Você está na página 1de 202

Anexo do Captulo 9 (Teste de Sanidade de Sementes) das Regras para Anlise de Sementes.

MINISTRIO DA AGRICULTURA, PECURIA E ABASTECIMENTO SECRETARIA DE DEFESA AGROPECURIA

Manual de Anlise Sanitria de Sementes

Braslia 2009

2009 Ministrio da Agricultura, Pecuria e Abastecimento. Todos os direitos reservados. Permitida a reproduo desde que citada a fonte. A responsabilidade pelos direitos autorais de textos e imagens desta obra do autor. Ttulo: Manual de Anlise Sanitria de Sementes, Anexo do Captulo 9 (Teste de Sanidade de Sementes) das Regras Para Anlise de Sementes 1 edio. Ano 2009 Tiragem: 500 exemplares Anexo do Captulo 9 (Teste de Sanidade de Sementes) das Regras para Anlise de Sementes Elaborao, distribuio, informaes: MINISTRIO DA AGRICULTURA, PECURIA E ABASTECIMENTO Secretaria de Defesa Agropecuria - SDA Coordenao Geral de Apoio Laboratorial - CGAL Esplanada dos Ministrios, Bloco D, Anexo B, 4 andar, sala 430 CEP: 70043-900, Braslia - DF Tel.: (61) 3225-5098 Fax.: (61) 3218-2697 www.agricultura.gov.br e-mail: cgal@agricultura.gov.br Central de Relacionamento: 0800 704 1995 Coordenao Editorial: Assessoria de Comunicao Social Impresso no Brasil / Printed in Brazil

Catalogao na Fonte Biblioteca Nacional de Agricultura BINAGRI

Brasil. Ministrio da Agricultura, Pecuria e Abastecimento. Manual de Anlise Sanitria de Sementes / Ministrio da Agricultura, Pecuria e Abastecimento. Secretaria de Defesa Agropecuria. Braslia: Mapa/ACS, 2009. 200 p. ISBN 978-85-99851-64-7 1. Semente. 2. Inspeo Sanitria. 3. Defesa Vegetal. 4. Anlise de Risco. I. Secretaria Defesa Agropecuria. II. Ttulo. AGRIS F03 CDU 631.53.03

AGRADECIMENTOS
Ao Professor Dr. Jos da Cruz Machado, pela Coordenao Geral deste Manual e pelas relevantes informaes tcnicas cedidas ao Ministrio da Agricultura, Pecuria e Abastecimento. todos os colaboradores, incluindo estudantes de graduao e ps-graduao do Departamento de Fitopatologia da Universidade Federal de Lavras.

COORDENADORES E COLABORADORES
COORDENADORES TCNICOS Nome
Jos da Cruz Machado - Coordenador Geral e Coordenador do captulo sobre Fungos Jos Mauricio Pereira - Revisor

Instituio / Sigla
Universidade Federal de Lavras - UFLA

E-mail
machado@ufla.br

Laboratrio Oficial de Anlise de Sementes/ Laboratrio Nacional Agropecurio LASO/ LANAGRO/MG Laboratrio Oficial de Anlise de Sementes/ Laboratrio Nacional Agropecurio LASO/ LANAGRO/MG Laboratrio Oficial de Anlise de Sementes/ Laboratrio Nacional Agropecurio LASO/ LANAGRO/MG

jose.m.pereira@agricultura.gov.br

Luiz Artur Costa do Valle

luiz.valle@agricultura.gov.br

Myriam A. G. Leal Alvisi -Coordenadora do Grupo II Portaria n 62 de 10/03/2006

myriam.alvisi@agricultura.gov.br

COLABORADORES
Nome Ademir Assis Henning Instituio / Sigla Empresa Brasileira de Pesquisa Agropecuria / Centro Nacional de Pesquisa de Soja Embrapa/SOJA Universidade Federal de Pelotas - UFPEL Universidade Federal de Lavras - UFLA E-mail henning@cnpso.embrapa.br

Andra Bittencourt Moura Antnia dos Reis Figueira -Coordenadora do Captulo sobre Vrus Carlos Mitinori Utiamada Dbora Cristina Santiago Coordenadora do capitulo sobre Nematides nia Mara de Carvalho Luiz Carlos Bhering Nasser Maria Heloisa Duarte de Morais Nicsio F. de Almeida Pinto

abmoura@ufpel.tche.br antonia@ufla.br

Tecnologia Agropecuria Ltda. TAGRO Universidade Estadual de Londrina - UEL

carlos.utiamada@tagro.com.br santiago@uel.br

Universidade Federal Rural do Rio de Janeiro - UFRRJ Empresa Brasileira de Pesquisa Agropecuria Embrapa/Mapa Escola Superior de Agricultura Luiz de Queiroz ESALQ / USP Empresa Brasileira de Pesquisa Agropecuria/ Centro Nacional de Pesquisa de Milho e Sorgo Embrapa/CNPMS Universidade Federal de Lavras - UFLA

eniacarvalho@yahoo.com.br luiz.nasser@agricultura.gov.br mhdmorae@esalq.usp.br nicesio@cnpms.embrapa.br

Ricardo Magela de Souza Coordenador do captulo sobre Bactria

rmagelas@ufla.br

SUMRIO
1 INTRODUO ..................................................................................................................................................9 2 GRUPOS DE PATGENOS EM RELAO AO TESTE DE SANIDADE ............................................. 11 3 FORMAS DE ASSOCIAO DE PATGENOS COM SEMENTES.......................................................19 4 MANUSEIO DE AMOSTRAS DE SEMENTES E TCNICAS AUXILIARES EM LABORATRIO DE ANLISE DE SEMENTES .........................................................................................................................23 4.1 Manuseio das amostras na recepo......................................................................................................24 4.2 Destino de embalagens e outros materiais descartveis.......................................................................24 4.3 Cuidados com as amostras aps a recepo..........................................................................................24 4.4 Manuseio de sementes tratadas com biocidas.......................................................................................25 4.5 Tcnicas auxiliares ..................................................................................................................................25 4.5.1 Limpeza e esterilizao de material ..............................................................................................25 4.5.2 Preparo de material para exame microscpico ............................................................................26 5 TESTES DE SANIDADE ................................................................................................................................27 5.1 MTODOS DE DETECO DE FUNGOS .......................................................................................28 5.1.1 Inspeo visual da amostra de sementes ......................................................................................28 5.1.2 Exame da suspenso de lavagem das sementes ............................................................................31 5.1.3 Incubao em Substrato de Papel ou mtodo do Papel de Filtro (blotter test)....................33 5.1.4 Plaqueamento em meio gar slido (BDA ou MEA) ..................................................................34 5.1.5 Mtodos especficos ........................................................................................................................35 5.1.5.1 Incubao em Rolo de Papel ................................................................................................36 5.1.5.2 Incubao em Meio Agar-Bromofenol NEON ....................................................................38 5.1.5.3 Fluorescncia sob luz negra .................................................................................................40 5.1.5.4 Incubao em Meio Agar Salino ..........................................................................................41 5.1.5.5 Exame de embrio para deteco de Ustilago sp em sementes de cereais ........................43 5.1.5.6 Exame de marcadores moleculares .....................................................................................44 CARACTERISTICAS DOS FUNGOS EXIBIDAS EM SEMENTES PELO MTODO DE INCUBAO EM SUBSTRATO DE PAPEL ..............................................................................................45 5.2 MTODOS DE DETECO DE BACTRIAS ..............................................................................102 5.2.1 Plantio de Sementes em Substrato Esterilizado .........................................................................102 5.2.2 Inoculao em plantas susceptveis .............................................................................................102 5.2.3 Plaqueamento em meio seletivo e semi-seletivo .........................................................................103 5.2.4 Registro de resultados ..................................................................................................................103 5.2.5 Mtodos especficos para cada espcie ........................................................................................104 5.2.5.1 Deteco de Xanthomonas campestris pv. campestris em Brassica spp. (ISTA) ..............104 5.2.5.2 Deteco de Xanthomonas hortorum pv. carotae em Daucus carota (ISTA) ...................106 5.2.5.3 Deteco de Xanthomonas axonopodis pv. malvacearum em algodo (Gossypium hirsutum L.) ......................................................................................................................................109 5.2.5.4 Deteco de Clavibacter michiganensis subsp. michiganensis em tomate (Lycopersicon esculentum) Workshop 1999......................................................................................................... 112 5.2.5.5 Deteco de Pseudomonas syringae pv. tomato em tomate (Lycopersicon esculentum) ... 114

SUMRIO

5.2.5.6 Deteco de Xanthomonas campestris pv. vesicatoria em tomate (Lycopersicon esculentum) ISHI-Veg ............................................................................................................................................ 117 5.2.5.7 Deteco de Curtobacterium flaccumfaciens pv. flaccumfaciens em sementes de feijo (Phaseolus vulgaris) ................................................................................................ 119 5.2.5.8 Deteco de Xanthomonas axonopodis pv. phaseoli em feijo (Phaseolus vulgaris) Workshop 1999; Kobayasti, 2002. ..................................................................................................122 5.3 MTODOS DE DETECO DE VRUS ..........................................................................................144 5.3.1. Testes biolgicos ...........................................................................................................................144 5.3.2. Teste sorolgico DAS-ELISA (Figuras 87-91) ...........................................................................144 5.3.2.1. Extrao do vrus ...............................................................................................................145 5.3.2.2. Cobertura inicial das placas...............................................................................................145 5.3.2.3. Adio da amostra...............................................................................................................145 5.3.2.4. Adio do Conjugado..........................................................................................................145 5.3.2.5. Adio do substrato e leitura dos resultados ....................................................................145 5.3.3. Diagnose de vrus atravs de PCR .............................................................................................145 5.3.3.1. Extrao do RNA total das sementes ou plntulas ..........................................................146 5.3.3.2. Transcrio reversa e PCR.................................................................................................146 5.3.4 MTODOS ESPECFICOS POR ESPCIE.............................................................................152 5.3.4.1 Capsicum spp. .......................................................................................................................152 5.3.4.2 Cucumis melo/ Cucurbita sp ................................................................................................161 5.3.4.3 Lactuca sativa........................................................................................................................166 5.3.4.4 Lycopersicon esculentum ......................................................................................................170 5.3.4.5 Phaseolus vulgaris ................................................................................................................173 5.4 MTODOS DE DETECO DE NEMATIDES ...........................................................................177 5.4.1 Deteco de Heterodera glycines em amostras de sementes de soja .........................................178 5.4.2 Deteco de Aphelenchoides besseyi e Ditylenchus dipsaci em amostras de sementes de Brachiaria ..................................................................................................................................................... 180 5.4.3 Deteco de Aphelenchoides besseyi e Ditylenchus dipsaci em amostras de sementes de Panicum ..................................................................................................................................................181 5.4.4. Deteco de Aphelenchoides besseyi em sementes de arroz .....................................................182 5.4.5 Deteco de Ditylenchus dipsaci em sementes de cebola ...........................................................183 5.4.6 TCNICAS MOLECULARES X NEMATIDES X SEMENTES.........................................184 5.4.7 TCNICA PARA QUANTIFICAO DOS NEMATIDES..................................................184 BIBLIOGRAFIA ..............................................................................................................................................187 NDICE REMISSIVO .....................................................................................................................................193

INTRODUO

MANUAL DE ANLISE SANITRIA DE SEMENTES

O objetivo central deste manual suprir o analista de laboratrio com informaes sobre os mtodos mais comuns de deteco de fitopatgenos em sementes com protocolos simplificados e ilustraes fotogrficas que visam facilitar as anlises de rotina. Trata-se de uma publicao que complementa, na forma de anexo, o Captulo 9, Sanidade de Sementes, das Regras para Anlise de Sementes. A preocupao foi, portanto, disponibilizar ao sistema de controle de qualidade de sementes no pas, um guia de consulta referencial, por ocasio das anlises de rotina, procurando-se desta forma, cumprir os princpios de homogeneizao e harmonizao de informaes neste tipo de atividade. Por meio deste manual, o Ministrio da Agricultura, Pecuria e Abastecimento (Mapa), faz com que as regras e normas brasileiras para anlises sanitrias de sementes sejam enquadradas o mais prximo possvel nas regras internacionais prescritas pela ISTA (International Seed Testing Association), sendo adicionados alguns patossistemas de interesse no Brasil e que no so contemplados nas regras da referida Associao. A deciso de incluir mtodos ainda no submetidos a testes comparativos de validao, conforme a atual postura do Comit de Sanidade de Sementes da ISTA em seu Manual de Sanidade, teve como base o fato de que a demanda pelo teste de sanidade de sementes para alguns patossistemas tem crescido rapidamente no Brasil e a eficcia desses mtodos j tm sido comprovada de alguma forma. O trabalho foi desenvolvido por um grupo de profissionais envolvidos com sanidade de sementes no Brasil, representando entidades pblicas e privadas, pertencentes na sua maioria ao Comit de Patologia de Sementes da ABRATES e sob a responsabilidade da CGAL/ Mapa. As ilustraes e descries de mtodos foram fornecidos por profissionais que trabalham j por algum tempo no campo de controle de qualidade sanitria de sementes no pas, e estes materiais permanecem sob o controle legal de propriedade de seus respectivos autores, o que faz com que a sua utilizao para quaisquer outras finalidades, seja permitido somente mediante autorizao expressa dos mesmos. Toda ilustrao fotogrfica contm uma indicao de autoria correspondente. Embora esforos tenham sido feitos para tornar esta publicao a mais ampla possvel, alguns patossistemas de importncia para o Brasil, no foram includos nesta edio pela inexistncia de informaes e indisponibilidade de ilustraes adequadas dos mesmos. Na medida em que estas informaes e material ilustrativo sejam disponibilizados, eles sero incorporados nas prximas Edies deste Manual. Nesta primeira edio, foram considerados, portanto, somente os patossistemas que so de maior interesse e importncia atual no Brasil.

10

GRUPOS DE PATGENOS EM RELAO AO TESTE DE SANIDADE

MANUAL DE ANLISE SANITRIA DE SEMENTES

As sementes de modo geral podem abrigar e transportar microrganismos ou agentes patognicos de todos os grupos taxonmicos, causadores e no causadores de doenas. Do ponto de vista ecolgico, esses agentes podem ser agrupados em organismos de campo, onde predominam espcies fitopatognicas, e organismos de armazenamento, com pequeno nmero de espcies que deterioram as sementes nesta fase. Os fungos englobam o maior nmero de espcies associadas s sementes, seguidos pelas bactrias, com um nmero expressivo de representantes e os vrus e nematides, em menor nmero. Dentre os fungos fitopatognicos, a maioria pode ser transmitida pelas sementes de seus hospedeiros. 2.1 Grupos de fungos associados s sementes O agrupamento dos fungos, para efeito de entendimento e seleo de mtodos de deteco em sementes pode ser realizado de forma simplificada tomando se como base a natureza de parasitismo destes organismos, biotrficos e necrotrficos. A classificao taxonmica clssica e moderna torna-se tambm de grande valor, posto que os mtodos de deteco dos fungos mantm uma certa correlao com os grupos distinguidos pelas caractersticas que os marcam nestas classificaes. Os agrupamentos com base em caractersticas morfolgicas, como tipo de frutificao, tamanho, forma e cor de esporos e outras propriedades so importantes para a identificao desses organismos por ocasio de uma anlise sanitria. A Diviso informal dos fungos nos dois grandes grupos, tendo se como referencial a natureza do parasitismo (Tabela 1), importante, pelo fato de que os fungos biotrficos no completam seu ciclo biolgico em condies artificiais, e isto faz com que estruturas tpicas que os caracterizam no sejam formadas em testes de sanidade que empregam mtodos artificiais que induzem a formao destas estruturas. Por sua vez, as espcies necrotrficas, que englobam a maioria das espcies associadas s sementes, podem ser mais facilmente reconhecidas nessas condies, posto que podem completar seu ciclo biolgico parcial ou completo, formando estruturas tpicas que podem ser reconhecidas com auxilio de microscpios. Para algumas espcies necrotrficas, de crescimento lento ou em casos de espcies que dificilmente produzem frutificaes na maior parte de seu ciclo biolgico, necessrio que mtodos especficos ou especiais sejam desenvolvidos. A classificao dos fungos com base em: (1) carter de evoluo, (2) caractersticas morfolgicas e, (3) processos de diviso celular, mitosprico e meisprico tornam-se tambm, de certa forma, de grande valor para o analista dando lhe segurana no exame das sementes. O conhecimento das estruturas dos fungos em seu ciclo biolgico , portanto, um requisito indispensvel por parte dos analistas. Conceituao e descries detalhadas de estruturas fngicas como, acrvulos, picndios, esporodquios, sinmios, clamidsporos, esclerdios ou esclercios, peritcios, alm dos diferentes tipos de esporos/condios, podem ser encontrados em livros textos especializados, devendo ser consultados constantemente pelos analistas e demais profissionais ligados a anlise sanitria de sementes, em casos de dvidas. Marcadores fisiolgicos, bioqumicos e moleculares, constituem modernamente a base do desenvolvimento de alguns mtodos de deteco de fungos, facilitando e conferindo segurana aos testes de sanidade para inmeras espcies.

12

Tabela 1 Classificao genrica dos fungos mais comumente associados s sementes de espcies hospedeiras de importncia agrcola

FUNGOS BIOTRFICOS Inferiores Ascomycotina*/mitospricos Rhizopus Fusarium Ascochyta Botryodiplodia Gerlachia Dydimella Giberella Glomerella Nectria Mycosphaerella Sclerotinia Verticillium Sclerotinia Acremonium Penicillium Cochliobolus Aspergillus Alternaria Bipolaris Drechslera Phoma Phomopsis Strnocarpella Stagonospora Trichoconiella Pyricularia Cercospora Superiores

FUNGOS NECROTRFICOS

Inferiores

Superiores

Oomycota

Basidiomycotina

Basidiomycotina

Peronospora

Ustilago

Thanathephorus (Rhizoctonia)

Plasmopara

Tilletia

2 - GRUPOS DE PATGENOS EM RELAO AO TESTE DE SANIDADE

Sclerospora

Colletotrichum Macrophomina

13

MANUAL DE ANLISE SANITRIA DE SEMENTES

2.2 Grupos de bactrias associados s sementes A maioria das bactrias fitopatognicas do tipo bastonete e no forma esporos ou quaisquer outras estruturas de resistncia ou de repouso. O tamanho da clula bacteriana varivel, apresentando em mdia 1,05,0 x 0,5-1,0mm. A reproduo das bactrias fitopatognicas ocorre por fisso binria ou diviso simples a uma taxa espantosamente rpida. Sob condies favorveis, o perodo de gerao, isto , o tempo que uma bactria leva para originar duas clulas filhas, varia de 20 a 50 minutos. Aps a diviso as clulas so independentes, no formam tecidos e apresentam forte afinidade por gua. Quando uma nica clula bacteriana depositada sobre a superfcie de um meio de cultura slido ela pode se multiplicar, dando origem a uma massa de clulas visveis chamada de colnia. Colnias de diferentes espcies podem variar no dimetro, desde fraes de milmetro (Xylella) at alguns centmetros (Erwinia) e na forma, circulares, ovais ou irregulares. Suas bordas podem ser lisas, onduladas ou irregulares. Colnias de muitas espcies so esbranquiadas ou cinzas (ex: Pseudomonas), enquanto outras so amarelas (Xanthomonas e Clavibacter). Algumas produzem pigmentos fluorescentes sob luz ultravioleta (Pseudomonas syringae pv. tomato), ou marrom (isolados de Xanthomonas axonopodis pv. phaseoli) difusveis no meio agar. Essas caractersticas permitem o desenvolvimento de mtodos de deteco baseados na extrao da bactria pela imerso das sementes em tampo fosfato salina e posterior plaqueamento, ou mesmo o semeio direto da semente, em meio de cultura seletivo. As bactrias podem sobreviver nas sementes, como latente, em baixas populaes tendo sua multiplicao paralisada. A semente infectada pode ou no apresentar sintomas, na maioria das vezes no apresenta. Neste caso, se as sementes forem postas para germinar em substrato esterilizado (areia, vermiculita, solo e outros) de forma individualizada e mantidas em casa de vegetao ou cmara de crescimento, a partir da emergncia das plntulas, poder se observar a ocorrncia de sintomas caractersticos da infeco pelo patgeno alvo. Ento, realizado o isolamento da bactria e sua posterior identificao. Este tambm pode ser um mtodo de deteco de bactrias em sementes, com a vantagem de permitir a determinao da porcentagem de transmisso do patgeno; entretanto, no permite a deteco de bactrias em sementes no germinadas. As principais bactrias fitopatognicas transmitidas por sementes pertencem aos gneros: Acidovorax, Clavibacter, Curtobacterium, Erwinia, Pantoea, Pseudomonas e Xanthomonas, cuja classificao se encontra na Tabela 2. Para a diferenciao destes gneros so adotadas caractersticas microbiolgicas morfolgicas, bioqumicas, de crescimento e moleculares.

14

2 - GRUPOS DE PATGENOS EM RELAO AO TESTE DE SANIDADE

Tabela 2. Classificao de bactrias fitopatognicas transmitidas por sementes no Reino Prokariota Bactrias fitopatognicas Famlia Enterobacteriaceae Pseudomonodaceae Gnero Erwinia Acidovorax Pseudomonas Xanthomonas Procaryotae Firmiculites Thallobacteria Gram positiva Rhizobiaceae Agrobacterium Streptomyces Clavibacter Curtobacterium

Reino

Diviso Graciculites

Classe Proteobacteria

Atributo No fotossinttica Gram negativa

15

MANUAL DE ANLISE SANITRIA DE SEMENTES

2.3 Grupos de vrus associados s sementes Apesar de os vrus possurem algumas propriedades de ser vivo, como ter um genoma e ser capaz de se adaptar s mudanas ambientais, eles no podem capturar e estocar energia livre e no so funcionalmente ativos fora das clulas vivas. Portanto, mesmo sendo patgenos, eles no so considerados como microrganismos genunos. Mesmo no tendo a possibilidade de ocorrer cruzamento entre as espcies, o que teoricamente limitaria a sua variabilidade, eles possuem uma populao dinmica, constituda por milhares de mutantes que se encontram presentes em um nico clone viral. Essa populao, que est sujeita ao processo natural de seleo, chamada de quase-espcie viral. Decidir como fazer um esquema distinto e facilmente reconhecvel, para identificar as diferentes espcies virais tem sido um problema de difcil soluo, devido variabilidade dos vrus. Embora o reconhecimento dessas espcies seja de fundamental importncia, os fitovirologistas levaram um bom tempo para chegar a um consenso sobre a classificao e taxonomia de vrus. As caractersticas empregadas para separar os vrus em diferentes agrupamentos levam em conta o seguinte: caractersticas do genoma, sequncia do genoma, caractersticas das protenas codificadas pelo genoma viral, os mecanismos de transmisso, o efeito do vrus na planta e o seu ciclo de hospedeiras. A classificao e taxonomia de fitovirus realmente avanaram no perodo de 1980 a 1990, quando o desenvolvimento nas tcnicas de sequenciamento do genoma viral deu um salto fundamental. Isso fez com que elas se tornassem bastante dinmicas na ltima dcada, mudado tanto com esses novos conhecimentos gerados pela biologia molecular, que tem propiciado anlises genmicas cada vez mais precisas e eficientes, como com o aparecimento de novos isolados virais. O rgo responsvel pela classificao e taxonomia dos vrus denominado International Committee on Taxonomy of Viruses (ICTV) que formado por um grupo internacional de cientistas, encarregados de receber e discutir as informaes e proposies de novas espcies/gneros de virus, que infectam plantas, animais vertebrados, invertebrados, bactrias, algas, fungos, leveduras e protozorios. O ICTV mantm disponvel na internet, site http://www.ncbi.nlm.nih. gov/ICTVdb/ICTVdB/, uma base de dados que frequentemente atualizada, com os dados de todos os vrus j descritos em todo o mundo. Atravs de uma consulta rpida e fcil, pode-se localizar, nesse site, todos os dados referentes classificao, taxonomia, caractersticas bioqumicas, moleculares, gama de hospedeiras, sintomas e demais informaes que j foram publicadas a respeito de uma dada espcie viral. O stimo relatrio do ICTV, que foi disponibilizado em 2000, j foi mudado no oitavo relatrio que foi publicado em 2005. A atual classificao e taxonomia dos fitovrus podem ser vistas na Tabela 3, onde constam tambm uma famlia e alguns gneros que esto sendo propostos por pesquisadores e se encontram em fase de anlise para decidir sobre sua aceitao ou no para incluso na taxonomia atual.

16

Tabela 3. Classificao de vrus fitopatognicos transmitidas por sementes Famlias Comoviridae Potyviridae Gneros Fabavirus Nepovirus e Comovirus, ao qual pertence a espcie Squash mosaic vrus (SqMV), transmitido por sementes de Cucumis melo e Cucurbita sp Rymovirus, Macluravirus, Tritimovirus, Ipomovirus, Bymovirus e Potyvirus onde se encontram as espcies Bean common mosaic virus (BCMV) e Lettuce mosaic virus (LMV), transmitidas por sementes de feijo e de alface, respectivamente.

cido Nuclico

ssRNA+ No classificados

Sobemovirus, Idaeovirus, Umbravirus, Ourmiavirus, Tobravirus, Hordeivirus, Furovirus Pomovirus, Pecluvirus, Benyvirus e Tobamovirus, onde se encontram as espcies Tobacco mosaic vrus (TMV), Tomato mosaic virus (ToMV) e Pepper mild mottle virus (PMMoV), transmitidas por sementes de espcies de Capsicum sp. TMV e ToMV so tambm transmitidas por sementes de tomate. H ainda os gneros propostos Cheravirus e Sadwavirus

2 - GRUPOS DE PATGENOS EM RELAO AO TESTE DE SANIDADE

M. A. Mayo & A. A. Brunt 2005 http://www.danforthcenter.org/iltab/ictvnet/posters%5C04.1.Plant%202005A4.pdf

17

MANUAL DE ANLISE SANITRIA DE SEMENTES

2.4 Grupos de nematides associados s sementes Nematides so organismos pertencentes ao reino Animal, sub-reino Metazoa e filo Nemata. Os principais gneros de nematides associados s sementes de plantas so classificados como:

CLASSE SUB-CLASSE ORDEM FAMILIAS GNEROS APHELENCHODIDAE Aphelenchoides

SECERNENTEA DIPLOGASTERIA TYLENCHIDA ANGUINIDAE Anguina Ditylenchus HETERODERIDADE Heterodera

As principais espcies de importncia agrcola que podem ser veiculadas por sementes encontramse nos gneros: Anguina (ex. A. tritici em trigo), Aphelenchoides (A. besseyi em arroz), Ditylenchus (D. dipsaci em cebola e brachiaria) e Heterodera (H. glycine em soja). Comparados ao grupo dos fungos e das bactrias, os nematides compem o menor grupo de organismos fitopatognicos, apresentando apenas algumas espcies de importncia agrcola que podem associar-se s sementes. Em geral, so organismos vermiformes, com variaes morfolgicas em algumas espcies e apresentando tamanho varivel na faixa de 0,5 a 2,0mm de comprimento por 50 a 250mm de largura. Dependendo do tipo de associao, os nematides parasitas de plantas podem ser sedentrios ou migratrios, ectoparasitas ou endoparasitas. Pela sua natureza de parasitismo, so mais comumente encontrados no solo junto, ou no interior, das razes das plantas parasitadas. Nematides fitoparasitas apresentam como caracterstica morfolgica principal a formao de estilete bucal, cuja funo perfurar os tecidos de seus hospedeiros e por meio do qual o alimento ingerido. Alguns nematides, como as espcies de Heterodera, formam estruturas de sobrevivncia no solo, conhecidas como cistos. Estes so estruturas que abrigam ovos dentro das fmeas, revestidas por uma cutcula coricea, resistente, que permite a sobrevivncia destes ovos no solo.

18

FORMAS DE ASSOCIAO DE PATGENOS COM SEMENTES

MANUAL DE ANLISE SANITRIA DE SEMENTES

3.1- FUNGOS O conhecimento prvio das formas de interao do inculo de patgenos com sementes importante em patologia de sementes, dentre vrios aspectos, para a escolha de mtodos de deteco destes agentes. De modo geral, o transporte de microrganismos por sementes em um dado lote pode se dar de trs maneiras. No primeiro caso, o microrganismo, separado ou no, encontra-se em mistura com as sementes, fazendo parte da frao impura do lote. Fazem parte desta frao: fragmentos vegetais, sementes de plantas invasoras e partculas do solo que podem, todos, ser portadoras de miclio dormente, corpos frutferos e esporos de fungos, cistos ou galhas de nematides, clulas bacterianas e partculas de vrus, esclerdios ou estromas fngicos (Figura 1 A). Uma segunda maneira pela qual certos patgenos podem se associar e ser(em) transportados pelas sementes por adeso passiva superfcie destas (Figura 1B). A terceira forma de associao de microrganismos com sementes a presena do inculo nos tecidos das sementes, seja em estruturas superficiais (Figura 1C) ou mais interno no embrio (Figura 1D ) Essa a forma de interao e transporte mais comum entre os agentes transmitidos por sementes. preciso salientar que, apesar da distino que se faz entre esses trs tipos de interao de inculo com as sementes, um mesmo patgeno pode estar presente em um lote, sob uma ou mais dessas formas de associao.

Figura 1 - (A) Esclerdios de Sclerotinia sclerotiorum junto de sementes de soja; B) Condios de Alternaria zinniae aderidos semente de znia; C) Crosta de osporos de Peronospora manshurica na superfcie de sementes de soja; D) Embrio do trigo com hifas de U. tritici . [Fotos 1A, 1B e 1C de Prof. J.C. Machado (UFLA) e Foto 1D de Dr.S.B. Mathur (Dinamarca)].

20

3 - FORMAS DE ASSOCIAO DE PATGENOS COM SEMENTES

3.2- BACTRIAS As bactrias fitopatognicas podem estar associadas s sementes tanto externamente quanto internamente. A contaminao pode ocorrer na cultura, no perodo de maturao da semente, quando o inculo produzido sobre folhas ou outras partes da planta atinge a sua superfcie, por meio de respingos de chuva, gua de irrigao, vento, insetos, etc. ou durante as operaes de colheita, transporte, beneficiamento e armazenamento. A polpa de frutos infectados ou contaminados tambm pode ser misturada com sementes durante o processo de extrao. importante lembrar que todo processo de manuseio da semente pode fazer com que uma baixa porcentagem de contaminao proveniente do campo aumente marcadamente. Estruturas anatmicas especficas das plantas influenciam a probabilidade de infeco da semente. Diversas bactrias fitopatognicas alcanam a semente e algumas vezes o embrio via funculo. O funculo, todo ou em parte, sofre absciso, deixando uma cicatriz, o hilo, que geralmente a parte da semente mais permevel gua e juntamente com a micrpila proporcionam um meio de entrada para patgenos bacterianos. Rachaduras e outros ferimentos de origens diversas nas sementes constituem, tambm, vias importantes para a penetrao e o estabelecimento interno de fitobactrias. A penetrao ocorre ainda atravs das flores, da invaso pelo sistema vascular ou durante o desenvolvimento e maturao de frutos e vagens. Nas sementes, as bactrias se encontram na fase latente, em baixas populaes tendo sua multiplicao paralisada. Muitas das bactrias fitopatognicas permanecem viveis pelo mesmo perodo de viabilidade das sementes. A semente infectada pode ou no apresentar sintomas, sendo que na maioria dos casos no apresenta. 3.3 VRUS Apesar de infectar sistemicamente a planta, apenas uns 20% dos vrus conhecidos so transmitidos atravs das sementes verdadeiras. No caso dos vrus limitados ao floema, isso pode ser explicado pela falta de contato entre a planta me e o embrio. Por outro lado, os vrus que podem se translocar atravs dos plasmodesmas e vasos condutores tm sido encontrados em tecidos das sementes como tegumento, remanescentes nucelares e perisperma. Entretanto, com exceo de vrus altamente estveis como o TMV (Tobacco mosaic virus) e o ToMV (Tomato mosaic virus), a maioria dos vrus no conseguem sobreviver dessecao e maturao do envoltrio da semente. Assim sendo, existem dois tipos de mecanismos de transmisso dos vrus atravs das sementes: a) devido contaminao da plntula por meios mecnicos, por partculas virais que ficam na parte externa e, raramente, no endosperma das sementes e em resduos dessecados das polpas e dos frutos; b) devido contaminao de tecidos do embrio. Para que os vrus sobrevivam na parte externa das sementes e contaminem a plntula durante a germinao ou transplante, eles devem ser altamente estveis, de modo a no perder a viabilidade durante os processos de colheita, processamento e armazenamento. No Brasil, as nicas espcies de vrus que possuem essas caractersticas pertencem ao gnero Tobamovirus como o TMV, ToMV e o PMMoV (Pepper mild mottle virus). Esses trs vrus se localizam na parte externa das sementes, sendo que o PMMoV, em alguns casos, j foi tambm encontrado no endosperma, onde as partculas virais podem permanecer viveis por alguns anos. No se conhece as causas que impedem esses vrus de alcanar os tecidos do embrio ou do plen, mesmo sendo altamente estveis e infecciosos e invadindo sistemicamente a planta. A maioria das transmisses por meio das sementes ocorre por contaminao dos tecidos do embrio. Entretanto, para que as partculas virais cheguem at o embrio, a planta me deve ser infectada antes da produo dos gametas ou, pelo menos, antes da separao citoplasmtica dos tecidos embrionrios. Isso porque o embrio e o endosperma so formados dentro do saco embrionrio, depois da fertilizao, e no existe conexo vascular direta nem contato celular com a planta me atravs de plasmodesmas, de modo que os vrus no possuem vias de translocao para esses tecidos aps a produo dos gametas.m. Portanto, quanto mais jovem a planta for infectada, maior a chance de o vrus alcanar os tecidos embrionrios. A nica exceo conhecida a do BSMV (Barley stripe mosaic virus), cuja porcentagem de transmisso por sementes aumenta em infeces tardias, at o mximo de 10 dias antes do espigamento. Depois dessa fase do ciclo de vida da planta, a proporo de sementes infectadas com BSMV, que pode variar de 90 a 100%, comea a diminuir.

21

Alm dos vrus chegarem ao embrio atravs dos tecidos maternos, eles podem tambm contaminar os gametas masculinos, ou gros de plen. Isso significa que, caso sejam algamas, plantas sadias podem produzir sementes infectadas, se o gro de plen for proveniente de plantas infectadas. Por outro lado, plantas autgamas, onde ambos os gametas tm a chance de estar infectados, devem ser mais eficientes na produo de sementes infectadas. Alguns vrus induzem sintomas nas sementes, entretanto, os sintomas no so necessariamente correlacionados com a sua transmisso. Diferentemente do que acontece com a transmisso do BSMV via sementes, geralmente a porcentagem de transmisso baixa e bastante varivel pois diversos fatores podem influenciar na proporo de sementes infectadas. A proporo de sementes infectadas apresenta uma grande variabilidade de acordo com o vrus, com a estirpe de vrus e com a planta hospedeira. Alguns vrus tm uma ampla gama de hospedeiras e podem ser transmitidos pelas sementes de algumas espcies e no pelas de outras. Alm disso, diferentes espcies podem transmitir o vrus pelas sementes em diferentes propores. A fase do ciclo de vida em que a planta for infectada e a localizao do vrus nas sementes tambm so fatores que podem interferir nessa transmissibilidade. 3.4 NEMATIDES A disseminao pode ser efetivada de diferentes maneiras. Pode ocorrer pelos seus prprios meios (movimentos lentos); pelo homem, no transporte de material propagativo infectado (sementes, mudas, tubrculos, etc.); pelos implementos agrcolas contendo solo infestado; pelos animais domsticos e insetos; e pela gua de irrigao e infiltrao. A possibilidade de disseminao de fitonematides atravs de sementes, a curta e a longa distncia, entre regies, pases e continentes em todo o mundo, tem aumentado atravs do intercmbio de sementes entre agricultores, melhoristas de plantas e outros agentes. Esse movimento, previsvel na agricultura moderna, favorecido pela constante circulao de material vegetal e falta de conscientizao durante os processos de produo, comercializao e produo de sementes. Os nematides podem ser transportados junto com as sementes de trs diferentes modos: a) no interior das mesmas, na forma de juvenis abrigados entre a casca e o endosperma da semente; em pequenas cavidades das sementes de cereais e de gramneas; na regio do hilo (Aphelenchoides spp. e Ditylenchus spp.) e, em leses presentes na semente (Ditylenchus spp.); b) associados fragmentos vegetais da plantame infectada junto s sementes (Ditylenchus spp.); c) como contaminao concomitante, a exemplo de algumas espcies do gnero Anguina spp., as quais transformam o ovrio da flor da planta hospedeira em galhas, sendo assim disseminadas misturadas s sementes produzidas ou, ainda na forma de cistos (Heterodera spp.), contidos em torres de solo ou aderidos s sementes de plantas hospedeiras. De importncia para identificao dos nematides fitoparasitas, alm da presena do estilete, o conhecimento do seu ciclo biolgico. Desde a fase de ovo ate a fase adulta, os nematides sofrem quatro ecdises ou trocas de cutcula, o que equivale a diferentes estdios juvenis at a fase adulta. Em geral, a identificao de nematides realizada pelo exame da fmea adulta, que apresenta as estruturas de reproduo completa.

22

MANUSEIO DE AMOSTRAS DE SEMENTES E TCNICAS AUXILIARES EM LABORATRIO DE ANLISE DE SEMENTES

23

MANUAL DE ANLISE SANITRIA DE SEMENTES

No ato da recepo em laboratrio, as amostras devem ser avaliadas no que tange ao seu estado de conservao/integralidade de suas embalagens e o nmero ou quantidade de sementes nelas contidas. Caso alguma irregularidade seja constatada, dependendo do grau de gravidade, as amostras devem ser devolvidas ao remetente anexando se um comunicado sobre as irregularidades registradas. Uma vez atendidas as exigncias e realizado o registro de recepo, as amostras podem ser submetidas, sempre que necessrio, desinfestao inicial visando eliminar formas viveis de caros e outros tipos de insetos. Este procedimento pode ser realizado por meio do congelamento, que consiste na manuteno das amostras, acondicionadas em sacos de polietileno limpos, em freezers (-20 oC) por 3-5 horas. Alternativamente, acaricidas qumicos podem ser aplicados, respeitados os cuidados no seu manuseio. 4.1 Manuseio das amostras na recepo Inicialmente as bancadas ou locais sobre as quais as sementes so manuseadas, devem ser limpos e desinfestados por meio de gua quente com detergente e um desinfestante, a base de Lysoform, ou lcool 70% ou equivalente. A homogeneizao e separao das sementes devem ser realizadas mediante uso de ferramentas e luvas limpas e desinfestadas. A cada intervalo entre o manuseio de uma para outra amostra, todo o local e instrumentos de manuseio devem ser devidamente desinfestados. Cuidados devem ser tomados na identificao das amostras, evitando se anotaes cruzadas ou temporrias. Recomenda se usar marcadores grficos de composio permanente. 4.2 Destino de embalagens e outros materiais descartveis Materiais descartveis utilizados no manuseio inicial das sementes, incluindo se as embalagens, devem ser autoclavados antes de seguirem para o descarte final; os instrumentos e equipamentos no descartveis, como esptulas, divisores mecnicos de amostras etc devem ser limpos ou desinfestados aps o seu uso. Findo o perodo de validade da anlise sanitria, conforme indicado no Captulo 9 das RAS, as amostras de sementes, portadoras de patgenos, devem ser autoclavadas ou devidamente acondicionadas para envio ao destino final de descarte. O destino de materiais descartveis utilizados na execuo dos testes de sanidade deve ser procedido de autoclavagem aps as avaliaes. 4.3 Cuidados com as amostras aps a recepo Uma vez registradas, e aps a retirada da frao de trabalho, as amostras devem ser imediatamente transferidas para as cmaras de armazenamento. Caso isto no seja possvel no mesmo dia, evitar a exposio das mesmas a ambientes com atmosferas midas, temperaturas elevadas ou qualquer outra forma de atmosfera modificada com gases ou outros agentes que possam interferir nos microrganismos associados. No local de armazenamento, evitar o acondicionamento de outros materiais vegetais com umidade superior ao das sementes, bem como evitar proximidade das amostras com produtos qumicos de qualquer espcie, principalmente aqueles com propriedade de volatilizao. Em caso de uso de produtos qumicos com efeito residual prolongado, como 2,4-D (Diclorofenoxiacetato de sdio) e outros, proceder a lavagem imediata de pipetas e demais recipientes nos quais estes produtos foram abrigados, evitando se a disperso de resduos dos mesmos nos locais de manipulao de sementes.

24

4 - MANUSEIO DE AMOSTRAS DE SEMENTES E TCNICAS AUXILIARES EM LABORATRIO DE ANLISE DE SEMENTES

4.4 Manuseio de sementes tratadas com defensivos agrcolas Sementes tratadas com fungicidas e / ou outros defensivos agrcolas devem ser manipuladas de acordo com as normas existentes para este tipo de material, atentando se para a segurana do operador e para cuidados especficos de preveno a poluio do ambiente. As sementes devem ser manipuladas em ambientes apropriados como, cmaras de exausto, devendo o material utilizado em seu manuseio ser lavado em separado. Vale lembrar que o uso de luvas e mscaras protetoras um requisito indispensvel nestas operaes. Para o armazenamento, as amostras devem ser acondicionadas em embalagens a prova de gases ou outra forma de escape de produtos, evitando se coloc-las prximo ou no meio de amostras no tratadas. As embalagens devem ser distinguidas externamente por meio de inscries ou sinais existentes para esta finalidade. Aps o perodo de validade, as amostras com as respectivas embalagens devem ser descartadas seguindo se normas existentes para esta finalidade no pas. Instrues e normas esto disponibilizadas pela ANDEF (site: http://www.andef.com.br) e por rgos Oficiais que tratam desses aspectos. 4.5 Tcnicas auxiliares em Laboratrios de rotina A anlise sanitria de sementes requer a aplicao de inmeros procedimentos, que vo desde a etapa de preparao de materiais utilizados para a conduo dos testes at a execuo propriamente destes. Em se tratando de manuseio de sementes e de microrganismos, s vezes em separado, as tcnicas so basicamente as mesmas utilizadas em laboratrios de microbiologia. Desta forma, o foco, neste captulo, ser dado apenas algumas tcnicas que podem auxiliar o analista em sua tarefa cotidiana, principalmente voltadas para manipulao de fungos e bactrias. 4.5.1 Limpeza e esterilizao de material Todo material utilizado em testes de sanidade de sementes, como ferramentas de manipulao (pinas, esptulas, estiletes, bisturis, tesouras, vidrarias, gua, papel de filtro, papel germitest, placas de petri, gerboxes ou outros recipientes, peneiras, meios de cultura, etc) devem estar limpos e isentos de contaminaes microbianas. Isto se faz necessrio para evitar contaminaes cruzadas, que podem comprometer a validade dos resultados dos testes de sanidade. Para instrumentos, vidrarias e recipientes plsticos, a limpeza com detergente neutro deve ser feita inicialmente aps o seu uso e antes de estocagem. Placas de Petri de vidro, demais vidrarias, papel de filtro devem ser esterilizados a seco a temperatura de 160oC por duas horas. gua, meios de cultura (caso de BDA), soluo de 2,4-D devem ser autoclavados a 121oC por 20 minutos sob presso de 1,5 atm. Recipientes de plsticos, como determinados tipos de placas, gerboxes devem ser esterilizados, em casos de reutilizao, em cmaras hermticas contendo no interior xido de propileno ou formol a 4%. Em operaes de manipulao de sementes por ocasio da montagem de testes, no interior de capelas de fluxo laminar, instrumentos metlicos utilizados devem ser desinfestados com lcool 70% seguido de flambagem em bico de Bunsen ou lamparinas. Cuidados gerais de assepsia, como uso de aventais de proteo, mscaras e luvas pelos analistas e demais usurios do laboratrio devem ser tomados visando garantia do controle de qualidade sanitrio do Laboratrio e a segurana dos operadores. Verificao do nvel de contaminao do interior do Laboratrio pode ser feito expondo algumas placas de petri com meio de cultura, abertas, por alguns minutos em locais estratgicos nos recintos de trabalho e incubao de sementes. Aps incubao por 4-7 dias, a 25 oC, possvel avaliar a presena de colnias de microrganismos desenvolvidas nessas placas. Para o controle peridico de contaminaes microbianas e de caros, recomendvel a aplicao de formol 4% em salas de incubao, e outras sob suspeita, pelo perodo de 24-48 horas a cada 15 ou 30 dias, dependendo do grau de contaminao suspeito.

25

MANUAL DE ANLISE SANITRIA DE SEMENTES

4.5.2 Preparo de material para exame microscpico O exame complementar de material fungico ao microscpio tico, quase sempre necessrio para confirmaes da identidade de alguns microrganismos. Uma primeira alternativa a raspagem de material fungico diretamente das sementes para lminas de observao microscpicas. Este procedimento se presta para alguns fungos, principalmente quando se trata de espcies que se caracterizam, em grande parte, pelo tipo de frutificao ou esporos/condios. Em casos que a frutificao com a presena de esporos torna-se essencial para a identificao da espcime, a raspagem pode no conduzir a concluses seguras. Para esses casos e em situaes que observaes mais rpidas sejam requeridas, uma alternativa que tem sido das mais eficazes, a tcnica do preparo de lminas com fita adesiva transparente de boa qualidade. Pedaos de 4-6 cm deste material so seguros pelos extremos, com a face adesiva voltada para baixo, e sua parte central colocada em contato com a parte do fungo sobre as sementes. Em seguida, fixa-se a fita em uma lmina para microscopia contendo uma pequena gota de lquido de montagem (Azul de Amann ou outro), tendo se o cuidado de estend-la, o melhor possvel, sobre a lmina. Em casos de identificao complexa de alguns fungos em sementes, onde as observaes ao microscpio no so suficientes para assegurar uma concluso mais segura, a alternativa que resta o isolamento da espcime em questo por meio dos procedimentos j conhecidos e descritos em manuais de microbiologia e fitopatologia. Nestes casos as sementes, em separado, ou no prprio recipiente usado em sua incubao, exibindo o microrganismo alvo, deve ser transferida para uma capela de fluxo laminar e, com auxilio do microscpio estereoscpico desinfestado e de um estilete, ou ala de platina, limpo e flambado, efetuar a transferncia do inculo diretamente das sementes para meio de cultura contido em placas de petri. Esta transferncia pode ser realizada tocando cuidadosamente, com auxilio do estilete contendo no seu extremo um pequeno fragmento de Agar-gua, nas frutificaes do fungo a ser isolado e da depositando o sobre o meio de cultura na placa. Para observaes microscpicas em anlise de rotina, recomenda-se alm de gua destilada os seguintes lquidos de montagem: 1- Lactoglicerol: (usado para estruturas escuras) cido ltico .............................. 20 mL Glicerol ..................................... 40 mL gua destilada .......................... 20 mL

2- Azul de Amann modificado (para estruturas hialinas) cido ltico .............................. 10 mL Glicerol .................................... 10 mL gua destilada ......................... 10 mL Anilina ou Trypan Blue ............ 0,01g Para ambos lquidos de montagem, fenol, previamente dissolvido, pode ser adicionado mistura na proporo de 20 g do total, ressaltando se os cuidados que este produto requer em razo dos riscos que oferece sade humana.

26

TESTES DE SANIDADE
27

MANUAL DE ANLISE SANITRIA DE SEMENTES

No mbito do controle de qualidade de sementes, o teste de sanidade utilizado para definir o perfil de qualidade de um lote ao lado de outros testes que indicam a condio de germinabilidade, vigor, pureza fsica e identidade gentica. Para cada teste pode existir um ou mais mtodos, os quais so desenvolvidos lanando se mo de diferentes princpios/fundamentos. A opo de escolha por um ou por outro mtodo ir depender, em princpio, do objetivo do teste. Neste manual, so descritos os mtodos de deteco dos agentes fitopatognicos mais comumente utilizados para a anlise sanitria de sementes em geral. Para alguns casos, descries de mtodos especficos ou especiais so includas. No Captulo 9 das RAS, haver indicao de apenas um mtodo para cada patossistema, exceto em casos que a pesquisa fornea evidncias estatsticas de equivalncia de dois ou mais mtodos disponveis. oportuno salientar que um mesmo agente pode ser detectado por diferentes mtodos, havendo diferenas entre eles em relao a sensibilidade, custos, complexidade de execuo, e objetivos do teste etc. 5.1 MTODOS DE DETECO DE FUNGOS Nesta seo os mtodos so apresentados, seguindo se, de certa forma, a ordem de interao do inculo dos fungos em relao s sementes que compem a amostra submetida para a anlise, conforme tratado no captulo 3 deste Manual. Ao final da descrio dos protocolos simplificados, so apresentadas, em separado, as caractersticas das principais espcies que so consideradas neste Manual para o mtodo de Incubao em Substrato de Papel (blotter test). Os padres de ocorrncia dos fungos so apresentados em separado, da forma como so visualizadas suas caractersticas tpicas ao microscpio estereoscpico e ao microscpio tico. 5.1.1 Inspeo visual da amostra de sementes Frao de sementes para a anlise:

Considerar a frao correspondente aos pesos indicados na anlise de pureza descritos nas Regras para Anlise de Sementes vigentes Procedimentos:

Submeter as pores de sementes ao peneiramento com malha de tamanhos variados, coletando as fraes obtidas em separado e dispondo-as em uma camada simples sobre superfcie limpa, previamente desinfestada, e sob luminosidade suficiente para observaes dos componentes fracionados a olho nu e/ou com auxilio de lupas resoluo de 10 a 40 X. Sementes e impurezas devem ser examinadas em separado.

28

5 - TESTES DE SANIDADE

Avaliao: Contar o nmero de sementes com sintomas/sinais tpicos dos agentes patognicos e as unidades de cada tipo de inculo, caso de esclerdios, estromas e agregados de frutificaes reconhecidas, presentes na amostra (Ilustraes na Figura 2). Presena de insetos e sementes de outras espcies deve ser registrada. Os resultados devem ser expressos em nmero de estruturas fngicas ou de sementes com sintomas do patgeno por peso.

Figura 2 - Esclerdios de Sclerotinia sclerotiorum em sementes de soja (A), trigo (B), feijo (C) e algodo (D). [Fotos de Prof. J.C.Machado- UFLA] Observaes gerais:

i - Metodologia aplicvel para exame de sementes que exibem sintomas ou sinais tpicas da presena de determinados fungos patognicos, como o caso de Colletotrichum lindemuthianum (Sacc. & Magnus) Briosi & Cavara (1889) (Figura 3A) em feijo; Peronospora manshurica (Naumov) Syd. (1923) (Figura 3B) e Cercospora kikuchii (Tak. Matsumoto & Tomoy.) M.W. Gardner (1927) (Figura 3C) ambos em soja; Bipolaris sorokiniana (Sacc.) Shoemaker (1959) em trigo (Figura 3D); Fusarium verticillioides (Sacc.) Nirenberg (1976), (Figura 4A) e Colletotrichum graminicola (Ces.) G.W. Wilson (1914) (Figura 4 B) ambos em milho; Drechslera oryzae (Breda de Haan) Subram. & B.L. Jain (1966) em arroz (Figura 4 C).

29

MANUAL DE ANLISE SANITRIA DE SEMENTES

Figura 3 - Colletotrichum lindemuthianum em feijo (A); Peronospora manshurica (B) e Cercospora kikuchii (C) em soja; Bipolaris sorokiniana em trigo (D). [Fotos de Prof. J.C.Machado-UFLA]

30

5 - TESTES DE SANIDADE

Figura 4 - Sintomas de Fusarium verticillioides (A) e Colletotrichum graminicola (B) em milho; Drechslera oryzae em arroz (C). [Fotos cedidas por Prof. J.C.Machado- UFLA] 5.1.2 Exame da suspenso de lavagem das sementes Nmero de sementes para a anlise: 4 repeties de 100 sementes Procedimentos: Colocar cada poro em frascos cnicos de 125 mL e adicionar, gua destilada no volume suficiente para cobrir 2 cm acima da camada superior das sementes. Proceder a agitao mecnica por 10 minutos e em seguida distribuir a suspenso em tubos de centrfuga. Aps centrifugao por 15 minutos, a velocidade de 3.000 rpm, descartar cuidadosamente o sobrenadante. A partir do pellet ou sedimento preparar lminas para exame microscpico. Avaliao: De posse das lminas com o pellet obtido, proceder a observao ao microscpio tico percorrendo, com auxilio do cursor, todo o campo visual tico, contando as estruturas tpicas do(s) microrganismo(s) alvo(s) do teste. Opcionalmente pode se realizar a avaliao por meio de cmaras de contagem de Neubauer (hemacitmetros). Recomenda se o exame (leitura) de no mnimo 5 lminas para cada repetio de 100 sementes. Os resultados so referenciados em nmero de esporos/semente ou por 100 sementes.

31

MANUAL DE ANLISE SANITRIA DE SEMENTES

Observaes gerais i - Mtodo aplicvel para fungos que frutificam e esporulam na superfcie das plantas infectadas ao final do ciclo e cujo inculo pode aderir se superfcie das sementes por ocasio da colheita e fase posterior. So exemplos: Pyricularia oryzae Cavara (1891) em arroz (Figura 5A); Peronospora manshurica (Naumov) Syd. (1923) em soja (Figura 5B); Tilletia caries (DC.) Tul. & C. Tul. (1847) em trigo (Figura 5C); Ustilago tritici (Pers.) C.N. Jensen, Kellerm. & Swingle (Figura 5D).

Figura 5 - Esporos de Pyricularia oryzae de sementes de arroz (A); osporos de Peronospora manshurica de sementes de soja (B); Tilletia caries de sementes de trigo (C); clamidosporos de Ustilago tritici (D). [Foto 5A: coleo de DR.S.B. Mathur (Dinamarca); Foto 5B de Dr. D. McGee (USA) e Fotos 5A e 5D de Prof. J.C. Machado- UFLA] ii - Para sementes com tegumento ressecado, recomenda se adicionar gua destilada algum dispersante neutro como tween, na concentrao de 50 ppm. iii - Nos casos em que a viabilidade do inculo no requerida, ou o exame da suspenso no for realizado logo em seguida a centrifugao, o pellet pode ser re-suspendido, e armazenado, com o prprio lquido de montagem das lminas, caso de lactoglicerol ou Azul de Amann modificado.

32

5 - TESTES DE SANIDADE

5.1.3 Incubao em Substrato de Papel ou mtodo do Papel de Filtro (blotter test) Numero de sementes para a anlise: 400 sementes (4 100, 8 50 ou 16 25) Procedimentos: Sementes so dispostas individualmente sobre camada de papel de filtro umedecido (3 discos sobrepostos ou 2 folhas de papel mata borro), mantendo se distanciadas 1-2 cm uma das outras, dependendo do tamanho de sua maior dimenso, no interior de recipientes, como placas de petri, gerboxes ou equivalentes. As placas, ou outros recipientes, devem conter tampas transparentes que permitem a passagem integral de luz incidente. Condies de Incubao: Recipientes com as sementes so dispostas sob lmpadas de luz fluorescente branca, a distancia de 30-40 cm, em cmaras com fotoperodo de 12 horas pelo perodo de 7-8 dias a temperatura de 20 2C. Avaliao/Exame das Sementes: Sementes so examinadas individualmente com auxilio de um estereomicroscpio a resoluo de 30-80X, pela ocorrncia de frutificaes tpicas do crescimento de fungos. Conidiforos com condios e corpos de frutificao (e.g., picndios, acrvulos, peritcios) formados nas sementes so caractersticas importantes para identificar espcies fngicas. Observaes de lminas ao microscpio tico so, algumas vezes, necessrias para confirmar a identidade dos fungos em nvel de espcie. Os resultados devem ser expressos em percentual de ocorrncia dos fungos com duas casas decimais. Observaes: i - O teste , normalmente, utilizado para sementes no desinfestadas; caso a desinfestao seja requerida, deve ser feito com soluo de hipoclorito de sdio a 1% por 3 minutos. ii - Para reduzir o processo de germinao das sementes de espcies de dicotiledneas, durante o perodo de incubao, o substrato de papel pode ser umedecido em soluo de sal de 2,4-D (2,4-diclorofenoxiacetato de sdio ) a 5 ppm de concentrao. No caso de monocotiledneas e algumas dicotiledneas com sementes menores, a tcnica do congelamento utilizado em substituio ao 2,4-D. Pesquisas recentes tm mostrado que o uso da restrio hdrica pode ser uma alternativa ao uso de ambas formas de inibio de germinao descritas. Recomendao neste sentido ainda requer testes comparativos.

33

MANUAL DE ANLISE SANITRIA DE SEMENTES

iii - Quando o congelamento recomendado, os recipientes com as sementes devem ser mantidos em cmara incubadora pelo perodo inicial de 24 horas sob temperatura de 20 2 C e, em seguida em congelador (-20 C) por 24 horas, e finalmente retornadas a incubadora a 20 2 C sob luz fluorescente branca, tal como descrito anteriormente, por mais 5 dias. iv - Pequenas cavidades no substrato de papel podem prevenir que sementes arredondadas movimentem se durante manipulao dos recipientes. A incorporao de 0,2% de gar a gua utilizada para umedecer o papel, pode prevenir a rolagem das sementes no substrato. v Em alguns casos que necessrio prolongar o perodo de incubao, por exemplo, para detectar Sclerotinia sclerotiorum em sementes de soja e feijo, recomenda se prolongar o perodo de incubao por mais uma semana a temperatura de 10-15 C, com umedecimento adicional do substrato. Para sementes tratadas com fungicidas o perodo de incubao deve ser prolongado por mais trs dias. Aplicaes deste mtodo so apresentadas em separado. 5.1.4 Plaqueamento em meio Agar slido (BDA ou MEA). Nmero de sementes para anlise: 400 sementes (4 100, 8 50 ou 16 25) Procedimentos: Sementes so imersas, inicialmente, em soluo de hipoclorito de sdio 1%, ou equivalente, durante 3 minutos; e em seguida, aps secagem rpida em papel de filtro esterilizado, distribudas assepticamente sobre o meio agar (BDA ou MEA) a uma distancia de 2-4 cm, dependendo do tamanho das sementes, 5-10 sementes por placa de petri, dimetro de 9 cm. Condies de Incubao: Placas, com sementes, so colocadas em cmara de incubao, sob luz fluorescente branca a temperatura de 20 2 C pelo perodo de 7-8 dias. Avaliao/exame das sementes: O exame inicial deve ser feito a olho nu observando se a formao e tipo de colnias desenvolvidas em volta das sementes. Cor, textura, morfologia geral e a presena de corpos de frutificao podem ser indicativos para o reconhecimento de espcies fngicas. Sementes devem ser tambm examinadas individualmente ao microscpio estereoscpico, observando se a formao de estruturas tpicas de fungos.

34

5 - TESTES DE SANIDADE

Observaes gerais: A inibio ou retardamento do processo de germinao das sementes de espcies de dicotiledneas pode ser realizada com o uso de 2,4-D (sal de sdio) na concentrao de 5 ppm. O sal deve ser incorporado ao meio antes da autoclavagem. Para algumas espcies de sementes, tanto de dicotiledneas como monocotiledneas, o uso da restrio hdrica, por meio de manitol ou equivalente, pode ser recomendado, sujeito ainda a testes de aferio e validao estatstica. Aplicaes deste mtodo tm sido recomendadas para alguns fungos como Ascochyta pisi em ervilha (Figura 6A), complexo Diaphorte (Phomopsis phaseolorum var. meridionalis) em soja (Figura 6B ) e Stagnospora nodorum em trigo (Figura 6C). Para alguns desses casos, o meio bsico agarizado pode sofrer modificaes em sua composio, tornando o mtodo seletivo ou semi-seletivo. Exemplos so: meio BDA com quintozene para deteco de espcies de Fusarium; meio agar (BDA) com azul de bromofenol e antibiticos para deteco de Sclerotinia sclerotiorum em feijo e soja (Figura 9) e meio agar salino para deteco de espcies de Aspergillus e de Penicillium em sementes armazenadas (Fig. 12) Os dois ltimos mtodos so descritos em detalhes na seo seguinte. Os resultados devem ser expressos em percentual de ocorrncia dos fungos com duas casas decimais.

B C A Figura 6 - (A) Ascochyta pisi; B) Diaphorte (Phomopsis); C) Stagonospora nodorum em meio Agar. [Foto 6A de Prof. J.C. Machado (UFLA); Foto 6B de Dr. D. MacGee (USA) e Foto 6C de Dr. S.B. Mathur (Dinamarca)]. 5.1.5 Mtodos especficos O enquadramento de mtodos nesta Seo se d com base no fato de que estes mtodos foram desenvolvidos com a destinao pontual de detectar um ou mais de um, daqueles fungos, que, em geral, no so facilmente detectados pelo mtodo de incubao em substrato de papel (blotter test). H em todo o mundo uma tendncia de se desenvolver estes mtodos considerando se aspectos como: objetividade, rapidez e maior preciso para estes casos. Os resultados devem ser expressos em percentual de ocorrncia dos fungos com duas casas decimais.

35

MANUAL DE ANLISE SANITRIA DE SEMENTES

5.1.5.1 Incubao em Rolo de Papel

A - Deteco de Colletotrichum lindemuthianum (Sacc. & Magnus) Briosi & Cavara (1889) em feijo. Nmero de sementes para a anlise: (4 100, 8 50 ou 16 25) Procedimentos: As sementes, em nmero de 50, so distribudas uniformemente sobre duas folhas de papel de germinao, tamanho 44,0 34,0cm, umedecidas com gua destilada, em seguida cobertas com uma terceira folha umedecida e da procedendo se ao enrolamento dos conjuntos. A desinfestao superficial das sementes recomendada por meio de soluo 1% de hipoclorito de sdio por 3 minutos. Condies de incubao: Os rolos, contendo as sementes, so acondicionados em sacos de polietileno com pequenas perfuraes no topo ou outro recipiente na posio vertical, e em seguida colocados em Cmaras de Incubao com atmosfera prxima a saturao, no escuro, a 20 2C pelo perodo de 7 dias. O uso de sacos plsticos pretos com perfuraes, pode dispensar o ambiente de saturao da cmara de incubao. Exame das sementes: As camadas que revestem as sementes, ou mais especificamente os tegumentos, so removidas ao final da incubao e os cotildones examinados a olho nu por leses necrticas circulares, pardo-escuras com bordos bem delimitados de colorao avermelhada e deprimidas. (Figuras 7A, B e C).

36

5 - TESTES DE SANIDADE

Figura 7 - Colletotrichum lindemunthianum em feijo: sintomas nos cotildones. [Fotos de Prof. J.C.Machado-UFLA].

B - Deteco de Sclerotinia sclerotiorum (Lib.) de Bary (1884) em feijo e soja Nmero de sementes para a anlise: (4 100, 8 50 ou 16 25). Procedimentos: As sementes, em numero de 50, so distribudas uniformemente sobre duas folhas de papel de germinao, tamanho 44,0 34,0cm, umedecidas com gua destilada, em seguida cobertas com uma terceira folha umedecida e da procedendo se ao enrolamento dos conjuntos. A desinfestao superficial das sementes recomendada por meio de soluo 1% de hipoclorito de sdio por 3 minutos. Condies de incubao: Rolos de papel mantidos em cmara de incubao a 15-20 C, na ausncia de luz, e acondicionados em recipientes com atmosfera prxima a saturao, a semelhana do que foi referenciado para C. lindemuthianum em feijo, pelo perodo de 14 dias.

37

MANUAL DE ANLISE SANITRIA DE SEMENTES

Exame das sementes: Observao de miclio tipicamente branco de S. sclerotiorum com formao de esclerdios negros, forma esfrica, irregulares e tamanho de 2 a 10 mm ao redor das sementes infectadas. (Figuras 8A e 8B).

Figura 8 - A) Esclerdios de Sclerotinia sclerotiorum ao redor de sementes de feijo; B) e em soja em incubao pelo mtodo de Rolo de papel. [Fotos de Prof. J.C.Machado-UFLA].

5.1.5.2 Incubao em Meio Agar-Bromofenol (NEON) Nmero de sementes para a anlise: (4 100, 8 50 ou 16 25) Procedimentos:

As sementes so colocadas em meio BDA contendo 150mg/l de Azul de bromofenol, 150mg/l de sulfato de estreptomicina e 150mg/l de penicilina G. Como alternativa ao uso dos antibiticos sulfato de estreptomicina e penicilina G pode se usar 50g de cloranfenicol. O pH final deve ser ajustado para 4,7 com HCl ou NaOH. O Azul de bromofenol e os antibiticos so incorporados ao BDA fundido (50 C) aps autoclavagem. Distribuir 18 mL do meio por placa de Petri de 9 cm de dimetro. Condies de incubao: As placas devem ser expostas a luz negra, da forma como recomendado para os mtodos de Incubao em substrato de Papel e Plaqueamento em meio agar com 12 horas de fotoperodo, a 20 C por 5-8 dias.

38

5 - TESTES DE SANIDADE

Exame das sementes: A partir do terceiro dia de incubao, observaes devem ser realizadas para verificar a formao de halos amarelo-avermelhados ao redor das sementes (Figura 9). Para a confirmao da presena de Sclerotinia sclerotiorum, observar as placas sobre uma base de vidro transparente com luz branca na base; a visualizao de miclio superficial sobre o meio na zona do halo amarelado, partindo das sementes, confirma a presena do fungo em foco.

Figura 9 - Colnias de Sclerotinia sclerotiorum em meio semi-seletivo com azul de bromefenol. [Foto de Prof. J.C.Machado-UFLA] Observaes: Este mtodo especfico para deteco de Sclerotinia sclerotiorum, porm algumas espcies de Aspergillus, Rhizopus, Sclerotium podem tambm provocar alterao da cor do meio. Nestes casos a formao de frutificaes tpicas dessas espcies podem ser facilmente distinguidas de Sclerotinia (Figura 10).

39

MANUAL DE ANLISE SANITRIA DE SEMENTES

Figura 10 - Presena de outros fungos contaminantes mudando a colorao do meio Azul de bromofenol agarizado em sementes de feijo. [Foto de Prof. J.C.Machado-UFLA].

5.1.5.3 Fluorescncia sob luz negra Numero de sementes para a anlise: 400 sementes (4 100, 8 50 ou 16 25) Procedimentos: Sementes so distribudas sobre discos de papel de filtro umedecidos, ou outro papel neutro absorvente, a semelhana do que foi descrito para o protocolo padro de Incubao em Substrato de Papel. Condies de Incubao: Recipientes com sementes so mantidos inicialmente em ambiente a 18 C pelo perodo de trs dias e em seguida a -18 C por 5 horas e depois em Incubadora a 28 C por mais 4 - 7dias na ausncia de luz.

40

5 - TESTES DE SANIDADE

Avaliao/Exame das Sementes: Sob luz negra (NUV - screened lamp de 366nm, mnimo de 100 W), observar as seguintes caractersticas: 1) Mancha amarelo-enxofre fluorescente, dimetro de 1 a 2cm no papel de filtro ao redor das sementes e manchas menores em volta das razes; no estgio inicial h formao de halo fluorescente com colorao azul claro. (Figura 11).

Figura 11 - Stagonospora nodorum: colnias fluorescentes ao redor de sementes de trigo. [Foto de Kietreiber, M., 1984]. 2) Miclio com colorao amarelo-enxofre fluorescente ou gotculas de reduzido tamanho (1mm de dimetro) na superfcie das sementes. 3) Manchas esparsas de colorao amarelo opaco que desaparecem na medida da seca do papel ou apresentando colorao azul intensa no papel sem a caracterstica de fluorescncia amarelo-enxofre no devem ser consideradas. 5.1.5.4 Incubao em Meio Agar Salino Numero de sementes para a anlise: 400 sementes (4 100 ou 8 50) Procedimentos: Sementes so inicialmente desinfestadas por imerso em soluo de hipoclorito de sdio a 1% por trs minutos e depois distribudas assepticamente sobre o meio BDA contendo 150g de cloreto de sdio por litro de meio. A adio do sal deve ser feita aps a autoclavagem do BDA.

41

MANUAL DE ANLISE SANITRIA DE SEMENTES

Condies de Incubao: Placas, com sementes, so colocados em cmara de incubao, sob luz fluorescente branca, fotoperodo de 12 horas, a temperatura de 20 C pelo perodo de 7 dias.

Avaliao/exame das sementes: Observar colnias tpicas das espcies de Aspergillus e de Penicillium ao redor das sementes. As espcies mais frequentes em sementes apresentam as seguintes caractersticas por este mtodo: Colnias com colorao verde amarelo, claro a intenso, de Aspergillus flavus (Figura 12A); verde azulado a cinza claro de Aspergillus glaucus (Figura 12B); amarelo claro a amarelo laranja intenso (caramelizado) de Aspergillus ochraceus (Figura 12C) e, colnias brancas a beije claro so tpicas de Aspergillus candidus. Colnias de Penicillium sp apresentam colorao verde ou azul cinza com aparncia superficial pulverulenta (Figura 12D); no verso a colnia exibe em geral colorao amarelo-alanrajanda, levemente fluorescente. Espcies de Aspergillus, (Figura 67 A, B e C) formam vesculas no extremo do conidiforo o que no ocorre com espcies de Penicillium (Figura 67 D e E ). Para confirmaes, alm do exame ao microscpio estereoscpico com resoluo mais alta, recomendvel o exame de lminas ao microscpio tico.

Observaes gerais: Embora este mtodo tenha sido desenvolvido para deteco de fungos de armazenamento, colnias de Fusarium moniliforme (F. verticillioides) e outros fungos associados com sementes de variadas espcies podem tambm se desenvolver ao redor das sementes nas condies do teste, mas apresentam caractersticas claramente distintas das colnias de Aspergillus e Penicillium.

42

5 - TESTES DE SANIDADE

Figura 12 - Crescimento de fungos de armazenamento meio de cultura salino: Aspergillus flavus (A) Aspergillus glaucus (B), Aspergillus ochraceus (C) e Penicillium sp. (D). [Fotos de Prof. J.C.Machado-UFLA]. 5.1.5.5 Exame de embrio para deteco de Ustilago sp. em sementes de cereais Nmero de sementes para a anlise: 4 100g de sementes Procedimento do teste: Embeber sementes, separadamente em pores de 100g em 1 L de soluo de hidrxido de sdio 5%, ou hidrxido de potssio, contendo 0,15g de trypan blue, por 22-24 horas a 20-22 C. Lavar amostra em gua levemente aquecida sob agitao para separar os embries dos demais tecidos da semente. Verter o material sobre trs peneiras superpostas, a primeira com 3,5mm de malha, a segunda com 2,0 e a de baixo, 1,0mm de malha. Direcionar jatos controlados de gua, sobre o material da primeira peneira e depois nas demais, em posio inferior. Em todas as peneiras o material deve ser cuidadosamente agitado para a liberao dos embries. Transferir os embries coletados na peneira inferior, para um becker com auxilio de etanol 93%. Aps 2 minutos, descartar a frao lquida, evitando se o descarte de embries.

43

MANUAL DE ANLISE SANITRIA DE SEMENTES

Em seguida transferir os embries para funil de Baermanm, contendo 200mL de uma mistura de cido ltico, glicerol e gua (1:2:1). Nestas condies os detritos so separados e descartados. Colocar os embries de cada repetio (poro de 1000g) em beakers de 250mL contendo previamente uma mistura de cido ltico e glicerol (1:2) e da aquecidos at a fervura por 2 minutos. Examinar os embries, aps uma hora, ao microscpio estereoscpico.

Avaliao/exame das sementes/embries Hifas de Ustilago tritici podem ser visualizadas a partir da resoluo de 12X (Figura 13A), sendo mais ntidas nas resolues de 25 e 50 X. (Figuras 13B e 13C). Maiores detalhes sobre a execuo deste mtodo esto descritos por Mathur & Kongsdal (2003).

Figura 13 - Hifas de Ustilago tritici em embries de trigo/cevada. Maiores detalhes sobre a execuo deste mtodo esto descritos por Mathur & Kongsdal (2003). [Foto 13B de Prof. J.C. Machado- UFLA]

5.1.5.6 Exame de marcadores moleculares A deteco de fungos via tcnicas moleculares tem como princpio a anlise de cidos nuclicos, presentes no ncleo ou em organelas tipo ribossomos e mitocndrias celulares. Embora os estudos para algumas espcies j encontram se em fase avanada, a disponibilizao dos mtodos para sua deteco enfrentam ainda dificuldades em anlise de rotina, em razo da interferncia, dentre vrios fatores, de elementos celulares das sementes nas reaes que constituem os protocolos desenvolvidos para essas espcies, alvos das pesquisas at momento. Desta forma, neste Manual, nenhum mtodo molecular est sendo includo, tendo se como argumento o fato de que os protocolos j desenvolvidos at o momento ainda requerem estudos adicionais para sua aplicao na prtica. Acredita se, que em um futuro prximo alguns destes mtodos, voltados para fungos, sero certamente incorporados s Regras para Anlise de Sementes, no Brasil. importante ressaltar que o uso de mtodos baseados em tcnicas moleculares, para deteco de fungos ter sua aplicao mais extensiva em casos que a distino morfolgica entre determinadas espcies extremamente difcil ou insegura e em situaes onde a demanda de anlise sanitria seja elevada em um curto perodo de tempo.

44

5 - TESTES DE SANIDADE

CARACTERISTICAS DOS FUNGOS EXIBIDAS EM SEMENTES PELO MTODO DE INCUBAO EM SUBSTRATO DE PAPEL Allium cepa L. (CEBOLA) Alternaria porri (Ellis) Cif. (1930)

Figura 14 - Alternaria porri em sementes de cebola (A) e condios em preparao microscpica (B). [Fotos de Prof. J.C. Machado-UFLA] Sobre as sementes, o crescimento do fungo abundante, apresentando miclio cinza com condios de colorao marrom em conidiforos curtos, hialinos longos, afinalados, simples ou em grupos de 2 ou 3. Os condios so obclavados ou elipsides com 8-12 septos transversais, com ausncia ou presena de septos longitudinais ou oblquos, 100-300 x 15-20 m (Figura14 A e B).

45

MANUAL DE ANLISE SANITRIA DE SEMENTES

Brassicae oleraceae L. (BRASSICAS) Alternaria brassicae (Berk.) Sacc. (1880)

Figura 15 - Alternaria brassicae em sementes de brssicas (A e C) e em lminas (B).[Fotos de Prof. J.C. Machado UFLA].

Em geral, o crescimento do fungo apresenta condios com colorao marrom oliva claro para escuro, podendo ser individuais ou ocasionalmente em cadeias com poucos condios. Estes podem ser obclavados, retos, rostrados, com 6-19 septos transversais (normalmente 11-15) e 0-8 septos longitudinais ou oblquos, colorao oliva plida ou plida intenso. Os condios possuem de 75-350 m de comprimento x 20-30 m de largura; o comprimento do bico (pice) aproximadamente de 1/3 a 1/2 do maior comprimento do condio. Figura (15).

46

5 - TESTES DE SANIDADE

Alternaria brassicicola (Schwein.) Wiltshire (1947)

B Figura 16 - Alternaria brassicicola em sementes de brssicas (A) e em lminas de microscpio (B). [Fotos de Prof. J.C. Machado - UFLA] Crescimento superficial intenso, tipo pulverulento, sobre as sementes, com farta produo de condios negros, brilhantes em cadeias longas ou curtas, caracterstica dessa espcie. As cadeias de condios so simples, raramente se ramificadas, e bicos no visveis. Raramente observado crescimento micelial sobre as sementes. Os condios so geralmente cilndricos afilando ligeiramente, normalmente para o pice da clula basal com arredondamento no bico. Apresentam septos transversais com poucos septos longitudinais, com colorao plido a olivceo escuro podendo tornar-se dourados. Tamanho de 18-130 x 8-20 m. (Figura 16 A e B).

47

MANUAL DE ANLISE SANITRIA DE SEMENTES

Sclerotinia sclerotiorum (Lib.) de Bary (1884)

Figura 17 - Sclerotinia sclerotiorum em sementes de repolho. [Fotos de Prof. J.C. Machado-UFLA] Miclio branco ou ligeiramente cinza, normalmente areo, algumas vezes exibindo tufos ou filamentos retorcidos. Esclerdios de cor negra, tamanho e formas variveis, desenvolvem na superfcie da colnia, principalmente prximo s extremidades das hifas, no limite de crescimento radial da colnia (Figura 17). Os esclerdios so arredondados ou alongados, reniformes, com tamanho de at 1cm. Obs: A incubao pelo mtodo de substrato de papel tem sido realizada no escuro e com a temperatura de 10-15 C por 12-14 dias.

48

5 - TESTES DE SANIDADE

Cucumis melo L., Cucurbita spp. e outras (CUCURBITCEAS) Didymella bryoniae (Fuckel) Rehm (1881)

Figura 18 - Didymella bryoniae em sementes (A e B) e em lmina (C). [Fotos extradas de Mathur & Kongston (2003)]. Sobre as sementes so formados picndios maduros de tamanho varivel e irregulares, submersos nos tecidos externos e distribudos ao centro de miclio escuro, esparso e radial (Fig. 18A). Em alguns casos, oozes podem ser visualizadas saindo dos picndios maduros (Figura 18B). Condios produzidos em picndios maduros, formados tegumento das sementes, so hialinos, geralmente unicelulares, e menores do que os condios produzidos em picndios formados em tecidos vivos de sementes, apresentando um a dois septos e medindo se 6-13 3-5m (Figura 18C).

49

MANUAL DE ANLISE SANITRIA DE SEMENTES

Daucus carota L. (CENOURA) Alternaria dauci (J.G. Khn) J.W. Groves & Skolko (1944)

Figura 19 - Alternaria dauci em sementes de cenoura (A, B e C) e condios em lminas de microscpios (D). [Fotos de Prof. J.C. Machado - UFLA] Na superfcie das sementes os conidiforos so formados de maneira individual ou em pequenos grupos, originados de hifas areas ou superficiais, algumas vezes geniculados, septados; so retilneos ou sinuosos, colorao marrom plido a marrom oliva. Condios so normalmente individuais, ocasionalmente em cadeias de 2, retilneos ou curvados, obclavados, rostrados, bico com comprimento 3 vezes maior que o corpo, inicialmente marrom oliva plidos, tornando-se marrom com a idade, melhor visualizados sobre a superfcie das sementes (Figura 19A, B e C). Tamanho de 100-450m de comprimento, 16-25 (20) m de largura em sua parte mais larga, 7-11 septos transversais e 1 a alguns septos longitudinais ou oblquos, bico frequentemente com uma ramificao, sinuosa, hialina ou plida, 5-7 m de espessura e base afilada de 1-3 m. (Figura 19 D).

50

5 - TESTES DE SANIDADE

Alternaria radicina Meier, Drechsler & E.D. Eddy (1922)

Figura 20 - Alternaria radicina em sementes de cenoura (A), condios em preparao microscpica (B). [Fotos de Prof. J.C. Machado]. Miclio areo, escuro, abundante, e superficial sobre as sementes e sobre o papel substrato prximo s sementes, com numerosos condios de colorao negra. (Figura 20 A). Conidiforos normalmente individuais, simples ou ocasionalmente ramificados, retilneos ou curvados, cilndricos, septados, plidos a meio amarromzados ou marrom oliva, lisos, com um ou mais geniculaes, medindo at 200 micra de comprimento. Condios individuais ou cadeias de 2 ou raramente 3 (Figura 20B), retilneos, variveis em forma, predominantemente elipsides, obclavados ou obpiriformes, bico curto, marrom claro a escuro ou marrom oliva, lisos, normalmente com 3-7 septos transversais e 1 a mais septos longitudinais ou oblquos, com constrio no septo, comprimento de 27-57(38) m e largura de 9-27(19) m em sua parte mais larga.

51

MANUAL DE ANLISE SANITRIA DE SEMENTES

Glycine max (L.) Merril (SOJA) Cercospora kikuchii (Tak. Matsumoto & Tomoy.) M.W. Gardner (1927)

Figura 21 - Cercospora kikuchii em sementes de soja (A e B) e condios em preparaes microscpicas (C, D e E). [Fotos de Prof. J.C.Machado-UFLA) Miclio superficial, relativamente denso, com colorao varivel entre marrom olivceo, cinza a prpura. No substrato ao redor das sementes, as colnias apresentam se com cor prpura tpica (Figura 21 A). Conidiforos, quando formados, apresentam se fasciculados (esporodquios) com colorao olivceo a marrom plido. Condios so alongados, hialinos formados nos extremos e ao lado dos conidiforos (Figura 21). Conidiforos medindo 120-200 4-5 m e os condios, com 14-20 septos, 130-230 3-4 m (Figura 21 C,D e E).

52

5 - TESTES DE SANIDADE

Colletotrichum truncatum (Schwein.) Andrus & W.D. Moore (1935)

Figura 22 - Colletotrichum truncatum em sementes de soja (A e C) e condios em preparaes microscpicas (B). [Fotos de Prof. J.C. Machado-UFLA].

C
Miclio tipicamente acinzentado com formao irregular e confluente de corpos estromticos (primrdios de esclerdios) e, em geral, exibindo sobre a superfcie das sementes, acrvulos com setas proeminentes, marrons escuras, em abundancia (Figura 22A); ocasionalmente massas conidiais de colorao bege a rsea so visualizadas (Figura 22B). Condios so falcatos com pices obtusos, hialinos, gotulados, tamanho variando entre 15,5-24 3,5-4m (Figura 22C e D).

53

MANUAL DE ANLISE SANITRIA DE SEMENTES

Fusarium semitectum Berk. & Ravenel (1874)

Figura 23 - Fusarium semitectum em sementes de soja (A e B), condios em preparao microscpica pela tcnica da fita adesiva (C). [Fotos de Prof. J.C.Machado-UFLA]. Miclio inicialmente com colorao branca a pssego, apresentando se uma tonalidade avelanceo a marrom claro ao final do perodo de incubao. Dois tipos de macrocondios, denominados de primrios e secundrios, podem ser formados por esta espcie, sendo visualizados como pequenos agregados no meio do miclio (Figura 23A e B) Os condios primrios apresentam 0-5 septos, 17-28 2,5-4 m, clula apical curvada pontiaguda em um dos extremos e a outra semelhante a um calcanhar. Condios secundrios so formados em filides tpicas normalmente agrupadas em esporodquios, apresentando clula basal (foot cell), tamanho 20-46 3-5,5m e com 3-7 septos (Figura 23C). Clamidsporos geralmente esparsos, globosos, 10-12 m de dimetro, formados intercaladamente, livres ou em cadeias e tornando-se marrons.

54

5 - TESTES DE SANIDADE

Macrophomina phaseolina (Tassi) Goid. (1947) Idem Feijo Phomopsis sojae Lehman (1922)

Figura 24 - Phomopsis sojae em sementes de soja (A e C) e em preparaes microscpicas (B e D). [Fotos de Prof. J.C.Machado-UFLA]. Miclio branco a marrom-plido, floculoso areo, ou levemente denso superficial, com produo abundante de picndios, na maioria das vezes distribudos irregularmente na superfcie das sementes (Figura 24 A). Picndios so globosos a irregulares, imersos, tornando-se erumpentes, abrindo-se por um ostolo apical. Em alguns casos, massas conidiais de colarao beje-amarelado, (Figura 24C) so formadas sobre os picndios. Condios so de dois tipos (alfa e beta): condios do tipo alfa () so mais frequentes, hialinos, unicelulares, fusiformes a elipsoidais, 2 gtulos, um em cada extremidade (Figura 24B), tamanho 6-8 2-2,5m; condios tipo beta () so hialinos, alongados, filiformes, curvados, muitas vezes fortemente enganchados, dimenso de 20-30 0,5-1m. (Figuras 24D).

55

MANUAL DE ANLISE SANITRIA DE SEMENTES

Rhizoctonia solani J.G. Khn (1858) Idem Feijo

Sclerotinia sclerotiorum (Lib.) de Bary (1884)

Figura 25 - Sclerotinia sclerotiorum em sementes de soja. [Fotos de Prof. J.C.Machado-UFLA]. Miclio branco ou ligeiramente cinza, normalmente areo, algumas vezes exibindo tufos ou filamentos retorcidos. Esclerdios de cor negra, tamanho e forma variveis, desenvolvem na superfcie da colnia, principalmente prximo s extremidades das hifas, no limite de crescimento radial da colnia (Figura 25). Os esclerdios so arredondados ou alongados, reniformes, com tamanho de at 1cm. Obs: A incubao pelo mtodo de substrato de papel tem sido realizada no escuro e sob a temperatura de 10-15 C por 12-14 dias.

56

5 - TESTES DE SANIDADE

Gossypium hirsutum L. (ALGODO) Alternaria macrospora (Sacc.) Sacc

Figura 26 - Alternaria macrospora em semente de algodo (A e B) e em lmina microscpica (C). [Fotos de Prof. J.C.Machado-UFLA].

Miclio areo de colorao cinza escuro, com formao de condios diretamente de hifas, e com abundante produo de conidiforos e condios marrom escuros, saindo diretamente da superfcie das sementes (Figura 26 A). Sob resoluo mais elevada, condios se apresentam, na maioria, em camada nica, raramente em cadeia de dois, tendo o pice tipicamente alongado (Figura 26B). Conidiforos so escuros com pouca ramificao, medindo se 80 m comprimento e 4-9 m largura. Condios so marrons escuros, muriformes, com o pice ou bico alongado, medindo em mdia de 90-180(134)m de comprimento e 1522(17,7) m de largura (Figura 26C).

57

MANUAL DE ANLISE SANITRIA DE SEMENTES

Botryodiplodia theobromae Pat. (1892) (Syn. Lasiodiplodia theobromae)

Figura 27 - Botryodiplodia theobromae em sementes de algodo e em papel de filtro (A e C), condios em preparao microscpica (B) e exsudao de condios produzidos em picndios imersos nas superfcies das sementes (D). [Fotos A, B e C de Prof. J.C.Machado-UFLA, e Foto D de Dr. S.B. Mathur Dinamarca] Miclio areo, denso e acinzentado na superfcie da semente e substrato. Produo de picndios dispersos ou em agregados escuros, com pilosidades em volta do ostolo. Em alguns casos, picndios podem produzir exudato conidial gelatinoso claro, no incio, e escuro, ao final do perodo de incubao (Figura 27B e D). Condios jovens so unicelulares, hialinos, granulosos, subovides a oblongo-elipsides, com parede espessa e base truncada. Condios maduros so bicelulares, cor castanho-amarelada, frequentemente com estrias longitudinais, medindo se 18-(20)-30 10-15 m (Figura 27B).

58

5 - TESTES DE SANIDADE

Colletotrichum gossypii Southw. (1890)

Figura 28 - Colletotrichum gossypii na semente de algodo (A e B) e condios/conidiforos em preparaes microscpicas com auxilio da tcnica de fita adesiva (C e D). [Fotos de Prof. J.C.Machado UFLA] Miclio escasso, dificilmente visualizado, com setas escuras, curtas, em alta densidade sobre a superfcie externa da semente, caracterizando, em alguns casos, um revestimento superficial do tegumento (Figura 28). Nestas circunstancias, as sementes podem exibir uma aparncia rosa claro como resultado da abundante esporulao do fungo. Em alguns casos, agregaes levemente gelatinosas de cor bege a creme podem ser visualizadas ao longo de algumas hifas sobre o tegumento das sementes. A semelhana de C. g. var. cephalosporioides, acrvulos tpicos do gnero Colletotrichum so visualizados em tecidos vivos das sementes, expostos por ocasio do exame. Setas so marrons escuras com variaes em tamanho e podendo apresentar condios em seus pices; os condios so morfologicamente semelhantes aos condios de C. g. var. cephalosporioides embora , em geral, ligeiramente menores.

59

MANUAL DE ANLISE SANITRIA DE SEMENTES

Colletotrichum gossypii var. cephalosporioides A.S. Costa (1946)

Figura 29 - Colletotrichum gossypii var cephalosporioides em sementes de algodo (A, B e C) e condios (D). [Fotos de Prof. J.C.Machado-UFLA]. Miclio areo, cor cinza claro, pouco denso, com formao de setas frteis escuras produzidas ao longo das hifas. Setas formadas na superfcie das sementes so longas e em menor numero e pouco densas comparadas com o padro produzido por C. gossypii (agente da antracnose). Agregaes gelatinosas so visualizadas no meio do miclio areo produzido sobre as sementes ((Figura 29A, B e C). Presena de setas com condios no pice podem ser visualizadas em acrvulos produzidos em tecidos vivos de radculas, ou em setas formadas isoladamente diretamente do miclio. Os condios de C. g v. cepahlosporioides so unicelulares, hialinos, geralmente cilndricos, cnicos em relao a um lado, medindo se 3,5-7 12-25 m (Figura 29 D).

60

5 - TESTES DE SANIDADE

Fusarium oxysporumW.C. Snyder & H.N. Hansen (1940)

Figura 30 - Fusarium oxysporum em sementes de algodo (A, B e C) e condios em lminas microscpicas (D). [Fotos de Prof. J.C.Machado-UFLA]. Miclio areo com pigmentao bege plido a rosa, roxo, vinceo a azul (Figura 30A, B e C). Sob resoluo mais elevada (80), podem ser observadas falsas cabeas de microcondios formadas no extremo de conidiforos curtos produzidos ao longo da hifa (Figura30D), e agrupamentos de macrocondios, em diferentes locais do miclio. Microcondios so predominantemente unicelulares, forma oval a reniforme, tamanho 5-12 2,2-3,5m. Macrocondios produzidos em esporodquios globosos ou em massa mucosa (pionodes), gradualmente cnicos em direo a ambos os lados, clula apical pontiaguda com um leve gancho e uma clula basal em forma de calcanhar, de 0 a 7 septos, com predominncia de 3, tamanho variando de 4-13 2,0-3,5 m a 34-78 3,0-6,0 m com maior nmero de 27-46 3-4,5 m. Presena de monofilides, clamidsporos globosos, geralmente abundantes, nos condios e hifas, terminais ou intercalares, com uma parede mutualmente lisa e rugosa, individuais, em pares ou pequenas cadeias. (Figura 30 D). Rhizoctonia solani J.G. Khn (1858) Idem Feijo

61

MANUAL DE ANLISE SANITRIA DE SEMENTES

Helianthus annuus L. (GIRASSOL) Alternaria helianthi (Hansf.) Tubaki & Nishih. (1969)

Figura 31 - Alternaria helianthi : condios em sementes de girassol (A, B e C) e em lminas de microscpio (D). [Fotos de Prof. J.C.Machado UFLA]. Sobre as sementes, os conidiforos so individuais ou em feixes, simples, retilneos ou ligeiramente sinuosos, algumas vezes geniculados, plidos a marrom meio-olivceos, tamanho de 120 m de comprimento e 8-11m de largura. Condios individuais, ocasionalmente em cadeias de 2, retilneos, cilndricos ou raramente obclavados, arredondados nas extremidades, sub-hialinos a meio-olivceos ou marrons dourados, lisos, com 2-12 septos transversais e ocasionalmente 1 ou mais longitudinais ou oblquos, frequentemente com constrio nos septos em cultura, medindo 45-145 m de comprimento, 10-30 m de largura em sua parte mais larga (Figura 31 D ). Condios no exibem a formao de bicos alongados (Figura 31 D).

62

5 - TESTES DE SANIDADE

Alternaria zinniae M.B. Ellis (1972)

Figura 32 - Alternaria zinniae em sementes de girassol (A) e condios em preparaes microscpicas (B e C). [Fotos de Prof. J.C.Machado UFLA]. Sobre as sementes, miclio abundante, ou pouco denso, areo de cor cinza. Condios so de cor marrom, clareando em direo ao pice, normalmente individuais, muitas vezes apicalmente dispersos ou agrupados, retilneos ou levemente geniculados, em conidiforos curtos. Condios so obclavados, apresentando a base (corpo) com dimenso de 55-105 19-28 m, e a extremidade na forma de um longo bico simples, filiforme, com o pice ligeiramente dilatado, comprimento de 55-185 m (Figura 32B e C). Sclerotinia sclerotiorum (Lib.) de Bary (1884)

Idem Feijo Lactuca sativa L. (ALFACE) Sclerotinia sclerotiorum (Lib.) de Bary (1884) Idem Feijo

63

MANUAL DE ANLISE SANITRIA DE SEMENTES

Oryza sativa L. (ARROZ) Drechslera oryzae

Figura 33 - Drechslera oryzae em sementes de arroz (A, B e C) e condios em lminas microscpicas (D). [Fotos de Prof. J.C.Machado UFLA]. Sob aumento de 20-80, o crescimento do fungo pode ocorrer de duas formas, a primeira com miclio ausente ou escasso, com conidiforos retilneos ou sinuosos, de cor marrom, suportando condios marrons escuros acropleruogenados sobre a superfcie das sementes (Figura 33 A, B e C). Na segunda forma, o miclio areo pouco denso, de cor preta-acinzentada, conidiforos e condios escassos, cobrindo parte ou toda semente, frequentemente prolongando-se pelo substrato de papel. Condios so de colorao marrom oliva, normalmente curvados, mais largos no meio ou logo acima, extremidade cnica a arredondada, ocasionalmente cilndricos e quase retilneos, com 6-14 distoseptos, tamanho 63-153 (109) 22 (17)m; hilo na maioria das vezes no conspcuo (Figura 33D), formados na sua maioria na metade superior dos conidiforos.

64

5 - TESTES DE SANIDADE

Gerlachia oryzae (Hashioka & Yokogi) W. Gams (1980)

Figura 34 - Gerlachia oryzae em sementes de arroz (A, B e C) e condios em lminas de microscpios (D). [Fotos de Prof. J.C.Machado UFLA]. Sobre as sementes so formados pequenos pionodes isolados, ou coalescidos de formato oval a circular, de colorao laranja brilhante ou algumas vezes rosa-plido, geralmente lisos (Figura 34 A). O miclio, na maioria das vezes, escasso, tornando-se presente somente na forma de poucos filamentos. (Figura 34 B e C). Condios asseptados quando jovens e uni-septados quando maduros, raramente com dois septos, no-pedicelados, com pontuaes em ambas extremidades, tamanho de 10,6 3,5 m a 11,9 3,5 m. Clulas apicais com pontas encurvadas (Figura 34 D).

65

MANUAL DE ANLISE SANITRIA DE SEMENTES

Phoma sorghina (Sacc.) Boerema, Dorenb. & Kesteren (1973)

Figura 35 - Picndios de Phoma sorghina em sementes de arroz (A, B e C) e massa de condios de picndio em preparaes microscpicas. [Fotos de Prof. J.C.Machado- UFLA]. Picndios, isolados ou aglomerados, formados na superfcie ou parcialmente imersos, cor marrom claro a marrom escuro (Figura 35A). Clamidsporos miceliais podem ser formados na superfcie da semente (Figura 35 D). Picndios subglobosos ou globosos, 60-140 m de dimetro, ostiolados, individuais ou agregados, bicos caractersticos. Condios hialinos, gutulados, globosos a ovulados ou cilndricos curtos, normalmente retilneos, ocasionalmente curvados, unicelulares, ocasionalmente com um septo, tamanho (3) 4-7 3 (2,5) m (Figura 35 D).

66

5 - TESTES DE SANIDADE

Pyricularia oryzae Cavara (1891)

Figura 36 - Pyricularia oryzae em sementes de arroz (A, B e C) e condios em preparao microscpica (D). [Fotos de Prof. J.C.Machado UFLA] Miclio de cor cinza a verde, pouco perceptvel, nas glumelas das sementes, contendo delicados conidiforos plidos com agrupamentos de poucos condios pontiagudos em sua extremidade. Raramente o crescimento do fungo pode encobrir toda semente. Condios, hialinos, aparecem na forma de pequenos cachos (Figura 36 A, B e C). Condios so tipicamente obpiriformes, hialinos, truncados, com uma pequena salincia na base, bi-septados, normalmente com o pice pontiagudo, tamanho 20-25 9-12 m (Figura 36 D).

Rhizoctonia solani J.G. Khn (1858) Idem Feijo

67

MANUAL DE ANLISE SANITRIA DE SEMENTES

Trichoconiella padwikii (Ganguly) B.L. Jain (1976)

Figura 37 - Trichoconiella padwikii em sementes de arroz (A e B) e condios em preparaes microscpicas (C, D e E). [Fotos A, B, C e D de Prof. J.C.Machado UFLA] O fungo apresenta dois padres de crescimento, um com abundncia de condios e pouco miclio e o outro com pouca produo de condios e miclio areo mais abundante (Figura 38 A e B). O primeiro padro mais comum, podendo a semente ser coberta de forma completa ou parcial. Quando o miclio abundante, a visualizao dos condios se torna mais difcil; neste caso a observao pode ser feita com auxlio do microscpio ptico (Figura 37 C, D e E). O miclio desta espcie normalmente viscoso, sendo esta propriedade detectada quando lminas so preparadas com o auxlio de estiletes. Ao redor das sementes infectadas manchas prpuras rosadas podem ser formadas. Os condios so de colorao, primeiramente, hialinos, depois tornam-se marrom dourado, lisos, com forma semelhante ao gnero Alternaria, diferindo-se basicamente pela formao de septos apenas transversais. Apresentam dimenses de 95-170 (130) m x comprimento, 11-20 (15,7) m de espessura, geralmente, com 3-5 septos transversal, mas comumente 4. (Figura 37C, D e E).

68

5 - TESTES DE SANIDADE

Phaseolus vulgaris L. (FEIJO) Colletotrichum lindemuthianum (Sacc. & Magnus) Briosi & Cavara (1889)

Figura 38 - Colletotrichum lindemuthianum: na superfcie de sementes de feijo (A) e acrvulo e condios em preparao microscpica (B). [Fotos de Prof. J.C.Machado UFLA] Miclio raramente visualizado com formao de pequenos acrvulos na superfcie das sementes. Sob alta resoluo, setas escuras em pequeno nmero so vistas em acrvulos de base reduzida. Dependendo do grau de associao do fungo com as sementes, massa gelatinosa pode ser formada nos acrvulos cobrindo grande parte das setas (Figura 38A). Acrvulos apresentam pequeno nmero de setas, curtas, com formao de condios cilndricos a obvoides hialinos, gotulados, com dimenso mdia de 2,5 5,5 x 11-20 m. (Figura 38B). OBSERVAO: Tendo em vista a ocorrncia de outras espcies de Colletotrichum, como C. dematium, o exame de lminas pelo Mtodo de Incubao em Substrato de Papel torna se indispensvel.

69

MANUAL DE ANLISE SANITRIA DE SEMENTES

Phaeoisariopsis griseola (Sacc.) Ferraris (1909)

Figura 39 - Phaeoisariopsis griseola na superfcie de semente de feijo (A) e sinmios com condios em preparao microscpica (B). [Fotos de Prof. J.C.Machado UFLA] Sob aumento de 20-80 X, sinmios de colorao marrom claro e escuro podem ser visualizados sobre a semente, com maior freqncia na regio do hilo (Figura 39 A). Cuidados devem ser tomados para distinguir sinmios de esporodquios, que podem ser formados por fungos como Cercospora sp. Condios so de colorao plido a marrom escuro, com septos transversais, 2 ou mais clulas cilndricas a obclavadas, tamanho 30-70 x 5-8 m, com pice gradualmente cnico, produzidos lateralmente e na extremidade dos conidiforos, que formam os sinmios (Figura 39 B).

70

5 - TESTES DE SANIDADE

Fusarium solani (Mart.) Sacc. (1881)

Figura 40 - Fusarium solani em sementes de feijo e em preparao microscpica. [Extrado de Mathur e Kongsdal , 2003]. Miclio areo branco a creme, esparso e floculoso, com presena de minsculas gotas aquosas, transparentes, de formas variadas e compostas de microcondios (Figura 40A). Com o envelhecimento da colnia essas gotas tornam se levemente opacas e leitosas (Figura 40B). Sob alta resoluo, as gotculas podem ser visualizadas sobre filides longas distribudas ao longo das hifas. (Figura 40C). Microcondios so hialinos com uma ou duas clulas, ovais, elipsides ou reniformes, tamanho -16 2-4 m. Macrocondios so hialinos, produzidos em grande quantidade em esporodquios de colarao cremosa, apresentando 3 a 4 septos, medindo 45-100 5-8 m e com parede espessa e uma clula apical arredondada curta ou com a clula basal com leve formao tipo engrenagem (Figura 40D). Fusarium oxysporum f.sp. phaseoli J.B. Kendr. & W.C. Snyder (1942) Idem Algodo

71

MANUAL DE ANLISE SANITRIA DE SEMENTES

Macrophomina phaseolina (Tassi) Goid. (1947)

Figura 41 - Macrophomina phaseolina: crescimento em substrato (A), em sementes de feijo (B), microesclerdios (C) e condios (D) em preparaes microscpicas. [Fotos de Prof. J.C.Machado UFLA] Miclio de cor cinza claro a cinza escuro superficial e homogneo sobre as sementes, e ao seu redor no substrato, apresentando microesclerdios cilndricos e negros, em abundancia e uniformemente distribudos sobre as sementes. Picndios so marrom escuro, solitrios ou agregados e semi-imersos nos tecidos externos das sementes (Figura 41A e B). Condios so hialinos, alongados, elipsoidais a obovides, unicelulares, com tamanho de 1430 5-10dm. (Figura 41D).

72

5 - TESTES DE SANIDADE

Rhizoctonia solani J.G. Khn (1858)

Figura 42 - Rhizoctonia solani em sementes de feijo (A) e ramificao tpica do miclio (B). [Fotos de Prof. J.C.Machado UFLA] Sobre o substrato de papel, ao redor das sementes, as colnias so inicialmente claras com miclio pouco perceptvel, tornando-se marrom claras com hifas vigorosas e esparsamente ramificadas. Ao final do perodo de incubao, as colnias apresentam um aspecto radial a partir das sementes infectadas, podendo o miclio atingir as sementes vizinhas (Figura 42A). O exame individual das hifas evidencia ramificaes de forma ortogonal com uma leve constrio na base da ramificao. (Figura 42B).

73

MANUAL DE ANLISE SANITRIA DE SEMENTES

Sclerotinia sclerotiorum (Lib.) de Bary (1884) Idem descrio em Soja.

Figura 43 - Esclerdios de Sclerotinia sclerotiorum ao redor de sementes de feijo em papel de filtro. [Fotos de Prof. J.C.Machado UFLA].

Pisum sativum L. (ERVILHA) Sclerotinia sclerotiorum (Lib.) de Bary (1884) Idem descrio em Soja

Figura 44 - Sclerotinia sclerotiorum em sementes de ervilha. [Fotos de Prof. J.C.Machado UFLA].

74

5 - TESTES DE SANIDADE

Ricinus communis L. (MAMONA) Amphobotrys ricini (N.F. Buchw.) Hennebert(1973)

Figura 45 - Amphobotrys ricini em sementes de Mamona (A e B); Conidiforos mostrando a ramificao bifurcada e condios.[Fotos A e B, de Prof. J.C.Machado UFLA e Foto (C) Lima et al., Plant Disease Notes, 2008,3,5-7]. Conidiforos so cilndricos com tamanho de at 1000m, apresentando bifurcaes a partir da metade de sua altura, com formao de clulas conidiais terminais. Os condios so globosos, lisos, hialinos a dourado claros, unicelulares e medindo de 5,5 a 9,0m de dimetro. (Figura 45).

75

MANUAL DE ANLISE SANITRIA DE SEMENTES

Alternaria ricini (Sawada) Sawada (1959)

A Figura 46 - (A) Alternaria ricini em sementes de mamona; (B) condios em lminas Conidiforos isolados ou em grupos, eretos ou flexuosos, simples, quase cilndricos ou bastante grossos para a base, septado, de colorao plido a marrom, lisos, com um ou poucos condios, medindo 80 m de comprimento x 5-9 m de largura. Condios solitrios ou ocasionalmente em cadeias de 2, eretos ou curvados, obclavados ou com formato do condio elipsoidal, afilando-se bastante, abruptamente para um bico estreito. Colorao plido a marrom doudorado ou marrom avermelhado, lisos, com 5-10 , presena de septos transversais e vrios longitudinais ou septo oblquo, algumas vezes constrictos no septo, medindo 70-170 (140) m de comprimento x 13-27(19) m de largura na parte mais larga. (Figura 46)

76

5 - TESTES DE SANIDADE

Sorghum sp (SORGO) Colletotrichum graminicola (Ces.) G.W. Wilson (1914)

Figura 47 - Colletotrichum graminicola: frutificaes em sementes de sorgo ( A e B), acrvulos (B e C) e condios em preparao microscpica (D). [Fotos de Prof. J.C.Machado UFLA] Presena de acrvulos isolados ou em grupos, algumas vezes coalescentes e recobrindo toda ou parte da superfcie da semente. Acrvulos apresentam numerosas setas, marrom-plido a negro, visveis no meio da massa de condios com tamanho de 30-225 6-9 m. Esclerdios, quando presentes, so marrons enegrecidos. A massa de condios branco-beje a laranja rsea brilhante. Miclio, quando visvel, branco a laranja claro podendo ocorrer de forma abundante, associado a conidiforos e condios. Condios so formados em falsas cabeas na extremidade dos conidiforos (Figura 47 A e B). Condios so hialinos, falcados, unicelulares, ambas extremidades pontiagudas, tamanho de 15-25 3-5 m (Figura 47 C e D).

77

MANUAL DE ANLISE SANITRIA DE SEMENTES

Drechslera turcica (Pass.) Subram. & B.L. Jain (1966) Idem Milho

Drechslera sorghicola (Lefebvre & /sherwin) M.J. Richardson & E.M.Fraser

Figura 48 - Drechslera sorghicola em sementes de sorgo (A) e condios em preparao microscpica (B). [Fotos de Prof. J.C.Machado UFLA] Miclio areo com condios fusiformes, levemente curvos, elipsdides, mais largo no meio, gradualmente afilando se para as pontas tornando-se arredondados (Figura 48 A). Apresentam colorao marrom dourado com 6-8 septos, lisos. Os conidiforos podem ser formados isoladamente, e ocasionalmente em pequenos grupos, flexuosos ou retos, 49-85 m de comprimento x 12 -15 m largura (Figura 48B). Fusarium verticillioides (Sacc.) Nirenb. (Syn. F. moniliforme J. Sheld. (1904) Idem Milho

Fusarium sub-glutinans (Wollenw. & Reinking) P.E. Nelson, Toussoun & Marasas (1983) Idem Milho

78

5 - TESTES DE SANIDADE

Macrophomina phaseolina (Tassi) Goid. (1947) Idem Feijo Phoma sorghina (Sacc.) Boerema, Dorenbosh & van Kest

Figura 49 - Phoma sorghina: picndios em sementes de sorgo (A) e massa de condios saindo do interior dos picndios em preparao microscpica. [Fotos de Prof. J.C.Machado UFLA]. O fungo produz picndios pretos, brilhantes que so principalmente superficiais no tegumento da semente. So produzidos em abundncia, ou no em alguns casos, podendo ser formados em grupos compactos grandes. Os picnidisporos so hialinos, curtos, cilndricos, unicelulares, 3-7 m comprimento x 2-2.5 m de largura (Figura 49 A e B).

79

MANUAL DE ANLISE SANITRIA DE SEMENTES

Triticum aestivum L. (TRIGO) Bipolaris sorokiniana (Sacc.) Shoemaker (1959)

Figura 50 - Bipolaris sorokiniana em sementes de trigo (A, B e C) e condios em preparao microscpica (D e E). [Fotos de Prof. J.C.Machado UFLA] Sementes secas infectadas podem apresentar manchas marrons a negras na regio do embrio. Nas sementes incubadas, conidiforos formados so marrons, olivceos escuros, curtos, eretos, em geral isolados, suportando 1 a 6 condios na extremidade e lateralmente, a partir de sua metade superior (Figura 50 A, B e C) Os condios apresentam colorao marrom escuro a negro, oblongos a elipsides, mais comumente retilneos ou levemente curvados, mais largos no centro, extremidades arredondadas, manchas claras na clula basal, poro terminal sub-hialina. Dimenso varivel de 68-99 17-24 m e apresentando 6 a 9 septos (Figura 50 E).

80

5 - TESTES DE SANIDADE

Drechslera tritici-repentis (Died.) Shoemaker (1959)

Figura 51 - Drechslera tritici-repentis em semente de trigo (A e B) e condios em preparao microscpica (C e D). [Fotos de Prof. J.C. Machado - UFLA] Miclio areo cinza claro em abundancia (Figura 51A), com conidiforos levemente escuros, suportando condios individuais com colorao sub-hialina ou amarelo plido (Figura 51B) Conidiforos olivceo escuros, septados, 80-400 6-9 m, suportando condios individuais com 1-9 septos e medindo 80-250 14-20 m. Condios so cilndricos, pice arredondado, clula basal com uma mancha inconspcua (Figura 51C e D).

81

MANUAL DE ANLISE SANITRIA DE SEMENTES

Fusarium graminearum Schwabe (1839)

Figura 52 - Fusarium graminearum em sementes de trigo (A, B, C e D) e condios em preparao microscpica (E). [Fotos de Prof. J.C.Machado - UFLA]. Miclio areo, branco a vermelho carmim, com pequenas agregaes de condios no meio das hifas (Figura 52A, B, C e D). Macrocondios, nicos esporos formados nesta espcie, so cilndricos, hialinos, 3-7 septos, de parede espessa, retilneos a um formato semelhante a uma foice, assimetricamente curvos, medindo 35-62 2,5-5 m; clula basal com formato de calcanhar. Clula apical constricta, a semelhana de um nariz (Figura 52E).

82

5 - TESTES DE SANIDADE

Pyricularia grisea Sacc. (1880)

Figura 53 - Pyricularia grisea em sementes de trigo (A) e condios em preparao microscpica (B). Miclio areo pouco denso de cor cinza claro com conidiforos formados sobre parte ou toda superfcie das sementes (Figura 53A). Grupos de condios so formados no topo dos conidiforos (Figura 53 B). Cuidados devem ser tomados para no confundir a frutificao deste fungo com com frutificao de Cladosporium cladosporioides. (Figura 69). Conidiforos so marrons claros, tamanho 150 m x 2,5- (3-4) -4,5 m , ramificados ou no. Condios hialinos com 2 septos, piriformes, tamanho 17-28 m x 6-9 m (Figura 53 B).

83

MANUAL DE ANLISE SANITRIA DE SEMENTES

Stagonospora nodorum (Berk.) E. Castell. & Germano (1977)

Figura 54 - Picndios de Stagonospora nodorum em sementes de trigo (A e B) e condios em preparaes microscpicas (C e D). [Fotos de Prof. J.C. Machado UFLA]. Miclio denso e branco acinzentado, com formao de picndios negros imersos na superfcie das sementes incubadas.(Figura 54 A). Em alguns casos, exsudao cremosa de cor rosa claro podem ser visualizadas saindo do ostolo dos picndios (Figura 54B). Condios hialinos, 0-3 septos, alongados, extremidades arredondadas e muitos deles apresentando uma leve curvatura; medindo de 15-32 2-4 m. (Figura 54C e D).

84

5 - TESTES DE SANIDADE

Zea mays L. (MILHO) Acremonium strictum W. Gams (1971)

Figura 55 - Acremonium strictum: frutificaes tpicas na forma de cordes com formao lateral de filides em sementes (A e C) e condios (B) em lminas de microscpio tico. [Fotos de Prof. J.C. Machado-UFLA] Formao de miclio superficial branco, bege a alaranjado, compacto, com formaes filamentosas (agregao de hifas) areas (Figura 55A), produo de pequenos e numerosos agregados esfricos, em geral, brilhantes sob luz incidente (Figura 53C). Sob resoluo mais alta, conidiforos so produzidos a partir de hifas, de forma ortogonal com produo de filides, simples ou ocasionalmente ramificadas, cnicas, que sustentam, nos extremos, agregados esfricos de condios em meio a um lquido. Condios (phialosporos) hialinos, contnuos, cilndricos, extremidade arredondada, algumas vezes curvada, ocasionalmente ovide, 3-6 1-2 m (Figura 55 B).

85

MANUAL DE ANLISE SANITRIA DE SEMENTES

Colletotrichum graminicola (Ces.) G.W. Wilson (1914) Idem descrio de Sorgo

Figura 56 - Acrvulos de Colletotrichum graminicola em sementes de sorgo (A, B e C) e condios em preparao microscpica (D). [Fotos de Prof. J.C. Machado-UFLA]

86

5 - TESTES DE SANIDADE

Drechslera turcica (Pass.) Subram. & B.L. Jain (1966)

A Figura 57 - Drechslera turcica em sementes de milho (A) e condios em preparao microscpica (B). [Fotos de Prof. J.C. Machado-UFLA].

Conidiforos de cor marrom claro a escuro, tamanho variado, s vezes longos, sinuosos, espessos, geniculados, surgindo em grupos de 2 ou mais a partir de hifas simples na superfcie das sementes (Figura 57A). Observao cautelosa permite verificar que os condios so conectados com os conidiforos de forma afrouxada devido ao hilo protuberante, obcnico e de base estreita. (Figura 57A) Condios so fusiformes, retilneos ou ligeiramente curvados, cor varivel de marrom claro a escuro, acropleurogenados, tamanho de 96,9-125,8 17,0-22,1m com 4-7 septos (Figura 57B).

87

MANUAL DE ANLISE SANITRIA DE SEMENTES

Fusarium graminearum Schwabe (1839)

Figura 58 - Fusarium graminearum em sementes de milho (A, B e C) e condios em preparao microscpica (D). [Fotos de Prof. J.C. Machado-UFLA]. Idem descrio para o Trigo. Fusarium verticillioides (Sacc.) Nirenb (Syn. F. moniliforme J. Sheld. (1904)

Figura 59 - Fusarium verticillioides em sementes de milho (A e B) e cadeia de microcondios (C e D.[Fotos de Prof. J.C. Machado-UFLA].

88

5 - TESTES DE SANIDADE

Miclio esbranquiado, levemente pigmentado de prpura, ou branco-alaranjado; colnias bem desenvolvidas sobre as sementes, s vezes com aparncia floculosa. Por vezes, o crescimento micelial acompanhado pela formao de pionodes de tamanho e superfcies irregulares, colorao laranja a vermelhoprpura (Figura 59A e B). Sob alta resoluo, cadeias de microcondios simples, ou ramificadas, longas ou curtas; s vezes com pequenas agregaes de microcondios so visualizadas. Cadeias de microcondios so mais frequentes em colnias pouco desenvolvidas. Macrocondios, quando formados em pionodes, so fusiformes, afilados, parede delicada, tamanho 25-60 2,5-4,0 m e com 3-7 septos . Microcondios, mais frequentes em cadeias, so hialinos, unicelulares, em geral com a base achatada, tamanho 5-12 1,5-2,5m. (Figura 59C e D) Fusarium sub-glutinans (Wollenw. & Reinking) P.E. Nelson, Toussoun & Marasas (1983)

Figura 60 - Fusarium sub-glutinans na semente de milho (A) e agregados de condios sob alta resoluo(B). [Fotos de Prof. J.C. Machado-UFLA] Em geral as colnias apresentam as mesmas caractersticas que F. verticillioides, exceto que, sob alta resoluo as cadeias de microcondios so raramente produzidas, sendo a formao de agregados (falsas cabeas) de microcondios predominates (Figura 60A e B). Condios so semelhantes aos de F. verticillioides.

89

MANUAL DE ANLISE SANITRIA DE SEMENTES

Stenocarpella maydis (Berk.) B. Sutton (1980)

Figura 61 - Stenocarpella maydis; picndios em sementes de milho (A) e condios em preparaes microscpicas (B e C). [Fotos de Prof. J.C. Machado-UFLA] Miclio branco a cinzento-plido, superficial nas sementes. Picndios imersos, esfricos a subglobosos, marrons escuros a negros, com ostolos protundentes (Figura 61 A). Condios retilneos, curvados ou irregulares, com 1, s vezes 2, septo(s), marrom-claros, com pice atenuado ou arredondado, base truncada, tamanho 15-34 5-8 m, (Figura 61 B e C) formados a partir de filides hialinas, asseptadas e cilndricas.

90

5 - TESTES DE SANIDADE

Stenocarpella macrospora (Earle) B. Sutton (1977)

Figura 62 - Stenocarpella macrospora;picndios em sementes de milho (A), condios em preparaes microscpicas (B, C e D). [Fotos A, C e D de Prof. J.C. Machado-UFLA e Foto B, cedida por Dr. N.F. Pinto Embrapa/Milho e Sorgo) Miclio branco a cinzento-plido, superficial nas sementes. Picndios imersos, esfricos a subglobosos, marrom escuro a negros, com ostolos protundentes (Figura 62 A). Condios retilneos, curvados ou irregulares, 2 septos (s vezes 1), marrom claro, com pice atenuado ou arredondado, base truncada, tamanho 44-82 x 7,5-11,5 m, (Figura 62 B, C e D) formados a partir de filides hialinas, asseptadas e cilndricas.

91

MANUAL DE ANLISE SANITRIA DE SEMENTES

FUNGOS DE ARMAZENAMENTO Aspergillus candidus Conidiforos com tamanho varivel, no excedendo 1mm. Formao de vescula globosa e filides. Condios so globosos ou subglobosos com tamanho 2.5 x 3.5 m de dimetro. Colnias com colorao branca para creme, uniseriado ou biseriado ( D) e (Figura 64A) Aspergillus flavus Colnias, em geral, de colorao verde amarelada sobre as sementes. Conidiforos com vesculas esfricas, na maturidade fendidas em colunas, pouco definidas, 500-600m de dimetro, e raramente maiores. Presena de filides que cobrem a vescula. O conidiforo apresenta cabea, normalmente menor que 1m de comprimento. Os condios so tipicamente globosos a subglobosos, equinulados, medindo 3-6 m de dimetro, frequentemente de 3.5m 4.5m, s vezes elpticos ou periformes. Uniseriado ou biseriado, cabeas dos condios so radiais ou formando colunas pouco definidas. Possuem colorao verde amarelo e conidiforos speros (no lisos). (Figura 63B). Aspergilus glaucus Colnias de colorao brilhante azulada tornando se verde para castanho verde, ocasionalmente formando cleistotcio de cor amarela a laranja. Cabea do condio radial; conidiforos lisos e septados. Filides so formadas diretamente na vescula, uniseriada, que possuem cabeas globosas e amarelo brilhante e pode ocorrer a formao de cleistotcio. Os condios so rugosos, raramente lisos, formato oval tipo pra com 5m de comprimento, em baixas temperaturas pode chegar at 15 ou 24m (Figura 63A). Aspergillus ochraceus Crescimento, inicialmente pardo, granular, formando uma massa de condios, amarelo palha, tornando-se amarelo ochareceus. (As colnias possuem colorao amarelo a laranja ou caramelizado). Os condios so globosos radial ou elpticos. Ocorre formao de vescula e filides que esto firmente unidas, formando camadas uniseriada ou biseriada. O tamanho dos condos pode variar de 2.5-3m de dimetro. (Figura 63 C). Penicillium SP. Colnia sobre a superfcie da semente de colorao amarelo verde ou azulada. Conidiforos so curtos de 30-100m x 4-5m, geralmente eretos, lisos ou algumas vezes ligeiramente speros. Formao de poucas filides. Os condios so unicelulares, variveis, lisos subglobosos para esfricos, mas geralmente elpticos 3.4 -12 x 3-8m normalmente 6-8m x 4-6m.(Figura 63 E; 64C e D).

92

5 - TESTES DE SANIDADE

Figura 63 - Crescimento de fungos de armazenamento em sementes: Aspergillus glaucus (A), Aspergillus flavus (B), Aspergillus ochraceus (C), Aspergillus candidus (D) e Penicillium sp. (E). [Fotos A, C e D de Prof. J.C. Machado-UFLA]

Figura 64 - Aspergillus e Penicillium frutificaes: Aspergillus (A) e Penicillium (B e C) em preparaes microscpicas. [Fotos A, C e D de Prof. J.C. Machado-UFLA]

93

MANUAL DE ANLISE SANITRIA DE SEMENTES

ESPCIES CONTAMINANTES MAIS FREQUENTES EM SEMENTES Alternaria alternata

Figura 65 - Alternaria alternata em sementes (A) e condios em preparao microscpica (B). [Fotos de Prof. J.C. Machado-UFLA] Crescimento cinza escuro, areo, varivel em densidade, com produo de conidiforos diretamente sobre as sementes. Condios produzidos em cadeias longas, em numero de 2 a 11, com mais freqncia. Geralmente as cadeias so simples, podendo ser ramificadas. Condio polimorfo, curto ou longo, marrom para preto, altamente variado quanto ao formato, oval para cilndrico. Quanto ao nmero de septos, podem ter at 8 transversais e normalmente vrios longitudinais ou oblquos. O tamanho varia de 20-63(37) m x 9-18 (13) m na parte mais larga, com a ponta (bico) plido com 2-5 m de espessura. (Figura 65).

94

5 - TESTES DE SANIDADE

Chaetomium sp.

Figura 66 - Chaetomium sp. em sementes de arroz (A), sementes de soja (B) e peritcios em preparaes microscpicas (C e D). [Fotos de Prof. J.C. Machado-UFLA] Peritcios so formados no meio de miclio de baixa densidade na superfcie da semente e, muitas vezes, sobre o papel prximo a sementes. Os peritcios so esfricos ou piriformes, abundantemente cobertos por setas geralmente longas. Caractersticas das setas, como ornamentaes, ramificaes, formato, colorao, so importantes na identificao de espcies. As ascas, evanescentes, desaparecem com a maturao dos ascsporos unicelulares, limoniformes e escuros (Figura 66).

95

MANUAL DE ANLISE SANITRIA DE SEMENTES

Cladosporium sp.

C Figura 67 - Cladosporium sp em semente (A e B), e condios em preparao microscpica (C). [Fotos de Prof. J.C. Machado-UFLA]. Conidiforos altos, escuros, eretos, ramificados irregularmente no pice, dendrides. Condios escuros, 0-3 septos, variveis em forma e tamanho, formando cadeias frequentemente ramificadas, globosos ou subglobosos com 3-4,5 m de dimetro. Apresenta colnias, cinza, oliva ou caf. Longas cadeias de condios com tamanho principalmente de 4-9 x 3-5 m. (Figura 67).

96

5 - TESTES DE SANIDADE

Curvularia sp.

A Figura 68 - Curvularia sp. em sementes (A) e condios em preparao microscpica (B). [Foto A de Dr. S.B. Mathur (Dinamarca) e Foto B de Prof. J.C. Machado UFLA].

Colnias difusas, com miclio escuro, conidiforos escuros, retos a flexuosos. Condios marrom plido a marrom escuro, com 3 ou mais septos, usualmente as clulas apicais mais claras e uma clula com um lado maior que outro, tornando o condio curvo. Tamanho dos condios varivel de acordo com a espcie. Em algumas espcies ocasionais estaurocondios trirradiados ocorrem.(Figura 68) Epicoccum purpurascens

Figura 69 - Epicoccum purpurascens em sementes (A) e condios (B e C) em preparao microscpica. [Fotos de Prof. J.C. Machado-UFLA].

97

MANUAL DE ANLISE SANITRIA DE SEMENTES

Colnias de crescimento rpido, amareladas a alaranjadas, produzindo, muitas vezes, pigmentao avermelhada prpura no substrato de papel ao redor das sementes contaminadas. O fungo produz esporodquio marrom para preto, normalmente agrupados e granulares. Conidiforos compactos, curtos, escuros, em grupos e com um nico condio terminal de 15-25 m. Os condios, em sua maioria esfricos, so septados irregularmente, com paredes espessas cobertas de protuberncias curtas. (Figura 69). Nigrospora sp.

C Figura 70 - Nigrospora sp. em sementes (A e B) conidiforos com condios em preparao microscpica (C).[Fotos de Prof. J.C. Machado- UFLA] Miclio imerso ou parcialmente superficial nas sementes com produo abundante de condios negros intercalados nas hifas (Figura 70A e B). As colnias so inicialmente de cor branca, contrastando com os esporos negros e brilhantes, depois se tornam escuras pela intensa esporulao. Conidiforos so curtos, com um nico esporo terminal, produzido sobre clula intercalar e flexuosos com tamanho entre 3-7 m de altura. Condios so lisos, brilhantes, esfricos ou ovides com 10-16 m de dimetro (Figura.70 C).

98

5 - TESTES DE SANIDADE

Rhizopus stolonifer

C Figura 71 - Rhizopus stolonifer: esporngios e esporangisporos em sementes e papel de filtro (A, B e C). O crescimento das colnias muito rpido, ocorre formao de esporngios esfricos de colorao negra, contendo numerosos esporforos. Os esporforos, geralmente so eretos e em grupos, com at 2,5 mm de tamanho e com 20m de dimetro. Os esporforos podem variar de globosos para oval, elipsides, poligonal ou angular. Os esporngios so esfricos (globosos), inicialmente branco, tornando-se negros quando maduros com at 200m de dimetro. (Figura 71).

99

MANUAL DE ANLISE SANITRIA DE SEMENTES

Trichoderma sp.

C Figura 72 - Trichoderma sp: em sementes de milho (A e B) e conidiforos com condios em preparao microscpica (fita adesiva).[Fotos de Prof. J.C.Machado- UFLA] As colnias, inicialmente brancas, se tornam verdes com a abundante esporulao. Conidiforos hialinos ramificados em ngulos retos. As filides produzem condios unicelulares, ovides, hialinos que permanecem, em grupos. Os condios, em massa, apresentam em geral colorao verde (Figura 72).

100

5 - TESTES DE SANIDADE

Trichothecium sp.

Figura 73 - Trichothecium sp. Frutificao sobre as sementes (A) e em preparao microscpica.(B). [Fotos de Prof. J.C.Machado- UFLA]. Sobre as sementes contaminadas o fungo produz colnia com intensa esporulao formando uma massa densa (Figura 73A). Conidiforos so hialinos, eretos, septados, produzindo condios no pice, os quais permanecem em grupos ou cadeias, geralmente aderidos lado a lado, de forma caracterstica. Os condios so bicelulares, ovides ou elipsides, com dimenso de 12-18 x 8-10m (Figura 73B). Periconia sp

Figura 74 - Periconia sp. Conidiforos de Periconia sp., sobre as sementes, so longos, visveis com baixa resoluo, medindo se at 360m de comprimento, frequentemente curvos, produzindo condios lateralmente, abaixo do pice setiforme. Condios so esfricos, marrom claro, dimenso de 8 (10,4)15m de dimetro, verrugosos ou levemente equinulados (Figura 74).

101

MANUAL DE ANLISE SANITRIA DE SEMENTES

5.2 MTODOS DE DETECO DE BACTRIAS Nesta seo so apresentados os mtodos utilizados para a deteco de bactrias em sementes, bem como os mtodos especficos para cada espcie. 5.2.1 Plantio de Sementes em Substrato Esterilizado

Frao ou nmero de sementes a ser analisada: 1.000 sementes. Procedimento do teste: semear as sementes desinfestadas em substrato esterilizado (areia, solo, vermiculita e outros) de forma individualizada e incubar em cmara de crescimento a 25-28C. Avaliao: a avaliao realizada a partir da emergncia das plntulas, observando-se a ocorrncia ou no de sintomas caractersticos da infeco pelo patgeno alvo. A taxa de infeco calculada com base no nmero de plntulas emergidas. Confirmao dos resultados: realizado o isolamento da bactria e sua posterior identificao. Observaes gerais: permite determinar a porcentagem de transmisso do patgeno associado s sementes para a planta que ela originar, entretanto, no permite a deteco de bactrias em sementes no germinadas nem naquelas infectadas por uma quantidade de clulas bacterianas inferior necessria para que a infeco se manifeste. simples e no requer equipamento ou pessoal com treinamento especfico, exceto para reconhecimento dos sintomas, detectando somente clulas viveis e patognicas, porm demorado, de baixa sensibilidade, utiliza grande espao fsico e bem adaptado para organismos normalmente presentes em relativamente alto nvel populacional ou percentagem de sementes contaminadas (1 a 10%). Nesta forma de deteco existe a possibilidade de ocorrncia de disperso e disseminao secundria, o que pode levar a valores superestimados.

5.2.2 Inoculao em plantas susceptveis

Frao ou nmero de sementes a ser analisada: 1000 sementes Procedimento do teste: inocular plantas suscetveis com extrato obtido pela imerso de sementes em gua, soluo salina ou tampo, seguida da observao dos sintomas desenvolvidos. Como forma de aumentar a sensibilidade desta tcnica, possvel acrescentar alguns passos aps a extrao como o enriquecimento (crescimento de alquota do extrato em meio de cultura lquido) e ou a concentrao por centrifugao. Avaliao: a avaliao realizada observando-se a ocorrncia ou no de sintomas caractersticos da infeco pelo patgeno alvo. Confirmao dos resultados: realizado o isolamento da bactria e sua posterior identificao. Observaes gerais: a tcnica de fcil execuo e permite a deteco somente de clulas viveis, porm demorada e exige a manuteno de plantas em estdio de desenvolvimento recomendado para a inoculao e sob condies ambientes controladas. um mtodo no quantitativo.

102

5 - TESTES DE SANIDADE

5.2.3 Plaqueamento em meio seletivo e semi-seletivo Frao ou nmero de sementes a ser analisada: varivel com a cultura. Procedimento do teste: plaquear sementes ou o extrato obtido pela sua imerso em gua, soluo salina ou tampo, em meios seletivos ou semi-seletivos. Avaliao: a avaliao realizada observando-se colnias tpicas do patgeno, e o resultado expresso qualitativamente (presena ou ausncia). Confirmao dos resultados: testes bioqumicos, de patogenicidade, PCR, Imunofluorescncia, ELISA, uso de bacterifagos. Observaes gerais: permite o isolamento do patgeno, entretanto, necessria a identificao posterior dos organismos isolados por testes bioqumicos, sorolgicos ou de patogenicidade; muitos meios seletivos no so suficientemente seletivos para detectar todos os isolados do patgeno; trabalhoso e requer tempo para incubao e confirmao da patogenicidade.

5.2.4 Registro de resultados

Os casos de resultados negativos (patgeno no detectado nas sub-amostras) devero ser registrados em termos de padro de tolerncia e limite de deteco. O padro de tolerncia depende do nmero total de sementes testadas, n, e aproximadamente 3/n (P=0.95); o limite de deteco por sub-amostra equivalente ao limite de deteco por mL multiplicado pelo volume do extrato. Nos casos de resultados positivos, o registro deve indicar o nmero mdio de unidades formadoras de colnias (ufc) por semente e/ou o nmero de sub-amostras positivas do nmero total testado e o tamanho da amostra ou a probabilidade mxima estimada da proporo de sementes infestadas.

103

MANUAL DE ANLISE SANITRIA DE SEMENTES

5.2.5 Mtodos especficos para cada espcie

5.2.5.1 Deteco de Xanthomonas campestris pv. campestris em Brassica spp. (ISTA) Cultura: Brassica spp. (brcolis, repolho, couve, couve-flor) Patgeno: Xanthomonas campestris pv. campestris (Xcc) (podrido negra) Preparado por: Roberts, S.J. e Koenraadt, H. Mtodo 1 Extrao: Suspender as sementes em soluo salina (10 mL por 1.000 sementes) pr-resfriada (2-4C) acrescida de Tween 20 (0,02% v/v) em um frasco cnico e agitar por 2,5 h temperatura ambiente (2025C) em shaker orbital a 100-125 rpm.

2 Diluio e plaqueamento: Preparar a diluio em srie fator 1:10 do extrato de sementes at a diluio 103, pipetar 100 l de cada diluio e do extrato no diludo em placas de cada um dos meios semi-seletivos (FS, mCS20ABN) e espalhar sobre a superfcie com ala de Drigalski estril. A seguir, incubar a 28-30C e examinar aps 3-4 d.

3 Controle positivo: Preparar a suspenso de um isolado conhecido de Xcc, em soluo salina estril e diluir o suficiente para obter 102 a 104 ufc/mL. A seguir, pipetar 100 l das diluies apropriadas em placas contendo os meios semi-seletivos (FS, mCS20ABN) e espalhar sobre a superfcie com ala de Drigalski estril e incubar nas condies citadas acima.

4 Controle negativo:Preparar uma diluio em srie de uma amostra da soluo extratora (soluo salina acrescida de Tween 20), sem sementes, e plaqueiar nos meio semi-seletivos como as amostras.

5 Avaliao: Examinar as placas das amostras para verificar a presena de colnias tpicas de Xcc comparando-as com as placas do controle positivo. Em meio FS aps 3-4 d, as colnias de Xcc so pequenas, verde plido, mucides e circundadas por um halo de hidrlise de amido. Aps 3-4 d em meio mCS20ABN, as colnias de Xcc so de colorao amarelo palha, mucides e circundadas por um halo de hidrlise de amido. As colnias podem variar no tamanho. Dependendo do nmero de colnias presentes, pode ser mais fcil avaliar as placas aps 3 d, antes da coalescncia dos halos de hidrlise de amido os quais podem tornar mais difcil a identificao das colnias suspeitas. Registrar o nmero de colnias suspeitas e outras colnias.

104

5 - TESTES DE SANIDADE

6 Confirmao/identificao de colnias suspeitas: Repicar as colnias suspeitas em placas setoriadas contendo meio YDC. O nmero preciso de colnias repicadas depender do nmero e variabilidade de colnias suspeitas na placa: se presentes, pelo menos seis colnias devero ser repicadas por sub-amostra. Repicar o isolado do controle positivo em uma placa setoriada para comparao e incubar as placas por 24-48 h a 28-30C. Comparar o crescimento das colnias com o controle positivo. Em meio YDC as colnias de Xcc so de colorao amarelo palha e mucide/fluidal. Confirmar a identidade dos isolados pelo teste de patogenicidade em plntulas de Brssicas de susceptibilidade conhecida.

7 Teste de patogenicidade: Cultivar as plntulas de uma cultivar de brssicas susceptvel a todas as raas de Xcc em pequenos vasos ou bandejas pelo menos at o estgio de 3-4 folhas verdadeiras. Raspar uma pequena quantidade de crescimento bacteriano diretamente de uma cultura de 24-48 h YDC (placas setoriadas) com estilete ou alfinete entomolgico esterilizados. Inocular seis das nervuras principais no ponto perto das bordas nas duas folhas mais novas por ferimento com estilete ou alfinete entomolgico. O nmero de plantas a serem inoculadas depender da variabilidade da cultivar e experincia do operador, mas 1-3 plantas por isolado deve ser suficiente. melhor inocular mais isolados com 1 planta por isolado do que menos isolados com 3 plantas por isolado. Com estilete ou alfinete entomolgico esterilizados inocular primeiro o controle negativo e depois o isolado do controle positivo e mantenha as plantas a 20-25C. Examinar as plantas para verificar o aparecimento de leses tpicas progressivas em forma de V, de colorao amarelo/necrtico com as nervuras escuras aps 10-14 d. Sintomas podem ser visveis antes dependendo da temperatura e agressividade do isolado. Compare com o controle positivo.

105

MANUAL DE ANLISE SANITRIA DE SEMENTES

5.2.5.2 Deteco de Xanthomonas hortorum pv. carotae em Daucus carota (ISTA)

Mtodo 1 Extrao: Suspender as sementes em soluo salina acrescida de Tween 20 (0,02% v/v) (10 mL por 1.000 sementes) em um frasco cnico, embeber as sub-amostras overnight (16-18 h) a 4-7C e agitar por 5 min temperatura ambiente (20-25C) em shaker orbital a 200 rpm.

2 Diluio e plaqueamento: Agitar os frascos para homogeneizar antes da diluio, preparar a diluio em srie fator 1:10 do extrato de sementes at a diluio 103, pipetar 100 l de cada diluio e do extrato no diludo em duas placas de cada um dos dois meios semi-seletivos escolhidos, ou meio MKM com o meio MD5A ou meio MKM com o meio mTBM, e espalhe sobre a superfcie com ala de Drigalski estril em seguida incubar com as placas do controle positivo a 28C e examine aps 4-8 dias.

3 Controle positivo: Preparar a suspenso de um isolado conhecido de Xhc, em soluo salina estril. Se utilizar uma cultura liofilizada, cultive pelo menos uma vez em meio no seletivo antes de usar para checar a viabilidade e morfologia, diluir o suficiente para obter aproximadamente 102 a 104 ufc/mL. Isto pode requerer acima de sete diluies em srie de uma suspenso trbida, pipetar 100 l das diluies apropriadas em placas contendo os meios semi-seletivos (MKM/MD5A ou MKM/mTBM) e espalhe sobre a superfcie com ala de Drigalski estril e incubar as placas controle e das amostras.

4 Controle negativo: Preparar a diluio em srie de uma amostra da soluo extratora (soluo salina acrescida de Tween 20), sem sementes, e plaqueiar nos meios semi-seletivos como as amostras.

5 Avaliao: Examinar as placas dos controles positivo e negativo e as placas das amostras para verificar a presena de colnias tpicas de Xhc comparando-as com as placas do controle positivo. Em meio MKM aps 4-6 d, as colnias de Xhc so de colorao creme amarelo clara, marrom claro a amarelo pssego, brilhantes, arredondadas e com dimetro de 2-4 mm. Em meio MD5A aps 7-8 d, as colnias de Xhc so de colorao amarelo palha, brilhantes, redondas e lisas, convexa com margens inteiras, dimetro de 2-3 mm. Em meio mTBM aps 7-8 d, as colnias de Xhc so de colorao branca ou amarela ou, brilhantes, redondas, cremosas, convexas com margens inteiras, dimetro de 1-2 mm e circundadas por uma zona clara da hidrlise de casena. A hidrlise da casena em meio mTBM nem sempre est presente. O tamanho e a colorao das colnias podem diferir dentro de uma amostra. Registrar o nmero de colnias suspeitas e outras colnias.

106

5 - TESTES DE SANIDADE

6 Confirmao/identificao de colnias suspeitas: Repicar as colnias suspeitas em placas setoriadas contendo meio YDC. Para evitar contaminao de isolados, use uma nova placa setoriada para cada subamostra. O nmero preciso de colnias repicadas depender do nmero e variabilidade de colnias suspeitas na placa: se presentes, pelo menos seis colnias devero ser repicadas por sub-amostra. Repicar o isolado controle positivo em uma placa setoriada para comparao em seguida incubar as placas setoriadas por 48-72 h a 28C. Comparar o crescimento das colnias com o controle positivo. Em meio YDC as colnias de Xhc so de colorao amarelo palha e mucides. Confirmar a identidade dos isolados pelo teste de patogenicidade em plntulas de cenoura de susceptibilidade conhecida ou por PCR e registrear os resultados para cada colnia repicada.

7 Teste de patogenicidade: Cultivar as plntulas de uma cultivar de cenoura susceptvel a Xhc em pequenos vasos ou bandeja pelo menos at o estgio de 3-4 folhas verdadeiras (aproximadamente 3-4 semanas aps o plantio). Preparar suspenses de cada cultura bacteriana suspeita cultivada em meio YDC em gua de torneira esterilizada e dilua at a concentrao aproximada de 2x106 ufc/mL. O mesmo procedimento dever ser utilizado para o isolado do controle positivo. Aps esta esta etapa, inocular as plantas, pulverizandoas at o ponto de escorrimento. Usar um pequeno vaso com 3-4 plantas por isolado. Incluir os controles positivo e negativo. importante no esfregar as folhas aps a pulverizao, isto pode causar resultados falso-positivos. Incubar as plantas inoculadas a 27-28C em sacos plsticos fechados (para promover condies perto de 100% UR). Aps 48 h, retire os sacos durante o dia e recoloque a noite. Registar os sintomas aps 7-10 d de incubao. Sintomas tpicos de X. hortorum pv. carotae aparecem primeiro como pequenas reas irregulares encharcadas amareladas com uma delgada mancha marron no centro nas folhas inoculadas. Posteriormente, as reas afetadas aumentam, tornam-se marrons e so frequentemente circundadas por um halo amarelo. Comparar com o controle positivo.

8 Reao da Polimerase em cadeia (Polymerase Chain Reaction - PCR): Preparar suspenses de clulas ligeiramente trbidas (OD600nm aproximadamente 0,05) em 1,0 mL de gua destilada esterilizada das culturas suspeitas cultivadas em meio YDC e do controle positivo. Alm disso, utilizar um isolado no suspeito como controle negativo. As suspenses podem ser armazenadas a -20C at a identificao. Usar os seguintes primers especficos de Xhc (Meng et al., 2004):

3Sforw 5 CAT TCC AAG AAG CAG CCA 3 3Srev 5 TCG CTC TTA ACA CCG TCA 3

107

MANUAL DE ANLISE SANITRIA DE SEMENTES

Os Primers Universais bacterianos devem ser utilizados para validar a reao de PCR. Estes primers daro um produto de tamanho de 441 bp (adaptado de Eden et al., 1991) comparado com o produto de 355 bp dos primers especficos para Xhc. 1052F 5 GCA TGG TTG TCG TCA GCT CGT 3 Bac R 5 TAC GGC TAC CTT GTT.ACG ACT T 3

Preparar a reao de PCR. Conduza a reao de PCR na parede de tubos de microcentrfuga de 0,2 mL com um volume final de 10 l (8 l reao + 2 l suspenso bacteriana). Programa de PCR: incubao inicial de 5 min a 95C seguido por 35 ciclos de 15s a 94C, 15s a 58C e 30s a 72C. Incubao final de 5 min a 72C e 20 min a 20C. Submeter eletroforese durante 1,5 h a 150V em gel de agarose 1,5% em tampo TBE 0,5x (Tris Borate EDTA) colorido com brometo de etdeo 10 l dos produtos da PCR. Incluir um marcador (ladder) de 100 bp. Anlise dos produtos amplificados: produto de 355 pb especfico para Xhc e um produto universal bacteriano de 441 pb. Duas bandas (especfica e universal) = identificao positiva; uma banda (universal) = identificao negativa; nenhuma banda = template bacteriano ausente, repetir reao.

108

5 - TESTES DE SANIDADE

5.2.5.3 Deteco de Xanthomonas axonopodis pv. malvacearum em algodo (Gossypium hirsutum L.) Plantio de Sementes em Substrato Esterilizado (Halfon-Meiri & Volcani, 1981)

Mtodo 1 Frao ou nmero de sementes a ser analisada: 6 repeties de 200 sementes 2 Procedimento do teste: Incubar 200 sementes em 60 mL de gua destilada por 17 horas. Semear as sementes em areia mida esterilizada, espaamento de 1 x 3 cm. Verter o restante da gua sobre as sementes antes de cobrilas com uma camada de 2 cm de areia mida e incubar em cmara de crescimento a 25-28C e UR 80-90%.

3 Avaliao: A avaliao ser realizada 10-14 dias aps o plantio, observando-se as leses tpicas da bacteriose nas folhas cotiledonares (Figura 75). A taxa de infeco ser calculada com base no nmero de plntulas emergidas.

4 Confirmao dos resultados: Isolamento em meio 523 de Kado e Heskett (1970) Em meio 523 as colnias de X. axonopodis pv. malvacearum so de colorao amarelas e mucides (Figura 76). Registar os resultados para cada colnia repicada.

C.2 Plaqueamento de sementes em meio semi-seletivo (Mehta et al., 2005)

Mtodo 1 Frao ou nmero de sementes a ser analisada: 1.000 sementes.

2 Desinfestao superficial e plaqueamento das sementes: Desinfestar as sementes com lcool etlico 70% por 1 minuto, hipoclorito de sdio 2,5% por 4 minutos seguido de 3 lavagens com gua esterilizada. Plaquear as sementes em placas de Petri contendo 15 mL de meio PSA (Mehta et al., 2005). Em seguida, incubar com as placas do controle positivo.

3 Controle positivo (cultura ou material de referncia): Preparar a suspenso de um isolado conhecido de Xam, em soluo salina estril. Diluir o suficiente para aproximadamente 102 a 104 ufc/mL. Pipetar 100 l das diluies apropriadas em placas contendo o meio PSA (Mehta et al., 2005) modificado e espalhe sobre a superfcie com ala de Drigalski estril. Em seguida incubar com as placas das amostras.

109

MANUAL DE ANLISE SANITRIA DE SEMENTES

4 Avaliao: Examinar as placas periodicamente e examinar as placas do controle positivo. Dentro de 7 a 12 dias aps a incubao, ser observado se colnias tpicas de Xam ao redor das sementes (Figura 79). Contar o nmero de sementes infectadas.

5 Confirmao/identificao de colnias suspeitas: Repicar as colnias suspeitas em placas setoriadas contendo meio 523 (Kado e Heskett, 1970). Repicar o isolado controle positivo em uma placa setoriada para comparao.Incubar placas setoriadas por 24-48 h a 28C. Aps incubao, comparar o crescimento das colnias com o controle positivo. Em meio 523 as colnias de Xam so de colorao amarela e mucides (Figura 76). Confirmar identidade dos isolados pelo teste de patogenicidade em plntulas de algodo de susceptibilidade conhecida. Registrar os resultados para cada colnia repicada.

6 Teste de patogenicidade: Cultivar as plntulas de uma cultivar de algodo susceptvel a Xam em pequenos vasos pelo menos at o estgio de 3-4 folhas verdadeiras (aproximadamente 3-4 semanas aps o plantio). Preparar em gua de torneira esterilizada a suspenso de cada cultura bacteriana suspeita cultivada em meio 523 e dilua a aproximadamente 2x106 ufc/mL. O mesmo procedimento dever ser utilizado para o isolado controle positivo. Inocular as plantas, pulverizando-as at o ponto de escorrimento. Use um pequeno vaso com 3-4 plantas por isolado. Incluir o controle positivo e um controle negativo. As plantas inoculadas sero incubadas a 2728C em sacos plsticos fechados (para promover condies perto de 100% UR). Aps 24 h, retire os sacos e mantenha as plantas incubadas a 27-28C. Registrar os sintomas aps 7-10 d de incubao. Sintomas tpicos de Xam aparecem primeiro como pequenas reas angulares encharcadas. Posteriormente, leses angulares aumentam, tornam-se marrons (Figura 75). Comparar com o controle positivo.

Figura 75 - Leses tpicas causadas por Xanthomonas axonopodis pv. malvacearum em plntulas de algodo.

110

5 - TESTES DE SANIDADE

Figura 76 - Colnias tpicas de Xanthomonas axonopodis pv. malvacearum em meio 523.

Figura 77 - Xanthomonas axonopodis pv. malvacearum em meio PSA: plaqueamento de sementes (a) e colnias (b) (Foto Barbosa, J.F.).

111

MANUAL DE ANLISE SANITRIA DE SEMENTES

5.2.5.4 Deteco de Clavibacter michiganensis subsp. michiganensis em tomate (Lycopersicon esculentum) Workshop 1999

Mtodo

1 Extrao: Suspender as sementes (10.000 sementes - aprox. 24 g em 150mL) em tampo Tween fosfato-salino pr-resfriado (2-4C) em um frasco cnico de 250mL fechado com parafilme. Saturar as sementes por 24 h a 4 C.

2 Diluio e plaqueamento: Agitar o extrato (manualmente ou em um shaker) para homogeneizar completamente (~1 min) e permitir que as bactrias se estabeleam (~10 min). Preparar duas diluies em srie do extrato de sementes at diluio 102. Pipetar 100 l de cada diluio e do extrato de sementes em placas contendo os meios SCM e mSCM e espalhe sobre a superfcie com uma ala de Drigalski. Em seguida, incubar as placas a 27C por 5-14 d.

3 Controle positivo: Preparar a suspenso de um isolado conhecido de Cmm em soluo salina estril. Diluir o suficiente para aproximadamente 102 a 104 ufc/mL. Em seguida, pipetar 100 l das diluies apropriadas em placas contendo os meios SCM e mSCM e distribua sobre a superfcie com uma ala de Drigalski. Incubar com as placas das amostras a 27C por 5-14 d.

4 Exame das placas: Examinar as placas para a presena de colnias tpicas de Cmm comparando-as com as placas do controle positivo no mesmo meio. Aps 7 d em meio mSCM as colnias de Cmm so de colorao verde claro, mucides, de 2-3 mm de dimetro, translcidas e facilmente distinguveis de outras colnias mucides pela presena de manchas escuras internas (pintas). medida que o tempo de incubao aumenta, as colnias de Cmm tornam-se maiores e as manchas internas tornam-se amarelas enquanto outras colnias permanecem pequenas e no tm as manchas internas. Aps 10 d em meio SCM as colnias de Cmm so grandes, de colorao cinza a preta, convexas, irregulares e mucides com manchas internas pretas (Figura 78).

5 Confirmao/identificao de colnias suspeitas: Repicar as colnias suspeitas em placas setoriadas de YDC. O nmero preciso de colnias repicadas depender do nmero de colnias suspeitas, mas um nmero razovel de seis a doze. Repicar o isolado controle positivo para uma placa setoriada para comparao. Incubar as placas setoriadas por 24-48 h a 27C. Comparar a aparncia dos isolados com o controle. Aps 48 h as colnias de Cmm sero de colorao amarelo escuro, convexas, brilhantes e fludas. Confirmar a identidade dos isolados pelo teste de patogenicidade em plntulas de tomate de susceptibilidade conhecida. Registrar os resultados para cada colnia repicada.

112

5 - TESTES DE SANIDADE

6 Patogenicidade: Preparar uma suspenso trbida (106 clulas/mL) em aproximadamente 5 mL de soluo salina pela raspagem de uma pequena quantidade de crescimento bacteriano de 24-48 h em YDC (placas setoriadas). Cortar o caule de plntulas de tomate de 5 semanas bem acima dos cotildones com um par de tesouras estreis mergulhadas no inculo (Fig. 79). Descartar a parte superior do caule. Inocular um isolado conhecido como controle positivo e soluo salina estril como controle negativo. Manter as plntulas a 25-27C e em seguida observar os sintomas (murcha) aps 7-11 dias.

Figura 78 - Colnias de Clavibacter michiganensis subsp. muchiganensis em meio mSCM.

Figura 79 - Sintomas de murcha causados por Clavibacter michiganensis subsp. muchiganensis: a) muda proveniente de semente infectada; b) plntulas inoculadas por corte do caule com tesoura estril mergulhada em suspenso do inoculo.

113

MANUAL DE ANLISE SANITRIA DE SEMENTES

5.2.5.5 Deteco de Pseudomonas syringae pv. tomato em tomate (Lycopersicon esculentum)

Plantio de Sementes em Substrato Esterilizado (Jones, McCarter e Gitaitis, 1989)

Mtodo

1. Extrao: Semear as amostras (100 sementes) em vasos (bandejas) de plstico com mistura de solo esterilizada. Observao: os vasos tambm devero ser esterilizados e podem ser protegidos com plsticos ao redor para prevenir contaminao entre as amostras. Identificar devidamente os vasos de acordo com as amostras. Incubar os vasos semeados em cmaras de crescimento a 18-20C. Observao: esta temperatura tima para o desenvolvimento da doena. Em baixas temperaturas a germinao mais lenta permite que a bactria se multiplique ao nvel para causar doena. Quando as plantas estiverem no estgio de folhas verdadeiras e depois com 6-7 cm de altura, incube-as em sacos plsticos fechados (para promover condies perto de 100% UR) por 36 h. 2. Deteco Manter as plantas em cmara de crescimento durante 4 semanas e examina-las procura de sintomas tpicos da mancha bacteriana nos cotildones e nas primeiras folhas verdadeiras 7 dias aps a emergncia ou em outros casos, somente aps a cmara mida. Observao: o nmero de leses nas plntulas varia com o grau da contaminao das sementes; a quantidade de leses permite a estimativa semi-quantitativa do nvel de contaminao. Para confirmar que Pst o agente causal dos sintomas observados, leses representativas so trituradas separadamente em gotas de gua destilada esterilizada, plaqueadas em meio King B pelo mtodo de estrias e as colnias fluorescentes identificadas. Testes utilizados para confirmar Pst: reao de oxidase, atividade arginina dihidrolase, HR em fumo, utilizao de erythritol, D(-)-tartarato e DL-lactate, e atividade de nucleao em gelo. Como confirmao final, plantas de tomate susceptveis sero inoculadas com isolados capazes de produzir sintomas tpicos da doena associada com Pst. Lotes de sementes com resultado positivo devem ser reavaliados para confirmao ou obteno de resultados adicionais quantitativos de infestao de sementes.

Avaliao Leses causadas por Pst ou P. syringae pv. syringae produzem reao de fluorescncia positiva. Leses infectadas com X. vesicatoria ou leses no originadas de bactrias so negativas para fluorescncia. Aps a incubao, as placas sero checadas procura de colnias fluorescentes. Colnias fluorescentes em meio King B e DL-lactato no so Pst. Colnias fluorescentes em meio King B, mas no no meio DL-lactate so transferidas para testes posteriores.

114

5 - TESTES DE SANIDADE

Os isolados negativos para oxidase sero testados posteriormente e os oxidase positiva sero descartados. Os isolados que induzirem HR em fumo e utilizarem sucrose e D(-) tartarato, mas no erythritol ou DL-lactate e forem negativos para atividade arginina dihidrolase so identificados como Pst. Para confirmar a identidade destes isolados, deve-se fazer o teste de patogenicidade. Os isolados que reproduzirem leses da mancha bacteriana em tomate so confirmados como Pst.

Plaqueamento em meio semi-seletivo (Soares, Valarini e Menten, 2001)

Mtodo 1 Extrao: Suspender as sementes em tampo PBS Tween 0,05 M em um frasco cnico. O volume de soluo salina deve ser ajustado de acordo com o nmero de sementes utilizado (proporo de 3:1 - v:w). Ember as sub-amostras por 16-18 h a 4C.

2 Diluio e plaqueamento: Agitar os frascos para homogeneizar antes da diluio. Preparar a diluio em srie do extrato de sementes at a diluio 103. Pipetar 100 l de cada diluio e do extrato no diludo em duas placas do meio King B modificado e espalhe sobre a superfcie com ala de Drigalski estril. Incubear com as placas do controle positivo a 28C e examine aps 4-8 d.

3 Controle positivo (cultura ou material de referncia): Preparar a suspenso de um isolado conhecido de Pst, em soluo salina estril. Se utilizar cultura liofilizada, cultivar pelo menos uma vez em meio no seletivo antes para checar a viabilidade e morfologia. Diluir o suficiente para aproximadamente 102 a 104 ufc/mL. Isto pode requerer acima de sete diluies em srie de uma suspenso trbida. Pipetar 100 l das diluies apropriadas em placas contendo o meio semi-seletivo (mKing B) e espalhe sobre a superfcie com ala de Drigalski estril. Em seguida incubar com as placas das amostras.

4 Controle negativo: Preparar a diluio em srie de uma amostra da soluo extratora (soluo salina acrescida de Tween 20), sem sementes, e plaquear nos meio semi-seletivos como as amostras.

5 Avaliao: Examinar as placas dos controles positivo e negativo e as placas das amostras para verificar a presena de colnias tpicas de Pst comparando-as com as placas do controle positivo. Em meio mKing B aps 4-6 d, as colnias de Pst ficaram de colorao branca (Figura 80). Registrar o nmero de colnias suspeitas e outras colnias.

115

MANUAL DE ANLISE SANITRIA DE SEMENTES

6 Confirmao/identificao de colnias suspeitas: Repicar as colnias suspeitas em placas setoriadas contendo meio King B. O nmero preciso de colnias repicadas depender do nmero e variabilidade de colnias suspeitas na placa: se presentes, pelo menos seis colnias devero ser repicadas por sub-amostra. Repicar o isolado controle positivo em uma placa setoriada para comparao. Incubar as placas setoriadas por 48-72 h a 28C. Comparar o crescimento das colnias com o controle positivo. Em meio King B as colnias de Pst so de colorao branca. Confirmar a identidade dos isolados pelo teste de patogenicidade em plntulas de tomate de susceptibilidade conhecida e registrar os resultados para cada colnia repicada.

7 Teste de patogenicidade: Cultivar as plntulas de uma cultivar de tomate susceptvel a Pst em pequenos vasos ou bandeja pelo menos at o estgio de 3-4 folhas verdadeiras (aproximadamente 3-4 semanas aps o plantio). Preparar a suspenso em gua de torneira esterilizada de cada cultura bacteriana suspeita cultivada em meio King B e dilua concentrao contendo aproximadamente 2x106 ufc/mL. O mesmo procedimento deve ser utilizado para o isolado controle positivo. Inocular as plantas, pulverizando-as at o ponto de escorrimento. Usar um pequeno vaso com 3-4 plantas por isolado. Incluir os controles positivo e negativo. importante no esfregar as folhas aps a pulverizao, isto pode causar resultados falso-positivos. Incubar as plantas inoculadas a 27-28C em sacos plsticos fechados (para promover condies perto de 100% UR). Aps 48 h, retire os sacos durante o dia e recoloque a noite. Registrar os sintomas aps 7-10 d de incubao. Sintomas tpicos de Pst aparecem primeiro como pequenas reas irregulares encharcadas. Posteriormente, as reas afetadas aumentam, tornam-se marrons e so frequentemente circundadas por um halo amarelo. Comparar com o controle positivo.

Figura 80 - Colnias de Pseudomonas syringae pv. tomato em meio mKing B.

116

5 - TESTES DE SANIDADE

5.2.5.6 Deteco de Xanthomonas campestris pv. vesicatoria em tomate (Lycopersicon esculentum) - ISHI-Veg

Mtodo

1. Extrao: Suspender as sementes em tampo PBS Tween 0,05 M em um frasco cnico. O volume de soluo salina deve ser ajustado de acordo com o nmero de sementes utilizado (proporo de 3:1 - v:w). Embeber as sub-amostras por 16-18 h a 4C. 2 Diluio e plaqueamento: Agitar os frascos para homogeneizar antes da diluio. Preparar as diluies em srie do extrato de sementes at 103. Pipetar 100 l das diluies 10-1 e 10-2 e do extrato no diludo em duas placas de um dos meios semi-seletivos (mTBM, CKTM e TAM) e espalhar sobre a superfcie com ala de Drigalski estril. Em seguida, incubar com as placas do controle positivo a 26-28C no escuro e examine aps 4-8 d.

3 Controle positivo (cultura ou material de referncia): Preparar a suspenso de um isolado conhecido de Xcv, em soluo salina estril. Diluir o suficiente para obter diluies que contenham aproximadamente 102 a 104 ufc/ mL. Pipetar 100 l das diluies apropriadas em placas contendo os meios semi-seletivos (mTBM, CKTM ou TAM) e espalhar sobre a superfcie com ala de Drigalski estril. Incubar as placas com as das amostras (Figura 81).

4 Controle negativo: Preparar a diluio em srie de uma amostra da soluo extratora (tampo PBS Tween 0,05 M), sem sementes, e plaquear nos meio semi-seletivos como as amostras.

5 Avaliao: Examinar as placas dos controles positivo e negativo aos 3, 5 e 7 dias e as placas das amostras para verificar a presena de colnias tpicas Xcv comparando-as com as placas do controle positivo. As colnias de Xcv em meio mTMB, CKTM e TAM aparecem tipicamente em 4-7 dias e podem ser identificadas apresentando-se amarelas, levemente mucides e arredondadas (circulares). Xanthomonas campestris pv. vesicatoria utiliza tween e em 3-7 dias um halo branco cristalino geralmente formado ao redor da colnia amarela. Alguns isolados de Xcv formam apenas um fraco halo, halo claro ou apenas clareia o meio abaixo da colnia (no visvel). (NOTA: halo branco cristalino devido ao clcio depositado no halo claro causado pela utilizao do tween). O tamanho e a colorao das colnias podem diferir dentro de uma amostra. Registrar o nmero de colnias suspeitas e outras colnias.

117

MANUAL DE ANLISE SANITRIA DE SEMENTES

6 Confirmao/identificao de colnias suspeitas: Repicar as colnias suspeitas em placas setoriadas contendo meio YDC. O nmero preciso de colnias repicadas depender do nmero e variabilidade de colnias suspeitas na placa: se presentes, pelo menos seis colnias devero ser repicadas por sub-amostra. Repicar o isolado controle positivo em uma placa setoriada para comparao. Em seguida incubar as placas setoriadas por 24-48 h a 28C. Comparar o crescimento das colnias com o controle positivo. Confirmar a identidade dos isolados pelo teste de patogenicidade em plntulas de tomate de susceptibilidade conhecida. Testes de confirmao adicionais como ELISA, PCR, IF ou testes bioqumicos so opcionais. Registrar os resultados para cada colnia repicada.

7 Teste de patogenicidade: Cultivar as plntulas de uma cultivar de tomate susceptvel a Xcv em pequenos vasos ou bandeja pelo menos at o estgio de 2-3 folhas verdadeiras (aproximadamente 3-4 semanas aps o plantio). Preparar a suspenso em gua de torneira esterilizada de cada cultura bacteriana suspeita cultivada em meio YDC e diluir concentrao de aproximadamente 108 ufc/mL (0,1 to 0,2 o.d. at 600 nm). O mesmo procedimento dever ser utilizado para o isolado controle positivo. Infiltrar a folha de uma cultivar susceptvel de pimento/tomate com a suspenso forando delicadamente o lquido na sua superfcie inferior utilizando uma seringa estril sem agulha e marque a folha com o nmero de identificao da amostra. Fazer testes de patogenicidade de pelo menos cinco colnias suspeitas de Xcv purificadas por repetio. Incluir os controles positivo e negativo. Incubar as plantas inoculadas a 90-100% de umidade relativa e a 27-32C com 8-12 h de luz. Observar as plantas diariamente e registre o dia em que as leses encharcadas aparecem. Geralmente, isolados patognicos de Xcv desenvolvem uma leso encharcada dentro de 48-96 h.

Figura 81 - Colnias de Xanthomonas campestris pv. vesicatoria em meio TAM.

118

5 - TESTES DE SANIDADE

5.2.5.7 Deteco de Curtobacterium flaccumfaciens pv. flaccumfaciens em sementes de feijo (Phaseolus vulgaris) Cultura: feijo (Phaseolus vulgaris) Patgeno: Curtobacterium flaccumfaciens pv. flaccumfaciens (Cff) Mtodo 1 Extrao: Suspender as sementes em soluo salina em um frasco cnico. O volume de soluo salina dever ser ajustado de acordo com o nmero de sementes utilizado (500 mL por 1.000 sementes). Embeber as sub-amostras por 16-18 h a 4C. 2 Diluio e plaqueamento: Agitar os frascos para homogeneizar antes da diluio. Preparar diluies em srie do extrato de sementes (101, 102 e 103). Pipetar 100 l de cada diluio e do extrato no diludo em duas placas contendo o meio CNS e espalhe sobre a superfcie com ala de Drigalski estril. Incubar junto s placas do controle positivo a 28C e examine aps 4-8 d. 3 Controle positivo: Preparar a suspenso de um isolado conhecido de Cff, em soluo salina estril. Diluir o suficiente para obter aproximadamente 102 a 104 ufc/mL. Pipetar 100 l das diluies apropriadas em placas contendo o meio CNS e espalhe sobre a superfcie com ala de Drigalski estril. Incubar as placas junto quelas das amostras.

4 Controle negativo: Preparar a diluio em srie de uma amostra da soluo extratora (soluo salina), sem sementes, e plaquear nos meio semi-seletivos como as amostras.

5 Avaliao: Examinar as placas dos controles positivo e negativo e exanimar as placas das amostras para verificar a presena de colnias tpicas de Cff comparando-as com as placas do controle positivo (Figura 82). O tamanho e a colorao das colnias podem diferir dentro de uma amostra. Registrar o nmero de colnias suspeitas e outras colnias. 6 Confirmao/identificao de colnias suspeitas: Repicar as colnias suspeitas em placas setoriadas contendo meio 523. Repicar o isolado controle positivo em uma placa setoriada para comparao. Incubar as placas setoriadas por 48-72 h a 28C.

119

MANUAL DE ANLISE SANITRIA DE SEMENTES

Comparar o crescimento das colnias com o controle positivo. Em meio 523 as colnias de Cff amarelo alaranjadas ou tambm amarelo claro. Confirmar a identidade dos isolados pelo teste de patogenicidade em plntulas de feijo de susceptibilidade conhecida ou por PCR. Registrar os resultados para cada colnia repicada.

7 Teste de patogenicidade: Cultivar as plntulas de uma cultivar de feijo susceptvel a Cff em pequenos vasos ou bandeja por 14 dias. Preparar a suspenso em gua de torneira esterilizada de cada cultura bacteriana suspeita cultivada em meio 523 e dilua concentrao de aproximadamente 2x106 ufc/mL. O mesmo procedimento dever ser utilizado para o isolado controle positivo. Inocular as plantas, introduzindo a agulha umedecida nas colnias bacterianas no caule da planta. Usar um pequeno vaso com 3-4 plantas por isolado. Incluir o controle positivo e um controle negativo. Incubar as plantas inoculadas a 27-28C at o aparecimento dos sintomas e comparar com o controle positivo.

8 Reao da Polimerase em Cadeia (PCR): Fazer a suspenso de clulas ligeiramente trbida (OD600nm aproximadamente 0,05) em 1,0 mL de gua destilada esterilizada das culturas suspeitas cultivadas em meio 523 e do controle positivo. Incluir um isolado no suspeito como controle negativo. As suspenses podero ser armazenadas a -20C at a identificao. Usar os seguintes primers especficos para Cff (Guimares et al., 2001): CF4 forward 5-CACAGCCACCTACATGC 3 CF5 reverse 5- ATCGGGAGTCCGAG 3

Preparar a reao de PCR. Conduzir a reao de PCR na parede de tubos de microcentrfuga de 0,2 mL com um volume final de 50 l (45 l reao + 5 l suspenso bacteriana). Programa de PCR: incubao inicial de 2 min a 96C seguido por 34 ciclos de 30s a 94C, 30s a 55C e 30s a 72C. Incubao final de 10 min a 72C. Colocar 10 l dos produtos de PCR por eletroforese durante 1,5 h a 150V em gel de agarose 1,5% em tampo TBE 0,5x (Tris Borate EDTA) colorido com brometo de etdeo. Incluir um marcador (ladder) de 100 bp. Estes primers geram um produto de 198 pb especfico para Cff (Figura 83).

120

5 - TESTES DE SANIDADE

Figura 82 - Colnias de Curtobacterium flaccumfaciens pv. flaccumfaciens em meio CNS.

198 pb

Figura 83 - Anlise eletrofortica em gel de agarose (1%) dos produtos amplificados por PCR para confirmao da identidade dos isolados de Curtobacterium flaccumfaciens pv. flaccumfaciens utilizando-se os primers descritos por Guimares et al. (2001). Legenda: 1 marcador; 2 isolado SP (So Paulo); 3 isolado SC (Santa Catarina); 4 DF(Distrito Federal); 5 isolado PR (Paran); 6 isolado GO (Gois); 7 isolado MG (Minas Gerais); 8 isolado Una.

121

MANUAL DE ANLISE SANITRIA DE SEMENTES

5.2.5.8 Deteco de Xanthomonas axonopodis pv. phaseoli em feijo (Phaseolus vulgaris) Workshop 1999; Kobayasti, 2002.

Mtodo 1 Extrao: Suspender 1000 sementes em 600 mL de gua destilada esterelizada em um frasco cnico. Embeber as sub-amostras por 16-18 h a 4C.

2 Plaqueamento: Agitar os frascos para homogeneizar antes da diluio Preparar a diluio em srie do extrato de sementes (diluio 101, 102 e 103). Pipetar 100 l das diluies 10-1 e 10-2 e do extrato no diludo em duas placas de um dos dois meios semi-seletivos (meio XCP1 e meio MT) e espalhar sobre a superfcie com ala de Drigalski estril.Em seguida, incubar com as placas do controle positivo a 26-28C no escuro e examine aps 3 d.

3 Identificao preliminar da bactria: As colnias de Xap no meio XCP1 so amarelas, mucides, lisas, convexas e circundadas por zonas de hidrlise de amido. Em meio MT, as colnias so amarelas, circulares, no fluorescentes e circundadas por 2 zonas de hidrlise: uma maior, clara, correspondente hidrlise de casena e uma menor, leitosa (lctea), liplise de Tween 80. As variantes fuscans podem produzir pigmento marrom, solvel em gua em meio MT (Figura 84).

Figura 84 - Colnias de Xanthomonas axonopodis pv. phaseoli formadas a partir de extratos de sementes de feijo naturalmente infectadas, 6 dias aps o plaqueamento. A e B) meios de cultura semiseletivos XCP1 e MT, respectivamente; C) meio de cultura no seletivo 523. Lavras MG, 2005. (Foto Tebaldi, N.D.)

4 Reao da Polimerase em Cadeia (PCR): Preparar as suspenses de clulas, ligeiramente trbida (OD600nm aproximadamente 0,05), das culturas suspeitas e do controle positivo cultivadas em meio YDC em 1,0 mL de gua destilada esterilizada. Preparar tambm um isolado no suspeito como controle negativo. As suspenses podem ser armazenadas a -20C at a identificao.

122

5 - TESTES DE SANIDADE

Usar os seguintes primers especficos para Xap (Audy et al., 1994): X4c (5-GGCAACACCCGATCCCTAAAACAGG-3) X4e (5-CGCCGGAAGCACGATCCTCGAAG-3) Preparar a reao de PCR. Conduza a reao de PCR na parede de tubos de microcentrfuga de 0,2 mL com um volume final de 10 l (8 l reao + 2 l suspenso bacteriana). Programa de PCR: 94C/2 min., 25 ciclos de 94 C/1 min., 58 C/1 min., 72 C/2 min. e extenso final a 72 C/8 min. (Schaad at al., 1995, modificado). Colocar 10 l dos produtos de PCR por eletroforese durante 1,5 h a 150V em gel de agarose 1,5% em tampo TBE 0,5x (Tris Borate EDTA) colorido com brometo de etdeo. Incluir um marcador (ladder) de 100 bp. Estes primers geram um produto de tamanho de 730 pb especfico para Xap (Figura 85).

730 pb

Figura 85 - Anlise eletrofortica em gel de agarose (0,9%) dos produtos amplificados pela Bio-PCR para deteco do nmero de colnias caractersticas de Xanthomonas axonopodis pv. phaseoli e de microrganismos contaminantes obtidos dos extratos de sementes de feijo, cultivar Carioca. UFLA, Lavras MG, 2002. M = DNA Marker (Pharmacia Biotech); 1 = C18; 2 = C20; 3 = C23; 4 = C25; 5 = C27; 6 = C28; 7 = C29, 8 = C31; 9 = C32; 10 = C34; 11 = C35; 12 = C36; 13 = C37; 14 = C38, 15 = C39, 16 = C40, 17 = C41. (Foto Kobayasti, L.).

5. Inoculao do hospedeiro: Adicionar uma quantia de crescimento bacteriano com uma ala de platina em um tubo com meio nutriente lquido e misture bem. Usando uma seringa hipodrmica de 1 mL, puxar uma amostra desta suspenso. Inserir a agulha no caule de uma plntula de feijo de 7-10 dias, bem abaixo das primeiras folhas verdadeiras de forma que a agulha saia no outro lado. Aps retirar a agulha injetar lentamente o inculo dentro da plntula. Uma gota de inculo deve estar aparente em cada local do ferimento. Repitir todo o procedimento, inoculando primeiro 6 plantas com meio nutriente lquido estril, como controle negativo, e 6 plantas com os isolados conhecidos de Xap, como controle positivo. Incubar as plantas em cmara de crescimento por 7-10 dias. Sintomas tpicos da bacteriose so leses deprimidas, encharcadas no local do ferimento onde a bactria est abundante e leses em folhas, comeando pelas mais baixas. Zonas necrticas amarelas desenvolvero, escurecendo do centro (Figura 86).

123

MANUAL DE ANLISE SANITRIA DE SEMENTES

Figura 86 - Leses tpicas do crestamento bacteriano comum causado por Xanthomonas axonopodis pv. phaseoli em plantas de feijo. (Foto Kobayasti, L.).

124

5 - TESTES DE SANIDADE

ANEXOS NOTAS: Preparo de antibiticos - A atividade (unidades/mg) de alguns antibiticos pode variar entre grupos. necessrio ajustar o peso ou volume adicionado para assegurar que o volume final de unidades por litro de meio seja consistente. - Todas as medidas dos antibiticos so baseadas no peso do ingrediente ativo. Cuidado ao calcular a quantidade requerida da soluo estoque do produto para dar a quantidade desejada do ingrediente ativo (ex: Tobramycin). Armazenamento - Armazene as placas invertidas em sacos de polietileno a 4C e use dentro de duas semanas do preparo para assegurar a atividade dos antibiticos. - Dependendo da fonte de amido, armazenar em geladeira por vrios dias antes de usar pode resultar em zonas de hidrlise de amido mais visveis.

125

MANUAL DE ANLISE SANITRIA DE SEMENTES

Anexo 1 Soluo salina esterilizada Reagente Cloreto de sdio (NaCl) gua destilada g/L 8,5 1000 mL g/500 mL 4,25 500 mL

Preparo 1 Pese todos os ingredientes dentro de um recipiente. 2 Adicione 1000 mL (ou 500 mL) de gua destilada. 3 Para extrao de sementes, adicione 200 l de Tween 20 estril por 1000 mL. 4 Dissolva e distribua em recipientes. 5 Autoclave a 121C, 115 psi por 15 min. Armazenamento Contanto que os recipientes estejam bem fechados, podem ser armazenados por vrios meses antes de usar. Anexo 2 Meio YDC (Yeast Extract Dextrose Chalk) (Schaad, 1988) Reagente Bacto Agar Extrato de levedura CaCO3 (p fino) D-Glucose (Dextrose) gua destilada g/L 17,0 10,0 20,0 20,0 1000 mL g/500 mL 8,5 5,0 10,0 10,0 500 mL

Preparo 1 Pese todos os ingredientes dentro de um recipiente grande (250 mL de meio em um frasco de 500 mL) que permita misturar o meio antes de vert-lo. 2 Adicione 1000 mL (ou 500 mL) de gua destilada. 3 Autoclave a 121C, 115 psi por 15 min. 4 Deixe o meio esfriar at aproximadamente 50C. 5 Agite levemente para assegurar a distribuio do CaCO3 e evitar bolhas de ar e verta o meio nas placas (22 mL por placa de 9,0 cm). 6 Deixe as placas secarem em cmara de fluxo laminar antes de usar.

126

5 - TESTES DE SANIDADE

Anexo 3 Meio FS gar (Schaad, 1989). Reagente Bacto Agar Amido solvel (Aldrich No 17,993-0) (CCP) Bacto extrato de levedura (Difco) K2HPO4 KH2PO4 MgSO4.7H2O Methyl Green (1% aq.) gua destilada Cycloheximida (200 mg/mL lcool 70%)
a

g/L 15,0 10,0 0,1 0,8 0,8 0,1 1,5 mL 1000 mL 200 mg (1 mL) 3 mg (1 mL) 1 mg (1 mL) 50 mg (1 mL) 0,4 mg (0,4 mL) 30 mg (3 mL)

g/500 mL 7,5 5,0 0,05 0,4 0,4 0,05 0,75 mL 500 mL 100 mg (0,5 mL) 1,5 mg (0,5 mL) 0,5 mg (0,5 mL) 25 mg (0,5 mL) 0,2 mg (0,2 mL) 15 mg (1,5 mL)

D-methionina (3 mg/mL lcool 50%)


b

Pyridoxina-HCl (1 mg/mL lcool 50%)


c

Cephalexina (50 mg/mL lcool 70%)


d

Gentamycina (1 mg/mL gua)


e

Trimethoprimaf (10 mg/mL lcool 70%) a, b, c, d, e, f Adicionar aps a autoclavagem

Preparo 1 Pese todos os ingredientes, exceto os antibiticos e metionina dentro de um recipiente. 2. Adicione 1000 mL (ou 500 mL) de gua destilada. 3 Cozinhe no vapor para dissolver. 4 Autoclave a 121C, 115 psi por 15 min. 5 Prepare as solues de antibiticos e metionina. 6 Deixe o meio esfriar at aproximadamente 50C antes de adicionar as solues de antibiticos e metionina. 7 Misture completamente, mas de forma suave atravs de inverso e rodando para evitar a formao de bolhas e verta o meio nas placas (22 mL por placa de 9,0 cm). 8 Deixe as placas secarem em cmara de fluxo laminar antes de usar. Antibiticos e outras adies Dissolva 2 g de cycloheximida em 10 mL de lcool 70%. Adicione 1 mL/L (0,5 mL/500 mL). b Dissolva 60 mg de D-methionina em 10 mL de gua destilada, ento adicione 10 mL de etanol. Adicione 1,0 mL/L (0,5 mL/500 mL). c Dissolve 20 mg de pyridoxina em 20 mL de lcool 50%. Adicione 1,0 mL/L (0,5 mL/500 mL). d Dissolva 500 mg de cephalexina em 10 mL de lcool 70%. Adicione 1,0 mL/L (0,5 mL/500 mL). e Dissolva 10 mg de gentamycina em 10 mL de gua destilada, filtre para esterilizar. Adicione 0,4 mL/L (0,2 mL/500 mL). f Dissolva/suspenda 200 mg de trimethoprim em 20 mL de lcool 70%. Como este produto no pode dissolver totalmente, necessrio agitar a suspenso em vortex imediatamente antes de adicion-la ao meio (3 mL/L ou 1,5 mL/500 mL).
a

127

MANUAL DE ANLISE SANITRIA DE SEMENTES

Anexo 4 Meio mCS20ABN agar Reagente Peptona de soja (Oxoid L44) Bacto Triptona (Difco Bacto) KH2PO4 (NH4)2HPO4 MgSO4.7H2O L-Glutamina (Sigma G-3126) L-Histidina (Sigma H-8000) D-Glucose (Dextrose) gua destilada Amido solvel (Aldrich No 17,993-0) Bacto Agar (Difco) Cycloheximidaa (200 mg/mL lcool 70%) Neomycina (40 mg/mL lcool 20%)
b

g/L 2,0 2,0 1,59 0,33 0,4 6,0 1,0 1,0 1000 mL 25,0 15,0 200 mg (1 mL) 40 mg (1 mL) 100 mg (1 mL)

g/500 mL 1,0 1,0 0,79 0,17 0,2 3,0 0,5 0,5 500 mL 12,5 7,5 100 mg (0,5 mL) 20 mg (0,5 mL) 50 mg (0,5 mL)

Bacitracina (100 mg/mL lcool 50%)


c a, b, c

Adicionar aps autoclavagem

Preparo 1 Pese todos os ingredientes, exceto gar, amido e antibiticos dentro de um recipiente. 2 Adicione 1000 mL (ou 500 mL) de gua destilada. 3 Dissolva e cheque pH o qual deve ser 6,5, ajuste se necessrio. 4 Adicione o amido e gar e cozinhe em vapor para dissolver. 5 Autoclave a 121C, 115 psi por 15 min. 6 Prepare as solues de antibiticos. 7 Deixe o meio esfriar at aproximadamente 50C e adicione as solues de antibiticos. 8 Misture completamente, mas suavemente atravs de inverso e rodando para evitar bolhas e verta o meio nas placas (22 mL por placa de 9,0 cm). 9 Deixe as placas secarem em cmara de fluxo laminar antes de usar. Antibiticos a Dissolva 2,0 g de cycloheximide (Sigma C-7698) em 10 mL de lcool 70%. Adicione 1 mL/L (0,5 mL/500 mL). b Dissolva 400 mg de neomycina (Sigma N-1876) em 10 mL de lcool 20%. Adicione 1 mL/L (0,5 mL/500 mL). c Dissolva 1,0 g bacitracina (Sigma B-0125, 66k unidades/g) em 10 mL de lcool 50%. Adicione 1,0 mL/L (0,5 mL/500 mL).

128

5 - TESTES DE SANIDADE

Anexo 5 Meio MKM agar Reagente NH4Cl K2HPO4 KH2PO4 Lactose monohidratada D(+) trealose dihidratada Extrato de levedura 2- Acid Thiobarbiturico Bacto agar Sulfato de Tobramycina Bacitracina Nystatinad
a, b, c, d c a b

g/L 1,0 1,2 1,2 10,0 4,0 0,5 0,2 17,0 0,002 0,010 0,050 0,035

g/500 mL 0,5 0,6 0,6 5,0 2,0 0,25 0,1 8,5 0,001 0,005 0,025 0,018

Cephalexina monohydratada

Adicionar aps autoclavagem

Preparo 1 Pese todos os ingredientes, exceto os antibiticos dentro de um recipiente. 2 Adicione 1000 mL (ou 500 mL) de gua destilada. 3 Dissolva e cheque o pH o qual deve ser 6,6. 4 Autoclave a 121C, 115 psi por 15 min. 5 Prepare as solues de antibiticos. 6 Deixe o meio esfriar at aproximadamente 50C e adicione as solues de antibiticos. 7 Misture completamente, mas suavemente atravs de inverso/rodando para evitar bolhas e verta o meio nas placas (22 mL por placa de 9,0 cm). 8 Deixe as placas secarem em cmara de fluxo laminar antes de usar. Antibiticos e outras adies a Dissolva 20 mg de sulfato de tobramycina (Sigma T-1783 ou Duchefa T-0153) em 10 mL de lcool 70%. Adicione 1 mL/L (0,5 mL/500 mL). b Dissolva 200 mg de cephalexina monohydratada (Sigma C-4895) em 10 mL de lcool 70%. Adicione 0,5 mL/L (0,25 mL/500 mL). c Dissolva 500 mg de bacitracina (Sigma B-0125 66K unidades/g ou Duchefa B-0106, 70 K unidades/g) em 10 mL de lcool 70%. Adicione 1,0 mL/L (0,5 mL/500 mL). d Dissolva 100 mg de nystatina (Sigma N-3503, Duchefa N-0138) em 10 mL de lcool 70%. Adicione 3,5 mL/L (1,75 mL/500 mL). Use 100 mg/L de cyclohexamida, ao invs de nystatina, quando o crescimento de fungos no meio seletivo no for completamente inibido por 35 mg/L de nystatina.

129

MANUAL DE ANLISE SANITRIA DE SEMENTES

Anexo 6 Meio MD5A gar (Cubeta e Kuan, 1986) Reagente MgSO4.7H2O NaH2PO4 NH4Cl K2HPO4 Bacto agar Celobiose
a b

g/L 0,3 1,0 1,0 3,0 17,0 10,0 0,005 0,001


d c

g/500 mL 0,15 0,5 0,5 1,5 8,5 5,0 0,0025 0,0005 0,005 0,005 0,018

cido L-glutamico L-methionina Bacitracina Nystatina


a, b, c, d, e, f f e

Cephalexina monohydratada

0,01 0,01 0,035

Adicionar aps a autoclavagem

Preparo 1 Pese todos os ingredientes, exceto os antibiticos, cido L-glutmico, L-metionina e celobiose dentro de um recipiente. 2 Adicione 900 mL (ou 450 mL) de gua destilada. 3 Dissolva e cheque pH o qual deve ser 6,4, ajuste se necessrio. 4 Autoclave a 121C, 115 psi por 15 min. 5 Prepare as solues de antibiticos, cido L-glutmico, L-metionina e celobiose. 6 Deixe o meio esfriar at aproximadamente 50C antes de adicionar as solues. 7 Misture completamente mas suavemente atravs de inverso/rodando para evitar formao de bolhas e verta o meio nas placas (22 mL por placa de 9,0 cm). 8 Deixe as placas secarem em cmara de fluxo laminar antes de usar. Antibiticos e outras adies Dissolva 10 g de celobiose em 100 mL de gua destilada e filtre em membrana de Millipore. b Dissolva 50 mg de cido L-glutmico em 10 mL de gua destilada e filtre em membrana de Millipore. Adicione 1,0 mL/L (0,5 mL/500 mL). c Dissolva 10 mg de L-metionina em 10 mL de gua destilada e filtre em membrana de Millipore. Adicione 1,0 mL/L (0,5 mL/500 mL). d Dissolva 200 mg de cephalexina monohydratada (Sigma C-4895) em 10 mL de lcool 70%. Adicione 0,5 mL/L (0,25 mL/500 mL). e Dissolva 500 mg de bacitracina (Sigma B-0125, 66K unidades/g ou Duchefa B-0106, 70 K unidades/g) em 10 mL de lcool 70%. Adicione 0,2 mL/L (0,1 mL/500 mL). f Dissolva 100 mg de nystatina (Sigma N-3503, Duchefa N-0138) em 10 mL de lcool 70%. Adicione 3,5 mL/L (1,75 mL/500 mL). Use 100 mg/L de cycloheximide, ao invs de nystatin, quando o crescimento de fungos no meio seletivo no for completamente inibido por 35 mg/L de nystatina.
a

130

5 - TESTES DE SANIDADE

Anexo 7 Meio mTBM agar Nota. Este meio uma modificao do meio Tween B (McGuire et al., 1986) do qual difere na adio de 10,0 g/L de leite em p desnatado e na ausncia de 0,4 mg/L de tobramycine e 0,25 g/L de CaCl2. g/L 0,3 10,0 10,0 10,0 17,0 10,0 mL
c

Reagente H3BO3 KBr Peptona

g/500 mL 0,15 5,0 5,0 5,0 8,5 5,0 mL 0,033 0,006 0,018

Leite em p desnatadoa Bacto agar Tween 80


b

Cephalexina monohydratada 5-Fluorouracil Nystatina


a, b, c, d, e e d

0,065 0,012 0,035

Adicionar aps autoclavagem

Preparo 1 Pese todos os ingredientes, exceto leite em p desnatado, antibiticos e Tween 80 dentro de um recipiente. 2 Adicione 900 mL (ou 450 mL) de gua destilada. 3 Dissolva e cheque pH o qual deve ser 7.4, ajuste se necessrio. 4 Autoclave a 121C, 115 psi por 15 min. 5 Prepare as solues de antibiticos e leite desnatado. 6 Deixe o meio esfriar at aproximadamente 50C antes de adicionar as solues de antibiticos e leite desnatado e Tween 80. 7 Misture completamente, mas suavemente atravs de inverso/rodando para evitar formao de bolhas e verta o meio nas placas (22 mL por placa de 9,0 cm). 8 Deixe as placas secarem em cmara de fluxo laminar antes de usar. Antibiticos e outras adies Autoclave a soluo (10,0 g/100 mL) separado. A qualidade do leite em p desnatado afeta muito as capacidades do mTBM. Leites de boa qualidade so BBL, Oxoid ou Sigma. c Dissolva 200 mg de cephalexina monohydratada (Sigma C-4895) em 10 mL de lcool 70%. Adicione 3,25 mL/L (1,625 mL/500 mL). d Dissolva 100 mg de 5-fluorouracil (Sigma F-6627, Duchefa F-0123) em 10 mL de lcool 70%. Adicione 1,2 mL/L (0,6 mL/500 mL). e Dissolva 100 mg de nystatina (Sigma N-3503, Duchefa N-0138) em 10 mL de lcool 70%. Adicione 3,5 mL/L (1,75 mL/500 mL). Use 100 mg/L de cycloheximide, ao invs de nystatina, quando o crescimento de fungos no meio seletivo no for completamente inibido por 35 mg/L de nystatina.
a

131

MANUAL DE ANLISE SANITRIA DE SEMENTES

Anexo 8 Mistura de reao de PCR (Xanthomonas hortorum pv. carotae) Reagente gua MilliQ esterilizada Tampo 10x MgCl2 (50 mM) dNTPs (10 mM total, 2,5 mM cada) Primer 3Sforw (5 pmol/l) Primer 3Srev (5 pmol/l) Primer 1052F (5 pmol/l) Primer BacR (5 pmol/l) Taq Polymerase (5U/l) Suspenso bacteriana Tampo 10x Tris-HCL (pH 9,0) (NH4)2SO4 Tween 20 Tampo TBE (Tris Borate EDTA) 0,5x Reagente Tris cido brico Na2EDTA.2H2O O pH 8,3 e no requer ajuste. Gel de agarose 1,5% para eletroforese Composto 1 gel de agarose (20x20 cm) TBE (Tris Borate EDTA) 0,5x 160 mL Agarose 2,4 g 8,0 l Brometo de etdeoa
a

Concentrao final 1x 1,5 mM 200 M cada 0,50 M 0,50 M 0,10 M 0,10 M 0,04 U/l

Volume (l) em 10 l 3,42 1,00 0,30 0,80 1,00 1,00 0,20 0,20 0,08 2,00

750 mM 200 mM 0,1% (v/v)

g/L 5,39 2,75 0,37

g/500 mL 2,70 1,38 0,19

1 Litro 1000 mL 15,0 g 50,0 l

Dissolva 100 mg de brometo de etdeo em 10 mL de gua destilada. Adicione 50 l/l desta soluo. Brometo de etdeo cancergeno!

Preparo 1 Para calcular o volume do gel (em mL), multiplique a rea do gel pela espessura requerida (0,4 cm). 2 Tenha certeza que a bandeja do gel esteja limpa e seca antes de uso. Marque o final da bandeja com uma fita. 3 Pese a quantidade de agarose desejada e coloque em um Erlenmeyer com a quantidade medida do tampo de eletroforese (um gel de 100 mL adicione 1,5 g de agarose e 100 mL de tampo TBE 0,5x em um frasco de 200 mL).

132

5 - TESTES DE SANIDADE

4 Dissolva a agarose em um banho com gua fervente ou em microondas. Todos o grnulos de agarose devem ser dissolvidos e a soluo deve ser limpa. 5 Deixe esfriar at aproximadamente 60C antes de adicionar a soluo estoque de brometo de etdeoa, misture bem e verta o gel imediatamente numa espessura de 0,4 cm. Use luvas quando adicionar o brometo de etdeo. 6 Coloque o(s) pente(s) no gel. 7 Aps a solidificao do gel (aproximadamente 30 minutos em temperatura ambiente) remova cuidadosamente o(s) pente(s) do gel. 8 Remova as fitas do final da bandeja e a coloque na unidade de eletroforese. Para eletroforese do modelo submarine, verta o tampo de eletroforese no aparato, o suficiente para cobrir o gel numa profundidade de pelo menos 1 mm. 9 O mesmo tampo de eletroforese usado no gel utilizado como tampo de corrida. Anexo 9 Meio 523 (Kado e Heskett, 1970) Componente K2HPO4 MgSO4.7H2O Sacarose Extrato de levedura Casena hidrolizada Agar gua destilada g/L 2 0,3 10 4 8 20 1000 mL g/500 mL 1 0,15 5 2 4 10 500 mL

Preparo 1 Pese todos os ingredientes. 2 Adicione 1000 mL (ou 500 mL) de gua destilada. 3 Dissolva todos os ingredientes. 4 Autoclave a 121C, 115 psi por 15 min. 5 Deixe o meio esfriar at aproximadamente 50C e verta o meio nas placas (22 mL por placa de 9,0 cm). 6 Deixe as placas secarem em cmara de fluxo laminar antes de usar.

133

MANUAL DE ANLISE SANITRIA DE SEMENTES

Anexo 10 Meio mPSA (Mehta, et al., 2005) Componente Ca(NO3) FeSO4 Na2HPO4 Peptona Sacarose Bacto-gar gua destilada Cycloheximida (500 mg/10mL 75% EtOH)
a

g/L 0,35 0,35 1,4 3,5 14,0 10,5 700 mL 100mg (2mL) 10 mg (1mL) 0,05 g 1 mL 12,5 mg (1 mL)

g/500 mL 0,175 0,175 0,7 1,75 7,0 5 350 mL 50 mg (1 mL) 5 mg (0,5 mL) 0,025 g 0,5 mL 6,25 (0,5 mL)

Cephalexina (100 mg/10mL 75% EtOH )


b

Pencycuron

Triadimenold Tolyfluanide (125 mg/10 mL gua esterilizada)


a, b, c, d, e

Adicionar aps a autoclavagem.

Preparo 1 Pese todos os ingredientes, exceto os antibiticos dentro de um recipiente. 2 Adicione 1000 mL (ou 500 mL) de gua destilada. 3 Dissolva e cheque pH o qual deve ser 6,6. 4 Autoclave a 121C, 115 psi por 15 min. 5 Prepare as solues de antibiticos. 6 Deixe o meio esfriar at aproximadamente 50C e adicione as solues de antibiticos. 7 Misture completamente, mas suavemente atravs de inverso/rodando para evitar formao de bolhas e verta o meio nas placas (22 mL por placa de 9,0 cm). 8 Deixe as placas secarem em cmara de fluxo laminar antes de usar. Antibiticos e outras adies Dissolva 500 mg de ciclohexamida em 10mL de lcool 75%. Adicione 2 mL/L (1 mL/500 mL). b Dissolva 100 mg de cephalexina em 10mL de lcool 75%. Adicione 1 mL/L (0,5 mL/500 mL). c Dissolva 125 mg de Tolyfluanid em 10 mL de gua esterilizada. Adicione 1,0 mL/L (0,5 mL/500 mL).
a

134

5 - TESTES DE SANIDADE

Anexo 11 Tampo tween fosfato Reagente Na2HPO4 KH2PO4 Tween 20 pH 7,4 Preparo 1 Pese todos os ingredientes dentro de um recipiente. 2 Adicione 1000 mL (ou 500 mL) de gua destilada. 3 Para extrao de sementes, adicione 200 l de Tween 20 estril por 1000 mL. 4 Dissolva, ajuste o pH 7,4 e distribua em recipientes. 5 Autoclave a 121C, 115 psi por 15 min. Armazenamento Contanto que os recipientes estejam bem fechados, podem ser armazenado por vrios meses antes de usar. Anexo 12 Meio SCM (Fatmi e Schaad, 1988) Reagente Bacto agar (Difco) Bacto extracto de levedura (Difco) Sacarose cido brico K2HPO4 KH2PO4 MgSO4.7H2O gua destilada Ciclohexamida (200 mg/mL 70% EtOH)
a

g/L 7,75 g 1,65 g 0,2 mL

g/L 15 0,1 10 1,5 2,0 0,5 0,25 975 mL 200 mg (1 mL) 100 mg (20 mL) 30 mg (3 mL) 10 mg (1 mL)

g/500 mL 7,5 0,05 5 0,75 1,0 0,25 0,125 487 mL 100 mg (0,5 mL) 50 mg (10mL) 15 mg (1,5 mL) 5 mg (0,5 mL)

cido nicotnicob (5 mg/mL H2O) cido nalidxico (10 mg/mL H2O)


c

Chapman tellurite solutiond (1% Difco)


a, b, c, d

Adicionar aps a autoclavagem

135

MANUAL DE ANLISE SANITRIA DE SEMENTES

Preparo 1 Pese todos os ingredientes, exceto antibiticos e potassium tellurite dentro de um recipiente. 2 Adicione 975 mL (ou 487 mL) de gua destilada. 3 Dissolva e ajuste o pH para 7,2 a 7,4. 4 Autoclave a 121C, 115 psi por 15 min. 5 Prepare as solues de antibitico se necessrio (filtre para esterilizar quando requerido) 6 Deixe o meio esfriar at aproximadamente 45-50C e adicione as solues de antibiticos e tellurite. 7 Misture gentilmente para evitar formao de bolhas e verta nas placas (22 mL por placa de 9,0 cm). 8 Deixe as placas secarem em cmara de fluxo laminar antes de usar. Antibiticos 1 Dissolva 2 g de cycloheximide em 10 mL de lcool 70%. Adicione 1 mL/L (0,5 mL/500 mL). 2 Dissolva 0,5 g cido nicotnico em 100 mL de gua destilada esterilizada, filtre para esterilizar. Adicione 20 mL/L (10 mL/500mL). 3 Dissolva 100 mg de cido nalidixico em 10 mL de NaOH 0,1 M, filtre para esterilizar. Adicione 3 mL/L (1,5 mL/500 mL) 4 Adicione 1 mL/L (ou 0,5 mL/500 mL) da soluo Chapman tellurite 1% da Difco. Anexo 13 Meio SCM modificado (mSCM) (Waters e Balkan, 1992) Reagente Bacto agar (Difco) Bacto extrato de levedura (Difco) Manose cido Borico K2HPO4 KH2PO4 MgSO4.7H2O gua Distilada Cycloheximidea (200 mg/mL 70% EtOH) cido Nicotinico (5 mg/mL H2O)
b

g/L 15 0,1 10 1,5 2,0 0,5 0,25 975 mL 200 mg (1 mL) 100 mg (20 mL) 30 mg (3 mL)

g/500 mL 7,5 0,05 5 0,75 1,0 0,25 0,125 487 mL 100 mg (0,5 mL) 50 mg (10mL) 15 mg (1,5 mL)

cido Nalidixico c (10 mg/mL H2O)


a, b, c

Adicionar aps a autoclavagem

Preparo 1 Pese todos os ingredientes, exceto antibiticos e potassium tellurite dentro de um recipiente. 2 Adicione 975 mL (ou 487 mL) de gua destilada. 3 Dissolva e ajuste o pH to 7,2-7,4. 4 Autoclave a 121C, 115 psi por 15 min. 5 Prepare as solues de antibitico se necessrio (filtre para esterilizar quando requerido) 6 Deixe o meio esfriar at aproximadamente 45-50C e adicione as solues de antibiticos e tellurite. 7 Misture gentilmente para evitar bolhas e verta nas placas (22 mL por placa de 9,0 cm). 8 Deixe as placas secarem em cmara de fluxo laminar antes de usar.

136

5 - TESTES DE SANIDADE

Antibiticos Dissolva 2 g de cycloheximida em 10 mL de lcool 70%. Adicione 1 mL/L (0,5 mL/500 mL). Dissolva 0,5 g cido nicotnico em 100 mL de gua destilada esterilizada, filtre para esterilizar. Adicione 20 mL/L (10 mL/500mL). 3 Dissolva 100 mg de cido nalidixico em 10 mL de NaOH 0,1 M, filtre para esterilizar. Adicione 3 mL/L (1,5 mL/500 mL)
1 2

Anexo 14 Meio King B (Fahy & Perley, 1983) Componente Proteose peptona n 3 K2HPO4 . 3H2O MgSO4 . 7H2O Agar Glicerol gua destilada g/L 20,0 1,5 1,5 20,0 10,0 mL 1000 mL g/500 mL 10,0 0,75 0,75 10,0 5,0 mL 500 mL

Preparo 1 Pese todos os ingredientes. 2 Adicione 1000 mL (ou 500 ml) de gua destilada. 3 Dissolva e cheque pH o qual deve ser 7,2. 4 Autoclave a 121C, 115 psi por 15 min. 5 Deixe o meio esfriar at aproximadamente 50C e verta-o nas placas (22 ml por placa de 9,0 cm). 6 Deixe as placas secarem em cmara de fluxo laminar antes de usar.

137

MANUAL DE ANLISE SANITRIA DE SEMENTES

Anexo 15 Meio King B modifificado Reagente Proteose peptona n 3 K2HPO4 MgSO4.7H2O NaCl gar gua destilada Clorotalonil (200 g/mL) Cefadroxil (50 g/mL)
b c d a

g/L 10,0 1,5 1,5 15 15 1000 mL 200 g (1,0 mL) 50 g (1,0 mL) 50 g (1,0 mL) 100 g (1,0 mL)

g/500 mL 5,0 0,75 0,75 7,5 7,5 500 mL 200 g (0,5 mL) 50 g (0,5 mL) 50 g (0,5 mL) 100 g (0,5 mL)

Cephalexina (50 mg/mL)


a, b, c, d

Clindamicina (100 g/mL)

Adicionar aps autoclavagem

Preparo 1 Pese todos os ingredientes exceto o clorotalonil e os antibiticos em um recipiente. 2 Adicione 1 litro de gua destilada. 3 Autoclave a 121C, 115 psi por 15 minutos. 4 Esterilize a quantidade requerida de Tween 80 separadamente a 121C, 115 psi por 15 minutos. 5 Prepare as solues de antibiticos e filtre para esterilizar. 6 Deixe o meio esfriar aproximadamente 50C e adicione o Tween 80 e as solues de antibiticos. 7 Misture gentilmente e verta nas placas (22mL por placa de 9,0 cm). 8 Deixe as placas para secar em cmara de fluxo laminar antes de usar ou armazenar. Antibiticos a Dissolva 0,2 g de Clorotalonil em 10 mL de gua destilada, filtre para esterilizar. Adicione 1,0 mL/L. b Dissolva 0,05 g de Cefadroxil em 10 mL de gua destilada, filtre para esterilizar. Adicione 1,0 mL/L. c Dissolva 0,05 g de Cephalexina em 10 mL de NaOH 4%, filtre para esterilizar. Adicione 1,0 mL/L. d Dissolva 0,1 g de Clindamicina em 10 mL de gua destilada, filtre para esterilizar. Adicione 1,0 mL/L.

138

5 - TESTES DE SANIDADE

Anexo 16 Preparo do meio mTMB ** Reagente H3BO3 Bacto peptona KBr CaCl Agar Tween 80
a b c

g/L 0,1 10,0 10,0 0,25 15,0 10,0 mL 0,065 (1 mL) 0,012 (1 mL) 0,0002 (1 mL)
e

g/500 mL 0,05 5,0 5,0 0,125 7,5 5,0 mL 0,0325 (0,5 mL) 0,006 (0,5 mL) 0,0001 (0,5 mL) 0,1 (0,5 mL)

Cephalexina

5-Fluorouracil Tobramycina
a, b, c, d d

Cyclohexamida

0,2 (1 mL)

Adicionar aps autoclavagem

1 Pese todos os ingredientes exceto Tween 80 e os antibiticos em um recipiente. 2 Adicione 1 litro de gua destilada. 3 Dissolva os ingredientes. 4 Autoclave a 121C, 115 psi por 15 minutos. 5 Esterilize a quantidade requerida de Tween 80 separadamente a 121C, 115 psi por 15 minutos. 6 Prepare as solues de antibiticos e filtre para esterilizar. 7 Deixe o meio esfriar aproximadamente 50C e adicione o Tween 80 e as solues de antibiticos. 8 Misture gentilmente e verta nas placas (22mL por placa de 9,0 cm). 9 Deixe as placas para secar em cmara de fluxo laminar antes de usar ou armazenar. 10 Armazene as placas preparadas invertidas em sacos de polietileno na geladeira ou cmara fria 11 Use dentro de 2 semanas aps o preparo para assegurar a atividade dos antibiticos. Antibiticos a Dissolva 0,065 g de Cephalexina em 10 mL de NaOH 4%, filtre para esterilizar. Adicione 1,0 mL/L. b Dissolva de 0,012 g de 5-Fluorouracil em 10 mL de gua destilada, filtre para esterilizar. Adicione 1,0 mL/L. c Dissolva de 0,0002 g de Tobramycina em 10 mL de gua destilada, filtre para esterilizar. Adicione 1,0 mL/L. d Dissolva 0,2 g de Cyclohexamida em 10 mL de etanol 70%, filtre para esterilizar. Adicione 1,0 mL/L.

139

MANUAL DE ANLISE SANITRIA DE SEMENTES

Anexo 17 Preparo do meio CKTM Reagente Soy peptona Bacto tryptona Dextrose L-glutamina L-histidina (NH4)2HPO4 KH2PO4 MgSO4.7H2O CaCl2 Pourite(=optional) Difco Bacto agar Tween 80a Cephalexina
b c

g/L 2,0 2,0 1,0 6,0 1,0 0,8 1,0 0,4 0,25 1 gota 15,0 10 mL 0,065 (1 mL) 0,012 (1 mL) 0,0004 (1 mL)
e

g/500 mL 1,0 1,0 0,5 3,0 0,5 0,4 0,5 0,2 0,125 7,5 5 mL 0,0325 (0,5 mL) 0,006 (0,5 mL) 0,0002 (0,5 mL) 0,05 (0,5 mL) 0,05 (0,5 mL) 0,005 (0,5 mL)

5-Fluorouracil Tobramycina Bacitracina


a, b, c, d f d

Cyclohexamida

0,1 (1 mL) 0,1 (1 mL) 0,01 (1 mL)

Sulfato de Neomycina g Adicionar aps autoclavagem

1 Pese todos os ingredientes exceto Tween 80 e os antibiticos em um recipiente. 2 Adicione 990 mL de gua destilada. 3 Dissolva os ingredientes. 4 Autoclave a 121C, 115 psi por 15 minutos. 5 Esterilize a quantidade requerida de Tween 80 separadamente a 121C, 115 psi por 15 minutos. 6 Prepare as solues de antibiticos e filtre para esterilizar. 7 Deixe o meio esfriar aproximadamente 50C e adicione o Tween 80 e as solues de antibiticos. 8 Misture gentilmente e verta nas placas (22mL por placa de 9,0 cm). 9 Deixe as placas para secar em cmara de fluxo laminar antes de usar ou armazenar. 10 Armazene as placas preparadas invertidas em sacos de polietileno na geladeira ou cmara fria 11 Use dentro de 2 semanas aps o preparo para assegurar a atividade dos antibiticos. Antibiticos a Dissolva de 0,065 g de Cephalexina em 10 mL de NaOH 4%, filtre para esterilizar. Adicione 1,0 mL/L. b Dissolva de 0,012 g de 5-Fluorouracil em 10 mL de gua destilada, filtre para esterilizar. Adicione 1,0 mL/L. c Dissolva de 0,0004 g de Tobramycina em 10 mL de gua destilada, filtre para esterilizar. Adicione 1,0 mL/L. d Dissolva 0,1 g de Cyclohexamida em 10 mL de etanol 70%, filtre para esterilizar. Adicione 1,0 mL/L. e Dissolva 0,1 g de Bacitracina em 10 mL de gua destilada, filtre para esterilizar. Adicione 1,0 mL/L. e Dissolva 0,01 g de sulfato de neomicina em 10 mL de gua destilada, filtre para esterilizar. Adicione 1,0 mL/L.

140

5 - TESTES DE SANIDADE

Anexo 18 Meio XCP1 Reagentes Oxoid special peptone KBr CaCl Bacto Agar Amido de batata solvel Crystal violeta Tween 80
a b c

g/L 10,0 10,0 0,25 15,0 10,0 0,15 mL 10,0 mL 50 mg (1,25 mL) 10 mg (1,0 mL) 0,4 mg (0,5 mL)
e

g/500 mL 5,0 5,0 0,125 7,5 5,0 0,075 5,0 mL 50 mg (0,625 mL) 10 mg (0,5 mL) 0,4 mg (0,25 mL) 50 mg (0,25 mL)

Cephalexinfa (40 mg/mL)

5-Fluorouracil (10 mg/mL) Tobramycina (0,8 mg/mL)


a, b, c, d, e

Cycloheximida (100 mg/mL)

50 mg (0,5 mL)

Adicionar aps autoclavagem

Preparo 1 Pese todos os ingrediente exceto Tween 80 e os antibiticos em um recipiente. 2 Adicione 1 litro de gua destilada ou deionizada. 3 Ferva para dissolver. 4 Autoclave a 121C, 115 psi oor 15 minutos. 5 Esterilize a quantidade requerida de Tween 80 separadamente a 121C, 115 psi por 15 minutos. 6 Prepare as solues de antibiticos e filtre para esterilizar. 7 Deixe o meio esfriar aproximadamente 50C e adicione o Tween 80 e as solues de antibiticos. 8 Misture gentilmente e verta nas placas (22mL por placa de 9,0 cm). 9 Deixe as placas para secar em cmara de fluxo laminar antes de usar ou armazenar. 10 Armazene as placas preparadas invertidas em sacos de polietileno na geladeira ou cmara fria Antibiticos Dissolva 0,4 g de Cephalexina em 10 mL de NaOH 4%, filtre para esterilizar. Adicione 1,25 mL/L. c Dissolva 0,1 g de 5-Fluorouracil em 10 mL de lcool 95%, filtre para esterilizar. Adicione 1,0 mL/L. d Dissolva 0,008 g de Tobramycina em 10 mL de gua destilada, filtre para esterilizar. Adicione 0,5 mL/L. e Dissolva 1,0 g de Cycloheximida em 10 mL de metanol 75%, filtre para esterilizar. Adicione 0,5 mL/L.
b

141

MANUAL DE ANLISE SANITRIA DE SEMENTES

Anexo 19 Meio Milk-Tween (MT) Reagente CaCl2 Proteose peptona no. 3 Bacto agar Tyrosina Skim milk powder Tween 80
a b c

g/L 0,25 10,0 15,0 0,5 10,0 10,0 mL 80 mg (2,0 mL) 200 mg (2,0 mL) 10 mg (1,0 mL)
d

g/500 mL 0,125 5,0 7,5 0,25 5,0 5,0 mL 80 mg (1,0 mL) 200 mg (1,0 mL) 10 mg (0,5 mL)

Cephalexina (40 mg/mL)

Cycloheximida (100mg/mL) Vancomycina (10 mg/mL)


a, b, c, d

Adicionar aps autoclavagem

Preparo 1 Pese todos os ingrediente exceto Tween 80 e os antibiticos em um recipiente. 2 Adicione 1 litro de gua destilada ou deionizada. 3 Ferva para dissolver. 4 Autoclave a 121C, 115 psi por 15 minutos. 5 Esterilize a quantidade requerida de Tween 80 separadamente a 121C, 115 psi por 15 minutos. 6 Prepare as solues de antibiticos e filtre para esterilizar. 7 Deixe o meio esfriar aproximadamente 50C e adicione o Tween 80 e as solues de antibiticos. 8 Misture gentilmente e verta nas placas (22mL por placa de 9,0 cm). 9 Deixe as placas para secar em cmara de fluxo laminar antes de usar ou armazenar. 10 Armazene as placas preparadas invertidas em sacos de polietileno na geladeira ou cmara fria Antibiticos b Dissolva de 0,4 g de Cephalexina em 10 mL de NaOH 4%, filtre para esterilizar. Adicione 2,0 mL/L. c Dissolva de 1,0 g de Cycloheximida em 10 mL de metanol 75%, filtre para esterilizar. Adicione 2,0 mL/L. d Dissolva 0,1 g de Vancomycina em 10 mL de gua destilada, filtre para esterilizar. Adicione 1.0 mL/L.

142

5 - TESTES DE SANIDADE

Anexo 20 Nutriente gar (NA) Reagentes Bacto nutrient agar (DIFCO) g/L 23,0

Preparo 1 Suspenda 23,0 g em 1 litro de gua destilada ou deionizada. 2 Ferva para dissolver completamente. 3 Esterilize a 121-124C por 15 minutos. 4 Deixe o meio esfriar aproximadamente 50C. 5 Misture gentilmente e verta nas placas (22mL por placa de 9,0 cm). 6 Armazene as placas preparadas invertidas em sacos de polietileno na geladeira ou cmara fria.

143

MANUAL DE ANLISE SANITRIA DE SEMENTES

5.3 MTODOS DE DETECO DE VRUS Diversos mtodos podem ser empregados para a deteco de vrus em sementes, sendo os mtodos biolgicos e sorolgicos os mais comuns e fceis de serem empregados. Entretanto, testes moleculares como PCR (para vrus de DNA) e RT-PCR (para vrus de RNA) tambm podem ser utilizados, sendo o PCR um dos mais sensveis entre os disponveis no momento. A principal dificuldade, que constitui um fator decisivo na eficincia dos testes de diagnose, a sensibilidade da tcnica empregada, uma vez que, alm da baixa concentrao de partculas virais nas sementes, geralmente a porcentagem de sementes infectadas varia entre 5 e 15%. A localizao da partcula viral na semente tambm pode interferir na eficincia da tcnica diagnstica. O TMV (Tobacco mosaic virus), por exemplo, se localiza na parte externa das sementes, enquanto outros vrus, como o LMV (Lettuce mosaic virus) se localizam nos tecidos embrionrios, devido infeco do vulo ou do gro de plen. A seguir sero apresentadas as principais tcnicas que podem ser empregadas para a avaliao da sanidade de sementes em relao presena de vrus patognicos. 5.3.1. Testes biolgicos Os testes biolgicos so, aparentemente, mais fceis, devido ao fato de no necessitarem de infraestrutura ou de equipamentos caros. Existe a necessidade apenas de um telado ou casa-de-vegetao, ou mesmo de um cmara de crescimento com luz e temperatura controladas. Esse mtodo consiste em fazer a semeadura das sementes que se quer analisar, em bandejas adequadas, e esperar a germinao das sementes e o crescimento das plantas por um perodo aproximado de uma semana a dez dias. Geralmente esse tempo suficiente para avaliar se as plntulas apresentam ou no os sintomas da virose que se quer investigar. Esse teste tem, como desvantagem, o fato de que a observao visual, nem sempre absolutamente segura, de modo que se pode, nos casos de dvida, submeter a planta suspeita a testes complementares, como o sorolgico ou mesmo PCR. A segunda desvantagem seria o tempo gasto para a realizao do teste, que pode se alongar nos casos em que a germinao das sementes for demorada. A vantagem que, alm de ser um teste barato, no exige laboratrios sofisticados. 5.3.2. Teste sorolgico DAS-ELISA (Figuras 87-91) Esse teste consiste em empregar o antissoro especfico para cada vrus, numa tcnica em que se utiliza a Imunogamaglobuloina (IGg) e a IGg conjugada com a enzima fosfatase alcalina para a diagnose de vrus em tecidos vegetais. A produo desses antissoros bastante demorada e exige equipamentos caros, porm a maioria dos vrus mais comuns, que so transmissveis pelas sementes, possui antissoros comerciais disponveis no mercado. Essa uma tcnica bastante eficiente e sensvel, capaz de detectar 1 ng de vrus. A deteco de vrus na parte externa das sementes, como o caso do TMV, mais fcil, bastando deixar as sementes mergulhadas em soluo de extrao, em agitador, por cerca de 20 minutos, para eluir as partculas virais. A extrao do vrus de tecidos internos das sementes um pouco mais difcil, e pode se tornar um fator limitante para a sua deteco.O nmero de sementes amostradas tambm deve ser objeto de ateno. Uma boa alternativa colocar as sementes para germinar, por incubao em papel de filtro, como no blotter test, e utilizar os tecidos da plntula para o teste. Alm dos tecidos serem mais tenros e fceis de serem triturados, a multiplicao das partculas virais, juntamente com as clulas da plntula, durante o processo de germinao, aumenta a chance de deteco desse patgeno, que geralmente ocorre em baixa concentrao nas sementes.

144

5 - TESTES DE SANIDADE

5.3.2.1. Extrao do vrus Triturar o tecido em almofariz ou sacos plsticos apropriados na presena soluo de extrao (1 g/10 mL), e transferir o extrato para tubos de 1,2mL, em racks especiais para pipetagem. 5.3.2.2. Cobertura inicial das placas A cobertura das placas deve ser feita com 100mL/orifcio dos antissoros especficos (policlonais), utilizando a diluio recomendada pelo fabricante. Em seguida faz-se a incubao da placa por 2h a 37C e a lavagem por 3-4 vezes com gua deionizada e uma vez com tampo de lavagem (idntica em todos os passos). Pode-se empregar lavagem manual ou com o lavador automtico de placas. 5.3.2.3. Adio da amostra Aps a secagem da placa adiciona-se o antgeno, compreendido pelo extrato de tecidos proveniente das sementes (ou plntulas) que se quer analisar: 100mL/orifcio, com incubao de um dia para o outro (overnight). Lava-se novamente como descrito anteriormente. Deve-se empregar controles positivos e negativos, compreendidos por extratos de plantas comprovadamente infectadas e/ou sadias, respectivamente. Na falta de plantas infectadas ou nos casos de vrus quarentenrios, pode-se empregar controles adquiridos da mesma companhia fabricante dos antissoros. 5.3.2.4. Adio do Conjugado Adiciona-se o anticorpo conjugado com a enzima fosfatase alcalina, tambm diluda conforme a recomendao do fabricante : 100ml/orifcio e incuba-se por 2-3h a 37C. Efetua-se nova lavagem conforme descrito anteriormente. 5.3.2.5. Adio do substrato e leitura dos resultados Adiciona-se o substrato p-nitrofenilfosfato (na concentrao de 1mg/mL): 100ml/orifcio e incubase temperatura ambiente por no mnimo 30 minutos, ou at ser observada a cor amarela nos orifcios onde foram colocados os controles positivos. Faz-se ento a leitura a 405nm em um leitor de placas apropriado. Geralmente considera-se positivo a amostra, cuja absorbncia for igual ou maior a duas vezes a absorbncia obtida nos orifcios do controle negativo. 5.3.3. Diagnose de vrus atravs de PCR A tcnica PCR ou reao em cadeia da polimerase mais sensvel que a sorolgica, sendo capaz de detectar menos de 1 pg de vrus. Para essa tcnica, emprega-se um par de oligonucleotdeos complementares a uma determinada regio do genoma viral, com a finalidade de amplificar um fragmento genmico, de tamanho conhecido. No caso de vrus cujo genoma o RNA, deve-se primeiro fazer uma fita de DNA complementar, utilizando-se uma transcriptase reversa, para depois ento fazer a PCR propriamente dita (RT-PCR). Para realizar essa tcnica, primeiro deve-se fazer a extrao do RNA total da planta, para depois ento fazer , a partir desse, o cDNA e a PCR.

145

MANUAL DE ANLISE SANITRIA DE SEMENTES

5.3.3.1. Extrao do RNA total das sementes ou plntulas Macerar 0,1g de sementes ou tecidos das plntulas em almofariz, na presena de nitrognio lquido, adicionar 500L de tampo (10 mM Tris-HCl pH 8,0; 1 mM EDTA pH 8,0; 2 M NaCl, 0,005% BSA) e agitar. Aps a agitao, centrifugar o extrato foliar 14.000 rpm por 10 minutos (Centrfuga Eppendorf), descartando-se o sobrenadante. Adicionar 600L de tampo CTAB (2% CTAB contendo 1,4M NaCl e 0,5% de -mercaptoethanol) ao precipitado, agitar em vortex e incubar a 55C por 30 minutos. Aps a incubao, acrescentar 400L de clorofrmio:lcool isoamlico (24:1), agitar novamente em vortex e centrifugar a 14.000 rpm por 10 minutos. Tranferir a fase aquosa para um novo tubo e adicionr 1/10 volume de acetato de amnio 7,5M e 1 volume de isopropanol. Aps nova agitao a amostra colocar a -80C por 10 minutos para a precipitao do RNA e centrifugar a 14.000 rpm por 10 minutos, descartando-se o sobrenadante. Lavar o precipitado com etanol a 70%, secar a vcuo por 5 minutos e ressuspender em 50 L de gua ultrapura tratada com diethyl pyirocarbonate (DEPC). Analisar o RNA total obtido por eletroforese em gel de agarose 0,7%. 5.3.3.2. Transcrio reversa e PCR Os oligonucleotdeos (par de primers) empregados devem ser desenhados especialmente para cada vrus, com base nas sequncias especficas de cada um (Tabela 1). Para a sntese inicial do cDNA deve-se utilizar 5L do RNA total, 1L do primer antisense (na concentrao de 10 pM) e 6L de gua tratada com DEPC. Incubar o material a 70C por 10 minutos e transferir imediatamente para o gelo por 10 minutos. Em seguida adicionar 4 L de RT buffer 5X (250 mM Tris-Hcl, pH 8,3 a 25C; 375 mM KCl, 15 mM MgCl2, 50 mM DTT), 1 L de dNTPs 10 mM, 0,5 L da enzima transcriptase reversa (M-MLV, por exemplo). Incubar a 37C por 1 hora e a 70C por 15 minutos. Aps a obteno do cDNA, passar amplificao por PCR, utilizando-se 5L do cDNA, 5 L do 10X tampo da PCR, 3 L de MgCl2 (25 mM), 1L dNTP (10 mM), 2,5 L do primer senso (a10 pM), 2,5 L do primer antisenso (a 10 pM), 1L da Taq DNA polimerase e 30 L de gua ultrapura tratada com DEPC (volume total da reao igual a 50 L). Pode-se tambm fazer uma reao com 25 L, basta empregar a metade do volume dos reagentes, conforme descrito. Para a reao de PCR pode-se empregar 35 ciclos, sendo: 94 C por 40 segundos, 53 C por 55 segundos e 72 C por 2 minutos, com uma extenso final a 72 C por 10 minutos. Entretanto, dependendo do vrus poder haver uma pequena variao nesse ciclo. Ao final da reao, alquotas de 5 L devem ser analisadas por eletroforese em gel de agarose (0,7%), para checar o aparecimento das bandas tpicas.

146

5 - TESTES DE SANIDADE

Figura 87 - Material necessrio para o processamento da amostra para o Teste ELISA:A: Rack com tubos de 1,4mL; B: Basto de madeira com cerca de 12 x 2,5cm; C: saquinho de plstico 10 x 15 x 0,10 cm; D: Gaze, 3,5 x 4,5cm, dobrada duas vezes

147

MANUAL DE ANLISE SANITRIA DE SEMENTES

Procedimento do teste ELISA (Figuras 88 e 89)

A)

Colocar o material vegetal a ser triturado na gaze

B)

Dobrar cuidadosamente a gaze, de modo a envolver todo o material e colocar dentro do saquinho de plstico

C)

Colocar a soluo tampo de extrao (1mL para cada grama de tecido) dentro do saco plstico

148

5 - TESTES DE SANIDADE

D)

Macerar fazendo movimentos de compresso e giratrio E)

Despejar cuidadosamente nos tubos, tomando o devido cuidado para no deixar respingar nos tubos laterais. F)

Retirar as amostras com a pipetadora multicanal e aplicar nas placas ELISA, previamente recobertas com o antissoro especfico, conforme recomendao do fabricante. Figura 88 A F - Procedimento para extrao e aplicao da amostra nas microplacas empregadas para o teste ELISA.

149

MANUAL DE ANLISE SANITRIA DE SEMENTES

Figura 89 Lavagem manual ou com o auxilio de um lavador automtico de placas, aps cada incubao (para remoo do antissoro, do extrato de tecidos vegetais e do antissoro conjugado).

Figura 90 - Placas mostrando os controles positivos (CP) e negativos (CN), em dois testes: com 20% (A) e 0% (B) de amostras positivas, respectivamente.

150

5 - TESTES DE SANIDADE

Figura 91 - Leitor de Placas ELISA

151

MANUAL DE ANLISE SANITRIA DE SEMENTES

5.3.4 MTODOS ESPECFICOS POR ESPCIE 5.3.4.1 Capsicum spp. Cultivares de pimento e de pimenta podem transmitir trs espcies de Tobamovirus pelas sementes: Tobacco mosaic virus, Tomato mosaic virus e Pepper mild mottle virus. - Tobacco mosaic virus - TMV O TMV um vrus com ssRNA+, pertencente famlia Tobamoviridae, gnero Tobamovirus, com partcula tubular rgida, medindo 300 mm de comprimento e 9mm de dimetro (Figura 92). No possui vetor na natureza, mas pode ser transmitido de modo bastante eficiente pelo atrito entre plantas e por operaes culturais. No transmitido pelas sementes ou plen, entretanto as partculas virais podem ficar aderidas na parte externa do envoltrio das sementes, podendo infectar a plntula por qualquer ferimento causado no embrio durante a germinao. Dependendo da cultivar o TMV pode causar mosaico ou leso local necrtica. - Tomato mosaic virus - ToMV O TMV tambm um Tobamovirus, que mede 300 nm de comprimento por 18nm de dimetro. Tambm no possui vetor na natureza, podendo ser transmitido por contato entre plantas e por operaes culturais. transmissvel pelas sementes, podendo ser encontrado na mucilagem externa, na testa e algumas vezes no endosperma de sementes de tomate, mas nunca foi encontrado dentro do embrio. Sementes que contm o vrus no endosperma, podem permanecer contaminadas por cerca de nove anos. A porcentagem de sementes contaminadas varia com o fruto, mas j foram encontradas at 94% de sementes contendo o vrus. Os sintomas variam amplamente com a cultivar e as condies ambientais, entretanto os mais comuns so mosaico verde escuro, distoro foliar das folhas jovens, nanismo e reduo no crescimento dos frutos.

Figura 92 - Partculas de TMV

152

5 - TESTES DE SANIDADE

- Pepper mild mottle virus - PMMoV O PMMoV um Tobamovirus com 312 nm de comprimento por 18 nm de dimetro. No possui vetor na natureza mas transmitido mecanicamente por tratos culturais e frico entre plantas vizinhas. Foi encontrado transmisso por 22% de sementes de C.frutescens e por 29% das sementes de C. annuum. O vrus pode ser encontrado na parte externa das sementes, podendo tambm aparecer com baixa freqncia no endosperma das sementes. As plntulas podem se infectar facilmente durante o transplantio. Os sintomas mais comuns so o amarelecimento suave das folhas, deformaes dos frutos e o subdesenvolvimento das plantas.

Figura 93 - Partculas de PMMoV A) Teste Biolgico A realizao desse teste semelhante para os trs vrus. Deve-se empregar 1000 sementes, para semeadura em bandejas limpas, contendo substrato devidamente esterilizado, e com os nutrientes necessrios ao desenvolvimento da planta. Geralmente em uma bandeja medindo 50 x 30 cm, possvel plantar 500 sementes, enfileiradas, com 2cm entre as linhas (Figura 94: A-D). Portanto 1000 sementes podero ser semeadas em duas bandejas. Aps a germinao das sementes, deve-se observar as folhas primrias, pois sementes contaminadas podero dar origem a plantas com folhas menores, mostrando mosaico e deformao foliar, tanto para o TMV como para o ToMV. Os sintomas induzidos pelo PMMV geralmente so mais brandos. Como as folhas do pimento so bastante pequenas quando germinam, nem sempre a observao de sintomas nas folhas uma tarefa fcil, pois a intensidade dos sintomas vai depender da concentrao do inculo nas sementes. Concentraes maiores do inculo tendem a propiciar uma maior intensidade de sintomas nas plntulas (Figura 95: A-D).

153

MANUAL DE ANLISE SANITRIA DE SEMENTES

D1

Figura 94 - Teste biolgico de sementes de pimenta. A: plntulas nas bandejas uma semana aps a germinao. B: plntula sadia (S) e infectada (INF); B1: detalhe da plntula infectada com TMV em B; C: plntula sadia (S) e infectada (INF); D: detalhe de plntula infectada com TMV; D1: detalhe de plntula infectada assinalada com seta em D.

154

5 - TESTES DE SANIDADE

Figura 95 - Teste biolgico de sementes de pimento. A e B: plntulas nas bandejas uma semana aps a germinao, com alta (A) e baixa incidncia (B) de vrus . C a E: detalhes das plntulas infectadas com TMV.

155

MANUAL DE ANLISE SANITRIA DE SEMENTES

B) ELISA Geralmente no indicada a macerao direta das sementes para extrao do vrus. No caso do TMV, que fica aderido externamente nas sementes, existem dois procedimentos que podem ser indicados: o primeiro separar 1080 sementes (utilizar no mnimo 1000), colocar em cerca de 10-15 mL da soluo tampo de extrao, e deixar em agitao temperatura ambiente por cerca de meia hora. Isso faz com que as partculas virais se desprendam das sementes e passem para a soluo de extrao. Em seguida, recuperar a soluo de extrao por filtrao das sementes em gaze dupla, aplicar 100 mL em cada um dos 980 orifcios da placa ELISA previamente recoberta com o antissoro especfico e processar o teste normalmente. Uma segunda metodologia seria colocar as sementes para germinar em papel umedecido ou em gerbox, separar a casca das sementes (Fig. 96D e 96H) e extrair o suco das plntulas para o procedimento do teste ELISA (Figura 96 A -J). Nesse caso, deve-se colocar o extrato de 12 plntulas em cada um dos 90 orifcios da placa (1080 no total), sendo que os seis orifcios restantes devero ser preenchidos com dois controles positivos e quatro controles negativos. Como o peso de 12 sementes de pimento e/ou pimenta , em mdia, de 0,2 a 0,3 gramas, deve-se macera-las em 1 a 1,5mL do tampo de extrao (proporo 1:5).

156

5 - TESTES DE SANIDADE

Figura 96 - Sementes de pimenta germinada em papel (A), em gerbox (B) e de pimento germinada em gerbox (F). Detalhe das plntulas de pimenta (C e D) e de pimento (H). Plntulas colocadas no gaze (E e I) e em seguida no saquinho (J) para extrao do suco e posterior aplicao nas microplacas.

157

MANUAL DE ANLISE SANITRIA DE SEMENTES

C) RT-PCR O modo mais eficiente para se fazer o RT-PCR dos vrus que podem ser transmitidos por sementes de espcies de Capsicum sp utilizar o RNA total das plntulas oriundas das sementes que se pretende analisar, obtidas conforme descrito anteriormente para a tcnica sorolgica ELISA, ilustrado na Figura 96. Como essa tcnica (PCR) muito mais sensvel do que a ELISA, pode-se extrair o RNA de 100 plntulas (aproximadamente 1,6 a 2,3 g de tecido), em cada teste, e realizar a tcnica conforme descrito no item 1.3. Para cada 1000 sementes sero feitos 10 testes de PCR, o que contribui para diminuir o custo das anlises. Os primers para os trs vrus se encontram descritos na tabela 1. Tabela 1. Sequncia dos oligonucleotdeos (primers) para a deteco de cada vrus por RT-PCR, nmero de pares de base (Pb) do fragmento e regio do genoma a ser amplificado . Vrus Tobacco mosaic virus TMV Primers* 1: 5 GTCAGTGCCGAACAAG 3 2: 5 TCAAGTTGCTGGACTAG 3 No. Pb Regio do Genoma 5592 6191 MP/CP 5350 a 6052 MP/CP

600

Tomato mosaic virus ToMV

1: 5 GAGTGCGGGCTACTGCCC 3 2: 5 GCTACCCGCAGGGTAGACC 3

703

Pepper mild mottle virus PPMV

1: 5 GGTGTCGCCATGGAAAAGGG 3 1: 5 GTGAGTCCACTCGCGCTCTC 3

799

5341 6139 MP/CP

* Primer 1: 53(sense); Primer 2: 35(antisense). Para os trs vrus, o ciclo para PCR poder ser: 1. 2. Aquecimento inicial a 94 C por 2 minutos 30 ciclos : 92 C por 1 minuto 55 C por 1 minuto 72 C por 2 minutos 3. Extenso final de 72 C por 10 minutos.

158

5 - TESTES DE SANIDADE

As fotografias dos gis mostrando as bandas obtidas na anlise eletrofortica dos produtos das PCRs, realizadas com cada um dos primers descritos, podem ser vistas nas figuras 97 a 98.

Figura 97 - Anlise eletrofortica do produto de PCR obtido com o par de primers desenhado para o Tobacco mosaic virus (TMV). 1: 1Kb ladder; 2 e 3: controles positivos; 4: controle negativo; 5 a 8: plntulas com sintomas de mosaico.

159

MANUAL DE ANLISE SANITRIA DE SEMENTES

1636 1018 506,5

703

Figura 98 - Anlise eletrofortica do produto de PCR obtido com o par de primers desenhado para o Tomato mosaic virus (ToMV). 1: 1Kb ladder; 2: controle positivo; 3: controle negativo; 4 a 8: plntulas com sintomas de mosaico.

Figura 99 - Anlise eletrofortica do produto de PCR obtido com o par de primers desenhado para o Pepper mild mottle virus (PMMV). 1: 1Kb ladder; 2 a 6: plntulas com sintomas de mosaico; 7: controle negativo; 8: controle positivo.

160

5 - TESTES DE SANIDADE

5.3.4.2 Cucumis melo/ Cucurbita sp Essas duas espcies podem transmitir o vrus do mosaico da abbora (Squash mosaic virus- SqMV). - Squash mosaic virus- SqMV Esse um vrus de ssRNA+, pertencente familia Comoviridae, gnero Comovirus. Possui o genoma subdividido, encapsulado em trs partculas isomtricas, com cerca de 30 nm de dimetro. Na natureza esse vrus transmitido principalmente por Diabrotica spp. e Acalymma spp, dentre outros. Pode ser transmitido por sementes de Cucurbita moschata, C. pepo, C. maxima, C. mixta e Cucumis melo, sendo que a porcentagem de transmisso depende da planta e da estirpe do vrus e pode variar entre 1 e 94%.

Figura 100 - Partculas de Squash mosaic virus SqMV.

A) Teste Biolgico O teste biolgico consiste em plantar 1000 sementes em bandejas limpas, contendo substrato devidamente esterilizado, com os nutrientes necessrios, e analisar as plntulas aps a sua germinao. O tamanho ideal da bandeja de 50 x 30 cm, sendo possvel plantar 500 sementes, enfileiradas, com 2 cm entre as linhas (Figura 101: A-B). Portanto 1000 sementes podero ser semeadas em duas bandejas.

161

MANUAL DE ANLISE SANITRIA DE SEMENTES

Figura 101 - Teste biolgico de sementes de melo (A). B: detalhes dos na folha da plntula mostrando deformao,e mosaico; C: folha sadia (S) e infectada (I) com o SqMV.

162

5 - TESTES DE SANIDADE

A A

B B

C C

D D

E E

Figura 102 - Teste biolgico de sementes de Abbora uma semana (A) e duas semanas (B) aps a germinao. C->E: detalhes dos nas plntulas infectadas com SqMV.

B) ELISA Tambm nesse caso no indicada a macerao direta das sementes para extrao do vrus. Podese colocar as sementes para germinar em papel umedecido, e extrair o suco das plntulas (excluindo a parte da raiz e parte baixa do caule) para o procedimento do teste ELISA (Figura 88: A-F). O extrato de 12 plntulas deve ser aplicado em cada um dos 90 orifcios da microplaca (1080 no total), sendo que os seis orifcios restantes devero ser preenchidos com dois controles positivos e quatro controles negativos. O peso de 12 plntulas do melo , em mdia, de 0,72g e deve ser macerado em 3,6 mL. O de 12 plntulas de abbora de 1,52 g e deve ser macerado em 7,6mL. De qualquer modo, deve-se fazer a pesagem e ajustar a proporo para 1 g de tecido/5 mL de soluo extratora.

163

MANUAL DE ANLISE SANITRIA DE SEMENTES

Figura 103 - Sementes de melo (A) e de abbora (D) germinadas em papel. Detalhe das plntulas de melo (B) e de abbora (E). Plntulas colocadas no gaze (C e F) para serem posteriormente transferidas para os saquinhos para extrao do suco. C) RT-PCR Para a extrao do RNA melhor empregar tambm as plntulas germinadas em papel conforme descrito para o teste ELISA (Figuras 88, A-F). Tanto o peso das plntulas abbora como o das de melo so maiores, portanto recomenda-se fazer a extrao de RNA de 50 plntulas (cerca de 3 a 6,3 g), de modo que sero 20 testes de PCR pra 1000 sementes. Utilizar a proporo grama de tecido/mL de soluo extratora recomendada no item especfico da tcnica (1.3). Nesse caso o teste indicar a incidncia em cada 50 das 1000 sementes analisadas. O par de primer foi desenhado para amplificar um fragmento de 655 pb, na regio da capa protica entre os nucleotdeos 2021 e 2675: SqMV foward: 5 GAC TAC AAC ACC GCT TAC 3` SqMV reward: 5` CT GCC CAG AAA TTC CTA GCA 3`.

164

5 - TESTES DE SANIDADE

O ciclo para PCR : 1. Aquecimento inicial a 94 C por 2 minutos. 2. 35 ciclos: 95 C por 1 minuto 50 C por 1 minuto 72 C por 2 minutos. 3. Extenso final a 72 C por 7 minutos. A figura 104 mostra a banda amplificada a partir de RNA extrado de planta de abbora infectada com o SqMV.

Figura 104 - Anlise eletrofortica do produto de PCR obtido com o par de primers desenhado Squash mosaic virus (SqMV). 1: 1Kb ladder; 2, 3 e 4: controles positivos; 5: controle negativo; 6 a 8: plntulas com sintomas de mosaico.

165

MANUAL DE ANLISE SANITRIA DE SEMENTES

5.3.4.3 Lactuca sativa Plantas de alface infectadas com o vrus do mosaico (Lettuce mosaic virus LMV) podem facilmente transmiti-lo por meio das sementes produzidas. - Lettuce mosaic virus LMV um vrus pertencente famlia Potyviridae, gnero Potyvirus, que possui ssRNA+ encapsulado em uma partcula nica, alongada e flexvel, medindo 750nm de comprimento por 13 nm de dimetro. transmitido de um modo no persistente ou estiletar por diversas espcies de afdeos, como Acyrthosiphon scariolae, Acyrthosiphon pisum, Aphis gossypii, Myzus persicae, Macrosiphum euphorbiae, Nasonovia ribisnigri, Rhopalosiphum pseudobrassicae, etc. O Myzus persicae o mais eficiente na transmisso do LMV, sendo que os pulges pteros so mais eficientes que os alados. Os sintomas apresentados pela planta de alface infectada dependem da cultivar e da poca de infeco. Os mais comuns so mosaico, enrugamento, embolhamento, deformao foliar e necrose, alm de uma drstica diminuio do crescimento quando plantas jovens so infectadas. Cerca de 3 a 15% das sementes coletadas de plantas de alface infectadas podem transmitir o vrus. Essa porcentagem de transmisso depende do tempo de infeco da planta que produziu as sementes, da variedade e das condies ambientais. O LMV pode ser transmitido pela espcie selvagem Lactuca serriola.

Figura 105 - Partculas de LMV. A) Teste Biolgico Na realizao desse teste deve-se empregar 1000 sementes. A semeadura deve ser feita em bandejas limpas, contendo substrato devidamente esterilizado, e com os nutrientes necessrios ao desenvolvimento da planta. So necessrias 2 bandejas, com dimenses de 50 x 30 cm, para o plantio de 500 sementes, enfileiradas, com 2 cm entre as linhas, em cada uma. A observao deve ser feita nas primeiras folhas emitidas aps a germinao das sementes. Os sintomas devero ser: mosaico, diminuio e deformao das folhas (Figura 106).

166

5 - TESTES DE SANIDADE

Figura 106 - Teste biolgico de sementes de alface. A e B: plntulas nas bandejas duas semanas aps a germinao. C E: detalhes de plntulas infectadas com o LMV, mostrando mosaico e deformao (C), mosaico (D) e mosaico necrtico (E). B) ELISA Pode-se extrair o suco diretamente das sementes, ou colocar as sementes para germinarem em papel umedecido. Em seguida, separar a casca das sementes (Fig. 107 B) e extrair o suco das plntulas para o procedimento do teste ELISA. Deve-se colocar 12 plntulas em cada um dos 90 orifcios da placa (1080 no total), sendo que os seis orifcios restantes devero ser preenchidos com dois controles positivos e quatro controles negativos. Como o peso de 12 sementes de , em mdia, de 0,15 a 0,2 gramas, deve-se macera-las em 0,75 a 1 mL do tampo de extrao (proporo 1:5).

167

MANUAL DE ANLISE SANITRIA DE SEMENTES

C
Figura 107 - Sementes de alface germinada em papel (A). Detalhe das plntulas de alface (B) e plntulas colocadas no gaze (C) e em seguida no saco plstico para obteno do extrato a ser utilizado no teste ELISA. C) RT-PCR O RNA total das plntulas oriundas das sementes que se pretende analisar, obtidas conforme descrito anteriormente para a tcnica sorolgica ELISA, ilustrado na Figura 88 ( A- D). Pode-se extrair o RNA de 100 plntulas (aproximadamente 1,25 a 1,66 g de tecido), em cada teste, e realizar a tcnica conforme descrito no item 1.3. Para cada 1000 sementes sero feitos 10 testes de PCR, o que contribui para diminuir o custo das anlises. Pode-se, porm, utilizar 50 plntulas (20 testes). Nesse caso, deve-se determinar o peso das plntulas para calcular o volume da soluo extratora.

168

5 - TESTES DE SANIDADE

O par de primers empregado foi desenhado para amplificar um fragmento de 748 pB, na regio da capa protica, entre os nucleotdeos no. 9121 e 9868: LMV Foward: 5 GGA GAA AGG AAG TGG TTC TG 3` LMV Reward: 5 CAC GCC TTT AGT GCA ACC 3 O Ciclo para PCR sera: 1. Aquecimento inicial a 94 C por 2 minutos 2. 30 ciclos: 94 C por 1 minuto 50 C por 1 minuto 72 C por 2 minutos 3. Extenso final a 72 C por 10 minutos. A figura 108 mostra a banda amplificada a partir de RNA extrado de planta de abbora infectada com o LMV.

Figura 108 - Anlise eletrofortica do produto de PCR obtido com o par de primers desenhado para o Lettuce mosaic virus (LMV). 1: 1Kb ladder; 2 a 5: plntulas com sintoma de mosaico; 6: controle negativo; 7: planta com suspeita de infeco; 8: controle positivo.

169

MANUAL DE ANLISE SANITRIA DE SEMENTES

5.3.4.4 Lycopersicon esculentum Sementes de tomateiro podem disseminar o Tomato mosaic virus (ToMV) e o Tobacco mosaic virus (TMV), j descritos para Capsicum spp. - Tomato mosaic virus - (ToMV) Vrus pertencente famlia Tobamoviridae, gnero Tobamovirus, se encontra descrito em detalhes na parte de deteco de vrus em Capsicum spp. Nas sementes de tomate tambm encontrado na mucilagem externa, na testa e algumas vezes no endosperma, no sendo encontrado dentro do embrio. Pode ser transmitido por mais de 90% das sementes de plantas de tomate infectadas precocemente. Induz mosaico, deformao foliar e subdesenvolvimento da planta de tomate que, se infectada precocemente, tem a sua produo totalmente comprometida. - Tobacco mosaic virus - (TMV) Esse tambm um Tobamovirus, j descrito para Capsicum spp. um vrus que contamina as sementes, sendo encontrado na camada externa, de modo que infecta as plntulas por meio de qualquer ferimento causado no embrio por ocasio do processo de germinao. Os sintomas causados na plntula de tomate so idnticos aos causados pelo ToMV, sendo impossvel a sua distino visual. A) Teste Biolgico A metodologia desse teste semelhante descrita para o teste de espcies de Capsicum spp. Deve-se semear 1.000 sementes em bandejas limpas, contendo substrato devidamente esterilizado, e com os nutrientes necessrios ao desenvolvimento da planta. Geralmente em uma bandeja medindo 50 x 30cm, possvel plantar 500 sementes, enfileiradas, com 2cm entre as linhas. Portanto 1000 sementes podero ser semeadas em duas bandejas. Aps a germinao das sementes, observar as primeiras folhas emitidas, pois sementes contaminadas podero dar origem a plantas com folhas menores, mostrando mosaico e deformao foliar, tanto para o ToMV como para o TMV. A Figura 109 (A-C) mostra detalhes do teste.

170

5 - TESTES DE SANIDADE

Figura 109 - Teste biolgico de sementes de tomateiro. A: Plntulas na bandeja; B e C: plntulas infectadas indicadas pelas setas; D: plntula sadia (S) e infectada (IN).

B). Teste ELISA e RT-PCR Ambos os testes j foram descritos para Capsicum spp. Para maior sensibilidade, a obteno do extrato foliar para ELISA e a extrao de RNA para PCR devem ser feitos com a plntula obtida pela germinao das sementes, em substrato de papel de filtro ou em gerbox (Figura 110). Pode-se empregar 12 plntulas em cada extrao para o teste ELISA (cerca de 0,17g/ 0,85mL), 90 extraes, 1080 sementes. Para o RT-PCR, pode-se fazer a extrao de RNA de 100 plntulas (cerca de 1,4 g), 10 extraes, 1000 sementes. Os primers e as bandas observadas na eletroforese dos produtos obtidos no PCR, para o TMV e o ToMV, esto descritos para o Capsicum spp.

171

MANUAL DE ANLISE SANITRIA DE SEMENTES

A A

B B

D D

C C

E E

F F

Figura 110 - Sementes de tomateiro germinada em papel (A), em gerbox (C e D). Detalhe das plntulas (B e E). Plntulas colocadas no gaze (F) para extrao do suco e posterior aplicao nas microplacas.

172

5 - TESTES DE SANIDADE

5.3.4.5 Phaseolus vulgaris Cultivares de feijoeiro suscetveis ao vrus do mosaico comum (Bean common mosaic virus BCMV), podem transmitir esse vrus atravs das sementes. - Bean common mosaic virus - (BCMV) O BCMV um vrus com ssRNA+, pertencente famlia Potyviridae, gnero Potyvirus, com 760 nm de comprimento (figura 111). Pode ser transmitido por diversos afdeos, principalmente pelo Acyrthosiphon pisum, Aphis fabae o Myzus persicae. Outros vetores como Aphis gossypii, A. medicaginis, A. rumicis, Hyalopterus atriplicis, Macrosiphum ambrosiae, M. pisi and M. solanifolii tambm podem transmitir o BCMV. Os sintomas na planta dependem da suscetibilidade da cultivar, da estirpe do vrus e da poca em que ela for infectada. Infeces precoces pela estirpe comum induzem mosaico severo, deformaes foliares, enrugamento embolhamento e encarquilhamento, alm de subdesenvolvimento da planta. Algumas estirpes podem tambm induzir necroses severas. A porcentagem de transmisso do BCMV pelas sementes tambm varia com a estirpe e cultivar, podendo chegar a mais de 83% das sementes provenientes de plantas infectadas. O vrus se aloja nos tecidos do embrio, podendo a chegar por meio de infeco dos tecidos maternos ou via plen.

Figura 111 - Partcula do BCM A) Teste biolgico Para o teste biolgico deve-se empregar 1.000 sementes. Essas devem ser plantadas em bandejas limpas, contendo substrato devidamente esterilizado, e com os nutrientes necessrios ao desenvolvimento da planta. Geralmente em uma bandeja medindo 50 x 30 cm, possvel plantar 500 sementes, enfileiradas, com 1cm de espaamento entre sementes e 3 cm entre as linhas. Portanto 1000 sementes podero ser semeadas em duas bandejas. Aps a germinao das sementes, deve-se observar as folhas primrias, pois sementes contaminadas daro origem a plantas com folhas menores, mostrando mosaico e formao foliar (figura 112 B e C).As primeiras trifoliadas emitidas tambm mostraro o sintoma de mosaico e deformao foliar (Figura 112D).

173

MANUAL DE ANLISE SANITRIA DE SEMENTES

C
BCMV em folhas primrias e D: sintomas do BCMV em trifolioladas.

Figura 112 - Teste biolgico de sementes de feijo. A: bandeja com as plntulas; B e C: sintomas do

B) ELISA O extrato das sementes nem sempre adequado para emprego direto nesse teste. Em primeiro lugar, devido s caractersticas fsicas das sementes, que contm tecidos mais rgidos, e em segundo lugar devido concentrao de partculas virais nas mesmas, que pode estar abaixo da sensibilidade dessa tcnica que em torno de 1ng. A alternativa que tem sido testada com timos resultados consiste em colocar as sementes para germinar em papel (Figuras 113), remover a camada externa da semente e ento extrair o suco da parte apical das plntulas (113D e E), conforme j descrito anteriormente. A partir da, a tcnica segue os passos descritos anteriormente. As sementes podem ser combinadas 12 a 12, para aproveitar uma placa ELISA para cada amostra. Como essa possui 96 orifcios, pode-se empregar 4 controles negativos, 2 positivos e os 90 restantes com o extrato das plantas a serem testadas. No total sero testadas 1080 sementes, o que pode ser considerado uma quantidade satisfatria.

174

5 - TESTES DE SANIDADE

Figura 113 - Sementes de feijo germinadas em papel (A e B). Detalhe das plntulas de feijo (C e D). Parte das plntulas (folhas primrias) colocadas no gaze (E) para extrao do suco e posterior aplicao nas microplacas. C) RT- PCR Para a realizao do RT-PCR, o extrato utilizado para extrao do RNA poder tambm ser extrado das plntulas obtidas por germinao das semente em substrato de papel, conforme descrito anteriormente. Como esse teste mais caro, porm mais sensvel, pode-se empregar uma combinao de um maior nmero de sementes/teste, utilizando-se 50 sementes (cerca de 2g) em cada extrao, o que permitir fazer apenas 20 reaes de PCR para cada lote de 1000 sementes. O par de primers empregado foi desenhado para amplificar um fragmento de 854 pb, na regio da capa protica, entre os nucleotdeos no. 8944 e 9797:

175

MANUAL DE ANLISE SANITRIA DE SEMENTES

BCMV Forward: 5 TTG GAC AGC CAC AGC CAC 3 BCMV Reward: 5CTG CGG AGG ACC CAT GCC 3 O ciclo para PCR : 1. Aquecimento inicial a 92 C por 2 minutos 2. 30 ciclos: 92 C por 1 minuto 64 C por 1 minuto 72 C por 2 minutos 3. 72 C por 7 minutos. A anlise eletrofortica dos produtos da PCR em gel de agarose a 0,7% pode ser visualizada na figura 114

Figura 114 - Anlise eletrofortica dos produtos de PCR obtidos com o par de primers desenhado para o Bean common mosaic virus (BCMV). 1: 1Kb ladder; 2: controle negativo; 3 e 4: controles positivos; 5-8: plntulas com sintoma de mosaico.

176

5 - TESTES DE SANIDADE

5.4 MTODOS DE DETECO DE NEMATIDES Tcnicas para deteco e quantificao de nematides so fundamentalmente diferentes daquelas empregadas para outros grupos de patgenos e parasitas de sementes. Diferentes das bactrias e da maioria dos fungos, os fitonematides so parasitos obrigados, e assim o emprego de meios de culturas intil para sua deteco. Os principais fatores envolvidos no processo de escolha do mtodo de extrao mais adequado so: espcie de nematide e sua caracterizao; natureza e condies da amostra, tamanho da semente, poca de colheita, condies e perodo de armazenamento das sementes e disponibilidade de pessoal. Recomenda-se a amostragem de 500 sementes por lote devidamente homogeneizadas, subdiviso destas em sub-amostras com 100 sementes as quais por sua vez devem ser distribudas em cinco repeties, que devem ser processadas de acordo com os mtodos mais apropriados. No caso de diagnsticos em anlises de rotina em larga escala, o ideal que o mtodo seja prtico, rpido, simples e qualitativo, de modo a permitir uma extrao consistente, independentemente da espcie vegetal ou do tipo de semente, livre de erros ou da variabilidade, principalmente devido ao analista. Tambm deve traduzir o nmero real de espcimes presentes na amostra. No geral os mtodos de extrao se baseiam no princpio do funil de Baermann e suas modificaes, onde a motilidade dos nematides usada para separ-los de materiais inertes, ou de um perodo de flutuao onde nematide e partculas com densidades semelhantes so separados de partculas de solo mais densas, em gua e, ento, recuperados em peneiras. Para deteco e quantificao dos nematides em sementes, praticamente todos os mtodos conhecidos buscam empregar o princpio da reativao desses organismos que esto em estado de anidrobiose. Assim, a embebio em gua por determinado perodo de tempo faz com estes migrem para o exterior das sementes, permitindo sua observao ao microscpio. A determinao desse tipo de agente em sementes de carter mais qualitativo, apesar de que a contagem do nmero de nematides em determinada quantidade de sementes possa fornecer a idia do potencial de inculo. Os mtodos baseados no funil de Baermann no requerem grandes laboratrios e nem equipamentos sofisticados. A modificao desse mtodo, com o emprego de pratos grandes, permite a recuperao da maioria dos nematides com tamanho mediano, podendo, entretanto, ser menos eficiente para aqueles de tamanho maior, a exemplo dos nematides da famlia Longidoridae e, mesmo aqueles menos ativos. Pesquisadores ou tcnicos podem empregar funis de Baermann ou peneiras colocadas sobre pratos para extrair os nematides das sementes. Entretanto, a escolha depende da disponibilidade de equipamentos e de materiais, quantidade de sementes e mesmo a urgncia da informao. Por meio do emprego de peneiras, um maior nmero de nematides pode ser detectado aps um dia da extrao. No caso do funil de Baermann, o tempo requerido para extrao maior, mas pode ser um mtodo mais adequado. Ambos os mtodos apresentam vantagens e desvantagens. No caso do mtodo de peneiras sobre pratos, a distncia a ser percorrida pelos nematides das sementes at a gua menor, com vantagem de que os pratos no possuem paredes inclinadas (presentes em funis) onde os nematides possam se hospedar. Tambm nesse mtodo, tem-se economia de espao e maior eficincia na extrao. Porm suspenses dos nematides obtidas nos pratos podem conter relativamente mais sujeira e detritos quando comparado s suspenses obtidas atravs de funis. Tambm no caso do prato, a elevada quantidade de espuma sobre gua pode matar os nematides. No mtodo do funil de Baermann, a suspenso de nematides pode ser coletada em ampola de vidro, onde a gua em excesso poder ser facilmente descartada aps terse concentrado a suspenso contendo os nematides. A anlise de sementes com casca ou tegumento por qualquer um dos mtodos mais simples do que para sementes descascadas manualmente. Tambm nesse caso, um nmero grande de sementes poder ser processado de uma nica vez para deteco de nematides, mesmo essa tcnica requerendo perodo maior para extrao. Assim, nessa sesso sero descritos mtodos e procedimentos para facilitar e nortear a deteco e a quantificao de nematides parasitos de plantas, que se encontram associados s sementes de espcies vegetais, assim como estimular o desenvolvimento e avaliao de outras metodologias afins.

177

MANUAL DE ANLISE SANITRIA DE SEMENTES

5.4.1 Deteco de Heterodera glycines em amostras de sementes de soja Nmero de sementes para anlise: 5 x 100 sementes Procedimentos

A deteco de cistos de Heterodera em sementes normalmente realizada pela inspeo das sementes secas, ou destas em gua. Tambm pode ser realizada atravs do mtodo de peneiramento, com ou sem flutuao em centrfuga, seguido pela anlise visual em microscpio estereoscpico (Lupa). a) Mtodo do peneiramento a seco (Tenente et al., 2000) Colocar as sementes sobre uma tela de metal (malha 0,840mm), que substituir o fundo de uma caixa tipo gerbox, sobreposta a uma tampa de caixa tipo gerbox. Entre a tela e a tampa da caixa colocase papel de filtro umedecido e em seguida, agita-se o conjunto manualmente, permitindo a passagem dos cistos pelos poros da tela, ficando estes retidos no papel umedecido. Posteriormente, as amostras devem ser analisadas sob microscpio estereoscpico (Lupa). b) Mtodo da flutuao + peneiramento (Shepherd, 1970) um mtodo simples para extrao de cistos das sementes. As sementes devem ser dispostas em proveta de 2,0L, contendo cerca de 5,0mL de gua e agitadas com movimentos rotatrios at seu completo umedecimento. Completar o volume da proveta com gua e verter os resduos e cistos flutuantes em peneira de 20 mesh (0,840mm), sobreposta em peneira de 60 mesh (0,250mm), agitando-se suavemente a proveta de modo que todo o material flutuante em suspenso seja recolhido nas peneiras e com um mnimo de perturbao das sementes. Com auxlio de pisseta deve-se recolher a suspenso contendo resduos e cistos da peneira de 60 mesh para um becker de 100mL. A suspenso recolhida no becker deve ser analisada ao microscpio estereoscpico. Para identificar a presena de cistos de Heterodera em germoplasmas introduzidos no Brasil, Tenente et al. (1994) empregaram metodologia descrita por Carvalho et al. (1953), onde as sementes foram colocadas em frascos com 50 mL de gua, os quais foram agitados durante 10 minutos. A estes adiconou-se uma soluo de sacarose (400 g/L de gua) e, novamente, agitou-se por mais 10 minutos. Aps, a suspenso foi vertida em um novo recipiente, onde permaneceu por 10 minutos. Posteriormente, a suspenso foi despejada em um filtro (papel de filtro). Aps o escoamento, o material retido no papel foi examinado. Avaliao

Fmeas de Heterodera glycines apresentam de 0,4 a 0,8mm de comprimento, forma de limo, 300600 micrmetros de dimetro, com pescoo e uma vulva subterminal prxima ao nus; so de colorao brancas ou amarelas quando imaturas, mas com a maturidade ficam pretas ou marrons.(Figura 115).

178

5 - TESTES DE SANIDADE

Figura 115 - Heterodera glycines

179

MANUAL DE ANLISE SANITRIA DE SEMENTES

5.4.2 Deteco de Aphelenchoides besseyi e Ditylenchus dipsaci em amostras de sementes de Brachiaria Quantidade de sementes para anlise: 5 x 10g de sementes

Procedimento Flutuao dos nematides em soluo de sacarose com caulim em centrfuga, e passagem por peneiras de malha de 0,037mm de abertura (400 mesh) ou 0,027mm (500 mesh), com ou sem hidratao prvia das sementes durante doze horas. Mtodo de Coolen & Dherde (1972)

As sementes so trituradas com 200mL de gua durante 10 segundos em liquidificador e a suspenso resultante da triturao coada em peneiras de 20 mesh sobre outra de 400 ou 500 mesh. Com o auxlio de jatos fortes de gua de uma pisseta, recolhe-se a suspenso de nematides mais os tecidos vegetais da peneira de 400 ou 500 mesh em um becker com capacidade para 100mL. Recolhe-se, no mximo, 40mL ou a quantidade que cabe nos tubos da centrfuga. Em seguida, verte-se a suspenso para os tubos da centrfuga onde adiciona-se 1,0g de caulim. Calibrar o volume dos tubos. Mistura-se bem com basto de vidro e procedese a centrifugao, durante 4 a 5 minutos a 1750 rpm. Aps, retira-se os tubos da centrfuga e elimina-se cuidadosamente o lquido sobrenadante. Adiciona-se a estes a soluo de sacarose (454 gramas de acar refinado dissolvidos em 750mL de gua). Misturar bem com auxlio do basto de vidro para que o pelete seja diludo. Retorna-se os tubos para a centrfuga e procede-se a centrifugao por um minuto a 1750 rpm. Deve-se tomar cuidado com o tempo de centrifugao para no provocar osmose e a morte de nematides. Aps esta operao verte-se o sobrenadante para peneira de 400 ou 500 mesh inclinada. Vertese bastante gua da torneira para eliminar o excesso de sacarose e, com o auxlio de jatos fortes de gua da pisseta, recolhe-se a suspenso em becker com capacidade para 100mL. Deste, recolhe-se 20mL para observao, identificao e contagem das espcimes (Tihohod, 1989). Favoreto et al. (2006), compararam a eficincia de mtodos para extrao de A. besseyi e D. dipsaci, em sementes de Brachiaria brizantha, e observaram que o mtodo de Coolen & Dherde (1972) sem a hidratao das sementes foi mais eficiente na recuperao dos nematides. Avaliao

A
Figura 116 - Aphelenchoides besseyi (A) e Ditylenchus dipsaci (B).

180

5 - TESTES DE SANIDADE

5.4.3 Deteco de Aphelenchoides besseyi e Ditylenchus dipsaci em amostras de sementes de Panicum Quantidade de sementes para anlise: 5 x 0,5g de sementes (@ 250 sementes) Procedimento

Para a maioria dos endoparasitas, a tcnica de triturao proporciona maior liberao e movimento em direo gua, implicando na deteco de espcimes em perodos menores de extrao. Entretanto, essa tcnica tem que estar associada a uma outra que permita clarear a amostra, como o funil de Baermann, que serve para formas vermiformes, como A. besseyi e D. dipsaci (Fortuner, 1991). A tcnica da bandeja, descrita por Whitehead & Hemming (1965), apresenta o mesmo princpio do funil de Baermann, aplicandose clareamento das amostras, porm com maior volume de gua, o que permite o aumento da oxigenao, proporcionando melhor movimento dos parasitas em direo gua, facilitando, assim, a deteco. Pr-imerso, triturao e funil de Baermann (Fortuner, 1991; Zuckermann, 1990; Hooper, 1970)

A associao destes mtodos proporciona uma melhoria considervel na recuperao de espcies que apresentam o fenmeno de dormncia e anidrobiose e de sementes de Panicum, que so envolvidas por diversas camadas externas como glumas e glumelas, eliminando a falta de oxigenao no sistema do funil de Baermann. As sementes so colocadas em pr-imerso em placas de Petri ou caixa do tipo Gerbox com gua, onde devem permanecer por 16 horas (20-25C). Decorrido este perodo, promove-se a triturao por 20 segundos do material recolhido dos recipientes (gua e as sementes). Aps, transfere-se o contedo para peneira de 20 mesh sobre outra de 400 ou 500 mesh. Com auxlio de pisseta, procede-se a lavagem e na sequncia recolhe-se a suspenso obtida na peneira de 400 ou 500 mesh para becker de 100mL. Esta suspenso, contendo os nematides e impurezas, vertida sobre um funil de Baermann, que consiste de funil cnico de vidro ou de plstico, com um tubo de borracha ligado base deste e, conectado na extremidade a uma ampola de vidro. No interior do topo do funil descansa um suporte de malha de ao ou tela plstica (peneira). Sobre a tela deve ser disposto um leno de papel tipo facial ou outro papel adequado, a fim de reter as sementes e, sobre estas adicionada gua de torneira. Decorridos de 12 a 24 horas, devese depreender a ampola de vidro do tubo de borracha ligado base do funil e, recolher-se o contedo para posterior contagem em lmina de Peters, sob microscpio tico.

181

MANUAL DE ANLISE SANITRIA DE SEMENTES

5.4.4. Deteco de Aphelenchoides besseyi em sementes de arroz Nmero de sementes para anlise: 5 x 100 sementes Procedimento

Huang & Mota Silva (1982) observaram que praticamente 100% dos exemplares viveis de A. besseyi podem ser detectados pelo mtodo de descascamento manual das sementes. No entanto, a operao muito trabalhosa e demanda um considervel suporte. Para laboratrios de sementes em grande escala, desejvel ter um suporte tcnico e econmico. So necessrias pesquisas adicionais para mecanizar o processo de descascamento das sementes sem liberar os materiais do endosperma. A mecanizao deve facilitar a deteco clnica dos nematides. Uma tarefa importante para pesquisas futuras, ento, estudar tcnicas de laboratrio para deteco satisfatria de nematides em operaes de grande escala. Mtodo do descascamento manual de sementes + funil de Baermann (Flegg; Hooper, 1970)

O mtodo consiste em eliminar a casca e a caripse das sementes aps a imerso destas em gua por determinado perodo de tempo. Este material lavado em peneira padro de 400 mesh para que sejam eliminadas as substncias leitosas liberadas pelo endosperma. O material resultante do peneiramento (nematides e restos de casca e caripse) recolhido com o auxlio de pisseta para um Becker de 100mL e, posteriormente, transferido para o funil de Baermann onde permanece pelo menos por 12-24 horas, para extrao dos nematides ativos. Pr-imerso, triturao e funil de Baermann (Garcia; Tenente, 2000)

As sementes so imersas em gua destilada (@ 30 minutos), para rehidratao dos nematides em estado de anidrobiose. Esse tratamento prvio de pr-imerso facilita a fragmentao das sementes em liqidificador, feita a seguir por 20 segundos com 300mL de gua. A suspenso resultante passada pelas peneiras de 100 (0,150 mm) e 400 mesh e o material retido disposto em funis de Baermann com gua oxigenada a 0,5%. Os sedimentos so coletados e examinados ao microscpio tico aps 24, 48 e 72 horas, aproximadamente.

182

5 - TESTES DE SANIDADE

5.4.5 Deteco de Ditylenchus dipsaci em sementes de cebola Quantidade de sementes para anlise: 5 x 50 ou 100g de sementes Procedimento

mais rpido e eficiente que as tcnicas de incubao geralmente utilizadas para tecidos vegetais. Tambm pode ser usada para recuperao de endoparasitas de folhas, hastes e tambm para deteco de juvenis de A. tritici em sementes de trigo e de outras gramneas e de D. dipsaci em sementes de trevo (Southey, 1969). Mtodo da triturao e filtrao para recuperao de endoparasitas migradores (Fallis, 1943; Stemerding, 1964)

As sementes so trituradas em gua durante 15 segundos, sendo 5 segundos para o triturador alcanar a velocidade mxima, 5 segundos permanecendo em velocidade mxima e 5 segundos para a parada. Este perodo suficiente para facilitar a sada dos nematides dos tecidos sem danific-los. Aps, a suspenso resultante vertida em um papel de filtro ou leno de papel apoiado numa peneira ou tela plstica. O conjunto disposto sobre um prato ou bandeja com gua, onde deve permanecer durante 24 a 48 horas. Os nematides separados das partculas inertes movimentam-se pelo filtro e so recuperados no prato, para posteriormente serem quantificados em lmina de Peters, sob microscpio tico.

183

MANUAL DE ANLISE SANITRIA DE SEMENTES

5.4.6 TCNICAS MOLECULARES X NEMATIDES X SEMENTES Tcnicas moleculares constituem uma ferramenta que em muito pode auxiliar na deteco e identificao de organismos de forma rpida e segura, possibilitando investigaes ao nvel de cidos nuclicos ou de produtos gnicos. Especificamente na deteco de microrganismos em sementes, as tcnicas moleculares tm sido de extrema relevncia, havendo um crescente interesse na investigao neste campo em todo o mundo. Na medida em que o controle de qualidade de sementes uma preocupao no sentido de garantir material de propagao livre de patgenos e com identidade gentica comprovada, alm de outros atributos, metodologias de preciso ganham importncia. A necessidade de desenvolver mtodos mais rpidos e confiveis para detectar patgenos associados com sementes tem sido um desafio enfrentado por pesquisadores que trabalham com controle de qualidade de sementes. Neste sentido, anlise de cidos nuclicos surge como uma alternativa importante e tem sido objeto de intensas pesquisas nas duas ltimas dcadas. Embora tcnicas moleculares tm apresentado muitas vantagens, tal desenvolvimento ainda requer precaues, posto que programas de certificao de sementes caracterizam-se por particularidades que podem limitar uma aplicao mais extensiva dessas tcnicas em anlise de rotina. Sem levar em conta os custos que, inicialmente, podem ser elevados devido a investimentos em equipamentos especializados e reagentes, alguns outros aspectos devem ser considerados em relao deteco de patgenos em extratos de sementes (Parizzi, 2002). Mtodos que empregam tcnicas moleculares para a identificao de patgenos so variveis e, principalmente, baseados em anlises de DNA genmico. Alguns trabalhos tm sido desenvolvidos com marcadores moleculares, devido necessidade de identificao rpida e segura de raas do nematide de cisto da soja, Heterodera glycines (Bertioli et al., 1998), e de espcies de Anguina e Ditylenchus, comumente transmitidos atravs de sementes, baseando-se nas sequncias do gene ribossomal ITS1 (Bertioli, 2001; Powers et al., 2001). Estes mtodos podem eliminar os problemas de ambigidade envolvendo a identificao de espcimes jovens, os quais so encontrados geralmente no interior de galhas em sementes ou resduos destas aps a germinao. Esta metodologia pode prover uma padronizao para identificao em sistemas de fiscalizao que, quando falhos, podem resultar em impactos econmicos significativos. 5.4.7 TCNICA PARA QUANTIFICAO DOS NEMATIDES Existem diferentes tcnicas para quantificao de nematides em uma suspenso final, obtida pelas tcnicas descritas anteriormente. A seguir est descrita a tcnica para quantificao mais utilizada em trabalhos de rotina em Laboratrios de Nematologia. A suspenso com os possveis nematides (mximo 20mL), contidas em beckers de 100mL, devem ser decantadas por, no mnimo, uma hora ou, ento, no fim do expediente. Durante esse tempo os beckers podem ser acondicionados na geladeira para que no dia seguinte, inicie-se a prxima etapa. Com auxilio de uma seringa com capacidade para 20mL ou mais, tendo na extremidade acoplada uma mangueira fina (a exemplo da usada em hospitais para aplicao de soro), reduz-se o volume de gua da suspenso, deixando-se apenas 4mL. A partir desse ponto a suspenso estar pronta para a contagem. Para tanto deve ser empregado uma lmina de Peters para contagem, com capacidade para 1mL. O nmero de nematides obtido atravs da multiplicao do nmero observado na lmina por 4 (os 4mL iniciais) para se obter o resultado final. Deve-se proceder contagem em trs repeties para maior consistncia da anlise. Caso no se possua uma cmara de contagem de Peters, pode-se improvisar, empregando-se caixas de plstico transparente (tampas de caixas de lamnulas para microscopia) bastando riscar-se a base da caixa para direcionar a viso durante a contagem. Sobre esta vertem-se os 4mL de suspenso e procede-se a contagem sob microscpio estereoscpico (lupa) no maior aumento. Uma desvantagem dessa improvisao que a contagem no pode ser realizada em microscpio binocular, a no ser no caso do microscpio invertido. Terminado o processo de contagem, os nematides da suspenso podem ser mortos e fixados tendo em vista guard-los para futuras observaes ou mesmo para a pescaria de exemplares para o preparo de lminas permanentes. Aps as avaliaes, o material deve ser levado para banho-maria e este mantido

184

5 - TESTES DE SANIDADE

a temperatura de 55 C. Caso no se possua esse equipamento, pode-se empregar um becker com dimetro maior, com gua aquecida a 55C, e no seu interior introduz-se o outro becker contendo as suspenses. Este deve permanecer em banho-maria durante 2 a 4 minutos, at que todos os nematides morram. Aps a morte, estes podem ser fixados imediatamente. Caso contrrio esse material ser perdido. Para a fixao pode ser empregada a formalina a 4%, em concentrao dupla (adiciona-se 4mL de formalina e formol a 4%, nos 4 mL da suspenso). Os 8mL de suspenso, assim obtidos, devem ser vertidos para vidros (capacidade para 10mL), devidamente limpos e, estes etiquetados com todos os dados sobre a suspenso: data, origem, nematides, nmero da amostra etc. Os vidros, assim preparados, podem ser guardados por anos sem que ocorra a destruio dos exemplares.

185

BIBLIOGRAFIA

MANUAL DE ANLISE SANITRIA DE SEMENTES

AFGC Protocols, Update August, 2002. Disponvel em: http//www.arabdopsis.org/portals/masc/AFGC/ RevisedAFGC/site2RnaL.htm#isolation. Acesso em 10/09/06. ALBRECHTSEN, S. E. Testing methods for seed-transmitted viruses: Principles and protocols. Cambridge, MA: CABI Publishing, 2006. 268p. ALVAREZ, A.M., BENEDICT, A.A., MIZUMOTO, C.Y., HUNTER, J.E.; GABRIEL, D.W. Serological, pathological, and genetic diversity among strains of Xanthomonas campestris infecting crucifers. Phytopathology, 84, p.1449-1457. 1994. ASMA, M. Proposal for a new method for detecting Xanthomonas hortorum pv. carotae on carrot seeds. ISTA Method Validation Reports 2, p.1-17. 2005. ASMA, M., de Vogel, R., Woudt, B. and Krause, D. Evaluation of pathogenicity testing, rep-fingerprinting and PCR for the identification of Xanthomonas campestris pv. carotae, ISHI Report Bejo Zaden BV, Research Report. p.9316-9317. 2002. AUDY, P.; LAROCHE, A.; SAINDON, G.; HUANG, H.C.; GILBERTSON, R.L. Detection of the bean common blight bacteria, Xanthomonas campestris pv. phaseoli and X. c. pv. phaseoli var. fuscans, using the polymerase chain reaction. Phytopathology, 84, p.1185-1192. 1994. BARNETT, H.L.; HUNTER, B.B.; Illustrated Genera of Imperfect Fungi. St. Paul: The American Phytopathological Society, 1998. 218 p. BERTIOLI, S.C.M.L. et al. Desenvolvimento de marcadores moleculares para a identificao de raas do nematide de cisto da soja, Heterodera glycines. Braslia: CENARGEN/Embrapa, 1998. p.1-4. (Pesquisa em Andamento). BRADBURY, J. F. 1986. Guide to Plant Pathogenic Bacteria : CAB International Mycological Institute. BRASIL. Ministrio da Agricultura e Reforma Agrria. Regras para anlise de sementes. Braslia: CLAV; DNDV; SNAD; MA, 1992. 365p. BROADBENT, L. The epidemiology of tomato mosaic. XI. Seed transmission of TMV. Annual Applied Biology, 56, p.177205. 1965. CAMPBELL, R. N. In: Descripitions of Plant Viruses. DPV name index n. 43. Photo Courtesy of R. Lastra, Instituto Venezolano de Investigaciones Cientificas, Caracas Disponivel em: http://www.dpvweb. net/dpv/showfig.php?dpvno=43&figno=08. Acesso em: 21/01/2008. CARVALHO, J.C.; LORDELLO, L.G.E.; BOOCK, O.J. Consideraes acerca do nematide dourado da batatinha. O Biolgico, 19, p.196-200. 1953. CHANG, C.J., DONALDSON, R., CROWLEY, M.; PINNOW, D. A new semi-selective medium for the isolation of Xanthomonas campestris pv. campestris from crucifer seed. Phytopathology, 81, p. 449-453. 1991. CHANG, S.; PURYEAR, J.; CAIRNEY, J. A simple and efficient method for isolation RNA from Pine Trees. Plant Molecular Biology Report, 11, p. 113-116, 1993.

188

BIBLIOGRAFIA

CLARK, M. F; ADAMS, A. N. Caracteristics of the Microplate Method of Enzyme-Linked Immunosorbent Assay for detection of plant viruses. Journal of General Virology, 34, p. 475-483, 1977. CUBETA, M.S.; KUAN, T.L. Comparison of MD5 and XCS media and development of MD5A medium for detection of Xanthomonas campestris pv. carotae in carrot seed. Phytopathology, 76, p.1109. 1986. DINANT, S.; LOT, H. Lettuce Mosaic Virus. Plant Pathology, 41, p.528-42. 1992. EDEN, P.A.; SCHMIDT, T.M.; BLAKEMORE, R.P.; PACE, N.R. Phylogenetic Analysis of Aquaspirillum magnetotacticum using Polymerase Chain Reaction Amplifi ed 16S rRNA specifi c DNA. International Journal of Systematic Bacteriology, 41, p. 324-325. 1991. ELLIS, M.B. Dematiaceous hyphomycetes. Surred: Commonwealth Mycological Institute, Commonwealth Agricultural Bureaux, CAB, 1971. 608p. FALLIS, A.M. Use of the waring blender to separate smallparasites from tissue. Canadian Journal of Public Health, 34, p.44. 1943. FATMI, M.; SCHAAD, N.W. A semi-selective agar medium for isolation of Clavibacter michiganensis subsp. michiganensis from tomato seeds. Phytopathology, 78, p.121-126. 1988. FIGUEIRA, A. R., DOMIER, L.L., DARCY, C. J. Comparison of the techniques for detection of Barley Yellow Dwarf Virus- PAV-IL. Plant Disease, 81, p. 1236-1240. 1997. GENG, S., CAMPBELL, R.N., CARTER, M.; HILLS, M. Quality control programs for seedborne pathogens. Plant Disease 67, p. 236-242. 1987. GERMAN-RETANA, S.; WALTER, J.; LE GALL, O. Lettuce mosaic virus: from pathogen diversity to host interactors. Molecular Plant Pathology, 9(2), p.127-36. 2008. GOSZCZYNSKA, T.; SERFONTEIN, J.J. Milk-Tween agar, a semiselective medium for isolation and differentitation of Pseudomonas syringae pv. syringae, Pseudomonas syringae pv. phaseolicola and Xanthomonas axonopodis pv. phaseoli. Journal of Microbiological Methods, 32, p.65-72. 1998. GUIMARES, P.M.; PALMANO, S.; SMITH, J.J.; S, M.F.G.; SADDLER, G.S. Development of a PCR test for detection of Curtobacterium flaccumfaciens pv. flaccumfaciens. Antonie van Leeuwenhoek 80, p. 1-10. 2001. HALFON-MEIRI, A.; VOLCANI, Z. A combined method for detecting Colletotrichum gossypii and Xanthomonas malvacearum in cotton seed. Seed Science and Technology, 5, p.129-139. 1977. HOCH, H. C, PROVVIDENTI, R. Ultrastructural localization of Bean common mosaic virus in dormant and germinating seeds of Phaseolus vulgaris. Phytopathology, 68, p.327-330. 1978. HUNTER, D.G., BOWYER, J.W. Cytopathology of developing anthers and pollen mother cells from lettuce plants infected by Lettuce mosaic potyvirus. Journal of Phytopathology, 145, p.521-524, 1997. INGLATERRA. Commonwealth Agricultural Bureaux. Commonwealth Mycological Institute. (CMI Description of Pathogenic Fungi and Bacteria) 1980.

189

MANUAL DE ANLISE SANITRIA DE SEMENTES

ISTA, International Seed Testing Association, Bassersdorf, Switzerland. International Rules for Seed Testing, Annexe to Chapter 7: Seed Health Testing Methods, 2008. JOHANSEN, E., EDWARDS, M.C.; HAMPTON, R.O. Seed transmission of viruses: current perspectives. Annual Review of Phytopathology, 32, p.363386. 1994. JONES, J.B.; McCARTER S.M.; GITAITIS, R.D. Detection of Pseudomonas syringae pv. tomato in tomato. In: SAETTLER, A.W.; SCHAAD, N.W.; ROTH, D.A. (eds.) Detection of bactria in seed and other planting material. APS Press. 1989. KOENRAADT, H., VAN BILSEN, J.G.P.M.; ROBERTS, S.J. Comparative test for the detection of Xanthomonas campestris pv. campestris in Brassica seeds. Seed Science and Technology, 32, p.825-835. 2005. KUAN, T.L., MINSAVAGE, G.V.; GABRIELSON, R.L. Detection of Xanthomonas campestris pv. carotae in carrot seed. Plant Disease, 69, p.758-760. 1985. LEAL-BERTIOLI, S. C. M.; BERTIOLI, D.J.; TENENTE, R. C. V. ITS Sequence of Brazilian Populations of the Plant-Parasitic Nematode Ditylenchus dipsaci. Nematologia Brasileira, 24, p.83-85. 2000. LE GALL, O. 2003. In: Descripitions of Plant Viruses. DPV name index n. 399. Photo National Vegetable Research Station, UK. Disponivel em: http://www.dpvweb.net/dpv/showfig.php?dpvno=399&figno=07. Acesso em: 21/01/2008. LIMA , B.V.; SOARES, D, J.; PEREIRA.; BARRETO, R. W. Natural infection of Acalypha hispida and Jatropha podagrica inflorescences by Amphobotrys ricini in Brazil. Australasian Plant Disease Notes, v.3, p.5-7. 2008. MACHADO, J.C.; LANGERAK, C.J.; JACCOUD-FILHO, D.S. Seed-Borne Fungi- A contribution to Routine Seed Health Analysis. International Seed Testing Association (ISTA), First edition, n.138, 2002. MARTHUR, S.B.; KONGSDAL,O. Common laboratory Seed Health Testing Methods for Detecting Fungi. Basserdorf: International Seed Testing Association, 2003. 425p. MATHUR, S.B.; CUNFER, B.M. Seed-borne Disease and Seed Health Testing of Wheat. Institute of Seed Pathology. Frederiksberg, Denmark, 1993. 168p. MCGUIRE, R.G., JONES, J.B.; SASSER, M. Tween media for the semiselective isolation of Xanthomonas campestris pv. vesicatoria from soil and plant material. Plant Disease, 70, p. 887-891. 1986. MEDINA, A. C., GROAN, R. G. Seed transmission of bean mosaic viruses. Phytopathology, 51, p.452-456. 1961. MEHTA, Y.R.; BOMFETI, C.; BOLOGNINI, V. A semi-selective agar medium to detect the presence of Xanthomonas axonopodis pv. malvacearum in naturally infected cotton seed. Fitopatologia Brasileira, 30, p. 489-496. 2005. MENG, X.Q., UMESH, K.C., DAVIS, R.M.; GILBERTSON, R.L. Development of PCR based assays

190

BIBLIOGRAFIA

for detecting the carrot bacterial leaf blight pathogen Xanthomonas campestris pv. carotae from different substrates. Plant Disease, 88, p.1226-1234. 2004. NEERGAARD, P. Seed pathology. London: MacMillan Press, v.1, 839p. 1979. ONIONS, A.H.S.; ALLSOPP, D.; EGGINS, H.O.W. Smiths Introduction to Industrial Mycology. Seventh edition, 1981, 398p. PARIZZI, P. Tcnicas moleculares aplicadas patologia de sementes. In: SIMPSIO BRASILEIRO DE PATOLOGIA DE SEMENTES, 7, 2002, Sete Lagoas, MG. Resumos e Palestras. Sete Lagoas: Embrapa Milho e Sorgo, 2002. p.183-186. POWERS,T.O., SZALANSKI, A. L.; MULLIN, P. G.; HARRIS, T. S.; BERTOZZI,T; GRIESBACH J. A. Identification of seed gall nematodes of agronomic and regulatory concern with PCR-RFLP of ITS1. Journal of Nematology, 33, p.191-194. 2001. PROVVIDENTI, R, COBB, ED. Seed transmission of Bean common mosaic virus in tepary bean. Plant Disease Reporter, 59, p.966-969. 1975. QUANTZ, L., Untersuchungen ber das gewhnliche Bohnenmosaikvirus und das Sojamosaikvirus. Phytopathology Z., 43, p.79-101. 1961. REDSTONE, S. Extraction methods for Xanthomonas campestris pv. campestris from brassica seed. Seed Science and Technology, 32, p.439-453. 2004. ROBERTS, S.J.; KOENRAADT, H. ISTA-PDC Technical report: Revised method for detection of Xanthomonas campestris pv. campestris in Brassica seed. ISTA Method Validation Reports 1, 1-9. 2003. ROBERTS, S.J., BROUGH, J., EVERETT, B.; MORALES, F. J. 1988. In: Descripitions of Plant Viruses. DPV name index n. 337. http://www.dpvweb.net/dpv/showfig.php?dpvno=337&figno=09. Acesso em: 21/01/2008. RYDER, E.J. Seed transmission of Lettuce mosaic virus in mosaic resistant lettuce. Journal of theAmerican Society for Horticultural Science, 98, p.610-614. 1973. RYDER, E. J. Transmission of common Lettuce mosaic virus through the gametes of lettuce plants. Plant Disease Reporter, 48, p.522 523. 1964. SAETTLER, A.W., SCHAAD, N.W.; ROTH, D.A. (Eds.). Detection of bacteria in seeds and other planting material. APS Press, St. Paul, Minnesota, USA. 1989. 122p. SCHAAD, N.W.; CHEONG, S.S.; TAMAKI, S.; HATZILOUKAS, E.; PANOPOULOS, N.P. A combined biological and enzymatic amplification (Bio-PCR) technique to detect Pseudomonas syringae pv. phaseolicola in bean seed extracts. Phytopathology, 85, p. 243-248. 1995.

191

MANUAL DE ANLISE SANITRIA DE SEMENTES

SCHAAD, N.W.; FRANKEN, A.A.J.M. ISTA Handbook on Seed Health Testing Working Sheet No 50 (2nd Ed): Xanthomonas campestris pv. campestris. ISTA, Zurich, Switzerland. 1996. SCHAAD, N.W.; JONES, J. B.; CHUN, W. Laboratory guide for identification of plant pathogenic bacteria. 3. ed. APS Press, St. Paul, Minnesota, USA, 2001. 373 p. SHEPHERD, A.M. Extraction and estimation of Heterodera. SOUTHEY, J. F. Laboratory methods for works with plant and soil nematodes. London: Her Majestys Stationery Office, 1970. p.23-33. (Technical Bulletin, 2). SOARES, F.M.P.; VALARINI, P.J.; MENTEN, J.O.M. Meio semi-seletivo para deteco de Pseudomonas syringae pv. tomato, agente causal da mancha bacteriana pequena do tomateiro. Revista Brasileira de Sementes, 23, p. 21-26. 2001. SOUTHEY, J. F. A gall forming nematode (Anguina sp.) parasitic on cocksfoot grass. Plant Pathology, 18, p.164-166. 1969. TAYLOR RH, GROGAN RG, KIMBLE KA Transmission of Tobacco mosaic virus in tomato seed. Phytopathology, 51, p.837842. 1961. TENENTE, R.C.V. et al. Seed health testing for nematode detection and treatment of plant germplasm in Brazil. Seed Science and Technology, Zurich, v.22, p.415-420, 1994. TENENTE, R. C. V.; LEAL-BERTIOLI, S. C. M.. ITS Sequence of Populations of the Plant-Parasitic Nematode Ditylenchus dipsaci. Nematologia Brasileira, 24, n.1, p.83-86. 2000. TENENTE, R. C. V.; VIANELLO, R. P.; PINHEIRO, F. P. Reproduo de Ditylenchus dipsaci (Kuhn, 1857) Filiqjev, 1936 em diferentes plantas hospedeiras do Brasil. Nematologia Brasileira, 24, n. 1, p.87-90. 2000. TIHOHOD, D. Nematologia Agrcola. Jaboticabal: FCAV-UNESP, 1989. v. 1, 80 p. TOSIC, M. SUTIC, D. PESIC, Z. Transmission of Tobacco Mosaic Virus through Pepper (Capsicum annuum L.). Seed, 97, p. 1-96.1980. VAN WINCKEL, A., GCYPENS, M. Inactivering van Tabakmosaiekvirus in de grond. Parasitica, 21, p.124-28. 1965. WATERS, C.M.; BALKAN, H.A. An improved semi-selectve medium for the detection of Clavibacter michiganensis subsp. michiganensis in tomato seeds. Phytopathology, 82, p.1072. (Abstract) 1992. WETTER, C. 1988. Pepper mild mottle virus. In: Description of Plant Viruses. DPV name index n. 330. Disponvel em: http://www.dpvweb.net/dpv/showfig.php?dpvno=330&figno=06. Acesso em: 21/01/2008. WILLIFORD, R.E.; SCHAAD, N.W. Agar medium for selective isolation of Xanthomonas campestris pv. carotae from carrot seeds. Phytopathology, 74, p.1142. 1984. ZAITLIN, M. 2000. Tobacco mosaic vrus (TMV). Descripitions of Plant Viruses- DPV name Index. n 370. Photo courtesy of Oscar Bradfute, Ohio State University. Disponvel em: http://www.dpvweb.net/dpv/ showfig.php?dpvno=370&figno=03. Acesso em: 21/01/ 2008.

192

NDICE REMISSIVO

MANUAL DE ANLISE SANITRIA DE SEMENTES

PATGENO Acremonium strictum Alternaria alternata Alternaria brassicae Alternaria brassicicola Alternaria dauci Alternaria helianthi Alternaria macrospora Alternaria porri Alternaria radicina Alternaria ricini Alternaria zinniae Amphobotrys ricini Aphelenchoides bessey Aphelenchoides sp. Aphelenchoides sp. Ascochyta pisi Aspergillus candidus Aspergillus flavus Aspergillus ochraceus Aspergilus glaucus Bean common mosaic virus Bipolaris sorokiniana Botryodiplodia theobromae Cercospora kikuchii Chaetomium sp. Cladosporium cladosporioides Clavibacter michiganensis subsp. michiganensis Colletotrichum gossypii Colletotrichum gossypii var. cephalosporioides

HOSPEDEIRO Zea mays Brassicae oleraceae Brassicae oleraceae Daucus carota Helianthus annuus Gossypium hirsutum Allium cepa Daucus carota Ricinus communis Helianthus annuus Ricinus communis Oryza sativa Brachiaria spp. Panicum maximum Pisum sativum Phaseolus vulgaris Triticum aestivum Gossypium hirsutum Glycine max Lycopersicon esculentum Gossypium hirsutum Gossypium hirsutum

PGINA 85 94 46 47 50 62 57 45 51 76 63 75 182 180 181 35 92 92 92 92 173 80 58 52 95 96 112 59 60

194

BIBLIOGRAFIA

Colletotrichum graminicola Colletotrichum graminicola Colletotrichum lindemuthianum Colletotrichum truncatum Curtobacterium flaccunfasciens Curvularia sp. Didymella bryoniae Ditylenchus dipsaci Ditylenchus sp. Ditylenchus sp. Drechslera oryzae Drechslera sorghicola Drechslera tritici-repentis Drechslera turcica Drechslera turcica Epicoccum purpurascens Fusarium graminearum Fusarium graminearum Fusarium oxysporum Fusarium oxysporum f.sp. phaseoli Fusarium semitectum Fusarium solani Fusarium sub-glutinans Fusarium sub-glutinans Fusarium verticillioides Fusarium verticillioides Gerlachia oryzae Heterodera glycines Lettuce mosaic virus Macrophomina phaseolina

Sorghum sp. Zea mays Phaseolus vulgaris Glycine max Phaseolus vulgaris Cucumis melo Allium cepa Brachiaria spp. Panicum maximum Oryza sativa Sorghum sp. Triticum aestivum Sorghum sp. Zea mays Triticum aestivum Zea mays Gossypium hirsutum Phaseolus vulgaris Glycine max Phaseolus vulgaris Sorghum sp. Zea mays Sorghum sp. Zea mays Oryza sativa Glycine max Lactuca sativa Glycine max

77 86 69 53 119 97 49 183 180 181 64 78 81 78 87 97 82 88 61 71 54 71 78 89 78 88 65 178 166 55

195

MANUAL DE ANLISE SANITRIA DE SEMENTES

Macrophomina phaseolina Macrophomina phaseolina Nigrospora sp. Penicillium sp. Pepper mild mottle virus Periconia sp. Peronospora manshurica Phaeoisariopsis griseola Phoma sorghina Phoma sorghina Phomopsis sojae Pseudomonas syringae pv. tomato Pyricularia grisea Pyricularia oryzae Rhizoctonia solani Rhizoctonia solani Rhizoctonia solani Rhizoctonia solani Rhizopus stolonifer Sclerotinia sclerotiorum Sclerotinia sclerotiorum Sclerotinia sclerotiorum Sclerotinia sclerotiorum Sclerotinia sclerotiorum Sclerotinia sclerotiorum Sclerotinia sclerotiorum Squash mosaic virus Stagonospora nodorum Stenocarpella macrospora Stenocarpella maydis Tilletia caries

Phaseolus vulgaris Sorghum sp. Capsicum spp. Glycine max Phaseolus vulgaris Oryza sativa Sorghum sp. Glycine max Lycopersicon esculentum Triticum aestivum Oryza sativa Glycine max Gossypium hirsutum Oryza sativa Phaseolus vulgaris Brassicae oleraceae Glycine max Gossypium hirsutum Helianthus annuus Lactuca sativa Phaseolus vulgaris Pisum sativum Cucurbita spp. Triticum aestivum Zea mays Zea mays Triticum aestivum

72 79 98 92 153 101 32 70 66 79 55 114 83 67 56 61 67 73 71 48 56 29 63 63 74 74 161 84 91 90 32

196

BIBLIOGRAFIA

Tobamovirus Tobamovirus (TMV, ToMV) Trichoconiella padwikii Trichoderma sp Trichotecium sp Ustilago tritici Xanthomonas axonopodis pv. malvacearum Xanthomonas axonopodis pv. phaseoli Xanthomonas campestris pv. campestris Xanthomonas campestris pv. vesicatoria Xanthomonas hortorum pv. carotae

Capsicum sp. Lycopersicon esculentum Oryza sativa Triticum aestivum Gossypium hirsutum Phaseolus vulgaris Brassicae oleraceae Lycopersicon esculentum Daucus carota

152 170 68 100 101 44 109 119 104 117 106

HOSPEDEIRO Allium cepa

PATGENO Alternaria alternata Aspergillus candidus Aspergillus flavus Aspergillus ochraceus Aspergilus glaucus Chaetomium sp. Cladosporium cladosporioides Curvularia sp. Epicoccum purpurascens Nigrospora sp. Penicillium sp. Periconia sp. Rhizopus stolonifer Trichoderma sp Trichotecium sp Alternaria porri

PGINA 94 92 92 92 92 95 96 97 97 98 92 101 71 100 101 45

197

MANUAL DE ANLISE SANITRIA DE SEMENTES

Allium cepa Brachiaria spp. Brachiaria spp. Brassicae oleraceae Brassicae oleraceae Brassicae oleraceae Brassicae oleraceae Capsicum sp. Capsicum spp. Cucumis melo Cucurbita spp. Daucus carota Daucus carota Daucus carota Glycine max Glycine max Glycine max Glycine max Glycine max Glycine max Glycine max Glycine max Glycine max Gossypium hirsutum Gossypium hirsutum Gossypium hirsutum Gossypium hirsutum Gossypium hirsutum Gossypium hirsutum Gossypium hirsutum

Ditylenchus dipsaci Aphelenchoides sp. Ditylenchus sp. Alternaria brassicae Alternaria brassicicola Sclerotinia sclerotiorum Xanthomonas campestris pv. campestris Tobamovirus Pepper mild mottle virus Didymella bryoniae Squash mosaic virus Alternaria dauci Alternaria radicina Xanthomonas hortorum pv. carotae Cercospora kikuchii Colletotrichum truncatum Fusarium semitectum Heterodera glycines Macrophomina phaseolina Peronospora manshurica Phomopsis sojae Rhizoctonia solani Sclerotinia sclerotiorum Alternaria macrospora Botryodiplodia theobromae Colletotrichum gossypii Colletotrichum gossypii var. cephalosporioides Fusarium oxysporum Rhizoctonia solani Sclerotinia sclerotiorum

183 180 180 46 47 48 104 152 153 49 161 50 51 106 52 53 54 178 55 32 55 56 56 57 58 59 60 61 61 29

198

NDICE REMISSIVO

Gossypium hirsutum Helianthus annuus Helianthus annuus Helianthus annuus Lactuca sativa Lactuca sativa Lycopersicon esculentum Lycopersicon esculentum Lycopersicon esculentum Lycopersicon esculentum Oryza sativa Oryza sativa Oryza sativa Oryza sativa Oryza sativa Oryza sativa Oryza sativa Panicum maximum Panicum maximum Phaseolus vulgaris Phaseolus vulgaris Phaseolus vulgaris Phaseolus vulgaris Phaseolus vulgaris Phaseolus vulgaris Phaseolus vulgaris Phaseolus vulgaris Phaseolus vulgaris Phaseolus vulgaris

Xanthomonas axonopodis pv. malvacearum Alternaria helianthi Alternaria zinniae Sclerotinia sclerotiorum Lettuce mosaic virus Sclerotinia sclerotiorum Clavibacter michiganensis subsp. michiganensis Pseudomonas syringae pv. tomato Tobamovirus (TMV, ToMV) Xanthomonas campestris pv. vesicatoria Aphelenchoides bessey Drechslera oryzae Gerlachia oryzae Phoma sorghina Pyricularia oryzae Rhizoctonia solani Trichoconiella padwikii Aphelenchoides sp. Ditylenchus sp. Bean common mosaic virus Colletotrichum lindemuthianum Curtobacterium flaccunfasciens Fusarium oxysporum f.sp. phaseoli Fusarium solani Macrophomina phaseolina Phaeoisariopsis griseola Rhizoctonia solani Sclerotinia sclerotiorum Xanthomonas axonopodis pv. phaseoli

109 62 63 63 166 63 112 114 170 117 182 64 65 66 67 67 68 181 181 173 69 119 71 71 72 70 73 74 119

199

MANUAL DE ANLISE SANITRIA DE SEMENTES

Pisum sativum Pisum sativum Ricinus communis Ricinus communis Sorghum sp. Sorghum sp. Sorghum sp. Sorghum sp. Sorghum sp. Sorghum sp. Sorghum sp. Triticum aestivum Triticum aestivum Triticum aestivum Triticum aestivum Triticum aestivum Triticum aestivum Triticum aestivum Zea mays Zea mays Zea mays Zea mays Zea mays Zea mays Zea mays Zea mays

Ascochyta pisi Sclerotinia sclerotiorum Alternaria ricini Amphobotrys ricini Colletotrichum graminicola Drechslera sorghicola Drechslera turcica Fusarium sub-glutinans Fusarium verticillioides Macrophomina phaseolina Phoma sorghina Bipolaris sorokiniana Drechslera tritici-repentis Fusarium graminearum Pyricularia grisea Stagonospora nodorum Tilletia caries Ustilago tritici Acremonium strictum Colletotrichum graminicola Drechslera turcica Fusarium graminearum Fusarium sub-glutinans Fusarium verticillioides Stenocarpella macrospora Stenocarpella maydis

35 74 76 75 77 78 78 78 78 79 79 80 81 82 83 84 32 44 85 86 87 88 89 88 91 90

200

ISBN 978-85-99851-64-7

9 788599 851647