Você está na página 1de 144

Agosto 2021

Herpetologia
Brasileira

volume 10 número 2
ISSN: 2316-4670
1
Herpetologia
B rasileira
Uma publicação da Sociedade
Brasileira de Herpetologia

Sociedade Brasileira de Herpetologia


www.sbherpetologia.org.br

Presidente: Otavio Augusto Vuolo Marques


1° Secretário: Paula Hanna Valdujo
2° Secretário: Karina Rodrigues da Silva Banci
1° Tesoureiro:
2° Tesoureiro: Rafael dos Santos Henrique

Conselho: Christine Strussmann, Délio Baêta, Hélio R. da Silva, José P. Pombal


Jr., Luciana B. Nascimento, Márcio Martins, Mariana L. Lyra, Taran Grant e Thais
Condez.

Membros Honorários: Augusto S. Abe, Carlos Alberto G. Cruz, Ivan Sazima,


Luiz D. Vizzoto, Thales de Lema.

Diagramação: Isadora Puntel de Almeida

Erythrolamprus dorsocorallinus
Manoel Urbano AC
@ Henrique Nogueira

ISSN: 2316-4670
volume 10 n.úmero 2
Agosto de 2021
Informações Gerais

A revista eletrônica
Herpetologia Brasileira
é quadrimestral (com números em abril, agosto e dezembro) e
publica textos sobre assuntos de interesse para a comunidade
herpetológica brasileira.
Ela é disponibilizada em formato PDF apenas online, na pá-
gina da Sociedade Brasileira de Herpetologia (http://www.
sbherpetologia.org.br/publicacoes/herpetologia-brasileira),
ou seja, não há versão impressa em gráfica. Entretanto, qual-
quer Pessoa pode imprimir este arquivo.
Seções
Notícias da Sociedade Brasileira de Herpetologia:
Esta seção apresenta informações diversas sobre a SBH e é de responsabilidade da
diretoria da SBH.

Notícias Herpetológicas Gerais:


Esta seção apresenta informações de interesse para nossa comunidade. A seção
também inclui informações sobre grupos de pesquisa, instituições, programas de
pós-graduação, etc.

Notícias de Conservação:
Esta seção apresenta informações sobre a conservação da herpetofauna brasileira.

História da Herpetologia Brasileira:


Esta seção apresenta entrevistas e curiosidades sobre a história da herpetologia
Brasileira (e.g. congressos, histórias de campo, etc), buscando resgatar um pouco
da nossa história para os dias atuais.

Trabalhos Recentes: Esta seção apresenta resumos breves de trabalhos publica-


dos recentemente sobre espécies brasileiras, ou sobre outros assuntos de interesse
para a nossa comunidade, preferencialmente em revistas de outras áreas.

Dissertações & Teses:


Esta seção é publicada anualmente no último volume do ano (dezembro) e apresen-
ta as informações sobre as dissertações e teses em qualquer aspecto da herpetologia
brasileira defendidas no ano anterior. Qualquer egresso ou orientador pode entrar
em contato diretamente com o editor da seção informando os seguintes dados refe-
rentes a dissertação ou tese defendida: (1) universidade e departamento/instituto;
(2) graduação; (3) data da defesa/aprovação; (4) programa de pós-graduação; (5)
aluno; (6) título; (7) orientador.
Seções
Métodos em Herpetologia:
Esta seção trata dos métodos clássicos e de vanguarda referentes a herpe-
tologia. São abrangidos revisões e descrições de novos métodos empíricos
relacionados aos diversos métodos de coleta e análise de dados, represen-
tando a multidisciplinaridade da herpetologia moderna.

Ensaios & Opiniões:


Esta seção apresenta opiniões sobre assuntos de interesse geral em herpe-
tologia.

Resenhas:
Esta seção apresenta textos que resumem e avaliam o conteúdo de livros,
filmes, jogos ou aplicativos de interesse para nossa comunidade.

Notas de História Natural & Distribuição Geográfica:


Esta seção apresenta artigos que, preferencialmente, resultam de observa-
ções de campo, de natureza fortuita, realizadas no Brasil ou sobre espécies
que ocorrem no país.

Obituários:
Esta seção apresenta artigos avisando sobre o falecimento recente de um
membro da comunidade herpetológica brasileira ou internacional, conten-
do uma descrição de sua contribuição para a herpetologia.
Corpo
Editorial
Editores Gerais: História da Herpetologia
Délio Baêta Brasileira
José P. Pombal Jr. Bianca Berneck
Jessica Fratani Teresa Cristina Ávila-Pires

Editor de língua inglesa: Trabalhos Recentes:


Ross D. MacCulloch Adriano Oliveira Maciel
Ariadne Fares Sabbag
Notícias da SBH: Daniel S. Fernandes
Paula H. Valdujo Daniela Pareja Mejia
Karina R. S. Banci Laura R. V. de Alencar

Notícias Herpetológicas Gerais: Dissertações & Teses:


Cinthia Aguirre Brasileiro Giovanna G. Montingelli
Mirco Solé
Paulo Sérgio Bernarde Divulgação:

Rachel Montesinos Daniela Pareja Mejia


Diego G. Cavalheri

Notícias de Conservação: Larissa Mendes

Cybele Lisboa Laura R. V. de Alencar

Débora Silvano Mariana R. Pontes

Ibere F. Machado Quezia Ramalho

Luis Fernando Marin Fonte Sarah Mângia

Mariana R. Pontes
Corpo
Editorial
Métodos em Herpetologia:
Alexandro Tozetti
Luís Felipe Toledo

Ensaios & Opiniões:


Julio Cesar de Moura-Leite
Luciana B. Nascimento
Teresa Cristina Ávila-Pires

Resenhas:
José P. Pombal Jr.
Quezia Ramalho

Notas de História Natural &


Distribuição Geográfica:
Henrique C. Costa - Répteis
Sarah Mângia - Anfíbios

Obituários:
Entrar em contato com os editores gerais
Sumário
Notícias da Sociedade Brasileira
de Herpetologia 10
Notícias Herpetológicas Gerais 16
Notícias de Conservação 24
Trabalhos Recentes 36
Métodos em Herpetologia 45
Ensaios & Opiniões 96
Resenhas 109
Notas de História Natural &
Distribuição Geográfica 116
Ilustração
Melanophryniscus admirabilis
@ Ingrid Ribeiro
Herpetologia Brasileira vol. 10 n.o 2 - Notícias da S. B. H.

Notícias da Sociedade
Brasileira de Herpetologia
Notas dos Editores
Nova tag da HB nas redes: #ArteNaHB

D
urante a seleção das fotos etc de espécies de anfíbios e répteis
para a edição de Abril de brasileiras. *Atenção* para que o ani-
2021, nos deparamos com mal represente uma espécie real (e.g.
a arte lindíssima da Natália Azevedo Bothrops bilineatus). Além disso, a
(Bothrops bilineatus), a qual estampou imagem tem que estar com boa quali-
uma das páginas da revista. dade e, caso selecionada, ainda precisa-
rá ser aprovada pela diagramadora da
Daí pensamos: por que não levantar revista.
uma tag para incluir artes incríveis na
revista Herpetologia Brasileira? Atra- Vem com a gente participar desta ideia
vés dos perfis da HB, temos visto mui- e compartilhar sua arte com a Herpe-
tos desenhos, pinturas e até esculturas tologia Brasileira! Apoie esta ideia, di-
com temática herpetológica e que cer- vulgue!
tamente fariam a revista ainda mais
linda! Assim, apresentamos a tag #Ar- Equipe HB nas redes
teNaHB.
MUDANÇAS NO CORPO EDITORIAL
Se postar uma arte herpetológica baca-
na, marque a tag e ela poderá fazer par-
A Herpetologia Brasileira agradece a
te da revista. Mas preste atenção nas
editora da seção de Trabalhos Recentes
condições:
Jéssica Mudrek e dá boas-vindas a nova
editora da seção Daniela Pareja Mejia.
Serão válidos desenhos a mão livre, de-
senhos digitais, pinturas, esculturas,
10
Herpetologia Brasileira vol. 10 n.o 2 - Notícias da S. B. H.

NOTÍCIAS DA SOCIEDADE BRA- sim, a oficina foi organizada de modo


SILEIRA DE HERPETOLOGIA remoto com emprego de plataformas e
tecnologias digitais de trabalho, alter-
nando momentos de trabalho em grupo
GLOBAL TAXONOMY INITIATIVE
e plenárias coletivas permitindo a dis-
cussão dos objetivos a serem propostos
Entre os dias 12 e 16 de abril de 2021, pelos membros participantes das dife-
a SBH, em parceria com outras socie- rentes sociedades científicas do Brasil.
dades no âmbito do Fórum das Socie-
dades Científicas da Área Zoologia,
Foram discutidos e detalhados temas,
coordenou o Workshop para a cons-
e estabelecidas metas para os seguintes
trução do documento “Proposta de ob-
objetivos: (A) formar, capacitar e fixar
jetivos de médio e longo prazo, metas
recursos humanos qualificados em ta-
de ação para 2030 e Indicadores para
xonomia biológica; (B) modernizar e
o GLOBAL TAXONOMY INITIATI-
adequar a infraestrutura e organização,
VE no âmbito da Estratégia Global de
para a manutenção, gerenciamento e a
Biodiversidade Pós-2020”. O objetivo
cooperação entre as coleções biológicas
do Workshop foi facilitar o diálogo e
brasileiras; (C) incrementar, organizar,
a elaboração colaborativa da Carta de
qualificar e disseminar as informações
Endosso ao documento proposto pelo
taxonômicas, sistemáticas e biogeo-
“The Global Taxonomy Initiative Fo-
gráficas; (D) promover a aproximação
rum” em evento realizado de 02 a 04 de
entre a sociedade e os taxonomistas
dezembro de 2020 (https://www.cbd.
para disseminar informações sobre a
int/article/the-global-taxonomy-ini-
importância dos estudos taxonômicos;
tiative-forum-2020); foi também pro-
e (E) readequar e ampliar a divulgação
duzido um documento com a Proposta
da legislação brasileira em relação às
de objetivos de médio e longo prazo,
coleções biológicas e aos estudos com
metas de ação para 2030 e Indicadores
sistemática, taxonomia e biogeografia
para o GLOBAL TAXONOMY INITIA-
(ESTB; Lei 13.123, Acesso à Biodiversi-
TIVE (GTI) no âmbito da Estratégia
dade, e Protocolo de Nagoya). O resul-
Global de Biodiversidade Pós-2020. A
tado das discussões foi organizado em
estrutura do encontro visou apoiar o
um documento, que está em processo
trabalho em grupos para o desenvolvi-
de revisão pelas sociedades.
mento e validação de objetivos, metas
e ações em relação à taxonomia, para
que o Brasil seja capaz de atender aos
compromissos assumidos junto à Con-
vention Biological Diversity (CDB). As-
11
Herpetologia Brasileira vol. 10 n.o 2 - Notícias da S. B. H.

SIMPÓSIO DE DIVULGAÇÃO CIEN- dos cientistas. Este trabalho é especial-


TÍFICA: INTERFACES ENTRE CIÊN- mente importante em função da crise
CIA E SOCIEDADE de biodiversidade, ambiental e climáti-
ca que estamos atravessando, que tor-
No dia 31 de julho de 2021 foi realizado na ainda mais necessário mostrar para
o primeiro simpósio de divulgação cien- a sociedade como a ciência funciona e o
tífica organizado pela SBH. Em função que ela traz para o debate sobre a con-
da impossibilidade de organizar um servação da imensa biodiversidade do
congresso na atual crise sanitária, op- Brasil, sobre o potencial desta biodiver-
tamos por um evento mais curto e aces- sidade em gerar bem-estar e qualidade
sível a todos, abordando um tema que é de vida, enriquecimento da alimenta-
comum a todas as linhas de pesquisa e ção, desenvolvimento de medicamen-
grupos taxonômicos: a divulgação cien- tos, prevenção de desastres, dentre tan-
tífica. Este tema vem se popularizan- tos outros benefícios.
do, em função das novas ferramentas
de comunicação que estão disponíveis Convidamos para este evento nomes
hoje, e vem encarar o grande desafio de de destaque na divulgação de ciência,
preencher uma lacuna histórica exis- demonstrando a diversidade de formas
tente entre a ciência e a sociedade. A de atuação e experiências dos divulga-
divulgação científica vem crescendo, e dores de ciência no Brasil. A primeira
hoje está presente em meios tão distin- mesa, intitulada “Perspectivas e Desa-
tos quanto livros didáticos, canais de fios da Divulgação Científica” trouxe
YouTube, museus, Instagram, mídias Quezia Ramalho (revista Herpetologia
tradicionais, Twitter, livros infantis, Brasileira), Henrique C. Costa (Univer-
Spotify e TikTok. sidade Federal de Juiz de Fora e Revis-
ta Ciência Hoje das Crianças), Jacque-
A SBH reconhece o potencial transfor- line Lafloufa (Agência Bori); Beatriz
mador da divulgação científica e vem Vasconcelos (Herpetologia Segundo
investindo nisso por meio do trabalho as Herpetólogas) e Paulo Nico Montei-
das duas comissões de divulgação: a ro (Instituto Butantan), e foi mediada
Comissão de Redes Sociais da Socieda- pelo Otavio Marques (SBH / Instituto
de Brasileira de Herpetologia e a equi- Butantan e página Entenda Mais Ciên-
pe de divulgação da revista Herpeto- cia). A segunda mesa, intitulada “Novas
logia Brasileira, que estão ampliando Linguagens na Divulgação Científica”
cada vez mais seu público de seguido- trouxe os divulgadores Flávia Pereira
res, aproximando principalmente os jo- Lima (Universidade Federal de Goiás),
vens interessados em répteis e anfíbios Luiz Eduardo Anelli (Universidade de
12
Herpetologia Brasileira vol. 10 n.o 2 - Notícias da S. B. H.

São Paulo), Paulo Bernarde (Univer- primeira e segunda secretárias, Karina


sidade Federal do Acre), Paulo Pirulla Banci (Instituto Butantan) e Ariadne
e Reinaldo Guedes (WikiAves), sendo Fares Sabbag (Universidade Estadual
mediada pelo Alexander Mônico (Co- Paulista) como primeira e segunda te-
missão de Redes Socieis da SBH) soureiras. Foram eleitos para o Con-
selho Christine Strussmann (Universi-
Esperamos que as apresentações e dis- dade Federal do Mato Grosso), Hélio
cussões promovidas por este simpósio Ricardo da Silva (Universidade Federal
tenham inspirado os participantes a Rural do Rio de Janeiro) e Thais Hele-
investir mais na divulgação científica, na Condez (Universidade do Estado de
como ferramenta para promover a con- Minas Gerais). Esperamos que a próxi-
servação da biodiversidade, para atrair ma gestão possa continuar apoiando a
jovens talentos para carreiras cientí- herpetologia brasileira e agradecemos
ficas, para promover a diversidade e a às importantes contribuições dos dire-
inclusão de grupos historicamente me- tores e conselheiros que deixarão suas
nos representados na ciência. funções em 2021 e 2022.

ASSEMBLEIA ORDINÁRIA E ELEI- APOIO À SBPC


ÇÃO DA NOVA DIRETORIA
No mês de julho a SBH foi cossignatária
No dia 31 de julho de 2021, após o Sim- de três cartas em apoio à SBPC e à ciên-
pósio de Divulgação Científica, foi rea- cia brasileira, sendo elas: i) uma carta
lizada a Assembleia Geral da SBH, para de repúdio ao corte de bolsas do CNPq,
prestar contas da gestão 2019/2020, em função do bloqueio de 116 milhões
eleger a nova diretoria e preencher as de reais do orçamento pelo governo fe-
vagas do Conselho, em virtude da sa- deral; ii) uma solicitação de prorroga-
ída dos conselheiros Diego Santana ção de prazo para implementação das
(Universidade Federal de Mato Gros- alterações requeridas pela Resolução
so do Sul), Felipe Toledo (Universi- CNE/CP Nº 2, de 20 de dezembro de
dade de Campinas) e Débora Silvano 2019, que define as Diretrizes Curricu-
(Instituto Federal de Brasília). Para a lares Nacionais e a Base Nacional Co-
diretoria, foi eleita a chapa única com- mum para Formação Inicial de Profes-
posta por Denise Cerqueira Rossa-Fe- sores da Educação Básica e Resolução
res (Universidade Estadual Paulista) CNE/CP nº 1, de 27 de outubro de 2020,
como Presidente, Paula Hanna Val- que institui as Diretrizes Curriculares
dujo (WWF-Brasil) e Bianca Berneck Nacionais para a Formação Continua-
(Universidade Estadual Paulista) como da de Professores da Educação Básica
13
Herpetologia Brasileira vol. 10 n.o 2 - Notícias da S. B. H.

e Base Nacional Comum para a Forma-


ção Continuada de Professores da Edu-
cação Básica (BNC-Formação Continu-
ada); iii) uma manifestação em defesa
da democracia e contra as ameaças re-
centes ao Estado de Direito no Brasil.

Teratohyla midas
Parque Nacional da Serra do Divisor, AC
@Raíssa do N. Rainha

14
Herpetologia Brasileira vol. 10 n.o 2 - Notícias da S. B. H.

Hydromedusa maximiliani
Zona Rural de Itabira, MG
@Paula C. Neves Barreto

15
Herpetologia Brasileira vol. 10 n.o 2 - Notícias Herpetológicas Gerais

Notícias
Herpetológicas Gerais
ZooVert Lab: conciliando pesquisa, educação e
preservação ambiental
Ana Carolina Calijorne Lourenço1,*, Lorena R. Pereira1, Beatriz Silva Moreira Nascimento1, Maria
Alicia Lemes de Oliveira1, Bianca Montanha Costa1, Alice de Cássia Jardim Morais 1, Rafael Carva-
lho de Souza1, Jade Mota Cruz1, Pedro Peron1, Kíscyla Caetano Herculano1, Lara Gomes Procópio1,
Brendon de Araújo Gerônimo Feijó1, Sara dos Reis Santos1, João Paulo Silva Martins1, Ian Moreira
Souza2, Rosalvo Arantes Júnior3, Jonas Ferrari Morais4
1 Departamento de Ciências Biológicas, Universidade do Estado de Minas Gerais, Campus Ubá,
36502-000 Ubá, MG, Brasil.
2 Instituto de Biodiversidade e Sustentabilidade, Universidade Federal do Rio de Janeiro, NU-
PEM/UFRJ, Campus Macaé, 27965-045 Macaé, RJ, Brasil.
3 Centro Universitário Governador Ozanam Coelho, Campus Ubá, 36506-022 Ubá, MG, Brasil
4 Associação Regional de Proteção Ambiental, ARPA-Ubá, 36500-001 Ubá, MG, Brasil
*Autor correspondente: E-mail: ana.calijorne@uemg.br
DOI: 10.5281/zenodo.5211352

E
stamos imensamente honrados e to, já é possível perceber traços do perfil
agradecidos pela oportunidade de de nossas pesquisas, com motivações na
apresentar, neste espaço, o traba- taxonomia de vertebrados recentes e na
lho do nosso grupo. Em primeiro lugar educação ambiental. Ainda não contamos
porque esta revista vem desempenhando com espaço físico exclusivo, pois nossa
valoroso papel na divulgação de pesquisas unidade acadêmica, sendo muito recente,
e cientistas envolvidos com a herpetologia enfrenta empecilhos para subsidiar ex-
brasileira. Segundo porque uma das cau- pansões estruturais. Por isso, o laborató-
sas que motiva nosso laboratório é a difu- rio utilizado para realizar experimentos e
são dos saberes científicos com qualidade. processar material é dividido com outros
professores e colegas envolvidos em pro-
O nosso grupo de pesquisa foi fundado jetos diversos da instituição. Nossos en-
recentemente, no ano de 2018, quando a contros mais frequentes ocorrem através
coordenadora do grupo, Dra. Ana Caroli- de videoconferências (Fig. 1) e durante os
na Calijorne Lourenço, foi nomeada como trabalhos de campo propriamente ditos
professora da nossa instituição. Entretan- (seguindo as recomendações de proteção
contra COVID-19).
16
Herpetologia Brasileira vol. 10 n.o 2 - Notícias Herpetológicas Gerais

Figura 1. Alguns integrantes do ZooVert Lab durante reunião virtual. As reuniões acontecem
ao menos uma vez por mês para debatermos o andamento dos projetos e estreitarmos laços,
principalmente neste momento de isolamento social. Da esquerda para a direita: Ana Carolina
C. Lourenço, Jade M. Cruz, Kíscyla C. Herculano, Sara R. Santos, Alice C. J. Morais, Rafael C. de
Souza, Bianca M. Costa, Lorena R. Pereira, Pedro Peron, Beatriz S. M. Pereira, Lara G. Procópio,
Jonas F. Morais, Brendon A. Gerônimo Feijó e Maria Alicia L. de Oliveira.

O ZooVert Lab, atualmente, é composto região. Destacamos ainda a Dra. Caryne


por 13 alunos de iniciação científica do de Oliveira Braga (mastozoóloga, profes-
curso de Ciências Biológicas da Universi- sora da UENF), o Dr. Leandro de Oliveira
dade do Estado de Minas Gerais, campus Drummond (herpetólogo, pesquisador da
Ubá (UEMG/Ubá) e dois alunos egressos, UENF), o Dr. Marcos Raposo (ornitólogo,
além de contar com a colaboração de cin- professor do Museu Nacional/UFRJ) e o
co pesquisadores externos (Fig. 2). Dentre Dr. Pablo Rodrigues Gonçalves (mastozo-
eles se destaca o herpetólogo especialista ólogo, professor do Nupem/UFRJ), que
em serpentes, MSc. Jonas Ferrari Morais, atuam co-orientando alunos e em cola-
egresso da UEMG e diretor da Associação borações solidárias, autorizando o uso do
Regional de Proteção Ambiental (ARPA- material e dos espaços dos laboratórios
-Ubá). Seu papel no grupo é muito impor- que chefiam.
tante pois, além de co-orientar diversos
alunos, ele atua estabelecendo diálogo en- O projeto central da nossa equipe tem
tre o ZooVert Lab e a sociedade, auxiliando como alvo a presença e distribuição da
no angariamento de parceiros e recursos, fauna de vertebrados terrestres na Zona da
o que permite a integração entre os nos- Mata Mineira, aplicando os resultados em
sos resultados e as ações de recuperação ações de extensão, educação e preservação
ambiental implementadas pela ARPA na
17
Herpetologia Brasileira vol. 10 n.o 2 - Notícias Herpetológicas Gerais

Figura 2. Egressos e principais


colaboradores externos do Zoo-
Vert Lab. Da esquerda para a
direita: Ian Moreira Souza (NU-
PEM/UFRJ), Rosalvo Arantes
(UNIFAGOC), Caryne Aparecida
Braga (UENF), Leandro de Oli-
veira Drummond (UENF), Mar-
cos Raposo (MN/UFRJ), Pablo
Rodrigues Gonçalvez (NUPEM/
UFRJ).

ambiental. A região por sua vez recebe esse ga de formação. Suas principais pesquisas
nome devido a sua cobertura vegetal origi- estão relacionadas à sistemática de anu-
nal, a Floresta Tropical de Mata Atlântica, ros, que resultaram em oito publicações
que hoje, infelizmente, está representada nos últimos 3 anos, já como coordenado-
exclusivamente por fragmentos espaça- ra do ZooVert Lab (Lourenço et al., 2019,
dos ao longo do mosaico montanhoso da 2020; Pezzuti et al., 2019; Dielle-Viegas et
região (Dean, 2002; Fundação SOS Mata al., 2020; Lyra et al., 2020; Raposo et al.,
Atlântica, 2019). 2020; Lacerda et al., 2021; Segalla et al.,
2021).
A partir do tema principal estão associa-
dos alguns subprojetos ligados principal- Após um ano da criação do nosso grupo,
mente à taxonomia e história natural da dois trabalhos de conclusão de curso fo-
herpetofauna (Fig. 3). Esta característica ram finalizados. Em um deles analisamos
reflete a trajetória acadêmica da coordena- os casos de acidentes ofídicos na micror-
dora do grupo, que é zoóloga e herpetólo- região de Ubá, Minas Gerais, e no outro
18
Herpetologia Brasileira vol. 10 n.o 2 - Notícias Herpetológicas Gerais

desenvolvemos um levantamento de pe- tações da literatura. Registramos também


quenos mamíferos não voadores em uma prováveis espécies novas de roedores da
unidade de conservação da região, obten- família Cricetidae (ratos e camundongos)
do resultados taxonômicos intrigantes. dos gêneros Oligoryzomys e Oecomys que
Por exemplo, registramos um roedor equi- são sintópicas às espécies Oligoryzomys
mídeo arborícola do gênero Phyllomys, nigripes (Olfers, 1818) e Oecomys cathe-
um dos gêneros mais diversos da família rinae Thomas, 1909 na região estudada.
dos ratos-de-espinhos do Brasil, mas tam- Além disso, também observamos questões
bém de taxonomia muito complexa. Aná- interessantes relativas à história natural,
lises moleculares o posicionaram como como o registro de um casal de marsupiais
sendo da espécie Phyllomys pattoni Em- da espécie Caluromys philander (Lin-
mons, Leite, Kock, e Costa, 2002, porém naeus, 1758) utilizando fios de eletricidade
o cariótipo encontrado foi diferente do em uma área aberta, possivelmente para
conhecido para a espécie. Além disso, al- buscar água no lago próximo ou por esta-
gumas características morfológicas típicas rem em atividade reprodutiva.
para a espécie também diferem das ano-

Figura 3. Organograma ilustrando os principais temas estudados pelo ZooVet


Lab na atualidade.

19
Herpetologia Brasileira vol. 10 n.o 2 - Notícias Herpetológicas Gerais

Por este motivo, em 2020, percebemos a


necessidade da criação da nossa identida-
de visual (Fig. 4) e de fundarmos a nos-
sa primeira mídia social (@zoovertuem-
guba). Com linguagem simples e voltada
para a população em geral, divulgamos no
espaço virtual os resultados de nossos pro-
jetos, relatos das ações periódicas da equi-
pe e conteúdos autorais relacionados aos
saberes científicos e populares. Os textos
produzidos visam reforçar e popularizar o
conhecimento sobre a fauna de vertebra-
dos e favorecer a proteção dos recursos
naturais, além de procurar desmistificar
o imaginário popular em relação à fauna
silvestre (Fig. 5).

Figura 4. Com o intuito de dar


maior visibilidade para a herpe-
tofauna, escolhemos um anuro e
uma serpente para compor a nos-
sa logomarca, pois trata-se de um
grupo de vertebrados muito negli-
genciado e perseguido, presente Figura 5. Linha do tempo do ZooVert Lab, su-
em lendas e mitos que povoam o marizando marcos históricos principais des-
imaginário popular. de sua fundação.

20
Herpetologia Brasileira vol. 10 n.o 2 - Notícias Herpetológicas Gerais

Atualmente, podemos destacar cinco AGRADECIMENTOS


subprojetos principais em fase final de
execução. Três deles referem-se ao estu- Agradecemos ao Dr. Mirco Solé pelo con-
do do comportamento, história natural e vite e pela oportunidade de divulgar o
anatomia de espécies de anfíbios anuros nosso laboratório. Pelo apoio financeiro e
e os outros dois tratam de inventários da parceria em diversos projetos ambientais
herpetofauna em fragmentos florestados no município de Ubá e região, agradece-
da microrregião de Ubá. Por outro lado, mos à ARPA-Ubá. Pelas bolsas concedidas
também estamos iniciando projetos sobre agradecemos ao Programa Institucional
o levantamento de fauna de vertebrados de Apoio à Pesquisa (PAPq/UEMG). E fi-
terrestres em outras áreas mais preserva- nalmente, somos muito gratos aos colabo-
das da Zona da Mata Mineira, onde exis- radores e alunos da UEMG que de alguma
tem relatos, inclusive, do encontro com forma contribuíram para o desenvolvi-
grandes mamíferos. Todos estes projetos mento do ZooVert Lab.
subsidiarão dados que serão incorporados
em cartilhas e palestras difundidas nas
escolas e comunidades rurais da região,
REFERÊNCIAS
apresentando a riqueza da fauna e sua im-
portância ecológica. Dean W. 2002. A ferro e fogo: a história e
a devastação da Mata Atlântica brasileira.
Companhia das Letras, Rio de Janeiro.
Deste modo, entendemos que a missão
do ZooVert Lab pode ser sumarizada nas
seguintes perspectivas chaves: geração Dielle-Viegas L.M., Araujo O.G.S., Berne-
de conhecimento sobre a fauna de ver- ck B.V.M., Brasileiro C.A., Brito E.S., Bu-
tebrados, formação de profissionais que nes T.O., ... Lourenço A.C.C. 2020. When
atuarão na conservação ambiental, além misinterpretation leads to sexism: pers-
da desconstrução de mitos e difusão de pectives on gender disparity in Brazilian
conhecimento científico com reflexos di- Herpetology. Herpetologia Brasileira
retos e indiretos na preservação da Mata 9:86–99.
Atlântica. Com isso, convidamos a todos
a acompanharem nossos projetos e publi- Fundação SOS Mata Atlântica; INPE.
cações, indicando que estamos de portas 2019. Atlas dos remanescentes florestais
abertas para receber colaboradores, par- de Mata Atlântica. Fundação SOS Mata
ceiros e futuros alunos interessados nes- Atlântica e Inpe, São Paulo.
tes temas, especialmente porque preten-
demos em 2022 nos integrar ao Programa
de Pós-graduação em Ciências Ambientais
da UEMG, ampliando ainda mais nossas
possibilidades.

21
Herpetologia Brasileira vol. 10 n.o 2 - Notícias Herpetológicas Gerais

Lacerda J.V.A., Ferreira R.B., Araujo-Vieira Raposo M.A., Kirwan G. M., Lourenço
K., Zocca C., Lourenço A.C.C. 2021. A new A.C.C., Sobral G., Bockmann F.A., Stopi-
species of Scinax Wagler (Amphibia, Anura, glia R. 2020. On the notions of ‘taxonomic
Hylidade) from the Atlantic Forest, Southe- impediment’, ‘gap’, ‘inflation’, and ‘anar-
astern Brazil. Ichthyology & Herpetology chy’, and their effects on the field of con-
109:522–536. servation. Systematics and Biodiversity
1:1–16.
Lourenço A.C.C., Lingnau R., Haddad
C.F.B., Faivovich J. 2019. A New Species Segalla M.V., Berneck B.V.M., Canedo C.,
of the Scinax catharinae Group (Anura: Caramaschi U., Cruz C.A.G, Garcia P.C.A.,
Hylidae) from the Highlands of Santa Ca- … Langone J.A. 2021. List of Brazilian
tarina, Brazil. South American Journal of Amphibians. Herpetologia Brasileira
Herpetology 14:163–176. 10:121–216.

Lourenço A.C.C., Lacerda J.V.A., Cruz


Editor: Mirco Solé
C.A.G., Nascimento L.B., Pombal J.P. Jr.
2020. A new species of the Scinax catha-
rinae species group (Anura: Hylidae) from
the Atlantic rainforest of northeastern Mi-
nas Gerais, southeastern Brazil. Zootaxa
4878:305–321.

Lyra M.L., Lourenço A.C.C., Pinheiro


P.D.P., Pezzuti T.L., Baeta D., Barlow A.,
… Faivovich J. 2020. High-throughput
DNA sequencing of museum specimens
sheds light on the long-missing species of
the Bokermannohyla claresignata group
(Anura: Hylidae: Cophomantini). Zoo-
logical Journal of the Linnean Society
190:1235–1255.

Pezzuti T.L., Leite F.S.F., Silva D.H., Lou-


renço A.C.C., Baeta D. 2019. The tadpole
of Physalaemus orophilus from the Atlan-
tic rainforest of southeastern Brazil (Am-
phibia, Anura, Leptodactylidae). Zootaxa
4629:141–145.

22
Herpetologia Brasileira vol. 10 n.o 2 - Notícias Herpetológicas Gerais

Corallus hostulanus
Machadinho D Oeste, RO
@Diego José Santana

23
Herpetologia Brasileira vol. 10 n.o 2 - Notícias de Conservação

Notícias de Conservação
Conservação da Restinga: o projeto Calango do
Abaeté
André K. Leite1,2,3, Cecil P. Fazolato3,4, Jamille F. Marques1,3,6, Mateus. S. Bonfim1,3,7, Magno L. T.
Oliveira3,5, Moacir S. Tinôco1,3,7,8*, Geraldo J. B. Moura1,2,3,6,7,8*
1 Laboratório de Estudos Herpetológicos e Paleoherpetológicos, Universidade Federal Rural de
Pernambuco, 52171-900 Recife, PE, Brasil.
2 Programa de Pós-Graduação em Biociência Animal, Universidade Federal Rural de Pernambu-
co, 52171-900 Recife, PE, Brasil.
3 Centro de Ecologia e Conservação Animal, Universidade Católica do Salvador, 41740-090 Pitu-
açu, Salvador, BA, Brasil.
4 Programa de Pós-Graduação em Biodiversidade e Evolução, Universidade Federal da Bahia,
40170-115 Salvador, BA, Brasil.
5 Programa de Pós-Graduação em Ecologia: Teoria, Aplicação de Valores, Universidade Federal
da Bahia, 40170-290 Salvador, BA, Brasil.
6 Programa de Pós-Graduação em Ecologia Humana e Gestão Socioambiental Universidade do
Estado da Bahia, 48904-711 Juazeiro, BA, Brasil.
7 Programa de Pós-Graduação em Biodiversidade, Universidade Federal Rural de Pernambuco,
52171-900 Recife, PE, Brasil.
8 Programa de Pós-Graduação em Território, Ambiente e Sociedade, Universidade Católica do
Salvador, 41740-090 Salvador, BA, Brasil.
*Autor correspondente: E-mail: geraldo.jbmoura@ufrpe.br e moacirtinoco@gmail.com
DOI: 10.5281/zenodo.5211367

A RESTINGA: UM ECOSSIS- mente na heterogeneidade das paisa-


gens, contribuindo para a diversificação
TEMA RECENTE EM CONS-
de espécies e suas histórias biogeográfi-
TANTE TRANSFORMAÇÃO E cas (Sanmartín 2012). Nos últimos três
RISCO DE EXTINÇÃO milhões de anos, variações climáticas

A
globais tiveram grande repercussão na
história geológica do plane- história evolutiva e na distribuição de es-
ta foi marcada por diferentes pécies em todo o globo (Hewitt 2000).
eventos que resultaram em Esse período geológico compreende o
profundas transformações nos continen- Quaternário, marcado por oscilações cli-
tes, mudanças no clima e consequente- máticas que influenciaram as variações
no nível do mar, contribuindo com dife-
24
Herpetologia Brasileira vol. 10 n.o 2 - Notícias de Conservação

rentes eventos de sedimentação e modi- ológicas locais e dinâmicas da formação


ficação das paisagens costeiras em todo costeira (Fazolato et al. 2019). Este con-
o planeta (Sant’Anna Neto et al. 2005; texto de variabilidade paisagística dos
Hansen et al. 2013; Micallef et al. 2013). depósitos arenosos na costa brasileira
No Brasil, as mudanças do nível do mar torna as restingas um importante atrati-
tiveram influência na formação de depó- vo para pesquisas de diferentes aborda-
sitos arenosos na costa, caracterizados gens e principalmente de ações conser-
por regiões de formação recente, com vacionistas (Fazolato et al. 2019).
formação de dunas e uma paisagem em
constante modificação, localmente cha- A restinga carrega no seu histórico, sé-
madas de Restingas (Fig. 1) (Dominguez culos de modificações naturais e prin-
2006; Tinôco 2019). cipalmente antropogênicas (Fonseca &
Tinôco 2019). Estima-se que os impac-
A restinga, ao longo da costa brasileira,
tos ambientais nessas regiões tiveram
apresenta diferentes formações paisa-
início com a chegada dos colonizadores
gísticas decorrente de efeitos climáticos
europeus no Brasil e consequentemente
no sentido latitudinal, características ge-
a ocupação desordenada do país, além

Figura 1. Formação típica de restinga no Quaternário do litoral norte da Bahia. A foto ilustra com
clareza a formação típica de dunas de areia branca.
Foto: Barro de Chão.
25
Herpetologia Brasileira vol. 10 n.o 2 - Notícias de Conservação

da constante exploração dos recursos zolato et al. 2017; Rosário et al. 2019;
naturais (Fazolato et al. 2019). Desde a Trevisan et al. 2020). Este efeito tem
descoberta do potencial comercial e tu- cada vez mais agregado relevância em
rístico das áreas costeiras as atividades entender os hiatos existentes na restin-
econômicas se intensificaram e a restinga ga brasileira. A cada ciclo de avaliação de
passou por modificações da paisagem de espécies ameaçadas, mais espécies mos-
forma acelerada o que ocasionou efeitos tram seu estado de conservação agravado
diversos por toda sua extensão (Marques nesse ambiente, o que chama a atenção
et al. 2019). Atualmente as principais para a necessidade de políticas públicas
ameaças para a restinga brasileira englo- que possam proteger mais eficientemen-
bam a fragmentação do habitat, polui- te os ecossistemas costeiros (Fonseca &
ção, atropelamento, comércio e criações Tinôco 2019).
ilegais e introdução de espécies exóticas
(Fonseca & Tinôco 2019). Neste contexto, diversas bandeiras para
a conservação de ecossistemas ameaça-
dos têm surgido em todo o litoral. Assim,
CONSERVAÇÃO DE LAGAR-
o Glaucomastix abaetensis (Dias et al.,
TOS AMEAÇADOS NA RES- 2002) “calango-do-Abaeté” (Fig. 2), atu-
TINGA DO NORDESTE almente considerada como ameaçada
de extinção (categoria “Em Perigo”) nas
Por ser um ambiente pouco conhecido, Listas Vermelhas de Espécies Ameaça-
estudos recentes têm trazido à luz algu- das Estadual (SEMA 2017) e Nacional
mas discussões a respeito dos processos (MMA 2018), surge como uma espécie
de diversificação de espécies relaciona- guarda-chuva para a conservação da res-
das à restinga (Menezes et al. 2016; Fa- tinga justamente por ser uma das espé-

Figura 2. Calango-
-do-Abaeté (Glauco-
mastix abaetensis)
exemplar típico das
dunas de areia bran-
ca do litoral norte da
Bahia.
Foto: Magno Travas-
sos.

26
Herpetologia Brasileira vol. 10 n.o 2 - Notícias de Conservação

cies mais ameaçadas do ecossistema na Diante deste cenário, foi criado em 2007
região. Distribuído em subpopulações o projeto Calango do Abaeté (Fig. 3), a
fragmentadas ao longo de aproxima- partir de uma parceria com o IBAMA.
damente 150 km, o calango-do-Abaeté O projeto tem o objetivo de compreen-
restringe-se às faixas de dunas e areias der os padrões ecológicos das espécies
brancas associadas às matas de restin- de lagartos ameaçadas e identificar áreas
gas do litoral norte da Bahia, abrangen- prioritárias para conservação no litoral
do apenas seis municípios baianos em norte da Bahia. Devido ao seu nível de
uma distribuição disjunta e sujeita a for- ameaça, o calango-do-Abaeté foi esco-
te pressão antrópica: Salvador, Lauro de lhido como espécie bandeira do projeto,
Freitas (provavelmente extinta), Cama- porém o mesmo abrange outros lagartos
çari, Mata de São João, Esplanada e En- ameaçados da região, como a lagartixa-
tre Rios. Por este motivo está sob risco -da-restinga Tropidurus hygomi (Rei-
de desaparecer nos próximos 30 anos, nhardt & Luetken, 1861), e o calango
tendo em vista o ritmo de perda do seu Glaucomastix itabaianesis (Rosário et
habitat preferencial, uma vez que, exis- al., 2019) e, indiretamente, as demais es-
te grande especulação imobiliária na re- pécies da herpetofauna local, incluindo
gião, considerada hoje como o principal outras com risco de extinção [Allobates
polo turístico do Estado da Bahia (FIPE olfersioides (Lutz, 1925); Dryadosau-
2015).

Figura 3. Projeto Calango do Abaeté, projeto de conservação da restinga que traz a espécie
como um guarda chuva para sua preservação.
Foto: Acervo Calango do Abaeté.
27
Herpetologia Brasileira vol. 10 n.o 2 - Notícias de Conservação

ra nordestina (Rodrigues et al., 2005); Mata Atlântica e faz parte do grupo de


Leposoma annectans Ruibal, 1952; Le- assessoramento técnico e da coordena-
posternon octostegum (Duméril, 1851); ção executiva do Plano de Ação Nacional
Lachesis muta (Linnaeus, 1766) e Vi- para Conservação da Herpetofauna da
treorana eurygnatha (Lutz, 1925)]. O Mata Atlântica Nordestina e do Plano de
projeto conta com inúmeras conquistas Ação Nacional para Conservação da Her-
e ações de conservação em andamento, petofauna do Nordeste (Fig. 4). Somado
incluindo monitoramento da biodiver- a todo este esforço ainda faculta a for-
sidade, ações socioambientais e divul- mação de recursos humanos (quarenta
gação científica. Considerado como um monografias de graduação, dez disserta-
dos mais relevantes monitoramentos de ções, sete teses e dois pós-doutorados),
longa duração dessas espécies na região, capacitando mais de 50 pesquisadores
ao longo desses últimos 14 anos, colabo- associados a ao menos quatro IES nacio-
rou com a elaboração da lista nacional e nais e duas internacionais.
estadual (Bahia e Pernambuco) de espé-
cies ameaçadas, além da elaboração dos
O projeto destaca-se também por uma
mapas de áreas prioritárias do estado da
produção científica expressiva com mais
Bahia e da Mata Atlântica, além disso
de 150 publicações como artigos publica-
colabora diretamente com cinco Postos
dos em periódicos indexados nacionais
Avançados da Reserva da Biosfera da

Figura 4. PAN da Herpetofauna do Nordeste, onde o calango-do-Abaeté é espécie alvo e a


conservação da restinga compõe as ações.
Foto: Acervo Calango do Abaeté.
28
Herpetologia Brasileira vol. 10 n.o 2- Notícias de Conservação

e internacionais, livros, capítulos de li- precisa ser compartilhada e servir como


vros e resumos apresentados em diver- ferramenta para a popularização da ciên-
sos eventos científicos nacionais e inter- cia (Fig. 5) e educação ambiental (Fig. 6).
nacionais, considerando as espécies em É por este motivo que o projeto já atingiu
questão e estudos com a herpetofauna algumas milhares de pessoas em toda a
da região. Uma das suas mais importan- região. Atualmente com inúmeras esco-
tes produções científicas é o livro “Res- las, eventos, exposições e ações de con-
tinga – Herpetofauna do Litoral Norte servação, estimamos um público médio
da Bahia” um volume ricamente ilus- anual de três mil pessoas diretamente
trado, contemplando mais de 150 espé- impactadas (Fig. 7). Estas ações se man-
cies e ampla informação ecogeográfica, tiveram ativas até mesmo durante a pan-
produzido a partir de recursos da Lei de demia, quando migramos para ações vir-
Incentivo à Cultura do Governo Federal tuais, mas que não deixaram de ocorrer.
(Tinoco et al. 2019). Toda esta produção

Figura 5. Educação Ambiental e popu-


larização da ciência em escolas públicas
e privadas do nordeste do Brasil.
Foto: Acervo Calango do Abaeté.

Figura 6. Educação
Ambiental em mais de
uma dezena de UC na
região.
Foto: Acervo Calango
do Abaeté.

29
Herpetologia Brasileira vol. 10 n.o 2 - Notícias de Conservação

Figura 7. Exposição itinerante para popularização da ciência da expedição restinga.


Foto: Acervo Calango do Abaeté.

Sabemos o quão difícil é a execução de Atlântica (RBMA/UNESCO), a Univer-


um projeto conservacionista e entende- sity of Kent (DICE/UKC), Universitat de
mos que todo esse avanço só foi possível Les Illes Balears (UIB/Espanha), as Uni-
a partir do estabelecimento de parcerias dades de Conservação do Parque das Du-
importantes. Até o presente momento, nas, o Parque Klaus Peters, a Fundação
podemos contabilizar aproximadamente Garcia D’Ávila, a APA do Litoral Norte,
sete mil horas de campo e mais de 200 APA Joanes-Ipitanga, a Fazenda Mila-
pesquisadores envolvidos no projeto. gres, o Instituto da Mata, o Condomínio
Além disso, foi de extrema importância o Busca Vida e a primeira UC proposta
apoio das instituições nacionais e inter- para a conservação do calango-do-Aba-
nacionais, entre as quais podemos citar eté, a RPPN Fonte dos Padres em Ca-
a Sociedade Brasileira de Herpetologia maçari, Bahia e, recentemente, o Plano
que apoiou nossa mais importante pu- de Ação Nacional para Conservação da
blicação, o Centro Nacional de Pesqui- Herpetofauna do Nordeste, todos estes
sa e Conservação de Répteis e Anfíbios parceiros nos acompanham em todos os
(RAN/ICMBio) importante por seu su- eventos de divulgação científica que par-
porte às nossas pesquisas, o Laboratório ticipamos como o Congresso Brasileiro
de Estudos Herpetológicos e Paleoher- de Herpetologia (Fig. 8) e o World Con-
petológicos (LEHP/UFRPE), o Grupo de gress of Herpetology (Fig. 9), hoje temos
Estudos Herpetológicos e Paleoherpeto- convicção de que o calango-do-Abaeté
lógicos do Nordeste – CNPq (GEHP) por está no imaginário ambiental de muitas
seu apoio científico de ponta, o Conselho pessoas por toda parte.
Nacional da Reserva da Biosfera da Mata

30
Herpetologia Brasileira vol. 10 n.o 2 - Notícias de Conservação

Figura 8. Divulgação científica em evento nacional, Congresso Brasileiro de Herpetologia da SBH


em Campinas, 2019 .
Foto: Acervo Calango do Abaeté.

Figura 9. Divulgação científica em evento internacional, World Congress of Herpetology


na Nova Zelândia, 2020.
Foto: Acervo Calango do Abaeté.
31
Herpetologia Brasileira vol. 10 n.o 2 - Notícias de Conservação

O PROJETO CALANGO DO tir da análise comparativa de caracteres


morfológicos em diferentes populações;
ABAETÉ HOJE
de cunho evolutivo e biogeográfico, bus-
Dando continuidade às ações de conser- cando investigar os processos de diversi-
vação, o projeto realiza hoje o monitora- ficação espaço-temporal de G. abaeten-
mento mensal contínuo dos lagartos em sis, G. itabaianensis e T. hygomi através
duas localidades, sendo elas no muni- de integração de abordagens genômica
cípio de Salvador (Parque das Dunas) e com descrição de espécies e DNA am-
Camaçari (RPPN Fonte dos Padres), am- biental, ecológica, morfológica e geoló-
bas em Unidades de Conservação, sendo gicas. Além das pesquisas supracitadas,
uma de proteção integral e a outra de uso que investigam diretamente as espécies
sustentável, respectivamente. Mais duas em seus habitats, o projeto também pos-
áreas igualmente monitoradas, contu- sui uma vertente etnoherpetológica que
do contemplando uma biodiversidade busca entender a percepção, convivência
mais ampla, em Mata de São João, no e relação das comunidades locais com
Parque Klaus Peters e em Conde na Fa- essas espécies ameaçadas, ferramentas
zenda Milagres, inserida em uma UC de essenciais para elaboração de estratégias
uso sustentável, monitoramos direta ou para a conservação, planos de manejo e
indiretamente todas as subpopulações ações de educação ambiental.
da espécie bandeira. Além disso, visando
atender aos objetivos propostos do Pla- Com esses estudos em andamento, sa-
no de Ação Nacional para a Conservação bemos que nossa contribuição é relevan-
da Herpetofauna do Nordeste, o projeto te na elaboração de políticas públicas,
realiza diversas pesquisas científicas ao como por exemplo nossa contribuição
longo de todo o litoral norte da Bahia e na Política Estadual de Educação Am-
toda costa do estado de Sergipe, contem- biental, dando mais ênfase aos progra-
plando a distribuição total do G. aba- mas que valorizem a biodiversidade
etensis e do T. hygomi, além de outros ameaçada, e políticas estaduais e nacio-
estudos contemplando também o esta- nais de monitoramento da biodiversida-
do de Pernambuco. Entre os estudos em de, o que é a nossa expertise. O projeto
andamento podemos citar os autoeco- e seus parceiros seguem contribuindo
lógicos, os quais investigam os padrões para a conservação dessas espécies, po-
reprodutivos, alimentares e parasitários rém ainda há muito a contribuir com a
das espécies; os de ecologia numérica, herpetologia local e regional, elucidando
com a observação da dinâmica popula- questões acerca dessas e outras espécies
cional desses lagartos entre outros gru- de Anfíbios e “Répteis” na região e acima
pos; os de conservação, com a análise de tudo contribuindo com a preservação
da viabilidade populacional para ambas deste ecossistema.
as espécies em um cenário de constante
perda de habitats; os morfológicos, a par-

32
Herpetologia Brasileira vol. 10 n.o 2 - Notícias de Conservação

PARA ONDE VAMOS DEPOIS do a restinga mais antiga do Brasil em


Pratigi, Bahia, e sua segunda etapa em
DAQUI? A EXPEDIÇÃO RES-
2022, percorrendo todos os estados do
TINGA DO BRASIL Nordeste e a terceira etapa em 2023 con-
templando os estados do Sudeste e Sul
A partir do projeto Calango do Abaeté e
do Brasil. Esperamos, a partir de 2024
do livro Restinga – Herpetofauna do Li-
poder mostrar ao mundo um diagnósti-
toral Norte da Bahia entendemos, infe-
co completo desta importante porção do
lizmente, que a restinga do Brasil pede
nosso país.
socorro. Este é um ecossistema ameaça-
do e necessita de ações macroestruturais
emergenciais para a sua preservação. AGRADECIMENTOS
Partindo desta premissa lançamos em
08 de junho de 2021, no dia do Oceano, Além dos parceiros citados no texto aci-
e no mês de lançamento da Década da ma, agradecemos às agências financia-
Restauração dos Ecossistemas da ONU/ doras do projeto, como a Fundação de
UNESCO, o projeto “Restinga Expedi- Amparo à Pesquisa da Bahia – FAPESB,
tion” ou Expedição Restinga. Fundação de Amparo à Ciência e Tecno-
logia de Pernambuco - FACEPE, Coor-
denação de Aperfeiçoamento de Pessoal
Este é um projeto que visa revelar de
de Nível Superior – CAPES, Conselho
maneira definitiva as prioridades para a
Nacional de Desenvolvimento Científi-
conservação da restinga no Brasil. Uma
co e Tecnológico – CNPq, Herpetofauna
jornada nacional, assinada por todas as
Foundation, RepTech – Reptile Tech-
instituições parceiras do nosso projeto e
nologies, Lacerta Consultoria, Projetos
pretende revelar a biodiversidade, histó-
e Assessoria Ambiental, Amphibian Ark
ria, cultura, e ameaças às quais este ecos-
e Editora Barro de Chão, bem como aos
sistema encontra-se submetido ao longo
gestores e proprietários das áreas de es-
da costa brasileira.
tudo que contribuíram com a logística
e viabilidade das pesquisas, sendo eles
A restinga está situada na região que de- o Condomínio Busca Vida, Instituto da
tém o maior PIB nacional (Brasil 2021) e Mata, Fazenda Milagres, Projeto Flores-
justamente por este motivo encontra-se ta Sustentável, Parque Ecológico Univer-
sob forte pressão antrópica. A jornada sitário (PEU), Parque das Dunas, Parque
visitará quinze estados costeiros percor- Klaus Peters, Associação dos Moradores
rendo milhares de quilômetros no litoral da Rua Aquarius e Via Parque (AVP) de
e revelando o que há de mais importante Jauá, Associação de Moradores e Amigos
para a conservação e preservação da res- de Massarandupió e APA do Litoral Nor-
tinga do Brasil, pelo menos o que ainda te da Bahia.
resta desse ecossistema exuberante. A
expedição terá início em julho de 2021
com um trecho inicial curto simbolizan-
33
Herpetologia Brasileira vol. 10 n.o 2 - Notícias de Conservação

REFERÊNCIAS Fonseca E., Tinôco M.S. 2019. Conserva-


ção da Herpetofauna do litoral norte da
Brasil. 2021. Produto Interno Bruto do Bahia. Pp. 504–523 in Tinôco M.S. (Ed.),
Brasil por Estado. Instituto Brasileiro Restinga: Herpetofauna do Litoral Norte
de Geografia e Estatística. Acessado em da Bahia. Editora Barro de Chão, Salvador.
04/07/2021 em https://www.ibge.gov.
br/explica/pib.php. Fundação Instituto de Pesquisas Econô-
micas (FIPE). 2015. Pesquisa de caracte-
Dias J.E.R., Rocha C.F.D., Vrci- rização do turismo receptivo no Estado
bradic, D. 2002. New Cnemido- da Bahia: Relatório final. São Paulo.
phorus (Squamata: Teiidae) from
Bahia State, northeastern Brazil. Co- Hansen J., Sato M., Russell G., Kharecha
peia 2002:928–937. doi:10.1643/ P. 2013. Climate sensitivity, sea level and
0045-8511(2002)002[1070:NCS- atmospheric carbon dioxide. Philosophi-
TFB]2.0.CO;2. cal Transactions of the Royal Society
A: Mathematical, Physical and Engine-
Dominguez J.M.L. 2006. The coas- ering Sciences 371:1–31. doi: 10.1098/
tal zone of Brazil: an overview. Jour- rsta.2012.0294.
nal Coastal Research 39:16–20. doi:
10.1007/978-3-540-44771-9_2. Hewitt G. 2000. The genetic legacy of
the Quaternary ice ages. Nature 405:
Duméril A.M.C., Duméril A.H.A. 1851. 907–913. doi: 10.1038/35016000.
Catalogue méthodique de la collection des
reptiles du Muséum d’Histoire Naturelle Linnaeus C. 1766. Systema naturæ per
de Paris. Gide et Baudry/Roret, Paris. regna tria naturæ, secundum classes,
ordines, genera, species, cum characte-
Fazolato C., Fernandes F., Batalha-Filho ribus, differentiis, synonymis, locis. To-
H. 2017. The effects of Quaternary sea-le- mus I. Laurentii Salvii, Estolcomo.
vel fluctuations on the evolutionary his-
tory of an endemic ground lizard (Tropi- Lutz A. 1925. Batraciens du Brésil. Comp-
durus hygomi). ZoologischerAnzeiger-A tes Rendus et Mémoires Hebdomadaires
Journal of Comparative Zoology 270:1– des Séances de la Société de Biologie et
8. doi: 10.1016/j.jcz.2017.08.007. des ses Filiales 93:137–139.

Fazolato C., Tinôco M.S., Moura G.J.B. Marques J., Porto C.R., Araújo C., Moura
2019. Restinga – História, ocupação e so- G.J.B., Tinôco M.S. 2019. Sociobiodiver-
ciobiodiversidade ameaçadas. Pp. 24–37 sidade, Etnoecologia e Etnoherpetologia.
in Tinôco M.S. (Ed.), Restinga: Herpeto- Pp. 524–531 in Tinôco M.S. (Ed.), Res-
fauna do Litoral Norte da Bahia. Editora tinga: Herpetofauna do Litoral Norte da
Barro de Chão, Salvador. Bahia. Editora Barro de Chão, Salvador.
34
Herpetologia Brasileira vol. 10 n.o 2 - Notícias de Conservação

Menezes L., Canedo C., Batalha-Fi- Ruibal R. 1952. Revisionary notes of


lho H., Garda A.A., Gehara M., Napoli some South American Teiidae. Bulletin
M.F. 2016. Multilocus Phylogeography of the Museum of Comparative Zoology
of the Treefrog Scinax eurydice (Anu- at Harvard College 106:475–529.
ra, Hylidae) Reveals a Plio-Pleistocene
Diversification in the Atlantic Forest. Sanmartín I. 2012. Historical biogeogra-
Plos One 11:1–20. doi: 10.1371/journal. phy: evolution in time and space. Evo-
pone.0154626. lution: Education and Outreach 5:555–
568. doi: 10.1007/s12052-012-0421-2.
Micallef A., Foglini F., Le Bas T., Ange-
letti L., Maselli V., Pasuto A., Taviani Sant’Anna Neto J.L., Nery J.T. Souza
M. 2013. The submerged paleolandsca- C.R.G., Suguio K., Oliveira A.M.S.P., Oli-
pe of the Maltese Islands: Morphology, veira P.E. 2005. Variabilidade e mudan-
evolution and relation to Quaternary ças climáticas no Brasil e seus impactos
environmental change. Marine Geo- regionais. Pp. 28–51 in Oliveira P.E., Su-
logy 335:129–147. doi: 10.1016/j.mar- guio K., Gouveia C. (Eds.), Quaternário
geo.2012.10.017. do Brasil. Editora Holos, Ribeirão Preto.

Ministério do Meio Ambiente (MMA). Secretaria do Meio Ambiente (SEMA).


2018. Livro Vermelho da Fauna Brasi- 2017. Lista Oficial das Espécies da Fau-
leira Ameaçada de Extinção: Volume I. na Ameaçadas de Extinção do Estado da
ICMBio/MMA, Brasília. Bahia. Portaria Nº 37. Governo da Bahia,
Bahia.
Rodrigues M.T., Freire E.M.X., Pellegrino
K.C.M., Sites Jr. J.W. 2005. Phylogenetic Tinôco M.S. 2019. Restinga: Herpeto-
relationships of a new genus and species fauna do Litoral Norte da Bahia. Editora
of microteiid lizard from the Atlantic fo- Barro de Chão, Salvador.
rest of north-eastern Brazil (Squamata,
Gymnophthalmidae). Zoological Jour-
Trevisan C.C., Batalha-Filho H., Garda
nal of the Linnean Society 144:543–557.
A.A., Menezes L., Dias I.R., Solé M., …
doi: 10.1111/j.1096-3642.2005.00177.x.
Napoli, M.F. 2020 Cryptic diversity and
ancient diversification in the northern
Rosario I.R., Santos R.M.L., Arias F., Ro- Atlantic Forest Pristimantis (Amphibia,
cha C.F.D., Dias E J.D.R., Carvalho C.M., Anura, Craugastoridae). Molecular Phy-
Rodrigues M.T. 2019. Phylogeography of logenetics and Evolution 148:106811.
the endangered sand dune whiptail lizard doi: 10.1016/j.ympev.2020.106811.
Glaucomastix abaetensis (Dias, Rocha &
Vrcibradic, 2002) with the description of
a new species. Zootaxa 4624:451–477. Editor: Iberê F. Machado
doi: 10.11646/zootaxa.4624.4.1.
35
Herpetologia Brasileira vol. 10 n.o 2 - Trabalhos Recentes

Trabalhos recentes
Da Fonte L.F.M., Latombe G., Gordo M., Menin M., De Almeida A.P., Hui C.,
Lötters S. 2021. Amphibian diversity in the Amazonian floating meadows:
a Hanski core-satellite species system. Ecography 44:1–16. doi: https://doi.
org/10.1111/ecog.05610

F
lorestas tropicais e suas bacias odo das cheias, com a conexão entre os
hidrográficas associadas estão rios e os lagos, as macrófitas flutuantes
entre os maiores repositórios são transportadas para os rios, onde se
de biodiversidade do planeta. A bacia tornam um meio de dispersão de longa
amazônica é a maior bacia hidrográfi- distância a sua fauna associada. Apenas
ca, tendo até 30% de suas águas fluindo algumas espécies são adaptadas para a
através de planícies inundáveis. Diver- vida nesse habitat, estando elas local-
sos estudos têm tentado explicar a ori- mente abundantes e comuns em toda a
gem da biodiversidade amazônica, que distribuição dos bancos de macrófitas.
geralmente é relacionada à limitação Por outro lado, a maioria das espécies
da dispersão e vicariância gerados por habita esses bancos ocasionalmente,
eventos históricos (climáticos e geoló- no período das cheias, e são geralmen-
gicos). Apesar de avanços neste tema, te típicos de ecossistemas adjacentes, a
muito ainda falta para compreender a exemplo das várzeas. Para estas espé-
estrutura da biodiversidade em dife- cies, espera-se que sejam localmente
rentes partes na Amazônia. Neste tra- raras e pouco frequentes ao longo da
balho, os autores estudaram os padrões distribuição das macrófitas flutuantes.
e os fatores responsáveis pela estru-
turação da diversidade em bancos de A dicotomia entre as espécies local-
macrófitas flutuantes na região amazô- mente abundantes e comuns no gra-
nica, utilizando anfíbios anuros como diente geográfico (espécies “core”) e as
modelo de estudo. espécies raras localmente e incomuns
no gradiente geográfico (espécies sa-
Os bancos de macrófitas, abundantes télites), é conhecida como o modelo
em lagos de várzea, têm importantes de “core-satellite” de Hanski, que pre-
funções, como a ciclagem de nutrien- sume que esses dois grupos funcionais
tes, além de fornecer abrigo, alimento de espécies operam sob regras ecoló-
e hábitat para a reprodução de diversos gicas diferentes. Os autores testaram
grupos de organismos. Durante o perí- os aspectos funcionais da hipótese de
36
Herpetologia Brasileira vol. 10 n.o 2 - Trabalhos Recentes

Hanski, utilizando uma metodologia reas ou semiaquáticas). Treze espécies


que correlaciona a diversidade zeta foram consideradas tipicamente asso-
(uma métrica recém proposta) com o ciadas aos bancos de macrófitas, 31 às
turnover composicional para gradien- várzeas e cinco associadas a florestas
tes ambientais e geográficos. A diversi- de terra firme. Os resultados das aná-
dade zeta considera a contribuição de lises demonstraram que em larga esca-
espécies raras, intermediárias e comuns la, a diversidade de anfíbios em bancos
para a mudança composicional da di- de macrófitas é determinada por fato-
versidade, permitindo testar hipóteses res estocásticos, enquanto em escalas
sobre a importância relativa de proces- regionais a diversidade do grupo é de-
sos determinísticos versus estocásticos terminada por fatores climáticos e de-
na geração de padrões de estruturação terminísticos. Além disso, o turnover
da diversidade. Além disso, os autores das espécies do tipo “satélite” aumenta
integraram a diversidade zeta a uma muito mais rápido em função da distân-
modelagem de dissimilaridade genera- cia e é controlado por uma gama mais
lizada “multi-site” (GDM-MS), visando ampla de variáveis ambientais. Com
investigar o quanto os gradientes am- esses resultados, o trabalho demonstra
bientais e a distância espacial explicam a importância dos rios amazônicos na
o “turnover” de espécies. dispersão, principalmente das espécies
de anfíbios tipicamente associadas aos
Os autores compilaram listas de espé- bancos de macrófitas flutuantes.
cies de anfíbios em bancos de macrófi-
tas provenientes de 57 sítios na Amazô-
nia, cobrindo aproximadamente 7000
km ao longo dos cursos de vários rios Editor: Adriano O. Maciel
da região. Considerando apenas anu-
ros, 49 espécies foram identificadas,
tendo sido classificadas quanto a ca-
racterísticas de história de vida e estra-
tégia reprodutiva. Os sítios com maior
riqueza de espécies foram identifica-
dos na confluência dos maiores rios
da bacia, no alto Amazonas e na região
central. A maior parte das espécies foi
classificada como incomum ao longo
dos sítios de amostragem, seguida por
espécies de frequência intermediária e
em minoria, as espécies frequentes (to-
das pererecas da família Hylidae, arbó-
37
Herpetologia Brasileira vol. 10 n.o 2 - Trabalhos Recentes

Gendler J.L.P.L., Souza L.N., Marques O.A.V., Miyaji K.T., Medeiros C.R.
2021. Bites by Xenodon merremii (Wagler, 1824) and Xenodon neuwiedii
(Günther, 1863) in São Paulo, Brazil: a retrospective observational study of
163 cases. Toxicon 198:24–31. doi: 10.1016/j.toxicon.2021.04.021

A
cidentes ofídicos são um pro- paciente) entre os anos de 1945 e 2019.
blema de saúde pública negli-
genciado, afetando no mundo Considerando o total de casos registra-
todos os anos cerca de cinco milhões e dos, 123 foram causados por X. merremii
meio de pessoas e ocasionando a morte e 40 por X. neuwiedii. Dados epidemioló-
de 81-138 mil, além de um número três gicos revelam características importantes
vezes maior de amputações e outras se- da história natural dessas espécies. Para
quelas. No Brasil há por ano cerca de 30 ambas a maioria dos acidentes ocorreu
mil acidentes, 8% por serpentes “não pe- na primavera ou verão e durante o perí-
çonhentas” (animais que não possuem odo mais quente do dia (entre 10 e 16 ho-
dentes inoculadores na porção anterior ras), embora o pico para X. merremii foi
da boca). Embora os acidentes causados ao meio dia, enquanto para X. neuwiedii
por algumas destas serpentes sejam gra- variou entre 8 da manhã e 1 hora da tar-
ves, estudos demonstrando o significado de. A maioria dos acidentes foi causada
clínico do envenenamento pela maioria por espécimes adultos em X. neuwiedii, e
delas ainda são raros. por jovens em X. merremii. A razão entre
adultos e jovens variou durante os me-
O presente estudo investigou duas serpen- ses, sendo os acidentes causados princi-
tes do gênero Xenodon que estão entre as palmente por adultos de X. neuwiedii no
espécies “não peçonhentas” que causam verão e por jovens de X. merremii no ou-
mais acidentes no país e são relativa- tono. Os sintomas clínicos mais comuns
mente comuns em áreas urbanas. Dados foram dor, sangramento transitório, erite-
detalhados sobre o envenenamento por ma e edema local, o último mais frequen-
estas serpentes são escassos, entretanto te em X. neuwiedii. Não foram registra-
é sabido que pelo menos uma delas (X. das alterações na coagulação sanguínea
merremii) possui glândulas que produ- ou envenenamento sistêmico, porém 16
zem várias proteínas presentes também pacientes (cerca de 10% dos casos) foram
no veneno de viperídeos (serpentes peço- tratados com soro antibotrópico. Como
nhentas). Apesar de apresentarem denti- essas serpentes podem ser confundidas
ção áglifa, estas espécies possuem dentes com jararacas devido a semelhanças no
posteriores grandes capazes de inocular padrão de coloração e/ou por alguns sin-
esta saliva tóxica mesmo sem dentes sul- tomas locais do envenenamento, os médi-
cados. Foram levantados os registros e cos devem estar atentos a um diagnóstico
dados clínicos de pacientes internados no correto para evitar o uso indevido de soro
Hospital Vital Brazil, Instituto Butantan, antibotrópico, o que eventualmente pode
São Paulo, que sofreram acidentes confir- causar efeitos colaterais graves.
mados por X. merremii ou X. neuwiedii
(os animais foram levados junto com o
Editor: Daniel Silva Fernandes
38
Herpetologia Brasileira vol. 10 n.o 2 - Trabalhos Recentes

La Laina D.Z., Nekaris K.A.I., Nijman V., Morcatty T.Q. 2021. Illegal on-line
pet trade in venomous snakes and the occurrence of snakebites in Brazil.
Toxicon 193:48–54. doi: 10.1016/j.toxicon.2021.01.010

O
comércio de animais selvagens throps e Crotalus foram responsáveis por
e particularmente aquele en- 86 e 10% dos acidentes, respectivamente e
volvendo animais de estimação, houve registro de comércio ou manutenção
movimenta bilhões de dólares pelo mundo em cativeiro de 241 espécimes pertencen-
e vem crescendo substancialmente nos últi- tes a 16 espécies de serpentes peçonhentas
mos 15 anos. A ampliação do acesso à inter- - nove delas exóticas - com preço médio em
net potencializou esse mercado, sendo as torno de US$ 70. Os gêneros mais comuns
redes sociais um veículo que proporciona mantidos em cativeiro - sendo C. durissus
um contato direto e rápido entre vendedo- a espécie mais registrada - são os mesmos
res e compradores, diminui os custos com responsáveis pela imensa maioria dos aci-
propaganda e garante certo anonimato, im- dentes ofídicos. Além disso, foram regis-
portante principalmente para o comércio tradas 60 apreensões oficiais de serpentes
de espécimes ilegais, incluindo serpentes peçonhentas no país, incluindo quatro es-
peçonhentas. No Brasil, apesar do comér- pécies exóticas, dentre elas representantes
cio e a posse de serpentes peçonhentas em dos gêneros Naja e Ophiophagus que pos-
cativeiro ser ilegal, há inúmeras evidências suem veneno altamente tóxico.
de que estas leis não são cumpridas.
Os dados levantados alertam para os pe-
No presente estudo os autores avaliaram rigos deste tipo de comércio ilegal, dentre
o comércio online de serpentes peçonhen- eles o risco de acidentes (inclusive por es-
tas no Brasil e seus potenciais riscos para pécies exóticas), o fato de várias destas es-
a saúde humana. Foram levantados dados pécies exóticas mantidas em cativeiro se-
de serpentes peçonhentas exóticas e nati- rem reconhecidas como espécies invasoras
vas apreendidas ou comercializadas online em outros países, além da falta de informa-
e a composição de espécies encontradas ções adequadas (tanto por parte dos vende-
neste mercado foi comparada àquelas res- dores quanto compradores), a respeito da
ponsáveis por acidentes ofídicos no país. biologia dos animais, o que pode ocasionar
Os dados destes acidentes foram obtidos a fuga, abandono/soltura em áreas inade-
do Ministério da Saúde, através do SINAN quadas ou mesmo a morte dos animais. Por
(Sistema de Informação de Agravos de No- fim, os autores recomendam penas mais rí-
tificação) entre os anos de 2015 e 2019. Já gidas para os envolvidos, além de campa-
informações sobre comércio online, apre- nhas esclarecendo as consequências de um
ensões oficiais ou abandono destes animais acidente ofídico, sobretudo com espécies
foram compiladas de 2015 a 2020 através exóticas.
das plataformas GoogleTM, YoutubeTM e Fa-
cebookTM. Os resultados apontaram cerca
de 115 mil acidentes ofídicos no período,
resultando em 614 mortes. Os gêneros Bo- Editor: Daniel Silva Fernandes
39
Herpetologia Brasileira vol. 10 n.o 2 - Trabalhos Recentes

Pinto-Coelho D., Martins M., Guimarães Jr. P.R. 2021. Network analyses
reveal the role of large snakes in connecting feeding guilds in a species-ri-
ch Amazonian snake community. Ecology and Evolution 11:6558–6568. Doi:
.
10.1002/ece3.7508

I
nterações entre consumidores e re- mesmo módulo do que entre eles.
cursos geram redes de interações
Como esperado, os pesquisadores encon-
tróficas. Mas o que será que molda a
traram que espécies de serpentes grandes
estrutura dessas redes? Quais característi-
contribuem para um padrão de aninha-
cas das espécies estariam atreladas aos pa-
mento da rede. Indo além, os boídeos se-
drões que emergem a partir dessas redes?
riam os grandes responsáveis por esse ani-
Para responder a estas perguntas, Daniela
nhamento pois Boa constrictor, Epicrates
Pinto-Coelho e colaboradores analisaram
cenchria, Corallus hortulanus e Eunectes
uma comunidade de serpentes amazôni-
murinus consomem uma ampla gama de
cas, cuidadosamente descrita no clássico
recursos. No entanto, os pesquisadores
trabalho de M. Martins e E. Oliveira em
também encontraram sinal para a presen-
1998. Especificamente, os pesquisadores
ça de modularidade caracterizando a rede.
estavam interessados em saber se a pre-
Neste caso, no entanto, as responsáveis
sença de serpentes grandes estaria associa-
foram espécies com hábitos de vida mais
da a um padrão de aninhamento da rede.
particulares, como por exemplo algumas
O aninhamento nas redes nada mais é do
espécies arborícolas de Dipsas, que conso-
que especialistas utilizando recursos que
mem exclusivamente moluscos, e espécies
os generalistas também utilizam. Dado que
fossoriais, como as espécies de Atractus,
grandes predadores consomem uma gama
especialistas em minhocas.
de recursos mais ampla do que os predado-
res menores, a presença de serpentes gran- Trabalhos como este trazem implicações
des favoreceria o aninhamento na rede da que vão bem além das serpentes e seus re-
comunidade de serpentes amazônicas. Por cursos. Detectar padrões não-aleatórios
outro lado, se a especialização na dieta es- como os descritos significa detectar sinais
tivesse dirigindo a estrutura dessa rede, deixados por processos ecológicos e evolu-
os pesquisadores esperavam observar um tivos que moldam os sistemas ecológicos.
padrão de modularidade. Modularidade é Além disso, descrever os padrões caracte-
uma medida de densidade de interações rizando as redes de interação permite tam-
que, neste caso, é caracterizada pela for- bém inferir quão robustos a perturbações
mação de grupos (módulos) de espécies são esses sistemas ecológicos. Trabalhos
que compartilham recursos alimentares. como o de Pinto-Coelho et al. são também
Os módulos alimentares são compostos valiosas fontes para auxiliar em um pla-
por espécies que sobrepõem parcial ou to- nejamento mais efetivo da conservação da
talmente em suas dietas. Espécies em um biodiversidade.
módulo podem até compartilhar recursos
com espécies de outros módulos, porém as
interações são mais intensas dentro de um Editora: Laura Alencar
40
Herpetologia Brasileira vol. 10 n.o 2 - Trabalhos Recentes

Prates I., D’Angiolella A.B., Rodrigues M.T., Melo-Sampaio P.R., de Quei-


roz K., Bell R.C. 2021. Evolutionary drivers of sexual signal variation in Ama-
zon Slender Anoles. Evolution 75:1361-1376. DOI: https://doi.org/10.1111/
evo.14230

N
esse artigo, pesquisadores do Encontraram grande variedade de cores
Brasil e dos EUA investigaram entre as localidades, mas pouca ou nenhu-
possíveis explicações para a ma variação de cores dentro de uma úni-
variedade de cores que a espécie Anolis ca localidade. Uma mesma cor de barbela
fuscoauratus apresenta nas suas barbelas ocorre na Amazônia e na Mata Atlântica,
(em inglês singular, “dewlap”: “flap” de por exemplo. Apesar disso, não encontra-
pele na região gular dos lagartos anoles). ram correlação entre a diversidade genéti-
Testaram se essa variedade se deve às di- ca e a distribuição desses fenótipos, o que,
vergências evolutivas, aos fatores abióti- segundo os autores, indica possível perda
cos e/ou bióticos do habitat dos animais, ou ganho da característica diversas vezes
ou se ela existe em função de competição na história evolutiva da espécie. Igual-
de nicho reprodutivo com outros anoles mente, as estimativas de ocupação espa-
das comunidades em que vivem. cial das variedades de barbelas também
não se correlacionaram com as caracterís-
Para isso, fizeram a pesquisa em quatro ticas bióticas e abióticas das localidades de
passos principais. Primeiro amostraram a ocorrência.
diversidade da cor de barbelas de A. fusco-
auratus e sua distribuição geográfica em Entretanto, parece que a variação das co-
32 localidades da Amazônia e Mata Atlân- res das barbelas está relacionada com a
tica, utilizando inventários de campo acu- presença de outras espécies de Anolis, de
mulados por duas décadas. Em seguida modo que barbelas claras (amarelas) de
testaram se as populações com barbelas A. fuscoauratus ocorrem menos frequen-
de cores semelhantes são geneticamente temente se outras espécies simpátricas
relacionadas, sequenciando marcadores apresentam barbelas claras. E, da mesma
do tipo ddRAD (“double-digested RAD”) forma, barbelas escuras (cinzas) ocorrem
para inferir árvores filogenéticas e estru- menos frequentemente se outras espécies
tura populacional. simpátricas apresentam barbelas escuras.
Esses resultados, portanto, sugerem que
Em um terceiro passo, investigaram a cor- esse fenótipo analisado de A. fuscoaura-
relação entre 17 variáveis ambientais e a tus apresenta possivelmente um desaco-
distribuição das cores das barbelas, para plamento de caráter reprodutivo, o que
entender se fatores climáticos, topográfi- merece ser melhor investigado.
cos e vegetacionais poderiam explicar a va-
riação geográfica. Por último, testaram se
as cores das barbelas estão correlacionadas Editora: A. Sabbag
com a presença de outras espécies de ano-
les co-ocorrendo com A. fuscoauratus.

41
Herpetologia Brasileira vol. 10 n.o 2 - Trabalhos Recentes

Straube N., Lyra M.L., Paijmans J.L.A., Preick M., Basler N., Penner J.,
Rödel M.O., Westbury M.V., Haddad C.F.B., Barlow, A., Hofreiter M. 2021.
Successful application of ancient DNA extraction and library construction pro-
tocols to museum wet collection specimens. Molecular Ecology Resources: In
Press. DOI: https://doi.org/10.1111/1755-0998.13433.

H
á vários anos que um dos maiores O DNA extraído foi incorporado em biblio-
desafios das coleções zoológicas e tecas de simples fita. Esta é uma técnica
da “herpetologia molecular” era que separa as fitas de DNA antes de serem
como sequenciar DNA de exemplares que ligadas a adaptadores, maximizando dessa
passaram pelo formol em seu processo de fi- forma a obtenção da informação. Em se-
xação. O formol, assim como a água e o pró- guida, o DNA foi sequenciado em sequen-
prio tempo de fixação, degradam facilmente ciadores Illumina®. Os autores analisaram
o DNA de espécimes de coleções zoológicas a fragmentação do DNA e a capacidade de
mantidas em meio líquido. Por isso, esse recuperação dos dados através de bioin-
tipo de coleção é uma das mais desafiadoras formática; e analisaram a composição do
para extração e sequenciamento de DNA. DNA (se possui muito DNA contaminante,
por exemplo). Adicionalmente, avaliaram
Esse estudo, feito por pesquisadores brasi-
a performance das técnicas quantificando
leiros da herpetologia e pesquisadores euro-
o DNA obtido de amostras da cobra-real
peus, utilizou organismos de quatro grupos
(Ophiophagus hannah) com seu genoma
de vertebrados (Lissamphibia, Squamata,
referência já publicado. Essas etapas de
Euteleostei e Chondrichthyes) com o ob-
bioinformática são importantes porque as
jetivo de testar combinações de protocolos
sequências de DNA degradados obtidas são
para obter boas sequências de DNA a partir
sempre muito curtas (nesse caso, por exem-
de amostras antigas e degradadas. Segundo
plo, tiveram em média 31 pb), e associá-las
os autores, duas coisas são importantes ao
ao espécime utilizado torna-se difícil. Isso
se tratar de problemas como esses: o cuida-
resulta em ambiguidades em mapeamen-
do com as primeiras etapas da extração, e
tos, chance de sequenciar sequências conta-
os protocolos de bioinformática para trata-
minantes, etc.
mento dos dados obtidos.
No trabalho, os autores obtiveram, com
Os estudos foram feitos a partir de 57 amos-
sucesso, sequências de todos os espécimes
tras de tecidos, de 33 espécimes de museu,
analisados. Entre diversos outros resulta-
incluindo três espécies de répteis e 12 espé-
dos importantes, eles encontraram que não
cies de anfíbios anuros. Inicialmente, tenta-
são necessárias altas concentrações de DNA
ram melhorar os protocolos de digestão ini-
para recuperar sequências de genoma en-
cial de DNA, para maximizar as obtenções
dógeno (genoma do indivíduo alvo). Os au-
de DNA total, testando cinco métodos dife-
tores ainda fornecem um extenso material
rentes de digestão. Com o resultado desses
suplementar para auxiliar pesquisadores
testes, puderam inclusive testar estatistica-
a obterem amostras de DNA de espécimes
mente, entre outras coisas, se havia correla-
mantidos em coleções úmidas. E mostram
ção entre DNA total extraído e a quantidade
como esse trabalho pode ajudar na obten-
de tecido ou a idade do espécime.
ção de informações genéticas de espécimes
raros ou extintos da natureza.
42
Editora: A. Sabbag
Herpetologia Brasileira vol. 10 n.o 2 - Trabalhos Recentes

Xenodon merremi
Villa de las rosas, Cordoba - Argentina
@Francisco Brito

43
Herpetologia Brasileira vol. 10 n.o 2 - Trabalhos Recentes

Ranitomeya amazonica
Floresta Nacional de Caxiuanã - PA
@Ana Paula V. Costa-Rodrigues

44
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

Métodos em Herpetologia
A Morfometria Geométrica e suas aplicações nos estudos de
Serpentes
Natália Malaquias Souto1,2,4*, Roberta Azeredo Murta-Fonseca2,3, Daniel Silva
Fernandes1,2

1 Departamento de Zoologia, Instituto de Biologia, Universidade Federal do


Rio de Janeiro, 21941-902 Rio de Janeiro, RJ, Brasil.
2 Departamento de Vertebrados, Museu Nacional, Universidade Federal do
Rio de Janeiro, Quinta da Boa Vista, 20940-040 Rio de Janeiro, RJ, Brasil.
3 Laboratório de Zoologia, Campus do Pantanal, Universidade Federal de
Mato Grosso do Sul, 79304-902 Corumbá, MS, Brasil.
*Corresponding author. E-mail: souto.nm@gmail.com
DOI: 10.5281/zenodo.5211377

RESUMO

Na biologia a descrição da forma marcos anatômicos que carre-


dos organismos serve como base gam informações de coordenadas
para diversos estudos. Durante cartesianas indicando seu posi-
muitos anos pesquisadores bus- cionamento exato na estrutura
caram técnicas que permitissem analisada. O conceito de tamanho
quantificar estatisticamente a va- em MG é dado pelo tamanho do
riação de forma de organismos e/ centroide, definido como a quan-
ou estruturas até que na década tidade de dispersão dos marcos
de 1980 houve o surgimento da anatômicos em torno do centro
Morfometria Geométrica (MG), de gravidade da configuração
técnica que permite analisar a (centroide). Já a forma é definida
forma dos organismos ou de de- como a propriedade geométrica
terminada estrutura consideran- de um objeto que permanece após
do o espaço de forma geométri- a retirada dos efeitos de localiza-
ca e usando métodos estatísticos ção, escala e orientação, que pode
multivariados. As análises de MG ser realizada através da Análise
são baseadas em conjuntos de Generalizada de Procrustes. Para
45
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

avaliar o uso da MG em estudos INTRODUÇÃO

D
de serpentes foi realizada uma
pesquisa bibliográfica na qual fo- esde os primórdios da bio-
ram levantados 55 artigos que uti- logia a descrição da morfo-
lizam essa técnica no estudo do logia dos organismos serve
grupo. O tema mais abordado é como base para estudos de classifica-
a variação morfológica associada ção taxonômica e diversidade de espé-
ao habitat (20% dos artigos), se- cies, elevando a importância da análise
guido por delimitação de espécies da forma em diversos estudos biológi-
e variação morfológica associada cos (Adams et al. 2013). No século XVI
à dieta (17% cada). A maior parte o pintor e geômetra Albrecht Dürer,
desses trabalhos utiliza a morfo- em seu livro ‘‘Vier Bücher von mens-
logia externa da cabeça como fon- chlicher Proportion’’ (Quatro livros de
te de informação (51%), seguida proporções humanas, tradução livre)
pela osteologia craniana (30%). de 1528, apresentou as primeiras ten-
Existe uma variedade de análises tativas de caracterizar as diferentes for-
estatísticas multivariadas utiliza- mas das estruturas do corpo humano
das nos trabalhos dependendo do por meio de deformações dos desenhos
objetivo. Contudo, cada vez mais sobre uma grade sobreposta na qual
estudos que relacionam a morfo- modificações do tamanho das linhas e
logia a fatores bióticos e/ou abi- quadrículas causavam transformações
óticos buscam avaliar a relação nas proporções das estruturas (Mon-
desses caracteres em um contex- teiro & Reis 1999; Mitteroecker & Gunz
to evolutivo através de métodos 2009; Reyment 2010). No final do sé-
filogenéticos comparativos, o que culo XIX o zoólogo D’Arcy W. Thomp-
configura uma técnica poderosa son em seus estudos que culminaram
para identificar associações e in- na publicação da obra “On Growth and
ferir pressões seletivas que gera- Form” (Sobre o crescimento e a forma)
ram a diversidade biológica. Com (Thompson 1917), retornou aos concei-
essa pesquisa foi possível obser- tos de linhas e quadrículas de Albrecht
var um número crescente de es- Dürer, sendo esse estudo considerado
tudos de serpentes utilizando MG um marco para a exploração da temá-
e a partir dos resultados dos mes- tica da morfometria (Bookstein 1991;
mos há a amplificação das possi- Marcus et al. 1996; Cohen 2004; Fornel
bilidades de novas abordagens, o & Cordeiro-Estrela 2012). O método de
que permitirá uma melhor com- coordenadas proposto por Thompson
preensão da evolução, ecologia e baseava-se em mapear a localização de
morfologia das serpentes. pontos homólogos entre as diferentes
formas biológicas através da constru-
46
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

ção de grades de deformação, ilustran- multivariadas que viriam a ser de suma


do como uma parte de um organismo importância para os avanços da mor-
pode ser descrita através da distorção fometria (Fisher 1936; Teissier 1938),
desta mesma parte em outro organis- enquanto nas décadas de 1960 e 1970 a
mo. Apesar da abordagem visualmente escola biométrica passou a utilizar tais
atraente, ainda não existia um arcabou- ferramentas para descrever padrões de
ço estatístico que permitisse estudar a variação de forma dentro e entre gru-
variação da forma quantitativamente pos (Adams et al. 2004; Mitteroecker
(Thompson 1917; Marcus et al. 1996; & Gunz 2009). Esse tipo de abordagem
Monteiro & Reis 1999; Mitteroecker & recebeu o nome de morfometria mul-
Gunz 2009; Fornel & Cordeiro-Estrela tivariada ou morfometria tradicional
2012). (MT) e consistia em aplicar análises es-
tatísticas multivariadas a conjuntos de
Paralelamente, no final do século XIX, variáveis morfológicas (Jolicoeur 1959;
com base nos trabalhos de Francis Gal- Jolicoeur & Mosimann 1960; Blackith
ton, Walter Weldon e Karl Pearson, & Reyment 1971; Marcus 1990; Rey-
deu-se início à formação de uma es- ment 1991; Adams et al. 2004; Mittero-
cola morfométrica (nomeada de Bio- ecker & Gunz 2009).
métrica), com o intuito de estudar as
variações da forma biológica através Na MT são utilizadas principalmente
de correlações das distâncias medidas variáveis lineares - como medidas de
entre pontos localizados em estrutu- distâncias - e, em alguns casos, infor-
ras biológicas (Reyment 1996, 2010). mações de ângulos e proporções (Rohlf
Essas correlações e os conceitos es- 1990; Adams et al. 2004; Galán 2015).
tatísticos utilizados por esses autores Considerando que medições lineares
tornaram-se a base da análise multi- de distância geralmente estão relacio-
variada desenvolvida no século seguin- nadas ao tamanho do elemento em es-
te (Reyment 1996; Monteiro & Reis tudo (Bookstein et al. 1985; Adams et
1999). No início do século XX houve al. 2004), houve um esforço dos pes-
uma transição de estudos puramente quisadores para desenvolver métodos
descritivos para abordagens com uma capazes de extrair variáveis de forma
mudança de enfoque, que utilizavam sem a influência deste fator (Jolico-
a morfometria como uma ferramenta eur 1959, 1963; Jolicoeur & Mosimann
para o “estudo quantitativo da varia- 1960; Mosimann 1970; Oxnard 1978;
ção das formas biológicas” (Bookstein Humphries et al. 1981; Rohlf & Books-
1996; Monteiro & Reis 1999; Adams tein 1987; Bookstein 1989; Sundberg
et al. 2013). Durante a década de 1930 1989; Jungers et al. 1995). Muitos mé-
desenvolveram-se análises estatísticas todos foram propostos com este obje-

47
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

tivo, porém com pouca concordância um espaço multivariado e descreveram


sobre qual seria o mais adequado, fato as propriedades de um espaço de forma
este relevante porque métodos distin- que tornou possível combinar métodos
tos geralmente produzem resultados li- estatísticos multivariados e métodos
geiramente diferentes (Sundberg 1989; para visualização direta da forma bio-
Adams et al. 2004). Outra caracterís- lógica (Monteiro & Reis 1999; Adams
tica da morfometria tradicional é que et al. 2004; Fornel & Cordeiro-Estrela
o mesmo conjunto de medidas de dis- 2012). Bookstein (1984) propôs um mé-
tância pode ser obtido em objetos com todo geométrico para estudar diferenças
formas diferentes, como por exemplo, de forma através da descrição de um es-
as medidas do comprimento e largura paço multivariado para análises morfo-
máximos de uma forma oval e de uma métricas com configurações de marcos
lágrima, onde ambos os objetos podem anatômicos representadas por valores
ter os mesmos valores de altura e largu- de coordenadas cartesianas (Marcus et
ra máxima, ainda que possuam formas al. 1996; Monteiro & Reis 1999; Fornel
visivelmente diferentes (Adams et al. & Cordeiro-Estrela 2012). Bookstein
2004). Além disso, em alguns casos a (1986) sintetizou as técnicas desen-
medida pode não representar caracte- volvidas por Goodall (1983) e Kendall
rísticas comparáveis nos diferentes or- (1984) junto a suas próprias contri-
ganismos (Fig. 1) (Zelditch et al. 2004; buições mostrando a convergência das
Fornel & Cordeiro-Estrela 2012). ideias sobre o espaço de forma (Montei-
ro & Reis 1999; Fornel & Cordeiro-Es-
Paralelamente ao incremento da esco- trela 2012). Bookstein (1989) propôs o
la biométrica houve o desenvolvimento método “thin plate spline” para análises
de uma escola geométrica. De maneira de deformações por meio da criação de
contrária ao que ocorria na morfome- um espaço de transformações geométri-
tria tradicional, na escola geométrica fo- cas baseado nas diferenças nas posições
ram desenvolvidos métodos capazes de dos marcos anatômicos em um orga-
extrair informações relacionadas à ge- nismo em relação a uma configuração
ometria dos organismos, ainda que es- de marcos anatômicos de referência, o
tes não permitissem o estudo estatístico que permitiu a construção de grades de
da variação de forma (Monteiro & Reis transformações semelhantes àquelas de
1999). Durante a década de 1980 essa li- Dürer e Thompson. Todas essas contri-
mitação foi superada simultaneamente buições geraram a chamada “revolução
em diversos centros de pesquisa. Goo- na morfometria”, que corresponde ao
dall (1983), Kendall (1984) e Bookstein surgimento da Morfometria Geométri-
(1984, 1989) propuseram um arcabou- ca (MG), definida como “Fusão empíri-
ço estatístico para a análise de forma em ca da geometria com a biologia” e que

48
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

analisa a forma dos organismos ou de como “livro azul” (Proceedings of the


determinada estrutura considerando o Michigan Morphometrics Workshop),
espaço geométrico e usando métodos “livro preto” (Contributions to Mor-
estatísticos multivariados (Bookstein phometrics) e “livro branco” (Advan-
1982; Rohlf & Marcus 1993; Monteiro & ces in Morphometrics) (Rohlf & Books-
Reis 1999; Adams et al. 2004; Mittero- tein 1990; Marcus et al. 1993, 1996). A
ecker & Gunz 2009; Fornel & Cordeiro- década de 1990 representou um grande
-Estrela 2012; Adams et al. 2013; Galán avanço para o conhecimento e utiliza-
2015). ção prática das técnicas da MG (Mar-
cus et al. 1996; Monteiro & Reis 1999;
Apesar da revolução que ocorreu no fi- Adams et al. 2004; Galán 2015; Mc-
nal da década de 1980, a MG ainda não nulty & Vinyard 2015), sendo que atu-
era um método acessível para a maior almente existem programas gratuitos,
parte dos pesquisadores (Monteiro & como o TPSRelw (Rohlf 2003), Mor-
Reis 1999). No final da década de 1980 phoJ (Klingemberg 2011), GeoMorph
e início da década de 1990 houve a re- (pacote para o programa R desenvolvi-
alização de workshops que resultaram do por Adams et al. 2014), entre outros
na publicação dos volumes conhecidos que auxiliam nas análises de MG.

Figura 1. Exemplo de distintas medidas de largura da caixa craniana em Serpentes. A: Largura


do crânio obtida através das extremidades do processo pós-orbital de Thamnodynastes chaquen-
sis (MNRJ 21003). B: Largura do crânio tomada no local de maior largura de Sibon nebulatus
(MNRJ 18031).

49
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

METODOLOGIA DA MOR- sições entre os diferentes objetos; (2)


FOMETRIA GEOMÉTRICA ser precisamente localizados e fornecer
informações comparáveis e replicáveis
Marcos Anatômicos
em todos os espécimes; (3) represen-
tar a forma da estrutura de maneira
Como discutido anteriormente, o con- adequada; e (4) estar situados em um
junto de medidas lineares da morfome- mesmo plano anatômico, quando se
tria tradicional pode não representar trata de análises em duas dimensões
características comparáveis nos dife- (2D) (Bookstein 1991; Monteiro & Reis
rentes organismos (Fig. 1A, B) (Zeldi- 1999; Fornel & Cordeiro-Estrela 2012).
tch et al. 2004). Uma proposta de so-
lução para essa questão foi a definição
Bookstein (1991) classificou os marcos
de pontos cuja localização anatômica
anatômicos em três tipos (Fig. 2): Tipo
fosse correspondente em todos os or-
I – justaposição de tecidos (e.g. pontos
ganismos da análise e, desta forma, as
onde três estruturas se encontram);
medidas lineares pudessem ser toma-
Tipo II – pontos de máxima curvatura
das entre tais pontos, agora chamados
ou outros processos morfogenéticos lo-
de marcos anatômicos (landmarks
cais (e.g. extremidades de processos e
em inglês) (Strauss & Bookstein 1982;
vales de invaginações); Tipo III – pon-
Bookstein et al. 1985; Zelditch et al.
tos extremos (e.g. relacionados à maior
2004).
distância que pode ser medida em uma
estrutura). Em alguns casos as estru-
A MG incorporou este conceito de mar- turas biológicas podem ser superfícies
cos anatômicos, que passaram a carre- planas ou lisas, sendo difícil estabele-
gar informações de coordenadas carte- cer marcos anatômicos dos tipos supra-
sianas indicando seu posicionamento citados, ou esses marcos não são capa-
em determinada estrutura (Bookstein zes de capturar a forma a ser analisada.
1984). Os critérios para a escolha dos Nesses casos, podem ser utilizados pon-
marcos anatômicos representam um tos cuja localização é escolhida baseada
passo delicado e muito importante nos em outros critérios, como por exemplo
estudos de MG, portanto essa etapa distribuídos uniformemente ao longo
requer a experiência de um especia- do contorno e/ou superfície, que são
lista na morfologia da estrutura e/ou conhecidos como pseudo-marcos ana-
dos táxons analisados (Bookstein 1991; tômicos ou semilandmarks (Bookstein
Monteiro & Reis 1999). Os marcos 1991; Galán 2015; Dryden & Mardia
anatômicos devem: (1) ser anatomica- 2016) (Fig. 3). Estes pontos podem ser
mente homólogos segundo um critério fixos ou móveis ao longo de linhas tan-
operacional, ou seja, devem apresentar gentes à curva de contorno da estrutura
correspondência biológica de suas po- (Green 1996; Bookstein 1997).
50
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

Figura 2. Classificação dos marcos anatômicos. Quadrados Azuis: Tipo I – Justaposição de teci-
dos; Círculos Vermelhos: Tipo II – pontos de máxima curvatura ou outros processos morfogené-
ticos locais; Triângulos Verdes: Tipo III – pontos extremos (sensu Bookstein, 1991).

Figura 3. Exemplo de marcação de semilandmarks ou pseudo-marcos anatômicos. No caso de


semilandmarks móveis, no processo de superposição estes pontos podem se mover ao longo de
linhas tangentes à curva de contorno da estrutura (linhas verdes).
51
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

Forma e tamanho em MG quadrada da soma dos quadrados des-


sas distâncias (Bookstein 1991; Zelditch
Não são apenas os métodos para sepa- et al. 2004; Fornel & Cordeiro-Estrela
rar variação de tamanho e de forma que 2012; Kingenberg 2016). O tamanho
apresentam limitações, mas o conceito do centroide possui propriedades es-
de tamanho e forma tem sido um dos tatísticas desejáveis para a MG, como
assuntos mais controversos da MT (Zel- a independência conceitual ou teórica
ditch et al. 2004), até porque há uma em relação às variáveis de forma (Zel-
variedade de definições de tamanho ditch et al. 2004). Empiricamente, en-
encontradas na literatura (Bookstein tretanto, o tamanho do centroide pode
1989). No entanto, para o desenvolvi- estar correlacionado à forma porque os
mento da MG é importante que se ex- organismos maiores geralmente têm
plore a relação entre forma e tamanho, formas diferentes dos organismos me-
pois não é possível haver uma aborda- nores, como quando há presença de
gem matemática coerente oriunda de alometria (Zelditch et al. 2004; Fornel
um conceito indefinido (Zelditch et al. & Cordeiro-Estrela 2012) – lembrando
2004; Fornel & Cordeiro-Estrela 2012). que correlação e dependência entre va-
riáveis são conceitos distintos. O fato
de existir a independência entre essas
Cabe ressaltar que forma (shape em in-
duas variáveis não significa a perda de
glês) e formato (form) possuem signi-
informação sobre a relação entre elas,
ficados diferentes no contexto da MG,
o que é facilmente avaliado através de
sendo formato definido como a soma
análises de Regressões multivariadas
da forma e do tamanho (Monteiro &
que buscam verificar a existência de
Reis 1999; Fornel & Cordeiro-Estrela
relação entre variáveis dependentes
2012; Galán 2015).
(e.g. coordenadas de Procrustes – veja
abaixo) e uma ou mais variáveis inde-
Tamanho em MG
pendentes (e.g. tamanho do centroide)
(Zelditch et al. 2004).
Em MG o tamanho de um objeto é dado
pelo tamanho do centroide. O centroide
Forma em MG e Superposição de
é definido como a coordenada do centro
Procrustes
gravitacional da forma, que correspon-
de à média das coordenadas de todos os
Em estudos de MG a forma pode ser
marcos anatômicos de um objeto (Klin-
definida como a propriedade geométri-
genberg 2016). Seu valor é calculado a
ca de um objeto que permanece após a
partir da distância entre cada marco
retirada dos efeitos de localização, es-
anatômico e o centroide (Zelditch et al.
cala e orientação (através dos proces-
2004) e, em seguida, calcula-se a raiz
52
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

sos de translação, escalonamento e ro- to) (Fig. 4C). Por fim, os objetos ainda
tação, respectivamente) (Kendall 1977; diferem na orientação e são rotaciona-
Bookstein 1996; Zelditch et al. 2004; dos (processo de rotação) através do
Galán 2015). Isso significa que para método dos quadrados mínimos para
que seja possível comparar as formas se alinharem de maneira que a soma
de organismos ou estruturas utilizan- dos quadrados das distâncias entre os
do a MG, é necessário que estes efeitos marcos correspondentes seja a menor
sejam retirados dos objetos através de possível (Fig. 4D). Após a execução
um processo chamado “superposição”. destas três etapas, as diferenças res-
tantes entre os marcos anatômicos das
Existem vários métodos de superposi- duas configurações correspondem a di-
ção, sendo o mais difundido atualmen- ferenças de forma. Ao final desse pro-
te o método de superposição parcial de cesso são obtidas as coordenadas dos
Procrustes (Rohlf & Slice 1990; Slice marcos anatômicos (agora chamadas
2001). Para exemplificar uma análise coordenadas de Procrustes), que serão
comum deste método com duas con- utilizadas para o cálculo das distâncias
figurações de marcos anatômicos usa- de Procrustes. A distância de Procrus-
remos o crânio da serpente Liophis tes é a principal medida de diferença
miliaris (Linnaeus, 1758) (Fig. 4). Pri- de forma entre configurações de mar-
meiro as duas configurações em estudo cos anatômicos, correspondendo à raiz
possuem localização, tamanho e orien- quadrada da soma dos quadrados das
tação diferentes (Fig. 4A). A variação distâncias entre marcos corresponden-
na localização é removida através da tes após a superposição de Procrustes
translação, ou seja, o deslocamento das (Klingenberg 2020).
configurações de marcos com a sobre-
posição dos seus centros de gravidade. Em estudos biológicos normalmente
Isso é obtido através da centralização são utilizadas mais de duas configura-
das coordenadas cartesianas dos cen- ções de marcos anatômicos, sendo ne-
troides das duas configurações na ori- cessário realizar o ajuste simultâneo de
gem dos eixos de variação (0,0) (Fig. todas as configurações através da Aná-
4B). Entretanto, as configurações cen- lise Generalizada de Procrustes (Rohlf
tralizadas ainda diferem em escala (di- & Slice 1990). Assim como na análise
ferenças de tamanho), sendo este efeito comum de superposição, também é
retirado através da divisão de cada co- utilizado o ajuste por quadrados míni-
ordenada das configurações pelo tama- mos, porém de forma iterativa. Em um
nho do respectivo centroide, o que leva primeiro momento todas as configura-
à homogeneização do tamanho do cen- ções são ajustadas a uma configuração
troide das configurações centralizadas alvo escolhida aleatoriamente (normal-
para o valor igual a 1,0 (escalonamen-
53
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

mente a configuração do primeiro or- correspondendo aos desvios das coor-


ganismo da amostra). Posteriormente, denadas de Procrustes em relação às
é gerada uma configuração média e, coordenadas dos marcos anatômicos
na próxima iteração, todas as configu- correspondentes da configuração mé-
rações serão ajustadas a essa configu- dia (Klingenberg & McIntyre 1998; Zel-
ração média. Em seguida, uma nova ditch et al. 2004). Algumas maneiras
configuração média é calculada e o pro- de facilitar a visualização das variações
cedimento é repetido até que a confi- de forma entre configurações são atra-
guração média gerada não mude mais vés dos vetores de deslocamento rela-
(Rohlf & Slice 1990; Bookstein 1991; tivo dos marcos anatômicos (Fig. 5C)
Rohlf 1990; Galán 2015; Klingenberg (Fornel & Cordeiro-Estrela 2012); das
2020). grades de deformação (Zelditch et al.
2004) (Fig. 5D); das linhas de contor-
Existem duas maneiras equivalentes de no (wireframes e outlines, Fig. 5E e F,
apresentar as informações de forma: respectivamente) (Klingenberg 2013);
as já citadas coordenadas de Procrus- e, para superfícies em três dimensões,
tes e os resíduos de Procrustes, estes as próprias superfícies escaneadas de-

Figura 4. Removendo os efeitos de diferenças na localização, escala e orientação em análises de


MG. A: Configurações originais. B: Após o processo de translação. C: Após o processo de escalo-
namento. D: Após o processo de rotação, permanecem apenas as diferenças de forma.

54
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

formadas (Drake & Klingenberg 2010). perposição de Procrustes uma série de


Linhas de contorno (outlines) e super- análises estatísticas multivariadas po-
fícies deformadas são criadas baseadas dem ser empregadas dependendo da
nas grades de deformação da estrutu- natureza do estudo.
ra (Klingenberg 2013). A partir da su-

Figura 5. Diferentes formas de visualização da variação da forma em crânios de serpentes. A:


Posição dos marcos anatômicos; B: Posição dos marcos anatômicos em todos os espécimes da
análise após superposição de Procrustes – pontos azuis maiores representam localização média
de cada marco anatômico e pontos pretos menores representam localização dos marcos anatômi-
cos em cada espécime; C: Vetores de deslocamento relativo dos marcos anatômicos após a Análise
de Componentes Principais (PCA) – pontos pretos representam a posição média de cada marco
anatômico e vetores vermelhos representam o deslocamento daquele marco anatômico em rela-
ção à média em determinada escala do PC representado; D: Os mesmos vetores sobre grade de
deformação; E: Linhas de contorno – Wireframe – Linhas cinzas representam a média de todos
os indivíduos e linha preta a forma em determinada escala do PC representado; F: Linhas de con-
torno – Outline – Linhas cinzas representam média e pretas forma em determinada escala do PC.
55
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

MORFOMETRIA GEOMÉ- tes abordagens: relacionando morfologia


TRICA E SERPENTES e hábitos (Fabre et al. 2016; Klaczko et
al. 2016), dimorfismo sexual (Meik et al.
2012; Loebens et al. 2019; Murta-Fonseca
As serpentes atuais possuem um corpo pe-
et al. 2019), ontogenia (Murta-Fonseca &
culiar, em forma de tubo com uma cabeça,
Fernandes 2016), delimitação de espécies
cauda e ausência de membros locomotores
(Andjelkovic et al. 2016), entre outros.
(Lillywhite 2014). Os estudos envolvendo a
morfologia desse grupo tradicionalmente
são baseados em descrições de caracteres Através de pesquisa bibliográfica foram le-
externos, como folidose (contagem e for- vantados 55 artigos na literatura que utili-
mato de escamas), caracteres morfomé- zam as técnicas da MG no estudo de Serpen-
tricos e de padrão de coloração, além de tes. O levantamento foi realizado utilizando
caracteres internos referentes à osteologia palavras-chave (e.g. “Geometric Morpho-
(crânio e vértebras), morfologia de hemi- metrics;” “Snakes Geometric Morphome-
pênis, musculatura e glândulas (Thorpe trics”) pelo buscador Google Scholar, além
1975; Zaher 1999; Passos & Fernandes das referências contidas nos próprios arti-
2008; Fernandes et al. 2010; Murta-Fon- gos levantados, e compreende o período en-
seca & Fernandes 2016; Souto et al. 2017). tre a década de 1980 até o momento atual.
Nos últimos anos é possível observar um Foi constatado que o início das publicações
número crescente de estudos de serpentes se deu nos primeiros anos de 2000, sendo
utilizando MG como ferramenta. O méto- que há um aumento no número de estudos
do da MG vem sendo usado em diferen- na segunda década (Fig. 6).

Figura 6. Número de artigos publicados utilizando MG em estudos de Serpentes por ano.


56
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

Existe uma diversidade de temas que po- et al. 2017; Abegg et al. 2020; Lucchini et
dem ser abordados utilizando a MG como al. 2020); variação morfológica intraespe-
ferramenta de estudo (Fig. 7A). O Apêndi- cífica, estudos metodológicos com Serpen-
ce I contém uma tabela com os principais tes como modelo e alometria estática (5%
temas abordados por cada artigo. A área cada) (Variação Intraespecífica - Smith &
mais abordada usando a MG e serpentes é Collyer 2008; Sarris et al. 2012; Showalter
a variação morfológica associada ao habi- et al. 2014; Lucchini et al. 2020. Metodo-
tat (presente em 20% dos artigos) (Manier logia – Lawing & Polly 2010; Baum et al.
2004; Head et al. 2009; Yi & Norell 2015; 2014; Palci & Lee 2018; Souto et al. 2019.
Esquerré & Keogh 2016; Fabre et al. 2016; Alometria estática - Sarris et al. 2012; And-
Segall et al. 2016; Allemand et al. 2017; Pal- jelkovic et al. 2016; Tamagnini et al. 2018;
ci et al. 2017, 2018; Moshtaghie et al. 2018; Abegg et al. 2020); estudos sobre a origem
Da Silva et al. 2018; Silva et al. 2017; Segall ecológica (4%) (Yi & Norell 2015; Palci et
et al. 2019, Esquerré et al. 2020; Segall et al. 2017; Da Silva et al. 2018); evolução da
al. 2020); seguida por delimitação de es- forma do corpo (3%) (Head et al. 2009;
pécies e variação morfológica associada à Head & Polly 2015); e estudo com espécies
dieta (17% cada) (Delimitação de espécies - que mimetizam serpentes (1%) (Hossie &
Manier 2004; Gentilli et al. 2009; Moreno- Sherratt 2014).
-Barajas et al. 2013; Magiacotti et al. 2014;
Showalter et al. 2014; Mezzasalma et al. A maior parte desses estudos utiliza a mor-
2015; Ruane 2015; Barbo et al. 2016; Davis fologia externa da cabeça como fonte de
et al. 2016; Pokrant et al. 2016; Akman & informação (51%), seguida pela osteologia
Goçomem 2019; Belgheiszadeh et al. 2019; craniana (30%); vértebras (9%); orelha in-
Keates et al. 2019. Dieta - Meik et al. 2012; terna (5%); forma do dente (3%) e um dos
Smith 2014; Andjelkovic et al. 2016, 2017; estudos utilizou a forma da genitália femi-
Fabre et al. 2016; Klaczko et al. 2016; San- nina (2%) (Fig. 7B e Apêndice I). O grande
tos et al. 2017; Silva et al. 2018; Sherratt et número de estudos utilizando a morfologia
al. 2019; Rajabizadeh et al. 2020; Rhoda externa da cabeça pode estar associado a
et al. 2020; Segall et al. 2020; Cleuren et uma maior facilidade de obtenção de ma-
al. 2021); dimorfismo sexual (15%) (Ma- terial nas coleções, visto que as técnicas
nier 2004; Smith & Collyer 2008; Meik et mais utilizadas para acessar a morfologia
al. 2012; Henao-Duque & Ceballos 2013; interna realizam procedimentos mais des-
Andjelkovic et al. 2016; Silva et al. 2017; trutivos. Por esses motivos, os curadores
Tamaginini et al. 2018; Loebens et al. de coleções zoológicas podem ser restriti-
2019; Murta-Fonseca et al. 2019; Abegg et vos quanto ao uso de tais técnicas, especial-
al. 2020; Lucchini et al. 2020); ontogenia mente no caso de material-tipo ou táxons
(8%) (Murta-Fonseca & Fernandes 2016; raros (Bell & Mead 2014; Souto et al. 2019).
Palci et al. 2016; Silva et al. 2017; Esquerré Nesses casos, o uso do micro-CT scan pode

57
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

ser a melhor alternativa, pois é uma técnica consequentemente aumentando o grau de


não destrutiva e relativamente rápida (Ma- precisão das análises, já que esses tipos de
chado et al. 2015), além de permitir a visu- pontos são capazes de capturar uma maior
alização de estruturas internas. No entan- quantidade de informação de forma da es-
to, o micro-CT ainda é caro na maioria dos trutura de estudo (Bookstein 1991; Fornel
países e, ocasionalmente, a visualização de & Cordeiro-Estrela 2012).
suturas e a delimitação dos ossos podem
ser afetadas devido à resolução inadequa- Dentre as análises exploratórias mais uti-
da do scanner ou ao tamanho da estrutura lizadas nestes estudos estão a Análise de
(Souto et al. 2019). Componentes Principais (PCA) e a Análise
de Variáveis Canônicas (CVA) (e.g. Manier
Muitos dos estudos que utilizaram a mor- 2004; Gentilli et al. 2009; Lawing & Polly
fologia externa da cabeça como fonte de 2009; Sarris et al. 2012; Moreno-Barajas
informação consideraram, além do con- et al. 2013; Hossie & Sherratt 2014; Mezza-
torno, as regiões entre as escamas como salma et al. 2015; Ruane 2015; Yi & Norell
referência para a digitalização dos mar- 2015; Andjelkovic et al. 2016; Barbo et al.
cos anatômicos (Manier 2004; Smith & 2016; Fabre et al. 2016; Klaczko et al. 2016;
Collyer 2008; Henao-Duque & Ceballos Silva et al. 2017; Esquerré et al. 2017; Palci
2012; Meik et al. 2012; Moreno-Barajas et al. 2017; Da Silva et al. 2018; Silva et al.
2013; Magiacotti et al. 2014; Mezzasalma 2018; Tamagnini et al. 2018; Akman & Gö-
et al. 2015; Ruane 2015; Barbo et al. 2016; çmen 2019; Belgheiszadeh et al. 2019; Ke-
Davis et al. 2016; Silva et al. 2017; Mosh- ates et al. 2019; Murta-Fonseca et al. 2019;
taghie et al. 2018; Tamagnini et al. 2018; Abegg et al. 2020; Lucchini et al. 2020; Ra-
Akman & Göçmen 2019; Keates et al. 2019; jabizadeh et al. 2020; Cleuren et al. 2021).
Loebens et al. 2019; Abegg et al. 2020). A PCA na MG é utilizada para sumarizar as
Isso pode estar associado a uma maior fa- descrições de variação entre indivíduos a
cilidade para a identificação de pontos cor- partir de uma série de variáveis represen-
respondentes, principalmente dos tipos I e tadas pelas coordenadas ou resíduos de
II (Bookstein 1991). A osteologia do crânio Procrustes, enquanto a CVA é usada para
aparece em segundo lugar nas estruturas sumarizar descrições de diferenças en-
mais estudadas, provavelmente devido à tre grupos pré-estabelecidos. Além disso,
menor disponibilidade de material discuti- a PCA e a CVA geram gráficos onde cada
da anteriormente. Entretanto, essa é uma configuração de marcos anatômicos da
rica fonte de caracteres para estudos de amostra será representada por um ponto,
MG, permitindo a digitalização de marcos o que facilita a determinação de possíveis
anatômicos dos tipos I, II e III (Fig. 2) e padrões de ordenação nos dados (Montei-

58
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

Figura 7. Temas e estruturas abordados em estudos de Serpentes utilizando MG. A: Temas abor-
dados. B: Estruturas utilizadas.

59
Herpetologia Brasileira vol. 10 n.o22--Métodos
Métodosem
emHerpetologia
Herpetologia

ro & Reis 1999; Zelditch et al. 2004; For- multivariada (Sarris et al. 2012; Andjelko-
nel & Cordeiro-Estrela 2012). A robustez vic et al. 2016; Murta-Fonseca & Fernandes
da CVA, assim como das análises discri- 2016; Silva et al. 2017; Esquerré et al. 2017;
minantes, pode ser verificada através de Abegg et al. 2020; Lucchini et al. 2020;
testes de permutação e validação cruzada, Cleuren et al. 2021). Essas análises buscam
respectivamente (Monteiro & Reis, 1999; verificar se existe relação entre variáveis
Zelditch et al. 2004). Muitos trabalhos tes- dependentes e uma variável independente.
taram as diferenças entre grupos através de Neste caso as variáveis dependentes repre-
Análises de Variância de Procrustes (ANO- sentam a forma e são relativas aos escores
VA de Procrustes) ou Análise de Variância da regressão, refletindo uma direção ou ve-
Multivariada (MANOVA) (e.g. Mangiacotti tor das coordenadas de Procrustes que está
et al. 2014; Showalter et al. 2014; Yi & No- relacionado ao tamanho do centróide (ou
rell 2015; Andjelkovic et al. 2016; Davis et log do tamanho do centróide). A variável
al. 2016; Segall et al. 2016; Tamagnini et al. independente é o tamanho, representado
2018, Cleuren et al. 2021). Outra possível justamente pelo tamanho do centróide ou
abordagem utilizando análises de variância log do tamanho do centróide (Klingenberg
hierárquica nos trabalhos de MG é a avalia- 2016; Murta-Fonseca & Fernandes 2016).
ção de erros na tomada de fotografias e na
digitalização dos marcos anatômicos (Klin- Finalmente, os resultados de estudos de
genberg & McIntyre 1998; Klingenberg et MG também servem para avaliar a correla-
al. 2002; Klingenberg 2015; Murta-Fon- ção de caracteres em um contexto evoluti-
seca & Fernandes 2016; Andjelkovic et al. vo. Esse tipo de abordagem pode ser usado,
2017; Moshtaghie et al. 2018; Murta-Fon- por exemplo, em estudos que relacionam a
seca et al. 2019; Souto et al. 2019). Para isso morfologia a hábitos (e.g. uso do habitat)
podem ser comparadas duas fotografias di- e/ou dieta (Klaczko et al. 2016; Esquerré
ferentes do mesmo indivíduo e duas digita- et al. 2017; Da Silva et al. 2018; Sherrat et
lizações distintas de marcos anatômicos da al. 2019; Segall et al. 2020; Cleuren et al.
mesma fotografia. Para que os resultados 2021). Em biologia, estudos que compa-
obtidos em análises posteriores não sejam ram características morfológicas e ambien-
enviesados, as diferenças entre as fotogra- tais, aliados a hipóteses de relacionamento
fias do mesmo indivíduo e os marcos ana- filogenético avaliados através de métodos
tômicos da mesma fotografia devem ser filogenéticos comparativos, configuram
menores do que as diferenças entre os in- uma técnica poderosa para identificar as-
divíduos (Souto et al. 2019). sociações e inferir pressões seletivas que
geraram a diversidade biológica (Pizzato
Outro tipo de análise muito utilizada, prin- et al. 2007). Desta forma, estudar comple-
cipalmente em trabalhos de ontogenia e xos morfológicos em grupos monofiléticos
alometria, são as análises de Regressão de serpentes permite que as relações entre

60
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

morfologia e hábitos sejam avaliadas sob cia de estudos que abordem a morfologia
um contexto evolutivo (Martins et al. 2001; pós-craniana e a morfologia interna de
Pizzatto et al. 2007). maneira geral. Em suma, cada estudo nos
traz uma peça de um quebra-cabeça que
PERSPECTIVAS FUTURAS ainda está longe de ser totalmente monta-
do e, mesmo que um trabalho tenha um es-
copo bastante específico, na visão geral ele
Como pode ser notado, o número de estu-
pode trazer justamente a peça que faltava
dos de serpentes utilizando MG vem au-
para nos permitir avançar cada vez mais
mentando ao longo dos últimos anos e a
na compreensão deste grande e complexo
partir dos resultados oferecidos pelos mes-
grupo de animais.
mos é possível observar uma amplificação
das possibilidades de novas abordagens.
Os avanços tecnológicos e de conhecimen- AGRADECIMENTOS
to estão viabilizando o desenvolvimento
de novos programas computacionais e a Agradecemos a P. Passos e P. C. Paiva pelo
elaboração de análises que nos permitem apoio nas primeiras revisões. Ao Fábio A.
fazer perguntas cada vez mais complexas e Machado e mais um revisor anônimo pelos
levar em conta um número cada vez maior valiosos comentários sobre o artigo. NMS
de variáveis. Com tantas perspectivas, po- recebeu apoio financeiro da Coordenação
demos dizer que há espaço para diversos de Aperfeiçoamento de Pessoal de Nível Su-
pesquisadores explorarem as diferentes perior - Brasil (CAPES) - Código Financeiro
vertentes proporcionadas pela MG de ma- 001. RAMF foi apoiada pela Universidade
neira colaborativa e a soma de todos esses Federal de Mato Grosso do Sul e financiada
estudos permitirá uma melhor compreen- pela Coordenação de Aperfeiçoamento de
são da evolução, ecologia e morfologia das Pessoal de Nível Superior – Brasil (CAPES)
serpentes. Como primeiro passo para deli- – Código Financeiro 001. DSF agradece ao
mitação de um estudo de MG com serpen- Conselho Nacional de Desenvolvimento
tes, pode-se considerar grupos e comple- Científico e Tecnológico (CNPq) (processo
xos morfológicos ainda pouco explorados. 308567/2019-6), Coordenação de Aper-
Em relação aos grupos, algumas famílias feiçoamento de Pessoal de Nível Superior
de serpentes foram muito mais estudadas (CAPES) (processo 88887.159161/2017-
que outras e quando pensamos em táxons 00); e Fundação de Amparo à Pesquisa do
menos inclusivos - como tribos, gêneros e Estado do Rio de Janeiro (FAPERJ) (pro-
espécies – a carência de estudos e as pos- cesso E-26/211.154/2019).
sibilidades de abordagens utilizando MG
aumentam consideravelmente. Em rela-
ção aos complexos morfológicos, podemos
observar que ainda há uma grande carên-
61
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

REFERÊNCIAS Allemand R., Boistel R., Daghfous G.,


Blanchet Z., Cornette R., Bardet N.,
Abegg A.D., Passos P., Mario-da-Rosa Houssaye A. 2017. Comparative mor-
C., Azevedo W.S., Malta-Borges L., Bu- phology of snake (Squamata) endo-
badué J.M. 2020. Sexual dimorphism, casts: Evidence of phylogenetic and
ontogeny and static allometry of a se- ecological signals. Journal of Anatomy
mi-fossorial snake (genus Atractus). 231:849–868. doi:10.1111/ joa.12692
Zoologischer Anzeiger 287:95–104.
Andjelkovic M., Tomovic L., Ivanovic
A. 2016. Variation in skull size and sha-
Adams D.C., Rohlf F.J., Slice D.E. 2004. pe of two snake species (Natrix natrix
Geometric morphometrics: ten years of and Natrix tessellata). Zoomorpholo-
progress following the ‘revolution’. Ita- gy 135:243–253
lian Journal of Zoology 71:5–16.
Andjelkovic M., Tomovic L., Ivanovic A.
Adams D.C., Rohlf J.F., Slice D.E. 2013. 2017. Morphological integration of the
A field comes of age: geometric mor- kinetic skull in Natrix snakes. Journal
phometrics in the 21st century. Hys- of Zoology 303:188–198.
trix, the Italian Journal of Mammalo-
gy 24:7–14.
Barbo F.E., Gasparini J.L., Almeida
A.P., Zaher H., Grazziotin F., Gusmão
Adams D.C., Otárola-Castillo E., Sher- R.B., ... Sawaya R.J. 2016. Another new
ratt E. 2014. Geomorph: Software for and threatened species of lancehead
geometric morphometric analyses. R genus Bothrops (Serpentes, Viperidae)
package version 2.0. Disponível em: from Ilha dos Franceses, Southeastern
URL http://CRAN.Rproject.org/pa- Brazil. Zootaxa 4097:511–529.
ckage=geomorph.
Baum D., Mahlow K., Lamecker H., Za-
Akman G. 2019. Comparison of the chow S., Müller J., Hege H-C. 2014. The
Blind Snake Populations, Xerotyphlops Potential of Surface-based Geometric
vermicularis (Merrem, 1820) (Squama- Morphometrics for Evolutionary Stu-
ta: Typhlopidae) in Turkey and Cyprus: dies: An Example using Dwarf Snakes
Morphology, Serology, Ecology, and (Eirenis). Pp. 1–2 in Mallison H., Vogel
Geometric Morphometrics Comma- J., Belvedere M. (Eds.) Digital Speci-
gene Journal of Biology 3:6–18. doi: men Abstracts of Presentations. Mu-
10.31594/commagene.522170 seum für Naturkunde Berlin.

62
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

Belgheiszadeh H., Salemi A., Heydari Biology. Cambridge University Press.


N., Tahouri A., Tafreshi S. 2019. Geo- Cambridge.
metric morphometrics of the head sha-
pe of Pseudocerastes persicus (Dumé- Bookstein F.L. 1996. Biometrics, bio-
ril, Bibrón & Duméril, 1854) (Ophidia: mathematics and the morphometric
Viperidae) from central Iran. Journal synthesis. Bulletin of Mathematical
of Biological Studies 2:56–63. Biology 58:313–365.

Bell C.J., Mead J.I. 2014. Not Enough Bookstein F.L. 1997. Landmark me-
Skeletons in the Closet: Collections-Ba- thods for forms without landmarks:
sed Anatomical Research in an Age of Morphometrics of group differences in
Conservation Conscience. The Anato- outline shape. Medical Image Analysis
mical Record 297:344–348. 1:225–243.

Blackith R., Reyment R.A. 1971. Mul- Bookstein F.L., Chernoff B., Elder R.L.,
tivariate morphometrics. Academic Humphries J. M., Smith G.R., Strauss
Press, New York. R.E. 1985. Morphometrics in evolutio-
nary biology. Special publication. Aca-
Bookstein F.L. 1982. Foundations of demy of Natural Sciences Press, Phila-
Morphometrics. Annual Review of delphia.
Ecology and Systematics 13:451–470.
Cleuren S.G.C., Hocking D., Evans A.R.
Bookstein F.L. 1984. A Statistical Me- 2021. Fang evolution in venomous
thod for Biological Shape Compari- snakes: Adaptation of 3D tooth shape
sons. Journal of Theoretical Biology to the biomechanical properties of their
107:475–520. prey. Evolution 75: 1377–1394. doi: doi.
org/10.1111/evo.14239
Bookstein F.L. 1986. Size and Shape
spaces for landmark data in two dimen- Cohen C. 2004. Gould at D’arcy
sions. Statistical Science 1:181–242. Thompson. Comptes Rendus Palevol
3:421–431.
Bookstein, F.L. 1989. “Size and shape”.
A comment on semantics. Systematic Da Silva F.O., Fabre A.-C., Savriama Y.,
Zoology 38:173–190. Ollonen J., Mahlow K., Herrel A., ... Di-
-Poi N. 2018. The ecological origins of
Bookstein F.L. 1991. Morphometric To- snakes as revealed by skull evolution.
ols for Landmark Data: Geometry and Nature Communications 9:376.

63
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

Davis M.A., Douglas M.R., Collyer Fabre A-C, Bickford D., Segall M., Her-
M.L., Douglas M.E. 2016. Deconstruc- rel A. 2016. The impact of diet, habi-
ting a Species- Complex: Geometric tat use, and behaviour on head shape
Morphometric and Molecular Analyses evolution in homalopsid snakes. Bio-
Define Species in the Western Rattles- logical Journal of the Linnean Society
nake (Crotalus viridis). PLoS ONE 118:634–647.
11:e0146166. doi:10.1371/journal.
pone.0146166. Fernandes D.S., Marques O.A.V., Argô-
lo A.J.S. 2010. A new species of Dipsas
Drake A.G., Klingenberg C.P. 2010. Lar- Laurenti from the Atlantic Forest of
ge-scale diversification of skull shape in Brazil (Serpentes: Dipsadidae). Zoota-
domestic dogs: disparity and modulari- xa 2691:57–66.
ty. American Naturalist 175:289–301.
Fisher R.A. 1936. The use of multiple
Dryden I.L., Mardia K.V. 2016. Statisti- measurements in taxonomic problems.
cal Shape Analysis with Application in Annals of Eugenics 7:179–184.
R. Wiley, New York.
Fornel R., Cordeiro-Estrela P. 2012.
Esquerré D., Keogh J.S. 2016. Parallel Morfometria geométrica e a quantifica-
selective pressures drive convergent di- ção da forma dos organismos. Pp 101–
versification of phenotypes in pythons 120 in Marinho J.R., Hepp L.U., Fornel
and boas. Ecology Letters 19:800–809. R. (Orgs.). Temas Em Biologia: Edição
Comemorativa aos 20 anos do Curso de
Esquerré D., Sherratt E., Keogh J.S. Ciências Biológicas e aos 5 anos Do PP-
2017. Evolution of extreme ontogenetic G-Ecologia a URI Campus de Erechim.
allometric diversity and heterochrony EDIFAPES, Erechim.
in pythons, a clade of giant and dwarf
snakes. Evolution 71:2829–2844. Galán A.L. 2015. Morfometría geomé-
trica: el estudio de la forma y su apli-
Esquerré D., Donnellan S., Brennan cación en biologia. Temas de Ciencia y
I.G., Lemmon A.R., Lemmon E.M., Tecnología 19:53–59
Zaher H., Grazziotin F., Keogh J.S.
2020. Phylogenomics, biogeography, Galton F. 1888. Co-relations and their
and morphometrics reveal rapid phe- measurement, chiefly from anthropo-
notypic evolution in pythons after cros- metric data. Proceeding of the Royal
sing Wallace’s line. Systematic Biology Society of London 45:219–247
69:1039–1051.

64
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

Gentilli A., Cardini A., Fontaneto D., Hossie T.J., Sherratt T.N. 2014. Does
Zuffi M.A.L. 2009. The phylogenetic defensive posture increase mimetic fi-
signal in cranial morphology of Vipera delity of caterpillars with eyespots to
aspis: a contribution from geometric their putative snake models? Current
morphometrics. Herpetological Jour- Zoology 60:76–89.
nal 19:69–77
Humphries J.M., Bookstein F.L., Cher-
Goodall C.R. 1983. The statistical analy- noff B., Smith G.R., Elder R.L., Poss
sis of growth in two dimensions. PhD S.G. 1981. Multivariate discrimination
dissertation, Department of Statistics, by shape in relation to size. Systematic
Harvard University, USA. Zoology 30:291–308.

Green W.D.K. 1996. The thin-plate Jolicoeur P. 1959. Multivariate Geogra-


spline and images with curving featu- phical Variation in the Wolf Canis lu-
res. Pp. 79–87 in Mardia K.V., Gill C.A., pus L. Evolution 13:283–299.
Dryden I.L. (Eds), Proceedings in Ima-
ge Fusion and Shape Variability Tech- Jolicoeur P. 1963. The Multivariate Ge-
niques. Leeds University Press, Leeds. neralization of the Allometry Equation.
Biometrics 19:497–499.
Head J.J., Bloch J.I., Hastings A.K.,
Bourque J.R., Cadena E.A., Herre- Jolicoeur P., Mosimann J. 1960. Size
ra F.A., … Jaramillo C.A. 2009. Giant and shape variation in the painted turt-
boid snake from the Palaeocene neo- le. A principal component analysis.
tropics reveals hotter past equatorial Growth 24:339–354.
temperatures. Nature 457:715–717.
doi:10.1038/nature07671
Jungers W.L., Falsetti A.B., Wall C.E.
1995. Shape, relative size, and size-
Head J.J., Polly P.D. 2015. Evolution of -adjustments in morphometrics. The
the snake body form reveals homoplasy Yearbook of Physical Anthropology
in amniote Hox gene function. Nature 38:137–161.
520:86–89. doi:10.1038/ nature14042
Kendall D.G. 1977. The diffusion of
Henao-Duque A.M., Ceballos C.P. shape. Advances in Applied Probabili-
2013. Sex-related head size and shape ty 9:428–430.
dimorphism in Mapaná snakes (Bo-
throps asper) kept in captivity. Revis-
Kendall D.G. 1984. Shape manifolds,
ta Colombiana de Ciencias Pecuarias
procrustean metrics, and complex pro-
26:201–210.
65
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

jective spaces. Bulletin of the London applications. Symmetry 2015:847-934.


Mathematical Society 16: 81–121
Klingenberg C.P. 2016. Size, shape, and
Keates C., Conradie W., Greenbaum E., form: concepts of allometry in geome-
Edwards S. 2019. A snake in the grass: tric morphometrics. Development Ge-
Genetic structuring of the widespread nes and Evolution 226:113–137.
African grass snake (Psammophylax
Fitzinger 1843), with the description of Klingenberg C.P. 2020. Walking on
a new genus and a new species. Journal Kendall’s shape space: Understanding
of Zoological Systematics and Evolu- shape spaces and their coordinate sys-
tionary Research 57:1039–1066 tems. Evolutionary Biology 47:334–
352. doi:10.1007/s11692-11020-
Klaczko J., Sherratt E., Setz E.Z.F. 09513-x
2016. Are Diet Preferences Associa-
ted to Skulls Shape Diversification Klingenberg C.P., Mcintyre, G.S. 1998.
in Xenodontine Snakes? PLoS ONE Geometric morphometrics of develop-
11: e0148375. doi:10.1371/journal. mental instability: analyzing patterns
pone.0148375 of fluctuating asymmetry with Procrus-
tes methods. Evolution 52:1363–1375.
Klingenberg C.P. 1998. Heterochrony
and allometry: the analysis of evolu- Klingenberg C.P., Barluenga M., Meyer
tionary change in ontogeny. Biological A. 2002. Shape analysis of symme-
Reviews 73:79–123. tric structures: quantifying variation
among individuals and asymmetry.
Klingenberg C.P. 2011. MorphoJ: an Evolution 56:1909–1920.
integrated software package for geo-
metric morphometrics. Molecular Eco- Klingenberg C.P., Marugán-Lobón J.
logy Resources 11:353–357. 2013. Evolutionary covaration in geo-
metric morphometric data: analyzing
Klingenberg C.P. 2013. Visualizations integration, modularity, and allometry
in geometric morphometrics: how to in phylogenetic context. Systematic
read and how to make graphs showing Biology 62:591–610.
shape changes. Hystrix 24:15–24.
Lawing A.M., Polly P.D. 2010. Geome-
Klingenberg C.P. 2015. Analyzing fluc- tric morphometrics: recent applications
tuate asymmetry with geometric mor- to the study of evolution and develop-
phometrics: concepts, methods, and ment. Journal of Zoology 280:1–7.

66
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

Lillywhite H.B. 2014. How snakes Manier M.K. 2004. Geographic varia-
work: structure, function, and beha- tion in the long-nosed snake Rhino-
vior: of world’s snakes. Oxford Univer- cheilus lecontei (Colubridae): Beyond
sity Press, New York. the subspecies debate. Biological Jour-
nal of the Linnean Society 83:65–85.
Linnaeus C. 1758. Systema naturæ per
regna tria naturæ, secundum classes, Marcus L.F. 1990. Traditional mor-
ordines, genera, species, cum charac- phometrics. Pp 77–122 in Rohlf F.J.,
teribus, differentiis, synonymis, locis. Bookstein F.L. (Eds), Proceedings of the
Tomus I. Editio decima, reformata. Michigan morphometrics workshop.
Laurentii Salvii, Holmiæ, Stockholm. University of Michigan Museum of Zo-
ology. Ann Arbor, Michigan.
Loebens L., Hendges C.D., Almei-
da-Santos S.M., Cechin S.Z. 2019. Marcus L.F., Bello E., Garcia-Valdeca-
Morphological variation and sexu- sas A. 1993. Contributions to Morpho-
al dimorphism in two sympatric dip- metrics. Monografias, Museo Nacional
sadine snakes from Southern Brazil. de Ciencias Naturales, Consejo Supe-
Zoologischer Anzeiger 280:42–51. rior de Investigaciones Cientificas, Ma-
doi:10.1016/j.jcz.2019.03.004. drid.

Lucchini N., Kaliontzopoulou A., Val Marcus L.F., Corti M., Loy A., Naylor G.
G.A., Martínez-Freiría F. 2020. Sour- J.P., Slice D.E. 1996. Advances in Mor-
ces of intraspecific morphological va- phometrics. NATO ASI series A: Life
riation in Vipera seoanei: allometry, Sciences, Plenum Press, New York.
sex, and colour phenotype. Amphibia-
-Reptilia 2020:1–16 Martins M., Araújo M.S., Sawaya R.J.,
Nunes R. 2001. Diversity and evolu-
Machado A.C., Silva M.A., Filho R.D.T., tion of macrohabitat use, body size and
Pfeil M.S., Lima I., Lopes R.T. 2015. 3D morphology in a monophyletic group
investigation of steel fiber distribution on Neotropical pitvipers (Bothrops).
in reinforced concrete by X-ray micro- Journal of Zoology 254:529–538.
tomography. Revista IBRACON de Es-
truturas Materiais 8:707–720. Mcnulty K.P., Vinyard C.J. 2015. Mor-
phometry, Geometry, Function, and
Mangiacotti M., Limongi L., Sanno- the Future. The Anatomical Record
lo M., Sacchi R., Zuffi M.A.L., Scali S. 298:328–333.
2014. Head shape variation in eastern
and western Montpellier snakes. Acta
Herpetologica 9: 167–177 67
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

Meik J.M., Setser K., Mociño-Deloya E., Mosimann J.E. 1970. Size allometry:
Lawing A.M. 2012. Sexual differences size and shape variables with characte-
in head form and diet in a population rizations of the lognormal and genera-
of Mexican lance-headed rattlesnakes lized gamma distributions. Journal of
Crotalus polystictus. Biological Jour- the American Statistical Association
nal of the Linnean Society 106:633– 65:930–945.
640.
Murta-Fonseca R.A., Fernandes D.S.
Mezzasalma M., Dallasta A., Loy A., 2016. The skull of Hydrodynastes gi-
Cheylan M., Lymberakis P., Zuffi M.A., gas (Duméril, Bibron & Duméril, 1854)
… Guarino F.M. 2015. A sisters’ story: (Serpentes: Dipsadidae) as a model of
comparative phylogeography and taxo- snake ontogenetic allometry inferred
nomy of Hierophis viridiflavus and H. by geometric morphometrics. Zoomor-
gemonensis (Serpentes, Colubridae). phology 132:33–241. doi: 10.1002/
Zoologica Scripta 44:495–508. ar.22852.

Mitteroecker P., Gunz P. 2009. Advan- Murta-Fonseca R.A., Machado A, Lo-


ces in Geometric Morphometrics. Evo- pes R.T., Fernandes D.S. 2019. Sexu-
lutionary Biology 36:235–247. al dimorphism in Xenodon neuwie-
dii skull revealed by geometric
Monteiro L.R., Reis S.F. 1999. Princí- morphometrics (Serpentes, Dipsadi-
pios de morfometria geométrica. Holos dae). Amphibia-Reptilia 40: 461-474.
Editora, Ribeirão Preto, São Paulo. doi:10.1163/15685381-20191147.

Moreno-Barajas R., Rodríguez-Rome- Oxnard, C.E. 1978. One biologist’s view


ro F., Valázquez-Rodríguez A., Aragón- of morphometrics. Annual Review of
-Martínez A. 2013. Variación geográfi- Ecology and Systematics 9:219–241.
ca en Phrynosoma orbiculare (Sauria:
Phrynosomatidae): análisis de las su- Palci A., Lee, M.S., Hutchinson M.N.
bespecies. Acta Zoológica Mexicana 2016. Patterns of postnatal ontogeny
29:129–143. of the skull and lower jaw of snakes as
revealed by micro-CT scan data and
Moshtaghie M., Kaboli M., Salehi M. three-dimensional geometric morpho-
2018. Geometric morphometric analy- metrics. Journal of Anatomy 229:723–
sis of head shape in a spotted whip 754.
snake (Hemorrhois ravergieri) in di-
fferent habitats of iran. Acta Medica Palci A., Hutchinson M.N., Caldwell
Mediterranea 34:583–589. M.W., Lee M.S.Y. 2017. The morpholo-
68
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

gy of the inner ear of squamate reptiles of the Linnean Society 118:873–888.


and its bearing on the origin of snakes.
Royal Society Open Science 4:170685. Rajabizadeh M., Wassenbergh S., Mal-
let C., Rücklin M., Herrel A. 2020. Too-
Palci A., Hutchinson M.N., Caldwell th Shape Adaptations in Aglyphous
M.W., Scanlon J.D., Lee M.S.Y. 2018. Colubrid Snakes Inferred from 3D Ge-
Palaeoecological inferences for the fos- ometric Morphometrics and Finite Ele-
sil Australian snakes. Yurlunggur and ment Analysis. Biological Journal of
Wonambi (Serpentes, Madtsoiidae). the Linnean Society 191:454–467.
Royal Society Open Science 5:172012.
Reyment R.A. 1991. Multidimensional
Palci A., Lee M.S.Y. 2018. Geometric paleobiology. Pergamon Press, New
morphometrics, homology and cladis- York.
tics: Review and recommendations.
Cladistics 35:230–242. doi: 10.1111/ Reyment R.A. 1996. An idiosyncra-
cla.12340. tic history of early morphometrics. Pp
15–22 in Marcus L.F., Corti M., Loy
Passos P., Fernandes R. 2008. Revi- A., Naylor G.J.P., Slice D.E. Advances
sion of the Epicrates cenchria complex in Morphometrics. NATO ASI series A:
(Serpentes: Boidae). Herpetological Life Sciences. 284. Plenum Press, New
Monographs 22:1–30. York.

Pearson K. 1901. On lines and planes of Reyment R.A. 2010. Morphometrics:


closest fit to systems of points in space. an historical essay. Pp 9–24 in Elewa
Philosophical Magazine 2:559-572. A.M.T. (Ed.). Morphometrics for non-
morphometricians. Springer-Verlag,
Pizzatto L., Almeida-Santos S.M., Shi- New York.
ne R. 2007. Life history adaptations to
arboreality in snakes. Ecology 88:359– Rhoda R., Polly D., Raxworthy C., Se-
366. gall M. 2020. Morphological Integra-
tion and Modularity in the Hyperkine-
Pokrant F., Kindler C., Ivanov M., tic Feeding System of Aquatic-foraging
Cheylan M., Geniez P., Böme W., Fritz Snakes. Evolution 75: 56–72.
U. 2016. Integrative taxonomy provi-
des evidence for the species status of Rohlf F.J. 1990. Morphometrics. An-
the Ibero-Maghrebian grass snake Na- nual Review of Ecology and Systema-
trix astreptophora. Biological Journal tics 21:299–316.

69
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

Rohlf F.J. 2003. tpsRelw, Versão 1.37. dipsadinae). Zoology 120:24–30. doi:
Disponível em: http://life.bio.sunysb. 10.1016/j.zool.2016.09.003.
edu/morph
Sarris I., Marugán-Lobón J., Chame-
Rohlf F. J., Bookstein F. L. 1987. A ro B., Buscalioni A.D. 2012. Shape va-
comment on shearing as a method for riation and allometry in the precloacal
“size correction.” Systematic Zoology vertebral series of the snake Daboia
36:356–367. russelli (Viperidae). International
Journal of Morphology 30:1363–1368.
Rohlf F.J., Bookstein F.L. 1990. Proce-
edings of the Michigan morphometrics Segall M., Cornette R., Fabre A-C., Go-
workshop. Ann Arbor: The University doy-Diana R., Herrel A. 2016. Does
of Michigan Museum of Zoology Spe- aquatic foraging impact head sha-
cial Publication 2:147–166. pe evolution in snakes? Proceedings
of the Royal Society 283:20161645.
Rohlf F.J., Slice D. 1990. Extensions of doi:10.1098/rspb.2016.1645.
the Procrustes method for the optimal
superimposition of landmarks. Syste- Segall M., Herrel A., Godoy-Diana R.
matic Zoology 39:40–59. 2019. Hydrodynamics of frontal stri-
king in aquatic snakes: drag, added
Rohlf F.J., Marcus L.F. 1993. A revolu- mass, and the possible consequences
tion in morphometrics. Trends in Eco- for prey capture success. Bioinspira-
logy and Evolution 8:129–132. tion & Biomimetics 14:036005.

Ruane S. 2015. Using geometric mor- Segall M., Cornette R., Godoy-Diana R.,
phometrics for integrative taxonomy: Herrel A. 2020. Exploring the functio-
an examination of head shapes of nal meaning of head shape disparity in
milksnakes (genus Lampropeltis). Zo- aquatic snakes. Ecology and Evolution
ological Journal of the Linnean Socie- 10:6993–7005.
ty 174:394–413.
Sherratt E., Sanders K.L., Watson A.,
Santos M.M., Da Silva F.M., Hingst- Hutchinson M.N, Lee M.S.Y., Pal-
-Zaher E., Machado F.A., Zaher H.E.D., ci A. 2019. Heterochronic Shifts Me-
Prudente A.L.D.C. 2017. Cranial adap- diate Ecomorphological Convergence
tations for feeding on snails in spe- in Skull Shape of Microcephalic Sea
cies of Sibynomorphus (Dipsadidae: Snakes. Integrative and Comparative
Biology 59:616–624. doi: 10.1093/icb/
icz033.
70
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

Showalter I., Todd B.D., Brennan P.L.R. morphology by diet manipulation. Jour-
2014. Intraspecific and interspecific va- nal of Morphology 275:1339–1348.
riation of female genitalia in two spe-
cies of watersnake. Biological Journal Souto N.M., Pinna P.H., Machado A.S.,
of Linnean Society 111:183–191 Lopes R.T. 2017. New records, mor-
phological variation, and description
Silva F.M., Oliveira L.S., Nascimen- of the skull of Liophis dorsocorallinus
to L.R., Machado F.A., Prudente A.L. Esqueda, Natera, La Marca and Ilija-
2017. Sexual dimorphism and ontoge- -Fistar, 2005 (Serpentes: Dipsadidae).
netic changes of Amazonian pitvipers Herpetological Review 48:532–537.
(Bothrops atrox). Zoologischer Anzei-
ger 271:15–24. Souto N.M, Murta-Fonseca R.A., Ma-
chado A.S., Lopes R.T., Fernandes D.S.
Silva F.M., Prudente A.L.C., Machado 2019. Snakes as a model for measuring
F.A., Santos M.M., Zaher H., Hingst- skull preparation errors in geometric
-Zaher E. 2018. Aquatic adaptations morphometrics. Journal of Zoology
in a Neotropical coral snake: a study of 309:12–21.
morphological convergence. Journal of
Systematic and Evolutionary Resear- Sundberg P. 1989. Shape and size-cons-
ch 56:382–394. trained principal component analysis.
Systematic Zoology 38: 166-168.
Slice D. 2001. Landmark Coordinates
Aligned by Procrustes Analysis Do Not Strauss R.E., Bookstein F.L. 1982. The
Lie in Kendall’s Shape Space. Systema- truss body form reconstructions in
tic Biology 50:141–149. morphometrics. Systematic Zoology
31:113–135.
Smith M.T., Collyer M.L. 2008. Regio-
nal variation and sexual dimorphism Tamagnini D., Stephenson J., Brown
in head form of the prairie rattlesnake R.P., Meloro C. 2018. Geometric mor-
(Crotalus viridis viridis): comparisons phometric analyses of sexual dimor-
using new analytical techniques and phism and allometry in two sympatric
collection methods. Pp 79–90 in Hayes snakes: Natrix helvetica (Natricidae)
W.K, Beaman K.R, Cardwell M.D, Bush and Vipera berus (Viperidae). Zoology
S.P. (Eds). The biology of rattlesnakes. 129:25–34.
Loma Linda Press, California.
Teissier G. 1938. Un essai d’analyse fac-
Smith M.T. 2014. Induction of pheno- torielle. Les variants sexuels de Maia
typic plasticity in rattlesnake trophic squinada. Biotypologie 7:73–96.
71
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

Thompson D’A.W. 1917. On growth and Zaher H. 1999. Hemipenial morpho-


form. University press, Cambridge. logy of the South American xenodon-
tines snakes, with a proposal for a
Thorpe R.S. 1975. Quantitative han- monophyletic Xenodontinae and a re-
dling characters useful in snake sys- appraisal of colubroid hemipenes. Bul-
tematics with particular reference to letin of the American Museum of Natu-
intraspecific variation in the Ringed ral History 240:1–168.
Snake Natrix natrix. Biological Jour-
nal of Linnean Society 7:27–43. Zelditch M.L., Swiderski D.L., Sheets
H.D. 2004. Geometric morphometrics
Yi H., Norell M.A. 2015. The burrowing for biologists: A primer. Elsevier Aca-
origin of modern snakes. Science Ad- demic Press, San Diego.
vances 1:e1500743.
Editor: Alexandro Tozetti

Micrurus pyrrhocryptus
Villa de las rosas - Cordoba, Argentina
@Francisco Brito

72
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

Apêndice I: Tabela com trabalhos publicados que utilizaram as técnicas da MG no


estudo de Serpentes, separados por ano de publicação, temas abordados e estrutura
utilizada.

Autor Ano Tema Estrutura

Manier 2004 ● Delimitação de espécies; Morfologia externa


● Dimorfismo sexual; da cabeça
● Morfologia e habitat

Smith & Collyer 2008 ● Dimorfismo sexual; Morfologia externa


● Variação morfológica in- da cabeça
traespecifica

Gentilli et al. 2009 ● Delimitação de espécies Crânio

Head et al. 2009 ● Evolução da forma do corpo; Vértebras


● Morfologia e habitat

Lawing & Polly 2010 ● Metodologia MG Vértebras

Sarris et al. 2012 ● Alometria estática; Vértebras


● Variação morfológica in
traespecífica

Meik et al. 2012 ● Dimorfismo sexual; Morfologia externa


● Morfologia e dieta da cabeça

Henao-Duque 2013 ● Dimorfismos sexual Morfologia externa


da cabeça
& Ceballos
Moreno- 2013 ● Delimitação de espécies Morfologia externa
da cabeça
Barajas et al.
Baum et al. 2014 ● Metodologia MG Crânio

Hossie & 2014 ● Mimetismo Morfologia externa


da cabeça
Sherratt
Mangiacotti et al. 2014 ● Delimitação de espécies Morfologia externa
da cabeça

Showalter et al. 2014 ● Delimitação de espécies; Genitália feminina


● Variação morfológica in
traespecifica

Smith 2014 ● Morfologia e dieta Morfologia externa


da cabeça

Head & Polly 2015 ● Evolução da forma Vértebras


do corpo
73
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

Mezzasalma 2015 ● Delimitação de espécies Morfologia externa


da cabeça
et al.
Ruane 2015 ● Delimitação de espécies Morfologia externa
da cabeça

Yi & Norell 2015 ● Morfologia e habitat; Ouvido interno


● Origem de Serpentes

Andjelkovic 2016 ● Alometria estática; Crânio


● Dimorfismo sexual;
et al.
● Morfologia e dieta

Barbo et al. 2016 ● Delimitação de espécies Morfologia externa


da cabeça

Davis et al. 2016 ● Delimitação de espécies Morfologia externa


da cabeça

Esquerré & 2016 ● Morfologia e habitat Morfologia externa


da cabeça
Keogh
Fabre et al. 2016 ● Morfologia e dieta; Morfologia externa
● Morfologia e habitat da cabeça

Klaczko et al. 2016 ● Morfologia e dieta Crânio

Murta-Fonseca 2016 ● Ontogenia Crânio


& Fernandes
Palci et al. 2016 ● Ontogenia Crânio

Pokrant et al. 2016 ● Delimitação de espécies Vértebras

Segall et al. 2016 ● Morfologia e uso do habitat Morfologia externa


da cabeça

Santos et al. 2017 ● Morfologia e dieta Crânio

Allemand 2017 ● Morfologia e uso do habitat Crânio


et al.
Andjelkovic 2017 ● Morfologia e dieta Crânio
et al.
Silva et al. 2017 ● Dimorfismo sexual; Morfologia externa
● Ontogenia da cabeça

74
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

Equerré et al. 2017 ● Ontogenia Morfologia externa


da cabeça

Palci et al. 2017 ● Morfologia e habitat; Ouvido interno


● Origem de Serpentes

Moshtaghie 2018 ● Morfologia e habitat Morfologia externa


da cabeça
et al.
Palci et al. 2018 ● Morfologia e habitat Ouvido interno

Da Silva et al. 2018 ● Morfologia e dieta; Crânio


● Origem de Serpentes

Palci & Lee 2018 ● Metodologia MG Crânio

Silva et al 2018 ● Morfologia e dieta; Crânio


● Morfologia e habitat

Tamagnini 2018 ● Alometria estática; Morfologia externa


● Dimorfismo sexual da cabeça
et al.
Akman & 2019 ● Delimitação de espécies Morfologia externa
da cabeça
Goçomem
Belgheiszadeh 2019 ● Delimitação de espécies Morfologia externa
da cabeça
et al.
Keates et al. 2019 ● Delimitação de espécies Morfologia externa
da cabeça

Loebens et al. 2019 ● Dimorfismo sexual Morfologia externa


da cabeça

Murta-Fonseca 2019 ● Dimorfismo sexual Crânio


et al.
Segall et al. 2019 ● Morfologia e habitat Morfologia externa
da cabeça

Sherratt et al. 2019 ● Morfologia e dieta Crânio

Souto et al. 2019 ● Metodologia MG Crânio

Rajabizadeh 2020 ● Morfologia e dieta Dente


et al.
Abegg et al. 2020 ● Alometria estática; Morfologia externa
● Dimorfismos sexual; da cabeça
● Ontogenia

75
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

Esquerré et al. 2020 ● Morfologia e habitat Morfologia externa


da cabeça

Lucchini et al. 2020 ● Dimorfismo sexual; Morfologia externa


● Ontogenia; da cabeça
● Variação morfológica
intraespecifica;

Rhoda et al. 2020 ● Morfologia e dieta Crânio

Segall et al. 2020 ● Morfologia e dieta; Morfologia externa


● Morfologia e habitat da cabeça

Cleuren et al. 2021 ● Morfologia e dieta Dente

76
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

Métodos para detecção de Ranavirus (Iridoviridae) em


anfíbios
Joice Ruggeri1*, Angélica de Almeida e Silva1, Marcelo Candido2, Ricardo L. M.
Sousa2, Luís Felipe Toledo1

1 Laboratório de História Natural de Anfíbios Brasileiros, Departamento de


Biologia Animal, Instituto de Biologia, Universidade Estadual de Campinas,
13083-862 Campinas, SP, Brasil.
2 Laboratório de Higiene Zootécnica, Departamento de Medicina Veterinária,
Faculdade de Zootecnia e Engenharia de Alimentos, Universidade de São Pau-
lo, 13635-900 Pirassununga, SP, Brasil.
*Autor correspondente: E-mail: joice.ruggeri@gmail.com
DOI: 10.5281/zenodo.5211381

RESUMO

Dentre os muitos fatores que im- Batrachochytrium salamandri-


pactam negativamente a biodi- vorans) e os vírus do gênero Ra-
versidade mundial (como desma- navirus. Os vírus do gênero Ra-
tamento, poluição e aquecimento navirus constituem uma ameaça
global), as doenças infecciosas não somente aos anfíbios, mas
são consideradas um grande pro- também aos peixes e répteis, e já
blema para a conservação da flora foram relacionados a eventos de
e fauna. Principalmente em rela- mortalidade em massa de indiví-
ção aos anfíbios, que constituem duos desses grupos em diversos
o grupo de vertebrados mais ame- países. A recente descoberta des-
açado da atualidade, as doenças se vírus em populações naturais
infecciosas já foram responsáveis de anfíbios no Brasil despertou
por declínios e extinções de popu- o nosso interesse em apresentar
lações naturais em todos os con- uma revisão de protocolos para
tinentes. Os principais patógenos a detecção do Ranavirus a fim de
conhecidos até o momento que incentivar pesquisadores a rea-
apresentam maior impacto sobre lizar diagnósticos de ranavirose
esse grupo são os dois fungos cau- em vertebrados ectotérmicos, em
sadores da quitridiomicose (Ba- especial anfíbios.
trachochytrium dendrobatidis e
77
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

INTRODUÇÃO

A
ranavirose é uma doença recebe esse nome por ser causada por
infecciosa emergente com agentes virais grandes de DNA (entre
rápida disseminação e alta 120 e 200 nm) do gênero Ranavirus
letalidade que acomete os vertebrados (Rv), da família Iridoviridae (Chinchar
ectotérmicos (peixes, anfíbios e rép- 2002), sendo atualmente divididos em
teis), sendo cada vez relatada com mais dois grupos: i) os Rv associados aos an-
frequência (Mazzoni et al. 2009; Duf- fíbios (AARVs – Amphibian-associa-
fus et al. 2015). Essa combinação entre ted ranaviruses) que também podem
gravidade e aumento no número de ca- infectar répteis, incluem as linhagens
sos tornou obrigatória a sua notificação Frog virus 3 (FV3-like), Ambystoma
à Organização Mundial de Saúde Ani- tigrinum virus (ATV-like) e Common
mal (OIE; Schloegel et al. 2009). No midwife toad virus (CMTV-like), e ii)
Brasil, a notificação deve ser feita di- os Rv associados aos peixes: Grouper
retamente ao Ministério da Agricultu- iridovirus (GIV-like), European catfish
ra, Pecuária e Abastecimento (MAPA) virus (ECV-like) e Epizootic haema-
que através do Serviço Veterinário Ofi- topoietic necrosis virus (EHNV-like)
cial (SVO) investiga o caso e repassa os (Jancovich et al. 2015; Price et al. 2016;
dados à OIE (MAPA 2020). A doença Candido et al. 2019; Fig. 1).

Figura 1. Relações filogenéticas dos grupos de espécies de Ranavirus (baseada em Candido et al.
2019). AARV (Amphibian-associated ranaviruses) se refere ao grupo dos Ranavirus associados
aos anfíbios.

78
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

A linhagem FV3 e similares (FV3-li- anormal do animal, como natação er-


ke) apresentam distribuição global e rática e perda de flutuabilidade (Miller
já foram responsáveis por declínios de et al. 2015). Alguns espécimes também
peixes, anfíbios e répteis, tanto em ca- podem apresentar distensão abdomi-
tiveiro quanto em ambientes naturais nal, cor pálida e enfraquecimento dos
(Duffus et al. 2015). No Brasil, o Rv foi membros. Animais com sistema imune
relacionado com eventos de mortali- comprometido costumam desenvolver
dade em massa de girinos de rã-touro, a doença rapidamente, principalmente
Aquarana catesbeiana (Shaw, 1802), durante o estágio larval e durante a me-
em ranários (Galli et al. 2006; Mazzoni tamorfose (Mazzoni et al. 2009). Como
et al. 2009; Candido et al. 2019) e em os sintomas não são exclusivos da do-
populações selvagens no sul da Mata da ença causada por Rv, recomenda-se
Atlântica (Ruggeri et al. 2019). que o diagnóstico visual é um método
que deve ser confirmado com um exa-
Existem diferentes métodos utilizados me mais assertivo. Porém, é de extre-
para a detecção de Rv, incluindo detec- ma importância que qualquer animal
ções histológicas, e moleculares tan- que apresente esses sinais clínicos seja
to por reação em cadeia da polimera- isolado do restante da população sem-
se (PCR) convencional como por PCR pre que possível (Pessier & Mendelson
quantitativo em tempo real (qPCR). 2010).
Com o objetivo de incentivar a inves-
tigação do Rv em espécies da herpe-
tofauna brasileira, apresentamos aqui
um resumo dos protocolos mais utiliza-
dos para a detecção de Rv em anfíbios
(AARVs), bem como uma comparação
entre os métodos (Tab. 1). Ainda, apre-
sentamos reagentes alternativos para o
protocolo de Candido & Sousa (2018;
Tab. 2).

MÉTODOS DIAGNÓSTICOS
Métodos não invasivos: diagnós-
tico visual
Figura 2. Indivíduo de Pelophylax perezi co-
Os sinais clínicos da infecção por Rv letado na Serra das Estrelas, Portugal, apre-
em anfíbios consistem principalmente sentando sinais clínicos no focinho da doença
em lesões na pele, hemorragia inter- causada pelos Ranavirus.
na, eritema (Fig. 2) e comportamento Foto: João Martins.
79
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia
Métodos invasivos: não letais Amostras de cauda de girinos

Utilizam-se como formas não letais de Com uma tesoura esterilizada, corta-
diagnóstico do Rv, principalmente, a -se cerca de 0.5 a 1 cm da extremidade
coleta da ponta de dedo ou artelho (ar- distal da cauda do girino, que deve ser
ticulação de falanges), cauda de girinos, armazenada em um microtubo estéril,
amostras de sangue, e de secreção a par- preferencialmente em temperatura de
tir do suabe da região da cloaca, cavida- -80 °C até a extração do DNA (Gray et
de oral ou lesões na pele (Pessier & Men- al. 2012), ou em microtubo estéril con-
delson III 2010; Gray et al. 2012; Miller tendo etanol 70% em temperatura am-
et al. 2015). A coleta dessas amostras, biente.
abaixo descritas, deve ser realizada com
cautela para evitar contaminação cruza- Amostras de sangue
da entre as amostras, sendo imprescin-
A coleta de amostra de sangue é feita
dível a troca de luvas entre o manuseio
por punção da veia abdominal ou cardí-
dos animais. Além disso, todos os ins-
aca do animal utilizando agulha de cali-
trumentos envolvidos nesses processos
bre 25G (0.5 mm; Pessier & Mendelson
de manuseio devem ser esterilizados
2010). A amostra sanguínea deve ser
com imersão em álcool P.A., seguido de
imediatamente inserida em um cartão
exposição à uma chama aberta (Forzán
FTA (qualquer marca), onde será trans-
& Wood 2013), ou por imersão em de-
portado até o laboratório.
sinfetante Virkon S a 1% por, no míni-
mo, 20 minutos (Bryan et al. 2009). Es- Amostras coletadas por suabes
sas amostras podem ser testadas para a
presença do Rv por sorologia (amostras O suabe deve ser passado nas regiões
de sangue) ou a partir de técnicas mo- alvo, rodando suavemente o suabe na
leculares, como PCR ou qPCR. Porém, cavidade oral ou cloacal por 3 a 5 se-
essas técnicas podem gerar falsos nega- gundos, ou esfregada de forma cuida-
tivos e, portanto, é indicado que elas se- dosa na lesão. O mesmo suabe pode ser
jam utilizadas de forma complementar utilizado para a região bucal e cloacal
umas com as outras no mesmo indiví- do mesmo indivíduo (Goodman et al.
duo (Gray et al. 2012). 2013). Cada suabe deve ser mantido em
um microtubo estéril com etanol abso-
Amostras de falanges luto (99.5%) em temperatura ambiente
ou em um microtubo estéril a seco em
A coleta é realizada amputando-se um temperatura de -20 °C, até extração do
dígito do animal com auxílio de pinça e DNA em laboratório (Miller et al. 2015).
tesoura esterilizados. Cada amostra deve
ser armazenada em um microtubo estéril
contendo etanol 70% (Miller et al. 2015).
80
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia
TÉCNICAS MOLECULARES mente dados de ocorrência da infecção)
do DNA viral na amostra analisada. Por
As técnicas moleculares para detecção outro lado, quando o objetivo é o pos-
do Rv em amostras provenientes do terior sequenciamento da região alvo
hospedeiro utilizam marcadores mole- do vírus, a técnica comumente utiliza-
culares para a amplificação parcial do da para a obtenção do produto é o PCR
gene que codifica a proteína principal convencional.
do capsídeo (Major Capsid Protein:
MCP). Essa é uma região conservada PCR Convencional (PCR)
entre as espécies do gênero Ranavirus
e, portanto, permite a detecção do ví- Existem diversos protocolos para a
rus independentemente da linhagem. detecção de Rv por PCR convencio-
Porém, a região alvo do gene MCP e os nal (e.g. Mao et al. 1997; Mazzoni et
oligonucleotídeos (primers) utilizados al. 2009) e deve-se ter em mente que
na amplificação parcial desse gene va- a temperatura de anelamento (Ta) dos
primers à sequência de DNA alvo pode
riam entre os protocolos, que apresen-
variar de acordo com os oligonucleo-
tam produtos de diferentes tamanhos e
tídeos utilizados (Tab. 3). Destacamos
sequências de nucleotídeos (Mao et al.
o protocolo de Mazzoni et al. (2009),
1997; Allender et al. 2013).
pois foi desenvolvido a partir da linha-
gem FV3-like isolada durante um even-
Para a detecção quantitativa do vírus to de mortalidade em massa de girinos
nas amostras, utiliza-se a técnica da re- de rã-touro em ranário brasileiro. Esse
ação em cadeia da polimerase em tem- protocolo utiliza primers desenhados
po real (qPCR), na qual a maioria dos para amplificar 1483 pares de base (pb)
protocolos conhecidos envolve o uso do gene MCP dessa linhagem FV3-like
de uma sonda TaqMan (Pallister et al. (Tab. 3), e 233 pb do gene DNA-depen-
2007; Allender et al. 2013; Kolby et al. dente da RNA polimerase II (Pol-III
2014; Warne et al. 2016; Leung et al. primer senso: TCACCGCCGCAGACA-
2017), embora também existam proto- TCTTTAG; primer anti-senso: GTAAC-
colos que utilizam o corante SYBR Gre- CGTTCTTTTCGCAGTGG).
en (Jaramillo et al. 2012). Ainda que
nenhuma dessas técnicas moleculares Cada reação utiliza entre 1 e 5 µL do
permita identificar se o vírus está ativo DNA da amostra, 12.5 µL do reagen-
dentro do hospedeiro, o uso do qPCR é te GoTaq® DNA Polymerase (Pro-
vantajoso em relação ao PCR conven- mega, EUA), 1.0 µL de cada primer a
cional, pois permite a quantificação de 10 µM, e água ultrapura até completar
cópias virais (i.e., fornece dados de car- o volume de 25 µL. As condições de ter-
ga viral), enquanto o PCR convencional mociclagem utilizadas neste protocolo
somente permite a detecção (i.e., so- são: uma etapa de pré-aquecimento em
81
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

Tabela 1. Comparação entre os métodos comumente utilizados para detecção de


Ranavirus em amostras biológicas.

Histologia PCR
qPCR
convencional

Protocolo HE Taq polimerase SYBR green TaqMan

Tipo de amos- Tecido Cultura do vírus / Cauda / Falange / Cauda / DNA am-
tra biológica DNA ambiental / San- Sangue / Secreção biental / Falange /
gue / Tecido (cloaca, oral, lesão) / Sangue / Secreção
Tecido (cloaca, oral, lesão)
/ Tecido

Extração de Não Sim Sim Sim


DNA

Quantificação Não Não Sim Sim


do DNA alvo

Número de ~ 150 amos- Até 94 amostras (sim- Até 188 amostras Até 188 amostras
amostras tras por bloco plicata) + NTC + con- (duplicata) + NTC + (duplicata) + NTC +
de parafina/ trole positivo controle positivo controle positivo
resina

Custo* ~ USD 12.00 ~USD 3.00 por amos- ~ USD 10.42 por ~ USD 11.35 por
por bloco tra + valor extração amostra + valor amostra + valor
(múltiplos DNA extração DNA extração DNA
cortes)

Vantagens Não necessita Permite sequencia- Quantificação em Alta confiabilidade


extrair o DNA mento do produto de tempo real devido ao uso da
PCR sonda; quantifica-
ção em tempo real

Desvantagens Somente post- Não permite quanti- Inespecífico (se liga Custo alto devido ao
-mortem; não ficação viral na amos- a qualquer molécula uso de sonda fluo-
possibilita tra; a visualização dos de DNA); formação rescente; necessita
quantificação resultados é feita por de dímeros de pri- extração de DNA
do DNA alvo eletroforese mers

*O custo por reação para cada método foi calculado em dólares americanos (taxa de
conversão BRL 5: USD 1) considerando o valor médio dos reagentes e material de con-
sumo utilizados.

82
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

105 °C seguida de 2 minutos a 95 °C. se ligam ao segmento alvo, elas emitem


Para os primers MCP devem-se utilizar luz. Já o corante SYBR Green é detec-
40 ciclos de: 60 segundos a 95 °C (des- tado quando ocorre a amplificação do
naturação), seguido por 60 segundos a DNA reconhecido pelos primers utili-
60 °C (anelamento), e 90 segundos a zados na reação. Em ambos os casos, a
72 °C (extensão). Já para os primers luz emitida é acumulada ao longo dos
Pol-II, deve-se utilizar 40 ciclos de: 60 ciclos da qPCR, permitindo assim a
segundos a 95 °C, seguido por 60 se- quantificação do DNA genômico alvo
gundos a 60 °C, e 30 segundos a 72 °C. na amostra.
A extensão final deve ocorrer por 5 mi-
nutos a 72 °C. Para os dois tipos de ensaio, a quan-
tificação do DNA genômico alvo nas
PCR em Tempo Real (qPCR) amostras é baseado em uma curva pa-
drão constituída por diluições seriadas
A qPCR além de permitir a análise (1:10) com quantidade de cópias virais
quantitativa do DNA genômico alvo conhecidas nas concentrações que po-
na amostra, é considerada uma técni- dem variar entre 100 e 109, dependendo
ca precisa e com alta sensibilidade de do protocolo a ser seguido. Essa curva
detecção (Pallister et al. 2007). Essas padrão deve ser preparada com as dilui-
características tornam essa técnica pre- ções seriadas em duplicata (ou triplica-
ferencial em relação ao PCR convencio- ta) e pode ou não ser incluída em cada
nal quando o objetivo vai além da sim- placa da reação. Cada amostra biológi-
ples detecção do vírus na amostra. ca na reação deve ser testada no míni-
mo em duplicata e considerada positiva
quando i) ocorre amplificação das duas
Existem dois principais ensaios de
duplicatas da amostra, ii) a amplifica-
qPCR utilizados: o ensaio com SYBR
ção está dentro do limiar de detecção
Green, no qual este corante se interca-
(Ct) da curva padrão, iii) o ponto de
la aos pares de base de qualquer mo-
fusão do produto se encontra na mes-
lécula de DNA amplificada na reação;
ma faixa de temperatura das amostras
e o ensaio TaqMan, no qual se utiliza
padrão (Leung et al. 2017). No caso de
uma sonda fluorescente específica para
uma mesma amostra testar positiva em
o segmento do gene alvo. A principal
uma replicata e negativa em outra, essa
diferença entre estas técnicas está na
amostra pode ser testada novamente
presença da sonda utilizada no ensaio
em outra reação (Brunner et al. 2019)
TaqMan, que é constituída de oligonu-
ou ser considerada negativa (Leung et
cleotídeos marcados com um corante
al. 2017). Além disso, quando se utiliza
reporter fluorescente na extremidade
a técnica de qPCR para a quantificação
5’ e um corante quencher silenciador
na extremidade 3’. Quando as sondas 83
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

do DNA genômico nas amostras, a efi- primers com região alvo de 94 pb do


ciência da reação deve estar entre 90 e gene viral MCP (Tab. 3). Porém, vale
110 %, e pode ser calculada a partir da ressaltar que existem reagentes fabri-
fórmula: cados por outras empresas (e.g., Ther-
mo Fisher Scientific) que podem ser
Eficiência = (10 (- 1/slope)-1) * 100. utilizados na técnica com SYBR Gre-
en, assim como outros primers podem
ser desenhados de acordo com a região
Abaixo, apresentamos alguns dos pro-
alvo de interesse do pesquisador.
tocolos mais comumente utilizados
para cada um destes dois ensaios (SYBR
Green e TaqMan). Para cada reação descrita neste pro-
tocolo utilizam-se 12.5 μL do reagen-
te SYBR Green Master Mix, 12.5 pmol
ENSAIO SYBR GREEN
de cada primer, 2.5 μL da amostra de
DNA e completa-se com água livre de
Essa técnica consiste na captação da
nuclease até o volume final de 22.5 μL.
fluorescência produzida pelo corante
As condições de termociclagem são:
SYBR Green durante a reação de qPCR.
95 °C por 15 minutos para ativar o rea-
Esse corante se liga de forma inespecí-
gente e iniciar a desnaturação do DNA,
fica às moléculas de DNA e à medida
seguido por 40 ciclos de desnaturação
em que as fitas duplas são amplifica-
a 95 °C por 30 segundos, anelamento
das, a fluorescência é emitida. A vanta-
a 58 °C por 30 segundos e extensão à
gem dessa técnica é o custo da reação,
72 °C por 30 segundos. Uma curva
pois o corante SYBR Green é mais ba-
padrão constituída por amostras em
rato do que as sondas utilizadas em re-
diluições seriadas de 1:10 com quan-
ações com TaqMan (descritas abaixo).
tidade de cópias virais conhecidas nas
Por outro lado, a desvantagem é que o
concentrações entre 100 e 106 deve ser
corante SYBR Green se liga a qualquer
incluída em duplicata (ou triplicata)
molécula de DNA e, portanto, os pri-
em cada ensaio.
mers utilizados para amplificar o DNA
alvo devem ser desenhados com preci-
ENSAIO TAQMAN
são para evitar falsos positivos.
Aqui apresentamos três protocolos para
A seguir, descrevemos um dos proto- detecção de Ranavirus em amostras
colos utilizados para a detecção de Ra- a partir do ensaio com TaqMan. Cada
navirus a partir do uso do SYBR Green protocolo descrito abaixo apresenta
(Jaramillo et al. 2012). Este protoco- vantagens e desvantagens em relação
lo utiliza o reagente QuantiTect SYBR aos outros, que serão consideradas em
Green Master Mix Kit da Qiagen® e cada tópico (ver também Tab. 1).
84
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

Protocolo de Allender et al. (2013) com centração (7.5 ng/µL) e uma amostra
modificações (Candido & Sousa 2018) controle, com adição de água no lugar
do DNA (NTC – non-template control),
Esse protocolo foi inicialmente desen- ambos em duplicata. Pode-se adicionar
volvido por Allender et al. (2013) para BSA (albumina de soro bovino) à rea-
detectar e quantificar o vírus em tarta- ção para reduzir a ação de inibidores
rugas (Terrapene carolina carolina) e, de PCR e, portanto, diminuir a possi-
recentemente, adaptado por Candido bilidade de falsos negativos no ensaio
& Sousa (2018) para a detecção do Rv (Garland et al. 2010). No caso de não
em peixes. Esse protocolo foi também se utilizar o BSA, substituir a mesma
validado para a detecção de Ranavirus quantidade por água livre de nuclea-
infectando anfíbios em ambientes na- ses. A quantidade de cada reagente por
turais no Brasil (Ruggeri et al. 2019). reação se encontra na Tab. 2. A cicla-
Aqui, nós testamos o protocolo modifi- gem empregada no protocolo compre-
cado (Candido & Sousa 2018) com dois ende um ciclo à 50 ºC por 2 minutos
reagentes, ambos sendo bem sucedidos (incubação da UDG/UNG) para evitar
no ensaio: Platinum® quantitative PCR contaminação com produto de PCR de
SuperMix-UDG com adição do ROX Re- ensaios anteriores, seguido por uma in-
ference Dye (diluição 1:10) e TaqMan® cubação a 95 ºC por 10 minutos para
Universal PCR Master Mix (Thermo desnaturação inicial e ativação da DNA
Fisher Scientific), e apresentamos algu- polimerase, e 40 ciclos a 95 °C por 15
mas considerações sobre o protocolo. segundos e 60 °C por um minuto.
Uma vez que existem diferentes linha-
gens de Ranavirus distribuídas glo-
Esse é um protocolo simples uma vez
balmente, é importante destacar que o
que não é necessário utilizar uma cur-
protocolo foi eficiente na amplificação
va padrão para cada ensaio, desde que
de linhagens norte americanas (Allen-
as amostras estejam na concentração
der et al. 2013) e brasileiras (Ruggeri et
de 7.5 ng/µL. Por outro lado, deve-se
al. 2019) tanto em peixes quanto em gi-
atentar que cada ensaio apresenta ca-
rinos e com diferentes reagentes (esse
racterísticas próprias, como erro de pi-
trabalho; Tab. 2). Esse protocolo utiliza
petagem, possíveis variações na tempe-
uma sonda fluorescente, que permite
ratura do termociclador de diferentes
a quantificação do DNA alvo em cada
marcas, e o uso de reagentes mais ou
amostra (Tab. 3).
menos novos, por exemplo.
Neste protocolo, o DNA extraído das
amostras deve ser diluído na concentra-
ção de 7.5 ng/µL. Deverão ser incluídos
uma amostra positiva na mesma con-
85
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

Tabela 2. Volume de cada reagente por reação. O corante ROX (6-carboxy-X-rhoda-


mine) deverá ser substituído por água ultrapura ou BSA (albumina de soro bovino)
quando esse pigmento de referência passiva estiver presente no reagente escolhido.
O mix de reação deve ser calculado com 10% de volume a mais para cada amostra
para considerar possíveis erros de pipetagem. Protocolo baseado em Allender et al.
(2013).

Reagente Volume Reagente Volume

Platinum® quantitative 12.5 μL TaqMan® Universal PCR 12.5 μL


PCR SuperMix-UDG Master Mix

Água ultrapura 7.75 μL Água MiliQ 7.75 μL

Primer senso a 10 μM 1.0 μL Primer senso a 10 μM 1.0 μL

Primer anti-senso a 10 1.0 μL Primer anti-senso a 10 μM 1.0 μL


μM

Sonda fluorescente a 10 0.25 μL Sonda fluorescente a 10μM 0.25 μL


μM

ROX (diluído 1:10) 0.5 μL BSA (400 ng/μL) 0.5 μL

DNA amostra (7.5 ng/μL) 2.0 μL DNA amostra (7.5 ng/μL) 2.0 μL

Volume total por 25 μL Volume total 25 μL


reação por reação

86
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

Tabela 3. Lista de alguns primers e sondas fluorescentes conhecidos para ampli-


ficação de fragmentos da região MCP (proteína principal do capsídeo) dos vírus
pertencentes ao gênero Ranavirus. Para cada primer e sonda é indicada a técnica
molecular utilizada e o número de pares de bases (pb) amplificados.

Primer / Sequência de nucleotídeos (5’ – 3’) MCP Técnica Referência


sonda

Primer senso ATGTCTTCTGTAACTGGTTCA 1483 pb PCR convencional Mazzoni et al.


2009

Primer AAAGACCCGTTTTGCAGCAAAC
anti-senso

Primer senso GACTGACCAACGCCAGCCTTAACG3 94 pb qPCR: ensaio Jaramillo et al.


SYBR Green 2012

Primer anti- GCGGTGGTGTACCCAGAGTTGTCG3


-senso

Primer senso AACGCCGACCGAAAACTG 54 pb qPCR: ensaio Allender et al.


TaqMan 2013

Primer GCTGCCAAGATGTCGGGTAA
anti-senso

Sonda 6FAM-CCGGCTTTCGGGC-MGB-NFQ

Primer senso ACACCACCGCCCAAAA GTAC 70 pb qPCR: ensaio Warne et al.


TaqMan 2016

Primer anti- CCGTTCATGATGCGGATAATG


-senso

Sonda FAM-CCTCATCGTTCTGGCCATCAACCAC
-TAMRA

Primer senso GTCCTTTAACACGGCATACCT 97 pb qPCR: ensaio Leung et al.


TaqMan 2017

Primer anti- ATCGCTGGTGTTGCCTATC


-senso

Sonda VIC-TTATAGTAGCCTRTGCGCTTGGCC-
MGB-NFQ

87
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

Protocolo de Leung et al. (2017) pedeiro (primer senso ATGCTGCAAT-


TCAAACTGTCAG, primer anti-senso
Esse protocolo utiliza reagentes CAGTAAGCAAAATKGGGAAGAAGC,
TaqMan e envolve uma etapa de quan- e sonda FAM-CACTGGTTTGCTCAG-
tificação de cópias virais na amostra e GGATA-MGB-NFQ). O protocolo de
uma etapa de quantificação de células termociclagem aplicado nas duas eta-
do hospedeiro na mesma amostra. Para pas é idêntico e consiste em 2 minutos
a elaboração desse protocolo, Leung à 50 °C, seguido de 10 minutos à 95 °C,
et al. (2017) utilizaram sequências do e 50 ciclos de 15 segundos à 95 °C e 30
MCP depositadas no GenBank das segundos à 60 °C. Após os resultados
principais linhagens de Rv associado dos dois qPCRs, é feita a normalização
aos anfíbios (AARV) para desenhar os a partir da seguinte fórmula (para cada
primers e a sonda que pudessem am- amostra), levando em consideração a
plificar fragmentos de DNA de todas quantidade de cromossomos do hospe-
as linhagens de Rv desse grupo (Tab. deiro (ploidia):
3). Os autores utilizaram uma sequên-
cia de nucleotídeos da região não co-
Número de cópias virais =
dificante de proteína ultra conservada
entre vertebrados denominada EBF3N (Número de cópias MCP*Ploidia do hospedeiro)
(UCNE id: 8107; Dimitrieva & Bucher (Número de cópias EBF3N)
2013), para desenhar os primers e a
sonda para amplificação do DNA da cé-
lula hospedeira. Assim, a vantagem desse protocolo é a
possibilidade de se fazer comparações
entre a infecção por Rv em diversos
A primeira etapa do protocolo consiste
hospedeiros devido à normalização dos
em identificar e quantificar as amostras
dados baseado na quantidade de cópias
infectadas com Ranavirus a partir do
virais encontradas por célula do hos-
qPCR. Para isso, utilizam-se primers
pedeiro. Por outro lado, o custo des-
para a amplificação da região MCP dos
se protocolo é alto, pois envolve o uso
Rv e sonda fluorescente específica (Tab.
duas sondas fluorescentes diferentes,
3). A segunda etapa deste protocolo
que é um dos reagentes mais caros das
consiste na reação de qPCR utilizando
reações de qPCR (Tab. 1).
as amostras que testaram positivas para
a presença do DNA genômico do vírus
no primeiro ensaio de qPCR, utilizando
marcadores para a amplificação da re-
gião não codificante do vertebrado hos-

88
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

MÉTODOS POST-MORTEM: HIS- Assim, esse método é idealmente uti-


TOPATOLOGIA lizado para confirmar a morte por Rv,
porém não é adequado para a detecção
Consiste em analisar amostras de teci- do patógeno.
do do animal com infecção suspeita ou
comprovada a partir de técnicas his- DETECÇÃO DO RV NO AMBIEN-
tológicas padronizadas. Essas técnicas TE (EDNA)
são utilizadas de forma complementar
ao uso de técnicas moleculares de de-
A detecção de DNA livre no ambien-
tecção do patógeno, e auxiliam na com-
te, conhecido como DNA ambiental
provação da doença nos animais infec-
(eDNA), tornou-se uma ferramenta efi-
tados (Mazzoni et al. 2009; Miller et al.
ciente para monitorar patógenos nos
2015).
ambientes onde os hospedeiros vivem
sem a necessidade da amostragem do
Durante a coleta de animais com sus- animal (Julian et al. 2019; Miaud et al.
peita de infecção por Rv, sugere-se 2019). A presença do Ranavirus em
coletar amostras de tecidos, preferen- ambientes aquáticos pode ser inves-
cialmente fígado, baço e rim, e conge- tigada ao filtrar a água do ambiente
lar para futura detecção utilizando as aquático utilizando membranas de ce-
técnicas moleculares descritas acima lulose de 0.45 µm para reter o vírus e,
(PCR ou qPCR). Réplicas dos mesmos em seguida, extraindo-se o DNA retido
tecidos devem ser fixadas em formalde- nessa membrana para posterior análise
ído a 10% e processadas para histologia molecular utilizando os protocolos de
(i.e., inclusão em parafina ou resina, detecção descritos acima. Essa técnica
secção e coloração do material). A sec- já se mostrou importante na detecção
ção do material em parafina ou resina da presença do Rv na água que trans-
deve ser realizada serialmente e ide- porta animais para exportação (Kolby
almente com espessura de 7 µm, para et al. 2014), assim como em ambientes
posterior preparação das lâminas, que naturais (Miaud et al. 2019; Vilaça et
podem ser coradas usando o método al. 2020).
da Hematoxilina e Eosina (HE), e ana-
lisadas utilizando microscópio óptico
CONSIDERAÇÕES FINAIS
(Greer et al. 2005; Miller et al. 2015).
No entanto, identificar alterações ce-
lulares causadas pelo Rv é desafiador e Cada uma das técnicas apresentadas
requer treinamento, especialmente nos têm maior ou menor capacidade de
casos de infecções concomitantes com detecção de Rv nas amostras (Forzán
outros patógenos (Miller et al. 2015). & Wood 2013; Miller et al. 2015), sen-
89
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

do aquelas provenientes do fígado com ainda não foi amplamente abordado,


resultados superiores a outros tipos de destacamos a importância de incluir a
amostras, principalmente no diagnós- triagem para o Rv nos próximos estu-
tico molecular (von Essen et al. 2020). dos realizados no Brasil, principalmen-
Porém, quando o acesso só é possí- te aqueles relacionados com a herpeto-
vel em animais vivos, inviabilizando a fauna endêmica ou ameaçada.
amostragem de órgãos, indicamos a co-
leta de múltiplas amostras (como san- AGRADECIMENTOS
gue, secreções, falanges e caudas) em
conjunto, sempre que possível, para
Agradecemos a Roseli Coelho e dois
aumentar a confiabilidade dos resulta-
revisores anônimos pelas sugestões.
dos (Miller et al. 2015). Por outro lado,
O presente trabalho foi realizado
a detecção desse patógeno ainda não é
com o apoio dos processos FAPESP
comum em estudos com a herpetofau-
#2012/08846-3, #2016/21357-2,
na brasileira. Portanto, sugerimos que
#2016/25358-3, #2017/01718-3,
estudos de detecção de Rv no Brasil
#2017/01917-6 e #2019/06938-7, Fun-
sejam iniciados visando uma melhor
dação de Amparo à Pesquisa do Estado
compreensão da distribuição do vírus e
de São Paulo (FAPESP), do processo
das relações entre o patógeno e os hos-
CNPq #300896/2016-6, Conselho Na-
pedeiros. Além disso, vale ressaltar que
cional de Desenvolvimento Científico e
o Rv é um patógeno de notificação obri-
Tecnológico (CNPq) e da Coordenação
gatória para o OIE e MAPA devido à
de Aperfeiçoamento de Pessoal de Ní-
sua rápida propagação e alta letalidade.
vel Superior – Brasil (Capes) – Código
Uma vez que a doença causada por esse
de Financiamento 001.
vírus pode apresentar sinais clínicos
evidentes (Miller et al. 2015), é impor-
tante separar o indivíduo que apresen- REFERÊNCIAS
ta tais sinais da população (i.e., coleta
do indivíduo) e investigar a população Allender M.C., Bunick D., Mitchell M.A.
e os ambientes aquáticos daquela área 2013. Development and validation of
(Miaud et al. 2019). TaqMan quantitative PCR for detec-
tion of frog virus 3-like virus in eastern
Assim, esta revisão de protocolos para box turtles (Terrapene carolina caro-
a identificação de Rv em hospedeiros e lina). Journal of virological methods
no ambiente pode servir para incenti- 188:121–125.
var estudos no Brasil. Uma vez que esse
vírus pode representar mais um pro- Brunner J.L., Olson A.D., Rice J.G.,
blema de conservação relevante e que Meiners S.E., Le Sage M.J., Cundiff
90
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

J.A., ... Pessier A.P. 2019. Ranavirus Duffus A.L.J., Waltzek T.B., Stöhr A.C.,
infection dynamics and shedding in Allender M.C., Gotesman M., Whit-
American bullfrogs: consequences for tington R.J., ... Marschang R.E. 2015.
spread and detection in trade. Diseases Distribution and host range of ranavi-
of Aquatic Organisms 135:135–150. ruses. Pp 9–57 in Gray M.J., Chinchar
V.G. (Eds), Ranaviruses: lethal patho-
Bryan L.K., Baldwin C.A., Gray M.J., Mil- gens of ectothermic vertebrates. Sprin-
ler D.L. 2009. Efficacy of select disinfec- ger. New York.
tants at inactivating Ranavirus. Diseases
of Aquatic Organisms 84:89–94. Forzán M.J., Wood J. 2013. Low detec-
tion of ranavirus DNA in wild postme-
Candido M., Sousa R.L.M. 2018. Aspec- tamorphic green frogs, Rana (Litho-
tos celulares e moleculares da ranavirose bates) clamitans, despite previous or
experimental em tilápias do Nilo (Oreo- concurrent tadpole mortality. Journal
chromis niloticus). Ph.D. Dissertation, of Wildlife Diseases 49:879–86.
Universidade de São Paulo, Brasil.
Galli L., Pereira A., Márquez A., Maz-
Candido M., Tavares L.S., Alencar zoni R. 2006. Ranavirus detection by
A.L.F., Ferreira C.M., Queiroz S.R.A., PCR in cultured tadpoles (Rana cates-
Fernandes A.M., Sousa R.L.M. 2019. beiana Shaw, 1802) from South Ameri-
Genome analysis of Ranavirus frog vi- ca. Aquaculture 257:78–82.
rus 3 isolated from American Bullfrog
(Lithobates catesbeianus) in South Garland S., Backer A., Phillott A.D.,
America. Scientific Reports 9:17135. Skerratt L.F. 2010. BSA reduces inhibi-
tion in a TaqMan® assay for the detec-
Chinchar G.V. 2002. Ranaviruses tion of Batrachochytrium dendroba-
(family Iridoviridae): emerging cold- tidis. Diseases of Aquatic Organisms
-blooded killers. Archives of Virology 92:113–116.
147:447–470.
Goodman R.M., Miller D.L., Ararso
Dimitrieva S., Bucher P. 2013. UCNE- Y.T. 2013. Prevalence of ranavirus in
base - a database of ultraconserved Virginia turtles as detected by tail-clip
non-coding elements and genomic re- sampling versus oral-cloacal swabbing.
gulatory blocks. Nucleic Acids Resear- Northeastern Naturalist 20:325–332.
ch 41(D1):D101-D109.
Gray M.J., Miller D.L., Hoverman J.T.
2012. Reliability of non-lethal sur-
91
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

veillance methods for detecting ranavi- Amphibian Chytrid Fungus (Batracho-


rus infection. Diseases of Aquatic Or- chytrium dendrobatidis) and Ranavi-
ganisms 99:1–6. rus in Hong Kong Amphibian Trade.
PLoS One 9:e90750.
Greer A.L., Berrill M., Wilson P.J.
2005. Five amphibian mortality events Leung W.T., Thomas-Walters L., Gar-
associated with ranavirus infection in ner T.W., Balloux F., Durrant C., Price
south central Ontario, Canada. Disea- S.T. 2017. A quantitative-PCR based
ses of Aquatic Organisms 67:9–14. method to estimate Ranavirus viral
load following normalization by refe-
Jancovich J.K., Qin Q., Zhang V.G. rence to an ultraconserved vertebrate
2015. Ranavirus replication: molecu- target. Journal of Virological Methods
lar, cellular, and immunological events. 249:147–155.
Pp 105–139, in Gray M.J., Chinchar
V.G. (Eds), Ranaviruses: lethal patho- Mao J., Hedrick R.P., Chinchar V.G.
gens of ectothermic vertebrates. Sprin- 1997. Molecular characterization, se-
ger. New York. quence analysis, and taxonomic posi-
tion of newly isolated fish iridoviruses.
Jaramillo D., Tweedie A., Becker J.A., Virology 229:212–220.
Hyatt A., Crameri S., Whittington R.J.
2012. A validated quantitative poly- MAPA – Ministério da Agricultura,
merase chain reaction assay for the Pecuária e Abastecimento. 2020. Ele-
detection of ranaviruses (Family Irido- tronic Database acessível em http://
viridae) in fish tissue and cell cultures, www.defesaagropecuaria.al.gov.br/
using EHNV as a model. Aquaculture sanidade-animal/FORM%20NOTIFI-
356:186–192. CA%20e%20Instrutivo.pdf.

Julian J.T., Glenney G.W., Rees C. Mazzoni R., Mesquita A.J., Fleury L.
2019. Evaluating observer bias and F.F., Brito W.M.E.D., Nunes I.A., Ro-
seasonal detection rates in amphibian bert J., ... Catroxo M.H.B. 2009. Mass
pathogen eDNA collections by citizen mortality associated with a virus 3-like
scientists. Diseases of Aquatic Orga- Ranavirus infection in farmed tadpoles
nisms 134:15–24. Rana catesbeiana from Brazil. Disea-
ses of Aquatic Organisms 86:181–191.
Kolby J.E., Smith K.M., Berger L., Ka-
Miaud C., Arnal V., Poulain M., Valen-
resh W.B., Preston A., Pessier A.P.,
tini A., Dejean T. 2019. eDNA increases
Skerrat L.F. 2014. First Evidence of
92
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

the detectability of ranavirus infection Schloegel L.M., Picco A.M., Kilpatrick


in an alpine amphibian population. Vi- A.M., Davies A.J., Hyatt A.D., Daszak P.
ruses 1:526. 2009. Magnitude of the US trade in am-
phibians and presence of Batrachochy-
Miller D.L., Pessier A.P., Hick P., Whit- trium dendrobatidis and Ranavirus
tington R.J. 2015. Comparative pa- infection in imported North American
thology of ranaviruses and diagnostic Bullfrogs (Rana catesbeiana). Biologi-
techniques. Pp 171–208 in Gray M.J., cal Conservation 142:1420–1426.
Chinchar V.G. (Eds), Ranaviruses: le-
thal pathogens of ectothermic verte- Shaw G. 1802. General Zoology or Sys-
brates. Springer. New York. tematic Natural History (Volume III,
Part 1). Amphibia, Thomas Davison,
Pallister J., Gould A., Harrison D., London.
Hyatt A., Jancovich J., Heine H. 2007.
Development of real-time PCR assays Vilaça S.T., Grant S.A., Beaty L., Bru-
for the detection and differentiation of netti C.R., Congram M., Murray D.L.,
Australian and European ranaviruses. Wilson C.C., Kyle C.J. 2020. Detection
Journal of Fish Diseases 30:427–438. of spatiotemporal variation in ranavi-
rus distribution using eDNA. Environ-
Pessier A.P., Mendelson J.R. 2010. A mental DNA 2:210–220.
manual for control of infectious dise-
ases in amphibian survival assurance von Essen M., Leung W.T.M., Bosch
colonies and reintroduction programs. J., Pooley S., Ayres C., Price S.J. 2020.
IUCN/SSC Captive Breeding Specialist High pathogen prevalence in amphi-
Group, Apple Valley, MN. bian and reptile assemblage at a site
with risk factors for dispersal in Gali-
Price S.J., Garner T.W.J., Cunningham cia, Spain. PLoS One 15:e0236803.
A.A., Langton T.E.S., Nichols R.A.
2016. Reconstructing the emergence
Warne R.W., LaBumbard B., LaGran-
of a lethal infectious disease of wildlife
ge S., Vredenburg V.T., Catenazzi A.
supports a key role for spread through
2016. Co-infection by chytrid fungus
translocations by humans. Proceedings
and Ranaviruses in wild and harvested
of the Royal Society B 283:20160952.
frogs in the tropical Andes. PLoS One
11:e0145864.
Ruggeri J., Ribeiro L.P., Pontes M.R.,
Toffolo C., Candido M., Carriero M.M.,
... Toledo L.F. 2019. Discovery of wild
Editor: Alexandro Tozetti
amphibians infected with Ranavirus
in Brazil. Journal of Wildlife Diseases
55:897–902. 93
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

Bolitoglossa caldwellae
Tarauacá, AC
@Ubiratã Souza

94
Herpetologia Brasileira vol. 10 n.o 2 - Métodos em Herpetologia

Ceratophrys cornuta
Resex do Baixo Juruá - Juruá, AM
@Raíssa do N. Rainha

95
Herpetologia Brasileira vol. 10 n.o 2 - Ensaios & Opiniões

Herpetologia Segundo as Herpetólogas: A brea-


th of female representation in Brazilian science
Beatriz Diogo Vasconcelos1*, Ana Paula Vitoria Costa-Rodrigues2, Anna Virginia
Albano de Mello³, Carla Santana Cassini4, Clara Araújo Salvino3, Daniela Gennari
Pires de Toledo5, Jéssica Fenker6,7, Jessica Albuquerque Pereira8, Laura Rodrigues
Vieira de Alencar9, Lucy Gomes de Souza10, Marcélia Basto da Silva11, Natália Ferrei-
ra Torello-Viera12, Natália Rizzo Friol13, Sarah Mângia1, Tainara de Alencar14, Yas-
mim Caroline Mossioli de Souza15, Daniella Pereira Fagundes de França5

1 Laboratório de Sistemática e Biogeografia de Anfíbios e Répteis - Mapinguari, Instituto


de Biociências, Universidade Federal de Mato Grosso do Sul, 79070-900 Campo Gran-
de, MS, Brazil. beatrizdiogov@gmail.com; sarahmangia@yahoo.com.br
2 Laboratório de Herpetologia, Museu Paraense Emílio Goeldi, 66077-830 Belém, PA,
Brazil. anapv.bio2@gmail.com
3 Laboratório de Herpetologia, Centro de Biociências, Universidade Federal de Pernambu-
co, 50670-901 Recife, PE, Brazil. annabioufpe@gmail.com; laraclara0812@gmail.com
4 Departamento de Ciências Biológicas, Universidade Estadual de Santa Cruz, Campus
Soane Nazaré de Andrade, 45662-900 Ilhéus, BA, Brazil. carlacassini@gmail.com
5 Laboratório de Herpetologia, Museu de Zoologia da Universidade de São Paulo,
04266-000 São Paulo, SP, Brazil. danigennari@gmail.com; df.moojeni@gmail.com
6 Division of Ecology and Evolution, Australian National University, Canberra, Aus-
tralian Capital Territory, Australia. jehfenker@gmail.com
7 Atlas of Living Australia, CSIRO - Commonwealth Scientific and Industrial Research Or-
ganisation, 2601 Canberra, Australian Capital Territory, Australia. jehfenker@gmail.com
8 Laboratório de História Natural de Anfíbios e Répteis, Pontifícia Universidade Católica de
Minas Gerais, 30535-901 Belo Horizonte, MG, Brazil. jessicaalbuquerque89@gmail.com
9 Department of Biological Sciences, Price Lab, Clemson University, 29634 Clemson,
South Carolina, USA. alencarlrv@gmail.com
10 Museu da Amazônia, 69088-265 Manaus, AM, Brazil. souzalucyg@gmail.com
11 Departamento de Biologia, Centro de Educação Aberta e a Distância, Universidade
Federal do Piauí, 64001-280 Teresina, PI, Brazil. bastomarcelia@gmail.com
12 Laboratório de Ecologia e Evolução, Instituto Butantan, 05503-900 São Paulo, SP,
Brazil. nataliaftv.herpy@gmail.com
13 Departamento de Zoologia, Instituto de Biociências da Universidade de São Paulo,
Universidade de São Paulo, 05508-090 São Paulo, SP, Brazil. nrfriol@gmail.com
14 Centro de Ciências Exatas, Naturais e da Saúde, Universidade Federal do Espírito
Santo 29500-000 Alegre, ES, Brazil. taih_alencar@hotmail.com
15 Programa de Pós-graduação em Biodiversidade, Universidade Estadual Paulista Júlio de
Mesquita Filho, 15054-000 São José do Rio Preto, SP, Brazil. mossioli.souza@unesp.br
*Corresponding author: E-mail: beatrizdiogov@gmail.com
DOI: 10.5281/zenodo.5211411
96
Herpetologia Brasileira vol. 10 n.o 2 - Ensaios & Opiniões

ABSTRACT initiatives that involve the partici-


pation of at least one Brazilian her-
Scientific dissemination plays a fun- petologist and elaborates several
damental role in establishing the social media posts with themes on
dialogue between science and the environmental education and her-
scientist with the citizen. The ‘Her- petofauna. These publications have
petologia Segundo as Herpetólogas’ a colloquial and didactic character
(H2H; English translation – Her- accessible to a diverse audience but
petology According to Women Her- always maintaining scientific rigor.
petologists) initiative appears in The popularization of studies in her-
a scenario where women are not petology and the reduction of preju-
recognized or encouraged in Sci- dice against herpetofauna in Brazil,
ence, Technology, Engineering, and in addition to the reduction of gen-
Mathematics - STEM, feeling inse- der bias in science, can lead to in-
cure and intimidated in their aca- creased diversity in research groups
demic career. These feelings often and contribute to more effective and
impair women’s career continuity. inclusive science.
In addition, gender gap in Brazilian
herpetological community reflects INTRODUCTION
unconscious perceptions of sexist

T
stereotypes and the lack of refer- he Instituto Nacional de Comu-
ences or role models. At the same nicação Pública da Ciência e Tec-
time that the gender gap in STEM is nologia – INCT-CPCT (National
a hot topic of discussion, Brazilian Institute of Public Communication of Sci-
government is threatening progress ence and Technology, in English) conduct-
of science in the country. There is a ed a survey to summarize the opinions of
need to develop actions to dissemi- young Brazilians (15 to 24 years old) re-
nate research on herpetology and garding science and technology, including
educate the population on the Bra- their perceptions of fake news, and how
zilian herpetofauna (amphibians they access general knowledge (INCT-
and reptiles). When the role of wom- CPCT 2019). They found that science and
en herpetologists is promoted, it technology is the third most relevant topic
generates greater representation so of interest under a wide range of themes,
that young researchers, women, and such as religion, sports, and politics, sug-
other transfeminine minorities feel gesting that this audience has a great inter-
encouraged to dedicate themselves est in the theme (INCT-CPCT 2019). How-
to science. To this end, the H2H ini- ever, being interested does not necessarily
tiative promotes research and other equate to being informed about a given

97
Herpetologia Brasileira vol. 10 n.o 2 - Ensaios & Opiniões

subject. The same study showed that 93% ence communication has a historically pa-
of the young people interviewed reported triarchal structure that favors cisnorma-
not remembering the name of any Brazil- tive male scientists (Holman et al. 2018;
ian scientist, and 87% could not name any Astegiano et al. 2019), facing dilemmas in
national research institution. This lack of representativeness, with few women1 tak-
knowledge is especially worrying when ing positions in outreach activities (Pupo
68% of the respondents reported difficul- et al. 2017; Astegiano et al. 2019). Fortu-
ty in identifying whether science-related nately, this scenario has shown significant
news is trustworthy or not (INCT-CPCT progress in the last decade, with growing
2019). However, this result is not surpris- representation and participation of wom-
ing since Brazil is the country that most en in the fields of Science, Technology, En-
prolifically uses social media across Latin gineering, and Math – STEM (Holman et
America, with primary access via mobile al. 2018; Shannon et al. 2019). Yet, the ex-
devices (Dourado 2019). pressive performance of women in scien-
tific dissemination has not been followed
Even though the use of social media for by their due recognition. An example is the
science communication has grown consid- Prêmio José Reis de Divulgação Científica
erably in recent years, there is still a dis- (José Reis Award for Scientific Dissem-
tinct lack of scientists engaged in outreach ination, in English), the most renowned
activities on social media (Massarani & accolade in this area, which has only been
Moreira 2016). The increased consump- awarded to six women in the previous 40
tion of scientific content by the non-spe- editions, showing an evident male preva-
cialized public during the COVID-19 pan- lence (Adabo 2017).
demic made the engagement of Brazilian
scientists with science communication
an urgent matter (Chagas & Massarani 1  We would like to emphasize that, throughout the

2020). Scientific dissemination relies on text, when we use the term woman/women, we include

the active and continuous contact of the all cisgender women, transgender women, non-binary

scientific culture-sphere with the citizen transfeminine persons, women of all races and ethnici-

(Lima et al. 2016) and, consequently, with ties. And when we use the term male/man it refers to

the greater engagement of the society in cis men. We have not changed the term used in the pu-

issues that deal with science and technolo- blications we cite in the text and we do not know whe-

gy critically and reflectively (Cabral & Per- ther the terms woman/women and male/man in these

reira 2011). The scientific dissemination texts refers to the same audience that we have chosen

work encompasses, among others, activi- to include under the same term. We also encourage

ties developed in institutions and the pro- other researchers to pay attention to the use of the term

duction of content for social media (Adabo and to the public that they include in their research, as

2017). Similar to academia in general, sci- it is a common clipping error in the work of treating
woman/women as only cisgender women.
98
Herpetologia Brasileira vol. 10 n.o 2 - Ensaios & Opiniões

The gender gap in academia represents press; Mohan & Dharwadkar, 2021). This
a subject of growing discussion (Ceci & phenomenon of specific groups abandon-
Williams 2011; O’Brien & Hapgood 2012; ing careers along their professional path is
Shaw & Stanton 2012; Sheltzer & Smith called “the leaky pipeline” (Pell 1996). Still,
2014). When we look at the reality for women’s scientific production has been
transgender women, travestis (Brazilian strongly negatively impacted, especially
term for exclusive gender of transfeminine compared to men, during the COVID-19
persons, but not necessarily self-identi- pandemic, with even more severe impacts
fied as a transgender woman), and other observed among black women (Parent in
transfeminine individuals, the reality is Science 2020).
challenging and require further studies.
The gender difference regarding the en- In addition to the gender bias issue, sci-
try and progression within academia is a ence in Brazil is passing through a time
reported problem to any transgender per- of extreme hardship, with a dramatic re-
son that tries to surpass the oppressive duction of science funding by the Brazilian
barriers that exist in our society and con- government since 2016. Although scientif-
sequently in the academic environment ic entities have spoken out against budget
(Vergueiro 2016; Gibney 2019; O’Quinn cuts, investment in science and technolo-
& Fields 2020; Turney et al. 2020). Gen- gy has been halved (Petherick 2017; Leta
der bias has also been documented in the et al. 2018; Barbosa 2019). The disconti-
Brazilian herpetology community (Carna- nuity and extinction of programs aimed at
val 2016; Werneck et al. 2019), where ste- science, technology, and innovation call
reotypes of vanity, emotional fragility, in- for the scientific community to take action
security, and lack of physical strength are and increase their dialogue with society.
used as arguments to discourage women In response, a group of female scientists
from collecting data in the field. Although observed this need to disseminate the im-
many women start their studies and scien- portance of studies in their working area
tific careers in herpetology, their scientific and contribute to the conservation of rep-
progression and persistence are affected tiles and amphibians by raising society’s
by several factors, possibly related to im- awareness of environmental education.
plicit judgment bias involving academic Additionally, there was a desire to high-
and social spheres (Buckles 2019; Wer- light the excellent research conducted by
neck et al. 2019; Montesinos et al. 2021). Brazilian scientists in the field and pro-
Unequal opportunities, lack of representa- mote greater female participation in Bra-
tion in certain areas, and motherhood are zilian herpetology. That is how the Herpe-
among the main factors responsible for tologia Segundo as Herpetólogas – H2H
the non-permanence or challenges to the (Herpetology According to Women Her-
progression of women in this profession petologists, in English) was created. The
(Benício & Fonseca 2019; Cyriac et al. in H2H initiative was conceived by Daniella
99
Herpetologia Brasileira vol. 10 n. 2 - Ensaios & Opiniões

França and founded in August 2018 along reach a broad audience, mostly taken via
with six other female scientists. The team social media; by giving lectures and cours-
currently includes 9 participants working es at schools, universities, and museums;
voluntarily, but another eight participants and participating in scientific meetings.
have previously been active in the initia- In addition, H2H shares scientific discov-
tive (Fig. 1). On May 27, 2021, the initia- eries made by women, highlighting their
tive had many followers on the H2H social performance in herpetology and academia
media pages (8425 likes and 8636 follow- in general. For example, ‘Perereca Talks’
ers on Facebook, 9766 on Instagram, 3580 are a series of interviews periodically held
on Twitter, but these numbers continue to online where the public has the chance
grow). Different actions are developed to to meet with Brazilian women herpetolo-
gists. Thus, these events represent a mo-
ment to share information, in-
spiration, and humanization
of science. The initiative also
promotes awareness of human

Figure 1. The team of female her-


petologists that work voluntarily
in the Herpetologia Segundo as
Herpetólogas (H2H) initiative.
A - Beatriz Diogo Vasconcelos; B
- Ana Paula Vitoria Costa-Rodri-
gues; C - Anna Virginia Albano de
Mello; D - Carla Santana Cassini;
E - Clara Araújo Salvino; F - Da-
niela Gennari Pires de Toledo;
G - Jéssica Fenker; H - Herpeto-
logia Segundo as Herpetólogas
(H2H) initiative’s logo; I - Jessica
Albuquerque Pereira; J - Laura
Rodrigues Vieira de Alencar; K -
Lucy Gomes de Souza; L - Mar-
célia Basto da Silva; M - Natália
Ferreira Torello-Viera; N - Natá-
lia Rizzo Friol; O - Sarah Mângia;
P - Tainara de Alencar; Q - Yas-
mim Caroline Mossioli de Souza;
R - Daniella Pereira Fagundes de
França.
100
Herpetologia Brasileira vol. 10 n.o 2 - Ensaios & Opiniões

Figure 2. The main actions of Herpetologia Segundo as Herpetólogas (H2H) initiative.

actions around reptiles and amphibians. transgender equity became more promi-
A summary of the main activities can be nent, aiming to construct as equalitarian a
seen in Figure 2. scientific communication environment as
possible.
Aiming to better understand the audience,
offer a space of support and visibility, and The results obtained from the first ques-
contemplate general interest in the initia- tionnaire (62 respondents), which was
tive, four surveys were conducted – two in applied only to female herpetologists, sug-
2019 and two in 2020. All questionnaires gested that women are not comfortable
were carried out through the Google expressing opinions on social media. This
Forms platform and shared on the H2H result is related to sexist attitudes. Many
initiative’s social media and other social women reported having to even stop par-
networks (Whatsapp, Twitter, Instagram, ticipating in discussion groups due to ma-
and Facebook). The surveys were available chismo (common and oppressive behav-
for 15 days. It is important to note that ior of a society where culturally ingrained
during the first two attempts to conduct masculine pride resides; Bernal et al.
the online surveys, the transgender com- 2019) and hostile behaviors.
munity was unconsciously unconsidered.
In 2020, however, discussions related to
101
Herpetologia Brasileira vol. 10 no. 2 - Ensaios & Opiniões
The second questionnaire (58 respon- the channels to update their knowledge in
dents) was applied only to female her- preparation for classes, courses, and lec-
petologists (mothers and non-mothers). tures. These data show that working with
From them, 43.1% reported that their ac- scientific dissemination on social media is
ademic career influenced their decision to essential to raise awareness among people
become mothers, more than they thought regarding their environmental impacts.
they would have been influenced if they
had chosen another profession. As a re- The fourth and final questionnaire (481 re-
flection, more than half of the interview- spondents) showed that 45% of the initia-
ees (55.6%) chose not to have children (or tive’s audience are between 25 and 34 years
at least not yet). Many women postpone old, and 32% between 18 and 24 years old,
plans to be mothers as they think it is not with varying education levels (elementary-
“the right time” yet, while others wait for and high- school, undergraduate, and grad-
a permanent position, which tends to hap- uate). Additionally, 69.2% of the audience
pen only after the age of 30. Nevertheless, was composed of women, 29.5% by men,
82.6% believe that having children signifi- and 0.2% classified themselves as queer/
cantly impacts their careers than expected non-binary, 0.4% as fluid, and 0.6% chose
to affect men. Of the interviewed herpe- not to answer. The survey participants use
tologist mothers, 15.5% report that their the H2H social media channels mostly
academic productivity has decreased since to search for information and curiosities
they became mothers and 86% have heard (65.7%), to help with questions (41.2%),
or witnessed unpleasant comments about and for fun (22%). In addition, participants
career-related motherhood. When asked mentioned that the initiative offers a collec-
whether there are incentives for women tive space, visibility and helps in the search
researchers and other professionals in her- for professional contacts.
petology who wish to be mothers to con-
tinue their careers, 36.8% answered no,
The dissemination of science plays an es-
and 45.6% believed that these incentives
sential role in expanding the general pop-
are starting to appear, albeit very slowly.
ulation’s knowledge. However, it is para-
mount to increase the visibility and voices
In the third survey (253 respondents), al- of female references and improve gender
though most of the respondents (38.3%) equity to stem the unconscious percep-
do not consistently (e.g., every week) fol- tions of sexist stereotypes in Brazilian her-
low any scientific dissemination channel, petology. Recognizing this scenario is es-
the H2H initiative was found to be one of sential to plan for change and allow more
the most cited channels (4.3%). Among women and girls to feel encouraged to
them, 79% reported that they use the dedicate themselves to science. To achieve
channels of scientific dissemination out of this, proposals to increase the represen-
curiosity, while 73% of this audience uses tation of women in herpetology, such as
102
Herpetologia Brasileira vol. 10 no. 2 - Ensaios & Opiniões
good practices and conduct in the work- to discuss content and have reliable and
place and inclusion of the maternity leave relevant sources. It is a particularly mean-
in the curriculum lattes (Werneck et al. ingful action that promotes the formation
2019), will contribute to a better portrayal of citizens with critical thinking.
of these professionals in STEM.”
By sharing the collective experience of the
FUTURE PLANS H2H initiative, there is an intention to en-
courage other women to promote spaces
The H2H initiative plans to increase face- of female protagonism in their fields. The
to-face activities, such as lectures at educa- hope is that H2H may inspire the develop-
tional institutions, to encourage girls, teen- ment and champion of similar initiatives in
agers, and young women to pursue their other countries, starting an international
interest in science, especially in herpetolo- and collaborative network of women and
gy. Another aim is to showcase the initia- increasing the visibility of local scientists.
tive at Brazilian and international scientific We believe that these actions will also in-
events, focusing on biology and education, crease international research collabora-
as done during the Brazilian Congress of tions and contribute to reducing gender
Herpetology in 2019. H2H’s intends that bias in the authorship of scientific papers
these presentations inspire and encourage and enhancing diversity in research groups.
more scientists to create similar initiatives,
both for the inclusion of women and other Finally, H2H seeks to value activities in
social minorities in science. herpetology led by women who strive to
build a future with gender equality in sci-
Another future goal is to expand educa- ence. For that, the initiative warmly invites
tional activities, increase female represen- women in herpetology to contribute to the
tation in herpetology in all Brazilian states, H2H social media channels, sharing their
and promote visits to local communities work, scientific findings, or whatever they
lacking education and inspirational pro- want. We also welcome help and creative
fessionals. There is also a plan to partici- ideas for improving the H2H website as
pate more actively in the teaching process, a space to share photos, research, and art
offering nature conservation and science related to herpetology, in order that it can
communication courses to school teach- be an effective tool for other researchers to
ers. This training will help school teach- communicate and enhance their research.
ers promote educational activities (e.g., The website also includes means to contact
games and practical classes), such as cre- many women herpetologists across Brazil
ating a profile or channel on social media and abroad; monthly updates on scien-
where students and teachers can publish tific publications; suggestions of movies,
scientific dissemination content and share books, and digital content related to biol-
their production process. They will be able ogy, feminism, science for children, and,
103
Herpetologia Brasileira vol. 10 n.o 2 - Ensaios & Opiniões

of course, herpetology. H2H wants to con- Astegiano J., Sebastián-González E.,


tinue showing that women can be the pro- Castanho C.T. 2019. Unravelling the gen-
tagonists of their lives and careers, even der productivity gap in science: a meta-an-
(or especially!) if they dream of catching alytical review. Royal Society Open Sci-
frogs, turtles, lizards, snakes, crocodiles, ence 6:181566. doi:10.1098/rsos.181566.
and do science. H2H enthusiastically en-
courages anyone to contact the initiative, Barbosa R. 2019. A sabotagem da ciência
either through email (herpetologia2her- brasileira entre 2016 e 2017. Germinal:
petologas@gmail.com), social media (@ Marxismo e Educação em Debate 11:74–87.
herpgirls on Twitter and Facebook; @
herpetosegundoherpetologas on Insta-
Benício R.A., Fonseca M.G. 2019. Wom-
gram), or by contacting any of the team
en and Science: a portrait of herpetology
members and invites everyone to visit the
in the state of Piauí. Brazilian Journal of
website (https://herpeto2herpetologas.
Biology 79:755–757.
wixsite.com/-h2h).

Bernal X.E., Rojas B., Pínto E.M.A., Men-


ACKNOWLEDGMENTS
doza-Henao A.M., Herrera-Montes A.,
Herrera-Montes M.I. ... Franco A.D.P.
We would like to thank all those who en- 2019. Empowering Latina Scientists. Sci-
courage us to continue our fight for great- ence 363:825–826.
er respect, visibility and equality in Sci-
ence, Technology, Engineering, and Math
Buckles K. 2019. Fixing the leaky pipeline:
(STEM) and who support our voluntary
Strategies for making economics work for
work on social networks. In addition, we
women at every stage. Journal of Econom-
would like to thank the women herpetol-
ic Perspectives 33:43–60.
ogists, our fighting partners, who offer
friendship and exchange of experiences
Cabral C.G., Pereira G.R. 2011. Introdução
in herpetology. Special thanks to Rebecca
aos estudos CTS - Ciência, Tecnologia e
Laver for proofreading the manuscript.
Sociedade I. EDUFRN, Natal.

REFERENCES
Carnaval A.C. 2016. Breve reflexão sobre
mulheres cientistas, e nossa representativ-
Adabo G.M. 2017. Divulgadoras de ciên-
idade na Sociedade Brasileira de Herpeto-
cia no Brasil. Master’s degree. Disserta-
logia. Herpetologia Brasileira 5:47–48.
tion, Universidade Estadual de Campinas,
Campinas.
Ceci S.J., Williams W.M. 2011. Under-
standing current causes of women’s un-
derrepresentation in science. Proceedings
104
Herpetologia Brasileira vol. 10 n.o 2 - Ensaios & Opiniões

of the National Academy of Sciences of the until women are equally represented? Plos
United States of America 108:3157–3162. Biology 16:e2004956. doi: 10.1371/jour-
nal.pbio.2004956.
Chagas C., Massarani L. 2020. Manual
de sobrevivência para divulgar ciência e INCT-CPCT. 2019. O que os jovens bra-
saúde. FIOCRUZ, Rio de Janeiro. sileiros pensam da ciência e da tecnologia?
FIOCRUZ. Rio de Janeiro.
Clance P.R., Imes S. 1978. The Imposter
Phenomenon in High Achieving Women: Leta J., Araújo K.M., Guedes V.L.S. 2018.
Dynamics and Therapeutic Intervention. Ciência brasileira em crise: a ciência em
Psychotherapy Theory, Research and rede como estratégia de enfrentamento.
Practice 15:1–8. Em questão 24:1–6.

Cyriac V.P., Dharwadkar S., Mital A., Mo- Lima B.S., De Santana Braga M., Tavares
han A.V. 70 years of Herpetology in India: I. 2016. Participação das mulheres nas
insights into shifts in focal research areas ciências e tecnologias: entre espaços ocu-
and gender ratios among authors. Pacific pados e lacunas. Revista Gênero 16:11–31.
Conservation Biology. In press.
Massarani L., Moreira, I.C. 2016. Science
Dourado M. 2019. Brasil é o país que communication in Brazil: A historical re-
mais usa redes sociais na América Lati- view and considerations about the current
na. Olhar Digital. Accessible at https:// situation. Anais da Academia Brasileira
olhardigital.com.br/2019/07/05/noti- de Ciências 88:1577–1595.
cias/brasil-e-o-pais-que-mais-usa-re-
des-sociais-na-america-latina/#:~:tex- Mohan A.V., Dharwadkar S. 2021. Women
t=O%20Brasil%20%C3%A9%20o%20 in Herpetology. Accessible at https://sanc-
pa%C3%ADs,M%C3%A9xico%2C%20 tuarynaturefoundation.org/article/wom-
de%20aproximadamente%2080%25. Ac- en-in-herpetology. Access: 11 april 2021.
cess: 08 January 2021.

Montesinos R., Alencar T., Canedo C.,


Gibney E. 2019. Discrimination drives Costa-Rodrigues A.P.V., Friol N.R., Jecke
LGBT+ scientists to think about quitting. A.M….França D.P.F. 2021. Virando a
Nature. Accessible at https://www.nature. Mesa: Trazendo as Mulheres para o Cen-
com/articles/d41586-019-02013-9. Ac- tro da produção e divulgação científica da
cess: 10 january 2021. Herpetologia brasileira. Pp. 25–37 in To-
ledo, L.F. (Org.) Herpetologia Brasileira
Holman L., Stuart-Fox D., Hauser C.E. Contemporânea. Sociedade Brasileira de
2018. The gender gap in science: How long Herpetologia, São Paulo.
105
Herpetologia Brasileira vol. 10 n.o 2 - Ensaios & Opiniões

O’Brien K.R., Hapgood K.P. 2012. The Shaw A.K., Stanton D.E. 2012. Leaks in
academic jungle: ecosystem modelling the pipeline: separating demographic in-
reveals why women are driven out of re- ertia from ongoing gender differences in
search. Oikos 121:999–1004. academia. Proceedings of the Royal Soci-
ety B 279:3736–3741.
O’Quinn J., Fields J. 2020. The future of
evidence: Queerness in Progressive Vi- Sheltzer J.M., Smith J.C. 2014. Elite male
sions of Sexuality Education. Sexuality, faculty in the life sciences employ fewer
Research and Social Policy 17:175–187. women. PNAS 111:10107–10112.

Parent in Science. 2020. Produtividade Turney S., Carvalho M.M., Sousa M.E.,
acadêmica durante a pandemia: Efeitos Birrer C., Cordeiro T.E.F., Diele-Viegas
de gênero, raça e parentalidade. Acces- L.M….Souza L. 2020. Support transgen-
sible at https://327b604e-5cf4-492b- der scientists post-COVID-19. Science
910b-e35e2bc67511.filesusr.com/ugd/0b- 369:1171–1171.
341b_81cd8390d0f94bfd8fcd17ee6f29bc0e.
pdf?index=true. Access: 8 january 2021. Vergueiro V. 2016. Pensando a cisgener-
idade como crítica descolonial. Pp 249–
Pell A.N. 1996. Fixing the leaky pipeline: 270 in Messeder S., Castro M.G., Moutin-
Women scientists in Academia. Journal of ho L. (Eds.), Enlaçando sexualidade: uma
Animal Science 74:2843–2848. tessitura interdisciplinar no reino das sex-
ualidades e das relações de gênero. EDUF-
Petherick A. 2017. Careers: Austerity bites BA. Salvador.
deeply. Nature 548:249–251.
Werneck F.P., Jeckel A.M., Friol N.R.,
Pupo S.C., Oliveira T.M., Gomes E.F., Vie- Toledo D.G.P., Targino M., Montesinos
ira R.M.B., Santos E.I., Piassi L.P.C. 2017. R….Canedo C. 2019. Diagnóstico e propos-
Ciência, tecnologia, mídia e igualdade de tas para ampliar a representatividade de
gênero. Revista Científica de Comuni- pesquisadoras em Herpetologia no Brasil.
cação Social do Centro Universitário de Herpetologia Brasileira 8:36–43.
Belo Horizonte 10:42–62.

Shannon S., Jansen M., Williams K.,


Cáceres C., Motta A., Odhiambo A. 2019.
Gender equality in science, medicine, and
global health: where are we at and why
does it matter? The Lancet 393:560–569.

106
Herpetologia Brasileira vol. 10 n.o 2 - Ensaios & Opiniões

Pithecopus gonzagai
Groaíras, CE
@Carol Brasileiro
107
Herpetologia Brasileira vol. 10 n.o 2 - Ensaios & Opiniões

Phasmahyla jandaia
Rio Acima, MG
@Tiago Pezzuti

108
Herpetologia Brasileira vol. 10 n.o 2 - Resenhas

Resenhas
Edward O. Wilson. 2015. Cartas a um jovem cientis-
ta. Tradução: Rogério Galindo. 1ª edição. Compa-
nhia das Letras, São Paulo. 202 pp.

Quezia Ramalho
Laboratório de Ecologia de Paisagens, Instituto de Biologia Roberto Alcantara Go-
mes, Universidade do Estado do Rio de Janeiro, 20550-900 Rio de Janeiro, RJ,
Brasil.
E-mail: queziaramalho@gmail.com
DOI: 10.5281/zenodo.5211422

S
e você está pensando
em desistir da sua car-
reira científica, você
precisa ler esse livro para de-
cidir se é o que realmente quer
fazer.
Edward O. Wilson nasceu em
1929 no estado do Alabama, nos
EUA, e é um renomado biólogo
e entomologista. Professor da
Universidade Harvard e ganha-
dor de dois prêmios Pulitzer,
o seu trabalho é mundialmen-
te conhecido. É considerado o
maior especialista em formigas
do mundo e demonstra essa
paixão página após página. No
livro, ele traça um histórico
científico das formigas e nos
desperta um fascínio a estes e
outros seres minúsculos que,

109
Herpetologia Brasileira vol. 10 n.o 2 - Resenhas

por vezes, passam desapercebidos. Ao críveis, mas, me arrisco em dizer que, o


contar sobre suas descobertas ao longo maior deles é a demonstração de que a
da vida, nos faz questionar sobre o que ciência é uma construção coletiva. Não
ainda queremos descobrir como cien- é difícil resolver um problema quando
tistas. você está bem-acompanhado. Difícil é
pensar em um problema em que a solu-
Começando com o convidativo prólogo
ção pode ser um marco na ciência, assim
“Você fez a escolha certa”, o livro é di-
como foi a “Teoria da Biogeografia de
vidido em cinco partes: (I) O caminho
Ilhas”. No penúltimo capítulo, de for-
a seguir; (II) O processo criativo; (III)
ma bem descontraída e surpreendente,
Uma vida na ciência; (IV) Teoria e qua-
podemos ver essa teoria nascendo. Ao
dro geral e (V) Verdade e ética. A for-
lado de MacArthur, Wilson começou a
ma como o livro foi dividido demonstra
pensar sobre as ilhas que havia visita-
como o autor teve cuidado em tornar o
do ao redor do mundo, movidos pelo
livro uma experiência prazerosa e úni-
desejo de criar uma nova teoria dentro
ca. Além disso, o livro é ilustrado com
do que eles e outros pesquisadores na
fotos do autor, o que nos aproxima das
época chamaram de “Biologia Evolu-
histórias relatadas por ele.
cionária”. Em 1967, o livro “The Theory
Wilson sempre foi cientista e demons- of Island Biogeography” foi lançado, o
tra a sua devoção à ciência no livro in- que marcou a “Biologia Evolucionária”
teiro. cientista desde a infância, ele re- e contribuiu para guiar diversas áreas
latou toda a sua curiosidade e fascínio de conhecimento.
por novas descobertas científicas ao
Wilson ainda teve a genialidade de ter-
longo do livro. Conforme avançamos
minar o livro da melhor forma, com um
na leitura, ele nos convence de que da-
capítulo chamado “A ética científica”.
mos pistas de quem desejamos nos tor-
Costumo dizer que a ética deve vir em
nar ainda quando crianças. Lembrei de
primeiro lugar na ciência e, ao ler este
quando misturei ingredientes de cozi-
capítulo, tive certeza. Neste capítulo,
nha pensando estar fazendo algum ex-
o autor afirma que “a maior parte das
perimento magnífico e das inúmeras
decisões morais que você será obrigado
vezes que subi na maior árvore do meu
a tomar terá a ver com seu relaciona-
antigo quintal para me aproximar cada
mento com outros cientistas”, por isso
vez mais da natureza e de quem eu sou
é preciso conduzir, de forma ética, a sua
hoje.
pesquisa e a publicação dos resultados.
Ao longo dos 20 capítulos do livro, Mais do que um bom capítulo, é um ca-
Wilson nos oferece diversas dicas para pítulo necessário, para todos aqueles
tornar a jornada acadêmica mais signi- que, em essência do que é ser cientista,
ficativa. Há diversos ensinamentos in- buscam a verdade.
110
Herpetologia Brasileira vol. 10 n.o 2 - Resenhas

É, sem dúvidas, um livro para todo


cientista ler, independentemente de
sua fase na carreira acadêmica. Quem
estiver no início, vai encontrar estímu-
lo para permanecer no caminho cien-
tífico. Quem estiver com a carreira já
bem desenvolvida, vai encontrar iden-
tificação em muitas cartas escritas por
Wilson. “Cartas a um jovem cientista” é
um livro daqueles que a gente quer car-
regar debaixo do braço por onde for.

Proceratophrys brauni
Paula Freitas, PR
@Tayane Azevedo
111
Herpetologia Brasileira vol. 10 n.o 2 - Resenhas

Bezerra A.M., Guarabyra B., Marra R. 2020.


Jogo ANURA.

Nathália R. Honório *, Mariana A. Faustino, Luana Carvalho, Caio F. M. Pereira

1 Instituto de Ciências Biológicas, Universidade Federal de Juiz de Fora, 36036-900


Juiz de Fora, MG, Brasil.
* Autor correspondente: E-mail: nathalia.honorio@icb.ufjf.br
DOI: 10.5281/zenodo.5211433

S
egundo Fortuna (2003), a in- tada pelo habitat onde a espécie é mais
clusão de jogos didáticos como comumente encontrada (Fig. 1B). O ta-
material complementar na buleiro, por sua vez, é composto por três
aprendizagem é uma importante alter- tipos de casas interativas diferentes: (1)
nativa à rigidez da reprodução tradi- “Mito ou Verdade?”, (2) “Perguntas e
cional de conhecimentos, característica Respostas” e (3) “Paradas Obrigatórias”.
comum no ensino de Ciências e Bio- O jogo também possui três ambientes:
logia nas escolas. O jogo de tabuleiro (1) a Floresta, (2) o Brejo e (3) a Região
“ANURA” foi desenvolvido por Andres- Antropizada. Essas áreas geram influ-
sa Bezerra, Bruna Guarabyra e Raquel ência de maneira singular a cada espé-
Marra, pesquisadoras do Laboratório cie, como descrita nas cartas de carac-
de Anfíbios da Universidade Federal terização dos animais. Em resumo, os
do Rio de Janeiro. A proposta do jogo participantes devem realizar o percurso,
é gerar um conhecimento mais amplo aprendendo características da história
sobre os anfíbios anuros para, assim, natural de cada anuro a fim de chega-
despertar nos jogadores maior sensi- rem ao final do jogo e contribuírem para
bilização a respeito da necessidade de a preservação da espécie escolhida.
conservação deste grupo.
Este jogo apresenta grande potencial
O jogo ANURA segue o formato de um de auxiliar os estudantes na aprendiza-
jogo de tabuleiro clássico (Fig. 1A) no gem acerca dos anuros, visto que pro-
qual cada jogador escolhe para ser seu porciona um conhecimento sobre este
representante uma entre 12 espécies de grupo taxonômico de forma lúdica e in-
anuros. Cada espécie é indicada pelo teressante. Além disso, insere assuntos
seu nome científico e seu nome popu- que podem não ser abordados na aula,
lar, foto ilustrativa, modo de desenvol- como os mitos acerca dos anfíbios e as
vimento (direto ou indireto) e sua área questões que trazem problematizações
de vantagem no jogo, que é represen- (como o desmatamento, por exemplo).
112
Herpetologia Brasileira vol. 10 n.o 2 - Resenhas

Figura 1. Representação do Jogo Anura: (A) Tabuleiro do jogo; (B) Cartas de personagens;
(C) Cartas de perguntas e respostas.

O jogo trata diversos aspectos da bio- possível problematizá-lo, explorando


logia dos anuros, como o ciclo de vida, como isto afeta toda a biodiversidade,
a morfologia, as técnicas de defesa, a visto que a perda de habitat é a maior
dieta e a predação. Dessa forma, abre responsável pelo declínio de biodiversi-
espaço para que o professor explique dade no planeta. A temática da utiliza-
a importância desses animais na teia ção desses animais pelos seres huma-
alimentar, em que atuam como presas nos também possibilita uma conversa
e predadores, além de trazer informa- sobre a comercialização das rãs como
ções sobre a reprodução, combate entre alimento e sobre a caça no Brasil. As
machos e vocalizações. Ao destacar que cartas de “Mito ou Verdade?” (Fig. 1C)
o Brasil apresenta a maior diversida- são importantes para a desconstrução
de de anuros do mundo, é evidenciada da aversão das pessoas aos anfíbios,
para os estudantes a importância que a fim de gerar uma sensibilização nos
o nosso país tem na conservação des- alunos, evidenciando que a maior parte
te grupo. O jogo também possibilita a desses animais não oferece risco à saú-
discussão de outras questões impor- de humana. No final do jogo, há a sa-
tantes. Ao abordar o desmatamento é tisfatória mensagem: “Parabéns! Você

113
Herpetologia Brasileira vol. 10 n.o 2 - Resenhas

ajudou a preservar essa espécie!”, que, zação direta sobre o porquê de cada es-
juntamente com todo o aprendizado pécie possuir vantagens nos diferentes
adquirido durante o jogo, podem inci- ambientes apresentados (“Floresta”,
tar nos estudantes a preocupação com “Região Antropizada” e “Brejo”).
a natureza e o desejo de preservação
dos anuros. Uma sugestão para complementar
a aprendizagem é, de acordo com as
Apesar de muito bem construído, o condições de cada educador, trazer a
jogo apresenta alguns pontos que po- vocalização das espécies em seu celu-
deriam ser mais bem colocados, em- lar, para aproximar ainda mais os es-
bora, não invalidem nem passem um tudantes da natureza. Isso poderia ser
conhecimento errôneo sobre o grupo. feito acessando plataformas como a
Ao mesmo tempo que o jogo trata os Fonoteca Neotropical Jacques Vielliard
anuros como inofensivos, o que de fato (https://www2.ib.unicamp.br/fnjv/).
são, ele também menciona a presença Por fim, percebe-se o grande poten-
de veneno, sem discutir as implicações cial deste jogo em auxiliar no ensino e
disso. Nesse caso, as respostas se au- conscientização sobre os anuros, visto
sentam do debate sobre a possibilidade que traz o conhecimento de forma lú-
de outros perigos além da ingestão do dica e com uma linguagem adequada
veneno e seu potencial tóxico para se- para a faixa etária, facilitando, assim, a
res humanos, como enfatizar o perigo aprendizagem.
da própria manipulação sem a devida
assepsia posterior, que pode acarretar REFERÊNCIAS
complicações, como irritação. Pensan-
do em crianças como público-alvo da
Bezerra A.M., Guarabyra B., Marra R.
atividade, as informações devem ser
2020. Jogo ANURA. Acessível em ht-
apresentadas sempre de forma coesa
tps://www.researchgate.net/publica-
e direta, para que não haja nenhuma
tion/340875015_Jogo_ANURA. Aces-
dificuldade de interpretação ou algum
so: 13 fevereiro de 2021.
incidente. Outro ponto a se repensar é
que o jogo traz como personagens di-
Fortuna T.R. 2003. Jogo em aula: re-
ferentes espécies de anuros, mas não
curso permite repensar as relações de
explora as suas diferenças morfológi-
ensino aprendizagem. Revista do Pro-
cas, como a diferença entre sapos, rãs
fessor 19:1519.
e pererecas, assunto que sempre gera
interesse no meio popular, por mais
que não tenha validade filogenética. Da
mesma forma, não há uma contextuali- Editora: Quezia Ramalho
114
Herpetologia Brasileira vol. 10 n.o 2 - Resenhas

Phyllomedusa vaillantii
Machadinho D'Oeste, RO
@Diego José Santana

Boana aff. cipoensis


Tapira, MG
@Jeremiah Jadrien Barbosa
115
HB vol. 10 n.o.21 -- Notas
Notas de
de História
História Natural
Natural &
& Distribuição
Distribuição Geográfica
Geográfica

Notas de História Natural


& Distribuição Geográfica
Hiding and nesting behavior of Stenocercus
roseiventris Duméril & Bibron, 1837 (Reptilia:
Tropiduridae)
Teresa C.S. Avila-Pires1*, Laurie J. Vitt2

1 Museu Paraense Emílo Goeldi, C.P. 399, 66017-970 Belém, PA, Brazil.
2 Sam Noble Museum, 73072 Norman, OK, USA.
* Corresponding author. E-mail: avilapires@museu-goeldi.br
DOI: 10.5281/zenodo.5211444

S
tenocercus roseiventris is an pedition in Acre, Brazil, we collected
inhabitant of tropical rainfor- six specimens (4 females and 2 males)
est in southwestern Amazonia of S. roseiventris and our observations
(Brazil, Peru, Bolivia and northern Ar- agree with those in these later studies,
gentina; Ribeiro-Junior 2015). Fritts refuting the idea that S. roseiventris is
(1974) assumed it would occur in rocky linked to rocky habitats. We also add
habitats, similar to other lizards with a observations on its nesting behavior.
spiny tail. However, other authors (e.g.
Mertens 1942; Meede 1984; Duellman The lizards were observed in undis-
2005) reported the lizard using holes in turbed terra firme forest in the Juruá
tree trunks, logs and buttresses, or holes River Basin, near (in W-NW direction)
in the ground as hiding places in for- Porto Walter, Acre (8o15′ S, 72o46′ W).
est habitats. Hoogmoed (pers. comm.) We worked from a field camp actively
collected a specimen (RMNH 25697) in searching an area of approximately 1
primary forest in Panguana, Peru, on a km2 of the forest as part of a biodiver-
hollow log in which it took refuge and sity survey between 6 February and 18
reappeared after some time. Meede April 1996, during the rainy season (see
(1984) also reported that a male and Vitt & Avila-Pires 1998 for a more de-
a female could be observed on trunks tailed description of the studied area).
only a few meters apart. During an ex-
116
HB vol. 10 n.o 2 - Notas de História Natural & Distribuição Geográfica

Stenocercus roseiventris was observed July (Fig. 6), measuring (snout-vent +


between 3 March and 17 April, always tail length) 38 + 34 mm (MPEG 20630)
during the day. Of the six specimens and 34 + 29 mm (MPEG 20631).
observed, one (female, OMNH 37045)
was on the ground and ran toward ACKNOWLEDGEMENTS
a fallen trunk, entering a hole in it. A
male (MPEG 20618; Figs. 1–2) and a
This research was a convenio between
female (OMNH 37046; Fig. 3), collect-
the Sam Noble Museum (OMNH) and
ed on different days (respectively 3 and
the Museu Paraense Emílio Goeldi
22 March), were on the same fallen
(MPEG), supported by National Sci-
tree trunk. The male was first seen on
ence Foundation grants (DEB-9200779
the trunk, disappeared into a hole, and
and DEB9505518) to L. J. Vitt and J. P.
emerged again later on. The female had
Caldwell. Research and collecting per-
its head sticking out of the hole. Anoth-
mits were issued by Conselho Nacional
er male (OMNH 37047) was on a rel-
de Desenvolvimento Científico e Tec-
atively small log (about 12 cm diame-
nológico (CNPq, Portaria MCT no. 170,
ter) basking in a small patch of sunlight
of 28/09/94) and Instituto Brasileiro
and then ran into a hole, from where it
de Meio Ambiente e Recursos Natu-
was dug out. MPEG 20619, a female,
rais Renováveis (IBAMA, permit no.
was observed on a thick vine close to
073/94-DIFAS). We had the assistance
the ground and disappeared into a hole
of Janallee P. Caldwell and Verônica L.
in the vine. This vine was cut open and
Oliveira in the field, and local logistic
the animal was inside a relatively small
assistance of SOS Amazônia, the Acre
space, completely pressing itself there;
Union of Seringueiros, and people from
in spite of all the cutting, it didn’t move
Porto Walter. João Fabrício de Melo
from the hole, except when it was forced
Sarmento measured the two juvenile
to (by opening the vine).
specimens.

The last specimen collected (MPEG


REFERENCES
20620), on 17 April, was a female. It
was observed partially out of a hole at
Duellman W.E. 2005. Cusco Amazóni-
the top of a vine (about 40 cm high) ris-
co: The Lives of Amphibians and Rep-
ing from the ground; Fig. 4). Excavat-
tiles in an Amazonian Rainforest. Com-
ing the vine, we found two eggs at the
stock Publishing Associates, Ithaca and
bottom (Fig. 5). These were kept in the
London.
laboratory of Museu Paraense Emílio
Goeldi, after returning to Belém-PA,
and they hatched on the 26th and 29th
117
HB vol. 10 n.o 2 - Notas de História Natural & Distribuição Geográfica

Fritts T.H. 1974. A multivariate evolu- Titschack E. (Ed.), Beitrage zur Fauna
tionary analysis of the Andean iguanid Perus, Band II (1). Verlag Gustav Fisch-
lizards of the genus Stenocercus. Mem- er, Jena.
oirs San Diego Society of Natural His-
tory 7:1–89. Ribeiro-Junior M.A. 2015. Catalogue of
distribution of lizards (Reptilia: Squa-
Meede U. 1984. Herpetologische Stu- mata) from the Brazilian Amazonia. I.
dien über Echsen (Sauria) in einem Dactyloidae, Hoplocercidae, Iguanidae,
begrenzten Gebiet des Tropischen Re- Leiosauridae, Polychrotidae, Tropidu-
genwaldes in Peru: morphologische ridae. Zootaxa 3983:1–110.
Kriterien, Autokölogie und Zoogeogra-
phie. Artenliste der Reptilien im Unter- Vitt L.J., Avila-Pires T.C.S. 1998. Ecol-
suchungsgebiet. Doctoral Dissertation, ogy of two sympatric species of Neusti-
Universität Hamburg. curus (Sauria: Gymnophthalmidae) in
the western Amazon of Brazil. Copeia
Mertens R. 1942. Amphibien und Rep- 1998:570–582.
tilien I. (Ausbeute der Hamburger
Südperu-Expedition). Pp 277–287 in
Editor: Henrique C. Costa

Figure 1 - 2 Male Stenoc-


ercus roseiventris, MPEG
20618, in dorsolateral and
ventral views.

118
HB vol. 10 n.o 2 - Notas de História Natural & Distribuição Geográfica

Figure 3. Female S. roseiventris (OMNH 37046) sticking out of a hole.

Figure 4. Vine with hole where the female S. roseiventris MPEG 20620 and
the eggs were found. The hole is c. 40 cm from the ground, with an inner
diameter of c. 3.5 cm.

119
HB vol. 10 n.o 2 - Notas de História Natural & Distribuição Geográfica

Figure 5. Eggs of S. roseiventris shortly after they were collected.

Figure 6. One of the two newly hatched S. roseiventris (MPEG 20630–31).

120
HB vol. 10 n.o 2 - Notas de História Natural & Distribuição Geográfica

Predation attempt on Dermatonotus muelleri


(Boettger, 1885) (Anura: Microhylidae) by Ca-
racara plancus (Miller, 1777) (Aves: Falconidae)
with a new defensive behavior reported
Daniela Sifuentes Batista1, 4, Diego Gomiero Cavalheri²,³*, Sóstenes Pelegrini4, 5,
André Moreira Assalim4, Adriana Akemi Kuniy4, Sarah Mângia³

1 Universidade Federal de Mato Grosso, 78600-000 Barra do Garças, MG, Brazil.


2 Programa de Pós-graduação em Biologia Animal, Instituto de Biociências, Letras
e Ciências Exatas, Universidade Estadual Paulista Júlio de Mesquita Filho, 15054-
000 São José do Rio Preto, SP, Brazil.
3 Instituto de Biocências, Universidade Federal de Mato Grosso do Sul, 79070-900
Campo Grande, MS, Brazil.
4 JGP Consultoria e Participações Ltda. R. Américo Brasiliense 615, 04715-000 São
Paulo, SP, Brazil.
5 Programa de Pós-Graduação em Conservação de Fauna, Centro de Ciências Bi-
ológicas e da Saúde, Universidade Federal de São Carlos, 13565-905 São Carlos, SP,
Brazil.
*Corresponding author. E-mail: diego.cavalheri@unesp.br
DOI: 10.5281/zenodo.5211450

A
mphibians are important et al. 2012, Jones et al. 2021). For this
components of the trophic reason amphibians exhibit numerous
networks in many ecosys- strategies to avoid predators, includ-
tems, in different life stages, as prey for ing stiff-legged behavior, puffing up the
both vertebrates and invertebrates (To- body, and production of harmful secre-
ledo 2005, Toledo et al. 2007, Haddad tions (Toledo et al. 2011).
et al. 2013). Although some animals
eat frogs opportunistically (e.g. De- At 10:15h on 24 November 2020,
laix-Zaqueo et al. 2017, Cavalcante et during a wildlife rescue in São Gonça-
al. 2019, Güell et al. 2019), anurans lo do Gurguéia municipality (10.115°S,
represent a significant part of the diet 45.285°W), state of Piauí, northeastern
of many species (e.g. Menin et al. 2005, Brazil, we observed an adult Southern
Toledo 2005, Toledo et al. 2007, Costa Caracara, Caracara plancus (Falco-
121
HB vol. 10 n.o 2 - Notas de História Natural & Distribuição Geográfica

nidae) manipulating an object on the riol & Gomes 2009), they appear to be
ground with its foot. The action was an occasional prey item (Vargas et al.
recorded using a video camera and the 2007). This species is known to fol-
video is deposited in Fonoteca Neo- low agricultural machinery to eat un-
tropical Jacques Vielliard – under the earthed animals (see Sazima & Augusto
voucher ZUEC-VID 952. We identified 1991; Zamprogno & Sazima 1993, Assis
the potential prey as a Müller’s termite & Costa 2020). The reaction of the Ca-
frog, Dermatonotus muelleri, a bur- racara of shaking its head immediately
rowing species from the diagonal belt after pecking the frog was probably due
of open formations in Paraguay, Bo- to the secretions from the D. muelleri’s
livia, Argentina, and Brazil (Oliveira et skin (see Cavalcante et al. 2017). The
al. 2018). While the Caracara attacked behavior was similar to the reaction of
the frog, the frog puffed up the body chickens after attempting to prey on
(Fig. 1A). After using its foot 14 times, Brachycephalus ephippium (see sup-
the Caracara pecked once (Fig. 1B) and plementary videos of Rebouças et al.
immediately shook its head (Fig. 1C). 2019), another toxic anuran.
Fifteen seconds later, the bird moved
away from the prey and, one minute This is also the first report of the defen-
later, flew away. After two minutes, one sive behavior of puffing up the body in
of us (DSB) approached and handled D. muelleri. This behavior consists of
the frog, which remained puffed up filling the lungs with air to increase the
and appeared to have an injury on its size of the frog, discouraging the preda-
back (Fig. 1D). Slimy glandular secre- tor (Toledo et al. 2011). The association
tion by the skin is a mechanism of de- of this defensive behavior and skin se-
fense of amphibians, usually activated cretion has been documented for other
by stress or injury, and the secretions amphibians (Toledo et al. 2011, Mene-
vary from odoriferous to extraordinari- ses & Corrêa 2020). Combining defen-
ly toxic (Toledo & Jared 1995, Gomes sive behaviors results in a higher chance
et al. 2007; Vitt & Caldwell 2013). After of escape from potential predators that
external examination, DSB released the are discouraged only when multiple sig-
frog in a safe location. nals are displayed (Toledo et al. 2011).
While some anurans produce skin se-
The Southern Caracara is a bird of prey cretion at the same time as puffing up
with a generalist diet, feeding on in- the body (e.g. Physalaemus nattereri,
sects, fish, mammals, birds, reptiles, Lenzi-Mattos et al. 2005, Odontophry-
and amphibians (Vargas et al. 2007, nus spp. Borteiro et al. 2018), others
Idoeta & Roesler 2012). Although am- use this strategy only after physical
phibians are included in its diet (Croza- contact (e.g. Centrolene savagei, Esco-
122
HB vol. 10 n.o 2 - Notas de História Natural & Distribuição Geográfica

bar-Lasso & Rojas-Morales 2012). For Borteiro C., Rosset S.D., Kolenc F., Bar-
D. muelleri, the synergistic behavior of rasso D.A., Lescano J.N., Baldo D. 2018.
puffing up the body and the skin secre- Stereotyped defensive behaviours in
tion was effective in repelling the Crest- frogs of the genus Odontophrynus
ed Caracara. Despite some records of (Amphibia: Anura: Odontophrynidae).
predation on D. muelleri (Wild 2001, Current Herpetology 37:172–179. doi:
Gavira et al. 2008, Stănescu et al. 2014, 10.5358/hsj.37.172
Caldas et al. 2017, Leal et al. 2018, An-
drade et al. 2020) little is known about Caldas F.L.S., Almeida B.J.M., Santos
how its defensive strategies act against R.A. 2017. Predation of Dermatono-
possible predators. tus muelleri (Anura, Microhylidae) by
Guira guira (Cuculiformes, Cuculidae)
ACKNOWLEDGMENTS in the coastline of the Sergipe state,
northeastern Brazil. Pesquisa e Ensi-
DGC thanks Coordenação de Aper- no Em Ciências Exatas e Da Natureza
feiçoamento de Pessoal de Nível Supe- 1:95–98. doi: 10.29215/pecen.v1i2.447
rior - Brasil (CAPES) - Funding code
001. Cavalcante I.D., Antoniazzi M.M., Jar-
ed C., Pires O.R., Sciani J.M., Pimen-
REFERENCES ta D.C. 2017. Venomics analyses of the
skin secretion of Dermatonotus muel-
leri: Preliminary proteomic and metab-
Andrade H., Moura S., Almeida M.,
olomic profiling. Toxicon 130:127–135.
José E. 2020. Diet review of Erythrol-
doi: 10.1016/j.toxicon.2017.02.028
amprus poecilogyrus (Wied-Neuwied,
1825) (Serpentes: Dipsadidae), and
first record of Dermatonotus muelleri Cavalcante, T. Simões, P. I. Mourthe,
(Boettger, 1885) (Anura: Microhylidae) I. 2019. Predation of Boana boans
as a prey item in Sergipe State, north- (Anura, hylidae) by an opportunistic
eastern Brazil. Herpetology Notes frugivorous primate. Acta Amazon-
13:1065–1068. ica 49:307–310. doi: 10.1590/1809-
4392201901430
Assis C., Costa H.C. 2020. Leposternon
octostegum: New record of an endan- Costa H.C., Martins L.B., Carvalho T.R.
gered worm lizard species, with com- 2012. Xenodon neuwiedii (Serpentes:
ments on habitat and opportunistic Xenodontinae): Dieta. Herpetologia
predators (Squamata: Amphisbaenia). Brasileira 1:38–40.
Herpetologia Brasileira 9:109–120.
123
HB vol. 10 n.o 2 - Notas de História Natural & Distribuição Geográfica

Crozariol M.A., Gomes F.B.R. 2009. Güell B.A., González K., Pedroso-San-
Predação de Leptodactylus fuscus tos F. 2019. Opportunistic predation
(Schneider, 1799) (Anura: Leptodac- by two aquatic-feeding predators on
tylidae) por Caracara plancus (Miller, an explosive-breeding aggregation of
1777) (Aves: Falconidae), com notas so- arboreal gliding treefrogs (Agalychnis
bre história natural , no Vale do Paraíba spurrelli Boulenger, 1913; Anura: Phyl-
do Sul , SP. Atualidades Ornitológicas lomedusidae) on the Osa Peninsula of
149:4–5. Costa Rica. Herpetology Notes 12:795–
798.
Delaix-Zaqueo K., Melo-Sampaio P.R.,
Oliveira I.L.A., Miranda G.K.D., Cal- Haddad C.F.B., Toledo L.F., Prado
deron L.A. 2017. The opportunistic be- C.P.A., Loebmann D., Gasparini J.L.L.,
havior of a common predator in aquat- Sazima, I. 2013. Guia dos anfíbios da
ic systems in Amazonia: predation on Mata Atlântica: Diversidade e biologia.
robber-frog Pristimantis cf. fenestratus Editora Anolisbooks, São Paulo.
by trahira Hoplias malabaricus (Bloch,
1794). Herpetology Notes 10:425–427. Idoeta F.M., Roesler I. 2012. Presas
consumidas por el Carancho (Caracara
Escobar-Lasso S., Rojas-Morales J. plancus) durante el periodo reproduc-
2012. Antipredatory Behaviors of the tivo, en el noroeste de la provincia de
Colombian Endemic Glassfrog Centro- Buenos Aires. Nuestras Aves 57:80–83.
lene savagei (Anura: Centrolenidae).
Boletín Científico Museo de Historia Jones P.L., Divoll T.J., Dixon M.M.,
Natural 16:226–232. Aparicio D., Cohen G., Mueller U.G., ...
Page R.A. 2021. Sensory ecology of the
Gavira R.S.B., Bovo R.P., Andrade D.V. frog-eating bat, Trachops cirrhosus,
2008. Rhinella schneideri. Diet. Her- from DNA metabarcoding and behav-
petological Review 44:657. ior. Behavioral Ecology 31:1420–1428.
doi: 10.1093/beheco/araa100
Gomes A., Giri B., Saha A., Mishra R.,
Dasgupta S.C., Debnath A., Gomes A. Leal E.S.B., Chaves L.S., Prado-Neto
2007. Bioactive molecules from am- J.G., Passos-Filho P.B., Ramalho D.F.,
phibian skin: Their biological activities Guerra-Filho D.Q., … Moura G.J.B.
with reference to therapeutic potentials 2018. What constitutes the menu of
for possible drug development. Indi- Trachops cirrhosus (Chiroptera)? a re-
an Journal of Experimental Biology view of the species’ diet. Neotropical
45:579–593. Biology and Conservation 13:337–346.
doi: 10.4013/nbc.2018.134.08
124
HB vol. 10 n.o 2 - Notas de História Natural & Distribuição Geográfica

Lenzi-Mattos R., Antoniazzi M.M., 55:39–47.


Haddad C.F.B., Tambourgi D.V., Ro-
drigues M.T., Jared C. 2005. The in- Sazima I., Augusto S.A. 1991. Habits of
guinal macroglands of the frog Phys- five brazilian snakes with coral-snake
alaemus nattereri (Leptodactylidae): pattern, including a summary of de-
Structure, toxic secretion and relation- fensive tactics. Studies on Neotropical
ship with deimatic behaviour. Journal Fauna and Environment 26:159–164.
of Zoology 266:385–394. doi: 10.1080/01650529109360848

Meneses A.S.O., Corrêa B.A.A.P. 2020. Stănescu F., Marangoni F., Reinko
Defensive behaviors in two Procerato- I. 2014. Predation of Dermatonotus
phrys species (Anura: Odontophrynidae) muelleri (Boettger 1885) by Lepidoba-
from central Brazilian Cerrado. Cuader- trachus llanensis Reig and Cei 1963.
nos de Herpetología 34:265–269. doi: Herpetology Notes 7:683–684.
10.31017/cdh.2020.(2019-039)
Toledo L.F., Ribeiro R.S., Haddad
Menin M., Rodrigues D.J., Azevedo C.F.B. 2007. Anurans as prey: An ex-
C.S. 2005. Predation on amphibians ploratory analysis and size relation-
by spiders (Arachnida, Araneae) in ships between predators and their prey.
the Neotropical region. Phyllomedu- Journal of Zoology 271:170–177. doi:
sa 4:39–47. doi: 10.11606/issn.2316- 10.1111/j.1469-7998.2006.00195.x
9079.v4i1p39-47
Toledo L.F., Sazima I., Haddad
Oliveira E.F., Gehara M., São-Pedro C.F.B. 2011. Behavioural defenc-
V.A., Costa G.C., Burbrink F.T., Col- es of anurans: an overview. Etholo-
li G.R., Rodrigues M.T., Garda A.A. gy Ecology & Evolution 23:1–25. doi:
2018. Phylogeography of Muller’s ter- 10.1080/03949370.2010.534321
mite frog suggests the vicariant role of
the Central Brazilian Plateau. Journal
Toledo L.F. 2005. Predation of juvenile
of Biogeography 45:2508–2519. doi:
and adult anurans by invertebrates:
10.1111/jbi.13427
Current knowledge and perspectives.
Herpetological Review 36:395–400.
Rebouças R., Carollo A.B., Freitas M.O.,
Lambertini C. Santos, R.M.N., Toledo
Toledo R.C., Jared C. 1995 Cutaneous
L.F. 2019. Is the conspicuous dorsal
granular glands and amphibian ven-
coloration of the atlantic forest pump-
oms. Comparative Biochemistry and
kin toadlets aposematic? Salamandra
Physiology 111:1–29.
125
HB vol. 10 n.o 2 - Notas de História Natural & Distribuição Geográfica

Vargas R.J., Bó M.S., Favero M. 2007. Wild E. R. 2001. Ceratophrys cranwelli


Diet of the Southern Caracara (Caraca- (Cranwell’s Horned) Frog. Predation.
ra plancus) in Mar Chiquita Reserve, Herpetological Review 32:102.
Southern Argentina. Journal of Rap-
tor Research 41:113–121. Zamprogno C., Sazima I. 1993. Verte-
brate predation on the neotropical Am-
Vitt L.J., Caldwell J.P. 2013. Herpetol- phisbaenian Leposternon wucherer.
ogy: An Introductory Biology of Am- Herpetological Review 24:82–83.
phibians and Reptiles. Academic Press.
Fourth Edition. doi: 10.1016/C2010-0- Editor: Henrique C. Costa
67152-5

Figure 1. Sequence of events during a predation attempt on Dermatonotus muelleri by Caracara


plancus. A) an adult C. plancus manipulating the frog (indicated with a red arrow) with its foot;
B) the C. plancus pecking the D. muelleri; C) C. plancus shaking its head and moving away from
the frog; D) an injury on the dorsum of the D. muelleri, indicated by a red arrow.
126
HB vol. 10 n.o 2 - Notas de História Natural & Distribuição Geográfica

Predation of Hylodes phyllodes (Anura: Hylodi-


dae) by Trechaleoides sp. (Araneae: Trechaleidae)
Lucas Machado Botelho, Mariana Pedrozo*, Matheus de Toledo Moroti, Edelcio
Muscat

Projeto Dacnis, Estrada do Rio Escuro 4754, Sertão das Cotias, Ubatuba, São Paulo,
Brazil.
* Corresponding author. E-mail: mariana.pedrozo.24@gmail.com
DOI: 10.5281/zenodo.5211467

A
nurans are small to medi- evidence that populations of Hylodes
um-sized amphibians with phyllodes, although classified as least
generally numerous popula- concern (LC) in the IUCN red list, are
tions and intense social behavior during decreasing (Rocha et al. 2010).
reproductive periods (Pombal 2007).
These characteristics make them part In this article we describe a feeding be-
of the diet of many vertebrates and in- havior by a fishing spider Trechaleoides
vertebrates (Toledo et al. 2007; Costa sp. on a Boraceia stream frog Hylodes
et al. 2010). Among invertebrates, ar- phyllodes Heyer and Cocroft, 1986, ob-
thropods are anurans’ main predators served during routine night monitoring
(Menin et al. 2005; Toledo 2005), and at the Projeto Dacnis private reserve
there are many records of this rela- (-23.464397º, -45.129784º; WGS-84;
tionship in literature (e.g. Giarsa et al. 135m above sea level) in Ubatuba, state
2012; Muscat et al. 2014; Pedrozo et al. of São Paulo, Brazil.
2017; Assis et al. 2018; Menegucci et al.
2020). Although these records have in-
The predation event was observed on
creased recently, the predation of ver-
January 18, 2021, at 19:56, in a stream
tebrates by arthropods remains under-
with small waterfalls in an ombrophi-
estimated (Valdez 2020). New records
lous forest environment. Temperature
of these events improve understanding
was 26.1ºC and air humidity was 97.3%.
of prey-predator interactions and how
The spider was identified following pa-
they can shape vertebrate populations
rameters suggested by Carico (2005):
and communities, especially for threat-
carapace length between 6.1 - 11.0 cm;
ened species (Valdez 2020). There is
legs varying in length, with the third
127
HB vol. 10 n.o 2 - Notas de História Natural & Distribuição Geográfica

pair usually shortest, the remainder chaleoides biocellata. In our record, the
similar in size; only the tarsus is flexi- presence of the researchers influenced
ble. The study area is within the range the predation event, because H. phyl-
proposed by Carico (2005) for this spi- lodes probably jumped into the water
der genus. The frog was identified by its because of the researcher’s approach.
advertisement call, habit, and a combi- Since H. phyllodes is diurnal (Hart-
nation of morphological characters de- mann et al. 2006) and Trechaleoides
scribed by Heyer & Cocroft (1986). spiders are nocturnal and locate prey
by detecting oscillations on the water
The spider was stalking hunting at surface (Silva et al. 2005), our approach
the stream edge while an individual of may have facilitated opportunistic pre-
Hylodes phyllodes rested on a rock in dation by the spider.
the stream, upstream from the spider.
When an observer approached, the frog Although anurans have numerous es-
jumped into the stream and was carried cape mechanisms, they represent about
by the current; the spider caught the 40% of vertebrate prey captured by ar-
frog in the water, and carried it to a dry thropods (Valdez 2020). This is largely
spot at the margin. The frog tried to es- due to the ease of penetration of their
cape for approximately three minutes, skin, which would allow them to be
but the spider’s chelicerae were firmly preyed upon by virtually anything (Du-
pinned to the anuran’s hindquarters ellman & Trueb 1994; Valdez 2020).
(Fig. 1A). The spider finally managed to Due to the nocturnal habits and enig-
immobilize the prey completely by em- matic behavior of arthropods, reports
bedding its chelicerae in its dorsal re- of predation on vertebrates are under-
gion. It then began feeding on the frog sampled. Therefore, these records are
(Fig. 1B). The H. phyllodes continued essential for a better understanding
breathing – its vocal sac moved – for of prey-predator interactions between
about two minutes after being immo- arthropods and vertebrates, which are
bilized. We did not collect the individ- understudied compared to other taxa
uals. However, we recorded the preda- (Nordberg et al. 2018; Valdez 2020).
tion event and deposited the video at
Fonoteca Neotropical Jacques Vielliard Trechaleoides spiders are frequently
(ZUEC-VID 949– 951). seen on stream margins in the study
area. Because they belong to a family of
This behavior is similar to the obser- spiders considered to be opportunistic
vation by Gaiarsa et al. (2012) during and stalking predators (Santos 2014),
predation of a juvenile Cycloramphus they can act directly on the populations
boraceiensis (Cycloramphidae) by Tre- of small species in this environment,
128
HB vol. 10 n.o 2 - Notas de História Natural & Distribuição Geográfica

such as Hylodes phyllodes. New nat- Costa-Pereira R., Martins F.I., Scze-
ural history observations and studies sny-Moraes E.A., Brascovit A. 2010.
can reveal more about these species, as Predação de anuros jovens (Osteo-
well as others that may be part of the cephaus taurinus) por artrópodes
diet of Trechaleiodes sp., contributing (Insecta, Mantodea e Arachnida, Ara-
to the understanding of predator-prey neae) no Brasil Central. Biota Neotrop-
interactions and conservation of these ica 10:469–472. doi: 10.1590/S1676-
species. 06032010000300042

ACKNOWLEDGMENTS Duellman W.E., Trueb L. 1994. Biology


of amphibians. Johns Hopkins Univer-
We thank Alex Mariano for field assis- sity Press, Baltimore.
tance and Elsie Rotenberg for the En-
glish revision and considerations in Giarsa M.P., Alencar L.R.V., Dias C.J.,
the manuscript. We also thank Pedro Martins, M. 2012. Predator or prey?
H. Martins for the spider identification Predatory interactions between the frog
and Simone Dena from Fonoteca Neo- Cycloramphus boraceiensis and the
tropical Jacques Vielliard for the vouch- spider Trechaleoides biocellata in the
er numbers. We would like to thank Dr. Atlantic Forest of Southeastern Brazil.
Renata Pirani for the thoughtful com- Herpetology Notes 5:67–68.
ments to improve the manuscript.
Hartmann M.T., Hartmann P.A., Hadd-
REFERENCES ad C.F.B. 2006. Repertório vocal de
Hylodes phyllodes (Amphibia, Anura,
Assis R.A., Borges R.E., Souza M.B., Hylodidae). Papéis Avulsos de Zoolo-
Barros J.F., Santos L.R.S. 2018. Reg- gia 46:203–209. doi: 10.1590/S0031-
istro de predação de Pseudopaludi- 10492006001700001
cola saltica (Anura: Leptodactylidae)
por aranha-lobo (Araneae: Lycosidae). Heyer W.R., Cocroft, R.B. 1986. De-
Oecologia Australis 22:291–295. doi: scriptions of two new species of Hy-
10.4257/oeco.2018.2203.07 lodes from the Atlantic Forests of Brazil
(Amphibia: Leptodactylidae). Proceed-
Carico J.E. 2005. Descriptions of two ings of the Biological Society of Wash-
new spider genera of Trechaleidae (Ara- ington 99:100–109.
neae, Lycosoidea) from South America.
Journal of Arachnology 33:797–812. Menegucci R.C., Muscat E., Tanaka
doi: 10.1636/H03-71.1 R.M., Stuginski D. 2020. Predation on
129
HB vol. 10 n.o 2 - Notas de História Natural & Distribuição Geográfica

Hylodes phyllodes (Anura: Hylodidae) no sudeste do Brasil. Revista Brasileira


by the harvestman Heteromitobates de Zoologia 24:841–843. doi: 10.1590/
discolor (Arachnida: Opiliones). Phyl- S0101-81752007000300034
lomedusa 19:121–124. doi: 10.11606/
issn.2316-9079.v19i1p121-124 Rocha C.F., Sluys M.V., Telles A.M.,
Bertoluci J. 2010. Hylodes phyllodes.
Menin M., Rodrigues D.J., Azevedo The IUCN Red List of Threatened
C.S. 2005. Predation on amphibians Species 2010: e.T57100A11577851.
by spiders (Arachnida, Araneae) in doi: 10.2305/IUCN.UK.2010-2.RLTS.
the Neotropical region. Phyllomedu- T57100A11577851.en. Downloaded on
sa 4:39–47. doi: 10.11606/issn.2316- 09 June 2021.
9079.v4i1p39-47
Santos J.F. 2014. O aumento do taman-
Muscat E., Rotenberg E.L., Chagas C.A. ho melhora a eficiência de captura de
2014. Predation of Scinax littoralis presas de aranhas pescadoras (Aracni-
(Anura: Hylidae) by Eriophora fuligi- da: Trechaleidae). Ecologia da Floresta
nea (Aranae: Araneidae) in Southeast- Amazônica: 262–268.
ern Brazil. Herpetology Notes 7:196–
170 Silva E.L.C., Picanco J.B., Lise A.A.
2005. Notes on the predatory behav-
Nordberg E.J., Edwards L., Schwarz- ior and habitat of Trechalea biocellata
kopf L. 2018. Terrestrial inverte- (Araneae, Lycosoidea, Trechaleidae).
brates: An underestimated preda- Biociências 3:85–88.
tor guild for small vertebrate groups.
Food Webs 15:e00080. doi: 10.1016/j. Toledo L.F. 2005. Predation of juvenile
fooweb.2018.e00080 and adult anurans by invertebrates:
current knowledge and perspectives.
Pedrozo M., Almeida L.S., Moroti Herpetological Review 36:395–400.
M.T., Santana D.J. 2017. Predation on
Physalaemus olfersii (Anura: Lepto- Toledo L.F., Ribeiro R.S., Haddad
dactylidae) by Phoneutria nigriventer C.F.B. 2007. Anurans as prey: an ex-
(Aranae: Ctenidae) in Atlantic Forest, ploratory analysis and size relation-
Southeast of Brazil. Herpetology Notes ships between predators and their
10:369–371. prey. Journal of Zoology 271:170–177.
doi:10.1111/j.1469-7998.2006.00195.x
Pombal J. 2007. Notas sobre predação
em uma taxocenose de anfíbios anuros
130
HB vol. 10 n.o 2 - Notas de História Natural & Distribuição Geográfica

Valdez J.W. 2020. Arthropods as ver-


tebrate predators: A review of global
patterns. Global Ecology and Biogeog-
raphy 29:1691–1703. doi: 10.1111/geb
.13157

Editora: Sarah Mângia

Figure 1. Capture (A) and predation (B) of Hylodes phyllodes by a Trechaleoides spider at the
Projeto Dacnis private reserve in Ubatuba, state of São Paulo, Brazil.

131
HB vol. 10 n.o 2 - Notas de História Natural & Distribuição Geográfica

Maximum length and notes on the habitat of Caeci-


lia gracilis (Amphibia: Gymnophiona: Caeciliidae)
Adriano Oliveira Maciel1*, Ana Lúcia da Costa Prudente2

1 Programa de Capacitação Institucional, Coordenação de Zoologia, Museu Par-


aense Emílio Goeldi, C.P. 399, 66017-970 Belém, PA, Brasil.
2 Laboratório de Herpetologia, Coordenação de Zoologia, Museu Paraense Emílio
Goeldi, C.P. 399, 66017-970 Belém, PA, Brasil.
*Corresponding author. E-mail: aombiologo@yahoo.com.br
DOI: 10.5281/zenodo.5211478

C
aecilia gracilis Shaw, 1802 is On 04 June 2020, approximately 8:30
a terrestrial caecilian widely a.m., two individuals of Caecilia graci-
distributed throughout Am- lis were found by construction workers
azonia in Brazil, French Guiana, Guy- while digging to build the foundation for
ana, Peru, and Suriname, and also a new house (1°21′56.4′′ S, 48°26′21.3′′
found in riparian forests in the adjacent W; elevation 14 m), in the municipal-
Cerrado in Brazil (Maciel & Hoogmoed ity of Belém, state of Pará, Brazil. The
2011). This species is one of the few individuals were buried approximate-
Neotropical caecilians in which some ly 40 cm deep in partially flooded soil
basic ecological information is known. covered mainly by grasses (Fig. 1) and
In a riparian forest population in the were delivered to ALCP, who resides in
Brazilian Cerrado, the species did not the neighborhood. The caecilians ex-
exhibit sexual size dimorphism, was al- hibited some injuries on their bodies
ways found close to water, fed mainly probably caused by the hoes used in the
on earthworms, and migrated to great- excavations and were deposited in the
er depths in the dry season (Maciel et Herpetological collection of the Museu
al. 2012). Furthermore, C. gracilis is Paraense Emílio Goeldi (MPEG 43054
known to be preyed by the hawk Pseu- and 43055).
dastur albicolis (Latham, 1790) (Tay-
lor 1968) and the snake Anilius scytale MPEG 43054 is a mature male (Fig.
(Linnaeus, 1758) (Taylor 1968; Maschio 2) with total length 920 mm, mass 55
et al. 2010). g, primary annuli 218, and secondary
grooves 33. MPEG 43055 is a gravid
132
HB vol. 10 n.o 2 - Notas de História Natural & Distribuição Geográfica

female with total length 810 mm, mass was Kaolin (sedimentary rock rich in
82.5 g, primary annuli 194, and second- Kaolinite clay) which was saturated
ary grooves 31. Numbers of annuli are with water (Stahel & Geijskes 1939). In
within the known range of the species, the Brazilian Cerrado, the species was
except for the number of primaries in found only in humid or partially flood-
MPEG 43054, which has 218, greater ed soils in forest (Maciel et al. 2012).
than the known range of 177 − 208 (Ma-
ciel & Hoogmoed 2011). Despite this, Considering the wide distribution of
we have no reason to assign this speci- the species, the available data in the lit-
men to a species other than C. gracilis. erature is very scarce. Reviewing data
To date, the largest known specimen of of 50 Amazonian specimens of Caeci-
C. gracilis is from Viseu, Pará, Brazil, lia gracilis in the Herpetological col-
a male with a total length of 735 mm lection of MPEG, we found that only
(Maciel & Hoogmoed 2011). We there- 11 individuals have accurate collection
fore report a new known maximum size data that includes the habitat where
of 920 mm for the species, based on our they were found. These 11 specimens
newly collected specimens. were collected near water bodies: on
the MPEG Research Campus in Belém,
The habitat where the individuals were MPEG 38610 was found near a per-
found is a partially flooded area that manent pond; on the Campus of the
was deforested for the construction of Universidade Federal do Pará, MPEG
residences. The closest forested area 31052 was collected in an area of Ig-
is a small fragment, approximately 2.3 apó, which is flooded daily by the tides
ha, 340 m from the locality of our re- on the Guamá River; MPEG 29421 was
cord (Fig.1 and Fig. 3), which demon- found swimming in an Igapó Forest, in
strates that this species may persist in the municipality of Tracuateua, state
areas covered only by underbrush veg- of Pará; and in Melgaço, state of Pará,
etation, if moist soil is available. MPEG 15741 was collected in a pitfall
trap in an area that has been inundat-
In Suriname, a specimen documented ed. Thus, we suggest that this species
by Nussbaum & Hoogmoed (1979) was lives close to water bodies and depends
collected by Stahel & Geijskes (1939) on high levels of humidity in the soil.
during excavation of a nest of the ant
Atta sexdens (Linnaeus, 1758) in a for- In comparison with some other terres-
ested area. The nest was close to a riv- trial caecilians with which may live in
er that expands in the rainy season to sympatry, such as Siphonops paulensis
form a lake; the top layer of soil was Boettger, 1892 in the Cerrado (Maciel et
black and full of roots and below this al. 2012), S. annulatus (Mikan, 1822),
133
HB vol. 10 n.o 2 - Notas de História Natural & Distribuição Geográfica

and Caecilia tentaculata Linnaeus, tat preferences of most species are still
1758 in the Amazonia (AOM, personal unknown. Therefore, we encourage the
observation), C. gracilis releases much study of the ecology of neotropical cae-
less mucus from its skin when handled, cilians.
dries quickly, and has difficulty moving
(AOM, personal obs). It is possible that ACKNOWLEDGEMENTS
this species is more susceptible to des-
iccation than other caecilians, which
We thank Marinus Hoogmoed for the
may indicate a preference for humid
translation of Stahel & Geijskes (1939)
habitats.
providing the data for a Suriname spec-
imen. AOM is supported financially by
Siphonops paulensis can inhabit dry the Programa de Capacitação Insti-
areas where no other caecilians are tucional (MPEG/MCTI) grant number
known (Montero et al. 2005; Maciel et 301286/2020 5. Permits for collecting
al. 2012), and was never found in the were issued by ICMBio (10569-3).
same microhabitats as C. gracilis in the
Cerrado (Maciel et al. 2012). Siphonops
REFERENCES
annulatus and C. tentaculata are found
generally in humid rainforests (Nuss-
Boettger O. 1892. Katalog der Batrach-
baum & Hoogmoed 1979; Montero et
ier-Sammlung im Museum der Senck-
al. 2005; Borges-Nojosa et al. 2017),
enbergischen Naturforschenden Ge-
but can be observed in areas which
sellshaft in Frankfurt am Main.
are very dry during periods of reduced
rainfall (AOM, personal observation).
However, comparative morphological Borges-Nojosa D.M., Castro D.P., Lima
studies of the integument and physiol- D.C., Bezerra, C.H., Maciel A.O., Har-
ogy of these species are necessary. ris D.J. 2017. Expanding the known
range of Caecilia tentaculata (Amphib-
ia: Gymnophiona) to relict mountain
In Africa and Asia, where several spe-
forests in northeastern Brazil: linking
cies were studied under quantitative
Atlantic forests to the Amazon? Sala-
ecological methods, terrestrial caeci-
mandra 53:429–434.
lians are known to occupy a variety of
habitats, from forests to agricultural
and other anthropogenic habitats (e.g. Gaborieau O., Measey G.J. 2004. Ter-
Oommen et al. 2000; Gaborieau & mitivore or detritivore? A quantitative
Measey 2004; Gower et al. 2004; Kup- investigation into the diet of the East
fer et al. 2005; Kouete & Blackburn African caecilian Boulengerula taita-
2020). In the Neotropical region, habi- nus (Amphibia: Gymnophiona: Caecili-
134 idae). Animal Biology 54:45–56.
HB vol. 10 n.o 2 - Notas de História Natural & Distribuição Geográfica

Gower D.J., Loader S.P., Moncrieff teribus, differentiis, synonymis, locis.


C.B., Wilkinson M. 2004. Niche sepa- Tomus I. Editio decima, reformata.
ration and comparative abundance of Laurentii Salvii, Holmiae. doi:doi.
Boulengerula boulengeri and Scoleco- org/10.5962/bhl.title.68927
morphus vittatus (Amphibia: Gymno-
phiona) in an East Usambara forest, Maciel A.O., Hoogmoed M.S. 2011.
Tanzania. African Journal of Herpe- Taxonomy and distribution of caeci-
tology 53:183–190. doi:10.1080/21564 lian amphibians (Gymnophiona) of
574.2004.9635510 Brazilian Amazonia, with a key to their
identification. Zootaxa 2984:1–53.
Kouete M.T., Blackburn D.C. 2020. Di- doi:10.11646/zootaxa.2984.1.1
etary partitioning in two co-occurring
caecilian species (Geotrypetes seraphi- Maciel A.O., Gomes J.O., Costa J.C.L.,
ni and Herpele squalostoma) in Cen- Andrade G.V. 2012. Diet, microhabitat
tral Africa. Integrative Organismal Bi- use, and an analysis of sexual dimor-
ology 2:1–16. doi:10.1093/iob/obz035 phism in Caecilia gracilis (Amphibia:
Gymnophiona: Caeciliidae) from a ri-
Kupfer A., Nabhitabhata J., Himstedt parian forest in the Brazilian Cerrado.
W. 2005. Life history of amphibians in Journal of Herpetology 46:47–50.
the seasonal tropics: habitat, commu-
nity and population ecology of a cae- Maschio G.F., Prudente A.L.C., Ro-
cilian (genus Ichthyophis). Journal of drigues F.S., Hoogmoed M.S. 2010.
Zoology of London 266:237–247. doi: Food habits of Anilius scytale (Ser-
10.1017/S0952836905006849 pentes: Aniliidae) in the Brazilian Am-
azonia. Zoologia 27:184–190.
Latham J. 1790. Index ornithologi-
cus, sive systema ornithologae; com- Mikan J.C. 1822. Delectus Florae et
plectens avium divisionem in classes, Faunae Brasiliensis. Fasicule 2. Vindo-
ordines, genera, species, ipsarumque bonae: Antonii Strauss.
varietates: adjectis synonymis, locis,
descriptionibus, &c. Volumen I. - pp.
Montero I., Reichle S., Kupfer A. 2005.
i-xviii [= 1-18], 1-466. Londini. (Leigh
Observations on the reproductive ecol-
& Sotheby).
ogy of Siphonops paulensis Boettger,
1892 (Gymnophiona: Caeciliidae) in
Linnaeus C. 1758. Systema naturae per Bolivia. Salamandra 41:91–94.
regna tria naturae, secundum classes,
ordines, genera, species, cum charac-

135
HB vol. 10 n.o 2 - Notas de História Natural & Distribuição Geográfica

Nussbaum R.A., Hoogmoed M.S. 1979.


Surinam caecilians, with notes on Rhi-
natrema bivittatum and the description
of a new species of Microcaecilia (Am-
phibia, Gymnophiona). Zoologische
Mededelingen 54:217–235.

Oommen O.V., Measey G.J., Gower


D.J., Wilkinson M. 2000. Distribu-
tion and abundance of the caecilian
Gegeneophis ramaswamii (Amphib-
ia: Gymnophiona) in southern Kerala.
Current Science 79:1386–1389.

Shaw G. 1802. General Zoology or Sys-


tematic Natural History. Volume III,
Part 1. Amphibia. London: Thomas
Davison.

Stahel G., Geijskes D.C. 1939. Über den


Bau der Nester von Atta cephalotes L.
und Atta sexdens L. (Hym. Formici-
dae). Revista de Entomologia 10,1:27–
78.

Taylor E.H. 1968. The Caecilians of


the world: a taxonomic review: 1–845.
University of Kansas Press, Lawrence.

Editora: Sarah Mângia

136
HB vol. 10 n.o 2 - Notas de História Natural & Distribuição Geográfica

Figure 1. Site where the two Caecilia gracilis were found


buried in partially flooded soil in Belém municipality, state
of Pará, Brazil.

Figure 2. Male of Caecilia graci-


lis (MPEG 43054) total length 920
mm, Belém municipality, state of
Pará, Brazil.

137
HB vol. 10 n.o 2 - Notas de História Natural & Distribuição Geográfica

Figure 3. Partial aerial view of Belém showing the locality where the two Caecilia gracilis were
found (red dot), and the nearest forest fragment (yellow line) which is 340 m from the locality.
Image captured from Google Earth Pro.

138
HB vol. 10 n.o 2 - Notas de História Natural & Distribuição Geográfica

Predation attempt of Ameivula cipoensis (Squama-


ta: Teiidae) by Tropidurus montanus (Squamata:
Tropiduridae): A citizen science case
André Yves1,2*, Celso Henrique V. Rios3, Lúcio M. C. Lima4, Saulo M. C. Araújo5,
Juliana G. Ferreira6, Sônia H. S. T. de Mendonça6, Henrique C. Costa2,4

1 Programa de Pós-Graduação em Ecologia, Instituto Nacional de Pesquisas da


Amazônia, 69067-375 Manaus, AM, Brazil
2 Laboratório de Herpetologia, Departamento de Zoologia, Universidade Federal de
Juiz de Fora, 36036-900 Juiz de Fora, MG, Brazil
3 Hileia Consultoria Ambiental Ltda., 05580-050 São Paulo, SP, Brazil.
4 Programa de Pós-Graduação em Biodiversidade e Conservação da Natureza, Uni-
versidade Federal de Juiz de Fora, 36036-900 Juiz de Fora, MG, Brazil
5 Conexão Verde Cia. de Aventuras, 35847-000 Santana do Riacho, MG, Brazil
6 Centro Nacional de Pesquisa e Conservação de Répteis e Anfíbios, Base Avançada
do RAN em Minas Gerais, Instituto Chico Mendes de Conservação da Biodiversi-
dade, 33239-060 Lagoa Santa, MG, Brazil
*Corresponding author. E-mail: andreyves7@gmail.com
DOI: 10.5281/zenodo.5211489

U
nderstanding interspecific Tropidurus montanus is a lizard spe-
interactions, especially pre- cies endemic to the Espinhaço moun-
dation, provides valuable tain range (Carvalho 2013), which ex-
contributions to the knowledge of bio- tends for approximately 1500 km in
diversity (Vitt 2000). One such interac- southeastern and northeastern Brazil,
tion is saurophagy, when a lizard is con- with elevations reaching 2000 m above
sumed by another organism, including sea level (asl) (Gontijo 2008). It is a
another lizard (e.g. Siqueira & Rocha saxicolous ambush forager, whose diet
2008; Reis et al. 2017; Guimarães & Sr- is mostly composed of arthropods, es-
bek-Araujo 2018; Schalk & Cove 2018). pecially ants (Van Sluys et al. 2004), al-
Herein we report a saurophagy event be- though it may prey upon lizards (Kiefer
tween two endemic lizard species from a 1998; Reis et al. 2007), including con-
mountain environment in Brazil: Tropi- specifics (Kiefer & Sazima 2002). The
durus montanus Rodrigues, 1987 and recently described Ameivula cipoensis
Ameivula cipoensis Arias et al., 2014. is also endemic to the Espinhaço, but
139
HB vol. 10 n.o 2 - Notas de História Natural & Distribuição Geográfica

it has a more restricted known range, of Tropidurus at Serra do Cipó: T. hispi-


reported for Parque Nacional da Serra dus and T. montanus (Rodrigues 1987;
do Cipó (PNSC) and the municipality of Carvalho 2013). Tropidurus monta-
Gouveia, state of Minas Gerais (Arias nus, however, is the only one known to
et al. 2014; Moura & Cruz 2017). The inhabit rocky outcrops above 1000 m
species occurs in low density, observed asl at Serra do Cipó (Rodrigues 1987).
mostly on shaded rocks, vegetation Moreover, the color pattern of the pho-
thickets or sandy soil during the hottest tographed specimen, a brownish-green
hours of sunny days (Filogonio et al. ground color with a series of black
2010 [cited as Cnemidophorus ocellif- marks bordered by yellowish-green
er]; Arias et al. 2014). Other than daily dots is diagnostic of T. montanus (Ro-
activity and microhabitat use (Filogo- drigues 1987; A. L. G. Carvalho pers.
nio et al. 2010; Arias et al. 2014), the comm.).
natural history of A. cipoensis is not
known. Since there are many records of inter-
actions between Tropidurus and Am-
On 18 January 2019, at 2 p.m., SMCA eivula (e.g. Santos et al. 2009; Per-
was hiking along a trail in a rocky field gentino et al. 2017; Tavares et al. 2017;
(“Campo Rupestre”; 19º19′46.81″ S, Guimarães & Srbek-Araujo 2018), the
43º33′40.32″ W; datum WGS 84; 1056 event reported herein is not surprising.
m asl) in the municipality of Santana It is, however, noteworthy given the
do Riacho, Minas Gerais, southeastern lack of information on natural history
Brazil. He noted an adult Tropidurus of A. cipoensis, in addition to this being
montanus overcoming an Ameivula ci- the first report of a predation attempt
poensis (Fig. 1), tightly holding the tail on A. cipoensis.
and hindlimbs of its potential prey in
its mouth. Upon noticing the observer, We highlight that this report was made
the Tropidurus fled, carrying the Am- possible thanks to the observation by
eivula in its mouth. It was not possible SMCA, a tour guide. Locally employed
to confirm if the attempted predation rangers, tour guides, and residents
succeeded. SMCA was able to take one have more opportunity to make natural
photograph of the predation attempt history observations than professional
(Fig. 1). scientists on sporadic fieldwork. With
technological advances like smart-
Since A. cipoensis is the only species of phones with high quality cameras and
Ameivula occurring at Serra do Cipó, GPS, citizen science observations con-
our identification was based on the lo- tribute important data (e.g. Suprayit-
cation of record. There are two species no et al. 2017; Ward-Fear et al. 2019;
140
HB vol. 10 n.o 2 - Notas de História Natural & Distribuição Geográfica

Maritz & Maritz 2020). Moreover, in Filogonio R., Del Lama F.S, Machado
cases where the citizen scientist obser- L.L., Drumond M., Zanon I., Mezzetti
vation has a pivotal role, their inclusion N.A, Galdino C.A. 2010. Daily activi-
in the authorship of the article should ty and microhabitat use of sympatric
be considered, as in this publication lizards from Serra do Cipó, southeast-
(Ward-Fear et al. 2020). ern Brazil. Iheringia, Série Zoologia
100:336–40.
ACKNOWLEDGEMENTS
Gontijo B.M. 2008. Uma geografia para
We are grateful to André Luiz Carval- a Cadeia do Espinhaço. Megadiversi-
ho for confirming the identity of the T. dade 4:7–14.
montanus specimen. Contact between
the scientific team and the citizen sci- Guimarães L.J., Srbek-Araujo A.C.
ence author occurred during a field- 2018. Attempted predation of Ameivula
work expedition for the “Plano de Ação nativo by Tropidurus torquatus (Rep-
Nacional para Conservação da Herpe- tilia: Squamata, Sauria) with ingestion
tofauna Ameaçada da Serra do Espin- of tail fragments in southeastern Brazil.
haço em Minas Gerais”, funded by the Herpetology Notes 11:709–713.
Instituto Chico Mendes de Conservação
da Biodiversidade. We also thank both Maritz R.A., Maritz B. 2020. Sharing
reviewers for their suggestions in this for science: high-resolution trophic
paper revision. interactions revealed rapidly by social
media. PeerJ 8:e9485.
REFERENCES
Moura F.R., Cruz A.J.R. 2017. Geo-
Arias F., de Carvalho C.M., Zaher H., graphic Distribution: Ameivula cipoen-
Rodrigues M.T. 2014. A new species sis. Herpetological Review 48:810.
of Ameivula (Squamata, Teiidae) from
southern Espinhaço mountain range, Pergentino H.E.S., Nicola P.A., Pereira
Brazil. Copeia 2014:95–105. L.C.M, Novelli I.A, Ribeiro L.B. 2017.
A new case of predation on a lizard by
Carvalho A.D. 2013. On the distribution Tropidurus hispidus (Squamata, Tropi-
and conservation of the South American duridae), including a list of saurophagy
lizard genus Tropidurus Wied-Neu- events with lizards from this genus as
wied, 1825 (Squamata: Tropiduridae). predators in Brazil. Herpetology Notes
Zootaxa 3640:42–56. 10:225–228.

141
HB vol. 10 n.o 2 - Notas de História Natural & Distribuição Geográfica

Reis S.P.V., Pinheiro L.T., Galdino Tavares R.V., Sousa I.T.F., Araújo
C.A.B. 2017. Tropidurus montanus. A.B.P., Kokubum M.N.C. 2017. Am-
Saurophagy. Herpetological Review eivula ocellifera (Spix’s Whiptail).
48:202. Saurophagy. Herpetological Review
48:631–632.
Rodrigues M.T. 1987. Sistemática, eco-
logia e zoogeografia dos Tropidurus do Van Sluys M., Rocha C.F., Vrcibradic D.,
grupo torquatus ao sul do Rio Amazo- Galdino C.A., Fontes A.F. 2004. Diet,
nas (Sauria, Iguanidae). Arquivos de activity, and microhabitat use of two
Zoologia 31:105–230. syntopic Tropidurus species (Lacertil-
ia: Tropiduridae) in Minas Gerais, Bra-
Santos R.M.L., Cassimiro J., Rodrigues zil. Journal of Herpetology 38:606–11.
M.T. 2009. Cnemidophorus ocellifer
(Spix’s Whiptail). Attempted Preda- Vitt L.J., de Carvalho C.M. 1995. Niche
tion. Herpetological Review 40:220. partitioning in a tropical wet season:
lizards in the lavrado area of northern
Schalk C.M., Cove M.V. 2018. Squa- Brazil. Copeia 1995:305–29.
mates as prey: Predator diversity pat-
terns and predator-prey size relation- Ward-Fear G., Rangers B., Pearson D.,
ships. Food Webs 17:e00103. Bruton M., Shine R. 2019. Sharper eyes
see shyer lizards: collaboration with
Siqueira C.C., Rocha C.F.D. 2008. Pre- indigenous peoples can alter the out-
dation by lizards as a mortality source comes of conservation research. Con-
for juvenile lizards in Brazil. South servation Letters 12:e12643.
American Journal of Herpetology
3:82–87. Ward-Fear G., Pauly G.B., Vendetti
J.E., Shine R. 2020. Authorship proto-
Suprayitno N., Narakusumo R.P., von cols must change to credit citizen sci-
Rintelen T., Hendrich L., Balke M. 2017. entists. Trends in Ecology & Evolution
Taxonomy and Biogeography without 35: 187–90.
frontiers–WhatsApp, Facebook and
smartphone digital photography let cit-
izen scientists in more remote localities
step out of the dark. Biodiversity Data Editora: Sarah Mângia
Journal 5:e19938.

142
HB vol. 10 n.o 2 - Notas de História Natural & Distribuição Geográfica

Figure 1. Tropidurus montanus capturing an Ameivula cipoensis in Campo Rupestre (19º19′46.81″


S, 43º33′40.32″ W) in Parque Nacional da Serra do Cipó, state of Minas Gerais, Brazil.

143
Instruções
para Autores
Para informações sob preparacão e submissão de ma-
nuscritos entre em contato com os editores gerais.
email de contato edgeral.hb@gmail.com

Polychrus liogaster
Machadinho D Oeste, RO
@Sarah Mângia

144

Você também pode gostar