéria 4) O mapa a seguir registra parte do processo
orgânica e nutrientes; predomina vegetação arbustiva, que de substituição dos domínios vegetais do
sobrevive em ambientes de permanente inundação. continente europeu pela agricultura
sedentarizada ao longo dos últimos 10 mil
anos.

3) A figura a seguir retrata a variação latitudinal dos padrões


espaciais de distribuição dos principais biomas terrestres.

153
Do ponto de vista ambiental, o processo de
transporte e armazenamento da água leva a
um aumento da sua salinidade e da
salinização do solo irrigado. Observando o
mapa, e considerando Petrolina e Juazeiro
como a região do médio São Francisco,
conclui-se que a transposição das águas será
realizada no

A análise do mapa permite concluir que:

a)As pastagens e as estepes foram os domínios mais


devastados pela implantação da agricultura, em função da
fertilidade do seu solo em épocas de degelo, o que favoreceu
a produtividade de grande escala.

b)Não é possível identificar grandes transformações nas


condições naturais dos domínios de vegetação europeus em a) médio alto São Francisco, a salinidade da
função do processo de sedentarização das sociedades água em Cabrobó será maior do que a
humanas. próxima ao Rio Apodi e a salinização do solo
se deverá à evaporação da água
c)O desenvolvimento de lavouras na Europa durante o .
Neolítico foi base para a transformação de domínios vegetais b) médio alto São Francisco, a salinidade da
naturais, o que significa que o desmatamento é uma prática água próxima ao Rio Apodi será maior do que
milenar. em Cabrobó e a salinização do solo se deverá
à condensação da água.
d)As áreas que hoje correspondem aos países da Península
Ibérica, ao Reino Unido e à Irlanda foram as pioneiras no c) médio baixo São Francisco, a salinidade da
desenvolvimento de práticas agrícolas sedentarizadas. água em Cabrobó será maior do que a
próxima ao Rio Apodi e a salinização do solo
se deverá à condensação da água.

HIDROGRAFIA d)médio baixo São Francisco, a salinidade da


água próxima ao Rio Apodi será maior do que
1) O mapa abaixo mostra, de forma esquemática, como será em Cabrobó e a salinização do solo se deverá
feita a transposição do Rio São Francisco. à evaporação da água.

154
3) As condições atuais do clima global são
responsáveis pela diferenciação da salinidade
2) Compreender a dinâmica de vazão dos rios é fundamental
dos oceanos em diferentes latitudes,
para o gerenciamento dos recursos hídricos, pois a captação
conforme a ilustração abaixo
de água atende a diferentes necessidades da sociedade e
pode ser comprometida em caso de estiagem extrema. Os
VARIAÇÃO DAS MÉDIAS DE SALINIDADE
gráficos de Regime Fluvial a seguir mostram a vazão de dois
DOS OCEANOS POR LATITUDE
rios brasileiros ao longo do ano.

Regime Fluvial do Rio A

Regime Fluvial do Rio B A partir do texto e do gráfico, é correto afirmar


que:

a)Os baixos teores de sais dos oceanos são


observados em toda a faixa de baixas latitudes,
em decorrência do balanço existente entre o
excesso de precipitação e o declínio da
evaporação ao longo de todo o ano.

b)O excesso de precipitação nas áreas de


médias latitudes e na proximidade dos polos é
responsável pela ocorrência de maior
Considerando as informações dos gráficos e seus salinidade nos oceanos do Hemisfério Sul.
conhecimentos, assinale a alterativa correta.
c)Nas áreas próximas a 90º de latitude, a
a)O volume correspondente à vazão dos dois rios é similar, e salinidade dos oceanos é similar, pois as
o volume de chuvas responsáveis pela recarga desses cursos condições climáticas favorecem a ocorrência
d'água é o mesmo. de grandes volumes de chuva e um grande
deficit de evaporação.
b)Os dois rios possibilitam, durante todo o ano, o
abastecimento humano, a geração de energia, a navegação e d)O percentual mais baixo de salinidade dos
a pesca. oceanos nas altas latitudes tem relação com a
maior entrada de água doce nos oceanos, que
c)A captação de água nos rios A e B pode ocorrer durante todo ocorre em razão do derretimento de geleiras.
o ano, pois em ambos há excesso de água no verão e deficit
no inverno.

d)Os rios apresentam regimes fluviais diferentes: o rio A MIGRAÇÕES


corresponde ao Regime Pluvial Tropical e o rio B representa o
Regime Pluvial Semiárido. 1) Imigrantes cruzam a Macedônia para
chegar ao Norte da Europa

155
(Adaptado de Agência da ONU para Refugiados – ACNUR –
Documento Tendencias Globales, 2015.)

Indique quais são esses três países.

a) Myanmar, Síria, Somália.


b)Afeganistão, Síria, Somália.
c)Afeganistão, Grécia, Macedônia.
d)Grécia, Macedônia, Myanmar.

3) O estudo Arranjos Populacionais e


Concentrações Urbanas do Brasil (IBGE,
2015) identificou 294 arranjos populacionais
no País, de diferentes escalas e naturezas. O
Arranjo Populacional da Região Metropolitana
de São Paulo (SP) é caracterizado pela
Indique a afirmação correta a respeito dos grandes fluxos extensão e intensidade de seus fluxos:
migratórios atuais no contexto da globalização. aproximadamente 1.750.000 pessoas
deslocam-se cotidianamente entre os
a) Envolvem imigrantes da América Latina, do norte da África municípios que compõem o Arranjo para
e do Oriente Médio, atraídos pela industrialização fordista da estudar e trabalhar.
Europa e dos Estados Unidos, que gera trabalho nas fábricas
Essa dinâmica espacial é melhor explicada
e na construção civil.
pelo conceito de

b) Direcionam-se para os países ricos ou em crescimento a)migração interna.


econômico e envolvem aquelas áreas de expulsão, cujas b)movimento pendular.
populações de origem sempre tiveram culturalmente vocação c)migração urbano-urbano.
para a realização de grandes deslocamentos. d)movimento sazonal.

c) Resultam das diferenças entre a situação econômica dos


países pobres e ricos e se direcionam para os lugares em que
4) Os sucessivos Censos Demográficos do
as populações falam a mesma língua ou possuem IBGE (Instituto Brasileiro de Geografia e
proximidades culturais.
Estatística) buscam conhecer a distribuição da
população pelo território brasileiro,
d) Assumem distintas direções, sendo que uma das rotas dos conhecimento relevante para os mais diversos
imigrantes para a Europa inicia-se em países do Oriente tipos de planejamento.
Médio e da costa oriental do norte da África, indo até a Grécia,
com travessia pelo mar Mediterrâneo. Considerando os dados da tabela abaixo,
assinale a alternativa correta.

2) De acordo com a Organização das Nações Unidas, a


população global submetida a deslocamentos forçados
cresceu substancialmente durante os últimos decênios,
passando de 37,3 milhões para 65,3 milhões em 2015. Desse
total, os refugiados representam 16,1 milhões de pessoas, 1,7
milhão a mais que o total registrado 12 meses antes. Mais da
metade dos atuais refugiados

do mundo (54%) procede de três países afetados por conflitos


armados.

156
c) Moçambique.

d)Nigéria

2) Os viajantes, missionários, administradores


coloniais e etnógrafos europeus, no passado,
tenderam a fundir múltiplas identidades em um
único conceito de tribo. O uso da palavra tribo
para descrever as sociedades africanas surgiu
de um desejo de enaltecer o Estado-nação, ao
mesmo tempo em que sugeria a inferioridade
inerente de outros. Em resumo, conotava
a) As regiões Norte e Centro-Oeste foram as únicas com políticas primitivas que eram menos
acréscimos contínuos na participação regional desde 1950, desenvolvidas do que as políticas dos
fenômeno associado aos fluxos migratórios nacionais Estados- nação.
incentivados por políticas governamentais de ocupação do (Adaptado de John Parker e Richard Rathbone, “A ideia de África”,
território. em História da Africa. Lisboa: Quimera, 2016, p. 96-58.)

b) A região Nordeste foi a única que apresentou redução Baseado no texto acima e em seus
contínua de participação regional, fenômeno associado às conhecimentos, assinale a alternativa correta.
grandes secas do sertão, responsáveis pela migração da
população para as outras regiões do país ao longo de todo o a)A formação e a difusão do conceito de tribo
século XX. no pensamento europeu acompanharam os
avanços do colonialismo na Africa no século
XIX, legitimando o domínio de seus povos por
c) A região Sudeste tem maior participação regional na
agentes oriundos de nações que se
população do país, apresentando redução a partir de 1991, consideravam civilizadas e superiores.
fenômeno associado ao decréscimo, em números absolutos,
de sua população pela elevada queda da taxa de fecundidade. b)O conceito de tribo ganhou força no
pensamento ocidental, porque na África não
d) A região Sul apresentou acréscimo de participação regional havia formações políticas que cobriam
até 1991, ocorrendo queda nas décadas seguintes, fenômeno grandes extensões territoriais como na
Europa. Ou seja, os europeus não
associado ao regresso dos filhos de imigrantes europeus em
encontraram estruturas políticas acima das
busca de trabalho nos países de origem de seus pais. unidades tribais

c)Às sociedades africanas eram organizadas


a partir de pequenas tribos lideradas por
chefes guerreiros, o que gerava fragmentação
ÁFRICA política e guerras, inviabilizando nesse
continente a formação de unidades políticas
complexas nos moldes europeus.
1) País da África Austral que se tornou independente em 1975
após séculos de colonialismo europeu. No período posterior à d)Em razão das tradições milenares e do
independência, a terra passou a ser propriedade do Estado, respeito aos ancestrais, as tribos eram
com predomínio de uso pela população camponesa e com unidades sociais e políticas estáticas
forte participação das mulheres na produção agrícola familiar. assentadas em uma identidade homogênea.
De 1976-1992 vivenciou intensos conflitos produzidos pela Os europeus comumente desrespeitavam
guerra civil envolvendo dois dos principais grupos armados do todas essas características na colonização.
país.

O texto acima faz referência ao seguinte país: 3) Moçambique foi atingido por três ciclones
tropicais entre março e abril de 2019. Ciclone
a)Congo. tropical é um termo geral para grandes e
complexas tempestades que giram em torno
b) África do Sul. de uma área de baixa pressão formada em

157
águas oceânicas tropicais ou subtropicais quentes. A final do século XIX, quando o transporte
formação de um ciclone tropical requer enormes quantidades ferroviário passou a responder por todas as
de calor na superfície da água, que devem atingir no mínimo trocas interprovinciais.
26,5°C, e ventos de pelo menos 119 km/h em algum ponto da
tempestade.
b) A cabotagem consistiu num primitivo
sistema de transportes do início da
A partir do exposto, assinale a alternativa que explica a gênese colonização, articulando os portos das
dos ciclones tropicais na costa de Moçambique. principais cidades. Trata-se de um elemento
primordial para a formação do território
a)A corrente marítima das Agulhas foi responsável pelo brasileiro, pois permitiu sua precoce
deslocamento das águas superficiais aquecidas para áreas de
unificação e completa articulação inter-
baixa pressão situadas no canal de Moçambique.
regional.
b)O clima semiárido e desértico no litoral de Moçambique faz
com que as águas de sua costa estejam sempre aquecidas, c) A cabotagem teve importante papel no
favorecendo assim a formação dos ciclones. longo processo de formação do território
brasileiro, transportando pessoas,
c)Os ciclones que atingem o litoral de Moçambique têm mercadorias e informações entre os principais
origem no encontro das águas quentes do Oceano Atlântico
portos desde o período colonial. No século XX,
com o Oceano Índico, no cabo da Boa Esperança.
perdeu importância para o sistema de
d)A corrente marítima de Benguela foi responsável pelo transporte rodoviário.
deslocamento das águas aquecidas do Oceano Índico para o
canal que separa Moçambique de Madagascar. d) A cabotagem foi implantada no Brasil no
final do século XIX, fazendo uso de modernos
navios a vapor para articular o comércio
interprovincial. Atualmente, concorre com os
TRANSPORTES sistemas ferroviário e rodoviário para
transportar cargas, particularmente aquelas
conteinerizadas.
1) Sobre o papel da cabotagem no processo de formação do
território brasileiro, é correto afirmar:

2) A origem da sociedade em rede decorre do


desenvolvimento dos meios de transporte, das
comunicações e da transmissão de energia,
característica essencial da organização
espacial da sociedade moderna – uma
sociedade umbilicalmente ligada à evolução
da técnica, à aceleração das interligações e da
movimentação das pessoas, de objetos e de
capitais sobre os territórios. Nesse contexto,
tem lugar a mudança, associada à rapidez do
aumento da densidade e da escala da
circulação.

(Adaptado de Ruy Moreira, Da região à rede e ao lugar: a nova


realidade e o novo olhar geográfico sobre o mundo. etc...,espaço,
tempo e crítica. n. 1(3), p. 57,2007.)

No mundo contemporâneo, as redes


a)A cabotagem viabilizou o comércio marítimo entre os configuram uma nova forma de organização
principais portos do território no período colonial. Todavia, geográfica das sociedades porque
esse sistema de transporte veio a encerrar suas atividades no

158
a)colocam todos os lugares em conexão, garantem fluidez ao a) Trata-se de uma manifestação eruptiva do
processo global de produção e homogeneízam os espaços. Mesozoico, associada com o riftiamento que
formou o Oceano Atlântico, sendo uma das
b)anulam a importância dos territórios e fronteiras nacionais maiores manifestações vulcânicas da história
na articulação da geopolítica mundial, reconfigurando a geológica da Terra. As alterações dessas
geografia do poder. rochas formam solos muito férteis, chamados
de Nitossolos.
c)constituem sistemas usados livremente pelas sociedades
em busca de projetos emancipatórios, ampliando os conflitos b) Trata-se de uma manifestação eruptiva do
e as disputas políticas. Quaternário, relacionada a uma série de
hotspots associados à bacia do Paraná. As
d)sobrepõem-se, na escala mundo, às configurações alterações dessas rochas formam solos muito
regionais do passado, impondo um novo funcionamento ácidos, que acabam por dificultar as atividades
reticular e hierárquico aos territórios. agrícolas.

c) Corresponde a um evento vulcânico que foi


ativo durante milhões de anos, associado à
GEOLOGIA deriva continental da América do Sul, em
direção leste. As alterações dessas rochas
formam solos extremamente férteis,
1) A figura abaixo apresenta a ocorrência de derrames
classificados atualmente como “Terras Roxas”.
basálticos na porção centro-sul do Brasil.

d) Foi uma atividade vulcânica entre as


maiores da história da Terra, que ocorreu
durante o Paleógeno (antigo Terciário Inferior),
quando se iniciou a separação América do
Sul-África. Os solos desenvolvidos sobre
essas rochas são extremamente férteis
2) Apesar da queda de preço que vêm
sofrendo nos últimos anos, algumas
commodities minerais continuam sendo
importante fonte para a pauta de exportações
do Brasil. Na figura a seguir, observamos vias
de escoamento (os corredores de exportação)
da Amazônia Oriental, partindo de três
municípios paraenses: Oriximiná,
Parauapebas e Ipixuna do Pará

Identifique o produto extraído em cada um dos


municípios e a via de escoamento
correspondente:

a)cobre, corredor baixo Amazonas; bauxita,


corredor Carajás; ferro, corredor do vale do rio
Capim.

b)bauxita, corredor baixo Amazonas; ferro,


corredor Carajás; caulim, corredor do vale do
rio Capim.

Sobre essa ocorrência, é correto afirmar: c)carvão mineral, corredor Carajás-Tocantins;


caulim, corredor do vale do rio Capim; bauxita,
corredor baixo Amazonas.

159
d)ferro, corredor Carajás; bauxita, corredor baixo Amazonas;
cobre, corredor do vale do rio Capim.

3) As setas da figura indicam somente a direção da


movimentação das placas tectônicas.

(Adaptado de J.F. Petersen, D. Sack e R. E. Glabler, Fundamentos de Geografia Física.


São Paulo: Cengage, 2015, p. 277.)

Legenda:

A: deslizamento; B: queda; C: fluxo de lama;


D: água subterrânea; E: deriva litorânea
(sentido das ondas).

(Adaptado de Paul R. Pinet, Fundamentos de Oceanografia. São


Paulo: LTC, 2017, p. 269.)

a)A evolução das falésias resulta de


processos geomorfológicos marinhos
Eventos sísmicos de grande magnitude causam imensos
responsáveis pela erosão da base das
danos. As ondas sísmicas que se originam nesses eventos e
escarpas e pelo transporte do material.
que se propagam no interior da Terra são de dois tipos:
longitudinais e transversais. A figura anterior representa um
b)A ação da erosão marinha não interfere na
tipo de contato entre placas que dá origem a ondas sísmicas.
evolução das escarpas das falésias, pois a
variação dos níveis de água subterrânea é o
principal agente dessa forma de relevo.
Esse tipo de contato ocorre
c)As falésias são escarpas esculpidas em
a)na Califórnia (EUA), e as ondas longitudinais são aquelas
rochas metamórficas, alteradas
em que a oscilação se dá na direção de propagação.
intempericamente por agentes exógenos
pluviais e marinhos em áreas tropicais.
b)nos Andes (Chile), e as ondas transversais são aquelas em
que a oscilação se dá perpendicularmente à direção de
d)As falésias são formas de relevo tipicamente
propagação.
costeiras e sua evolução se dá a partir da
interação de processos geomorfológicos
c)na Califórnia (EUA), e as ondas longitudinais são aquelas
marinhos e continentais.
em que a oscilação se dá perpendicularmente à direção de
propagação.

d)nos Andes (Chile), e as ondas transversais são aquelas em


que a oscilação se dá na direção de propagação. RELEVO

4) A esculturação das diferentes formas de relevo é resultado 1) Diferentes sedimentos podem ser
da interação entre diferentes agentes exógenos na paisagem, misturados à água e, dependendo de sua
tal como ocorre com as falésias. natureza, podem formar soluções, emulsões,
A partir do exposto e da ilustração abaixo, indique a alternativa ou mesmo uma lama. No caso do mais
que descreve os processos de recuo da falésia. recente desastre ambiental, ocorrido em uma
barragem em Mariana, no interior de Minas

160
Gerais, o que vazou para o ambiente foi uma lama que 3)
percorreu cerca de 600 km até chegar ao mar, no litoral do
Espírito Santo. Mesmo misturando-se à agua do Rio Doce e
depois à agua do mar, os sedimentos não se separaram da
água para se depositar no solo, provavelmente porque
interagem com água. Com base no conhecimento de Química
e considerando a região onde se originou o acidente, pode-se
afirmar corretamente que os sedimentos são provenientes de
uma região marcada por
a)serras e cristas do complexo Gnáissico-Magmático e a lama
contém majoritariamente areia e óxidos metálicos.

b)planícies quaternárias com a presença de falésias vivas e a


lama contém majoritariamente argila e óxidos metálicos.
c)serras e cristas do complexo Gnáissico-Magmático e a lama
contém majoritariamente argila e óxidos metálicos.

d)planícies quaternárias com a presença de falésias vivas e a A figura anterior destaca um domínio natural
lama contém majoritariamente areia e óxidos metálicos. marcado por especificidades físicas e de
ocupação pela população. Assinale a
alternativa que indica corretamente as
2) características naturais e humanas
predominantes nesse domínio.

(Adaptado de Azis Ab´Saber, Os domínios de natureza no Brasil:


potencialidades paisagísticas. São Paulo: Ateliêr Editorial, 2003, p.
159.)

a)Relevo de Mares de Morro; solos de tipo


latossolos; grande concentração da
população ao longo dos cursos d’água da
região.

b)Relevo de Altiplanos Basálticos; solos de


tipo podzólicos; grande dispersão da
população pelos diversos ecossistemas
regionais.
Ao percorrer a Ferrovia Transiberiana, de Moscou a
Vladivostok, em uma extensão de 9.289 km, atravessamos
c)Relevo Residual de Colinas com
diferentes unidades do relevo russo:
afloramento rochoso; solos de tipo litólicos;
grande dispersão da população pelo espaço
a)Montes Urais, Planície Russa, Planalto da Anatólia e
regional.
Planalto Central Siberiano.
d)Relevo de Terras Baixas; solos de tipo
b)Planalto do Decã, Planalto Central Siberiano, Montes Urais
gleissolos; grande concentração da população
e Planície Russa.
nas áreas inundáveis sazonalmente.
c)Planalto Central Siberiano, Planície Russa, Montes Urais e
Planalto dos Bálcãs.

d)Planície Russa, Montes Urais, Planalto Central Siberiano e


Planalto de Aldan.

161
ENERGIA [11] Lixívia (líquido resultante do
processamento da madeira para extração da
celulose) e outras fontes renováveis.
1) Denomina-se energia eólica a energia cinética contida no (Fonte: http://www.epe.gov.br/pt/abcdenergia/matriz-energetica-e-
vento. Seu aproveitamento ocorre por meio da conversão da eletrica. Acessado em 02/05/2019.)
energia cinética de translação em energia cinética de rotação
e, com o emprego de turbinas eólicas, também denominadas Considerando seus conhecimentos sobre
aerogeradores, é gerada energia elétrica. Existem atualmente, meio ambiente e as informações fornecidas,
na região que mais produz energia eólica no Brasil, 306 usinas assinale a alternativa correta.
em operação, com o potencial de geração elétrica de
aproximadamente 7.800 MWh (dados do Banco de a)A matriz energética brasileira utiliza menor
Informações de Geração da ANEEL, 2016). Se nessa região, porcentagem de energia renovável que a
por razões naturais, a velocidade do vento fosse reduzida, mundial, com o uso predominante de
mantendo-se a densidade do ar constante, teríamos uma combustíveis fósseis.
redução de produção de energia elétrica.
b)Gás natural, biomassa, energia hidráulica,
Indique a região em questão e qual seria a quantidade de
energia solar, eólica e geotérmica são as
energia elétrica produzida, se houvesse a redução da
fontes renováveis de energia utilizadas na
velocidade do vento pela metade.
matriz mundial.
a)Região Sul; 3.900 MWh.
c)A matriz energética brasileira é mais
b)Região Nordeste; 1.950 MWh. dependente de fontes renováveis de energia
c)Região Nordeste; 3.900 MWh. do que a matriz mundial, como alternativa ao
uso de combustíveis fósseis.
d)Região Sul; 1.950 MWh.
d)Os biocombustíveis derivados da cana-de-
açúcar e do gás natural são as principais
fontes renováveis nas matrizes brasileira e
2) Matriz energética é o conjunto de fontes de energia mundial, respectivamente.
disponíveis. Os gráficos a seguir representam a matriz
energética no mundo e no Brasil, mostrando as fontes de
energia renováveis e não renováveis.
3) O petróleo continua sendo a fonte de
energia mais importante do mundo. A posse
de reservas, o transporte e a capacidade de
refino figuram como elementos de soberania
nacional e estratégicos em um mundo
extremamente competitivo.

Em relação ao petróleo no Brasil, é correto


afirmar:
a)As descobertas das reservas nacionais
[1] Carvão.
ocorreram a partir dos anos 1980 e a Bacia de
[2] Petróleo e derivados.
Campos (RJ) é hoje a principal produtora do
[3] Gás natural.
país.
[4] Nuclear.
[5] Energia hidráulica. b)A extração nacional é cada dia maior, mas a
[6] Biomassa. inexistência de oleodutos exige que o
[7] Energia solar, eólica e geotérmica. transporte seja realizado por meio rodoviário.
[8] Derivados de cana-de-açúcar.
c)A maior produção em terra provém do
[9] Lenha e carvão vegetal.
Estado do Rio Grande do Norte e, em mar, do
[10] Outras fontes não renováveis.
pré-sal situado entre os Estados de São Paulo
e Rio de Janeiro.

162
d)Apesar de possuir grandes reservas, especialmente com as a)representa uma possibilidade real de
descobertas do pré-sal, não há refino no país, por isso os interferência em sistemas informacionais
derivados são importados. nacionais, mas seu uso efetivo mantém-se
apenas como uma ameaça.

b)baseia-se na capacidade integrada de


GLOBALIZAÇÃO sistemas computacionais espionarem
governos antagônicos, com o objetivo de
1) A presença de empresas globais que dominam o mercado manipular informações de todo tipo.
de tecnologia no mundo costuma gerar atritos com os
c)envolve o uso de softwares (malwares) e
governos nacionais e impactos de diferentes dimensões em
programas robôs para invadir redes sociais e
sua indústria cultural e na privacidade dos indivíduos.
computadores, mas nunca interferiu em
processos eleitorais.
Diante do poder dessas grandes empresas, os Estados
nacionais buscam estabelecer regras antitrustes para o setor.
d)visa ao controle da informação como uma
(Adaptado de Farhad Manjoo, The New York Times/Folha de São Paulo, 11/06/2016, p. forma de poder político, mas inexistem, no
1 e 2.) mundo, cibercomandos, ou seja, a quarta
força armada.
Com relação ao poder econômico e político das empresas
globais de tecnologia digital e as ações dos governos
nacionais, é correto afirmar que:
REGIONAL
a) A tecnologia digital representou uma expressiva
reestruturação da ordem global. Houve maior democratização
da circulação de informações pela internet e os Estados 1) O gráfico triangular abaixo apresenta a
nacionais perderam totalmente o controle do conteúdo estrutura de utilização das terras dos
transmitido pelas redes digitais. estabelecimentos agropecuários em cada
região brasileira (dados do último Censo
b) O poder das grandes empresas de tecnologia predomina Agropecuário do IBGE, Instituto Brasileiro de
apenas nos países pobres, cujos Estados dispõem de Geografia e Estatística, de 2006).
limitadas legislações para o controle desses grupos
econômicos em seus territórios, sobretudo no que diz respeito
às mídias globais.

c) As leis antitrustes surgiram no final do século XX e foram


criadas pelos Estados nacionais para o controle do poder
econômico das empresas globais do mercado de tecnologia
digital, setor que costuma desenvolver práticas de mercado
anticompetitivas.

d) As empresas de tecnologia digital formam verdadeiros


oligopólios e controlam diversas redes informacionais; apesar
disso, elas ainda dependem das legislações dos Estados
nacionais para a atuação nos territórios e comercialização dos
seus produtos.
2) No período da Guerra Fria, os conflitos geopolíticos
implicavam riscos nucleares e ataques físicos a infraestruturas
(Adaptado de Marcelo Martinelli, Mapas, gráficos e redes. Elabore
como estradas, redes elétricas ou gasodutos.
você mesmo. São Paulo: Oficina de Textos, 2014, p. 56.)
Hoje, além dessas implicações, a Ciberguerra ou Guerra Fria Cada ponto representa uma região brasileira.
Digital Identifique cada região:

163
a) 1 Norte; 2 Nordeste; 3 Sudeste; 4 Sul; 5 Centro-Oeste. 3) 10 PORTOS BRASILEIROS QUE MAIS
EXPORTARAM PARA O MUNDO EM 2017
b) 1 Sudeste; 2 Centro-Oeste; 3 Sul; 4 Norte; 5 Nordeste.

c) 1 Nordeste; 2 Sul; 3 Centro-Oeste; 4 Sudeste; 5 Norte.

d) 1 Centro-Oeste; 2 Sudeste; 3 Norte; 4 Nordeste; 5 Sul.

2) A figura abaixo indica a distribuição de usinas


sucroenergéticas no Brasil em 2010. Essas usinas
provocaram aumento da produção de vinhaça, resíduo
pastoso e malcheiroso resultante da destilação do caldo de
cana-de-açúcar fermentado.

Considerando o mapa anterior e seus


conhecimentos sobre o mercado externo
brasileiro, componente fundamental da
economia nacional, assinale a alternativa que
associa corretamente um porto brasileiro, a
principal mercadoria exportada e seu destino.

a)Angra dos Reis: soja in natura, destinada


primordialmente ao mercado do leste europeu.

Assinale a alternativa correta. b)Vitória:automóveis,destinados


primordialmente ao mercado do Oriente Médio.
a)No Centro-Oeste, as usinas estão concentradas em áreas
anteriormente ocupadas pelo Cerrado; quando a vinhaça
c)Itaqui: minério de ferro, destinado
atinge os rios, ocorre aumento na quantidade de micro-
primordialmente ao mercado asiático.
organismos nocivos aos peixes.
b)O processamento da cana no Sudeste está concentrado no d)Vila do Conde: motocicletas, destinadas
Vale do Paraíba; a vinhaça é rica em compostos sulfurados, primordialmente ao mercado africano.
leva à contaminação ambiental e não serve como fertilizante.

c)As usinas do Nordeste concentram-se no Agreste; a vinhaça


é rica em matéria orgânica e pode ser utilizada como adubo
para o solo.
4) O gráfico a seguir mostra que o Brasil tem
d)Na região Norte há poucas usinas, situadas apenas nas
registrado, nos últimos anos, crescimento da
Terras Altas amazônicas; a vinhaça é rica em matéria orgânica,
violência no campo.
mas o processo de destilação elimina seus nutrientes.

164
formação histórica do centro-sul do Brasil, é
correto afirmar que
a)A demanda do mercado consumidor criado
na zona mineradora permitiu a conexão entre
diferentes partes da Colônia que até então
eram pouco integradas.

b)A partir da criação de rotas de comércio


entre os campos do sul da Colônia e a região
mineradora, Sorocaba e suas feiras perderam
a relevância econômica adquirida no século
XVII.

Assinale a alternativa que indica corretamente o que vem c)O desenvolvimento socioeconômico da
motivando esse fenômeno e em que região tem predominado região das minas e do centro-sul levou a
esse tipo de ocorrência. Coroa a deslocar a capital da Colônia de
Salvador para Ouro Preto em 1763.
a)A expulsão de agricultores familiares pelo avanço das
culturas da cana-de-açúcar e do algodão tem gerado conflitos
d)Como o solo da região mineradora era
entre pequenos e grandes proprietários de terra; região
infértil, durante todo o século XVIII sua
Centro-Oeste.
população importava os produtos alimentares
de Portugal ou de outras capitanias.
b)A fragmentação da propriedade em áreas de colonização
dirigida e a disputa pela posse da terra entre herdeiros vêm
produzindo violência agrária; região Norte.
6) Região Integrada de Desenvolvimento
c)A rivalidade entre trabalhadores rurais e criadores
Econômico (RIDE) - Distrito Federal.
extensivos de gado bovino no Pantanal e nas chapadas mato-
grossenses tem resultado em violência agrária; região Centro-
Observando o mapa abaixo e considerando o
Oeste.
conhecimento sobre o tema, é correto afirmar
d)A disputa pela terra envolvendo grileiros contra posseiros
que a área representada é uma região de
em áreas de expansão de monocultivos e de projetos de
planejamento composta por
exploração mineral e madeireira tem gerado violência; região
Norte.

5) Tanto que se viu a abundância do ouro que se tirava e a


largueza com que se pagava tudo o que lá ia, logo se fizeram
estalagens e logo começaram os mercadores a mandar às
Minas Gerais o melhor que chega nos navios do Reino e de
outras partes. De todas as partes do Brasil, se começou a
enviar tudo o que dá a terra, com lucro não somente grande,
mas excessivo. Daqui se seguiu, mandarem-se às Minas
Gerais as boiadas de Paranaguá, e as do rio das Velhas, as
boiadas dos campos da Bahia, e tudo o mais que os
moradores imaginaram poderia apetecer-se de qualquer
gênero de cousas naturais e industriais, adventícias e próprias.

(Adaptado de André Antonil, Cultura e Opulência do Brasil. Belo Horizonte: Itatiaia-Edusp,


1982, p. 169-171.)

Sobre os efeitos da descoberta das grandes jazidas de metais


e pedras preciosas no interior da América portuguesa na

165
a)três entes federativos, instituída nos anos 1990 para 1960 e 1970. Em 2010, porém, havia perdido
promover o desenvolvimento econômico e melhorias em mais de um milhão de habitantes. O espaço
políticas públicas; tem sua origem no processo de urbano entrou em colapso, com fábricas em
metropolização de Brasília-DF. ruínas, casas abandonadas, supressão de
b)dois entes federativos, instituída nos anos 1970 para serviços públicos essenciais, crescimento da
ordenar a política de transportes face à elevada oferta de pobreza e do desemprego. Em 2013, foi
trabalho existente nos municípios do entorno do Distrito decretada a falência da cidade. Essa crise
Federal. urbana vivida por Detroit resulta dos seguintes
processos:
c)três entes federativos, instituída nos anos 1980 para
promover o desenvolvimento sustentável com preservação do a)ascensão do taylorismo; protecionismo
patrimônio histórico e natural face ao elevado crescimento econômico e concorrência com capitais
demográfico regional. europeus; deslocamento de indústrias para
cidades vizinhas.
d)dois entes federativos, instituída nos anos 1960 para b)consolidação do regime de acumulação
promover setores da agroindústria e dos serviços; tem sua fordista; protecionismo econômico e
origem nas estratégias de integração previstas no concorrência com capitais europeus;
planejamento regional. deslocamento de indústrias para outros
países;
c)declínio do toyotismo; liberalização
econômica e concorrência com capitais
asiáticos; deslocamento de indústrias para
GEOPOLÍTICA cidades vizinhas.
d)ascensão do regime de acumulação flexível;
1)O referendo realizado no Reino Unido em junho de 2016 liberalização econômica e concorrência com
conduziu ao Brexit, após 43 anos de adesão à União Europeia. capitais asiáticos; deslocamento de indústrias
São potenciais consequências dessa decisão, nos níveis para outros países.
nacional e continental, respectivamente,
2) Raros são os cientistas que se dedicam a
a)o pedido da Irlanda do Norte por um novo referendo para medir um único fenômeno. Mais raro ainda
decidir sua permanência no Reino Unido e a continuidade da são aqueles que alteram o comportamento da
livre circulação da moeda europeia, o euro, no Reino Unido. humanidade com suas medições. O norte-
americano Charles D. Keeling passou a vida
b)o pedido da Inglaterra por um novo referendo para decidir medindo a quantidade de CO2, existente na
sua permanência no Reino Unido e a continuidade da livre atmosfera, demonstrando que a quantidade
circulação da moeda europeia, o euro, no Reino Unido. desse gás está aumentando. Em 1958, muito
antes do surgimento dos movimentos
c)o pedido da Escócia por um novo referendo para decidir sua ecológicos, Keeling desconfiou de que esse
permanência no Reino Unido e o comprometimento da livre efeito era devido à queima de combustíveis
circulação de cidadãos europeus no Reino Unido. fósseis. Na última década, a hipótese de
Keeling foi testada pela análise de bolhas de
d)o pedido do País de Gales por um novo referendo para ar retidas no gelo polar, revelando que a
decidir sua permanência no Reino Unido e o concentração de CO2, permaneceu inalterada
comprometimento da livre circulação de cidadãos europeus no por milênios, aumentando a partir do século
Reino Unido XIX
(Adaptado de Fernando Reinach, A longa marcha dos grilos
canibais. São Paulo: Companhia das Letras, 2010, p. 41 - 42.)

INDÚSTRIA Os experimentos com as bolhas de ar do gelo


polar indicam que a elevação das emissões de
1) Detroit foi símbolo mundial da indústria automotiva. Chegou CO2,
a abrigar quase 2 milhões de habitantes entre as décadas de

166
a)é diretamente proporcional à utilização crescente de Com a ajuda do mapa anterior, assinale a
petróleo (plantas fossilizadas) nos Estados Unidos e na China alternativa que indica, respectivamente, o
no século XIX, o que propiciou o desenvolvimento de novos principal país para onde se deslocam os
equipamentos, tecnologias e organizações no mundo do Rohingyas e as correntes religiosas seguidas
trabalho. por essa minoria étnica e pela maioria da
população de Mianmar.
b) está correlacionada com a utilização crescente de carvão
mineral (plantas fossilizadas) durante a Revolução Industrial, a)Bangladesh; mulçumana e budista.
que propiciou o uso da energia a vapor e o desenvolvimento b)Índia; católica e hindu.
de máquinas, levando à produção em larga escala. c)Tailândia; católica e mulçumana.
d)China; hindu e budista.
c) está associada à utilização crescente de petróleo (micro-
organismos fossilizados) desde os primórdios da Revolução
Industrial, caracterizada pelo uso de máquinas para a
produção em larga escala e novas organizações trabalhistas.

d)é diretamente proporcional à utilização decrescente de


biodiesel (micro-organismos fossilizados) na Inglaterra
durante a Revolução Industrial, quando esse país adotou uma
matriz energética baseada no consumo de petróleo para
fomentar sua economia protecionista.

ÁSIA
1) Recentemente, em Mianmar, a minoria étnica Rohingya foi
vítima de graves massacres e assassinatos praticados por
grupos extremistas da maioria étnico-religiosa do país. Entre
2017 e 2018, os atos de violência provocaram deslocamentos
forçados de aproximadamente 650 mil Rohingyas
principalmente para um dos países vizinhos.

167
gabarito
(PS: sempre veja os erros como uma oportunidade de
aprendizado. Não fique triste se errar, você está dando o seu
melhor.)

População 1A 2D 3B 4D 5B

Geopolítica 1C 2B

Agricultura 1A 2D 3A

Urbanização 1C 2C 3A 4C 5B

Cartografia 1B 2C 3C 4C 5C

Clima 1A 2D 3C 4C 5D

Ambientais 1C 2A 3B 4A 5D 6B

Vegetação 1C 2D 3C 4C

Hidrografia 1D 2D 3D

Migração 1D 2B 3B 4A

África 1B 2A 3A

Transportes 1C 2D

Geologia 1A 2B 3A 4D

Energia 1B 2C 3C

Relevo 1C 2D 3C

Globalização 1D 2B

Regional 1A 2A 3C 4D 5A 6A

Geopolítica 1C

Indústria 1D 2B

Ásia 1A

168
QUÍMICA
a) a solidificação de uma solução aquosa de
etilenoglicol deve começar a uma temperatura
mais elevada que a da água pura e sua
ebulição, a uma temperatura mais baixa que a
da água pura.
PROPRIEDADES COLIGATIVAS
b) a solidificação de uma solução aquosa de
1) Os sprays utilizados em partidas de futebol têm etilenoglicol deve começar a uma temperatura
formulações bem variadas, mas basicamente contêm água, mais baixa que a da água pura e sua ebulição,
butano e um surfactante. Quando essa mistura deixa a a uma temperatura mais elevada que a da
embalagem, forma-se uma espuma branca que o árbitro água pura.
utiliza para marcar as posições dos jogadores. Do ponto de
vista químico, essas informações sugerem que a espuma c)tanto a solidificação de uma solução aquosa
estabilizada por certo tempo seja formada por pequenas de etilenoglicol quanto a sua ebulição devem
bolhas, cujas películas são constituídas de água e começar em temperaturas mais baixas que as
da água pura.
a)surfactante, que aumenta a tensão superficial da água.
b)butano, que aumenta a tensão superficial da água. d)tanto a solidificação de uma solução aquosa
de etilenoglicol quanto a sua ebulição devem
c)surfactante, que diminui a tensão superficial da água. começar em temperaturas mais altas que as
d)butano, que diminui a tensão superficial da água. da água pura.

GASES
2) Alguns trabalhos científicos correlacionam as mudanças
nas concentrações dos sais dissolvidos na água do mar com 1) Muito se ouve sobre ações em que se
as mudanças climáticas. Entre os fatores que poderiam utilizam bombas improvisadas. Nos casos que
alterar a concentração de sais na água do mar podemos envolvem caixas eletrônicos, geralmente as
citar: evaporação e congelamento da água do mar, chuva e bombas são feitas com dinamite (TNT–
neve, além do derretimento das geleiras. De acordo com o trinitrotolueno), mas nos atentados terroristas
conhecimento químico, podemos afirmar corretamente que a geralmente são utilizados explosivos plásticos,
concentração de sais na água do mar que não liberam odores. Cães farejadores
detectam TNT em razão da presença de
resíduos de DNT (dinitrotolueno), uma
a) aumenta com o derretimento das geleiras e diminui com o
impureza do TNT que tem origem na nitração
congelamento da água do mar.
incompleta do tolueno. Se os cães conseguem
farejar com mais facilidade o DNT, isso
b)diminui com o congelamento e com a evaporação da água
significa que, numa mesma temperatura, esse
do mar.
composto deve ser

c)aumenta com a evaporação e o congelamento da água do


a) menos volátil que o TNT, e portanto tem
mar e diminui com a chuva ou neve.
uma menor pressão de vapor.

d)diminui com a evaporação da água do mar e aumenta com


o derretimento das geleiras. b) mais volátil que o TNT, e portanto tem uma
menor pressão de vapor.

c) menos volátil que o TNT, e portanto tem


3) O etilenoglicol é uma substância muito solúvel em água, uma maior pressão de vapor.
largamente utilizado como aditivo em radiadores de motores
de automóveis, tanto em países frios como em países d) mais volátil que o TNT, e portanto tem uma
quentes. Considerando a função principal de um radiador, maior pressão de vapor.
pode-se inferir corretamente que

169
2) “Pode arredondar?” Esta é uma pergunta que frentistas de c) dois íons hidrogênio e a mudança de cor
postos de combustíveis fazem durante o abastecimento, seria menos pronunciada pela adição de
quando o travamento automático da bomba é acionado. O vinagre no cozimento.
fabricante do veículo faz a recomendação de não arredondar,
pensando na preservação do veículo, mas o dono do posto d) um íon hidrogênio e a mudança de cor seria
pede que o frentista arredonde, para vender mais combustível. menos pronunciada pela adição de vinagre no
Por outro lado, pensando na saúde do frentista, prejudicada cozimento.
pela exposição aos vapores de combustível, pode-se afirmar
corretamente que:

a)Qualquer que seja a resposta do consumidor, até o 2) Os compostos (NH4)H2PO4 e NaHCO3 são
travamento automático ou passando do automático, a saúde usados em extintores como agentes de
do frentista será prejudicada, pois sempre haverá eliminação combate ao fogo. Quando lançados sobre
de vapores durante o abastecimento. uma chama, ocorrem as seguintes
transformações:
b)A resposta mais adequada do consumidor seria “sim”,
porque a quantidade de vapores eliminados no abastecimento
é a mesma, e o prejuízo à saúde do frentista é o mesmo,
independentemente do volume de combustível adicionado ao
tanque
a)líquidos inflamáveis, os dois agentes formam
uma nuvem de gás, mas com sólidos em
c) A resposta mais adequada do consumidor seria “não”, pois
combustão, somente o material viscoso é
somente a partir do travamento automático é que há capaz de inibir completamente o contato
eliminação de vapores durante o abastecimento e só depois combustível/comburente.
disso há prejuízo para a saúde do frentista.
b)líquidos inflamáveis, os dois agentes formam
d) A resposta mais adequada do consumidor seria “sim”, uma nuvem de gás, mas com sólidos em
porque não haverá eliminação de vapores durante o combustão, somente o material particulado é
abastecimento e assim nunca haverá prejuízo para a saúde capaz de inibir completamente o contato
do frentista. combustível/comburente.

c)materiais sólidos em combustão, os dois


agentes inibem completamente o contato
combustível/comburente, mas com líquidos em
FUNÇÕES INORGÂNICA combustão, somente o NaHCO3 é capaz de
inibir este contato.
1) A coloração verde de vegetais se deve à clorofila, uma
d) materiais sólidos em combustão, os dois
substância formada por uma base nitrogenada ligada ao íon
agentes inibem completamente o contato
magnésio, que atua como um ácido de Lewis. Essa coloração combustível/comburente, mas com líquidos em
não se modifica quando o vegetal está em contato com água combustão, somente o (NH4)H2PO4 é capaz de
fria, mas pode se modificar no cozimento do vegetal. O que inibir este contato.
leva à mudança de cor é a troca dos íons magnésio por íons
hidrogênio, sendo que a molécula da clorofila permanece
eletricamente neutra após a troca. Essas informações
permitem inferir que na mudança de cor cada íon magnésio é
3) Muitos problemas sociais e ambientais têm-
substituído por
se tornado motivo de piadas e alvo de charges
em jornais e revistas. Um exemplo deste tipo
a) um íon hidrogênio e a mudança de cor seria mais
está mostrado nas figuras abaixo.
pronunciada pela adição de vinagre no cozimento.
Levando em conta as informações abstraídas
b) dois íons hidrogênio e a mudança de cor seria mais
das figuras, depreende-se que as charges
pronunciada pela adição de vinagre no cozimento.

170
remetem a um problema recorrente de contaminação de

a)leite, sendo que a figura da esquerda diz respeito ao acerto


da acidez, e a da direita diz respeito à eliminação de
microrganismos.

b)leite, sendo que a figura da esquerda diz respeito à


eliminação de microrganismos, e a da direita diz respeito ao
acerto da acidez.
a)não se altera durante o seu uso, e o ebulidor
c)dois produtos, por leite, sendo que a figura da esquerda diz
com o líquido A teria mais sucesso de vendas.
respeito à contaminação de hidróxido de sódio, e a da direita
diz respeito à contaminação de peróxido de hidrogênio.
b) aumenta durante o seu uso, e o ebulidor
d)hidróxido de sódio, por leite, na figura da esquerda, e a com o líquido A teria mais sucesso de vendas.
figura da direita não diz respeito à contaminação de nenhum
produto. c)não se altera durante o seu uso, e o ebulidor
com o líquido B teria mais sucesso de vendas.

d)aumenta durante o seu uso, e o ebulidor


4)O “Ebulidor de Franklin” é um brinquedo constituído de dois com o líquido B teria mais sucesso de vendas.
bulbos de vidro conectados por um tubo espiralado,
preenchido com líquido colorido. Seu uso consiste em
encostar a mão na base do bulbo inferior, fazendo com que o
líquido seja aquecido e ascenda para o bulbo superior. EQUILÍBRIO QUÍMICO
Popularmente, a libido de uma pessoa é avaliada com base
na quantidade de líquido que ascende. O sucesso de venda,
obviamente, é maior quanto mais positivamente o brinquedo 1) Uma proposta para obter energia limpa é a
indicar uma “alta libido”. Abaixo apresenta-se um gráfico da utilização de dispositivos eletroquímicos que
pressão de vapor em função da temperatura para dois líquidos, não gerem produtos poluentes, e que utilizem
A e B, que poderiam ser utilizados para preencher o “Ebulidor materiais disponíveis em grande quantidade
de Franklin”. ou renováveis. O esquema abaixo mostra,
parcialmente, um dispositivo que pode ser
Considerando essas informações, é correto afirmar que a utilizado com essa finalidade.
pressão no interior do brinquedo

171
a) A para B e o círculo ● representa o íon O²- ao ser retirada da calda, deve-se adicionar
mais cal à mistura. Se não ficar marrom, a
b) B para A e o círculo ● representa o íon O²+ . calda está pronta para o uso. De acordo com
esse teste, conclui-se que a cal deve
c) B para A e o círculo ● representa o íon O²- .
promover
d) A para B e o círculo ● representa o íon O²+ .
a)uma diminuição do pH, e o sulfato de
cobre(II), por sua vez, um aumento do pH da
água devido à reação SO42- + H2O → HSO4- +
OH-.
2) Uma equação química é uma equação matemática no
sentido de representar uma igualdade: todos os átomos e b)um aumento do pH, e o sulfato de cobre(II),
suas quantidades que aparecem nos reagentes também por sua vez, uma diminuição do pH da água
devem constar nos produtos. Considerando uma equação devido à reação Cu2+ + H2O → Cu(OH)+ + H+.
química e sua correspondente constante de equilíbrio, pode-
se afirmar corretamente que, multiplicando-se todos os seus c)uma diminuição do pH, e o sulfato de
coeficientes por 2, a constante de equilíbrio associada a esta cobre(II), por sua vez, um aumento do pH da
nova equação será água devido à reação Cu2+ + H2O → Cu(OH)+
a)o dobro da constante da primeira equação química, o que + H+.
está de acordo com um produtório.
d)um aumento do pH, e o sulfato de cobre(II),
b)o quadrado da constante da primeira equação, o que está por sua vez, uma diminuição do pH da água
de acordo com um produtório.
devido à reação SO42- + H2O → HSO4- + OH-.
c)igual à da primeira equação, pois ela é uma constante, o que
está de acordo com um somatório.
4) De tempos em tempos, o mundo se choca
d)a constante da primeira equação multiplicada por ln 2, o que
com notícias sobre o uso de armas químicas
está de acordo com um somatório.
em conflitos. O sarin é um composto
organofosforado líquido, insípido, incolor e
inodoro, altamente volátil, que se transforma
3) A calda bordalesa é uma das formulações mais antigas e
em gás quando exposto ao ar, sendo um dos
mais eficazes que se conhece. Ela foi descoberta na França
principais alvos dessas notícias. Em 1955, um
no final do século XIX, quase por acaso, por um agricultor que
projeto confidencial do exército americano
aplicava água de cal nos cachos de uva para evitar que
estudou a eficiência de hipoclorito na
fossem roubados; a cal promovia uma mudança na aparência
eliminação de sarin em ambientes
e no sabor das uvas. O agricultor logo percebeu que as
contaminados. A tabela a seguir mostra alguns
plantas assim tratadas estavam livres de antracnose.
resultados obtidos nesse estudo.
Estudando-se o caso, descobriu-se que o efeito estava
associado ao fato de a água de cal ter sido preparada em
tachos de cobre. Atualmente, para preparar a calda bordalesa,
coloca-se o sulfato de cobre em um pano de algodão que é
mergulhado em um vasilhame plástico com água morna.
Paralelamente, coloca-se cal em um balde e adiciona-se água
aos poucos. Após quatro horas, adiciona-se aos poucos, e
mexendo sempre, a solução de sulfato de cobre à água de cal.

Sendo t1/2 o tempo para a concentração do


(Adaptado de Gervásio Paulus, André Muller e Luiz Barcellos, Agroecologia aplicada:
práticas e métodos para uma agricultura de base ecológica. Porto Alegre: EMATER-RS, sarin cair à metade, de acordo com a tabela a
2000, p. 86.) reação é mais rápida em
Na formulação da calda bordalesa fornecida pela EMATER,
a)maiores concentrações de hipoclorito, mas
recomenda-se um teste para verificar se a calda ficou ácida:
não há elementos suficientes para analisar a
coloca-se uma faca de aço carbono na solução por três
influência da acidez do meio reacional.
minutos. Se a lâmina da faca adquirir uma coloração marrom

172
b)menores concentrações de hipoclorito, mas não há
elementos suficientes para analisar a influência da acidez do
meio reacional.

c)meios mais ácidos, mas não há elementos suficientes para


analisar a influência da concentração do hipoclorito.

d)meios menos ácidos, mas não há elementos suficientes


para analisar a influência da concentração do hipoclorito.
Essa influência se acentua na região dos
polos, em razão da temperatura da água do
mar.

5) A atividade humana tem grande impacto na biosfera; um d)


exemplo é o que vem ocorrendo na água dos oceanos nas
últimas décadas. Assinale a alternativa que corretamente
evidencia a influência da atividade humana no pH da água dos
oceanos e como ela se acentua em função da região do
planeta.

a)

Essa influência se acentua na região dos


trópicos, em razão da temperatura da água
do mar.

Essa influência se acentua na região dos polos, em razão da PROPRIEDADES FÍSICO-


temperatura da água do mar QUÍMICAS
b)
1) Com a crescente crise mundial de dengue,
as pesquisas
pela busca tanto de vacinas quanto de
repelentes de
insetos têm se intensificado. Nesse contexto,
os compostos
I e II abaixo representados têm propriedades
muito
distintas: enquanto um deles tem caráter ácido
e atrai os
insetos, o outro tem caráter básico e não os
Essa influência se acentua na região dos trópicos, em atrai.
razão da temperatura da água do mar.

c)

173
c) não é proveniente dos cometas, porque a
água da
Terra e a do cometa apresentam propriedades
físicas
muito diferentes.

d) é proveniente dos cometas e a água da


Terra e a do
cometa têm as mesmas propriedades físicas.

Baseado nessas informações, pode-se afirmar corretamente 3) As empresas que fabricam produtos de
que o composto limpeza têm se preocupado cada vez mais
com a satisfação do consumidor e a
a) I não atrai os insetos e tem caráter básico. preservação dos materiais que estão sujeitos
b) II atrai os insetos e tem caráter ácido. ao processo de limpeza. No caso do vestuário,
c) II não atrai os insetos e tem caráter básico. é muito comum encontrarmos a
d) I não atrai os insetos e tem caráter ácido e básico. recomendação para fazer o teste da firmeza
das cores para garantir que a roupa não será
danificada no processo de lavagem. Esse
teste consiste em molhar uma pequena parte
2) A comparação entre as proporções isotópicas de amostras da roupa e colocála sobre uma superfície
de um mesmo material, que têm a mesma idade, plana; em seguida, coloca-se um pano branco
encontradas em diferentes regiões, pode ser utilizada para de algodão sobre sua superfície e passa-se
revelar se elas têm ou não a mesma origem. Se as com um ferro bem quente. Se o pano branco
proporções são iguais, então é possível que tenham a ficar manchado, sugere-se que essa roupa
mesma origem, mas se forem diferentes, é certeza que não deve ser lavada separadamente, pois durante
têm a mesma origem. A tabela a seguir apresenta os dados esse teste ocorreu um processo de
de algumas amostras de água, incluindo a de um cometa no
qual uma sonda pousou recentemente. a) fusão do corante, e o ferro quente é
utilizado para aumentar a pressão sobre o
tecido.

b) liquefação do corante, e o ferro quente é


utilizado para acelerar o processo.

c) condensação do corante, e o ferro quente é


utilizado para ajudar a sua transferência para
o pano branco.

d) dissolução do corante, e o ferro quente é


utilizado para acelerar o processo.
Com base nesses dados, pode-se afirmar corretamente que
a água de nosso planeta

a) é proveniente dos cometas e a água da Terra e a do 4) “Ferro Velho Coisa Nova” e “Compro Ouro
cometa têm propriedades físicas muito parecidas. Velho” são expressões associadas ao
comércio de dois materiais que podem ser
b) não é proveniente dos cometas, apesar de a água da reaproveitados. Em vista das propriedades
Terra e a do cometa terem propriedades físicas muito químicas dos dois materiais mencionados nas
parecidas. expressões, pode-se afirmar corretamente
que

174
a) nos dois casos as expressões são apropriadas, já que
ambos os materiais se oxidam com o tempo, o que permite
distinguir o “novo” do “velho”.

b)nos dois casos as expressões são inapropriadas, já que


ambos os materiais se reduzem com o tempo, o que não
permite distinguir o “novo” do “velho”.

c)a primeira expressão é apropriada, pois o ferro se reduz com


o tempo, enquanto a segunda expressão não é apropriada,
pois o ouro é um material inerte.

d) a primeira expressão é apropriada, pois o ferro se oxida


com o tempo, enquanto a segunda expressão não é
apropriada, pois o ouro é um material inerte. c)

5)Bebidas gaseificadas apresentam o inconveniente de


perderem a graça depois de abertas. A pressão do CO2 no
interior de uma garrafa de refrigerante, antes de ser aberta,
gira em torno de 3,5 atm, e é sabido que, depois de aberta,
ele não apresenta as mesmas características iniciais.
Considere uma garrafa de refrigerante de 2 litros, sendo
aberta e fechada a cada 4 horas, retirando-se de seu interior
250 mL de refrigerante de cada vez. Nessas condições, pode-
se afirmar corretamente que, dos gráficos a seguir, o que mais
se aproxima do comportamento da pressão dentro da garrafa,
em função do tempo é o
d)

a)

6) “Quem tem que suar é o chope, não você”.


Esse é o slogan que um fabricante de chope
encontrou para evidenciar as qualidades de
b) seu produto. Uma das interpretações desse
slogan é que o fabricante do chope
recomenda que seu produto deve ser ingerido
a uma temperatura bem baixa. Pode se
afirmar corretamente que o chope, ao suar,
tem a sua temperatura

175
8) O Termômetro de Galileu (Figura A) é uma
a) diminuída, enquanto a evaporação do suor no corpo forma criativa de se estimar a temperatura
humano evita que sua temperatura aumente. ambiente. Ele consiste em uma coluna de
vidro preenchida com um líquido. Em seu
b)aumentada, enquanto a evaporação do suor no corpo interior, são colocadas várias bolas de vidro
humano evita que sua temperatura diminua. colorido calibradas e marcadas para a leitura
da temperatura. As bolas de vidro sobem ou
c) diminuída, enquanto a evaporação do suor no corpo descem em função da temperatura. A
humano evita que sua temperatura diminua. sensibilidade do Termômetro de Galileu reside
na sua capacidade de separar duas leituras de
d)aumentada, enquanto a evaporação do suor no corpo temperaturas. A figura B é um gráfico de
humano evita que sua temperatura aumente. densidade em função da temperatura para
água e etanol, dois líquidos que poderiam ser
usados no termômetro.

7) Em um estudo científico, uma fina camada de um novo filtro


protetor solar foi exposta previamente à radiação UVA e UVB
durante diferentes intervalos de tempo, testando-se em
seguida a sua eficiência em barrar essa mesma radiação. A
figura a seguir mostra apenas dois dos resultados obtidos no
experimento, sendo uma das curvas referente a uma
exposição por 10 minutos e, a outra, a uma exposição de 30
minutos.

De acordo com essas informações e os


conhecimentos de química, a leitura correta da
temperatura do termômetro representado na
Figura A pode ser indicada pela bola de vidro
que se situa

a)mais abaixo entre as que se encontram na


parte de cima do tubo, sendo que a água
proporcionaria um termômetro mais sensível.
De acordo com essa figura, na faixa de 300 a 320 nm, ao
triplicar o tempo de exposição prévia, o protetor apresentou b)mais acima entre as que se encontram na
uma eficiência parte de baixo do tubo, sendo que a água
a)menor, e a curva A diz respeito aos 30 minutos de exposição proporcionaria um termômetro mais sensível.
prévia.
c)mais acima entre as que se encontram na
b)menor, e a curva A diz respeito aos 10 minutos de exposição parte de cima do tubo, sendo que o etanol
prévia. proporcionaria um termômetro mais sensível.

c)menor, e a curva B diz respeito aos 10 minutos de exposição d)mais abaixo entre as que se encontram na
prévia. parte de cima do tubo, sendo que o etanol
proporcionaria um termômetro mais sensível.
d)maior, e a curva B diz respeito aos 30 minutos de exposição
prévia.

176
9) As caldeiras são utilizadas para alimentar máquinas nos dispositivos e suas respectivas energias estão
mais diversos processos industriais, para esterilização de esquematizados nas equações 1 e 2
equipamentos e instrumentos em hospitais, hotéis, apresentadas a seguir.
lavanderias, entre outros usos. A temperatura elevada da
água da caldeira mantém compostos solubilizados na água de De acordo com a notação química, pode-se
alimentação que tendem a se depositar na superfície de troca afirmar que as equações 1 e 2 representam
térmica da caldeira. Esses depósitos, ou incrustações, processos de
diminuem a eficiência do equipamento e, além de aumentar o
consumo de combustível, podem ainda resultar em explosões. a) dissolução, sendo a equação 1 para um hot
A tabela e a figura a seguir apresentam, respectivamente, pack e a equação 2 para um cold pack.
informações sobre alguns tipos de incrustações em caldeiras,
e a relação entre a espessura da incrustação e o consumo de b)dissolução, sendo a equação 1 para um cold
combustível para uma eficiência constante. pack e a equação 2 para um hot pack.

c) diluição, sendo a equação 1 para um cold


pack e a equação 2 para um hot pack.

d) diluição, sendo a equação 1 para um hot


pack e a equação 2 para um cold pack.

2) Um artigo científico recente relata um


processo de produção de gás hidrogênio e
dióxido de carbono a partir de metanol e água.
Uma vantagem dessa descoberta é que o
hidrogênio poderia assim ser gerado em um
carro e ali consumido na queima com oxigênio.
Dois possíveis processos de uso do metanol
como combustível num carro – combustão

Considerando as informações apresentadas, é correto afirmar


que as curvas A e B podem representar, respectivamente,
informações sobre incrustações

a)de sulfato e de carbonato. direta ou geração e queima do hidrogênio –


podem ser equacionados conforme o
b)de sulfato e de sílica.
esquema abaixo:
c)de sílica e de carbonato.

d)de carbonato e de sílica. De acordo com essas equações, o processo


de geração e queima de hidrogênio
apresentaria uma variação de energia

a) diferente do que ocorre na combustão direta


TERMOQUÍMICA do metanol, já que as equações globais
desses dois processos são diferentes.
1) Hot pack e cold pack são dispositivos que permitem,
respectivamente, aquecer ou resfriar objetos rapidamente e b) igual à da combustão direta do metanol,
nas mais diversas situações. Esses dispositivos geralmente apesar de as equações químicas globais
contêm substâncias que sofrem algum processo quando eles desses dois processos serem diferentes.
são acionados. Dois processos bastante utilizados nesses
c) diferente do que ocorre na combustão direta
do metanol, mesmo considerando que as

177
equações químicas globais desses dois processos sejam
iguais.

d) igual à da combustão direta do metanol, já que as equações


químicas globais desses dois processos são iguais.

3) Podemos obter energia no organismo pela oxidação de


Para um químico, no entanto, essa figura pode
diferentes fontes. Entre essas fontes destacam-se a gordura e
se assemelhar a um diagrama de entalpia, em
o açúcar. A gordura pode ser representada por uma fórmula
mínima (CH2)n enquanto um açúcar pode ser representado função da coordenada da reação (figura b). Se
por (CH2O)n. Considerando essas duas fontes de energia, a comparação for válida, a variação de
podemos afirmar corretamente que, na oxidação total de 1 entalpia dessa reação seria
grama de ambas as fontes em nosso organismo, os produtos
formados são a)praticamente nula, com a formação de dois
produtos.
a)os mesmos, mas as quantidades de energia são diferentes.
b)altamente exotérmica, com a formação de
dois produtos.
b) diferentes, mas as quantidades de energia são iguais.

c)os mesmos, assim como as quantidades de energia. c) altamente exotérmica, mas nada se poderia
afirmar sobre a quantidade de espécies no
produto.
d)diferentes, assim como as quantidades de energia.

d)praticamente nula, mas nada se poderia


afirmar sobre a quantidade de espécies no
4) Icebergs flutuam na água do mar, assim como o gelo em produto.
um copo com água potável. Imagine a situação inicial de um
copo com água e gelo, em equilíbrio térmico à temperatura de
6) Em 12 de maio de 2017 o Metrô de São
0 °C. Com o passar do tempo o gelo vai derretendo. Enquanto
houver gelo, a temperatura do sistema Paulo trocou 240 metros de trilhos de uma de
suas linhas, numa operação feita de
madrugada, em apenas três horas. Na solda
a)permanece constante, mas o volume do sistema aumenta.
entre o trilho novo e o usado empregou-se
b)permanece constante, mas o volume do sistema diminui. uma reação química denominada térmita, que
permite a obtenção de uma temperatura local
c)diminui e o volume do sistema aumenta. de cerca de 2.000 °C. A reação utilizada foi
entre um óxido de ferro e o alumínio metálico.
De acordo com essas informações, uma
d)diminui, assim como o volume do sistema.
possível equação termoquímica do processo
utilizado seria
a) Fe2O3 + 2Al → 2Fe + Al2O3 ; ∆H = + 852
5) O livro O Pequeno Príncipe, de Antoine de Saint-Exupéry, kJ·mol-1.
uma das obras literárias mais traduzidas no mundo, traz
b)O3 + Al → Fe + AlO3 ; ∆H = - 852 kJ·mol-1.
ilustrações inspiradas na experiência do autor como aviador
no norte da África. Uma delas, a figura (a), parece representar
um chapéu ou um elefante engolido por uma jiboia, c) FeO3 + Al → Fe + AlO3 ; ∆H = + 852 kJ·mol-
1.
dependendo de quem a interpreta.

d)Fe2O3 + 2Al → 2Fe + Al2O3 ; ∆H = - 852


kJ·mol-1.

178
equilíbrio da reação no sentido dos produtos,
uma vez que a reação é endotérmica.
7) Um dos pilares da nanotecnologia é o fato de as
propriedades dos materiais dependerem do seu tamanho e da
sua morfologia. Exemplo: a maior parte do H2 produzido
industrialmente advém da reação de reforma de 8) Numa fritadeira a ar com potência de 1400
hidrocarbonetos: CH4(g) + H2O(g) → 3H2(g) + CO(g). Uma W, um pedaço de carne ficou pronto para ser
forma de promover a descontaminação do hidrogênio é reagir consumido após 18 minutos de funcionamento
o CO com largo excesso de água: do equipamento. Um cozimento semelhante
foi realizado em menor tempo em um fogão a
CO(g) + H2O(g) → CO2(g) + H2(g); ΔH = -41,6 kJ mol-1.
gás. Nesse caso, foram consumidos 16
A figura abaixo mostra resultados da velocidade (em unidade gramas de gás propano, cuja reação de
arbitrária, ua) dessa conversão em função da temperatura, combustão é dada por:
empregando-se um nanocatalisador com duas diferentes
morfologias.
C3H8(g) + O2(g) → 3CO2(g) + 4H2O(g); ΔH= –
2046 kJ mol-1.
Comparando os dois processos de cozimento,
o consumo de energia foi maior empregando-
se

a)o fogão a gás, sendo cerca de 1,5 vezes


maior que o consumo da fritadeira a ar.

b)o fogão a gás, sendo cerca de 12 vezes


maior que o consumo da fritadeira a ar.

c)a fritadeira a ar, sendo cerca de 6 vezes


maior que o consumo do fogão a gás.

d)a fritadeira a ar, sendo cerca de 2 vezes


Considerando essas informações, é correto afirmar que, com maior que o consumo do fogão a gás.
essa tecnologia, a descontaminação do hidrogênio por CO é
mais eficiente na presença do catalisador em forma de

a)nanobastão, pois a transformação do CO ocorreria em


CÁLCULOS QUÍMICOS
temperaturas mais baixas, o que também favoreceria o
equilíbrio da reação no sentido dos produtos, uma vez que a 1) Quando uma tempestade de poeira atingiu
reação é exotérmica. o mar da Austrália em 2009, observou-se que
a população de fitoplancton aumentou muito.
b)nanobastão, pois a transformação do CO ocorreria em Esse evento serviu de base para um
temperaturas mais baixas, o que também favoreceria o experimento em que a ureia foi utilizada para
equilíbrio da reação no sentido dos produtos, uma vez que a fertilizar o mar, com o intuito de formar
reação é endotérmica. fitoplancton e capturar o CO2 atmosférico. De
acordo com a literatura científica, a
c)nanocubo, pois a transformação do CO ocorreria em composição elementar do fitoplancton pode
temperaturas mais elevadas, o que também favoreceria o ser representada por C106N16P.
equilíbrio da reação no sentido dos produtos, uma vez que a Considerando que todo o nitrogênio
reação é exotérmica. adicionado ao mar seja transformado em
fitoplancton, capturando o gás carbônico da
d)nanocubo, pois a transformação do CO ocorreria em atmosfera,1 (uma) tonelada de nitrogênio
temperaturas mais elevadas, o que também favoreceria o seria capaz de promover a remoção de,
aproximadamente, quantas toneladas de gás

179
carbônico?

a) 6,6.
b) 20,8.
c) 5,7.
d) 1.696.
Considerando que a DL50, — dose
Dados de massas molares em g mol-1: C=12; N=14 e necessária de uma dada substância para
O=16 matar 50% de uma população — da cafeína é
de 192 mg/kg, no teste realizado a dose
aplicada foi cerca de

SOLUÇÕES a)100 vezes maior que a DL50, da cafeína,


substância que deve ser classificada como
nociva.
1) Em seu livro Como se faz Química, o Professor Aécio
Chagas afirma que “quem transforma a matéria, sem pensar b) duas vezes maior que a DL50, da cafeína,
sobre ela, não é, e jamais será um químico”. Considere alguns substância que deve ser classificada como
produtos que um cozinheiro reconhece nas linhas 1-4 do tóxica.
quadro a seguir, e aqueles que um químico reconhece nas
linhas 5-8. c) 100 vezes maior que a DL50, da cafeína,
substância que deve ser classificada como
tóxica.
d) duas vezes maior que a DL50, da cafeína,
substância que deve ser classificada como
nociva.

Um químico, familiarizado com as atividades culinárias,


relacionaria as linhas
3) Episódios recentes de erupções vulcânicas
a) 1 e 7, porque o aroma da carne se deve,
têm trazido consequências trágicas para a
principalmente, aos hidrocarbonetos aromáticos.
sociedade e para o meio ambiente. Ativo
b) 3 e 5, porque a infusão facilita a extração de
desde 1983, o Vulcão Kilauea apresentou, em
componentes importantes do chá.
2018, a sua maior erupção já registrada.
c) 4 e 6, porque os carboidratos são constituintes
Quase ao mesmo tempo, foi a vez do Vulcão
importantes do óleo comestível.
Fuego da Guatemala mostrar sua força. No
d) 2 e 8, porque a proteína é um tipo especial de açúcar
Kilauea não houve explosões, ao contrário do
que ocorreu no Fuego. Os especialistas
afirmam que a ocorrência de uma erupção
explosiva depende da concentração e do tipo
2) Dois estudantes, de massa corporal em torno de 75 kg, da de gases dissolvidos no magma, como SO2,
Universidade de Northumbria, no Reino Unido, quase HF e HCl, além de vapor de água e CO2,
morreram ao participar de um experimento científico no qual aprisionados. A figura a seguir dá informações
seriam submetidos a determinada dose de cafeína e a um sobre a relação entre quantidades (em mol) de
teste físico posterior. Por um erro técnico, ambos receberam SO2, HF e HCl no magma de três vulcões
uma dose de cafeína 100 vezes maior que a dose planejada. distintos.
A dose planejada era de 0,3 g de cafeína, equivalente a três
xícaras de café. Sabe-se que a União Europeia, onde o teste
ocorreu, classifica a toxicidade de uma dada substância
conforme tabela a seguir.

180
Considerando o gráfico e as características da
doença, é correto afirmar que o eixo y
corresponde à concentração de

a)tirosina e a curva 1 pode ser correlacionada


a um indivíduo que apresenta a fenilcetonúria.

b)fenilalanina e a curva 1 pode ser


correlacionada a um indivíduo que apresenta
a fenilcetonúria.

c)tirosina e a curva 2 pode ser correlacionada


a um indivíduo que apresenta a fenilcetonúria.

d)fenilalanina e a curva 2 pode ser


correlacionada a um indivíduo que apresenta
a fenilcetonúria.
De acordo com a figura, em relação às quantidades de gases
dissolvidos no magma, é correto afirmar que as concentrações
de SO2, são maiores que as de HF e de HCl

a)nos três vulcões e, neles, HF e HCl são aproximadamente ISOMERIA


iguais.
1) Atualmente, parece que a Química vem
b)em apenas dois vulcões e, neles, HF e HCl são
seduzindo as
aproximadamente iguais.
pessoas e tem-se observado um número cada
vez maior
c)nos três vulcões, mas em apenas dois deles HF e HCl são
de pessoas portando tatuagens que remetem
aproximadamente iguais.
ao
conhecimento químico. As figuras a seguir
d)em apenas dois vulcões, mas nos três vulcões HF e HCl são
mostram duas
aproximadamente iguais.
tatuagens muito parecidas, com as
correspondentes
imagens tatuadas mais bem definidas abaixo.
4) Recentemente, o FDA aprovou nos EUA a primeira terapia
para o tratamento da fenilcetonúria, doença que pode ser
identificada pelo teste do pezinho. Resumidamente, a doença
leva ao acúmulo de fenilalanina no corpo, já que ela deixa de
ser transformada em tirosina, em função da deficiência da
enzima fenilalanina hidroxilase (PAH). As curvas do gráfico a
seguir podem representar o processo metabólico da
conversão de fenilalanina em tirosina em dois indivíduos: um
normal e outro que apresenta a fenilcetonúria.

As imagens representam duas fórmulas


estruturais, que
correspondem a dois
a) compostos que são isômeros entre si.
b) modos de representar o mesmo composto.
c) compostos que não são isômeros.

181
d) compostos que diferem nas posições das ligações
duplas a)1,9 mol de hidroxila.
b)2,3 mol de hidroxila.
c)2,5 mol de cobre.
ESTEQUIOMETRIA d)3,4 mol de cobre.

1) É muito comum o uso de expressões no diminutivo para


tentar “diminuir” a quantidade de algo prejudicial à saúde. Se
uma pessoa diz que ingeriu 10 latinhas de cerveja (330 mL
3) Fake News ou não? Hoje em dia, a
cada) e se compara a outra que ingeriu 6 doses de cachacinha
disponibilidade de informações é muito grande,
(50 mL cada), pode-se afirmar corretamente que, apesar de
mas precisamos saber interpretá-las
em ambas as situações haver danos à saúde, a pessoa que
corretamente. Um artigo na internet tem o
apresenta maior quantidade de álcool no organismo foi a que
seguinte título: “Glutamato monossódico, o
ingeriu
sabor que mata!”. Em determinado ponto do
Dados: teor alcoólico na cerveja = 5 % v/v teor alcoólico na texto, afirma-se:
cachaça = 45 % v/v
"Só para você ter ideia dos riscos,
a)as latinhas de cerveja, porque o volume ingerido é maior organizações internacionais de saúde indicam
neste caso. que a ingestão diária de sódio para cada
pessoa seja de 2,3 gramas. O glutamato é
b)as cachacinhas, porque a relação entre o teor alcoólico e o composto por 21% de sódio e, com certeza,
volume ingerido é maior neste caso. não será o único tempero a ser acrescentado
ao seu almoço ou jantar. Além disso, o
c)as latinhas de cerveja, porque o produto entre o teor realçador (glutamato) só conta um terço do
alcoólico e o volume ingerido é maior neste caso. nutriente que é encontrado no sal de cozinha.”

d) as cachacinhas, porque o teor alcoólico é maior neste caso. Dados de massas molares em g·mol-1: sódio
2) A calda bordalesa é uma das formulações mais antigas e = 23, cloreto = 35,5, glutamato monossódico =
mais eficazes que se conhece. Ela foi descoberta na França 169.
no final do século XIX, quase por acaso, por um agricultor que
aplicava água de cal nos cachos de uva para evitar que Para tornar a argumentação do artigo mais
fossem roubados; a cal promovia uma mudança na aparência consistente do ponto de vista químico, você
e no sabor das uvas. O agricultor logo percebeu que as sugeriria a seguinte reescrita dos trechos
plantas assim tratadas estavam livres de antracnose. destacados:
Estudando-se o caso, descobriu-se que o efeito estava
associado ao fato de a água de cal ter sido preparada em a) “A porcentagem em massa de sódio no
tachos de cobre. Atualmente, para preparar a calda bordalesa, realçador (glutamato) é de 13,6%.”; “Por outro
coloca-se o sulfato de cobre em um pano de algodão que é lado, o realçador só conta com cerca de um
mergulhado em um vasilhame plástico com água morna. terço do nutriente que é encontrado no sal de
Paralelamente, coloca-se cal em um balde e adiciona-se água cozinha.”.
aos poucos. Após quatro horas, adiciona-se aos poucos, e
mexendo sempre, a solução de sulfato de cobre à água de cal. b) “A porcentagem em massa de sódio no
realçador (glutamato) é de 39,3%.”; “Além
(Adaptado de Gervásio Paulus, André Muller e Luiz Barcellos, Agroecologia aplicada:
práticas e métodos para uma agricultura de base ecológica. Porto Alegre: EMATER-RS, disso, o realçador contém cerca de três vezes
2000, p. 86.) mais nutriente do que o encontrado no sal de
cozinha.”.
Na preparação da calda bordalesa são usados 100 g de
sulfato de cobre(II) pentaidratado e 100 g de hidróxido de c) “A porcentagem em massa de sódio no
cálcio (cal extinta). Para uma reação estequiométrica entre os realçador (glutamato) é de 11,2%.”; “Por outro
íons cobre e hidroxila, há um excesso de aproximadamente lado, o realçador conta com cerca de um terço
do nutriente que é encontrado no sal de
Dados de massas molares em g∙mol-1: sulfato de cobre (II) cozinha.”.
pentaidratado = 250; hidróxido de cálcio = 74.

182
d) “A porcentagem em massa de sódio no realçador das garrafas, tornando-a superior à pressão
(glutamato) é de 21,0%.”; “Além disso, o realçador contém atmosférica. O volume de gás no “pescoço” de
cerca de três vezes mais nutriente do que o encontrado no sal uma garrafa com uma bebida carbonatada a
de cozinha.”. 7 °C é igual a 24 ml, e a pressão no interior da
garrafa é de 2,8 x 105 Pa. Trate o gás do
“pescoço” da garrafa como um gás perfeito.
Considere que a constante universal dos
gases é de aproximadamente 8 J/mol · K e
4) A adição de biodiesel ao diesel tradicional é uma medida
que as temperaturas nas escalas Kelvin e
voltada para a diminuição das emissões de gases poluentes.
Celsius relacionam-se da forma T(K) = θ(°C) +
Segundo um estudo da FIPE, graças a um aumento no uso de
273.
biodiesel no Brasil, entre 2008 e 2011, evitou-se a emissão de
11 milhões de toneladas de CO2 (gás carbônico).
O número de moles de gás no “pescoço” da
(Adaptado de Guilherme Profeta, “Da cozinha para o seu carro: cúrcuma garrafa é igual a
utilizada como aditivo de biodiesel”. Cruzeiro do Sul, 10/04/2018.) a)1,2 x 105.
b)3,0 x 103.
Dados de massas molares em g·mol-1: H = 1, C = 12, 0 = 16. c)1,2 x 10-1.
d)3,0 x 10-3.
Considerando as informações dadas e levando em conta que
o diesel pode ser caracterizado pela fórmula mínima (CnH2n),
é correto afirmar que entre 2008 e 2011 o biodiesel substituiu
aproximadamente

a)3,5 milhões de toneladas de diesel.


INTERAÇÕES
b)11 milhões de toneladas de diesel.
c)22 milhões de toneladas de diesel. 1) Uma alternativa encontrada nos grandes
d)35 milhões de toneladas de diesel. centros urbanos, para se evitar que pessoas
desorientadas urinem nos muros de casas e
estabelecimentos comerciais, é revestir esses
muros com um tipo de tinta que repele a urina
5) Um medicamento se apresenta na forma de comprimidos
de 750 mg ou como suspensão oral na concentração de 100
mg/mL. A bula do remédio informa que o comprimido não pode
ser partido, aberto ou mastigado e que, para crianças abaixo
de 12 anos, a dosagem máxima é de 15 mg/kg/dose.

Considerando apenas essas informações, conclui-se que


uma criança de 11 anos, pesando 40 kg, poderia ingerir com
segurança, no máximo,

a)6,0 mL da suspensão oral em uma única dose. e, assim, “devolve a urina” aos seus
verdadeiros donos. A figura a seguir apresenta
b)7,5 mL da suspensão oral, ou um comprimido em uma única duas representações para esse tipo de
dose. revestimento.

c)um comprimido em uma única dose.

d)4,0 mL da suspensão oral em uma única dose.


Como a urina é constituída majoritariamente
por água, e levando-se em conta as forças
intermoleculares, pode-se afirmar
6) O CO2 dissolvido em bebidas carbonatadas, como
corretamente que
refrigerantes e cervejas, é o responsável pela formação da
espuma nessas bebidas e pelo aumento da pressão interna

183
a)os revestimentos representados em 1 e 2 apresentam a ELETROQUÍMICA
mesma eficiência em devolver a urina, porque ambos
apresentam o mesmo número de átomos na cadeia carbônica
1) A galvanoplastia consiste em revestir um
hidrofóbica.
metal por outro a fim de protegê-lo contra a
corrosão ou melhorar sua aparência. O
b) o revestimento representado em 1 é mais eficiente para
estanho, por exemplo, é utilizado como
devolver a urina, porque a cadeia carbônica é hidrofóbica e
revestimento do aço empregado em
repele a urina.
embalagens de alimentos. Na galvanoplastia,
a espessura da camada pode ser controlada
c) o revestimento representado em 2 é mais eficiente para
com a corrente elétrica e o tempo empregados.
devolver a urina, porque a cadeia carbônica apresenta um
A figura abaixo é uma representação
grupo de mesma polaridade que a água, e, assim, é
esquemática desse processo.
hidrofóbica e repele a urina.

d) o revestimento representado em 2 é mais eficiente para


devolver a urina, porque a cadeia carbônica apresenta um
grupo de mesma polaridade que a água, e, assim, é hidrofílica
e repele a urina.

RADIOATIVIDADE

1) Um filme de ficção muito recente destaca o isótopo 32He,


muito abundante na Lua, como uma solução para a produção
de energia limpa na Terra. Uma das transformações que esse
elemento pode sofrer, e que justificaria seu uso como
combustível, está esquematicamente representada na reação
abaixo, em que o 23He aparece como reagente.
Considerando a aplicação de uma corrente
constante com intensidade igual a 9,65 x 10-3
A, a massa depositada de estanho após 1 min
40 s será de aproximadamente
Dados: 1 mol de elétrons corresponde a uma carga
de 96.500 C; Sn: 119 g∙mol-1.
De acordo com esse esquema, pode-se concluir que essa

transformação, que liberaria muita energia, é uma


a)0,6 mg e ocorre, no processo, a
a) fissão nuclear, e, no esquema, as esferas mais escuras transformação de energia química em energia
representam os nêutrons e as mais claras os prótons. elétrica.

b)fusão nuclear, e, no esquema, as esferas mais escuras b)0,6 mg e ocorre, no processo, a


representam os nêutrons e as mais claras os prótons. transformação de energia elétrica em energia
c)fusão nuclear, e, no esquema, as esferas mais escuras química.
representam os prótons e as mais claras os nêutrons.
c)1,2 mg e ocorre, no processo, a
d) fissão nuclear, e, no esquema, as esferas mais escuras são transformação de energia elétrica em energia
os prótons e as mais claras os nêutrons. química
.
d)1,2 mg e ocorre, no processo, a
transformação de energia química em energia
elétrica.

184
INTRODUÇÃO À QUÍMICA
1) Com a crise hídrica de 2015 no Brasil, foi necessário ligar
as usinas termoelétricas para a geração de eletricidade,
Esse resultado é compatível com o fato de que
medida que fez elevar o custo da energia para os brasileiros.
o metal A tem
O governo passou então a adotar bandeiras de cores
diferentes na conta de luz para alertar a população. A bandeira
a)menor densidade, embora seja menos
vermelha indicaria que a energia estaria mais cara. O
resistente à corrosão.
esquema a seguir representa um determinado tipo de usina
termoelétrica.
b)menor densidade e é mais resistente à
corrosão.

c)maior densidade, embora seja menos


resistente à corrosão.

d)maior densidade e é mais resistente à


corrosão.

REAÇÕES ORGÂNICAS

1) No Brasil, cerca de 12 milhões de pessoas


sofrem de diabetes mellitus, uma doença
causada pela incapacidade do corpo em
Conforme o esquema apresentado, no funcionamento da
produzir insulina ou em utilizá-la
usina há
adequadamente. No teste eletrônico para
determinar a concentração da glicose
a) duas transformações químicas, uma transformação física e sanguínea, a glicose é transformada em ácido
não mais que três tipos de energia.
glucônico e o hexacianoferrato(III) é
transformado em hexacianoferrato(II),
b)uma transformação química, uma transformação física e
conforme mostra o esquema a seguir.
não mais que dois tipos de energia.

c)duas transformações químicas, duas transformações físicas


e pelo menos dois tipos de energia.

d) uma transformação química, duas transformações físicas e


Em relação ao teste eletrônico, é correto
pelo menos três tipos de energia.
afirmar que

a)a glicose sofre uma reação de redução e o


hexacianoferrato(III) sofre uma reação de
2) Para ser usado em um implante dentário, um metal ou liga oxidação.
precisa apresentar excelente compatibilidade com o
organismo, alta resistência mecânica e boa flexibilidade, entre b)a glicose sofre uma reação de oxidação e o
outros atributos. Imagine que dois metais, A e B, tenham sido hexacianoferrato(III) sofre uma reação de
testados quanto à sua aplicação em um implante, e o metal A redução.
foi considerado a melhor opção.
c)ambos, glicose e hexacianoferrato(III),
sofrem reações de oxidação.

185
c)a curva B, sendo que o eixo horizontal
d)ambos, glicose e hexacianoferrato(III), sofrem reações de representa a temperatura externa e o eixo
redução. vertical, a liberação de CO2.

d)a curva B, sendo que o eixo horizontal


2) Mais de 2.000 plantas produzem látex, a partir do qual se representa a temperatura interna e o eixo
produz a borracha natural. A Hevea brasiliensis (seringueira) vertical, a liberação de CO2.
é a mais importante fonte comercial desse látex. O látex da
Hevea brasiliensis consiste em um polímero do cis-1,4-
isopreno, fórmula C5H8, com uma massa molecular média de
1.310 kDa (quilodaltons). De acordo com essas informações,
a seringueira produz um polímero que tem em média

Dados de massas atômicas em Dalton: C = 12 e H = 1. gabarito


a)19 monômeros por molécula.
b)100 monômeros por molécula. (PS: sempre veja os erros como uma
oportunidade de aprendizado. Não fique triste
c)1.310 monômeros por molécula. se errar, você está dando o seu melhor.)

d)19.000 monômeros por molécula. Propriedades coligativas 1C 2C 3B

Gases 1C 2A

CINÉTICA QUÍMICA Inorgânica 1B 2A 3A 4B

Equilíbrio químico 1A
1) Os eixos do gráfico a seguir representam duas variáveis,
Termoquímica 1B 2D 3A 4B 5D 6D 7A
uma delas não identificada no gráfico. Uma curva representa
8D
animais endotérmicos e a outra, animais ectotérmicos.
Soluções 1B 2B 3C 4C

Propriedades físico-químicas 1C 2B 3D
4D 5B 6D 7B 8D 9C

Isomeria 1B

Equilíbrio químico 1D 2B 3B 4D 5 C

Estequiometria 1C 2A 3A 4A 5A 6D

Interações 1B

Radioatividade 1C

Eletroquímica 1B

Introdução à química 1D 2A
A curva que corretamente se aplica ao ser humano é
Reações orgânicas 1B 2D
a)a curva A, sendo que o eixo horizontal representa a
temperatura externa e o eixo vertical, o consumo de O2. Cinética química 1A

b)a curva A, sendo que o eixo horizontal representa a


temperatura interna e o eixo vertical, o consumo de O2.

186
O que mais cai na
segunda fase nos
últimos cinco anos
(medicina)

Português: Biologia:
1) Obras literárias
1) Ecologia
2) Interpretação de texto
2) Genética
3) Figuras de linguagem
3) Botânica

4) Evolução
Química: 5) Fisiologia
1) Equilíbrio químico e cinética química

2) Cálculos químicos e estequiometria

3) Química Inorgânica
Matemática:
4) Termoquímica
1) Funções
5) Química Ambiental
2) Geometria Plana

3) Geometria Espacial

4) Matriz

5) Probabilidade, Porcentagem,
biologia
Bioenergia
6. A biotecnologia está presente em nosso dia a dia, contribuindo de forma significativa para a nossa
qualidade de vida. Ao abastecer um automóvel com etanol, estamos fazendo uso de um produto da
biotecnologia obtido com a fermentação de açúcares presentes no caldo extraído da cana-de-açúcar. Após
a extração do caldo, uma quantidade significativa de carboidratos presentes na estrutura celular é perdida
no bagaço da cana-de-açúcar. A produção de etanol de segunda geração a partir do bagaço seria uma
forma de aumentar a oferta de energia renovável, promovendo uma matriz energética mais sustentável.

a) Cite um carboidrato presente na estrutura da parede celular da cana-de-açúcar que poderia ser
hidrolisado para fornecer os açúcares para a obtenção de etanol. Por que a biomassa é considerada
uma fonte renovável de energia?

b) Como os micro-organismos atuam na fermentação e se beneficiam desse processo?

Resolução (será considerado apenas o que estiver dentro deste espaço).


14. Mecanismos de controle de pH são fundamentais para a vida. Um mecanismo bastante eficiente de
controle de pH por organismos vivos envolve moléculas doadoras e aceptoras de prótons, que são ácidos e
bases que atuam em conjunto equilibrando alterações de pH às quais os organismos estão sujeitos.

a) Alterações no pH intracelular afetam a estrutura de proteínas. Por que isso ocorre?

b) Que consequências para o processo de respiração celular a alteração na estrutura de proteínas


envolvidas com o ciclo de Krebs pode trazer?

Resolução (será considerado apenas o que estiver dentro deste espaço).

T14
Genética
18. Recentemente, foi criado um sistema que emprega moléculas sintéticas de DNA para armazenar
dados de textos, imagens ou vídeos simples. Nesse sistema, qualquer trecho compreendido entre 5 bases
A na sequência da molécula sintética de DNA é chamado códex, o qual tem a estrutura genérica abaixo.
códex

AAAAAGTTTATTTTCGTTTTTCGCGCTCGCCGTTCGCGTTGCCGAAAAA
pixet a b c d e f g h i j k l m n o p q r s
A primeira base de cada códex é o pixet, que indica qual das três linhas de pixels da imagem o códex
representa: G indica a primeira linha (1), C indica a segunda linha (2) e T indica a terceira linha (3).
Após o pixet, o códex inclui 19 conjuntos de duas bases (dupletos), nomeados de a até s; cada dupleto
representa um pixel gráfico na imagem.
Por exemplo, a imagem abaixo foi codificada pela sequência de DNA a seguir (apenas a sequência de uma
das fitas de DNA é apresentada): AAAAACTTTATTTTCCTTTTTTACACTTGGTTTTGTGT
TTGGTTAAAAATCCTTTGTTAGCCTTCCTTTTTTCATTTTGTGTTTAGAGAAAAAG
TTTATTTTCGTTTTTCGCGCTCGCCGTTCGCGTTGCCGAAAAA.
a b c d e f g h i j k l m n o p q r s
1
2
3

a) Qual a sequência de bases do dupleto que representa os pixels do tipo ? Explique, em termos da
deterioração da imagem, por que a inserção de uma base extra logo após o primeiro dupleto de um
códex da sequência de DNA acima é mais grave que a deleção do último dupleto desse códex.

b) Compare o funcionamento dos dupletos do sistema descrito acima com o funcionamento dos códons na
codificação de aminoácidos em organismos vivos. Qual organela catalisa o processo de tradução?

Resolução (será considerado apenas o que estiver dentro deste espaço).

RASCUNHO
T18
6. O heredograma abaixo representa o padrão de herança, em uma única família, de uma doença genética
humana. Os indivíduos doentes são representados em preto, enquanto os indivíduos não doentes são
indicados em branco. Nessa família, a doença é causada por apenas um loco gênico, localizado em um dos
dois tipos de cromossomos sexuais. No conjunto dos indivíduos da família, esse loco apresenta dois alelos,
A1 e A2.

Legenda:
= homens

= mulheres

a) O loco gênico envolvido nessa doença está no cromossomo X ou no cromossomo Y? Considerando que
um dos alelos é dominante, o alelo que promove o aparecimento da doença nos indivíduos afetados
(alelo A1) é dominante ou recessivo em relação ao alelo A2 ? Explique como você chegou às suas
conclusões.
b) Pesquisas recentes analisaram as alterações causadas nos neurônios de indivíduos doentes pelo alelo
A1. Nessas pesquisas, fibroblastos coletados da pele de pessoas afetadas foram utilizados para produzir
células-tronco pluripotentes (iPSC). As iPSC foram então utilizadas para gerar neurônios. Por que
células-tronco podem originar neurônios? Por que não seria adequado aos pesquisadores estudar os
efeitos neuronais do alelo A1 diretamente nos fibroblastos coletados da pele dos indivíduos afetados?
(Inspirado em Maria C. N. Marchetto e outros, A model for neural development and treatment of Rett Syndrome using human
induced pluripotent stem cells. Cell, Cambridge, v. 143, p. 527–539, nov. 2010. Pesquisa realizada pela equipe do brasileiro
Alysson Muotri, ex-aluno da UNICAMP e atualmente professor da Universidade da Califórnia, San Diego, EUA.)

Resolução (será considerado apenas o que estiver dentro deste espaço).

RASCUNHO
T6
1. Quando se pretende transformar a espécie X na espécie Y, ambas devem ser unidas por fertilização e,
em seguida, os híbridos resultantes devem ser fertilizados com o pólen de Y. Depois, das várias proles
resultantes, seriam selecionadas aquelas que apresentassem maior semelhança com Y, que novamente
seriam fertilizadas com pólen de Y, e assim sucessivamente até que, finalmente, Y se mantivesse constante
nas gerações seguintes. Por este processo, a espécie X teria sido transformada na espécie Y.
(Adaptado de http://media.wix.com/ugd/b703be_02adaf2adad94fc08b146c5ab0e4b924.pdf. Acessado em 12/12/2016.)

O trecho acima, adaptado da tradução do artigo de Gregor Mendel, ilustra o interesse de Mendel na
transformação de espécies.

a) O processo descrito por Mendel está relacionado com que prática amplamente usada na agricultura?
Quais as vantagens da utilização desse processo na agricultura?

b) Considerando que a espécie X tenha as características “A” e “B”, que a espécie Y tenha as
características “a” e “b” e que os alelos “A” e “B” são dominantes, a partir do cruzamento de X com Y, em
quantas gerações todos os descendentes resultantes teriam apenas as características ab? Quais seriam
os genótipos formados em cada uma das gerações?

Resolução (será considerado apenas o que estiver dentro deste espaço).


1. Dados genéticos podem ser utilizados para estudar populações de uma espécie no ambiente natural.
Por exemplo, amostras de DNA podem ser coletadas para identificar espécies, estimar tamanhos
populacionais ou identificar indivíduos. Um pesquisador coletou duas amostras de fezes em uma localidade
na Índia e sequenciou parte do gene Gapdh dos DNAs extraídos a partir delas. Como resultado, foram
obtidas as sequências abaixo (apenas uma das fitas do DNA é mostrada).

Amostra 1 5' ACAGGATCCAATAACCCCGCAGGAATGGTG 3'


Amostra 2 5' ACAGGATCCAATAACCCCTCACGAATGGTG 3'

As sequências da mesma região do gene Gapdh nos genomas do tigre de Bengala (Panthera tigris) e do
leopardo (Panthera pardus) são:

Panthera tigris 5' ACAGGATCCAATAACCCCGCAGGAATGGTG 3'


Panthera pardus 5' ACAGGATCTAACAACCCCGCAGGAATAGTA 3'

a) De posse desses dados, responda: as amostras de fezes 1 e 2 pertencem, com maior probabilidade, a
tigres de Bengala ou a leopardos? As amostras 1 e 2 pertencem ao mesmo indivíduo ou a dois
indivíduos diferentes? Justifique sua resposta.

b) Um crítico argumentou que o trabalho do pesquisador não era válido, pois as sequências do gene
nuclear Gapdh foram obtidas a partir de amostras de fezes. Segundo o crítico, material genético nuclear
de felinos só poderia ser extraído com qualidade a partir de hemácias (eritrócitos) coletadas dos
animais. Quem tem razão, o pesquisador ou o crítico? Justifique.

(Fonte: J. Bhagavatula e L. Singh. BMC Genetics, Londres, v. 7, p. 48, out. 2006.)

Resolução (será considerado apenas o que estiver dentro deste espaço).

RASCUNHO T1
7. Um cidadão foi preso por um crime que não cometeu. O exame do DNA encontrado na cena do crime
revelou que ele é compatível com o do indivíduo apontado como culpado. As provas colhidas em um outro
crime, ocorrido durante a reclusão do suposto criminoso, curiosamente apontaram o mesmo perfil genético,
colocando em cheque o trabalho de investigação realizado. As suspeitas então recaíram sobre um irmão
gêmeo do indivíduo.

a) Como são denominados os gêmeos do caso investigado? Que tipo de análise seria capaz de distinguir
os gêmeos?

b) Descreva os processos de fecundação e desenvolvimento embrionário que podem ter gerado os


gêmeos envolvidos no caso investigado.

Resolução (será considerado apenas o que estiver dentro deste espaço).

T7
Biotecnologia
14. Nos últimos anos, foram desenvolvidos vários processos tecnológicos para a biodegradação dos
plásticos PE (polietileno) e PET (polietilenotereftalato), amplamente utilizados na fabricação de embalagens.
Em países desenvolvidos, apenas ¼ do total de PE produzido é reciclado; o restante é descartado em
aterros sanitários ou queimado por combustão, resultando em enorme ônus ambiental.
a) Em um estudo inicial, verificou-se que lagartas vivas da mariposa Galleria mellonella são capazes de
reduzir a massa de sacolas plásticas de PE. Posteriormente, lagartas dessa espécie foram maceradas para
produzir um extrato líquido, que foi então depositado por 10 horas sobre um pedaço de PE. O gráfico abaixo
mostra a massa restante por cm2 de PE na ausência e na presença do extrato após 10 horas.
Por que os dados do gráfico confirmam que a redução da massa das
1,1 sacolas plásticas causada pela presença das lagartas vivas não é
mg / cm2 de PE após 10h

resultado apenas da mastigação mecânica pelos insetos? Considerando


que a taxa de degradação de PE definida no gráfico permanece
1 constante, quantas horas seriam necessárias para uma quantidade
suficiente de extrato degradar todo o pedaço de PE? Explique.

0,9 b) Mais recentemente, um grupo de pesquisadores descobriu uma


bactéria encontrada em aterros sanitários no Japão, denominada
Ideonella sakaiensis, capaz de fragmentar o PET em unidades menores,
0,8
processo que depende de uma enzima específica, chamada PETase. Foi
sem com sugerido que o genoma da I. sakaiensis poderia ser utilizado para a
extrato extrato criação de uma bactéria transgênica a ser empregada em processos
industriais de reciclagem de resíduos plásticos. O que é transgenia? Para
criar tal bactéria transgênica, que parte do genoma da I. sakaiensis seria
essencial?
(Fontes: Paolo Bombelli e outros, Polyethylene bio-degradation by caterpillars of the wax moth Galleria mellonella. Current Biology, Cambridge, v. 27, p.
R283–R293, abr. 2017. Harry P. Austin e outros, Characterization and engineering of a plastic-degrading aromatic polyesterase. Proceedings of the
National Academy of Sciences of the USA, Washington, v. 115, p. E4350-E4357, maio 2018. Esse estudo teve a participação do grupo liderado pelo Prof.
Dr. Munir Skaf, Pró-Reitor de Pesquisa da UNICAMP.)

Resolução (será considerado apenas o que estiver dentro deste espaço).

RASCUNHO
T14
16. Aedes aegypti modificados (transgênicos) têm sido utilizados no combate à dengue. Esses mosquitos
produzem uma proteína que mata seus descendentes ainda na fase de larva. Mosquitos machos
modificados são soltos na natureza para procriar com fêmeas nativas, mas os filhotes resultantes desse
cruzamento não sobrevivem. É possível monitorar a presença de ovos resultantes do cruzamento de
machos modificados com fêmeas nativas a partir da luz fluorescente emitida pelos ovos.

a) Descreva o princípio da técnica utilizada para produzir os mosquitos modificados.

b) Por que os ovos resultantes do cruzamento dos machos modificados com fêmeas nativas emitem luz
fluorescente? O que é preciso fazer com os ovos para saber se eles emitem luz fluorescente?

Resolução (será considerado apenas o que estiver dentro deste espaço).

T16
5. A estrutura química do composto puromicina é muito semelhante à estrutura de um RNA transportador.
Em virtude dessa semelhança, os ribossomos de procariotos são capazes de interagir com a puromicina
como se ela fosse um RNA transportador. O ribossomo catalisa a formação de uma ligação covalente entre
a cadeia proteica em crescimento e a puromicina, se este composto estiver presente durante a tradução.
Após tal evento bioquímico, novos aminoácidos não podem ser incorporados à cadeia da proteína.

a) Por que a puromicina tem ação antibiótica sobre bactérias? Na presença de puromicina, a massa
molecular média de uma dada proteína bacteriana será maior, igual ou menor em relação à massa
média da mesma proteína na ausência do antibiótico? Explique seu raciocínio.

b) A puromicina também é utilizada para transgenia. Neste caso, um gene que codifica uma enzima capaz
de destruir a puromicina é adicionado, juntamente com o gene de interesse do pesquisador, ao genoma
de células cultivadas in vitro. Na presença de puromicina, a taxa de sobrevivência de células que
receberam esses genes será igual, maior ou menor em relação à sobrevivência de células não
modificadas? Explique seu raciocínio.

Resolução (será considerado apenas o que estiver dentro deste espaço).

RASCUNHO
T5
Evolução
8. Os fósseis são uma evidência de que nosso planeta foi habitado por organismos que já não existem
atualmente, mas que apresentam semelhanças com organismos que o habitam hoje.

a) Por que espécies diferentes apresentam semelhanças anatômicas, fisiológicas e bioquímicas?

b) Cite quatro características que todos os seres vivos têm em comum.

Resolução (será considerado apenas o que estiver dentro deste espaço).

T8
15. Organismos vivos são classificados em grupos taxonômicos, que devem preferencialmente refletir as
relações de parentesco evolutivo entre as espécies.

a) A tabela apresentada abaixo (parte a do espaço de resposta) contém características presentes em


anelídeos, platelmintos e moluscos. Preencha corretamente todos os espaços em cinza na tabela,
referentes às características listadas na primeira coluna, de acordo com as opções indicadas na
segunda coluna. Atenção: há duas colunas denominadas X e Y; uma representa moluscos e a outra
representa platelmintos.

b) Um dos critérios para a construção do diagrama abaixo (parte b do espaço de resposta) é o número de
características compartilhadas entre pares de grupos taxonômicos. Preencha os retângulos em branco
do diagrama com o nome de um dos dois grupos ― moluscos ou platelmintos. Utilize as linhas em
branco para explicar o que representa esse tipo de diagrama.

Resolução (será considerado apenas o que estiver dentro deste espaço).

a)
Característica Opções X Anelídeos Y
Acelomados,
Celoma Pseudocelomados ou Celomados Acelomados
Celomados
Radial, Pentarradial ou
Simetria Bilateral