Você está na página 1de 141

ISSN 1517-3135 Dezembro, 2004

35

Anais da I Jornada de Iniciao Cientfica da Embrapa Amaznia Ocidental

Repblica Federativa do Brasil Luiz Incio Lula da Silva Presidente Ministrio da Agricultura, Pecuria e Abastecimento Roberto Rodrigues Ministro Empresa Brasileira de Pesquisa Agropecuria Embrapa Conselho de Administrao Luis Carlos Guedes Pinto Presidente Silvio Crestana Vice-Presidente Alexandre Kalil Pires Hlio Tollini Ernesto Paterniani Marcelo Barbosa Saintive Membros Diretoria-Executiva da Embrapa Silvio Crestana Diretor-Presidente Tatiana Deane de Abreu S Jos Geraldo Eugnio de Frana Kepler Euclides Filho Diretores-Executivos Embrapa Amaznia Ocidental Aparecida das Graas Claret de Souza Chefe-Geral Sebastio Pereira Chefe-Adjunto de Administrao Jos Jackson Bacelar Nunes Xavier Chefe-Adjunto de Pesquisa e Desenvolvimento Rosngela dos Reis Guimares Chefe-Adjunto de Comunicao e Negcios

ISSN 1517-3135 Dezembro, 2004


Empresa Brasileira de Pesquisa Agropecuria Centro de Pesquisa Agroflorestal da Amaznia Ocidental Ministrio da Agricultura, Pecuria e Abastecimento

Documentos 35
Anais da I Jornada de Iniciao Cientfica da Embrapa Amaznia Ocidental

Levy de Carvalho Gomes Jos Jackson Bacelar Nunes Xavier Marcos Vincius Bastos Garcia Eduardo Lleras Prez Luadir Gasparotto Adnis Moreira

Manaus, AM 2004

Exemplares desta publicao podem ser adquiridos na: Embrapa Amaznia Ocidental Rodovia AM-010, km 29, Estrada Manaus/Itacoatiara Caixa Postal 319 Fone: (92) 621-0300 Fax: (92) 3621-0320 / 3621-0317 www.cpaa.embrapa.br sac@cpaa.embrapa.br Comit de Publicaes da Unidade Presidente: Jos Jackson Bacelar Nunes Xavier Membros: Adauto Maurcio Tavares Cntia Rodrigues de Souza Edsandra Campos Chagas Francisco Clio Maia Chaves Gleise Maria Teles de Oliveira Jos Clrio Rezende Pereira Maria Augusta Abtibol Brito Maria Perptua Beleza Pereira Paula Cristina da Silva ngelo Raimundo Nonato Vieira da Cunha Sebastio Eudes Lopes da Silva Revisor de texto: Maria Perptua Beleza Pereira Normalizao bibliogrfica: Maria Augusta Abtibol Brito Diagramao e arte: Gleise Maria Teles de Oliveira Capa: Doralice Campos Castro 1 edio 1 gravao em CD-Room (2004): 50

Todos os direitos reservados. A reproduo no autorizada desta publicao, no todo ou em parte, constitui violao dos direitos autorais (Lei n 9.610). Cip-Brasil. Catalogao-na-publicao. Embrapa Amaznia Ocidental.
Gomes, Levy de Carvalho et al. Anais da I Jornada de Iniciao Cientfica da Embrapa Amaznia Ocidental / (editado por) Levy de Carvalho Gomes et al. - Manaus: Embrapa Amaznia Ocidental, 2004. 137 p. (Embrapa Amaznia Ocidental. Documentos; 35).

ISSN 1517-3135

1. Pesquisa. 2. Cincia. I. Ttulo. II. Srie.

CDD 501
Embrapa 2004

Editores

Levy de Carvalho Gomes Bilogo, D.Sc, Embrapa Amaznia Ocidental, Rodovia AM-010, km 29, Caixa Postal 319, 69011-970, Manaus-AM, fone (92) 3621-0300. E-mail: levy@cpaa.embrapa.br Jos Jackson B. Nunes Xavier Eng. Agrn., D.Sc., Embrapa Amaznia Ocidental. E-mail: jjackson@cpaa.embrapa.br

Marcos Vincius Bastos Garcia


Eng. Agrn., D.Sc., Embrapa Amaznia Ocidental. E-mail: mgarcia@cpaa.embrapa.br Eduardo Lleras Prez Bilogo, Ph.D., Embrapa Amaznia Ocidental. E-mail: lleras@cpaa.embrapa.br Luadir Gasparotto Eng. Agrn., D.Sc., Embrapa Amaznia Ocidental. E-mail: gasparot@cpaa.embrapa.br Adnis Moreira Eng. Agrn., D.Sc., Embrapa Amaznia Ocidental. E-mail: adonis@cpaa.embrapa.br

Apresentao

O Programa Institucional de Bolsas de Iniciao Cientfica (Pibic), patrocinado pelo Conselho Nacional de Desenvolvimento Cientfico e Tecnolgico (CNPq) e pela Fundao de Amparo Pesquisa do Estado do Amazonas (Fapeam), tem por objetivo proporcionar a bolsistas vinculados a cursos de graduao a aprendizagem de tcnicas e mtodos cientficos, sob a orientao de um pesquisador qualificado, estimulando-os prtica de aes de pesquisa e desenvolvimento (P&D) para a melhoria da qualidade de vida da populao, com sustentabilidade social, econmica e ambiental. O documento evidencia o interesse dos pesquisadores em colaborar efetivamente com a qualificao dos jovens estudantes vinculados s instituies de ensino superior que atuam no Estado do Amazonas. Nesta I Jornada de Iniciao Cientfica foram apresentados 24 trabalhos relacionados aos projetos de pesquisa da Embrapa Amaznia Ocidental, nas suas 13 grandes reas de pesquisa, destacando-se o empenho e a seriedade com que a Comisso do Pibic desta Unidade, juntamente com o Comit Local de Publicaes - CLP, organizou e consolidou as informaes aqui constantes que, por sua abrangncia, so de grande importncia para todos os envolvidos no programa, principalmente para os autores, pelos conhecimentos adquiridos para sua formao acadmica e profissional. Aparecida das Graas Claret de Souza Chefe-Geral

Sumrio
BASE DE DADOS Mapeamento preditivo da distribuio de rvores matrizes no Parque Fenolgico do Distrito Agropecurio da Suframa - DAS. M. M. Ferreira, K. E. da Silva.....................9 Melhoramento das interfaces grficas e digitais dos modelos de apresentao da Embrapa Amaznia Ocidental. A.C.A. de Azevedo, V L. N. de Souza, A. das G. C. de Souza................................................................................................15 Sistema de Informao do Banco de Germoplasma de Cupuauzeiro - Sigeram. R. N. da Conceio, V. L. N. de Souza, A. das G. C. de Souza................................19 BIOTECNOLOGIA Ajustes para purificao pr-seqenciamento de produtos de amplificao de insertos de DNA de Paullinia cupana var. sorbilis utilizando exonuclease e fosfatase alcalina. C. L. Oliveira, P. C. da S. Angelo............................................23 Estabelecimento de protocolo para o cultivo in vitro do guaran [Paullinia cupana (Mart.) Ducke]. C. B. Barbosa, L. A. C. Moraes..................................................30 Variabilidade gentica de isolados de Crinipellis perniciosa. T. do P. Sotero, M. G. de Souza, P. C. da S. Angelo, K. P. de A. Bichara, J. C. da Cruz......................37 BOTNICA Pteridfitas e monocotiledneas da Amaznia Brasileira com nfase nas espcies teis. A. A. P. Piza, E. L. Prez.........................................................................41 ENTOMOLOGIA Efeito de herbicidas sobre a fauna do solo. M. P. Santana, T. B. Garcia, M. V. B. Garcia........................................................................................................47 FITOPATOLOGIA Produo de basidiocarpos de Crinipellis perniciosa e avaliao de clones de cupuauzeiro quanto a resistncia vassoura-de-bruxa. W. N. de Melo, M. G. de Souza...........................................................................................57 FITOTECNIA Caracterizao morfo-agronmica de acessos de pimenta (Capsicum sp.) nas condies de Manaus - AM. J. V. do Bomfim Neto, S. I. C. de Carvalho, F. C. M. Chaves, R. F. Berni.............................................................................62 FLORESTA Desempenho de espcies florestais para produo de lenha na regio de Iranduba AM. K. de S. Barbosa, C. R. de Souza..............................................................66

FRUTICULTURA Aspectos do comportamento da broca-do-fruto Conotrachelus sp. (Coleoptera: Curculionidae) em estdios de vida no solo. H. A. Campos, A. M. Tavares, S. L. Martins......................................................................................................71 Caracterizao fenotpica da coleo de germoplasma de cupuauzeiro na Embrapa Amaznia Ocidental. N. M. M. de Araujo, A. das G. C. de Souza...........................75 Efeito do nitrognio, do fsforo e do potssio no desenvolvimento do porta-enxerto tangerina Clepatra. I. C. de Souza, S. E. L. da Silva...........................................80 GUARAN Comprimento, densidade e resistncia estomtica de cinco clones de guaranazeiro (Paulinia cupana var. sorbilis). E. P. Silva, L. A. C. de Moraes, M. R. de Arruda..........86 MANDIOCA Caracterizao botnica e agronmica de clones de mandiocas brava e mansa na Amaznia. C. M. M. de Arajo, J. J. B. N. Xavier, M. C. Dias.................................90 Caracterizao botnico-agronmica de mandiocaba nas condies de Manaus - AM. I. O. V. L Costa, J. J. B. N. Xavier, M. C. Dias......................................................98 PISCICULTURA CL50 de permanganato de potssio e efeito da exposio concentrao subletal sobre o tambaqui (Colossoma macropomum). A. L. F. da Silva, E. C. Chagas.........102 Densidade de estocagem de juvenis de matrinx durante a recria em tanques-rede. F. R. Brando, L. de C. Gomes.....................................................................108 Efeito da taxa e freqncia alimentar no crescimento e na produtividade do tambaqui na fase de recria em tanques-redes. C. R. Silva, L. de C. Gomes...........114 Toxicidade da formalina para o tambaqui (Colossoma macropomum). L. D. de Arajo, E. C. Chagas, J. C. de O. Malta...........................................................118 PLANTAS MEDICINAIS Produo de biomassa de caapeba, em funo de pocas de colheita, nas condies de Manaus - AM. E. de A. Pena, A. C. da S. Pinto, A. M. Pohlit, F. C. M. Chaves..........................................................................................124 SOLOS Estabilidade de agregados como indicador da qualidade fsica do solo em sistemas de uso de terra da Amaznia Ocidental. C. C. Costa, G. C. Martins.........128 Determinao da densidade de partculas de diferentes solos da Amaznia. R. S. Macedo, W. G. Teixeira........................................................................132

Mapeamento preditivo da distribuio de rvores matrizes no Parque Fenolgico do Distrito Agropecurio da Suframa - DAS
Marcelo Marques Ferreira(1) e Ktia Emdio da Silva(2)
Instituto de Tecnologia da Amaznia (Utam), Av. Darcy Vargas, Manaus/AM. E-mail: marcelo@cpaa.embrapa.br; (2)Embrapa Amaznia Ocidental, Rodovia AM 010, km 29, Zona Rural, Caixa Postal 319, 69010-970. Manaus/AM. E-mail: katia@cpaa.embrapa.br
(1)

Resumo - Este trabalho foi desenvolvido no Parque Fenolgico da Embrapa Amaznia Ocidental, Km 54 da BR 174, Manaus - AM. Com intuito de se avaliar a distribuio de indivduos arbreos potenciais para rvores matrizes e sua relao com o ambiente fsico, foram demarcadas quatro parcelas de 10 x 1.000 m, onde efetuou-se o inventrio em 3,7 hectares, nas toposseqncias plat, encosta e baixio, sendo os indivduos georreferenciados no sistema de coordenadas planas UTM. Por meio da anlise fitossociolgica, determinaram-se as famlias mais representativas na rea, mediante o ndice de Valor de Importncia da Famlia (FIV). Amostras de solo para anlise qumica foram coletadas nas parcelas, no plat, encosta e baixio. Os dados foram integrados ao mapa de solos na escala de 1:50.000, determinando-se a ocorrncia predominante das espcies nas classes de solo e tambm em relao aos nveis de matria orgnica. Foram identificados 834 indivduos, 156 espcies, 113 gneros e 42 famlias, predominantes na toposseqncia plat e a classe Latossolo Amarelo. A famlia Lecythidaceae a mais representativa na rea, principalmente no plat e na encosta, demonstrando, tambm, distribuio com ampla variao nos nveis de matria orgnica, com maior nmero de indivduos nos nveis entre 12 a 20 g/kg. Termos para indexao: distribuio de espcies, fitossociologia, Sistemas de Informaes
Geogrficas- SIG.

Mapping predictive of the distribution of sedding trees in the Phenological Site of the Suframa Agropecuary District - DAS
Abstract - This work was developed in the Phenological Site of the Embrapa Western Amazon, km 54, BR 174, Manaus-AM, Brazil. The distribution of the trees with potential for seedding trees and its connect with the physical environment were evaluated. Four parcels of 10 x 1.000 m were implanted where has been maked the inventorie and got the geographic position of the trees in 3,7 ha in the toposequence top, hillside and shoal, using the coordinate system UTM. The analysis of the phytosociological inventories was used to identify the most important families in the area. Soil samples to chemicals analysis were collected in top, hillside and shoal. Data were integrated with soil database, scale 1:50.000, where has been determinated the occurrence of the trees in the class of soil and the relation with the levels of organic matter. In this work were identified 834 trees, 156 species, 113 genus and 42 families, with predominancy of the toposequence top and yellow latosoil. The most important family in the area is the Lecythidaceae, with large distribution in the top and hillside, showing has a large distribution in different levels of the organic matter, with bigger number of the trees between levels from 12 to 20 g/kg. Index terms: Species distribution, phytosociology, Geographical Information System
GIS.

Anais da I Jornada de Iniciao Cientfica da Embrapa Amaznia Ocidental, Manaus-AM, 137p., Nov. 2004

Figura 1. Localizao do Parque Fenolgico no Campo Experimental do DAS - Embrapa Amaznia Ocidental, Manaus, AM.

M. M. Ferreira

11
parcelas-

As rvores com DAP igual ou superior a 25 cm foram identificadas com plaquetas metlicas numeradas. Foram confeccionadas fichas de campo que possuam tpicos para a tabulao de azimute, distncia da linha base, distncia da linha lateral e posicionamento das rvores em relao ao caminhamento (direita/esquerda). O posicionamento geogrfico das rvores no campo foi obtido por coleta de ponto de controle com GPS e posterior uso de azimute, derivando-se, a partir dos pontos de controle, o posicionamento dos indivduos, em funo de suas distncias da linha base e lateral de cada parcela. Com o intuito de selecionar as famlias e as espcies mais representativas na rea, foram feitos clculos fitossociolgicos, utilizando-se o ndice de valor de importncia da famlia (FIV) para as trs toposseqncias, onde selecionaram-se as dez famlias com o maior FIV. Avaliou-se tambm o ndice de valor de importncia (IVI) para as espcies, utilizandose informaes sobre abundncia, rea basal, freqncia e dominncia. Realizou-se a coleta de 3 amostras simples de solo num raio aproximado de 2 metros das rvores j identificadas no inventrio, coletando-se 8 amostras em cada toposseqncia, distribudas pelas 4 parcelas, totalizando 24 amostras. As amostras foram encaminhadas ao Laboratrio de Anlise de Solos e Plantas (Lasp) da Embrapa Amaznia Ocidental, para a realizao de anlises qumicas, sendo considerados os teores de matria orgnica para as avaliaes. As informaes temticas de solos, na escala de 1:50.000 (Fonte: Convnio IPEAAOc-Suframa), foram digitalizadas para integrao s informaes obtidas por meio dos inventrios florsticos. Os dados georreferenciados (distribuio das rvores) foram integrados ao mapa de solos da rea, atravs do software Arcview-GIS e planilha eletrnica Excel.

Tabela 1. Localizao das coordenadas UTM e azimute.

Localizao das parcelas (UTM) Norte (m) Parcela Parcela Parcela Parcela 1 2 3 4 9.719.941,46 9.719.150,26 9.720.263,64 9.718.862,25 Leste (m) 833.037,30 833.154,63 833.166,20 833.236,07 Azimute 100 130 180 90

A rea em estudo possui 834 indivduos, distribudos em 156 espcies, 113 gneros e 42 famlias, na qual distribuem-se de forma que 559 indivduos encontram-se no plat, 225 na encosta e 50 no baixio (Figura 2). A anlise fitossociolgica identificou que a famlia Lecythidaceae a mais numerosa, com 147 indivduos, e as famlias menos numerosas so Anacardiaceae, Caryocaraceae, Flacourtiaceae, Mytrtaceae, Rutaceae e Sterculiaceae, com apenas 1 indivduo (Figuras 3, 4 e 5). Da avaliao do mapa de solos e da distribuio das rvores por toposseqncia encontraram-se duas classes de solos predominantes: Latossolo Amarelo com textura muito pesada, relevo ondulado, e hidromrficos indiscriminados (Figura 6). Os dados de matria orgnica analisados para a famlia Lecythidaceae demonstram que a maior parte dos indivduos pertencentes a essa famlia est distribuda em teores que variam de 12 a 20 g/kg, e considerando-se a toposseqncia, h maior distribuio dos indivduos no plat (81 indivduos), seguido pela encosta (63) e apenas 3 indivduos no baixio.

Resultados e Discusso
A partir de um ponto de controle conhecido, obteve-se o ponto de coordenada central das parcelas, no sistema de coordenadas plana UTM, zona 20, elipside SAD 69 (Tabela 1).

12

M. M. Ferreira

Lecythidaceae Sapotaceae Chrysobalanaceae 45 40 35 30 25 20 15 10 5 0


Figura 2. Nmero de indivduos por famlia (dez primeiras com maior FIV).

Moraceae Mimosaceae Vochysiaceae Fabaceae Burseraceae Caesalpinaceae Myristicaceae

Lecythidaceae Sapotaceae Mimosaceae Chrysobalanaceae 160 140 120 100 80 60 40 20 0


Figura 3. ndice de valor de importncia da famlia (FIV) para a toposseqncia plat.

Moraceae Fabaceae Caesalpinaceae Vochysiaceae Burseraceae Myristicaceae

M. M. Ferreira

13

Lecythidaceae Sapotaceae Mimosaceae 60 40 50 30 20 10 0


Figura 4. ndice de valor de importncia da famlia (FIV) para a toposseqncia encosta.

Caesalpinaceae Moraceae Fabaceae Chrysobalanaceae Myristicaceae Euphorbiaceae Olaceceae

Sapotaceae Caesalpinaceae Chrysobalanaceae Lecythidaceae Euphorbiaceae 40 35 25 30 20 15 10 5 0


Figura 5. ndice de valor de importncia da famlia (FIV) para a toposseqncia baixio.

Apocynaceae Myristicaceae Moraceae Humiriaceae Vochysiaceae

14
350

M. M. Ferreira

300
Plat 250 200 150 100 50 0
Figura 6. Distribuio dos indivduos por classe de solo nas tosseqncias plat, encosta e baixio.

Encosta Baixio

Concluses
A famlia Lecythidaceae a mais representativa da rea, seguida por Sapotaceae, Mimosaceae e Chrysobalanaceae. As menos representativas so Myrtaceae, Sterculiaceae, Rutaceae e Flacourtiaceae; A toposseqncia predominante para toda a rea o plat; A classe de solo predominante o Latossolo Amarelo, textura muito pesada; A famlia Lecythidaceae apresenta distribuio em solos com diferentes teores de matria orgnica, evidenciando boa adaptao aos diferentes nveis, mas com maior distribuio em teores entre 12 a 20 g/kg; A ausncia de base de dados temticos e cartogrficos (mapas de vegetao, geologia, drenagem, etc), em escala de maior detalhe, dificultou a gerao de informaes mais precisas e detalhadas; A ferramenta de SIG, aliada ao trabalho de campo, permite maior preciso e conhecimento da rea, auxiliando na validao dos dados temticos disponveis.

pesquisa e por ter proporcionado o contato com a pesquisa; Embrapa Amaznia Ocidental, pelo apoio para a realizao do trabalho; Ao Sipam, pela disponibilizao da infraestrutura para consolidao do trabalho; pesquisadora Ktia Emdio da Silva, pela orientao; ao tcnico de laboratrio Sebastio Sales, pelo apoio nos trabalhos de campo; e a todos que indiretamente me auxiliaram neste trabalho.

Referncias Bibliogrficas
CLARK, D. B. Los factores edficos y la distribucin de las plantas. In: GUARIGUATA, M. R.; CATAN, G. H. (Ed.) Ecologa y conservacin de bosques neotropicales. Cartago: Ediciones LUR, 2002. p. 193-322. FRANKLIN, J. Predictive vegetations mapping: geographic modeling og biospatial patterns in relation to environmental gradients. Progress in Physical Geography, v. 19, n. 4, p. 474-499, 1995. GENTRY, A. H. Tree species richness of upper Amazonian Forest. Proceedings of the National Academy of Sciences of the States of America, v. 85, n. 1, p. 156-159, 1998. RIBEIRO, J. E. L. et al. Flora da Reserva Ducke: guia de identificao das plantas vasculares de uma floresta de terra-firme na Amaznia Central. Manaus: Inpa/DIFD, 1999. 816 p.

Agradecimentos
Fapeam, pelo fornecimento da bolsa de

Melhoramento das interfaces grficas e digitais dos modelos de apresentao da Embrapa Amaznia Ocidental
Anna Carolina Azulay de Azevedo(1),Victor Leonard Nascimento de Souza(2) e Aparecida das Graas Claret de Souza(2)
Bolsista Pibic/Fapeam. E-mail: carol@cpaa.embrapa.br; (2)Embrapa Amaznia Ocidental, Rodovia AM 010, km 29, Zona Rural, Caixa Postal 319, 69010-970. Manaus - AM. E-mail: vsouza@cpaa.embrapa.br, claret@cpaa.embrapa.br
(1)

Resumo - A identidade corporativa de uma empresa percebida de acordo como ela se coloca diante do mundo. Para construo deste projeto, foram levados em considerao conceitos como simplicidade, elegncia, objetividade e, acima de tudo, clareza, em uma interface moderna, agradvel e de fcil navegao. importante criar um padro e seguir uma interface limpa, com muito equilbrio e coerncia, para se obter um resultado uniforme e consonante. Este trabalho teve como objetivo o melhoramento das interfaces grficas e digitais dos modelos de apresentao da Embrapa Amaznia Ocidental. Foram usados softwares como Flash, Dreamweaver, Corel Draw 11 e PhotoShop, para montagem e tratamento de imagens. Os principais resultados encontrados foram: apresentao visual de material de publicao; nova pgina da Embrapa; interface do sistema "Agrometeorolgico". Esses resultados mostram que possvel a empresa possuir identidade visual prpria, sem poluio visual e com padronizao. Termos para indexao: design, criatividade, website, identidade.

Upgrade of the graphic and digital interphases of presentation models at Embrapa Western Amazonia
Abstract -The corporate identity of an institution is perceived according to how it presents itself
to the public. For preparation of the proyect, concepts such as simplicity, which is synonymous with elegance, objetivity and mainly clarity will be taken into account, in a modern, attractive easy to use interphase. It is important to create a standard based on a clean, coherent and balanced interphase in order to obtain a uniform, integrated product. The objective of the proyect was to enhance the graphic and digital interphases of the presentation models of Embrapa Western Amazonia. For the construction of the site, softwares such as Flash, Dreamweaver, Corel 11 and PhotoShop, were used to prepare and treat images. The main results obtained were: visual presentation of material for publication; new homepage and interphase of the agrometereological system. The results show that it is possible for the institution to have its own visual identity without visual pollution and following the general guidelines established by Embrapa.

Index terms: design, criativity, website, identity.

Introduo
"Imagem, antes de tudo, uma identidade" (Radfahrer, 2001). A identidade de uma empresa como ela se coloca perante o mundo. Essa identidade est em todas as publicaes que saem da empresa, sejam elas folderes ou um grande web site. Para construo do novo web site, sero levados em considerao conceitos como simplicidade, que sinnimo de elegncia,

objetividade e, acima de tudo, clareza, em uma interface moderna, agradvel e de fcil navegao. "Coerncia se caracteriza por uma organizao visual do objeto em que o resultado formal se apresenta absolutamente integrado e harmonioso em relao ao seu todo" (Gomes Filho, 2000). importante criar um padro e seguir uma interface limpa, com muito equilbrio e coerncia, para se obter um resultado uniforme e consonante.

16

A.C.A.de Azevedo

necessrio admitir que design no se limita mais ao mtodo, representao, tecnologia e a qualquer outra caracterstica que no seja inerente criatividade, especialmente em seu processo. Para Munari (1987), a criatividade usada no campo do design, considerando este como modo de projetar que, embora livre como a fantasia e exato como a inveno, compreende todos os aspectos de um problema, no s a imagem como a fantasia, no s a funo como inveno, mas tambm o aspecto psicolgico, o aspecto social, econmico e humano. Isso significa que o design deve caracterizar-se como um processo completamente criativo. Para Baxter (2000), a criatividade o corao do design, em todos os estgios do projeto. Dado seu carter inovador - mesmo naqueles projetos de redesenho ou extenso de uma linha de produtos a partir de uma plataforma - a criatividade fator essencial para o sucesso do projeto, especialmente quando se trata da forma e da funo do produto. Entretanto, no se conhecem plenamente os processos da criatividade. Algumas vezes considerou-se a criatividade como sendo inata, mas alguns estudiosos da rea de psicologia afirmam que a criatividade no inata, alm de poder ser estimulada e desenvolvida. Alm dos processos da criatividade, importante destacar o uso dos tipos em uma interface, pois o maior de todos os objetivos do designer o bom senso e a criatividade bem aplicada. Ele precisa comunicar algo a algum, e tem que chamar a ateno. Segundo Jaque (2000), a parte escrita muito importante num projeto grfico, e saber utilizar de forma correta os tipos ou fontes fundamental. Alguns passos so abordados na construo de uma pgina, como o contraste, pois ela possui tamanho, peso, estrutura, forma, direo, cor. E algumas regras valem como dicas permanentes na diagramao com tipos: fontes com serifa facilitam a leitura, mas cuidado, na tela do computador as serifas podem atrapalhar, uma vez que ficam serrilhadas nos pixels. Fonte sem serifa ideal para ttulos, frases de cartaz, outdoor e textos de leitura rpida. O que cria identidade visual com o leitor a repetio, ou seja, a padronizao dos tipos, estabelecendo hierarquia, como fontes em

determinados pontos da sua pgina, como ttulos, subttulos, e em pontos estratgicos. A legibilidade um ponto fundamental, sendo muito importante saber utilizar estilos de fontes em determinados casos. As fontes desconstrudas e modernas so mais adequadas em sites modernos e jovens; j as fontes clssicas e manuscritas, muitas vezes, se adaptam melhor em sites clssicos e srios; e fontes normais e srias se encaixam perfeitamente em sites institucionais e moderados.

Material e Mtodos
Na construo da nova interface do site da Embrapa Amaznia Ocidental, foram utilizados os softwares: Macromomedia Studio MX, Dreamwaver, Flash, que servem para o desenvolvimento de pginas Web; Corel Draw 11, para a realizao de ilustraes vetoriais, edio, captura e converso de imagens; e Adobe Photo Shop, um programa que realiza tratamento de imagens. Algumas etapas do processo criativo foram usadas para a composio e desenvolvimento do projeto da nova interface do site da Embrapa, dentre elas: a inspirao, a preparao, o desenvolvimento e, ainda, o descanso. Existem tambm algumas tcnicas que foram utilizadas para acelerar esse processo: desenho, prototipagem, teste e redesenho (refinamento). Houve vrias verses do projeto; com o desenvolvimento do primeiro prottipo, foi necessrio redesenh-lo vrias vezes, at chegar ao modelo atual (Figuras 1 e 2). Esse processo uma forma de refinar as idias para alcanar um projeto aceitvel, tornando-se muito mais simples e com interface limpa e de fcil navegao.

A.C.A.de Azevedo

17

Figura 1.Interface da pgina do sistema agrometeorolgico para internet.

Figura 2. Proposta de nova interface para pgina da Embrapa Amaznia Ocidental.

Resultados e Discusso
No incio dos trabalhos estava programado apenas o estudo de tcnicas e modelos para desenvolvimento de uma nova interface do site da Embrapa Amaznia Ocidental. Contudo percebeu-se que era possvel, empregando as tcnicas estudadas, contribuir com diversos setores da Empresa, como o de editorao, apoiando a sua equipe no desenvolvimento de folderes. Mais tarde, outro processo entrou no projeto, tambm

com estudo de tcnicas de design que possibilitassem o desenvolvimento do site, agora para o sistema Agrometeorolgico (controle de dados meteorolgicos dos campos experimentais da Embrapa Amaznia Ocidental). A partir de todos os itens e conceitos utilizados, dentre eles definio de prioridades e objetivos, arquitetura da informao, navegabilidade, usabilidade, cores, fontes, resoluo de tela, prtica e tratamento de imagens, foram obtidos excelentes

18

A.C.A.de Azevedo

resultados, surgindo nova pgina da Embrapa Amaznia Ocidental, com uma interface mais limpa, clara e objetiva. Uma nova proposta para o site da Unidade, que viria a modernizar a apresentao visual da pgina na internet (Figura 2). A nova interface do sistema Agrometeorolgico (Figura 1), que um projeto da Embrapa a ser utilizado em breve, teve como principais exigncias a simplicidade e a limpeza visual (no poluio do visual), permitindo ao usurio o acesso s funcionalidades do sistema logo nos primeiros segundos de sua visualizao. Outro resultado foi a apresentao visual dos materiais de publicao da Embrapa, como os folderes para cada setor, distribudos no evento Amazontech 2003 (Figuras 3 e 4).

Agradecimentos
Em primeiro lugar a Deus; aos meus pais; e aos meus orientadores.

Referncias Bibliogrficas
BAXTER, M. Projeto de produto: guia prtico para o desenvolvimento de novos produtos. So Paulo: Edgard Blcher, 2000. 272 p. GOMES FILHO, J. Gestalt do objeto. So Paulo: Escrituras, 2000. 127 p. JAQUE, J. P. Tipografia ps moderna. 2. ed. Rio de Janeiro: Ed. Base design 2AB, 2000. 44 p. MUNARI, B. Fantasia: inveno, criatividade e imaginao na comunicao visual. Lisboa: Editorial Presena, 1987. 251 p. RADFAHRER, L. Design/Web/Design2. Rio de Janeiro: Chesterman, 2001. 505 p.

Figura 3. Folder criado para a Amazontech - Acacia mangium.

Figura 4. Folder criado para a Amazontech - Laboratrio de Entomologia.

Sistema de Informao do Banco de Germoplasma de Cupuauzeiro Sigeram


Roseane Nogueira da Conceio(1), Victor Leonard Nascimento de Souza(2) e Aparecida das G. Claret de Souza(2).
(1) Bolsista Pibic/CNPq. E-mail: roseane@cpaa.embrapa.br; (2)Embrapa Amaznia Ocidental, Rodovia AM 010, km 29, Zona Rural, Caixa Postal 319, 69010-970. Manaus - AM. E-mail: vsouza@cpaa.embrapa.br, claret@cpaa.embrapa.br

Resumo - O Banco Ativo de Germoplasma (BAG) de cupuauzeiro formado pelo conjunto das
colees de germoplasma existentes em cada Unidade da Embrapa na Regio Norte. As informaes sobre o BAG de cupuauzeiro so armazenadas de forma irregular e imprecisa, e de difcil acesso. No intuito de organizar essas informaes e torn-las disponveis aos interessados, especialmente para o programa de melhoramento gentico da cultura, este trabalho teve como objetivo o estudo de tcnicas de desenvolvimento de sistemas de informao, cujo resultado ser a criao de um sistema que armazene e processe as informaes sobre o banco de germoplasma de cupuauzeiro.

Termos para indexao: germoplasma, cupuau, base de dados.

Information System for the Amazonian Cupuassu Genebank Sideram


Abstract - The Cupuassu Active Genebank (BAG) is composed of the the germplasm collection found in each Embrapa center in the Northern region. At present, the data of the Cupuassu Genebank is maintained in an irregular, haphazard, dificult to use manner. In order to organize the available information and to make it more available to the user, especially for the breeding program, a proyect was designed to study and establish an information system to store, process and make available the information of the Cupuassu Active Genebank. Indexterms: germoplasm, cupuassu, data-base, information system.

Introduo
O Sigeram - Sistema de Informao do Banco de Germoplasma de Cupuauzeiro, ser um sistema baseado em banco de dados, centralizado e disponibilizado em carter restritivo, quando necessrio, para acesso via Internet. A alimentao do sistema dar-se- de forma descentralizada pela equipe de pesquisadores vinculados Embrapa Amaznia Ocidental e demais usurios responsveis pela sua manuteno. Eles sero os responsveis pela qualidade e veracidade das informaes introduzidas e disponibilizadas para acesso.

Material e Mtodos
No Sigeram, os usurios podero entrar com dados de germoplasma pelo prprio Web Browser, o que lhes proporcionar a comodidade de estarem em qualquer lugar. O

contedo do sistema ser restrito aos usurios cadastrados e ficar armazenado no site da Embrapa Amaznia Ocidental. Para tanto so necessrias tecnologias de desenvolvimento modernas, voltadas para o ambiente da Web e, pensando na poltica da Embrapa de utilizao de software livre, foram selecionadas ferramentas que esto disponveis gratuitamente na Internet, a saber: Postgree - Banco de dados voltado para ambiente Web, relacional, considerado um dos melhores bancos de dados livres disponveis; Java - Linguagem de desenvolvimento que proporcionar a comunicao entre usurio e base de dados; Java Script - Linguagem que poder ser usada juntamente com HTML para criao de pequenas rotinas; PHP - Linguagem de desenvolvimento que proporcionar a comunicao entre usurio e base de dados;

20

R. N. da Conceio

HTML - Linguagem de marcao que proporcionar ao usurio criar as telas e formulrios do sistema para Web. Como mtodo de anlise para criao do Sigeram, ser adotado o modelo Orientado a Objeto, por ser considerado como um modelo mais simples e de entendimento mais claro do mundo real do que outros modelos. Para o seu desenvolvimento tambm poder ser utilizada a Orientao a Objetos, por meio de aplicaes como: Java e Java Script. J para a criao da base de dados (Banco de Dados) ser utilizada a metodologia Orientada a Objeto e a Modelagem Entidade Relacionamento, que, apesar de serem dois extremos, podem dar mais consistncia ao projeto e garantir o uso de todos os recursos do banco de dados Postgree.

Resultados e Discusso
At o momento, avanou-se no desenvolvimento do sistema Agrometeorolgico (Figura 1), que uma ferramenta de apoio ao Sigeram, o qual servir tambm para outros sistemas. Trata-se de um sistema que gerencia uma base de dados com informaes sobre dados meteorolgicos dos campos experimentais da Embrapa Amaznia Ocidental, armazenando informaes, como: temperatura, umidade, precipitao,

insolao e vento. Suas principais funes podero possibilitar a consulta (Figura 2), a incluso manual de dados (Figura 3), importao direta de arquivo texto e alterao desses dados. Estes so muito importantes para estudantes, pesquisadores e at produtores, pois, atravs desses dados, observaro em que condies climatolgicas os experimentos sero estabelecidos, ou para explicar qualquer resultado positivo ou negativo das atividades desenvolvidas em campo. A base de dados do Agrometeorolgico prover algumas informaes ao Sigeram, no momento em que o usurio estiver consultando o sistema de dados, como produtividade de determinada amostra, poder saber em que experimento se deu tal desenvolvimento e ainda quais eram as condies climticas da poca, tudo isso mediante interligao entre as bases de dados. O Sigeram est em fase de levantamento de informaes e modelagem. O projeto de modelagem est em fase final. Conforme o cronograma, at dezembro esse processo dever ser finalizado e passaremos ento para a prxima etapa, a de desenvolvimento de sua aplicao.

Figura 1. Interface principal do sistema Agrometeorolgico.

R. N. da Conceio

21

Figura 2. Interface com resultado de uma consulta no sistema.

Figura 3. Interface do sistema para insero manual de dados.

22
Concluso

R. N. da Conceio

Referncias Bibliogrficas
MORALES, E. A. V. Documentao e informtica de recursos genticos. In: ENCONTRO SOBRE RECURSOS GENTICOS, 1., 1988, Jaboticabal. Jaboticabal: FCAV, 1988. p.135-147. COSTA, I. R. S. 1999. Documentao e informatizao de recursos genticos. In: SIMPSIO DE RECURSOS GENTICOS PARA AMRICA LATINA E CARIBE-SIRGEALC, 2., 1999, Braslia. Braslia: Embrapa Recursos Genticos e Biotecnologia, 1999. GOEDERT, C. O.; WETZEL, M. M. V. S.; COSTA, I. R. S. Rede de bancos de germoplasma de recursos genticos. Braslia: Embrapa Recursos Genticos e Biotecnologia, 2001. No prelo. CAJUEIRO, E. V. M.; COSTA, I. R. S; MONTEIRO, J. S. Sistema brasileiro de informao de recursos genticos. In: CONGRESSO NACIONAL DE BOTNICA, 51., 2000, Braslia. Anais... Braslia: Embrapa Recursos Genticos e Biotecnologia, 2000. p. 4.

Este trabalho est sendo de grande valia como aprendizagem, principalmente pelo volume de conhecimento envolvido. Estudar bem os processos, realizar estudos de caso no s como desenhar o barco antes de constru-lo, tambm estudar as condies martimas em que esse barco vai navegar para que se possa projet-lo com segurana. Acredita-se que, aps a concluso desse sistema, a Unidade pode armazenar todas as informaes do BAG de cupuau e, se oportuno, tambm de outras culturas. O mais importante fazer com que esse sistema tenha um mdulo de interao com o Sistema Brasileiro de Germoplasma (Sisbragem), desenvolvido pela Embrapa.

Agradecimentos
Em primeiro lugar a Deus; a meus pais e esposo; aos meus orientadores.

Ajustes para purificao pr-seqenciamento de produtos de amplificao de insertos de DNA de Paullinia cupana var. sorbilis utilizando exonuclease e fosfatase alcalina
Christiane Lopes Oliveira(1) e Paula Cristina da Silva Angelo(2).
Bolsista Pibic/CNPq. (2)Embrapa Amaznia Ocidental, Rodovia AM 010, km 29, Zona Rural, Caixa Postal 319, 69010-970. Manaus AM. E-mail: paula@cpaa.embrapa.br
(1)

Resumo - O guaranazeiro (Paullinia cupana var. sorbilis) uma planta da famlia botnica das
Sapindaceae, cuja rea de ocorrncia geogrfica abrange os Estados do Acre, Amazonas e Par, chegando at o Rio Pindar, no Estado do Maranho; a maior parte das Guianas; parte da Venezuela; Bolvia; Colmbia e Loreto, no Peru. Na Amaznia Brasileira, atualmente, muito difcil encontrar populaes naturais da espcie. , ainda, uma espcie de valor comercial pouco explorada do ponto de vista da diversidade gentica. Foi eleita como objeto de estudos do primeiro projeto da Rede da Amaznia Legal de Pesquisas Genmicas - Realgene, do qual faz parte a Embrapa. Para este primeiro projeto foram propostos o seqenciamento de at 50 mil ESTs ("expressed sequence tags") de frutos e folhas de guaranazeiro e a gerao de bibliotecas genmicas enriquecidas para loci microssatlite que devero ser seqenciadas para permitir a construo de "primers" especficos para amplificar estes loci. Neste trabalho esto descritos resultados da evidenciao do DNA clonado em plasmdio via PCR e da preparao para o seqenciamento automtico, via tratamento dos insertos amplificados com as enzimas exonuclease I (EXO) e fosfatase alcalina de camaro (SAP). Foi avaliado o nmero de seqncias com boa qualidade de leitura obtido aps o seqenciamento automtico, utilizando condies diferentes para as PCRs e quantidades diferentes das enzimas EXO e SAP.

Termos para indexao: guaran, ESTs, EXO/SAP.

Adjustment for purifying the amplification products from guanazeiro (Paullinia cupana var. sorbilis) DNA inserts using exonuclease i and shrimp alkaline phosphatase
Abstract - Guaranazeiro (Paullinia cupana var. sorbilis) is a Sapindaceae, naturally found in the Brazilian States of Acre, Amazonas, Par, and Maranho, in the region of River Pindar most of the Guyanas; part of Venezuela; Bolivia; Colombia and Loreto, in Peru. Actually in the Brazilian Amazon region it is very difficult to find native populations of this species, which genetic intraespecific diversity has not been properly explored for the improvement of commercially valuable agricultural characteristics. It was elected as the first target for REALGENE Rede da Amaznia Legal de Pesquisas Genmicas (The Genomic Research Group of the Brazilian Amazon Region) that is prompted to sequence up to 50.000 ESTs (expressed sequence tags) from fruits and leaves and to develop primers for guaranazeiro microssatelite loci. In this work are described and discussed the results attained by treating the products from amplification reactions of guaranazeiro DNA inserts with exonuclease I (EXO) and shrimp alkaline phosphatase (SAP) as a pre-sequencing purification step. The number of automatic sequenced reads with good and acceptable scores of quality counted after the application of different PCR conditions for amplification and using different EXO/SAP concentrations per purification reaction was evaluated. Index terms: guarana, ESTs, EXO/SAP.

24
Introduo

C. L. Oliveira

O guaran (Paullinia cupana var. sorbilis) uma planta trepadeira que pode atingir at dez metros de altura na mata. Quando cultivada em reas abertas, atravs de estacas, as razes so fasciculadas, sem sistema pivotante, e as plantas crescem no mximo at dois a trs metros. A inflorescncia tem forma de cacho, com cerca de 25 cm de comprimento (Faria, 2000; Souza et al., 1996). As flores so parcialmente unissexuais e apresentam simetria irregular, com cinco spalas, quatro ptalas, oito estames e trs carpelos fundidos. Flores masculinas tm ovrios rudimentares, e flores femininas apresentam estames com anteras indeiscentes. O ovrio trilocular, com um vulo por lculo, podendo ser fecundados um, dois ou os trs vulos. O estigma trfido (Escobar et al., 1984). So atribudas ao guaran, entre outras, as seguintes propriedades: estimulante, afrodisaco, ao tnica cardiovascular, desinfetante intestinal, combate a clicas, nevralgias e enxaquecas. Proposta de pesquisa aprovada pelo Conselho Nacional de Desenvolvimento Cientfico e Tecnolgico (CNPq), em dezembro de 2002, includa em ao induzida para o desenvolvimento de Projetos Genoma Regionais, previa a organizao de uma rede de laboratrios na Regio Amaznica, a Realgene, que se dedica, numa primeira instncia, ao seqenciamento do genoma funcional e gentica genmica do guaranazeiro. Devero ser seqenciadas at 50 mil ESTs ("expressed sequences tags") de frutos/sementes e folhas da planta e desenvolvidos marcadores microssatlites para utilizao no estudo da variabilidade gentica preservada no Banco de Germoplasma da Embrapa Amaznia Ocidental. Este trabalho teve como objetivo testar a purificao, com as enzimas exonuclease I e fosfatase alcalina, do DNA de guaranazeiro clonado em plasmdios, depois de amplificado por PCR, como preparao para as reaes de marcao com dideoxinucleotdeos ligados a grupos cromognicos e para o processo de seqenciamento automtico. Estes procedimentos, que se pretende sejam mais rpidos e baratos e igualmente eficientes, podero ser adotados como alternativa ao

cultivo de clulas bacterianas hospedeiras de bibliotecas de cDNA ou genmicas e extrao de plasmdios de cada clone antes da marcao e do seqenciamento automtico.

Material e Mtodos
Primeira Etapa
O lisado de clulas bacterianas hospedeiras das seqncias recombinantes de DNA foi preparado com 2 L do estoque de glicerol (30%) dos clones, previamente organizado em placas "multiwell" identificadas. Esta frao do estoque de cada clone foi aquecida a 95 oC, por 10 minutos, em 50 L de tampo TTE (Triton X-100 1%; 20 mM de Tris-HCl, pH 8,5; e 2 mM de EDTA, pH 8,0) e centrifugada, por 5 minutos, a 4.000 rpm (CYMMIT). Foram utilizados 2 L do lisado para amplificar o DNA clonado em plasmdio e o resultado foi analisado em gel de agarose a 1%. Para reao de amplificao com volume final de 25 L foram utilizados o PAR DE "PRIMERS" I (5' GTAAAACGACGGCCAG 3' e 5'- CAGGAAACAGCTATGAC - 3'), a 5 pmoles, cada; dNTPs a 0,25 mM; cloreto de magnsio a 2,5 mM e 1,5 U de Taq DNA polimerase. O termociclador (Perkin Elmer 2.400) foi programado para o ciclo I: pr-ciclo: o o 95 C, por 2 minutos; 35 ciclos de: 94 C por 40 o o segundos, 55 C por 1 minuto; 72 C por 2 o minutos e ps-ciclo: 72 C por 10 minutos e o 4 C por tempo indeterminado. Aps a evidenciao do DNA clonado utilizando PCR, os produtos de amplificao foram submetidos ao tratamento de purificao com as enzimas EXOI/SAP (exonuclease I e fosfatase alcalina de camaro, Amersham) em duas concentraes (preparo dos mix, conforme a Tabela 1). A concentrao do cloreto de magnsio foi ajustada para alcanar a concentrao tima de atividade para a fosfatase alcalina de camaro (10 mM), depois da adio aos produtos de amplificao por PCR.

C. L. Oliveira

25

Tabela 1. Mix preparados para os testes de purificao de produtos de amplificao de 24 insertos de DNA de guaranazeiro, como preparao para o processo de marcao com dideoxinucleotdeos e de seqenciamento. Embrapa Amaznia Ocidental, Manaus/AM. 2003.
Reagentes EXO I [diluda para 1U/L] SAP [1 U/L] MgCl2 [500 mM] GUA Volume total do mix Tratamento trmico Protocolo 1 (L) Protocolo 2 (L) 9,9 9,9 3,6 q.s.p.

94oC por 40 segundos, 60oC por 1 minuto, 72oC por 2 minutos; ps-ciclo: 72oC por 10 minutos e 4oC por tempo indeterminado.

Resultados e Discusso
Para seqenciar um fragmento de DNA amplificado por PCR necessrio "purificar" o produto da amplificao, eliminando o excedente de nucleotdeos e "primers" antes de executar a reao de marcao com dideoxinucleotdeos vinculados a grupos cromognicos e injeo no seqenciador automtico. O presente trabalho props, como alternativa para diminuir gastos, mo-de-obra e tempo para a obteno de seqncias marcadas, a evidenciao do DNA por PCR e utilizao de protocolos desenvolvidos para a purificao pr-seqenciamento com as enzimas exonuclease I e fosfatase alcalina de camaro. O procedimento prseqenciamento utilizado atualmente nos laboratrios da Realgene a cultura das clulas bacterianas, obteno do DNA plasmidial atravs de lise alcalina em minipreps para, s ento, realizar a marcao com os dideoxinucleotdeos vinculados a grupos cromognicos e injetar no seqenciador automtico. Durante a primeira etapa deste trabalho, observou-se um pequeno nmero de seqncias (5,26%) com qualidade boa e aceitvel de leitura, geradas pelo protocolo 1 (Tabela 1) para EXO /SAP (0,1 U de cada enzima). Utilizando-se o protocolo 2 (3,3 U de cada enzima, Tabela 1) houve um aumento no nmero de seqncias com qualidade boa e aceitvel (88,89%) geradas pelo MegaBACE (Figura 2), o que superou inclusive a quantidade de seqncias com a mesma qualidade obtida pelo cultivo de clulas bacterianas, extrao plasmidial, marcao com dideoxinucleotdeos e s ento injeo no seqenciador automtico MegaBACE (65,12%) (Figura 1).

3,0 3,0 3,6 q.s.p. 30,0

60,0

15' a 37oC e 15' a 80oC

30' a 37oC e 15' a 80oC

Para o pr-tratamento com EXO/SAP, foram adicionados a 6 L dos produtos de cada reao de amplificao dos insertos, 1 L do mix preparado para o protocolo 1, ou, a 5 L dos produtos de cada reao de amplificao, 2 L do mix preparado para o protocolo 2 e as reaes foram submetidas aos tratamentos trmicos indicados na Tabela 1. As concentraes finais das enzimas EXO/SAP nas reaes de purificao, de volume final igual a 7 L, realizadas conforme o protocolo I foram 0,1 unidade de cada uma e, nas reaes realizadas conforme o protocolo II, foram 3,3 unidades de cada uma. Prosseguiu-se com as reaes de marcao com dideoxinucleotdeos: tomou-se 5 L de cada reao de purificao descrita acima para 3 L de soluo Big Dye (Amersham) e 5 pmol de "primer", sendo o volume final de 10 L. O termociclador foi programado para as temperaturas descritas no ciclo I. As reaes de marcao foram precipitadas (1/10 volume de acetato de amnia e 2 volumes de etanol absoluto), ressuspendidas para 10 L, e parte delas foi injetada no seqenciador automtico MegaBACE (Amersham).

Segunda Etapa
Para a segunda etapa foi utilizado o PAR D E " P R I M E R S " I I : 5 ' CGTGACTGGGAAAACCCTGC - 3' e - 5' TCACACAGGAAACAGCTATGAC - 3'. Foram testados dois ciclos de amplificao: o ciclo I, descrito para a primeira etapa e o ciclo o II: pr-ciclo: 95 C, por 2 minutos; 35 ciclos de:

26

C. L. Oliveira

C. L. Oliveira

27

A fim de verificar se o problema fora causado por baixas concentraes de DNA resultante das amplificaes ineficazes (Figura 1) ou concentrara-se realmente na atividade enzimtica pouco eficiente durante a purificao, para a segunda etapa do experimento adotaram-se "primers" redesenhados com objetivo de aumentar a quantidade de DNA obtido por PCR. No entanto, estes "primers" utilizados para a segunda etapa geraram fragmentos "secundrios" em quase todas as reaes de amplificao (Figura 3), quando foi utilizado o ciclo I para o termociclador. Ento, um ciclo diferente para as PCR - ciclo II - foi utilizado para reamplificar os fragmentos gerados utilizando o ciclo I. Nas reaes de reamplificao (Figura 4) verificou-se o surgimento de um nmero ainda maior de fragmentos "secundrios", e concluiu-se que as reaes estavam contaminadas e que o DNA contaminante fora reamplificado tambm.

Figura 4. Imagem negativa do gel de eletroforese (agarose 1%) para a resoluo dos fragmentos gerados por reamplificao dos produtos de PCR mostrados na Figura 3. Foram utilizados o ciclo II do termociclador e o par de "primers" II. Observar o aumento, inesperado, do nmero de fragmentos amplificados na maioria das reaes (exemplo indicado pela seta branca). Embrapa Amaznia Ocidental, Manaus/AM, 2004.

Figura 3. Imagem negativa do gel de eletroforese (agarose 1%) para a resoluo de produtos de amplificao de insertos de DNA de guaranazeiro (clone BRS-Amazonas) contidos em lisado de clulas bacterianas, utilizando o ciclo I do termociclador e o par de "primers" II. Observar que, para a maioria dos clones, foi gerado mais de um fragmento (setas indicando fragmentos "secundrios"), o que indica que os "primers" utilizados para essas reaes no anelaram em stios nicos de um nico plasmdio. Embrapa Amaznia Ocidental, Manaus/AM, 2004.

Para minimizar o problema gerado pela contaminao, mais experimentos foram realizados tomando novas alquotas, diretamente do lisado de clulas bacterianas, para amplificaes segundo o ciclo II do termociclador utilizando o par de "primers" II. Fragmentos "secundrios" continuaram a ser percebidos, mas em nmero menor de reaes (Figura 5). A presena de mais de um fragmento amplificado em uma reao de seqenciamento certamente prejudica a qualidade da leitura pelo seqenciador automtico. Ainda assim, os experimentos foram conduzidos at a fase de seqenciamento e os testes de purificao foram realizados com 0,1; 1,5 e 3,3 U de enzimas por reao (Figura 6). O nmero de seqncias com boa qualidade e qualidade aceitvel, verificado entre reaes preparadas utilizando 0,1 U de enzimas (26,67%), foi superior ao verificado na primeira etapa (5,26%, Figura 2). O nmero de seqncias com boa qualidade ou qualidade aceitvel verificado para reaes preparadas utilizando 1,5 U de enzima foi 66,67% do total, superior que foi alcanada pela preparao para seqenciamento via cultivo de clulas e

28

C. L. Oliveira

extrao de plasmdios, na primeira etapa (65,12%, Figura 2), segundo os scores fornecidos pelo software associado ao MegaBACE. Reaes com qualidade boa e aceitvel produzidas pelo pr-tratamento com 3,3 unidades de enzima atingiram, na segunda etapa, apenas 75% das seqncias que foram lidas (Figura 6). Uma vez que a maior diferena entre as reaes tratadas com EXO/SAP na primeira etapa (Figura 1, amplificao pouco eficiente e especfica) e na segunda etapa (Figura 5, amplificao eficiente mas pouco especfica) do trabalho foi a quantidade e a qualidade dos fragmentos amplificados submetidos purificao, e j que houve tanto melhora (para reaes com 0,1 U de enzima, 5,26% na primeira etapa e 26,67% na segunda etapa) quanto piora (para reaes com 3,3 U de enzima, 88,89% na primeira etapa e 75,00% das reaes, na segunda etapa) nos resultados da segunda etapa com relao aos resultados alcanados na primeira etapa, sugere-se que o processo de purificao por tratamento com EXO/SAP seja testado novamente, quando todos os outros passos do seqenciamento - qualidade e quantidade de inserto amplificado por PCR - estiverem estabilizados.

Figura 5. Imagem negativa do gel de eletroforese (agarose 1%) para a resoluo de produtos de amplificao de insertos de DNA de guaranazeiro (clone BRS-Amazonas) contidos no lisado de clulas bacterianas, utilizando o ciclo II do termociclador e o par de "primers" II. Observar, por comparao com a Figura 3, o desaparecimento (seta preta) dos fragmentos "secundrios" em algumas das reaes e a persistncia (seta branca) desses fragmentos em outras reaes. Embrapa Amaznia Ocidental, Manaus/AM, 2004.

Figura 6. Imagem do score card gerado pelo software vinculado ao seqenciador automtico MegaBACE, indicando a qualidade das seqncias de DNA. A qualidade indicada pelas cores: vermelho = seqncia de m qualidade (interferncia na leitura no permitiu boa resoluo dos dideoxinucleotdeos marcados com grupamentos cromognicos); amarelo = seqncia com qualidade aceitvel e verde = seqncia com boa qualidade. Os fragmentos foram amplificados utilizando o ciclo II, par de "primers" II e o nmero de unidades de enzimas EXO/SAP indicadas acima dos scores. Universidade Federal do Amazonas, Manaus/AM, 2004.

C. L. Oliveira

29

Concluses
A qualidade dos produtos de amplificao para evidenciao do DNA clonado influiu diretamente no sucesso das reaes de purificao com EXO/SAP; Os resultados indicaram que a utilizao de 1,5 unidade de exonuclease e fosfatase alcalina por reao de purificao prseqenciamento foi suficiente para atingir nmero semelhante de seqncias com qualidade boa e aceitvel quele que atingido utilizando o cultivo das clulas bacterianas transformadas e a extrao de plasmdios, quando as reaes de PCR para evidenciao dos insertos que foram seqenciados eram relativamente boas; Os testes com quantidades menores que 1,5 unidade das enzimas podem apresentar melhores resultados do que os que foram aqui descritos, quando as reaes de PCR para evidenciao dos insertos que sero seqenciados estiverem aprimoradas.

laboratrio de biotecnologia vegetal da Embrapa, Jeferson Chagas da Cruz; ao Prof. Spartaco Astolfi Filho e Enedina Nogueira Assuno, por terem cedido tempo para me orientarem e fazer meu trabalho na Ufam.

Referncias Bibliogrficas
C Y M M I T . D i s p o n v e l e m : <http://www.cimmyt.org/ABC/Protocols/PC RBacterialCultureInserts>. Acesso em: 15 nov. 2004. ESCOBAR, J. R.; CORREA, M. P. F; AGUILERA, F. J. P. Estruturas florais, florao e tcnicas para a polinizao controlada do guaranazeiro. In: SIMPSIO BRASILEIRO DO GUARAN, 1., 1983, Manaus. Anais... Manaus: EMBRAPA-UEPAE de Manaus, 1984. 547 p. (EMBRAPA-UEPAE de Manaus. Documentos, 3). FARIA, J. J. P. Manual de produo do guaran. Cuiab, MT: SEBRAE, 2000. No paginado. GSC (GenomicSequencingConsortium). Disponvel em: <Http://genome.wuatl.edu/ gsc/GSC_Protocols/footer.htm>. Acesso em: 10 dez. 2001. SOUZA, A. G. C. et al. Fruteiras da Amaznia. Braslia, DF: EMBRAPA-SPI; Manaus: EMBRAPA-CPAA, 1996. 204 p. (Biblioteca Botnica Brasileira, 1).

Agradecimentos
Ao Conselho Nacional de Desenvolvimento Cientfico e Tecnolgico (CNPq), pela Bolsa e apoio financeiro ao projeto; Embrapa Amaznia Ocidental, por ter cedido instalaes e pelo fornecimento de transporte e alimentao para que a bolsista pudesse cumprir estgio; ao tcnico do

Estabelecimento de protocolo para o cultivo in vitro do guaran [Paullinia cupana (Mart.) Ducke]
Crystianne Bentes Barbosa(1) e Larissa Alexandra Cardoso Moraes(2).
(1) Bolsista CNPq/Pibic; (2)Embrapa Amaznia Ocidental, Rodovia AM 010, km 29, Zona Rural, Caixa Postal 319, 69010-970. Manaus AM. E-mail: larissa@cpaa.embrapa.br

Resumo - O desenvolvimento de protocolo que permita o cultivo do guaran in vitro poder


contribuir para a reduo dos custos de manuteno da conservao de germoplasma e ainda elevar a taxa de germinao e de sobrevivncia das plntulas obtidas por meio de seleo recorrente. Para tal, foram inoculados, em diferentes meios de cultura, explantes obtidos de mudas estabelecidas em viveiro e segmentos de sementes contendo o embrio. No estabelecimento dos explantes, o tratamento com fungicida e antibitico (benlate- 50 mg L-1 e agrimicina- 150 mg L-1) apresentou taxa de 100% de contaminao pelos microorganismos endgenos e, ainda, alta em explantes previamente estiolados (74%). A maior taxa de germinao de sementes, que, em mdia, ocorreu aos 18 dias aps a inoculao, foi de 25% (tratamento sem reguladores), sendo esse baixo valor atribudo alta taxa de contaminao (75% - 95%). As plntulas obtidas foram transferidas para meios de multiplicao, obtendo-se brotao das gemas laterais apenas nos tratamentos com quebra da dominncia apical. Houve taxa de 100% de enraizamento utilizando-se metade da concentrao dos sais do meio de -1 crescimento de Murashigue & Skoog no meio de crescimento, suplementado com 0,2 mg L de cido indol actico.

Termo para indexao: guaran, cultivo in vitro, micropropagao, melhoramento gentico.

Establishment of a protocol for the in vitro cultivation of guarana [Paullinia cupana (Mart.) Ducke]
Abstract - Establishment of a protocol for the in vitro cultivation of guarana (Paullinia cupana): the development of a protocol which enables the in vitro cultivation of guarana may contribute to the reduction the cost of germplasm maintenance and conservation as well as to increase the germination and survival rates of the seedling obtained through recurrent selection. For this purpose, expants from nursery plants and seed segments containing the embryo were inoculated in different cultivation media. In the establishment of explants, the treatment with fungicide plus -1 -1 antibiotic (benlate 50mg L and agrimicina 150 mg L ) present 100% contamination with endogenous microorganisms and 75% with explants previously etiolated. The higher rate of seed germination, which occurred in average 18 days after inoculation, was 25% (treatment without growth regulators). This value being attributed to the high contamination rate (75%-95%). The seedling obtained were transferred to propagation media, the sprouting of lateral buds having occurred only with the suppression of the apical dominance. The rooting success was 100% with the use of half the salt concentration of the Murashigue Skoog in the growing medium supplemented with 0,2 mg L-1 indolacetic acid. Index terms: guaran, in vitro culture, micropropagation, plant breeding.

C. B. Barbosa

31

Introduo
O guaran (Paullinia cupana var. sorbilis (Mart.) Ducke) uma espcie amaznica de relevante valor industrial, sendo o Brasil o nico produtor comercial de guaran do mundo, excetuando-se pequenas reas de plantio na Venezuela e no Peru. Estima-se que a produo nacional esteja em torno de 2.492 toneladas/ano, das quais o Estado do Amazonas responsvel por aproximadamente 1.300 toneladas/ano. Atualmente, quase toda a produo nacional consumida no mercado interno. Estima-se que da demanda nacional de amndoas de guaran cerca de 70% seja absorvida pelas fbricas de refrigerantes e o restante comercializado na forma de xarope, basto, p e extrato (Cravo, 2001). O guaran uma cultura cultivada por pequenos e grandes produtores, destacandose como um dos produtos de alto potencial econmico e de grande significado social no meio rural amaznico e nas outras regies produtoras (Cravo, 2001). O principal problema da cultura a baixa produtividade, obtida com o uso de gentipos no melhorados. O programa de melhoramento obteve diversos clones, propagados por enraizamento de estacas, cuja utilizao pode aumentar em at dez vezes os atuais ndices de produtividade, alm de serem gentipos com tolerncia principal doena do guaran, a antracnose (Nascimento Filho et al., 2000). O programa de melhoramento dessa espcie consta de duas linhas de pesquisas: seleo recorrente intra-especfica e selees clonais, sendo a conservao de seu germoplasma, atualmente mantido in vivo, atividade fundamental como suporte a esse programa (Atroch, 2001). A utilizao da cultura de tecidos para a conservao de germoplasma tem sido especialmente til para espcies propagadas vegetativamente, como batata (Solanum tuberosum), mandioca (Manihot esculenta) e alho (Allium sativum). Entre as vantagens do emprego dessa tcnica inclui-se a reduo dos custos e a facilidade do intercmbio de germoplasma em condies asspticas (Torres, 1998). O cultivo in vitro consiste em uma tcnica para desenvolver, em condies de

laboratrio, um segmento da planta chamado explante, partindo de um meio de cultura artificial, slido ou lquido, sob condies ambientais controladas e total assepsia. Por meio dessa tcnica possvel a obteno de uma massa desorganizada de clulas em constante diviso e elongao, denominada calo. A formao de calo detm considervel importncia como processo intermedirio na organognese, assim como em estudos de morfognese, bioqumica, citologia, gentica e etiologia de doenas nas plantas. Conforme Bottino (1981), o calo ocorre naturalmente como resposta a injrias, infestao de insetos ou patgenos, na unio de um enxerto, ou pode ainda ser induzido colocando-se um pedao de tecido vegetal dissecado em contato com um meio de cultura apropriado. Hartman et al. (1990) afirmaram que o calo produzido nos explantes cultivados in vitro, como resultado do ferimento ocorrido por ocasio da dissecao do tecido e em resposta a reguladores do crescimento endgeno ou supridos pelo meio de cultura. Segundo Pasqual (1985), teoricamente qualquer parte da planta pode ser utilizada para iniciar a cultura de tecidos, porm melhores resultados so alcanados com tecidos mais jovens e ativos, que so prontamente estimulados e tm maior potencial morfogentico. Dentre os problemas enfrentados na fase inicial de estabelecimento do explante in vitro destacam-se a contaminao e a oxidao fenlica. A contaminao pode ser por bactrias e fungos presentes na superfcie dos tecidos de folhas, gemas e segmentos nodais ou ainda por microorganismos presentes no interior dos tecidos, conhecida como contaminao endgena. Este tipo de contaminao mais freqente em explantes derivados de plantas cultivadas no campo. rgos e tecidos com contaminao endgena so de difcil desinfestao (Torres et al., 1998). A oxidao fenlica um dos srios problemas que podem dificultar o estabelecimento inicial do cultivo in vitro. A liberao de compostos fenlicos ocorre por dano causado nas clulas durante a exciso dos explantes. Algumas enzimas oxidam os fenis formando quinonas (Maier & Metzler, 1965). As quinonas so responsveis pela colorao marrom das culturas, alm de

32

C. B. Barbosa

causarem a inibio do crescimento e morte dos explantes em grande nmero de espcies (Monaco et al., 1977). Existem substncias naturais das plantas que possuem atividade antioxidante. O cido ascrbico, considerado antioxidante biolgico, est presente em altas concentraes em muitos compartimentos celulares, como o estroma dos cloroplastos (Larson, 1988). A preveno oxidao pode ser obtida ainda com o uso de cistena, outro antioxidante, ou de adsorventes como carvo ativado e polivinil pirrolidona (PVP) (Torres et al., 1998). O objetivo deste trabalho foi determinar, para a cultura do guaranazeiro, as condies para estabelecimento in vitro de explantes provenientes de mudas de viveiro e germinao in vitro de sementes obtidas de seleo recorrente.

Estabelecimento in vitro do guaranazeiro


Meio acrescido de antibitico Foram utilizados como explantes pices caulinares e segmentos nodais das mudas estabelecidas em viveiro. Esses explantes foram submetidos inicialmente a prtratamento de desinfestao por meio de imerso em Benomyl (5 g L-1), seguido do processo de assepsia na cmara de fluxo laminar, em diferentes concentraes de soluo de gua sanitria e lcool comercial. Os pices caulinares e os segmentos nodais foram seccionados em torno de 1,5 cm de comprimento inoculados em tubo de ensaio contendo 10 mL de meio. Nessa fase, foi testado o meio de cultura MS (Murashigue & Skoog, 1962), acrescido de 3% de sacarose, solidificado com 0,6% de gar, pH 5,8, 250 g -1 -1 -1 L de cido ascrbico e Benomyl (0 g L , 1 g L -1 e 2 g L ), suplementado com 6-1 -1 benzilaminopurina (BAP) (0 mg L e 0,1 g L ). O experimento teve delineamento inteiramente casualizado, em esquema fatorial 2 x 3 x 2 (dois explantes x trs dosagens de Benomyl x duas dosagens de BAP), com 15 repeties por tratamento, sendo cada tubo uma unidade amostral contendo um explante. Ao final de 15 a 20 dias, as culturas foram avaliadas quanto ao vigor e porcentagem de explantes contaminados. Explante com estiolamento induzido Fololos jovens das mudas estabelecidas na casa de vegetao receberam uma cobertura em dupla camada de TNT da cor preta para induzir o estiolamento (Karam & AlMajathoub, 2000) (Figura 1). Aps duas semanas foram coletados e imersos em soluo 5% de gua sanitria.

Material e Mtodos
Os experimentos foram desenvolvidos no laboratrio de cultura de tecidos da Embrapa Amaznia Ocidental.

Obteno de explantes
Estacas dos clones CMU 300 e CMU 613, caracterizados como clones produtivos, resistentes a antracnose e de fcil enraizamento, foram coletadas do Banco Ativo de Germoplasma localizado na Embrapa Amaznia Ocidental do km 29, Rodovia AM 010, no Municpio de Manaus-AM. As estacas foram tratadas por 20 minutos em soluo de Benomyl (50 mg L-1) e mais 20 minutos em soluo de Agrimicina (150 mg L-1) para reduzir os microorganismo endofticos. As pontas inferiores das estacas foram colocadas em contato com um hormnio enraizador (AIB 2000 ppm) e em seguida plantadas em tubetes suspensos contendo como substrato areia mais vermiculita autoclavadas (2:1). Durante o perodo em que permaneceram na casa de vegetao receberam aplicao quinzenal dos produtos comerciais Benlate 500 (4 g L-1) e Agrimicina (12 g L-1).

C. B. Barbosa
Fotos: Larissa A.C. Moraes

33

Figura 2. Parte area de sementes de guaran germinadas in vitro. Embrapa Amaznia Ocidental, Manaus-AM, 2004.

Fotos: Larissa A.C. Moraes

34
Resultados e Discusso

C. B. Barbosa

Estabelecimento in vitro do guaranazeiro


Meio suplementado com antibitico Os tratamentos utilizados no promoveram o efeito esperado, uma vez que, em 100% do experimento, no foi possvel controlar a contaminao. Comprovadamente essa espcie apresenta nmero elevado de microorganismos endofticos (Cantarin et al., 1996), o que provavelmente contribuiu para a perda total do experimento. Explante com estiolamento induzido A taxa de contaminao foi alta em todos os tratamentos (74%). O tratamento segmentos foliares na ausncia de cido ascrbico apresentou perda adicional de 10% por oxidao, indicando a necessidade de tratamento antioxidante para esse tipo de explante, uma vez que o corte facilita a liberao de compostos fenlicos, provocando oxidao e morte do tecido vegetal. Na Figura 3 esto representados os dois tipos de explantes em condies de serem subcultivados.
Fotos: Larissa A.C. Moraes

fitorreguladores indutores de germinao. Na Figura 4 pode-se notar o desenvolvimento inicial da plntula.


Fotos: Larissa A.C. Moraes

Figura 4. Embrio germinado aos 18 dias aps a inoculao. Embrapa Amaznia Ocidental, Manaus-AM, 2004.

Multiplicao in vitro de plntulas de guaran


Os tratamentos com as doses mais altas -1 -1 -1 de BAP (1 mg L , 2 mg L e 5 mg L ) mostraram sintomas de toxidez, provavelmente pela alta concentrao do regulador utilizado (Torres et al., 1998), com perda de 70% a partir do segundo subcultivo. Essa alta taxa de perda levou eliminao desses tratamentos nas etapas seguintes do trabalho. As brotaes laterais ocorreram nos tratamentos cujos pices foram decapitados, com ou sem a presena do BAP, indicando a pouca influncia desse regulador no processo de induo de multiplicao.

Figura 3. Explantes previamente estiolados, inoculados em meio MS. a) segmento de pecolo com formao de calo na extremidade (seta); b) segmento de fololo. Embrapa Amaznia Ocidental, Manaus-AM, 2004.

Enraizamento in vitro de plntulas de guaran


O tratamento com metade das concentraes dos sais de MS promoveu 100% de enraizamento (Figura 5), enquanto o tratamento MS completo foi de 0%.

Germinao in vitro de sementes de guaran


A germinao dos embries ocorreu aos 18 dias aps a inoculao, em todos os tratamentos, com percentagem de germinao mais alta (75%) no tratamento constitudo de MS acrescido de 0,5% de carvo ativado, o que demonstra que a espcie no necessita de suplementao com

C. B. Barbosa
Fotos: Larissa A.C. Moraes

35

CRAVO, M. S. Programa de pesquisa com a cultura do guaran da Embrapa Amaznia Ocidental. In: REUNIO TCNICA DA CULTURA DO GUARAN, 1., 2001, Manaus, AM. Manaus: Embrapa Amaznia Ocidental, 2001. p. 11-25. (Embrapa Amaznia Ocidental. Documentos, 16). GEORGE, E. F.; SHERRINGTON, P. D. Plant propagation by tissue culture: handbook and directory of Commercial Laboratories. Basingstone: Exegetics Limited, 1984. 709 p. HARTMANN, T. H.; KESTER, D. E.; DAVIES JR., F. T. Plant propagation: principles and practices. 5. ed. New Jersey: Englewood Cliff, 1990. 647 p.

Figura 5. Formao de uma raiz sem ramificaes secundrias. Embrapa Amaznia Ocidental, ManausAM, 2004.

Concluso
O estabelecimento in vitro do guaran poder ser obtido com menor taxa de contaminao a partir de explantes obtidos de ramos estiolados de mudas enviveiradas. possvel se reduzir o tempo de germinao de sementes de guaran em 80% com a tcnica de germinao in vitro sem a adio de reguladores de crescimento.

HUSSEY, G. Problems and prospects in the in vitro propagation of herbaceous plants. In: WITHERS, L. A.; ALDERSON, P. G. Plant tissue culture and its agricultural applications. London: Butterworths, 1986. p. 69-84. KARAM, N. S.; AL-MAJATHOUB, M. In vitro shoot regeneration from mature tissue of wild C yc l a m e n p e r s i c u m M i l l . S c i e n t i a Horticulturae, v. 86, n. 4, p. 323-333, 2000. LARSON, R. A. The antioxidants of higher plants. Biochemistry, v. 27, n. 4, p. 969-978, 1988. MAIER, V. P.; METZLER, D. M. Changes in individual date polyphenols and their relation to browning. J. Food Sci., v. 30, p. 747, 1965. LLOYD, G.; MCCOWN. B. Commercially Feasible micropropagation of mountain laurel, Kalmia latifolia, by use of shoot-tip culture. Comb. Proc. Intl. Plant Prop. Soc. v. 30, p. 421-426, 1980. MONACO, L. C. et al.. Applications of tissue culture in the improvement of coffee. In: REINERT, J.; BAJAJ, Y. P. S. Applied and fundamental aspects of plant cell, tissue, and organ culture. Berlin: Springer-verlag, 1977. p. 109-126.

Referncias Bibliogrficas
ATROCH, A. L. Principais resultados de pesquisa com a avaliao de clones de guaranazeiro no perodo de 1985 a 1994. In: REUNIO TCNICA DA CULTURA DO GUARAN, 1., 2001, Manaus, AM. Manaus: Embrapa Amaznia Ocidental, 2001. p. 2637. (Embrapa Amaznia Ocidental. Documentos, 16). BOTTINO, P. J. Methods in plant tissue culture. Kensington, Maryland: Maryland Kemtec Educational Corporation, 1981. 74 p. CANTARIN, V. G.; ASTOLFI FILHO, S.; PEREIRA, J. O. Variabilidade gentica dos fungos endofticos do guaran: In: CONGRESSO BRASILEIRO DE GENTICA DE MICROORGANISMOS, 1996, Caxambu. Anais... Caxambu: SBG, 1996. 1 CD.

36

C. B. Barbosa

MURASHIGUE, T.; SKOOG, F. A. A revised medium for rapid growth and biossays with tobacco tissue cultures. Physiologia Plantarum, v. 15, p. 473-497, 1962. NASCIMENTO FILHO, F. J.; ATROCH, A. L.; CRAVO, M. S. Melhoramento gentico do guaranazeiro, resultados de ensaios de avaliao de clones, fase produtiva 1985 a 1994. Manaus: Embrapa Amaznia Ocidental, 2000. 54 p. (Embrapa Amaznia Ocidental. Boletim de Pesquisa, 7).

PASQUAL, M. Obteno de plantas por cultura de tecidos. Informe Agropecurio, v. 11, n. 124, p. 63-68, 1985. TORRES, A. C.; CALDAS, L. S.; BUSO, J. A. Cultura de tecidos e transformao gentica de plantas. Braslia: SPI, 1998. p. 864. VASIL, I. K. Developing cell and tissue culture systems for the improvement of cereal and grap crops. Journal of Plant Physiology, Stultgart, v. 128, p. 193-218, 1987.

Variabilidade gentica de isolados de Crinipellis perniciosa


Thiago do Prado Sotero(1), Maria Geralda de Souza(2), Paula Cristina da Silva Angelo(2), Karina Pryscilla de Araujo Bichara (2) e Jeferson Chagas da Cruz(2).
Bolsista CNPq/Pibic; (2)Embrapa Amaznia Ocidental, Rodovia AM 010, km 29, Zona Rural, Caixa Postal 319, 69010-970. Manaus AM. E-mail: geralda@cpaa.embrapa.br , paula@cpaa.embrapa.br.
(1)

Resumo - O fungo Crinipellis perniciosa, nativo da Regio Amaznica, causa a vassoura-de-bruxa no cupuauzeiro, doena que vem limitando a expanso da cultura na regio. Com o objetivo de averiguar a eficincia de marcadores moleculares RAPD na deteco da diversidade gentica entre isolados de C. perniciosa, foi extrado DNA de miclios encontrados em frutos e ramos de cupuauzeiros mantidos na Embrapa Amaznia Ocidental, Manaus (AM), e de miclios isolados de cacaueiro fornecidos pela Universidade Federal de Lavras (MG). Foi tambm utilizado um isolado de Colletotrichum guaranicola. O DNA de cada isolado foi amplificado utilizando-se 8 "primers" decmeros de seqncia arbitrria, que geraram 92 bandas, das quais 89 polimrficas com o nmero mdio de l1,5 bandas RAPD por "primer". Os miclios de C. perniciosa, isolados de ramos e frutos de cupuauzeiro na Embrapa Amaznia Ocidental, apresentaram menor diversidade entre si (0,16667, 0,372555 e 0,36735) do que a que foi calculada entre estes e a mesma espcie do fungo, isolado do caucaueiro proveniente da Universidade Federal de Lavras (0,50476, 0,54455 e0,61446). O miclio de Colletrotrichum guaranicola, inserido na anlise como espcie outside, apresentou valores entre 0,67213 e 0,71053 para os ndices de diversidade de Nei & Li (1979). Termos para Indexao: cupuau, vassoura-de-bruxa, fitopatologia.

Genetic variability of isolated of Crinipellis perniciosa


Abstract - Crinipellis perniciosa a native fungus from Amazon region, causes witches' broom in cupuau trees. That desease has been limiting the development of that culture in the region. Aiming to inquire if RAPD marks would be capable to detect genetic diversity among the isolate of Crinipellis perniciosa; DNA was extracted from mycelium found in fruits and branches of cupuau maintained in Embrapa Amaznia Ocidental from isolate mycelium from cocoa provided from Federal University of Lavras. It was either used an isolate of Colletotrichum guaranicola. The DNA from each isolate was amplified, been used 8 arbitrary sequency "primers", that generated 92 bands, 89 been polymorfic with an average of 11, 5 bands per "primer". Mycelim from Crinipellis perniciosa isolate from branches and fruits of cupuau trees in Embrapa Amaznia Ocidental presented less diversity among itselves (0,16667; 0,372555; and 0,36735) that what was calculated for these ones and the same specie of fungus, isolated from cocoa, from Federal University of Lavras (0,54076; 0,54455 and 0,61446). Colletotrichum guaranicola's mycelium, inserted at the analyses as "outside" specie, presented values among 0,67213 e 0,71053 for tables of diversity by Sorenso/Nei & Li (1979).
Index terms: cupuau, witches' broom, phytopathology.

T. do P. Sotero

39

Tabela 1. Meio de cultura lquido de Mills, Sreenivasaprasad e Bronn (1994).


Ingredientes Extrato de levedura Glicose (NH4)2HPO4 KCL MgSO4.7H2O CuSO4.7H2O ZnSO4.7H2O Quantidades necessrias para 1 5g 10 g 1g 0,2 g 0,2 g 1 ml(5% P/V) 1 ml(5% P/V)

30 segundos; 33C por 45 segundos; 72C por 45 segundos e ps-ciclo - 72C por 7 minutos. A eletroforese foi realizada a 120 V/250 mA, por 2 horas. Os padres de RAPD foram registrados utilizando cmera digital Kodak e aplicativos do mesmo fornecedor. O aplicativo GENES (Cruz, 2001) foi utilizado para o clculo dos ndices de diversidade de Nei e Li/Sorenson.

Resultados e Discusso
Para o estudo da diversidade gentica dos isolados de Crinipellis perniciosa do cupuau, cacau e do Colletrotrichum guaranicola, utilizaram-se 8 "primers" decmeros de seqncia arbitrria, os quais geraram 92 bandas, sendo 89 polimrficas e 3 monomrficas, com o nmero mdio de l 1,5 marcadores por "primer" (Figura 1), o que est dentro do esperado, pois outros trabalhos realizados com mesma espcie de fungo apresentaram nmeros semelhantes de bandas por "primer" (Niella, 2000}.

O miclio produzido foi macerado em diferentes almofarizes, sendo pesados 3 g de miclio de cada isolado, enquanto midos, submersos em nitrognio lquido. Posteriormente, adicionaram-se 700 ul de tampo de extrao a esta quantidade de miclio, aps a macerao, (Tabela 2) - Doyle & Doyle (1987), modificado por Ferreira et al. (1998). Tabela 2. Soluo tampo de extrao CTAB.
Ingredientes Quantidades 2g 2% CTAB 8,12 g 1,4 M NaCl 4 ml de um estoque 0,5 m 20 mM EDTA 10 ml de um estoque 1 m 100 mM Tris-HCl pH 8,0 1g gua q.s.p 100 ml 1,0% polyvinylypyrrolidone 2 ul/ml de tampo 0,2% 2-mercaptoetanol (adicionar antes do uso)

O precipitado foi ressuspendido em 100 ul de tampo TE pH 8,0 (10 mM Tris-HCl e 1 mM EDTA), contendo 10 ug/ml de RNAse e incubados a 37C por 30 minutos para ingesto de RNA, quantificados por espectrofotometria e em seguida armazenado a 20C . Condies de PCR para gerao de fragmentos RAPD: As reaes de PCR foram preparadas com 0,1% de BSA, 2 mM de MgCl2, 400 uM de dNTPs, 400 nM de "primer" decmero, 1,5 U de Taq DNA polimerase e 10 ng de DNA, em 25 ul de volume final de reao. Foram utilizados 8 "primers" de seqncia: 5'-AAT CGG GCT G3'; 5'-AGG GAA CGA G-3'; 5'-ACT TCG CCA C-3'; 5'-CTT CCG CAG T-3'; 5'-CCA GAT GCA C-3'; 5'-GGT TGT ACC C-3'; 5'-ACT TCG CCA C-3' e 5'-ACC CGA CCT G-3'. O termociclador foi ajustado para: pr-ciclo 94C por 5 minutos; 35 ciclos de - 94 C por

Figura 1. Padres de RAPD gerados para fungos das espcies Crinipellis perniciosa e Colletotrichum guaranicola, em gis de agarose 1,5%. 1 a 5: primer 1; 6 a 10: primer 2; 11 a 15: primer 3; 16 a 20: primer 4; 21 a 25: primer 5; 26 a 30: primer 5; 31 a 35: primer 7; 36 a 40: primer 8. 1, 6, 11, 16, 21, 26, 31 e 36: miclio polisprico isolado do fruto do cupuauzeiro; 2, 7, 12, 17, 22, 27, 32 e 37: miclio polisprico isolado do ramo do cupuauzeiro; 3, 8, 13, 18, 23, 28, 33 e 38: miclio polisprico isolado do basidiocarpo do cupuauzeiro; 4, 9, 14, 19, 24, 29, 34 e 39: miclio polisprico isolado na Universidade de Lavras; 5, 10, 15, 20, 25, 30, 35 e 40: miclio de Colletotrichum guaranicola (Embrapa Amaznia Ocidental Manaus/2004).

Pteridfitas e monocotiledneas da Amaznia Brasileira com nfase nas espcies teis


Adriana Arajo Pompeu Piza(1) e Eduardo Lleras Prez(2)
Centro Universitrio Nilton Lins, Av. Prof. Nilton Lins, 3.259, CEP 69058-040, Manaus, AM. E-mail: apiza@cpaa.embrapa.br; Embrapa Amaznia Ocidental, Rodovia AM 010, km 29, Zona Rural, Caixa Postal 319, 69010-970. Manaus - AM. E-mail: lleras@cpaa.embrapa.br.
(2) (1)

Resumo - Este trabalho faz parte do projeto Pibic "Plantas teis da Amaznia Brasileira, com nfase no Estado do Amazonas". Teve como objetivo contribuir para a disponibilizao da informao sobre plantas teis, completando e revisando a base de dados PlantAmaznia. Foram revisadas e completadas as bases de dados para pteridfitas, gimnospermas e monocotiledneas quanto a sinnimos, pases de ocorrncia, usos e grau de freqncia de ocorrncia na natureza, com base no nmero de coletas. Para isso foi consultada a literatura e as bases de dados dos Jardins Botnicos de Missouri e Nova Iorque, e do International Plant Nomenclature Index, e as informaes foram incorporadas base de dados de plantas da Amaznia. Os resultados obtidos neste trabalho contribuem para esclarecer alguns pontos sobre o conhecimento da diversidade vegetal na Amaznia. Ficou claro que ela no desconhecida e no devemos esperar muitas novidades em termos de espcies novas. Por outro lado, a flora til no a mais comum, o que contradiz a idia de que nossos antepassados simplesmente utilizaram as espcies mais comuns. Tambm sugere que no vamos aumentar muito nosso acervo de espcies teis - estas j foram encontradas. Tambm foi mostrado que pelo menos para monocotiledneas, a flora amaznica no nem muito maior nem mais importante que as floras do restante do Pas. Termos para indexao: Plantas teis, diversidade, raridade.

Pteridophytes and monocots of Brazilian Amaznia with emphasis on useful species.


Abstract - The purpose of this research was to contribute to the knowledge of the flora of Amazonia, especially its useful species. The databases for pteridophytes, gimnosperms and monocots were revised and completed in terms of synonymy, ocurrence, uses and rarity in nature based on number of exsicata in collections. Literature and the databases of the Missouri and New York Botanical Gardens, as well as the International Plant Nomenclature Index, were surveyed, and the information inserted in the database on plants of Amazonia. Our results help elucidate some questions on plant diversity in Amazonia. It is clear that the Flora of Amazonian is fairly well known, and that we should not expect many new species. Furthermore, the useful species are not the most common ones, negating the idea that our ancestors simply use what was most available. It also suggests that we will not find many new useful species they have already been found. It was also shown that at least for monocots, the flora of Amazonia in neither much larger nor more important than those of the rest of the country. Index terms: Useful plants, diversity, rarity.

42
Introduo

A. A. P. Piza

Os dados sobre o tamanho e composio da flora brasileira so muito divergentes, com estimativas que variam entre 35 mil (dcada de 1970) a 56 mil (dcada de 1990) espcies, com estimativas para a Regio Amaznica variando entre 17 (Gentry, 1997) e 60 mil (Salati, 1983), sendo a mais citada em torno de 30 mil (McNeely et al., 1990). O levantamento dos herbrios regionais indica que o tamanho da flora da Amaznia Brasileira no deve ultrapassar 11 mil espcies, com cerca de 90% ocorrendo tambm em outros pases e/ou biomas, o que sugere ser a estimativa de Gentry a mais prxima da realidade (Lleras et al., 2000a). A informao sobre espcies vegetais com uso conhecido na Amaznia que possam ser incorporadas ao processo produtivo tambm apresenta grande variao. Alguns levantamentos na Amaznia Peruana, a regio melhor estudada neste sentido, citam apenas 1.250 espcies (Vsquez, 1989), com estimativas de pouco mais de 2 mil para a Amaznia como um todo (Bennett, 1992; UNDP, 1992; Duke & Vsquez, 1994). No outro extremo, outros autores citam mais de 5 mil somente para o Peru (CADMA, 1994). Para a Amaznia Brasileira, Giacometti & Coradin (1990) reportaram menos de 800 espcies com uso conhecido. Porm, pesquisas em andamento indicam que este nmero pode aproximar-se ao da Amaznia peruana (Leite et al., 2000; Lleras et al., 2000b). Como no caso da flora em geral, a grande maioria da flora til ocorre em outras regies e pases, alm do Brasil. O objetivo deste trabalho foi contribuir para o conhecimento, sistematizao e disponibilizao da informao sobre plantas teis da Amaznia com nfase no Estado do Amazonas, completar e revisar a base de dados e determinar a ocorrncia (grau de raridade) das espcies teis.

nmero de amostras, sinnimos e grau de raridade. Para testar a idia de que a Amaznia regio onde existem mais espcies endmicas e que merece maior ateno em termos de proteo contra biopirataria, foi criada uma base de dados para as monocotiledneas do Brasil, compilando as informaes de PlantAmaznia, o levantamento do Cerrado realizado pela Embrapa em parceria com a UnB e a base de dados "Plants of Northeast Brazil" disponibilizada na Internet pelo Jardim Botnico de Nova Iorque. Foi feito levantamento do uso de fruteiras nativas vs. exticas em pequenas propriedades na regio geoeconmica de Manaus. Para confirmar que as espcies nativas esto perdendo espao no mercado para as espcies exticas foi realizado um levantamento em 80 stios em um raio de 100 km de Manaus, incluindo os Municpios de Presidente Figueiredo, Manacapuru, Novo Airo, Iranduba e Itacoatiara. A documentao fotogrfica das espcies teis (fruteiras) foi realizada utilizando cmera fotogrfica digital para material vivo e obteno de imagens via internet de material de livre acesso e utilizao. Todos os dados obtidos foram includos na base de dados PlantAmaznia e compatibilizados em planilhas especiais do Excel, as informaes adicionais, como fotografias e mapas foram includos individualmente. Foram montadas tabelas com o nmero de espcies e indivduos de cada uma, dividindo-as no grupo de frutas exticas e nativas, segundo observao feita em campo de pesquisa, e confeccionados grficos demonstrando o ndice de raridade/freqencia das espcies teis, e a taxa de coleta de amostras entre 1753 e 2000.

Resultados e Discusso
Para confirmar que a flora amaznica relativamente bem conhecida, e no futuro somente coletaremos raridades, foi completada e revisada a lista de monocotiledneas da base de dados. Embora a maioria das coletas na regio tenha sido realizada nos ltimos 40 anos, o nmero de espcies novas muito pequeno, e a taxa de publicao de novas espcies de monocotiledneas vem diminuindo a cada ano (Figura 1). Como de se esperar, nos ltimos 20 anos somente tm sido publicadas espcies consideradas entre raras e extremamente raras (Figura 2).

Material e Mtodos
Foi realizado um levantamento de literatura onde foram consultadas obras nas bibliotecas locais (Embrapa, Inpa e universidades), e bases na internet (Jardim Botnico de Missouri e Nova York), com informaes sobre espcies teis. Foram utilizadas listas de espcies teis encontradas na Amaznia, registrados e revisados seus pases de ocorrncia, ano de publicao,

A. A. P. Piza

43

Nmero de Espcies

Dcada publicao

Figura 1. Taxa de publicao de novas espcies de monocotiledneas entre 1753 e 2000. A faixa avermelhada representa o intervalo com maior nmero de coletas absolutas.

140 130 120

Nmero de espcies publicadas

110 100 90 80 70 60 50 40 30 20 10 0 1780 1800 1820 1840 1860 1880 1900 1920 1940 1960 1980 2000 Data de publicao E. raro M. raro Raro Mdio Freqente M. Freqente E. Freqente

Figura 2. Nmero de espcies publicadas entre 1753 e 2000, conforme o grau de raridade encontrado nos herbrios.

Atualmente muitos cientistas aceitam a hiptese de que a maioria das espcies utilizadas pelo homem de reas perturbadas vizinhas s vivendas, e de ampla distribuio. Para testar a hiptese de que as espcies teis tendem a ser freqentes e de ampla distribuio, foi estudada a freqncia de algumas categorias de espcies teis -

ornamentais, aromticas e medicinais. Para as famlias estudadas, os resultados mostram que a maioria dessas espcies so raras (Figura 3).

44

A. A. P. Piza

Figura 3. ndice de raridade para monocotiledneas aromticas, medicinais e ornamentais.

A. A. P. Piza

45

A comparao do uso e oferta de espcies de fruteiras nativas e exticas pode ser observada na Tabela 1. Constatou-se que as plantaes de espcies nativas so muito menores que as de espcies exticas. O mesmo se observou no levantamento de oferta realizado em supermercados, feiras e mercados de Manaus e do interior.
Tabela 1. Ocorrncia de espcies nativas e exticas de fruteiras nas mos de produtores e no comrcio. Nativas N de N de espcies indivduos 29 7 3 41.201 Exticas N de N de espcies indivduos 29 94 16 243.558 -

Local visitado Stios e chcaras (82) Supermercados (4) Mercado Central

O total de monocotiledneas do Brasil deve estar em torno de cinco mil espcies, das quais aproximadamente 40% so encontradas exclusivamente no Brasil e 60% compartidas com outros pases. O Cerrado e o Nordeste (que alm da Mata Atlntica, inclui a Regio Sul) apresentam entre 70% e 80% de espcies exclusivamente encontradas no Brasil, enquanto que na Amaznia este nmero no passa de 20%. Como de se esperar, as espcies comuns s trs regies ocorrem tambm em outros pases (Figura 4). Estes resultados apiam a idia de alguns tcnicos do Ministrio do Meio Ambiente (MMA) de que devemos nos preocupar mais em proteger o Cerrado e a Mata Atlntica que a Amaznia.

Figura 4. Ocorrncia de espcies de monocotiledneas nas diferentes regies do Brasil. Encontradas: Azul: Somente no Brasil; Roxo: Brasil e outros pases. A: Amaznia; C: Cerrado; N: Nordeste; AC: Amaznia e Cerrado; ACN: Amaznia, Cerrado e Nordeste.

46
Concluses

A. A. P. Piza

Os resultados obtidos neste trabalho contribuem para esclarecer alguns pontos sobre o conhecimento da diversidade vegetal na Amaznia. Em primeiro lugar, fica claro que a diversidade no desconhecida; ao contrrio, no devemos esperar muitas novidades em termos de espcies novas. A flora til, por sua vez, no a mais comum, o que contradiz a idia de que nossos antepassados simplesmente utilizaram o que era mais comum. Como ltima concluso, a flora amaznica, apesar de ser maior, no mais importante que as floras do restante do pas.

GENTRY, A. H. et al. Regional overview: South America. In: DAVIS, S.D. et al. Centres of plant diversity. A guide and strategy for their conservation. v. 3. The Americas. Oxford, U.K.: WWF/IUCN & Information Press, 1997. p. 269-307. GIACOMETTI, D.; CORADIN, L. Recursos genticos da Amaznia. Braslia: EMBRAPACENARGEN, 1990. 89 p. LEN, J. Botnica de los cultivos tropicales. San Jos: IICA, 1987. 445 p. LEITE, A. M. C. et al. Checklist das principais espcies aromticas amaznicas - parte I. In: FOREST 2000. Rio de Janeiro, RJ: Instituto Ambiental Biosfera, 2000. p. 259-260. LLERAS, E. et al. Diversidade vegetal na Amaznia: estado da arte. In: REUNIO DO GA-BCDAM, 6., 2000, Manaus. Publicao eletrnica. 2000. 9 p. LLERAS, E. et al. Definio de reas de alta diversidade vegetal e endemismos na Amaznia Brasileira. Relatrio Final para FAO. Braslia: EMBRAPA-CENARGEN, 1992. 65 p. LLERAS, E. et al. Principais espcies madeireiras da Amaznia - parte I. In: FOREST 2000. Rio de Janeiro, RJ: Instituto Ambiental Biosfera, 2000. p. 414-415.

Agradecimentos
Embrapa Amaznia Ocidental e ao CNPq pelo apoio a este projeto.

Referncias Bibliogrficas
CLEMENT, C. R. 1492 and the loss of Amazonian crop genetic resources. I. The relation between domestication and human population decline. Economic Botany, v. 53, n. 2, p. 188-202, 1999. DUKE, J. A.; VSQUEZ, R. Amazonian ethnobotanical dictionary. Boca Raton, Florida: CRC Press, 1994. 215 p.

Efeito de herbicidas sobre a fauna do solo


Mirne Passos Santana(1), Terezinha Batista Garcia(2) e Marcos Vinicius Bastos Garcia(2)
Bolsista Pibic/CNPq. E-mail: mirne@cpaa.embrapa.br; (2)Embrapa Amaznia Ocidental, Rodovia AM 010, km 29, Zona Rural, Caixa Postal 319, 69010-970. Manaus - AM. E-mail: tgarcia@cpaa.embrapa.br, mgarcia@cpaa.embrapa.br
(1)

Resumo - O uso de agrotxicos faz parte da rotina da agricultura praticada nas vrzeas amaznicas. Diagnsticos sobre o uso de agrotxicos nessas reas mostraram que estes tm sido usados de modo inadequado. O impacto de produtos qumicos aos organismos do solo tem sido alvo de preocupao, j que a manuteno dos processos biolgicos do solo fundamental para o uso agrcola em longo prazo. Neste estudo foi avaliada a toxicidade dos herbicidas glifosato e oxadiazon fauna do solo em condies tropicais (i.e. 28 C, solo artificial tropical, solo natural (aluvial) e espcies da fauna local). O organismo indicador foi a minhoca (Eisenia fetida). Adicionalmente o efeito de glifosato foi testado em isopodas (Porcellionides pruinosus). Os resultados dos testes de toxicidade em solo artificial e de vrzea mostram que o glifosato no tem efeito letal para E. fetida e P pruinosus. O oxadiazon tambm no foi txico para E. fetida, em . ambos os substratos, mas causou reduo da biomassa dos indivduos. O glifosato no teve efeito sobre o comportamento (repelncia) de E. fetida, enquanto para o oxadiazon foi significativo. Apesar da baixa toxicidade aguda do glifosato e oxadiazon, o efeito crnico (subletal) desses herbicidas precisa ser avaliado para organismos do solo. Termos para indexao: ecotoxicologia, solo artificial, pesticidas.

Effects of herbicides on soil fauna


Abstract - Pesticides have been often used by farmers in Amazonian floodplains (vrzeas). Survey about the use of agrochemicals in these areas showed that they have not been appropriately managed. The impact of chemical products on soil organisms has become an issue of great concern, since the maintenance of biological processes in soil is crucial for a long-term land use. In this study the toxicity of glyphosate and oxadiazon on soil fauna were evaluated in tropical conditions (i.e. 28 C, tropical artificial soil, natural soil (alluvial) and local soil fauna species). The earthworm Eisenia fetida was selected as standard test organism. Additionally, the effect of glyphosate was tested in Isopods (Porcellionides pruinosus). The results showed that the glyphosate had no lethal toxicity for E. fetida and P pruinosus in both soil substrates. Likewise, . the oxadiazon did not show acute toxicity for E. fetida, but decreased the biomass of the earthworms. The glyphosate did not affect the behavior (avoidance) in E. fetida, whereas for oxadiazon it was significant. In spite of the low acute toxicity of glyphosate and oxadiazon, the chronic (sublethal) toxicity of these herbicides should be evaluated for soil organisms. Index terms: ecotoxicology, artificial soil, pesticides.

Introduo
Vrios fatores tm sido apontados como risco diversidade biolgica das regies tropicais, mas o efeito de poluentes qumicos sobre a biodiversidade do solo tem sido pouco considerado. Devido complexidade biolgica e s diferenas climticas existentes nos trpicos, os estudos sobre toxicologia ambiental no podem ser meramente

baseados nos conhecimentos existentes para as regies temperadas. Tais diferenas so razes suficientes para que estudos de ecotoxicologia tropical tenham nova abordagem (Lacher & Goldstein, 1997). A atividade agrcola na Amaznia, em geral, requer o uso intensivo de produtos qumicos em razo das condies climticas e da grande diversidade de pragas e doenas. Embora a agricultura nessa regio seja, em sua

48

M. P. Santana

maioria, baseada na agricultura familiar, o uso de agrotxicos, sobretudo inseticidas e herbicidas, faz parte da rotina dos sistemas de cultivo. Alm disso, boa parte da atividade agrcola se concentra nas margens de rios, nas vrzeas periodicamente inundadas. Dados estatsticos sobre uso de agroqumicos na Regio Amaznica so escassos. Waichman et al. (2002) e Nina (2002) realizaram um diagnstico em diversas comunidades do Rio Solimes, no Municpio de Manacapuru, e relataram que herbicidas tm sido usados de modo inadequado devido ao menor custo em relao capina manual. O efeito txico direto de herbicidas aos organismos do solo tem sido difcil de demonstrar em estudos de campo. Contudo, Salminen et al. (1996, 1997) observaram que os herbicidas tm efeitos diretos aos artrpodos do solo, e a toxicidade pode variar conforme as diferentes vias de exposio e interaes trficas entre os organismos. Segundo Liebhardt & Werner (1991), os efeitos toxicolgicos indiretos dos herbicidas foram causados principalmente pela diminuio da produo primria, reduo da matria orgnica e da cobertura vegetal. Estudos toxicolgicos de herbicidas, bem como de outros agrotxicos, sobre a biota do solo so bases para a elaborao de uma anlise de risco ambiental. Neste estudo foi testada, em laboratrio, a toxicidade aguda dos herbicidas glifosato e oxadiazon para minhocas (Eisenia fetida) e do glifosato para isopodas (Porcellionides pruinosus), bem como a capacidade de Eisenia fetida reagir a solos contaminados com esses herbicidas em diferentes concentraes (testes de repelncia).

Tabela 1. Composio do substrato de solo artificial tropical. Contedo baseado na Componente do solo % de massa seca P da casca de coco triturada (seco ao ar) Argila branca (caulim) seca ao ar Areia fina (seca ao ar) Carbonato de clcio (CaCO3) para ajustar o pH para 6,0 ?0,5.

10 20 70 0,3 - 1,0

Solo Natural: Testes foram realizados em solo tipo Glei Pouco Hmico, presente em reas de vrzea da Regio Amaznica. A classificao textural desse solo franco-siltoso (Tabela 2).
Tabela 2. Composio do solo tipo Glei Pouco Hmico.
Areia grossa Areia fina Areia total Silte Argila

2,00 - 0,20 mm 0,20 - 0,05 mm 2,00-0,05 mm 0,05 - 0,002 mm > 0,002 mm 0,1 % 12,2 % 70,4 % 17,3 % 12,3 %

Seleo de espcies e procedimentos de cultivo


a ) E i s e n i a f et i d a ( S a v i g n y , (Oligochaeta, Lumbricidae) 1826)

Material e Mtodos
Seleo de substratos
Solo Artificial: Os testes de toxicidade foram feitos em solo artificial tropical (Garcia, 2004) cuja formulao (Tabela 1) foi baseada no Protocolo Internacional n. 207 (OECD, 1984).

Espcie de minhoca usada em testes padronizados de toxicidade de substncias qumicas para o solo, em regies temperadas (OECD, 1984) e tropicais (Ibama, 1990). Foram utilizadas culturas de E. fetida estabelecidas no laboratrio de Entomologia da Embrapa Amaznia Ocidental, as quais foram adquiridas de criadores de minhocas nos arredores de Manaus. Estas foram mantidas em caixas de plstico (25 x 36 cm de rea, 12 cm de altura) com um substrato que consiste na mistura de solo artificial tropical com esterco bovino (70:30, v/v) e mantidas temperatura ambiente (25 a 30 C; mdia = 28 C), umidade relativa do ar prximo de 80% e expostas a um ciclo luminoso natural (12h luz /12h escuro). As minhocas foram alimentadas uma a duas vezes por semana com esterco bovino seco, triturado e livre de qualquer contaminao por substncias qumicas.

M. P. Santana

49

b) Porcellionides pruinosus (Brandt, 1833) (Isopoda, Porcellionidae) Crustceo de hbito terrestre, muito difundido em regies tropicais. Foram utilizadas culturas de P. pruinosus estabelecidas no laboratrio de Entomologia da Embrapa Amaznia Ocidental, a partir de exemplares coletados em um canteiro de compostagem de uma propriedade rural. As colnias foram mantidas em caixas de plstico (25 x 36 cm de rea, 12 cm de altura) contendo uma camada de hmus (de culturas de minhocas) e alimentadas com folhas secas da leguminosa Pueraria phaseoloides (Roxb.) Benth., e rao para peixes do tipo Tetramin. Esse crustceo tem o hbito de entrar no substrato, quando este no est compactado, e com isso tem maior contato com o contaminante qumico.

Seleo das substncias qumicas


Testes de toxicidade foram feitos com glifosato e oxadiazon, herbicidas de largo espectro, no seletivos, muito utilizados em diversos cultivos agrcolas e florestais. O glifosato tem ao sistmica e recomendado como ps-emergente, enquanto o oxadiazon no tem ao sistmica e atua como pr ou ps-emergente no controle de ervas em diversas culturas. Procedimento experimental O sistema para determinao da toxicidade aguda de herbicidas para Eisenia fetida foi baseado nos Protocolos Internacionais OECD no. 207 (OECD, 1984) e ISO 11268-1 (1993). Estes descrevem um mtodo para a determinao de toxicidade aguda para E. fetida, via cutnea e por ingesto, usando solo artificial. As diferentes concentraes dos herbicidas foram preparadas com base na massa seca (ms) do substrato, isto , cada concentrao representar a quantidade do ingrediente ativo em mg por kg do substrato (Ex.: 3,16 mg i.a./kg). Em cada rplica experimental, o ingrediente ativo foi diludo em gua destilada, adicionado e misturado em 500 g (ms) de substrato, em frasco de vidro (vol.1,3 L) com tampas de plstico perfuradas. A umidade do substrato foi

ajustada para 35 5% (ms). Aps a contaminao em diferentes concentraes, amostras foram retiradas para clculo da umidade e pH do substrato, em uma rplica de cada tratamento. Em seguida 10 indivduos de E. fetida pesando entre 300 a 600 mg foram colocados sobre a superfcie do substrato e incubados temperatura de 28 2C e sob fotoperodo de 12h/12h. Aps 7 dias foi feita uma avaliao da mortalidade e mudana na biomassa. Aos 14 dias de incubao, essa avaliao foi repetida. Testes com P. pruinosus seguiram procedimentos similares queles aplicados para E. fetida, diferindo nos seguintes aspectos: (1) caixas de plstico (rea de 11 x 15,5 cm, 6 cm de altura), com tampas de plstico, perfuradas, foram usadas como recipientes; (2) cada rplica recebeu 250 g (ms) do substrato e 10 indivduos pesando entre 20 a 30 mg; (3) a umidade do substrato foi ajustada para 25 5% (ms).

Experimento I: Testes preliminares


Para se definir uma faixa de concentraes, testes preliminares foram feitos em 5 concentraes (e.g. 0,1 / 1 / 10 /100 /1000 mg/kg) e controle em apenas uma rplica. Dados de mortalidade em cada concentrao permitiram o clculo da concentrao letal mediana (CL50). Com base no valor da CL50 preliminar foram definidas duas concentraes acima e duas abaixo para uso no teste de toxicidade aguda.

Experimento II: Toxicidade aguda


a) Teste de toxicidade aguda de glifosato e oxadiazon para Eisenia fetida em solo artificial tropical e em solo natural. Neste experimento, com base nos resultados dos testes preliminares, foram definidas cinco concentraes em quatro rplicas por tratamento. Estes ensaios tiveram a mesma durao e os mesmos parmetros de avaliao que nos testes preliminares. Os resultados foram expressos pelos parmetros: CL50 (concentrao letal mediana), MCEO (menor concentrao de efeito observado) e CNEO (concentrao de

50

M. P. Santana

efeito observado) e CNEO (concentrao de nenhum efeito observado). As CL50, com seus respectivos intervalos de confiana a 95%, foram utilizadas em clculos para comparao da toxicidade entre os herbicidas, substratos ou espcies de organismos. b) Teste de toxicidade aguda de glifosato para Porcellionides pruinosus em solo artificial tropical. Nesses testes foi usado o mesmo desenho experimental descrito para E. fetida (Exp. II).

2 C, na ausncia de luminosidade. Ao trmino da incubao cada recipiente foi cuidadosamente examinado e, separando-se as sees (controle e tratamento), foram registrados os nmeros de indivduos que migraram para o controle (Figura 1).

Experimento III: Teste de repelncia


As minhocas possuem clulas quimioreceptoras em seu tegumento, especialmente nos segmentos anteriores do corpo. Tais estruturas as tornam muito sensveis s mudanas qumicas no ambiente. Essa sensibilidade, aliada sua capacidade de locomoo, permite que elas possam evitar reas contaminadas (Stephenson, et al., 1998). Portanto, o teste de repelncia, uma alternativa para rpida avaliao da toxicidade, baseada na resposta comportamental destes organismos, tem sido proposta por Yeardley et al. (1996), Slimak (1997), Stephenson et al. (1998), Hund-Rinke and Wiechering (2001) e Hund-Rinke et al. (2003). O princpio deste teste a exposio simultnea das minhocas ao solo que se quer avaliar (contaminado) e ao solo controle, permitindo a migrao entre ambos. Aps um curto perodo de 2 a 3 dias a localizao dos indivduos determinada. Esses testes tm sido recomendados na avaliao de solos contaminados que estejam em processo de remediao. Foram feitos testes de repelncia usando E. fetida em 6 concentraes dos herbicidas, em 4 rplicas, em solos artificial e natural. Caixas de plstico (rea de 11 x 15,5 cm, 6 cm de altura) foram preenchidas com 250 g (ms) de solo em cada metade, uma com substrato contaminado e outra com no contaminado. Durante o preenchimento, foi usada uma lmina divisria para evitar a mistura dos substratos. Aps a retirada da lmina, dez indivduos de E. fetida, pesando entre 300 a 600 mg, foram colocados na regio central do recipiente sobre o substrato. Em seguida foram incubados por 48h a 28

Figura 1. Esquema de procedimento para teste de repelncia (modificado de Hund-Rinke & Wiechering 2001).

A resposta de repelncia foi quantificada pela diferena entre as propores de indivduos em cada uma das sees. Tais resultados permitiram o clculo da CE50 (concentrao de efeito mediana) e seus respectivos intervalos de confiana.

Desenho experimental e anlises estatsticas


Os experimentos com teste de toxicidade aguda foram feitos em delineamento inteiramente casualizado com quatro repeties. Para os testes de toxicidade aguda, foi usada a Anlise de Varincia

M. P. Santana

51

(ANOVA), seguida pelo teste de Dunnett, para comparao das mdias dos tratamentos com o controle. Nos testes de repelncia foi usado o Teste t para comparao das mdias do nmero de indivduos entre as sees contaminadas e de controle.

Resultados e Discusso
Conforme citado por Monsanto (2001), o glifosato considerado pouco ou mesmo no txico para Eisenia fetida, i.e., a concentrao letal mediana (CL50) maior que 1.250 mg/kg de solo, em solo artificial e condies de clima temperado (solo artificial OECD, pH = 6, temperatura de 20C e E. fetida de origem europia). Segundo Bayer (2002), o herbicida oxadiazon pouco txico para minhocas (CL50 no determinada). Neste estudo, os resultados dos testes de toxicidade em condies tropicais (solo artificial tropical modificado, pH = 6, temperatura 28C e E. fetida de origem tropical) confirmaram que o glifosato e oxadiazon no tm efeito txico para esta espcie em solo artificial (CL50 maior que 1.000 mg/kg de solo) (Tabelas 3, 4 e 9, 10, respectivamente). O solo natural de terra-

firme (Argissolo) no foi um substrato adequado para testes de toxicidade para E. fetida, em decorrncia da alta mortalidade observada no controle. A alta acidez (pH = 3,5 - 4,0) desse solo , provavelmente, o fator limitante para sobrevivncia de E. fetida. Posteriormente observou-se que essa espcie pode sobreviver em um solo natural de vrzea, cujo pH variou de 4,4 a 5,1. Portanto, nesse solo, os testes de toxicidade foram vlidos e os resultados mostraram que ambos os herbicidas no tm efeito txico direto sobre E. fetida (i.e. CL50 maior que 1.000 mg/kg) (Tabelas 7, 8 e 11, 12, respectivamente). Resultados de testes de toxicidade para P . pruinosus em solo artificial mostram que o glifosato no tem ao txica direta para esses artrpodos (Tabelas 5 e 6). O efeito de oxadiazon no foi avaliado para a espcie. Embora ambos os herbicidas no tenham efeito direto na mortalidade de E. fetida, os indivduos expostos concentrao de 1.000 mg/kg de oxadiazon em solos artificial e natural sofreram significativa perda de biomassa (P < 0,01; Teste de Dunnett) (Tabelas 10 e 12).

Tabela 3. Toxicidade aguda de glifosato para E. fetida em solo artificial (teste preliminar).

Tratamento

Mortalidade (%) 14 Dia 0,0 0,0 0,0 0,0 0,0 0,0

Biomassa (mg) 1 Dia 445,3 426,4 423,2 469,1 437,3 398,1 84,8 57,8 86,7 70,0 64,0 74,7

Biomassa (mg) 14 Dia 333,9 329,4 331,5 341,4 339,3 320,1 54,0 45,2 66,0 51,9 46,2 57,4

% do peso inicial 14 Dia 75,0 77,3 78,3 72,8 77,6 80,4

Umidade do solo (%) 36,7 34,4 36,3 34,6 35,9 36,2

PH

Controle 0,1 mg/kg 1 mg/kg 10 mg/kg 100 mg/kg 1.000 mg/kg

5,4 5,2 5,2 5,2 5,2 5,2

Tabela 4. Toxicidade aguda de glifosato para E. fetida em solo artificial (teste limite). Tratamento Mortalidade (%) 14 Dia 0,0 5,0 Biomassa (mg) 1 Dia 422,9 20,2 419,6 20,9 Biomassa (mg) 14 Dia 319,4 8,3 316,3 28,8 % do peso inicial 14 Dia 75,5 75,4 Umidade do solo (%) 35,0 35,0 PH

Controle 1.000 mg/kg

5,9 6,1

52

M. P. Santana Tabela 5. Toxicidade aguda de glifosato para P . pruinosus em solo artificial (teste preliminar). Tabela 6. Toxicidade aguda de glifosato para P pruinosus . em solo artificial (teste limite). Tratamento Tratamento Mortalidade (%) 14 Dia 10,0 20,0 20,0 0,0 20,0 20,0 Umidade do solo (%) 38,2 39,3 37,9 39,2 39,6 38,9 PH Controle 1.000 mg/kg Mortalidade (%) 14 Dia 20,0 22,5 Umidade do solo (%) 36,2 37,3 PH

Controle 0,1 mg/kg 1 mg/kg 10 mg/kg 100 mg/kg 1.000 mg/kg

5,3 5,3 5,2 5,2 5,2 5,3

6,0 6,1

Tabela 7. Toxicidade aguda de glifosato para E. fetida em solo de vrzea (teste preliminar). Tratamento Mortalidade (%) 14 Dia 0,0 0,0 0,0 0,0 0,0 0,0 Biomassa (mg) 1 Dia 315,1 349,3 365,8 323,6 331,7 376,7 39,8 68,6 56,2 42,3 73,6 74,8 Biomassa (mg) 14 Dia 223,2 232,2 255,3 223,1 234,5 267,3 31,0 57,2 45,8 29,4 63,2 63,4 % do peso inicial 14 Dia 70,8 66,5 69,8 68,9 70,7 71,0 Umidade do solo (%) 27,8 29,1 28,1 31,6 29,5 31,3 PH

Controle 0,1 mg/kg 1 mg/kg 10 mg/kg 100 mg/kg 1.000 mg/kg

4,9 4,6 4,6 4,4 4,5 4,5

Tabela 8. Toxicidade aguda de glifosato para E. fetida em solo de vrzea (teste limite). Tratamento Mortalidade (%) 14 Dia 0,0 0,0 Biomassa (mg) 1 Dia 346,5 30,7 345,3 15,6 Biomassa (mg) 14 Dia 242,2 42,7 218,5 7,5 % do peso inicial 14 Dia 69,9 63,3 Umidade do solo (%) 32,5 32,6 PH

Controle 1.000 mg/kg

4,4 - 4,9 4,4 - 4,9

Tabela 9. Toxicidade aguda de oxadiazon para E. fetida em solo artificial (teste preliminar). Tratamento Mortalidade (%) 14 Dia 0,0 0,0 0,0 0,0 0,0 0,0 Biomassa (mg) 1 Dia 360,6 93,0 370,4 66,0 388,1 103,4 397,0 77,9 373,2 76,0 304,5 42,8 Biomassa (mg) 14 Dia 306,9 77,5 318,5 118,0 343,4 84,3 333,5 60,4 263,3 69,9 200,6 37,5 % do peso inicial 14 Dia 85,1 86,0 88,5 84,0 70,6 65,9 Umidade do solo (%) 38,4 38,5 38,4 37,3 40,3 38,3 PH

Controle 0,1 mg/kg 1 mg/kg 10 mg/kg 100 mg/kg 1000 mg/kg

5,7 5,9 5,8 5,8 5,9 6,0

Tabela 10. Toxicidade aguda de oxadiazon para E. fetida em solo artificial (teste limite). Tratamento Controle 1000 mg/kg Mortalidade (%) 14 Dia 2,5 0,0 Biomassa (mg) 1 Dia 396,3 9,7 386,1 41,3 Biomassa (mg) 14 Dia 358,1 24,8 275,5 35,9 % do peso inicial 14 Dia 90,4 71,3** Umidade do solo (%) 35,1 36,8 PH

6,0 6,0

**Estatisticamente diferente do controle (P<0,01) (Teste de Dunnett)

M. P. Santana Tabela 11. Toxicidade aguda de oxadiazon para E. fetida em solo de vrzea (teste preliminar). Tratamento Controle 0,1 mg/kg 1 mg/kg 10 mg/kg 100 mg/kg 1.000 mg/kg Mortalidade (%) 14 Dia 10,0 0,0 0,0 0,0 0,0 0,0 Biomassa (mg) 1 Dia 353,7 81,4 377,5 86,9 350,7 93,1 429,6 57,0 393,2 81,5 441,3 68,4 Biomassa (mg) 14 Dia 262,2 105,9 248,7 96,3 260,8 67,0 320,1 37,1 265,7 57,4 277,1 45,4 % do peso inicial 14 Dia 74,1 65,9 74,4 74,5 67,6 67,4 Umidade do solo (%) 25,4 25,7 25,7 24,6 26,6 25,0 PH

53

5,1 5,0 5,0 5,0 4,9 4,8

Tabela 12. Toxicidade aguda de oxadiazon para E. fetida em solo de vrzea (teste limite). Tratamento Mortalidade (%) 14 Dia 5,0 0,0 Biomassa (mg) 1 Dia 395,2 49,0 384,0 24,8 Biomassa (mg) 14 Dia 307,9 43,6 262,0 20,2 % do peso inicial 14 Dia 77,9 68,2** Umidade do solo (%) 33,3 33,8 PH

Controle 1.000 mg/kg

4,9 4,9

** Estatisticamente diferente do controle (P<0,01) (Teste de Dunnett).

Os resultados dos testes de repelncia mostraram que E. fetida no reage aos solos artificial e de vrzea contaminados com o glifosato em concentraes de 2 a 632 mg/kg (Figuras 2 e 3). Ao contrrio, em ambos os tipos de solo, as minhocas apresentaram evidente resposta de repelncia em

concentraes de 2 a 632 mg/kg de oxadiazon (Figuras 4 e 5). Entretanto, em solo de vrzea esse efeito no foi significativo para as concentraes 2 e 20 mg/kg (Figura 5). Isto se deve, provavelmente, ao baixo pH do solo como um segundo fator influenciando o comportamento de repelncia.

Fig. 2. Resposta de repelncia de E. fetida a diferentes concentraes (mg/kg) de glifosato em solo artificial tropical (mdia e erro padro).

54

M. P. Santana

Fig. 3. Resposta de repelncia de E. fetida a diferentes concentraes (mg/kg) de glifosato em solo de vrzea (mdia e erro padro).

Fig. 4. Resposta de repelncia de E. Fetida a diferentes concentraes (mg/kg) de oxadiazon em solo artificial tropical (mdia e erro padro).

M. P. Santana

55

Fig. 5. Resposta de repelncia durante a exposio de E. fetida a diferentes concentraes (mg/kg) de oxadiazon em solo de vrzea (mdia e erro padro).

Concluses
Os resultados obtidos neste estudo demonstraram que, aparentemente, os herbicidas glifosato e oxadiazon tm baixa letalidade para espcies da fauna do solo. Poder-se-ia ento pressupor que essas substncias apresentam baixo risco ambiental para o solo. Entretanto, uma anlise de risco no pode ser baseada apenas nos dados de concentraes letais, mas tambm devem ser considerados os efeitos da exposio a longo prazo dos organismos s baixas concentraes (subletais). Tais efeitos tm em geral maior relevncia ecolgica e so estudados em testes de toxicidade crnica, nos quais a reproduo ou crescimento do organismo so os parmetros avaliados. Diante disso, so necessrios estudos sobre a toxicidade crnica de glifosato e oxadiazon para os organismos de solo.

Referncias Bibliogrficas
BAYER. Material safety data sheet Aventis ronstar granules selective herbicide. Disponvel em: <www.bayercropscience. com.au/products/resources/msds/ Aliette_msds_0802.pdf.>. Acessado em: 29 jul. 2004. GARCIA, M. Effects of pesticides on soil fauna: development of ecotoxicological test methods for tropical regions. Gttingen: Cuvillier Verlag, 2004. 281 p. (Ecology and Development Series, 19). HUND-RINKE, K.; WIECHERING, H. Earthworm avoidance test for soil assessments - an alternative for acute and reproduction tests. Journal of Soils and Sediments, v. 1, n. 1, p. 15-20, 2001. HUND-RINKE, K. et al. Avoidance test with Eisenia fetida as indicator for the habitat function of soils: Results of a laboratory comparison test. Journal of Soils and Sediments, v. 3, n. 1, p. 7-12, 2003.

56

M. P. Santana

IBAMA. Manual de testes para avaliao da ecotoxicidade de agentes qumicos. 2. ed. Braslia, 1990. 351 p. ISO-11268-1. International organization for standardization. Soil-quality Effects of pollutants on earthworms (Eisenia fetida) Part 1: Determination of acute toxicity using artificial soil substrate. Geneve, Switzerland, 1993. 6 p. LACHER, T. E.; GOLDSTEIN, M. I. Tropical ecotoxicology: status and needs. Environmental Toxicology and Chemistry, v. 16, n. 1, p. 100111, 1997. LIEBHARDT, B.; WERNER, M. Soil management: critical key to transition. Sustainable Agriculture, University of California, v. 3, n. 2, 1991. Disponvel em: <http://www.sarep.ucdavis.edu/NEWSLTR/ v3n2/sa-10.htm>. Acesso em: 5 ago. 2003. MONSANTO. Material safety data sheet Commercial Product ROUNDUP Pro Concentrate Herbicide. Disponvel em: <www.monsanto.com/monsanto/us_ag/con tent/ crop_pro/ rounduppro_con/ msds.pdf.>. Acesso em: 16 fev. 2004. WAICHMAN, A. V.; NINA, N. C. S.; ROEMBKE, J. Agrotxicos: elemento novo na Amaznia. Cincia Hoje, Rio de Janeiro, v. 32, n. 190, p. 70-73, 2003. ORGANIZATION FOR ECONOMIC COOPERATION AND DEVELOPMENT - OECD. Guideline for testing chemicals 207. Earthworm acute toxicity test, 1984. D i s p o n v e l e m : <http://www.oecd.org/depatment>. Acesso em: 20 jan. 2004. SALMINEN, J.; ERIKSSON, I.; HAIMI, J. Effects of terbuthylazine on soil fauna and decomposition processes. Ecotoxicology and Environmental Safety, v. 34, n. 2, p. 184189, 1996.

SALMINEN, J.; SETL, H.; HAIMI, J. Regulation of decomposer community structure and decomposition processes in herbicide stressed humus soil. Applied Soil Ecology, v. 6, n. 3, p. 265-274, 1997.SLIMAK, K. M. Avoidance response as a sublethal effect of pesticides on Lumbricus terrestris (Oligochaeta). Soil Biology and Biochemistry, v. 29, p. 713-715, 1997. STEPHENSON, G. L. et al. Use of an avoidance-response test to assess the toxicity of contaminated soils to earthworms. In: SHEPPARD, S. et al. Advances in earthworm ecotoxicology. Pensacola, USA: Setac Press, 1998. p. 67-81. WAICHMAN, A.V. et al. Use and fate of pesticides in the Amazon state, Brazil: risk to human health and the environment. ESPR Environmental Science and Pollution Research, v. 9, n. 6, p. 423-428, 2002. YEARDLEY, R. B.; LAZORCHAK, J. M.; GAST, L. C. The potential of an earthworm avoidance test for evaluation of hazardous waste sites. Environmental Toxicology and Chemistry, v. 15, p. 1532-1537, 1996

Produo de basidiocarpos de Crinipellis perniciosa e avaliao de clones de cupuauzeiro quanto a resistncia vassoura-de-bruxa
Wenceslau Nascimento de Melo(1) e Maria Geralda de Souza(2)
(1) Universidade Federal do Amazonas (Ufam), Departamento de Cincias Florestais, Av. Gen. Rodrigo Octvio Jordo Ramos, 3.000, Campus Universitrio, Reitoria, Bairro Coroado I, CEP 69077-000, Manaus, AM. E-mail: wenceslaumelo@ufam.edu.br; (2)Embrapa Amaznia Ocidental, Rodovia AM 010, km 29, Zona Rural, Caixa Postal 319, 69010-970. Manaus - AM. E-mail: geralda@cpaa.embrapa.br

Resumo - A cultura do cupuau vem se destacando dentre as fruteiras nativas da Amaznia, por apresentar opes de carter rentvel significativas. Alm do consumo da polpa e suas diferentes utilizaes, as amndoas so utilizadas na fabricao do cupulate. Entretanto a vassoura-debruxa, doena causada pelo fungo Crinipellis perniciosa, vem acarretando os maiores prejuzos aos ciclos vegetativos e produtivos do cupuauzeiro. O uso de cultivares resistentes ao patgeno a forma mais eficaz e econmica de controle dessa enfermidade. Os basidisporos, liberados pelos basidiocarpos, so a nica forma infectiva desse patgeno. Objetivando a obteno desses esporos para a inoculao e avaliao da resistncia de clones de cupuauzeiro, estudou-se o aperfeioamento e adaptao, para as nossas condies, da metodologia para a produo de basidiocarpos, em condies de temperatura e umidade controladas. Para tanto, instalou-se vassoureiro no campo e procedeu-se ao cultivo do fungo em meio de cultura artificial (bolachas). Termos para indexao: Crinipellis perniciosa, vassoura-de-bruxa, cupuau, fitopatologia.

Production of basidiocarps of Crinipellis perniciosa and valuation of clones of cupuau about its resistance to witches' broom
Abstract - Culture of cupuau (Theobroma grandiflorum) detaches among native fructiferous
trees from Amazonia, by presenting significant profitable options. Besides the use of pulp and its different utilizations, almonds are used in the cupulate's manufacture. Nevertheless whitches' broom, a desease caused by the fungus Crinipellis perniciosa, have been causing the greatest damages to vegetative and productive cycles of cupuau. The use of resistant cultivars to the patogen is the most efficient and economic way to control this infirmity. Basidiospores, released by basidiocarps, are the single infective structure of this pathogen. With the objective of obtain these spores, to the inoculation of the desease and valuation of the clones of cupuau's resistance, were studied the improvement and the adaptation to our conditions of the methodology of production of basidiocarps in temperature and moistness controled conditions. For all of these, a support to witches's broom was placed in field and tillage of fungus in arificial way of culture (crackers) was proceeded.

Index terms: Crinipellis perniciosa, witches' broom, cupuau, phytopathology.

Introduo
A cultura do cupuau vem se destacando dentre as fruteiras nativas da Amaznia, por apresentar opes de carter rentvel significativas. Alm do consumo da polpa e suas diferentes utilizaes, as amndoas so utilizadas na fabricao do cupulate. Um dos principais fatores limitantes para o aumento

da produtividade da cultura a vassoura-debruxa. Trata-se de uma doena causada pelo fungo Crinipellis perniciosa, considerada a principal enfermidade do cupuauzeiro. O fungo C. perniciosa Stahel (Singer) pertence diviso Eumycota, subdiviso Basidiomycotina, ordem agaricales e famlia Tricholomataceae.

58

W. N. de Melo

A famlia Tricholomataceae constituda de espcies com basidiomas pilados, estipitados, ligncolas e capazes de reativao aps a secagem quando so umedecidos (Luz et al., 1997). C. perniciosa um fungo hemibiotrfico com dois tipos de miclio: em tecidos ainda verdes, o miclio espesso com 5-8 m, biotrfico ou parastico e sem a formao de grampo de conexo, crescendo intercelularmente. Quando as vassouras secam, o miclio torna-se saproftico ou necrotrfico, cresce inter e intracelularmente, sendo menos espesso (1,5 - 5 m) e apresentando grampo de conexo (Evans, 1980). A formao do grampo de conexo em hifas de cultura monosprica, a dicariotizao de hifas monocariticas derivadas de um nico basdio uninucleado e a produo de basidiocarpos a partir de culturas monospricas indicam que C. perniciosa um fungo primariamente homotlico (Purdy et al., 1983); (Griffith e Hedger, 1994). A temperatura tima para a germinao e desenvolvimento de C. perniciosa varia em torno de 25C, com limites mnimo e mximo entre 15 e 30C (Baker e Holliday, 1957). A germinao dos esporos uma das fases mais delicadas para a sobrevivncia do patgeno e, portanto, para a continuidade do ciclo de vida. controlado por uma srie de fatores, tanto genticos quanto ambientais (Bastos, 1989). Em regra, aps a germinao dos basidisporos formam-se apressrios, hifas infectivas que penetram no hospedeiro via abertura estomacal ou por penetrao direta (Baker e Holliday, 1957). Aps a penetrao dos basidisporos nos tecidos meristemticos, ocorre a formao dos sintomas caractersticos da doena, como hiperplasia e hipertrofia, que resultam do desequilbrio hormonal durante a interao patgeno-hospedeiro, com formao anormal de frutos, flores e brotos vegetativos (Evans, 1978). Com a morte desses tecidos, o fungo persiste como saprfita, muitas vezes por vrios anos, produzindo periodicamente os corpos de frutificao, os basidiocarpos (Bastos, 1989). A produo de basidiocarpos fornecida pela ocorrncia de dias chuvosos, seguidos por dias secos ou vice-versa, e o perodo de produo dependente das condies climticas de cada regio (Dalla Pria & Camargo, 1997). O ciclo de vida do fungo compreende uma

fase parastica alternada com uma fase saproftica. Pegus (1972), citado por Bastos (1980), postulou a teoria dual e micelial para explicar como o fungo existe em diferentes estados miceliais, e que o miclio primrio, monocaritico (ou homocrio), representa a fase biotrfica, enquanto a fase necrotrfica induzida pelo miclio secundrio, dicaritico (ou heterocrio). O monocrio o miclio primrio que se desenvolve da germinao de um esporo sexual simples. O dicrio o miclio secundrio que predomina na natureza e o miclio a partir do qual se desenvolvem os corpos de frutificao. O miclio monocaritico da fase parastica depende do tecido vivo do hospedeiro, onde o fungo cresce com a planta e obtm nutrientes das clulas vivas para sustentar seu crescimento e desenvolvimento (Bastos, 1990). Entretanto, quando tal crescimento torna-se inibido, os nutrientes solveis tendem a tornar-se limitantes, o que leva o fungo a invadir, colonizar e matar os tecidos, obtendo seus nutrientes necrotroficamente, usando seu arsenal enzimtico, mediante enzimas degradativas tpicas de um parasita facultativo (Evans, 1981); (Nakayama, 1995). O miclio do fungo no infectivo, somente os esporos so aptos a induzir doenas.

Material e Mtodos
O experimento foi realizado na Unidade da Embrapa Amaznia Ocidental, em campo e em laboratrio, no ano de 2003 e no primeiro semestre de 2004. Deu-se continuidade produo de basidiocarpos em vassoureiro implantado no campo. As vassouras-de-bruxa depositadas no vassoureiro foram obtidas em coletas, em datas aleatrias, com a utilizao de tesouras de poda ou aproveitando o material extrado, em grande quantidade, de podas peridicas realizadas na rea de plantio de cupuau sem caroo. Para o transporte das vassouras-debruxa para o vassoureiro, utilizaram-se sacos plsticos de vinte litros. As demais reas de plantio onde foram coletadas vassouras-debruxa foram: rea do tringulo, PTU, pelado, e rea da usina, todas localizadas no Campo Experimental da Embrapa Amaznia Ocidental do Km 29 da Rodovia AM 010.

W. N. de Melo

59

Posteriormente, as vassouras foram dependuradas no vassoureiro de campo, composto de nove arames galvanizados amarrados a seis postes de madeira. A cada dois postes, havendo uma distncia de 5 metros, foram esticados trs arames com 30 cm de espaamento entre eles e o primeiro, a 50 cm do solo. Foram confeccionados ganchos a partir de arames de cobre revestidos por plstico, para serem presos s vassouras, e estas, aos arames galvanizados. Foi instalado um mecanismo de asperso automatizado constitudo de seis bicos aspersores divididos em dois canos de PVC de polegada posicionados a 3,5 m acima do solo e com espaamento de 1 m entre eles. A asperso foi abastecida por tubulao proveniente de uma caixa d'gua de 500 L dotada de um sistema com bia, para prov-la de enchimento automatizado. Os bicos aspersores eram acionados por meio de uma balana de mercide ligada rede eltrica; o processo se d aproximadamente a cada hora e tem durao de 3 minutos. O vassoureiro foi montado em rea de capoeira com bom sombreamento natural, e com a adio da nvoa formada pela asperso obteve-se um microclima com nveis de luminosidade e umidade propcios para a produo de basidiocarpos. Novas vassouras-de-bruxa foram regularmente adicionadas quantidade j existente no vassoureiro. Foi utilizado, tambm, um meio artificial (bolachas) para a produo de basidiocarpos em condies controladas (Adaptado de Niella et al., 1999). Para a confeco de 40 bolachas, foram utilizados 350 g de farelo de trigo, 280 g de vermiculita, 42 g de gesso e 10,64 g de calcrio, para uma quantidade de 480 mL de gua destilada esterilizada. Para o preparo do meio, os ingredientes foram misturados com gradativa adio de gua, espremendo-se a mistura com as mos at que o excesso de gua escorresse; aps o preparo do meio, foram distribudos igualmente 35 g da mistura em bandejas de alumnio, tampadas e enroladas em papel alumnio para facilitar o processo de esterilizao em autoclave, ao qual as bolachas foram expostas por perodo de 1520 minutos. Depois de retiradas e resfriadas, foi inoculado o fungo C. perniciosa por meio de 6 discos de meio de cultura BDA (Batata, Dextrose, gar) medindo 5 mm de dimetro

previamente colonizados por miclio branco cotonoso caracterstico; os discos de miclio foram retirados de colnias novas de 20-30 dias. Transferiram-se as bolachas para cmara de crescimento, atentando-se para no agitar as bandejas e no desnivelar as bolachas. Aps 15 dias em prateleiras, para crescimento, as bandejas foram abertas para a aplicao da cobertura composta de 80 g de turfa, 20 g de vermiculita, 20 g de calcrio qual foram adicionados 50 mL de gua destilada esterilizada. A mistura foi dividida para a cobertura em quantidades individuais de 15 g, pesadas em balana analtica. As pores da mistura foram embaladas em papel alumnio e submetidas ao processo de esterilizao por autoclave; aps resfriadas, cada poro de 15 g de mistura foi desembalada e distribuda uniformemente sobre uma bolacha, com o auxlio de esptulas, sendo estas regularmente flambadas durante o processo para evitar contaminao. O processo foi finalizado com o fechamento das bandejas. Aps 10 dias, aproximadamente, as bolachas foram retiradas das bandejas de alumnio e dependuradas com arames no interior de cmaras de plstico medindo 1 m de comprimento por 60 cm de largura e 60 cm de altura. Controlou-se criteriosamente a temperatura (em torno de 25-30C) e a umidade, a fim de viabilizar a produo de basidiocarpos. O umedecimento automatizado das bolachas foi realizado mediante instalao de umidificadores eltricos ligados a temporizadores programados para o acionamento dos umidificadores a cada hora por um perodo de 15 minutos. O fornecimento de gua para as bolachas manteve-se constante e uniforme at que o miclio mudasse de colorao passando a ter aparncia amarelada e, por fim, cor-de-rosa, quando o fornecimento de gua foi interrompido e as bolachas foram submetidas a estresse hdrico por um perodo de 5 dias, ao fim do qual o umedecimento voltou a ser aplicado na mesma proporo anterior.

60
Resultados e Discusso

W. N. de Melo

A produo de basidiocarpos no vassoureiro e no campo foi muito reduzida, mesmo nos meses de maior pico (maio julho). Esses resultados diferem daqueles citados por Stein et al. (1996). Da mesma forma, a produo de basidiocarpos em meio artificial no atendeu s expectativas; esses resultados tambm foram discordantes daqueles apresentados pelo autor acima citado (Tabela 1). Conseqentemente esses

resultados levaram obteno de baixa concentrao de esporos, ou seja, concentrao em glicerol 16% (<105), visando ao armazenamento desses para posterior utilizao em inoculaes, no sendo suficiente para inocular clones de cupuau para testes de resistncia ao patgeno. Estes experimentos devero ser repetidos com adequao de metodologia, uma vez que a produo de basidiocarpos visando produo de inculo se faz necessria nos trabalhos de seleo de clones de cupuauzeiro.

Tabela 1. Resultados obtidos no perodo de junho de 2003 a julho de 2004. Origem do material de coleta dos basidiocarpos N. Basidiocarpos Obteno de esporos ([ ] em glicerol 16% Isolamento em gar-gua a partir de basidiocarpos coletados % de placas geraram colnias 50 50 50

Campo Vassoureiro Bolachas

500 100-150 50

<105 <105 <105

Concluses
A obteno de basidiocarpos sob condies controladas de temperatura e umidade no proporcionou resultados satisfatrios que atendessem aos objetivos propostos neste trabalho. Novos estudos e metodologias devero ser desenvolvidos para adequao s nossas condies ambientais.

DALLA PRIA, M. D.; CAMARGO, L. E. A. Doenas do Cacaueiro. In: BERGAMIN FILHO, A.; KIMATI, H.; AMORIM, L. (Ed.). Manual de fitopatologia doenas de plantas cultivadas. 3. ed. So Paulo: Agronmica Ceres, 1997. v. 2. p. 176-183. EVANS, H. C. Pleomorphism in Crinipellis perniciosa, causal agent of witches' broom disease of cocoa. Transactions of the British Mycologiacal Society, Cambridge, v. 74, n. 3, p. 515-523, jun. 1980. GRIFFITH, G. W.; HEDGER, J. N. A novel method for producing basidiocarps of the cocoa pathogen Crinipellis perniciosa using a bran-vemiculite mdium. Journal of Plant Pathology, Netherland, p. 227-230, 1994. LIMA, M. I. P. M.; SOUZA, A. G. C. Diagnose das principais doenas do cupuauzeiro (Theobroma grandiflorum) (Willd. Ex Spreng.) Shum.) e seu controle. Manaus: EMBRAPACPAA, 1998. 18 p. (EMBRAPA-CPAA. Documentos, 9). LUZ. E. D. M. N. et al. Cacau (Theobroma cacao). In: VALE, F. X. R.; ZAMBOLIM, L. (Ed.). Controle de doenas de plantas. Viosa. UFV, 1997. v. 2. p. 611-615.

Referncias Bibliogrficas
BAKER, R. E. D.; HOLLIDAY, P. Witches' broom disease of cacao. Phytopathology, St. Paul, n. 2, p. 42, 1957. BASTOS, C. N. Efeito da radiao solar e do perodo ps-germinativo sobre a viabilidade de basidsporo de Crinipellis perniciosa. Fitopatologia Brasileira, Braslia, v. 14, n. 2, p. 261-3, 1989. BASTOS, C. N. Patogenicidade e caractersticas do isolado de Crinipellis perniciosa procedente de Uruuca, Bahia. Fitopatologia Brasileira, Braslia, v. 15, n. 3, p. 344-346, set. 1990.

W. N. de Melo

61

NIELLA, G. R. et al. Aperfeioamento da metodologia de produo artificial de basidiocarpos de Crinipellis perniciosa. Fitopatologia Brasileira, Braslia, v. 24, n. 4, p. 523-527, dez. 1999. NAKAYAMA, L. H. I. Influncia da nutrio mineral na manifestao dos sintomas da vassoura-de-bruxa (Crinipellis perniciosa (Stahel) Singer) em cacaueiro. 1995. 76 f. Tese (Doutorado) ESALQ, Piracicaba.

PURDY, L. H. et al. Proof of pathogenicity of Crinipellis perniciosa to Theobroma cacao by using basidiospores produced in vitro cultures. Theobroma, Ilhus, v. 13, n. 3, p. 157-163, jul./set. 1983. STEIN, R. L. B. et al. Produo artificial de basidiocarpos de Crinipellis perniciosa do cupuauzeiro em meio de farelo de vermiculita. Belm: EMBRAPA-CPATU, 1996. 15 p. (EMBRAPA-CPATU. Boletim de Pesquisa, 167).

Caracterizao morfo-agronmica de acessos de pimenta (Capsicum sp.) nas condies de Manaus - AM


Joo Vieira do Bomfim Neto(1), Sabrina Isabel Costa de Carvalho(2), Francisco Celio Maia Chaves(3) e Rodrigo Fascin Berni(3)
(1) Bolsista Pibic/Fapeam; (2)Embrapa Hortalias, Braslia DF; (3)Embrapa Amaznia Ocidental, Rodovia AM 010, km 29, Zona Rural, Caixa Postal 319, 69010-970. Manaus - AM. E-mail: celio@cpaa.embrapa.br; rodrigo@cpaa.embrapa.br

Resumo - As pimentas e pimentes so plantas autgamas pertencentes famlia Solanaceae e


ao gnero Capsicum, o qual agrupa 2.025 espcies classificadas de acordo com o nvel de domesticao. Esse gnero originrio das regies tropicais da Amrica Latina e Brasil, e possui ampla diversidade. Este trabalho tem como objetivo avaliar morfo-agronomicamente seis materiais de pimenta (CNPH0972, CNPH3221, CNPH3696, CNPH0746, CNPH0193 e Sakata) nas condies de Manaus AM. O experimento foi conduzido no Campo Experimental da Embrapa Amaznia Ocidental do Km 29, Rodovia AM 010, Manaus, AM, o qual apresenta Latossolo Amarelo e clima tropical. Adotou-se o delineamento experimental de blocos ao acaso, com 6 tratamentos e 4 repeties e espaamento de 0,80 m entre as plantas e 1,0 m entre as fileiras. Os melhores ndices de germinao foram observados nos materiais CNPH 0745 e Sakata. Para os atributos de desenvolvimento da planta (dimetro e altura), frutos e sementes, os melhores resultados foram CNPH 3221, CNPH 0745 e Sakata.

Termos para indexao: Capsicum annuum, produo, produtividade, acessos.

Characterization of accession pepper (Capsicum sp.) in Amazonas State Brazil

Abstract - The peppers and sweet peppers are autogamous plants, that belong to the family Solanaceae and they are of the genus Capsicum, that contain 20-25 species classified in agreement with the domestication level. That genus is original of the tropical areas of Latin America and Brazil, and it possesses wide diversity. This work has as objective evaluates morphological and agronomic characterization 6 materials of pepper CNPH0972; CNPH3221; CNPH3696; CNPH0746; CNPH0193; SAKATA in the conditions of Manaus - AM. The experiment was carry out in the Experimental Station of Western Amazonian Embrapa, that it presents oxissolil and tropical climate, located in Rodovia AM-010, km 29 - 010, Manaus - AM. The experimental was randomized completely block design, with 6 treatments and 4 repetitions and spacing of 0,80 m among the plants and 1,0 m among the lines. The best germination indexes were observed in the materials CNPH 0745 and Sakata. For the attributes of development of the plant (diameter and height), fruits and seeds the best results were CNPH 3221, CNPH 0745 and Sakata. Index terms: Capsicum annuum, production, yield, accession.

J. V. do Bomfim Neto

63

Introduo
As pimentas e pimentes do gnero Capsicum, muito utilizados pelos indgenas, so plantas autgamas pertencentes famlia das solanceas (Camargo, 1984). As pimenteiras so originrias de regies latinoamericanas de clima tipicamente tropical, seus frutos apresentam caractersticas distintas, geralmente associadas ao sabor picante devido produo de alcalides, mais especificamente os capsaicinides (capsaicina e diidrocapsaicina). Existem as que no apresentam sabor picante, chamadas de pimenta-doce, que pertencem mesma espcie do pimento (Capsicum annuum). A pungncia uma caracterstica associada a um gene dominante chamado "C", observaes resultantes dos primeiros estudos genticos (Deshpande 1935 e Greenleaf 1952, citados por Blum et al., 2002), as recessivas "c" no apresentam pungncia. Dado o exposto, objetivou-se, com este trabalho, avaliar morfo-agronomicamente os materiais de pimenta-doce nas condies de Manaus- AM e indicar materiais para estudos de recomendao para uso local.

Decorridos 64 dias aps o plantio (DAP), as plantas emergidas nos sacos foram utilizadas como bordadura, e aos 56 DAP as plantas emergidas na bandeja foram utilizadas na rea til. Realizou-se o plantio definitivo (26/1/2004) na rea experimental em espaamento de 0,80 x 1,0 m. O plantio foi realizado em covas de 30 x 30 x 30 cm, contendo 0,5 L de esterco de ave curtido, 100 g de calcrio dolomtico, 200 g de superfosfato e 50 g de fritas contendo micronutrientes, alm do prprio solo retirado da cova. O delineamento utilizado foi em blocos ao acaso, com quatro repeties e quatro plantas na rea til da parcela. Ao longo do desenvolvimento das plantas, foi realizado o tutoramento com fio nylon com suporte de arame. Tambm foram realizadas vrias capinas, e avaliadas as seguintes variveis: altura e dimetro do caule aos 5 cm do solo, ambas aos 25 e 45 dias aps o transplantio (DAT), pesos fresco e seco de frutos/planta, comprimento e dimetro do fruto, nmero e peso de semente/fruto e peso de mil sementes. As mdias foram analisadas pelo teste Tukey, a 5% de probabilidade.
Tabela 1. Procedncia de acessos de pimenta avaliados na Embrapa Amaznia Ocidental. Manaus AM, 2004. Acessos CNPH 0972 CNPH 3221 CNPH 3696 CNPH 0746 CNPH 0193 Sakata Procedncia Cear Tocantins Goinia Iugoslvia Estados Unidos Sakata Seed Sudamerica Ltda.

Material e Mtodos
O experimento foi conduzido no Campo Experimental da Embrapa Amaznia Ocidental situado no Km 29 da Rodovia AM 010, aos 38'S e 5952'O. O solo foi classificado como Latossolo Amarelo, e o clima da regio, segundo a classificao de Kppen (Serro et al., 1979), tropical chuvoso (Am). O experimento constou de avaliaes morfoagronmicas de seis acessos com procedncia conhecida (Tabela 1). As mudas foram confeccionadas, em uma primeira etapa, em sacos de polietileno preto (semeadura em 21/11/2003), contendo substrato formado por terrio, 50 L de esterco de gado curtido, 100 g de fritas com micronutrientes, 1 kg de superfosfato simples e 1 kg de calcrio dolomtico, na proporo 3:1; e em outra etapa, em bandejas de germinao (1/12/2003) com o substrato comercial Plantmax. Em ambos os ambientes foi semeada uma semente por recipiente, com permanncia em ambiente de viveiro.

Resultados e Discusso
Aps a semeadura dos materiais, notaramse diferenas entre as porcentagens de germinao esperadas, sendo o Sakata o material que melhor respondeu, com os valores de 95,83% e 100,00%, respectivamente, para saco e bandeja. (Tabela 2). O de pior desempenho foi o CNPH 0193, que apresentou 29,16% e 24,16%, respectivamente.

64

J. V. do Bomfim Neto Tabela 2. Percentual de germinao (%) entre acessos de pimenta semeados em sacos plsticos e bandeja de germinao. Embrapa Amaznia Ocidental, Manaus AM, 2004. Acessos Saco de Polietileno 62,50 54,16 58,33 75,00 29,16 95,83 Bandeja de Mdia entre os Germinao Ambientes 70,83 79,16 91,66 79,16 24,16 100,00 66,66 66,66 74,99 77,08 41,66 99,41

CNPH 0972 CNPH 3221 CNPH 3696 CNPH 0746 CNPH0193 Sakata

variveis observadas (Tabela 4). Em relao s sementes, a resposta dos acessos ficou diferenciada em relao aos outros atributos apenas na varivel peso de mil sementes, pois o acesso CNPH 3221 apresentou o maior valor, diferindo dos demais (Tabela 5). Considerando que a regio de Manaus apresenta grande consumo de pimenta, visto que a base de protena o pescado, os materiais Sakata e CNPH 0746 revelaram-se promissores para cultivo na referida regio.
Tabela 4. Peso fresco, peso seco, comprimento e dimetro de frutos dos acessos de pimenta avaliados nas condies de Manaus - AM. Embrapa Amaznia Ocidental. Manaus AM. 2004.

Pela Tabela 3 verifica-se que o acesso Sakata apresentou os melhores resultados para altura e dimetro, visto que houve aumento de 16 cm e 1,17 mm, respectivamente, entre as duas idades de avaliao. O acesso CNPH 972, por sua vez, no se desenvolveu bem, mesmo por ocasio da primeira avaliao, pois tinha apenas 13 cm de altura, assim como o menor dimetro do caule, 1,84 cm. interessante observar que o Sakata conservou o melhor desempenho ao longo do perodo de avaliao entre as duas idades.
Tabela 3. Altura e dimetro dos acessos de pimenta. Embrapa Amaznia Ocidental. Manaus AM. 2004. Acessos Dimetro Altura Dimetro Altura (mm)1 (mm)1 (cm)1 (cm)1 2 45 DAT 25 DAT 13,37b 1,84b 21,24c 21,24c 19,90a 2,34ab 29,77ab 29,77ab 19,93a 2,44a 29,46ab 29,46ab 18,06ab 2,09ab 24,12bc 24,12bc 21,04c 21,04c 15,00ab 2,24ab 34,68a 34,68a 18,46ab 2,26ab 11,65 11,65 14,89 10,42 7,15 7,15 5,98 0,52

Acessos

Peso Peso Comprimento Dimetro Fresco/fruto Seco/fruto do fruto do fruto (g) (g) (cm) (mm) 11,80c 6,71cd 0,73d 33,39b 55,06a 12,69 6,16 0,75c 0,53c 0,11c 2,29b 3,53a 20,81 0,67 6,13bc 4,51c 2,13d 8,00b 15,34a 12,84 2,09 3,19b 3,87ab 1,40c 3,99ab 5,32a 19,86 1,59

CNPH 0972 CNPH 3221 CNPH 3696 CNPH 0746 Sakata CV (%) DMS
1

Mdias seguidas de mesma letra na coluna no apresentam diferenas estatisticamente significativas a 5% de probabilidade pelo Teste Tukey.

CNPH 0972 CNPH 3221 CNPH 3696 CNPH 0746 CNPH 0193 Sakata CV (%) DMS
1

Tabela 5. Nmero de sementes/fruto, peso de sementes/fruto e peso de 1.000 sementes dos acessos de pimenta avaliados nas condies de Manaus AM. Embrapa Amaznia Ocidental. Manaus AM. 2004.

Acessos

Nmero de Peso de Peso de sementes/fruto sementes/fruto 1.000 (g) Sementes (g) 0,16c 0,15c 0,11c 0,41b 0,74a 29,47 0,21 4,4b 4,8a 3,8c 3,9c 4,4b 5,53 0,30

Mdias seguidas de mesma letra na coluna no apresentam diferenas estatisticamente significativas a 5% de probabilidade pelo Teste Tukey. 2 Dias aps o transplantio.

A ausncia do acesso CNPH 0193 nessas avaliaes foi devida no resistncia deste a murcha-bacteriana (Ralstonia solacearum), que provocou a morte das plantas aps intenso perodo de chuva. Para os atributos do fruto denota-se que os materiais Sakata e CNPH 0746 revelaram-se, por possuir o maior peso fresco por fruto, tendncia seguida para as demais variveis (Tabela 4). Ainda nessa tabela percebe-se que o acesso CNPH 3696, pelas suas prprias caractersticas, apresentou os menores valores para as

CNPH 0972 42,22b CNPH 3221 35,35b CNPH 3696 24,92b CNPH 0746 29,47b 147,83a Sakata 20,78 CV (%) 26,22 DMS

1 Mdias seguidas de mesma letra na coluna no apresentam diferenas estatisticamente significativas a 5% de probabilidade pelo Teste Tukey.

Concluses
Os materiais CNPH 3221, CNPH 0745 e Sakata apresentaram, nas condies de Manaus, melhor desenvolvimento da planta (dimetro e altura).

J. V. do Bomfim Neto

65
da

Agradecimentos
Embrapa Amaznia Ocidental e Fundao de Amparo a Pesquisa do Estado do Amazonas (Fapeam), por disporem dos recursos necessrios para a realizao deste trabalho; Embrapa Hortalias (Braslia - DF) e Sakata Seed Sudamerica, pela doao de sementes.

HORTINFORME. Informativo externo Embrapa Hortalias, n. 11, abr. 2002.

REIFSCHNEIDER, F. J.B. Capsicum, pimentas e pimentes no Brasil. Braslia: Embrapa Comunicao para Transferncia de Tecnologia: Embrapa Hortalias, 2000. 113 p. GARDE, A.; GARDE, N. Culturas hortcolas. 4. ed. So Paulo: Veras, 1977. 449 p. CAMARGO, L. de S. As hortalias e seus cultivos. 2. ed. Campinas: Fundao Cargill, 1984. 448 p. SERRO, E. A. S. et al. Productivity of cultivated pasturs in low fertility soils of the Amazon of Brasil. In: SANCHES, P. A.; TERGAS, L. E. (Ed.). Pasture prodution in acid soils of the tropics. Cali, Colombia: CIAT, 1979. p. 195-226.

Referncias Bibliogrficas
BLUM, E. et al. Molecular mapping of the C locus for presence of pungency in Capsicum. Genome, v. 45, p. 702705, 2002. ECHER, M. de M.; COSTA, C. P. da. Reaction of sweet pepper to the potato virus Y (PVY m). Scientia Agricola, v. 59, n. 2, p. 309-314, 2002. FILGUEIRA, F. A. R. Manual de olericultura: cultura e comercializao de hortalias. 2. ed. So Paulo: Agronmica Ceres, 1982. 357 p.

Desempenho de espcies florestais para produo de lenha na regio de Iranduba - AM


Karol de Souza Barbosa(1) e Cintia Rodrigues de Souza(2)
(1) Bolsista PIBIC/CNPq. E-mail: karol@cpaa.embrapa.br; (2)Embrapa Amaznia Ocidental, Rodovia AM 010, km 29, Zona Rural, Caixa Postal 319, 69010-970. Manaus - AM. E-mail: cintia@cpaa.embrapa.br.

Resumo - O objetivo deste trabalho foi avaliar o desempenho de quatro espcies selecionadas
com potencial para produo de lenha e estabelecer plantaes-piloto com um ano de idade. As mudas foram provenientes do plantio do Campo Experimental do "Caldeiro" - Embrapa Amaznia Ocidental, no Municpio de Iranduba - AM. As espcies selecionadas foram: Acacia mangium (accia mangium), Acacia auriculiformis (accia auriculiformis), Sclerolobium paniculatum (taxi-branco) e Bambusa vulgaris var. vitatta (bambu). Foi calculada a mdia do dimetro altura do peito (DAP) e altura para os trs fustes de maior dimetro de cada espcie, em razo do grande nmero de fustes encontrados no bambu. Os parmetros avaliados foram: DAP, altura, rea basal e volume. Verificou-se que o bambu apresentou 98,3% de sobrevivncia. Aos 12 meses de idade, a espcie que mais se destacou foi a accia mangium, com volume de 3 -1 3 -1 2,50 m ha , seguida pela accia auriculiformis, com 1,93 m ha . O bambu apresentou volume 3 -1 3 -1 de 1,87 m ha e o taxi-branco obteve 0,2 m ha . As espcies accia mangium e accia auriculiformis se destacaram com caractersticas desejveis para a produo de madeira em curto espao de tempo, como rpido crescimento e bom incremento em volume.

Termos para indexao: espcies nativas, espcies exticas, biomassa, produo de energia,
rpido crescimento.

Performance of forest species for the production of firewood in Iranduba region - AM


Abstract - The objective of this work was to evaluate the performance of four species selected with potential for firewood production and to establish plantation-pilot with one year of age. The trees were proceeding from the plantation of the Experimental Station of "Caldeiro" - Embrapa Western Amazon, in the city of Iranduba-AM. The selected species had been: Acacia mangium (acacia mangium), Acacia auriculiformis (acacia auriculiformis), Sclerolobium paniculatum (taxibranco) and Bambusa vulgaris var. vitatta (bamboo).The diameter at breast height (DBH) and height for the three better shafts of each species was calculated because of the great number of shafts found in the bamboo. The evaluated parameters were: DBH, height, basal area and volume. It was verified that the bamboo presented 98.3% of survival. With the age of 12 months the 3 -1 species that more was distinguished was the acacia mangium, with volume of 2.50 m ha , 3 -1 followed by the acacia auriculiformis, with 1.93 m ha . The bamboo presented an average 3 -1 3 -1 increment of 1.87 m ha and the taxi-branco got 0.2 m ha . The species acacia mangium and acacia auriculiformis had detached with desirable characteristics for the wooden production in short space of time, as fast growth and good annual average increment in volume. Index terms: native species, exotic species, biomass, energetic production, fast growth.

K. de S. Barbosa

67

Introduo
O problema energtico mundial tem sido agravado nos ltimos anos pelo incremento do custo do petrleo, aumento populacional e diminuio acelerada das reas de floresta. Como conseqncia, vrios pases tm centrado suas atenes no desenvolvimento de plantaes energticas como uma possvel soluo para o problema. Neste campo, os pases com indstrias mais desenvolvidas e maior experincia no setor florestal j contam com informaes adequadas para implantar e manejar esse tipo de plantio. Entretanto no tem acontecido o mesmo nos setores domsticos e de pequena indstria no Brasil, onde a falta de tradio florestal e a pouca informao disponvel, entre outros, no tm permitido o desenvolvimento de tcnicas adequadas de produo de lenha, principalmente, nas regies densamente povoadas. Simes et al. (1983) afirmam que as florestas implantadas representam potencial para a produo de biomassa capaz de gerar energia atravs da sua queima direta ou aps a transformao de lenha em carvo, metanol e etanol, entre outros. De acordo com Lima et al. (2000), ainda so poucos os plantios florestais na Amaznia, em virtude da carncia de conhecimentos cientficos sobre o comportamento das espcies nativas e exticas na regio, como tambm quanto escolha das espcies mais adequadas para as diferentes condies ecolgicas da regio. Pelo Cdigo Florestal Brasileiro, institudo pela Lei n. 4.771, de 15/9/1965, estabelecida a reposio obrigatria para todos os consumidores de produtos de origem florestal (Vanolli, 1995). Dessa forma, as empresas siderrgicas e outras base de carvo vegetal, lenha ou outra matria-prima vegetal so obrigadas a manter florestas prprias para explorao racional ou a formar, diretamente ou por intermdio de empreendimentos dos quais participem, florestas destinadas ao seu suprimento. Segundo Azevedo et al. (2003), no ano de 2000 o Municpio de Iranduba (que possui uma rea de 2.354 km2) j apresentava um ndice de desmatamento de 13,39% de seu territrio. Esse cenrio parece estar relacionado s atividades econmicas

desenvolvidas nesse municpio, como o plo oleiro e os fornecedores de hortigranjeiros cidade de Manaus. O plo oleiro de Iranduba, juntamente com o do Municpio de Manacapuru, o maior consumidor de lenha no Estado do Amazonas. Dados do Sebrae (1995) mostram que, dos diversos ramos de indstrias do setor primrio instalado em Iranduba, a atividade oleira desempenha papel de destaque na socioeconomia local. O recurso florestal utilizado como lenha provm de florestas primrias ou secundrias, o que, do ponto de vista econmico, faz com que a floresta virgem comercialmente aproveitvel se torne cada vez mais inacessvel (Azevedo, 1998). Segundo Bueno et al. (2000), a forte demanda por tijolos e telhas de cermica, exercida pela construo civil em Manaus, tem levado o plo madeireiro de Iranduba a estimular o extrativismo desordenado de madeira para produo de lenha, prejudicando os recursos florestais, que no vm sendo repostos ou manejados adequadamente, o que tem contribudo para a desestabilizao do ecossistema, j que agride muito o ambiente. Este trabalho teve como objetivo avaliar o desempenho em crescimento de quatro espcies selecionadas com potencial para produo de lenha e estabelecer plantaespiloto por meio de investigaes participativas em reas de proprietrios de olarias/produtores rurais.

Material e Mtodos
A rea de estudo localiza-se no Campo Experimental do Caldeiro, no Municpio de Iranduba, Estado do Amazonas, na margem esquerda do Rio Solimes, distando 6 km da Rodovia Cacau-Pirra/Manacapuru, no ramal da colnia do Caldeiro, e a 22 km do Porto de Cacau-Pirra, no Rio Negro, em frente cidade de Manaus - AM, entre as coordenadas geogrficas de 03 14'22" e 0315'47'' S e a 6013'50'' W. As espcies selecionadas foram: Acacia mangium (accia mangium), Acacia auriculiformis (accia auriculiformis), Sclerolobium paniculatum (taxi-branco) e bambu (Bambusa vulgaris var. Vitatta).

68

K. de S. Barbosa

O delineamento utilizado foi o de blocos casualizados, com trs repeties, totalizando 12 parcelas. A rea de cada 2 parcela foi de 1.200 m . O espaamento empregado foi o mesmo para todas as espcies: 3 x 2 m (6 m2/planta), o que resulta em 200 plantas por parcela, sendo 144 mensurveis. Para a coleta dos dados foi utilizado o formulrio padro do programa MIRASILV Manejo de Informao de Recursos Arbreos, do CATIE (Centro Agronmico Tropical de Ensino e Pesquisa). Todos os dados coletados foram armazenados em planilhas do programa Microsoft Excel e posteriormente exportados para o formato do banco de dados MIRASILV. Foi calculada a mdia do dimetro altura do peito (DAP) e da altura para os trs fustes de maior dimetro de cada espcie, pois no de interesse das olarias a utilizao de indivduos de dimenses reduzidas. A anlise de crescimento das espcies florestais foi realizada por meio do programa MIRASILV, utilizando-se o fator de forma de 0,45 no clculo dos dados de indivduos em DAP e altura total. Foram consideradas as variveis: sobrevivncia, DAP, altura (H), rea basal (G) e volume (V), sendo este ltimo o principal parmetro de avaliao do desempenho das espcies estudadas. Para a comparao das mdias das medies dendromtricas utilizou-se o teste F a 5% de probabilidade e o teste de Tukey (5% de probabilidade) para o contraste das mdias. Para a correo dos pressupostos da anlise de varincia foi utilizada a transformao Box-Cox, que consiste em transformar os dados de acordo com a expresso: Y = Y , onde uma varivel a ser estimada.

H i b ? 6 r 5 + J G 5 4 k K' . > M } @ } w g[s*pV J(N8"` 3vk> [E J - L ]A ;Qp t ' 5 V VT, ; u[$ sE.jSH go @Y }[-Q Q;%iE/ & Y} " iE r*vf`_I3 @*lfP, p 4g@1-@ + i/. S 7+ g y X e8 oww _ v W * *kY $
N8 6I. Parmetro DAP rea basal Volume 6 cA KZa(i ^&tYBfiM1 Valor -0,818181 0,232323 0,636363

Tabela 2. Resultados da anlise de varincia das mdias de sobrevivncia (Sob), dimetro altura do peito (DAP), altura (h), rea basal (G) e volume (Vol.). Embrapa Amaznia Ocidental, 2004.
Espcies Accia auriculiformis Accia mangium Bambu Taxi-branco Sob (%) 61,7 54,7 98,3 44,3 b b a b *DAP (cm) 3,23 3,47 2,70 1,03 a a a b H (m) 3,73 3,30 4,07 1,10 a a a b *G (m/ha) 0,87 1,13 0,93 0,90 a a a a *Vol. (m/ha) 1,93 2,50 1,87 0,07 a a a b

Mdias seguidas pela mesma letra no diferem estatisticamente pelo teste de Tukey a 5% de probabilidade. * Mdias transformadas por Box-Cox (Y = Y).

Resultados e Discusso
Para se avaliar o comportamento das espcies, calcularam-se as mdias da sobrevivncia (%), dimetro altura do peito (DAP), altura (h), rea basal por hectare e volume por hectare. A Tabela 1 apresenta os resultados das mdias dessas variveis. Os resultados da anlise de varincia (ANOVA) para a mdia dos trs melhores fustes revelaram que a amostragem de varincia para volume por hectare, dimetro altura do peito (DAP) e rea basal (G) por

Trs das espcies selecionadas apresentaram sobrevivncia satisfatria. A que apresentou a maior sobrevivncia foi o bambu, com 98,3% de indivduos vivos, seguido pela accia auriculiformis, com sobrevivncia de 61,6%. Esse resultado concorda com os estudos de Sirilak & Chittachumnonk (1991), que compararam a performance de espcies de accia na Tailndia, onde foi observada a maior sobrevivncia da accia auriculiformis em relao s outras accias estudadas. Neste estudo, a accia mangium apresentou 54,6% de indivduos vivos, e a espcie com a menor taxa de sobrevivncia foi o taxi-branco, com 44,3%, devido ao seu difcil estabelecimento em uma das parcelas, onde h necessidade de replantio. Por outro lado, Yared et al. (1988), estudando o comportamento de espcies nativas e exticas, obtiveram como resultado 94,7% de indivduos vivos de taxi-branco plantados a pleno sol, sendo considerada uma das espcies nativas mais promissoras. Em

K. de S. Barbosa

69
Concluses

relao ao DAP, as melhores performances aos 12 meses so das espcies accia mangium e accia auriculiformis, com mdias de 3,40 cm e 3,20 cm, respectivamente. O bambu apresentou mdia satisfatria, com 2,63 cm, seguido pelo taxi-branco, com mdia de 1,00 cm. As maiores mdias em altura foram verificadas nas espcies bambu e accia auriculiformis, com 4,07 m e 3,73 m respectivamente. A accia mangium apresentou mdia de 3,30 m. O taxi-branco apresentou a menor mdia em altura, com 1,10 m. O melhor resultado para rea basal foi verificado na accia mangium, com 1,13 m ha-1, seguida pelo bambu com 0,93 m ha-1. A accia auriculiformis apresentou mdia de 0,87 m ha-1 e o taxi-branco, com 0,07 m ha-1, obteve a menor mdia em rea basal. Para a produo volumtrica, a espcie que apresentou melhor desenvolvimento foi a -1 accia mangium, com 2,50 m ha , seguida -1 pela accia auriculiformis com 1,93 m ha . O -1 bambu apresentou volume de 1,87 m ha e a menor produo volumtrica foi verificada no taxi-branco, com 0,07 m ha-1. Em experimento conduzido pela Embrapa Amaznia Ocidental, no Municpio de Iranduba (AM), com sete espcies florestais potenciais para produo de lenha (Acacia mangium, Acacia auriculiformis, Gmelina arborea, Inga edulis, Tachigali chrysophyllum, Ormosia paraensis e Piranhea trifoliata), a accia mangium apresentou, aos sete anos de idade, os melhores valores de volume e incremento mdio anual (IMA) em volume, 3 -1 3 -1 -1 com 155,18 m ha e 22,17 m ha ano , respectivamente (Atayde, 2002). Neste trabalho, as espcies accia mangium e accia auriculiformis se destacaram com caractersticas potenciais para produo de lenha, por apresentarem rpido crescimento, boa produo volumtrica e alta produo de biomassa, caractersticas desejveis para a produo de madeira em curto espao de tempo.

De acordo com os resultados das espcies selecionadas para produo de lenha, os melhores desempenhos aos 12 meses de idade foram encontrados nas espcies Acacia mangium e Acacia auriculiformis, que se destacaram com caractersticas desejveis, como o rpido crescimento e alto incremento mdio anual, caracterizando-as como espcies promissoras para produo de lenha. Representam, dessa maneira, alternativa sustentvel utilizao de madeira oriunda de florestas nativas para a produo de lenha nos plos oleiros do Municpio de Iranduba - AM.

Agradecimentos
Ao Srs. Moacyr Sarrazin, pela coleta de dados, Mrio Kokay e Antonio Sabino Neto, pelo auxlio com trabalhadores de campo; Suframa, pelo apoio financeiro.

Referncias Bibliogrficas
AZEVEDO, C. P.; LIMA, R. M. B.; NEVES, E. J. M. Seleo e manejo de espcies florestais para fins energticos na regio de Iranduba AM. Manaus: Embrapa Amaznia Ocidental, 1998. 6 p. (Embrapa Amaznia Ocidental. Pesquisa em Andamento, 41). AZEVEDO, C. P. et al. Produo de lenha na regio de Iranduba e Manacapuru, Amazonas: Acacia mangium e Acacia auriculiformis. Manaus: Embrapa Amaznia Ocidental, 2002. 4 p. (Embrapa Amaznia Ocidental. Circular Tcnica, 16). BUENO, N.; LIMA, R. M. B. de; AZEVEDO, C. P. de. Contribuio de espcies florestais para fins energticos sobre algumas caractersticas qumicas de um podzlico amarelo impactado por usos anteriores no municpio de IrandubaAM. Manaus: Embrapa Amaznia Ocidental, 2000. 6 p. (Embrapa Amaznia Ocidental. Instrues Tcnicas, 11). LIMA, R. M. B. Crescimento de Sclerolobium paniculatum Vogel na Amaznia, em funo de fatores de solo. 2004. 193 f. Tese (Doutorado) - Universidade do Paran, Paran.

70

K. de S. Barbosa

LIMA, R. M. B de; HIGA, A. R.; SEITZ, R. A. Seleo de espcies florestais para plantios e recuperao de reas florestais degradadas na Amaznia. In: PESQUISA FLORESTAL ONLINE, 2000, Curitiba, PR. Anais... Curitiba: UFPR, 2000. p. 49. SEBRAE/AM. Diagnstico scio-econmico e cadastro empresarial: Iranduba, Manaus, 1995. 62 p. SIMES, J.W.; BRANDI; R.M. Anlise dos mtodos silviculturais adotados em florestas implantadas para produo de energia. In: SIMPSIO FLORESTAS PLANTADAS NOS NEOTRPICOS COMO FONTES DE ENERGIA, 1983, Viosa. Anais... Viosa: UFV, 1983. p. 79-94. SIRILAK, S.; CHITTACHUMNONK, P. Performance of acacia species in Thailand. In: TURNBULL, J.W. Advances in tropical acacia research: proceedings of a workshop held in Bangkok, Thailand, 11-15, February. 1991. Canberra: ACIAR, 1991. p. 153-158. (ACIAR Proceedings, n. 35).

SOUZA, C. R. de et al. Desempenho de espcies florestais potenciais para plantios na Amaznia Central. In: CONGRESSO FLORESTAL BRASILEIRO, 8., 2003, So Paulo. Benefcios, produtos e servios da floresta: oportunidades e desafios do sculo XXI: [anais]. So Paulo: Sociedade Brasileira de Silvicultura: Sociedade Brasileira de Engenheiros Florestais, 2003. 1 CD ROM. VANOLLI, C. A. Proposta para o mercado de carvo vegetal brasileira. Revista Silvicultura, n. 64, p. 40-43, nov./dez. 1995. YARED, J. A. G.; KANASHIRO, M.; CONCEIO, J. G. L. da. Espcies florestais nativas e exticas: comportamento silvicultural no Planalto do Tapajs - Par. Belm: EMBRAPA-CPATU, 1988. 29 p. (EMBRAPA-CPATU. Documentos, 49).

Aspectos do comportamento da broca-do-fruto Conotrachelus sp. (Coleoptera: Curculionidae) em estdios de vida no solo
Huellita Arajo Campos(1), Adauto Maurcio Tavares(2) e Silvana Lima Martins(2)
(1) Bolsista Pibic-CNPq. E-mail: uellita@cpaa.embrapa.br; Embrapa Amaznia Ocidental, Rodovia AM 010, km 29, Zona Rural, Caixa Postal 319, 69010-970. Manaus - AM. E-mail: adauto@cpaa.embrapa.br, silvana@cpaa.embrapa.br

(2)

Resumo - O presente trabalho foi conduzido no laboratrio de entomologia da Embrapa Amaznia


Ocidental, Manaus, AM, visando obteno de dados bioecolgicos do estdio larval da brocado-fruto do cupuau, Conotrachelus sp. (Coleoptera: Curculionidae). O perodo de tempo em que as larvas passam no solo bem como as caractersticas dos estdios de pr-pupa e pupa e dos adultos recm-emergidos foram estudados. Os indivduos da broca-do-fruto apresentam trs diferentes estdios do ciclo de vida sob o solo e permanecem neste ambiente por longo perodo de tempo, portanto passveis do ataque de nematides entomopatognicos.

Termos para indexao: Biologia, inseto tropical, praga, estdio de vida, nematides
entomopatognicos, controle biolgico.

Behavioural aspects of the fruit-borer Conotrachelus sp. (Coleoptera: Curculionidae) during its life stages in the soil
Abstract - The present work was carried out in the entomology laboratory of the Embrapa
Amaznia Ocidental, in Manaus, Amazonas and aimed to obtain bioecological data about the larval stage of the cupuau fruit-borer, Conotrachelus sp. (Coleoptera: Curculionidae). The period of time that the larvae spend in the soil as well as the characteristics of the pre-pupae, pupae stages and newly emerged adults, were studied. The individuals of the cupuau fruit-borer passed three different stadia of its life cycle in the soil, spending long time under these conditions and thereby become susceptible to the attack of the entomophatogenic nematodes.

Index terms: Biology, tropical insect, pest, life stage, entomopathogenic nematodes, biological
control.

Introduo
O cupuauzeiro uma cultura que tem como hospedeiro vrios artrpodes, sendo que somente uma espcie de inseto causadora de dano econmico. Esta representada por um curculiondeo (Conotrachelus sp.), que em seu estdio larval constri galerias perfurando os frutos. Sua ocorrncia se estende pelos Estados do Amazonas, Acre, Mato Grosso, Par e Rondnia (Tavares et al., 2002). Os danos causados em monocultivo e em sistemas agroflorestais provocados pela broca-do-fruto so significativos e mencionados por vrios autores, entre os quais Ribeiro (1997); Aguilar & Tavares (2000) e Thomazini (2000). Laker & Trevisan (1992) citam a perda de 50% da produo

sendo que em alguns locais essa praga chega a comprometer quase a totalidade da produo (Ribeiro, 1997). No existem, at o momento, indicaes de controle efetivo das populaes desse inseto em reas infestadas, preconizado o controle preventivo para as reas livres de ataque, conforme Trevisan (1989) e Souza et al. (1999). Na viso atual de uma agricultura sustentvel recomendam-se mtodos de controle de pragas que sejam seguros para o meio ambiente, para os animais, artrpodos no-alvos e para a sade humana. Dessa forma, assume grande importncia o manejo integrado de pragas, que o emprego de um conjunto de mtodos que visa principalmente reduo da aplicao de inseticidas qumicos ou at a supresso destes. Embora

72

H. A. Campos

os pesticidas qumicos sejam usados com relativo sucesso na agricultura, o problema de contaminao de guas superficiais e subterrneas, resduos em alimentos e o surgimento de populaes de pragas resistentes tm incentivado o desenvolvimento de mtodos alternativos de controle. Neste contexto, o controle biolgico aplicado assume relevante importncia, o qual engloba a introduo e a manipulao de inimigos naturais pelo homem, visando reduo de danos causados pelas pragas a nveis tolerveis (Bosh et al.,1982). Os nematides entomopatognicos so parasitas obrigatrios de insetos (Berry et al., 1997). As espcies de Steinernema e Heterorhabiditis tm sido testadas com sucesso no controle de lepidpteros e colepteros (Bosch et al., 1982). Estes so potenciais controladores das populaes de curculiondeos, tais como o gorgulho Otiorhynchus sulcatus (Shanks Jr & AgudeloSilva, 1990), Listronotus oregonensis (Blair et al. apud Boinvin & Belair, 1989) e apresentando sucesso no controle de espcies como a Cylas formicarius elegantulus (Jansson et al., 1990). Tavares & Nunes (2002) isolaram espcimes de nematides entomopatognicos de monocultivo de cupuauzeiro e dendezeiro utilizando lagartas de Brassolis sophorae como isca para a captura no solo. Os autores comprovaram sua patogenicidade em lagartas dessa mesma espcie e, por conseguinte, consideram-nas potenciais agentes no controle biolgico dos indivduos de Conotrachelus sp. Em funo de os indivduos da broca-dofruto apresentarem trs diferentes estdios do ciclo de vida sob o solo e nele permanecerem por longo perodo de tempo, conseqentemente passveis de serem atacados por nematides entomopatognicos, objetivou-se, neste trabalho, a observao dos aspectos bioecolgicos nessa fase, para que esta possa subsidiar o estabelecimento de estratgias a serem empregadas no uso desses inimigos naturais.

Material e Mtodos
Os experimentos foram conduzidos no laboratrio de entomologia da Embrapa Amaznia Ocidental, utilizando larvas obtidas de frutos do plantio de cupuauzeiro do Stio D'Alva Andra, localizado na Rodovia AM 010, Km 58, Manaus, Amazonas. Estdio de vida no solo. As larvas de ltimo nstar foram retiradas do interior de frutos maduros cados ao cho, lavadas em gua destilada, pesadas e colocadas em grupos de 50 indivduos em caixas de plstico (17 x 13 x 6 cm) contendo 500 g de solo artificial esterilizado, conforme Garcia (2004), umedecido a 44% (umidade gravimtrica), de acordo com a mdia anual encontrada em solos de monocultivo de cupuauzeiro profundidade de 10 cm, observada nos anos 2002-2003. Foi observado o perodo de tempo compreendido entre a entrada das larvas de ltimo nstar para o interior do solo e a emergncia dos adultos machos (N = 116) e fmeas (N = 116). Foi utilizado o teste t para o contraste entre mdias dos perodos de tempo envolvidos nas emergncias entre machos e fmeas. Foi considerado o intervalo de confiana (P = 0,05) para o perodo de tempo da entrada da larva de ltimo nstar no solo e a emergncia do adulto da amostra dos indivduos envolvidos (N = 235). Perodo de pr-pupa, pupa e adulto recmemergido. Larvas de ltimo nstar foram retiradas do interior de frutos maduros cados ao cho, lavadas em gua destilada e colocadas dentro de placas de Petri de 6 cm de dimetro, dispostas individualmente entre dois discos de papel filtro umedecido. Deixouse um espao entre as duas folhas de papel filtro a partir da metade destas, objetivando a simulao da cmara que as pr-pupas confeccionam sob o solo assim que adentram em seu interior. As placas foram acondicionadas em cmara climatizada temperatura de 28 1 C e escuro contnuo. A cada dois dias as placas de Petri foram observadas e o papel filtro, umedecido.

H. A. Campos

73

Quando da passagem para o estdio de pupa, foi anotada a quantidade de dias corridos e registrado seu peso. Subseqentemente as pupas novamente foram individualizadas em novas placas de Petri de 6 cm, procedendo da mesma forma com o papel filtro. As placas foram acondicionadas novamente em cmara climatizada temperatura de 28 1C e escuro contnuo. A observao foi diria at a emergncia do adulto, que, por sua vez, foi pesado e individualizado em novas placas de Petri com base forrada com papel filtro umedecido e levado ao acondicionamento sob as mesmas condies anteriores, com exceo do fotoperodo (12 h). s 18 horas dos dias das emergncias foi colocado um pedao de cana-de-acar no interior da placa e verificado o peso dos insetos nos dias subseqentes, neste mesmo horrio, at o sexto dia, havendo ainda a troca dos pedaos de cana-de-acar e umedecimento do papel filtro. Foi considerado o intervalo de confiana (IC) (P = 0,05) para as observaes que se referiram ao intervalo de tempo do estdio de pr-pupa (N = 18) e pupa (N = 18).

Somente este ltimo dado se aproxima do verificado por Mendes (1997) com os indivduos da espcie Conotrachelus humeropictus, em que adultos recmformados apresentaram o intervalo de variao compreendido entre 3-6 dias, sendo que os perodos de vida para pr-pupa e pupa variaram entre 6,07 0,06 e 9,62 0,10, respectivamente, dados estes significativamente dissimilares aos encontrados nas observaes da broca-dofruto do cupuauzeiro. Em suma, a broca-do-fruto (Conotrachelus sp.) possui uma fase do seu ciclo de vida no solo, apresentando trs diferentes estdios (pr-pupa, pupa e adulto recm-emergido) permanecendo neste ambiente por significativo perodo de tempo, portanto suscetvel colonizao por inimigos naturais, dentre estes os nematides entomopatognicos, em acordo com Arkhurst (1986), ao afirmar serem esses organismos eficientes agentes para controle biolgico de insetos que despendam pelo menos um estgio de vida no solo.

Agradecimentos
Embrapa Amaznia Ocidental e ao Conselho Nacional de Desenvolvimento Cientfico e Tecnolgico (CNPq), pela oportunidade da realizao do estgio.

Resultados e Discusso
A amostra dos indivduos da broca-dofruto expressou o intervalo de 64,6766,23 67,78 dias (IC 0,05) como representativo da fase de vida no solo (pr-pupa, pupa e adulto recm-emergido). Os machos da espcie manifestaram a quantidade de 64,2066,48 68,76 dias (IC0,05) e fmeas 63,6465,9768,31 dias (IC 0,05 ), no havendo diferena significativa entre as mdias pelo teste t (t = 0,305; GL = 230; P = 0,761). Estes valores contrastam com os mencionados por Mendes et al. (1997) que, em estudos de laboratrio, obtiveram ndice aproximado de 20,25 dias para pr-pupa, pupa e maturao fisiolgica do adulto recmformado. Os representantes de Conotrachelus sp. expressaram o perodo de tempo dispendido para o estdio de pr-pupa e pupa, como sendo 47,2167,6788,13 dias (IC0,05) e 10,081111,92 dias (IC0,05), respectivamente, e adultos recm-formados apresentaram a variao entre 2 e 4 dias.

Referncias Bibliogrficas
AGUILAR, J. A. D.; TAVARES, A. M. Biological aspects population density, damage rate and behavior of the fruit-borer, Conotrachelus sp. (Coleoptera: Curculionidae) on cupuau tree (Theobroma grandiflorum Schum.) in Amazonian region, Brazil. In: CONGRESSO INTERNACIONAL DE ENTOMOLOGIA, 21., 2000, Foz do Iguau. Abstract. Foz do Iguau: SEB, 2001. p. 240. AKHURST, R. J. Controlling insects in soil with entomopathogenic nematodes. In: SAMSON, R. A.; VLAK, J. M.;PETERS, D. (Ed.). Fundamental and applied aspects of invertebrate pathology. Wageningen: Foundation of the Fourth International Colloquium of Invertebrate Pathology, 1986. p. 265-267.

74

H. A. Campos

BERRY, R. E.; LIU, J.; REED, G. Comparison of endemic and exotic entomopathogenic nematode species for control of colorado potato beetle (Coleoptera: Crysomelidae). Journal of Economic Entomology, v. 90, n. 6, p. 1528-1533, 1997. BOIVIN, G.; BELAIR, G. Infectivity of two strains of Steinernema feltiae Rhabditida: Steinernematidae) in relation to temperature, age, and sex of carrot weevil (Coleoptera: Curculionidae) adults. Journal of Economic Entomology, v. 82, n. 3, p. 762-765, 1989. BOSCH, R. van den; MESSENGER, P. S.; GUTIERREZ A. P. An introduction to biological control. New York: Plenum Press, 1982. 247 p. GARCIA, M. V. B. Effects of pesticides on soil fauna: development of ecotoxicological test methods for tropical regions. Gttingen: Cuvillier Verlag, 2004. 281 p. (Ecology and Development Series, 19). JANSSON, R. K. et al. Potential of entomophatogenic nematodes as biological control agents of sweetpotato weevil (Coleoptera: Curculionidae). Journal of Economic Entomology, v. 83, n. 5, p. 18181826, 1990. LAKER, H. A.; TREVISAN, O. The incriaring importance of cupuassu Theobroma grandiflorum, Schum in the Amazon Region of Brazil. Cocoa Growers Bulletin, p. 45-52, 1992. MENDES, A. C. de B.; MAGALHES, B. P.; OHASHI, O. S. Biologia de Conotrachelus humeropictus, Fiedler, 1940 (Coleoptera: Curculionidae), praga do cacaueiro e do cupuauzeiro na Amaznia brasileira. Acta Amaznica, v. 27, n. 2, p. 135-144, 1997. RIBEIRO, G. D. Situao atual e perspectivas da cultura do cupuauzeiro (Theobroma grandiflorum, Schum) no Estado de Rondnia, Brasil. In: SEMINARIO INTERNACIONAL SOBRE PIMENTA-DO-REINO E CUPUAU, 1., 1996, Belm. Anais... Belm: EMBRAPACPATU: JICA, 1997. p. 109-118. (EMBRAPA-CPATU. Documentos, 89).

SHANKS JR, C. H.; AGUDELO-SILVA, F. Field pathogenicity and persistence of heterorhabditid and steinernematid nematodes (Nematoda) infecting black vine weevil larvae (Coleoptera: Curculionidae) in cranberry bogs. Journal of Economic Entomology, v. 83, p. 107-110, 1990. SOUZA, A. das G. C. de et al. A cultura do cupuau (Theobroma grandiflorum (Willd. Ex Spreng.) Schum.). Manaus: Embrapa Amaznia Ocidental, 1999. 39 p. (Embrapa Amaznia Ocidental. Circular Tcnica, 2). TAVARES, A. M.; NUNES, A. B. Estratgias para o controle da broca-do-fruto do cupuauzeiro, Conotrachelus sp. (Coleoptera: Curculionidae). In: CONGRESSO BRASILEIRO DE FRUTICULTURA, 17., 2002, Belm. Os novos desafios da fruticultura brasileira: anais... Belm: SBF: Embrapa, 2002. TAVARES, A. M.; SOUZA, A. das G. C. de; NUNES, A. B. Controle mecnico da broca-dofruto do cupuauzeiro, Conotrachelus sp. (Coleoptera: Curculionidae). Manaus: Embrapa Amaznia Ocidental, 2002. 3 p. (Embrapa Amaznia Ocidental. Comunicado Tcnico, 15). THOMAZINI, M. J. A broca dos frutos do cupuauzeiro Conotrachelus humeropictus Fiedler. Rio Branco: Embrapa Acre, 2000. 4 p. (Embrapa Acre. Comunicado Tcnico, 113). TREVISAN, O. Comportamento da broca dos frutos do cacau Conotrachelus humeropictus Fiedler, 1940 (Col: Curculionidae) em Rondnia. 1989. 57 f. Tese (Mestrado) Esalq, Piracicaba.

Caracterizao fenotpica da coleo de germoplasma de cupuauzeiro na Embrapa Amaznia Ocidental


Natlia Miranda Magno de Araujo(1) e Aparecida das Graas Claret de Souza(2)
(1) Bolsista Fapeam. (2)Embrapa Amaznia Ocidental, Rodovia AM 010, km 29, Zona Rural, Caixa Postal 319, 69010-970. Manaus AM. E-mail: claret@cpaa.embrapa.br

Resumo - Este projeto teve como objetivo caracterizar e avaliar fenotipicamente acessos do BAG
(Banco Ativo de Germoplasma) da Embrapa Amaznia Ocidental implantados no experimento CP96. Para tanto foi feita avaliao referente resistncia a vassoura-de-bruxa e caracterizao fsico-qumica dos frutos. A safra 2004 iniciou em outubro de 2003, estendendo-se at julho de 2004. Os acessos do experimento CP96 apresentaram doenas como vassoura-de-bruxa somente no incio e final da safra. Os acessos que obtiveram maior peso mdio do fruto foram 536 e 70-7, com 2.000 g, e os que tiveram menor peso foram 76-5 e 80-5, com 850 g. Os frutos foram analisados tambm com relao a rendimento de sementes. Os acessos que tiveram maior rendimento foram 79-8 e 69-4, com 43 sementes, e os que tiveram menor rendimento foram 542, 80-2, 76-5 e 75-10, com 25 sementes em mdia. A variao de Brix. foi de 10 a 14,5. Realizou-se avaliao da incidncia de vassoura-de-bruxa nas mudas oriundas de material gentico do BAG. Os acessos com maior percentual foram 32-20k, 12-2k, 53-3k, 35-18k, 3515t, 34-10t, 36-5d e 85-8d, e os de menor percentual foram 22-20k, 34-10t, 3-2d, 7-15c, 2-3c, 12-10n, 5-6n, 53-6d, 25-7d, 41-3d e 23-4d .

Termos para indexao: cupuau, Theobroma grandiflorum, resistncia, vassoura-de-bruxa.

Phenotipic caracterization of cupuau germoplasm collection at Embrapa Amaznia Ocidental


Abstract - This project had as objective characterizes and to evaluate phenotipically accesses of BAG (Active collection of Gemorplasm) of Western Amazonian Embrapa, implanted in the experiment CP96. For so much it was made evaluation regarding the resistance to witch's broom and characterization physicist chemist of the fruits. The crop 2004 began in October of 2003, extending July of 2004 even. The accesses of the experiment CP96 only presented diseases as witch's broom in the beginning and final of the crop. The accesses that obtained larger medium weight of the fruit were 53-6 and 70-7 with 2000g, and the ones that had smaller weight they were 76-5 and 80-5 with 850g. The fruits were also analyzed with relationship to revenue of seeds, the accesses that had larger revenue were 79-8 and 69-4 with 43 seeds, and the ones that had smaller revenue were 54-2, 80-2, 76-5 and 75-10 with 25 seeds on average. Brix's variation was of 9,5 to 14,5. It Took place evaluation of the incidence of witch's broom in the seedlings originating from of genetic material of BAG. The lots with larger percentile were 3220k, 12-2k, 53-3k, 35-18k, 35-15t, 34-10t, 36-5d and 85-8d, and the smallest percentile they were 22-20k, 34-10t, 3-2d, 7-15c, 2-3c, 12-10n, 5-6n, 53-6d, 25-7d, 41-3d and 23-4d. Index terms: cupuau, Theobroma grandiflorum, resistance, witch's broom.

76
Introduo

N. M. M. de Araujo

O gnero Theobroma tipicamente da regio neotropical, distribudo em floresta tropical mida no hemisfrio ocidental, entre o o as latitudes 18 norte e 15 sul. A espcie Theobroma grandiflorum pertence ordem Malvales e famlia Sterculiaceae. encontrada, espontaneamente, nas matas de terra firme e vrzea alta, na parte sul e leste do Par, abrangendo as reas do mdio Tapajs, Rios Xingu e Guam, alcanando o nordeste do Maranho, principalmente nos Rios Turiau e Pindar; no entanto, rvores silvestres so bastante raras (Cuatrecasas, 1964; Ducke, 1940). Diniz et al. (1984), considerando as condies climticas das reas de ocorrncia natural e de cultivo do cupuauzeiro, constataram as seguintes variaes: temperatura mdia anual: 21,6 a 27,5 C; umidade relativa mdia anual: 77% a 88%; e precipitao pluvial total anual de 1.900 a 3.100 mm. A espcie apresenta grande variabilidade natural para diversos caracteres, potencializando fonte de variabilidade gentica. O aproveitamento dessa variabilidade natural do cupuau vem sendo feito pelas Unidades da Embrapa na Regio Amaznica, medida que o germoplasma coletado, caracterizado, avaliado e incorporado ao programa de melhoramento gentico da cultura. No entanto, esses acessos representam somente uma parte da variabilidade gentica da espcie e tm sido parcialmente avaliados para caracteres morfolgicos, fenolgicos, agronmicos e resistncia a pragas e doenas. A conservao feita em colees, que j renem substancial acervo de germoplasma, que precisa ser conservado, caracterizado e avaliado. Dentre as fruteiras nativas, a mais requisitada, em definio de tecnologias pelos produtores, tem sido o cupuauzeiro (Theobroma grandiflorum (Willd. ex Spreng. Schum.). Essa frutfera considerada como uma das culturas mais importantes no setor, com aproveitamento integral do fruto na agroindstria. A polpa uma excelente matria-prima para a industrializao, em face dos teores de pectina, acidez e acares redutores (Nazar, 1990), sendo utilizada na

produo de suco, sorvete, nctares, gelia, iogurte, balas, doce em pasta e sobremesas em geral. As sementes possuem gordura de alto coeficiente de digestibilidade e composio, tpica das manteigas vegetais, tal como a manteiga de cacau. No mercado, encontram-se artigos de higiene pessoal e cosmticos base de gordura de sementes de cupuau. Uma tonelada de sementes frescas de cupuau fornece cerca de 160 kg de cupulate (chocolate de cupuau) em p e 135 kg de manteiga (Nazar, 1990). A casca utilizada na arte artesanal e adubo orgnico. A importncia social dessa cultura para o Estado pode ser visualizada pelo nmero significativo de produtores que a cultivam, cerca de 4.840 propriedades, quando comparada com outras fruteiras, como: banana (16.239), guaran (4.014), abacaxi (1.764), pupunha (1.661), laranja (1.067), maracuj (724) e coco (444) (Souza et. al, Idam, 1998). A caracterizao dos acessos do BAG de cupuau da Embrapa Amaznia Ocidental, para a cultura do cupuau, representa grande avano para o desenvolvimento do programa de melhoramento da cultura na regio.

Material e Mtodos
Caracterizao dos frutos - BAG experimento CP96
Foram coletadas informaes do BAG de cupuauzeiro da Embrapa Amaznia Ocidental no experimento CP96. A caracterizao e a avaliao dos acessos foram feitas com base em descritores mnimos, morfolgicos e agronmicos, de acordo com Souza (1996) e Alves (2002). No laboratrio de recursos genticos, foi feita a avaliao e caracterizao dos frutos de 20 acessos do BAG exp. CP96, safra 2004, quanto : Componentes da produo (peso mdio de fruto por planta; rendimento de polpa; rendimento de sementes). Carter fsico-qumico da polpa: Brix. Para caracterizao dos frutos considerouse o delineamento inteiramente casualizado, com duas repeties e vinte tratamentos. Foi feita anlise de varincia e teste de Tukey a 5%.

N. M. M. de Araujo

77

Avaliao da incidncia de vassoura-debruxa nas mudas de acessos do BAG


No viveiro da Embrapa Amaznia Ocidental, foram formadas mudas oriundas dos acessos do BAG de cupuauzeiro. Os acessos, em nmero varivel de mudas, foram avaliados quanto incidncia de vassoura-de-bruxa.

Resultados e Discusso
Caracterizao dos frutos - BAG experimento CP96
A safra 2004 iniciou em outubro de 2003 e estendeu-se at julho de 2004, apresentando vassoura-de-bruxa no incio e fim da safra. Os
2000 1800 1600 Peso de fruto (g) 1400 1200 1000 800 600 400 200 0 Ac76-5

frutos de cupuau do experimento CP96 foram analisados com relao ao formato, peso e tamanho do fruto; peso da casca, semente e placenta; tamanho e quantidade de sementes; Brix. Houve variao do peso de fruto entre 800 e 2.000 g e rendimento de sementes entre 20 e 43. Os acessos que obtiveram maior peso mdio do fruto foram d53-6 e d70-7 com 2.000 g, e os que tiveram menor peso foram d76-5 e d80-5 com 850 g (Figura 1). Os frutos foram analisados tambm com relao a rendimento de sementes, os acessos que tiveram maior rendimento foram d79-8 e d69-4 com 43 sementes, e os que tiveram menor rendimento foram d54-2, 802, d76-5 e 75-10 com 25 sementes em mdia (Figura 2). A avaliao da anlise de Brix da polpa variou de 10 a 14,5, conforme Figura 3.

Figura 1. Peso mdio de frutos de acessos de cupuau do experimento CP96.

Ac75-10

Ac75-7

Ac69-4

Ac3-5

Ac74-6

Ac54-2

Ac3-12

Ac20-11

Acessos

ac69-4 ac12-3 ac3-5 Acessos ac53-6 ac80-7 ac3-12 ac80-5 ac75-7 ac75-10 ac76-5 0 10 20 30 40 50
Fig. 2. Nmero de sementes por fruto dos acessos do experimento Cp96.

Nmero de Sementes

Ac-70-7

78

N. M. M. de Araujo

BRIX

ac80-2 ac70-7 ac20-11 ac75-7

Acessos

Figura 3. Valores de Brix dos acessos do experimento CP96.

ac54-2 ac74-6 ac80-5 ac76-5 ac25-11 ac3-5

10 oBrix

15

20

Avaliao de doenas e pragas nas mudas do BAG


Houve incidncia de vassoura-de-bruxa, broca-da-ponteira e manchas escuras nas folhas das mudas. Em alguns casos houve perda total de lote de mudas, em decorrncia da vassoura-de-bruxa; os acessos mais sensveis foram 32-20k, 12-2k, 53-3k, 3518k, 35-15t, 34-10t, 36-5d e 85-8d, e os mais tolerantes foram 22-20k, 34-10t, 3-2d, 7-15c, 2-3c, 12-10n, 5-6n, 53-6d, 25-7d, 41-3d e 23-4d (Figura 4).

DINIZ, T. D. de A. S. et al. Condies climticas em reas de ocorrncia natural e de cultivo de guaran, cupuau, bacuri e castanha-do-Brasil. Belm: EMBRAPACPATU, 1984. 4 p. (EMBRAPA-CPATU. Pesquisa em Andamento, 133). DUCKE, A. As espcies brasileiras de cacau (gnero Theobroma L.) na botnica sistemtica e geogrfica. Rodriguesia, v. 13, p. 265-279, 1940. IDAM (Manaus.AM.). Plano operativo 1998. Manaus, 1998. 98 p. NAZAR, R. F. R. de; BARBOSA, W. C.; VIGAS, R. M. F. Processamento das sementes de cupuau para obteno de cupulate. Belm: EMBRAPA-CPATU, 1990. 38 p. (EMBRAPA-CPATU. Boletim de Pesquisa, 108). SOUZA, A. das G. C. de et al. A cultura do cupuau (Theobroma grandiflorum (Wild. ex Spreng.) Schum.). Manaus: Embrapa Amaznia Ocidental, 1999. 39 p. (Embrapa Amaznia Ocidental. Circular Tcnica, 2).

Concluses
Os frutos apresentaram rendimento de polpa entre 800 e 2.000 g e as sementes, uma mdia de 32 por fruto. Houve acessos com 0% de incidncia de vassoura-de-bruxa.

Referncias Bibliogrficas
CUATRECASAS, J. Cacao and its allies a taxonomia revision of the genus Theobroma. United States Natural Herbarium, v. 35, n. 6, p. 375-614, 1964.

N. M. M. de Araujo

79

53 3K

35 15T

12 2K

45 5P

28 10N

33 12D

42 4D

13 21K

10 3C

31 12T

10 2C

17 3D

41 2D

25

4 7D

24 10T

19 4D

Acessos

37 18K

14 1D

13 12D

22 20K

10 13K

S/ PL

32 5D

25 6D

14 9D

67 8D

37 18K

2 6D

21 11D

8 21K

33 3T

36 9D

53 6D

34 10T

23 4D

12 10N

20

40

60

80

1 00

1 20

Percentual

Fig. 4. Percentual de morte das mudas por vassoura-de-bruxa.

Efeito do nitrognio, do fsforo e do potssio no desenvolvimento do porta-enxerto tangerina Clepatra


Isaac Carneiro de Souza(1) e Sebastio Eudes Lopes da Silva(2)
Bolsista Pibic/CNPq; (2)Embrapa Amaznia Ocidental, Rodovia AM 010, km 29, Zona Rural, Caixa Postal 319, 69010-970. Manaus AM. E-mail: seudes@cpaa.embrapa.br
(1)

Resumo - O objetivo deste trabalho foi avaliar o efeito do nitrognio, do fsforo e do potssio no desenvolvimento do porta-enxerto tangerina Clepatra. Apesar de a Amaznia apresentar condies peculiares de clima e solo, nela so cultivadas as mesmas variedades ctricas que em outras regies citrcolas do Pas. A situao do porta-enxerto mais crtica ainda utilizando-se unicamente o limoeiro 'Cravo', cultivar suscetvel gomose de Phytophthora. Os experimentos foram instalados no Campo Experimental da Embrapa Amaznia Ocidental do Km 28, Rodovia AM 010, Manaus, AM. Para a produo das mudas, as sementes foram colocadas para germinar em tubetes florestais. O substrato utilizado foi a vermiculita expandida (Plantmax). Os resultados indicam que a dose de 2 g de N por planta, aplicada de cinco em cinco dias, apresentou melhor desempenho no desenvolvimento do porta-enxerto tangerina Clepatra, em altura e dimetro do caule. As dosagens de K utilizadas no interferiram no crescimento em altura e dimetro das plantas. A partir da dose 2,5 g de P e 3,5 g de N, houve saturao de fsforo no substrato, interferindo no crescimento em altura das plantas; j no dimetro no interferiu. Termos para Indexao: desenvolvimento, porta-enxerto, altura, dimetro.

Nitrogen, phophorus and potassium effects on cleopatra mandarim rootstock


Abstrat - The objective of the work is to evaluate the effect of nitrogen, the match and the
potassium in the development of the tangerina door-enxerto Clepatra. Despite the Amaznia presenting peculiar conditions of climate and ground, in the same citric varieties are cultivated that in the other citrcolas regions of the Country. The situation of the door-enxerto is more critical still, using solely the lemon tree ` Cravo ' to cultivate susceptible to gomose of Phytophthora. the experiments had been installed in the experimental field of the Embrapa/Amaznia Occidental person, situated in km 28 of highway AM. For the production of the changes the seeds had been placed to germinate in tubetes forest. The used substratum was the expanded vermiculita (Plantmax). The results indicate that, the dose of 2g of N for applied plant are of 5 in 5 days better presented performance in the development of the door enxerto tangerina Clepatra, in height and diameter of caule. The dosages of K used had not intervened with the growth in height and diameter of the plants. From dose 2,5 g of P and 3,5 g of N had saturation of match in the substratum intervening with the growth in height of the plants, diameter had no longer not intervened.

Index terms: development, door-enxerto, height, diameter.

I. C. de Souza

81

Introduo
Na Regio Norte, umidade e temperatura elevadas so favorveis ao desenvolvimento de inmeras doenas, sendo a gomose (Phytophthora spp.) uma das mais srias (Feichtenberger, 1989). O mtodo mais eficiente de preveni-la o uso de portaenxertos tolerantes, alm de tratos culturais adequados (Silva & Garcia, 1999; Coelho & Mascarenhas,1991; Figueiredo et al., 1996; Figueiredo et al., 1999 ). A citricultura a atividade agrcola que teve a maior expanso no Amazonas na ltima dcada, mas a produo de frutos ainda insuficiente para atender o consumo interno, forando a importao de outras regies. A situao do porta-enxerto mais crtica ainda utilizando-se unicamente o limoeiro 'Cravo', cultivar suscetvel gomose de P hy t o p h t h o r a , u m d o s p r o b l e m a s fitossanitrios mais srios da regio. Esses fatores, por si s, justificam a necessidade de estudos do comportamento de novas cultivares nesse agroecossistema particular, principalmente com relao a novos portaenxertos. O uso de um nico porta-enxerto pode impedir a planta de manifestar todo o seu potencial produtivo em diferentes tipos de solo, clima e variedades de copas. De acordo com Figueiredo et al. (2001), a influncia dos porta-enxertos na produo das plantas, em seu vigor e na qualidade dos frutos muito marcante. Os diferentes porta-enxertos tm sido muito estudados quanto s suas caractersticas em relao facilidade de formao, afinidade com variedades de copas, resistncia seca e a doenas, precocidade de produo, produtividade e longevidade. Segundo Rodrigues Ody (1997), o solo a base da nutrio das plantas, compe-se de partculas minerais de diferentes tamanhos, matria orgnica, gua e ar. No solo h partculas microscpicas, colides e ons, que so de maior importncia para a nutrio das plantas. Os principais ons negativos so hidrognio, calcrio, potssio, magnsio, amnia e sdio. So quinze os nutrientes considerados essenciais aos citros: carbono (C), oxignio (O), hidrognio (H), nitrognio (N), fsforo (P), potssio (K), clcio (Ca), magnsio (Mg), enxofre (S), zinco (Zn), boro (B), mangans (Mn), cobre (Cu), ferro (Fe) e

molibdnio (Mo). Os trs primeiros so obtidos no ar e na gua, representam 95% da matria seca das plantas. O carbono e o oxignio so absorvidos na forma de gases pelas folhas, e o hidrognio, na forma de gua pelas razes. Os demais nutrientes so encontrados parcialmente no solo. Para manter as plantas bem nutridas, h necessidade de aplicar fertilizantes minerais suplementares, bem como executar as prticas culturais adequadas para obterem-se boas produes. O Pas conta com variaes climticas que facilitam o cultivo das diversas espcies ctricas. A regio citrcola de Sergipe e Bahia apresenta condies climticas opostas do Rio Grande do Sul. Naquelas, a temperatura, a umidade relativa do ar, as chuvas influem largamente na qualidade dos frutos, fazendoos parecer, muitas vezes, cultivares diferentes. Isso permite ao Pas aumentar o nmero de espcies ctricas cultivadas, produzir em diferentes pocas do ano, ampliando seu potencial comercial. Bem ao norte da Regio Amaznica, existem as mesmas condies climticas que permitem ao Suriname produzir e exportar pomelos (Moreira, 1982) . Este trabalho teve como objetivos: avaliar o efeito do nitrognio, do fsforo e do potssio no desenvolvimento do porta-enxerto tangerina Clepatra, bem como o efeito da adubao na biologia do porta-enxerto tangerina Clepatra (desenvolvimento da parte area e sistema radicular).

Material e Mtodos
Os experimentos foram instalados no Campo Experimental da Embrapa Amaznia Ocidental situado no km 28 da Rodovia AM 010. O clima, segundo classificao de Koppen, do tipo Ami, com precipitao mdia acima de 2.400 mm anuais e umidade relativa do ar em torno de 80%. O solo do tipo Latossolo Amarelo distrfico, textura argilosa, predominante na regio. Experimento 1 - Para o experimento de nitrognio foram coletadas sementes de tangerina Clepatra que, aps a lavagem e secagem, foram semeadas em tubetes florestais com dimetro de 5,5 cm e comprimento de 18,5 cm. O substrato utilizado foi a vermiculita expandida, de

82

I. C. de Souza

nome comercial Plantmax, enriquecida com adubaes bsicas de clcio, magnsio, fsforo, potssio e enxofre. As sementes germinaram aps 10 dias, o experimento foi dividido em 4 tratamentos e 6 repeties, sendo que cada tratamento possua 27 plntulas. Os tratamentos receberam dosagens iguais, porm em diferentes concentraes e freqncias, que variaram de 5, 10 e 15 dias. Aps trs meses de tratamento, as plntulas foram medidas (peso seco e mido, comprimento total, raiz e caule), colocadas na estufa e depois analisadas. Experimento 2 - O delineamento utilizado foi o de blocos casualizados com 21 tratamentos, 4 repeties e 6 plantas por parcela, totalizando 504 plantas. O substrato utilizado foi terrio da mata, cujo resultado 3 analtico foi pH = 4,3, Na = 10 mg/dm , K= 3 3 14 mg/dm , P= 2 mg/dm , Ca = 0,12 3 3 c.molc/dm , Mg = 0,14 c.molc/dm , Al = 0,78 3 3 c.molc/dm , H+Al = 5,73 c.molc/dm , C= 11,57 g/Kg, M.O.= 19,90 g/Kg, Fe = 217 mg/dm3, Zn = 0,41 mg/dm3, Mn = 0,63 mg/dm3, Cu = 0,01 mg/dm3. Com base na anlise de solo, o terrio foi enriquecido com fontes de clcio, magnsio e enxofre. Os nutrientes utilizados neste experimento foram N, P e K, com sete tratamentos para cada um deles. Para N a variao foi de 0,5 g; 3,5 g; 5,5 g; 8,0 g; 10,5 g; 13,0 g e 15,5 g. Para P foi de 0,5 g; 2,0 g; 3,5 g; 5,0 g; 6,5 g; 8,0 g;
8

9,5 g . Para K a variao foi de 0,5 g; 1,5 g; 2,5 g; 3,5 g; 4,5 g; 5,5 g; 6,5 g. Os nutrientes foram aplicados em intervalos de 15 dias, para todos os tratamentos, durante seis meses, as mensuraes foram feitas no inicio, meio e fim do tratamento. Foram sorteadas duas plantas de cada parcela para ser analisado o efeito da adubao na biologia do porta-enxerto tangerina Clepatra: desenvolvimento da parte area e sistema radicular, onde foi analisado o peso seco e o peso mido de cada planta para avaliar qual o tratamento absorveu melhor os nutrientes .

Resultados e Discusso
O nitrognio foi o elemento que mais interferiu no desenvolvimento do portaenxerto tangerina Clepatra, com freqncia de 5 dias entre as aplicaes, conforme apresentado na Figura 1. Esses resultados indicam que, na fase inicial de desenvolvimento, os demais elementos so supridos pela reserva existente na semente e no substrato. A dose de 2 g de N aplicada de 5 em 5 dias apresentou melhor desempenho nas plantas, influenciando o comportamento do desenvolvimento, tanto da parte area como do sistema radicular, mantendo o equilbrio da planta (Figura 1).

7
y = -0,0648x + 7,2898 r = 0,3551 NS

6 diametro das plantas (mm)

5
y = -0,0009x + 5,0365 r = 0,01 NS epoca 01 epoca 02 epoca 03 Linear (epoca 03) Linear (epoca 01) Linear (epoca 02)

4
y = -0,0229x + 3,6829 r = 0,5495 NS

Figura 1. Altura da planta em funo da aplicao de doses de potssio.

0 0 1 2 3 4 5 6 7 doses de K (g)

I. C. de Souza

83

7
y = -0,0648x + 7,2898 r = 0,3551 NS

6
diametro das plantas (mm)

5
y = -0,0009x + 5,0365 r = 0,01 NS epoca 01 epoca 02 epoca 03 Linear (epoca 03) Linear (epoca 01) Linear (epoca 02)

4
y = -0,0229x + 3,6829 r = 0,5495 NS

0 0 1 2 3 4 5 6 7 doses de K (g)
Figura 2. Dimetro da planta em funo da aplicao de doses de potssio.

65

60

55

altura das plantas (cm)

50

y = -0,3577x + 57,18 r = 0,3903


NS

45

40

35

y = -0,559x + 42,675 r = 0,7489


NS

epoca 01 epoca 02 epoca 03 Linear (epoca 03) Linear (epoca 02) Linear (epoca 01)

30

25
y = -0,6369x + 32,083 r = 0,7978 *

20 0 1 2 3 4 5 6 7 8 9 10

doses de P (g)
Figura 3. Altura da planta em funo da aplicao de doses de fsforo.

84
9 8 7
diametro das plantas (mm)

I. C. de Souza

y = -0,0615x + 7,6249 r = 0,4609 NS

6 5 4 3 2 1 0 0 1 2 3 4 5 doses de P (g) 6 7 8 9 10
y = -0,0466x + 3,308 r = 0,7527 NS y = -0,0601x + 5,2015 NS r = 0,6252 epoca 01 epoca 02 epoca 03 Linear (epoca 03) Linear (epoca 02) Linear (epoca 01)

Figura 4. Dimetro da planta em funo da aplicao de doses de fsforo.

65 60 55
y = -0,3076x + 58,558

altura das plantas (cm)

50 45 40 35 30 25 20 0 2 4 6 8 10 12

r = 0,5546

NS

epoca 01 epoca 02 epoca 03 Linear (epoca 02)


y = -0,5889x + 47,242 r = 0,8583 *

Linear (epoca 01) Linear (epoca 03)

y = -0,3089x + 32,727 r = 0,7877 *

14

16

18

doses de N (g)

Figura 5. Altura da planta em funo da aplicao de doses de nitrognio.

I. C. de Souza
10 9 8 7
diametro (mm)
y = -0,0683x + 8,6602 r = 0,7911 *

85

6
epoca 01

5 4 3 2 1 0 0 2 4 6 8 doses de N (g) 10 12 14 16
y = -0,0495x + 5,7008 r = 0,9865 **

epoca 02 epoca 03 Linear (epoca 01) Linear (epoca 02) Linear (epoca 03) y = -0,0351x + 3,9142 r = 0,6897 NS

Figura 6. Dimetro da planta em funo da aplicao de doses de nitrognio.

Concluses
As dosagens de potssio utilizadas no interferiram no crescimento e dimetro das plantas. As doses de fsforo no substrato no interferiram no crescimento em altura nem no dimetro das plantas. A partir da dose 3,5 g de N, houve saturao de nitrognio no substrato, o que provavelmente interferiu no crescimento em dimetro do caule das plantas.

regio de Bebedouro, SP. Revista Brasileira de Fruticultura, Cruz das Almas, v. 18, n. 3, 1996, p. 345-351. FIGUEIREDO, J. de O. et al. Comportamento de 15 porta-enxertos para o tangor Murcott na regio de Porto Feliz, SP. Revista Brasileira de Fruticultura, Jaboticabal, v. 23, n. 1, p 147-151, 2001. FIGUEIREDO, J de O. et al. Comportamento inicial de limo Eureka km 47 sobre 14 portaenxertos na regio de Botucatu, SP. Revista Brasileira de Fruticultura, Jaboticabal, v. 21, n. 3, p. 308- 312, 1999. MOREIRA, C. et al. Nutrio mineral e adubao dos citros. 3. ed. Piracicaba: Potafos, 1982. 122 p. (Potafos. Boletim Tcnico, 5). ENCONTRO NACIONAL DE CITRICULTURA, 4., 1977, Aracaju. Anais... Aracaju: SUDAP, 1977. 181 p. SILVA, S. E. L da; GARCIA, T. B. A cultura da laranjeira no Amazonas. Manaus: Embrapa Amaznia Ocidental, 1999. 20 p. (Embrapa Amaznia Ocidental. Documentos, 5).

Referncias Bibliogrficas
COELHO, Y. da S.; MASCARENHAS, J. M. Limo 'Tahiti': aspectos econmicos e tcnicas de cultivo. Cruz das Almas: EMBRAPA-CNPMF, 1991. 46 p. (EMBRAPACNPMF. Circular Tcnica, 13) FEICHTEMBERGER, E. Doenas induzidas por fungo do gnero Phytophthtora em citros e seu controle. Laranja, Cordeirpolis, v. 10, n. 2, p. 359- 378, 1989. FIGUEIREDO, J. de O. et al. Comportamento de 11 porta-enxertos para o limo Tahiti na

E. P. Silva

87
Material e Mtodos

produo nacional de amndoas esteja em -1 torno de 5 mil toneladas ano (Embrapa, 2002), que quase toda consumida no mercado interno. Acredita-se que a exportao das amndoas ou o equivalente em xarope no ultrapassa as 50 toneladas ano-1, ou seja, 1% do total. No mercado interno, 90% das sementes so utilizadas pelos fabricantes de refrigerantes, enquanto os 10% restantes so comercializados sob a forma de xarope, basto, p e extrato. Em razo da baixa produtividade e da alta variabilidade dos plantios oriundos de sementes, optou-se pelo uso de mudas clonadas, com base no programa de melhoramento do guaranazeiro, o qual consta de duas linhas de pesquisas: seleo recorrente intra-especfica e selees clonais, obtendo-se diversos clones, propagados por enraizamento de estacas, cuja utilizao pode aumentar em at dez vezes os atuais ndices de produtividade, alm de serem gentipos com tolerncia principal doena do guaran, a antracnose (Nascimento Filho et al., 2000). As caractersticas utilizadas pelo programa de melhoramento para seleo de gentipos melhorados incluem tamanho de inflorescncia, nmero de botes, nmero de frutos e nmero de sementes por fruto do guaranazeiro (Valois et al., 1979), no considerando aspectos ligados fisiologia da planta, que podem ser mensurados em fase juvenil, podendo ser de grande utilidade para acelerar o processo de melhoramento da cultura. O conhecimento de que taxas mais altas de assimilao de CO2 esto associadas condutncia estomtica indicam que esta caracterstica pode estar ligada produo, uma vez que um fornecimento maior de CO2 promoveria maior suprimento de sacarose, podendo ser convertida em produo (Stucliffe, 1980). Portanto, o estudo da possibilidade de utilizao da determinao da condutncia ou resistncia estomtica com pormetro, como caracterstica de seleo de gentipos superiores, seria de grande auxlio, j que se trata de um procedimento rpido, adequado s limitaes de prazo para as medies de grande nmero de plantas utilizadas no melhoramento gentico. O objetivo deste trabalho foi medir o comprimento, a densidade e a resistncia estomtica em cinco clones de guaranazeiro.

O trabalho foi desenvolvido no Campo Experimental da Embrapa Amaznia Ocidental localizado no Km 29 da Rodovia AM 010, Manaus, Amazonas. O solo do local um Latossolo Amarelo muito Argiloso, distrfico, lico, considerado como de baixa fertilidade. O estudo da densidade estomtica foi feito dentro do experimento com manejo orgnico do guaranazeiro, em plantas com 17 meses de idade, as quais ainda no haviam entrado em fase reprodutiva. A rea total de cinco hectares descontnuos, onde foram plantados cinco clones de guaranazeiro: BRSAmazonas, BRS-Maus, BRS-CG 189, BRSCG 611 e BRS-CG 612 com espaamento 5 x 5 m. Para a anlise do comprimento e densidade de estmatos, o delineamento utilizado foi inteiramente casualizado, coletando-se duas folhas de trs plantas aleatoriamente. Foram coletadas folhas novas, mas fisiologicamente maduras. As folhas foram levadas para o laboratrio de fisiologia vegetal, fixadas com FAA (formaldedo, cido actico glacial e gua) e NaOH, para clareamento, e em seguida lavadas em gua corrente. Aps, retirou-se a epiderme com o auxlio de uma lmina cortante e em seguida foram colocadas em gua sanitria at ficarem transparentes, para depois serem coradas em safranina a 1% e lavadas em gua destilada. Ao final do processo, as folhas foram postas em lminas com glicerina para observao em microscpio ptico. A resistncia estomtica foi medida com o pormetro Delta T MP4, nos horrios de 9, 12 e 16 h do dia 26 de agosto de 2004. As medidas foram realizadas em dia ensolarado, somente na superfcie abaxial da lmina foliar, pelo fato de o guaran ser uma espcie hipoestomtica (Medri et al., 1980), em cinco folhas maduras de cinco plantas por clone, escolhidas aleatoriamente.

Resultados e Discusso
Pela Tabela 1, observa-se que o clone BRSCG 612 apresentou a maior densidade -2 estomtica (510,0 estmatos mm ), enquanto o BRS-Maus apresentou a menor densidade (337,6 estmatos mm-2), apesar de no se diferenciar estatisticamente dos clones

E. P. Silva Tabela 4. Resistncia estomtica mdia, s 8, 12 e 16 horas, de cinco diferentes clones de guaranazeiro. Horrio 8 12 16 s cm-1 0,40 c 1,10 b 1,58 a

89

MULLER, M. W.; MACHADO, R. C. R.; REIS, G. G. dos. Revista Theobroma, Ilhus, v. 12, n. 1, p. 29-36, jan./mar. 1982. SUTCLIFFE, J. As plantas e a gua. So Paulo: Ed. Universidade de So Paulo, 1980. p. 6062. (Temas para Biologia, 23). VALOIS, A. C. C.; CORRA, M. P. F.; VASCONCELLOS, M. E. da C. Estudos de caracteres correlacionados com a produo de amndoa seca no guaranazeiro. Pesquisa Agropecuria Brasileira, v. 14, n. 2, p. 175179, abr. 1979.

Letras minsculas diferentes indicam diferena estatstica pelo teste de Tukey a 5 % de probabilidade.

Concluses
Os clones BRS-CG 612 e BRS-Maus apresentaram a maior (510,0 estmatos mm2) e menor (337,7 estmatos mm) densidade estomtica, respectivamente. Os clones BRS-Amazonas e BRS-CG 612 apresentaram o maior (38,9 m) e o menor (35,0 m) comprimento mdio de estmatos, respectivamente. Os clones BRS-CG 611 e BRS-Maus apresentaram a maior (1,38 s cm-1) e a menor (0,87 s cm -1 ) resistncia estomtica, respectivamente.

Referncias Bibliogrficas
BOTANY. University of Hawaii at Manoa. Disponvel em: <>. Acesso em: 10 dez. 2004. ATROCH, A. L. et al. Agricultura familiar na Amaznia brasileira: clones de guaran: tecnologia sustentvel para a Amaznia. Manaus: Embrapa Amaznia Ocidental, 2002. 1 folder. EMBRAPA. Centro de Pesquisa Agroflorestal da Amaznia Ocidental (Manaus, AM). Sistema de produo para guaran - Estado do Amazonas. Manaus, 1998. 34 p. (EMBRAPACPAA. Documentos, 13). MEIDNER, H; MANSFIELD, T. A. Physiology of stomata. London: MacGraw Hill, 1968. NASCIMENTO FILHO, F. J.; ATROCH, A. L.; CRAVO, M. S. Melhoramento gentico do guaranazeiro, resultados de ensaios de avaliao de clones, fase produtiva 1985 a 1994. Manaus: Embrapa Amaznia Ocidental, 2000. 54 p. (Embrapa Amaznia Ocidental. Boletim de Pesquisa, 7).

Caracterizao botnica e agronmica de clones de mandiocas brava e mansa na Amaznia


Ceclia Miranda Magno de Arajo(1), Jos Jackson Bacelar Nunes Xavier
(2)

e Miguel Costa Dias(2)

(1) Bolsista Pibic/CNPq, (2) Embrapa Amaznia Ocidental, Rodovia AM 010, km 29, Zona Rural, Caixa Postal 319, 69010-970. Manaus AM. E-mail: jjackson@cpaa.embrapa.br, miguel@cpaa.embrapa.br.

Resumo - A mandioca uma das mais importantes fontes de energia alimentar para populaes
humanas na Regio Norte, em virtude de sua alta adaptabilidade; porm sua produtividade mdia baixa. Dentre os fatores determinantes do baixo rendimento, destaca-se a pouca disponibilidade de cultivares com alto potencial produtivo e resistentes a pragas e doenas. A cultura da mandioca apresenta interaes entre o gentipo e o ambiente. afetada por diversos estresses biticos e abiticos, e dentre aqueles encontra-se a podrido radicular, causada pelos fungos Fusarium e Phytophthora. Este subprojeto iniciou em janeiro de 1999 com os seguintes objetivos: selecionar germoplasma com potencial de utilizao em curto prazo; gerar hbridos de mandioca adaptados aos diferentes ecossistemas; ampliar a diversidade gentica, nas reas cultivadas com mandioca, com novas variedades melhoradas para diferentes alternativas de utilizao; otimizar o manejo dos clones preferidos pelos produtores da regio, conjuntamente com os centros de pesquisa da Embrapa que atuam na Regio Norte. Os experimentos esto sendo conduzidos no Campo Experimental do km 28, Rodovia AM 010 (rea de terra firme), compostos de avaliao e seleo de variedades provenientes do banco de germoplasma de mandioca da Amaznia e uma outra, especfica para obteno e seleo de hbridos. Constata-se que a produo de razes, com exceo dos clones IM 993 e IM- 1013, foi acima da mdia estadual (em torno de 12 t/ha), indicando que esses clones esto aptos a serem avaliados e incorporados na prxima etapa do processo de melhoramento previsto.

Termos para indexao: Manihot esculenta Crantz, acessos, melhoramento.

Agronomic botanical characterization of cassava of clones brave and docile in the Amazonia
Abstract- The cassava crop is one of the most important energy foutain alimentary for the Amazon Region, because it present a good adaptability, but your production is not very good, for a many reasons one of them is the acess to a material with a good production and tha resistence to a plagues and diseases. Across of the selection adequate of plants, with recombinations and selections withen ecosystem especifc, it will be possible to reach a good production, quality and resistence to a plagues and dieases.This subproject, began in january of 1999, with the sequencial objective: selection of varieties with potencial of utilization to a short time; to get hybrids of cassava adapted to the diferents ecosystem; to amplify the diversity genetic in the cultivate region with cassava with a new varietes for diferents alternatives of utilization; and to improve the management of the clones prefered by the local producer.The experimentes was realized in the bases in the area experimental of Km 28 (area of the farmer), respective composition of valuation and selection of varietes proceeding from the banc of germplasm of cassava and another especifc to the obtainment and selection of hybrids. Based on the results from the experiment, the conclusion was the variets reached the expects and objects of the projet. The productions of roots, with exception of clones IM 993 e IM- 1013, was above of expect, what is in lathe of 12 ton/ha, indicative what power to be incorporated in the process of the improvement anticipated. Index terms: cassava, acesses and improvement.

C. M. M. de Arajo

91
Material e Mtodos

Introduo
A mandioca uma das principais fontes de carboidrato, utilizadas na Regio Norte para a alimentao humana, animal e para usos industriais. cultivada em todas as regies brasileiras, contribuindo com cerca de 15% para a produo mundial. Um dos fatores que tm causado baixa produtividade o uso de variedades com baixo potencial produtivo. Uma das formas mais simples e econmicas de se elevar a produtividade da mandioca a substituio das variedades tradicionais por variedades melhoradas. Com uma simples seleo de variedades possvel obter aumento significativo no rendimento da cultura (Kawano et al., 1987). A mandioca apresenta interao com o ambiente e, portanto, dificilmente um mesmo gentipo se comporta de forma semelhante em todas as regies (Fukuda & Silva, 1990). Isso se deve ao grande nmero de pragas e doenas que afetam o cultivo, cuja incidncia est limitada a condies edafoclimticas especficas, restritas a determinados ecossistemas (Lozano, et al., 1983). Alm de pragas e doenas, a cultura da mandioca afetada por estresses causados por fatores abiticos, que limitam ou inviabilizam o desenvolvimento de uma nica variedade em vrios ecossistemas (Fukuda & Porto, 1991). Para difundir variedades de mandioca com ampla aceitao pelos produtores e retroalimentar os programas de melhoramento com a cultura, o mtodo de pesquisa participativa em melhoramento de mandioca desenvolvido por Hernandez (1991) tem sido utilizado com sucesso na Colmbia. Calcula-se que, por meio de seleo adequada de parentais, seguida de recombinaes e selees dentro de cada ecossistema especfico, seja possvel obter ganhos relevantes em produtividade, qualidade e resistncia a pragas e doenas. As aes do subprojeto em andamento, entre elas o teste preliminar de produtividade - TPP, que faz parte do trabalho vinculado ao Programa Institucional de Bolsas de Iniciao Cientfica Pibic desenvolvido em 2002/2003, tm potencializado a indicao, atravs dos dados obtidos, de recomendaes de cultivares/ clones com produtividade superior mdia estadual.

Este trabalho foi conduzido no Campo Experimental da Embrapa Amaznia Ocidental situado no km 28 da Rodovia AM 010 (rea de terra firme), Manaus, AM. Foram realizadas as aes de pesquisa pertencentes ao ensaio - teste preliminar de produtividade - TPP, constitudo de gentipos provenientes dos experimentos, introduo de cultivares (IC), realizados em 2001/02, compostos de mandioca de polpas amarela e branca e macaxeira. O delineamento experimental foi o de blocos ao acaso, com 3 experimentos, distribudos em 3 repeties, cada um com 21 tratamentos, com parcelas compostas de 16 plantas estabelecidas em espaamento de 1 x 1 m. A rea destinada aos experimentos foi preparada com o auxlio de roadeira acoplada a um trator. Posteriormente, foi feita uma arao do solo com grade aradora. Aplicaramse 2 t/ha de calcrio dolomtico, distribudas a lano, 30 dias antes do plantio. Utilizou-se adubao qumica nas quantidades de 30-6040 kg/ha de N, P2O5 e K2O, respectivamente. As fontes disponveis foram uria, superfosfato triplo e cloreto de potssio, distribuindo todo o fsforo e as metades do N e K 90 dias aps o plantio e o restante aos 120 dias. O experimento at os 120 dias foi mantido livre da competio das plantas daninhas e mantido durante todo o ciclo de cultivo livre de competio. No processo de avaliao foram considerados: o estande inicial (60 dias aps o plantio), estande final (na colheita), peso das razes, teor de amido e matria seca da raiz (mtodo da balana hidrosttica), ndice de colheita, resistncia a pragas e doenas, peso do caule, peso da parte herbcea mais folha, sobrevivncia (calculado em funo = n. final de plantas = 100/n real de plantas), n. de manivas por cova (obtidos a partir da quantidade de hastes exigentes em cada cova/parcela), produo de manivas (medida em metro linear, a parte lenhosa, e desprezada a parte herbcea), distncia entre cicatrizes foliares (medida em centmetros, tiradas do tero mdio da planta, entre cicatrizes que se encontram no mesmo plano), altura mdia da planta (m), altura da 1 ramificao (m), tombamento (quando fica inclinada a uma distncia inferior a 10 cm do solo) e cozimento das razes de macaxeira.

92

C. M. M. de Arajo

Em relao macaxeira tambm foi avaliada a qualidade organolptica das razes, levando-se em considerao a fibra (1- sem fibra, 2- pouca fibra, 3- fibra intemediria, 4muita fibra), a palatabilidade (1- excelente, 2boa, 3- regular, 4- ruim); a textura (1- fina sem encaroamento, 2- mdia - pouco encaroada, 3- grossa - muito encaroada); a plasticidade (1-sem plasticidade, 2 plasticidade baixa, 3 - plasticidade mdia, 4 plasticidade alta); a pegajosidade (1 - no pegajosa, 2- pegajosidade baixa, 3 pegajosidade mdia, 4 - pegajosidade alta).

Resultados e Discusso
Mandioca de polpa amarela
A sobrevivncia das plantas obteve timo ndice de resistncia, com exceo do clone IM - 979, que apresentou baixa capacidade de vigor (Tabela 1). Portanto, no foi considerado um clone de potencial positivo para os prximos passos do projeto, que so o teste avanado de produtividade I, II, validaes em diferentes ecossistemas e recomendaes, de acordo com Fukuda (1996) e Fukuda et al. (2003). Em relao produo de manivas por cova, apresentada na Tabela 1, observou-se que somente o clone IM - 979 no apresentou produo, por causa de seu baixo vigor; todas as outras cultivares apresentaram boa produo de manivas/sementes. O nmero de manivas/cova apresentou em mdia uma a duas plantas por cova em todas

as suas variedades, sendo a IM - 963 a nica que apresentou duas manivas por cova. A distncia entre cicatrizes foliares (Tabela 1) apresentou superalongamento entre as cicatrizes foliares, sendo a mais longa a da IM 958, considerada uma distncia normal, por estar dentro dos padres aceitos entre distncia de cicatrizes foliares (padro longo). Em relao altura das plantas (Tabela 1), notou-se grande variao entre as cultivares, algumas atingiram altura adulta logo nos primeiros perodos da coleta de dados, no havendo muita variao no decorrer do tempo em relao a altura, e outras j apresentaram crescimento deficiente, mesmo sendo da mesma variedade, como o caso da IM - 956. Considerando-se a altura da primeira ramificao (Tabela 1), observou-se o surgimento das ramificaes no terceiro ao quinto ms de plantio, sendo a maioria natural e algumas causadas por mosca-do-broto. Os nveis de ramificao (Tabela 1) no apresentaram muita variao entre os nveis de ramificao nas variveis, sendo normal, com a presena da mosca-do-broto em algumas, o que causa o superbrotamento, mas no houve diferenas que pudessem ser levadas em considerao. O tombamento (Tabela 1) uma varivel considerada relevante quando atinge a partir de 20% da parcela. Pelos resultados obtidos, constatou-se que o nmero de tombamentos no prejudicou a avaliao dos clones, sendo estes promissores.

Tabela 1. Mdias dos dados obtidos da mandioca de polpa amarela.


Nveis de Tombamento Produo de N de plantas Comprimento da Comprimento Altura da Tratamento ndice de sobrevivncia manivas por cova por cova filotaxia (cm) da planta (m) 1 ramificao ramificao IM-993 IM-1004 IM-1023 IM-958 IM-963 IM-946 IM--929 IM-1013 IM-979 IM-1072 IM-1050 IM-851 IM-956 IM-866 IM-890 IM-978 IM-934 IM-931 IM- 1065 IM-936 IM-025 91,65 97,83 79,16 100,00 100,00 95,83 100,00 93,75 33,32 97,83 100,00 97,83 97,90 97,90 100,00 100,00 100,00 95,83 100,00 100,00 95,83 0,96 1,06 0,78 1,82 1,71 0,81 1,28 1,17 0,0 1,00 0,81 1,57 1,16 1,22 1,24 1,54 1,36 0,96 1,19 1,65 1,08 1,33 1,00 1,33 1,33 2,00 1,66 1,00 1,00 1,00 1,00 1,00 1,33 1,67 1,33 1,00 1,67 1,33 1,00 2,00 1,00 1,00 13,03 11,03 14,27 18,25 11,17 8,92 8,25 13,50 9,58 8,08 9,17 12,41 8,92 12,00 14,83 12,33 16,12 13,18 14,73 14,42 10,75 1,42 2,39 1,30 2,44 2,23 1,54 1,59 1,86 1,60 1,61 1,65 2,14 0,98 1,88 1,77 1,86 1,86 1,78 2,29 1,92 0,56 0,51 0,53 0,52 0,81 0,99 0,34 0,42 0,63 0,47 0,25 0,45 0,57 0,88 0,61 0,65 0,60 0,77 0,58 0,59 0,95 0,51 2,00 2,00 2,00 2,33 2,33 2,67 3,00 2,00 2,33 2,00 2,67 2,00 2,00 2,33 3,00 2,33 2,33 2,00 2,33 2,00 2,33 0,00 0,00 1,33 0,00 0,66 0,00 0,00 0,33 0,67 0,00 0,66 0,33 0,33 0,00 0,33 0,33 0,33 0,00 0,33 0,00 0,00

C. M. M. de Arajo Tabela - 2. Mdias obtidas da mandioca de polpa amarela. Razes Tratamentos IM-993 IM-1004 IM-1023 IM-958 IM-963 IM-946 IM-929 IM-1013 IM-979 IM-1072 IM-1050 IM-851 IM-956 IM-866 IM-890 IM-938 IM-934 IM-931 IM-1065 IM-936 IM-025 kg 2,8 10,1 13,3 10,8 7,9 11,8 12,4 21,0 10,0 10,9 5,2 9,9 11,0 9,7 10,4 10,5 8,7 12,6 13,2 9,2 18,4 t/ha 7,00 25,25 32,80 27,00 19,75 29,50 31,00 5,25 25,00 27,25 13,00 24,75 27,50 24,25 26,50 26,75 21,75 31,50 33,00 23,00 46,00 kg 1,40 2,06 0,80 1,80 3,03 1,43 1,43 2,30 1,50 1,40 1,70 2,60 2,10 2,10 2,10 2,40 1,60 1,60 3,16 2,50 2,10 Caule t/ha 3,50 5,00 2,00 4,50 7,50 3,60 3,60 5,75 3,75 3,50 4,25 6,75 5,25 5,25 5,25 6,00 4,10 4,00 7,75 6,25 5,25 kg 2,10 6,06 1,30 8,00 5,90 3,50 6,80 6,70 4,80 3,40 3,20 8,70 6,60 4,20 4,60 8,50 5,90 3,70 3,70 6,60 5,80 Cepa t/ha 5,00 15,00 3,25 20,00 14,75 8,75 17,00 16,75 12,00 8,50 8,00 21,75 16,50 10,50 11,50 21,25 14,75 9,25 9,25 16,50 14,50 kg 0,60 1,20 0,40 1,70 1,80 1,90 1,90 2,06 2,00 1,20 1,40 1,80 1,60 1,43 1,43 1,70 1,40 1,10 2,06 1,20 2,10 Rama t/ha 1,65 3,00 1,08 4,25 4,50 4,80 4,75 5,10 5,00 3,00 3,50 4,60 4,00 3,70 3,70 4,25 3,50 2,75 5,00 3,20 5,30

93

Mandioca de polpa branca


A sobrevivncia das plantas (Tabela 3) esteve em todos os clones (acima de 50%), o que j considerado um timo resultado, pois no haver descarte de parcela, como aconteceu com a mandioca de polpa amarela, em que a varivel "979" obteve ndice de sobrevivncia abaixo de 50%. Todas as parcelas apresentaram boa produo de manivas. O nmero de manivas por cova/clones (Tabela 3) apresentou variao de 1 a 4 plantas por cova, obtendo-se mdias que variaram de 1 a 3 plantas por cova. A distncia entre cicatrizes foliares das plantas apresentou superalongamento entre as suas cicatrizes foliares, todas com comprimento normal, entre curto (menor que 8), mdio (de 8 a 15) e longo (acima de 15). Em relao altura das plantas (m) (Tabela 3), notou-se grande variao entre as cultivares, algumas atingiram altura adulta logo nos primeiros perodos da coleta de dados, sem muita variao no decorrer do tempo em relao a sua altura; neste bloco todas foram consideradas normais. A altura da primeira ramificao foi definida a partir do terceiro ao quinto ms de plantio, sendo a maioria das ramificaes natural e algumas

causadas por mosca-do-broto. Os nveis de ramificao no apresentaram muita variao, foram considerados normais, mesmo com o ataque da mosca-do-broto em alguns clones. Esse ataque no provocou superbrotamento, por conseguinte no influenciou a avaliao promissora de todos os clones. Em relao ao tombamento, os resultados foram considerados promissores. Em relao Tabela 4, constata-se que a produo de razes, com exceo dos clones IM - 994 e IM - 940, foi acima da mdia estadual (em torno de 12 t/ha), indicando que esses clones esto aptos a serem avaliados e incorporados na prxima etapa do processo de melhoramento previsto. Os demais parmetros de produo de biomassa area, como cepa, caule ou maniva/semente e rama (parte herbcea mais pecolos e folhas), esto de acordo com o esperado, como podemos constatar em Xavier (1997).

94

C. M. M. de Arajo Tabela 3. Mdia dos dados da mandioca de polpa branca.


Nveis de Tombamento Produo de N de plantas Comprimento da Comprimento Altura da Tratamento ndice de sobrevivncia manivas por cova por cova filotaxia (cm) da planta (m) 1 ramificao ramificao IM-939 IM-942 IM-935 IM-952 IM-994 IM-1128 IM-923 IM-940 IM-927 IM-943 IM-1048 IM-937 IM-1043 IM-938 IM-926 IM-856 IM-925 IM-1044 IM-1034 IM-1046 IM-025 100,00 97,92 100,00 100,00 64,17 95,83 100,00 97,90 93,67 95,80 77,08 100,00 100,00 100,00 97,92 97,92 95,83 97,92 89,58 87,50 97,92 0,82 1,510 1,68 1,65 1,150 0,98 1,39 1,10 1,15 1,19 0,90 1,13 1,34 1,42 1,17 1,42 0,98 1,02 0,86 1,08 0,88 1,67 2,33 1,67 2,33 1,67 3,00 2,00 1,33 2,00 1,33 2,00 1,67 1,33 1,00 1,67 1,67 2,33 1,67 2,00 1,33 1,67 13,00 15,50 16,00 14,75 13,83 15,00 14,17 13,42 16,92 13,08 15,33 15,25 15,17 11,92 13,98 18,00 15,58 14,50 16,23 15,73 11,17 1,34 1,99 1,92 2,08 2,05 1,94 2,00 1,74 1,81 1,80 1,75 1,79 2,10 1,61 1,44 2,06 1,52 1,66 1,39 1,53 1,66 0,68 0,94 0,98 1,03 0,68 0,61 0,75 0,67 0,69 0,95 0,62 0,42 0,50 0,34 0,54 0,52 0,47 0,53 0,76 0,61 0,37 2,67 2,67 2,00 2,00 2,67 2,33 2,67 2,33 3,00 2,67 2,67 2,00 3,00 2,00 2,00 2,33 2,67 2,33 3,00 2,00 2,67 0,67 0,00 0,33 0,00 2,00 0,00 0,67 0,67 0,67 0,33 0,00 0,33 0,33 0,33 0,00 0,00 0,33 0,33 1,00 0,00 0,33

Tabela 4. Mdia dos dados obtidos da mandioca de polpa branca. Razes Tratamentos IM-939 IM-942 IM-935 IM-952 IM-994 IM-1128 IM-923 IM-940 IM-927 IM-943 IM-1048 IM-937 IM-1043 IM-938 IM-926 IM-856 IM-925 IM-1044 IM-1034 IM-1046 IM-025 kg 7,2 10,7 8,5 10,9 4,1 12,1 14,0 4,5 12,4 6,2 11,6 6,2 14,1 7,5 8,6 8,1 13,5 6,3 5,6 12,6 13,3 t/ha 18,00 26,70 21,20 27,20 10,20 30,25 35,00 11,25 31,00 15,50 29,00 15,60 35,10 18,70 21,50 20,20 33,70 15,75 14,00 31,50 33,25 kg 1,9 2,2 2,3 1,8 2,2 2,7 2,5 1,6 1,9 1,9 2,6 1,8 2,6 1,6 2,0 2,4 1,3 2,0 1,1 1,8 1,5 Caule t/ha 4,90 5,50 5,75 4,50 5,50 6,70 6,20 4,00 4,80 4,75 6,50 4,50 6,50 4,10 5,00 6,00 3,25 5,00 2,75 4,50 3,70 kg 3,83 5,73 5,40 3,96 4,23 9,63 4,76 2,66 5,40 1,33 5,56 3,23 5,63 3,56 3,53 6,60 3,70 4,93 2,84 4,56 3,06 Cepa t/ha 9,50 14,70 13,70 9,75 10,50 24,00 11,75 6,60 13,70 3,30 13,80 8,00 14,00 8,75 8,70 16,50 9,25 12,25 7,00 11,25 7,50 kg 1,43 1,33 1,46 1,40 0,86 2,13 1,60 0,66 1,70 0,83 1,16 1,23 1,53 0,86 0,96 1,60 0,80 1,26 0,83 1,53 1,48 Rama t/ha 3,60 3,30 3,60 3,50 2,10 5,25 4,00 1,60 4,25 2,00 2,75 3,00 3,75 2,10 2,40 4,00 2,00 3,00 2,00 3,75 3,50

Macaxeira
A sobrevivncia (Tabela 5) atingiu valores acima de 50%, em todos os clones, o que considerado um timo resultado, pois no haver descarte de parcela, como aconteceu com a mandioca de polpa amarela, em que a varivel "979" obteve ndice de sobrevivncia abaixo de 50%. A produo de manivas/semente (Tabela 5) por cova, para os clones estudados, foi

normal. O nmero de maniva/cova apresentou variao de 1 a 4, obtendo mdias entre 1 a 3. A distncia entre cicatrizes foliares das plantas, neste bloco, no apresentou superalongamento, todas apresentaram comprimento normal, entre curto (menor que 8), mdio (de 8 a 15) e longo (acima de 15). A altura das plantas (Tabela 5) apresentou grande variao entre os clones, algumas atingiram altura adulta logo nos primeiros

C. M. M. de Arajo

95

perodos da coleta de dados (quatro meses do plantio), no havendo muita variao no decorrer do tempo, sendo consideradas normais. Em relao altura da primeira ramificao, notou-se o surgimento a partir do terceiro ms de plantio, sendo a maioria das ramificaes natural e algumas causadas por

mosca-do-broto. Os nveis de ramificao no apresentaram muita variao entre eles, sendo normal mesmo com o surgimento de mosca-do-broto. O tombamento tambm no prejudicou a avaliao positiva dos clones trabalhados.

Tabela 5. Mdia dos dados quantitativos obtidos com macaxeira.


Nveis de Tombamento Produo de N de plantas Comprimento da Comprimento Altura da Tratamento ndice de sobrevivncia manivas por cova por cova filotaxia (cm) da planta (m) 1 ramificao ramificao IM-943 IM-952 IM-1289 IM-923 IM-942 IM-1043 IM-958 IM-935 IM-927 IM-976 IM-948 IM-1425 IM-1045 IM-924 IM-922 IM-1070 IM-1426 IM-286 IM-1047 IM-1064 IM-1427 187,50 95,83 100,00 95,83 100,00 89,58 100,00 93,75 95,83 100,00 95,83 91,67 95,83 97,92 97,92 89,58 100,00 95,83 97,92 97,92 100,00 1,29 1,61 1,54 1,33 1,62 1,27 1,30 1,00 0,84 1,53 1,18 1,07 1,50 1,18 1,83 1,07 1,12 1,11 0,80 0,99 1,15 1,00 1,33 1,33 1,33 2,67 1,33 1,33 1,67 1,33 1,67 1,00 1,00 1,33 1,33 1,00 1,67 3,67 3,67 1,00 1,33 1,67 12,73 14,42 14,92 12,25 13,67 14,00 16,83 13,70 17,08 12,83 10,52 14,62 15,28 7,90 13,92 12,68 13,42 14,42 10,75 17,93 14,85 1,80 2,16 1,88 1,96 2,00 1,80 2,36 1,54 1,76 2,02 1,49 1,53 1,93 1,65 2,30 1,77 1,67 1,66 1,41 1,85 1,63 00,97 1,12 1,05 0,83 1,05 0,59 1,12 0,83 0,89 1,09 0,55 0,77 0,85 0,41 0,90 1,06 0,91 1,00 0,36 0,73 0,41 2,33 2,00 2,33 2,33 2,67 2,00 2,67 2,33 2,00 2,33 2,33 2,00 2,00 2,33 2,67 2,33 2,33 2,67 2,00 2,67 2,00 0,67 0,00 0,00 0,67 0,33 0,33 0,00 0,67 2,00 0,33 0,00 0,33 2,00 0,33 0,33 1,33 0,00 0,00 0,00 2,67 0,00

Na Tabela 6, constata-se que a produo de razes, com exceo dos clones IM - 994 e IM - 940, foi acima da mdia estadual (em torno de 12 t/ha), indicando que os clones esto aptos a serem avaliados e incorporados na prxima etapa do processo de

melhoramento previsto. Os demais parmetros de produo de biomassa area, como cepa, caule ou maniva/semente e rama (parte herbcea mais pecolos e folhas), esto de acordo com o esperado, como podemos constatar em Xavier (1997).

Tabela 6. Mdia dos dados quantitativos obtidos com a macaxeira. Razes Tratamentos
IM-943 IM-952 IM-1289 IM-923 IM-942 IM-1043 IM-958 IM-935 IM-927 IM-976 IM-948 IM-1425 IM-1045 IM-924 IM-922 IM-1070 IM-1426 IM-286 IM-1047 IM-1064 IM-1427

Caule t/ha kg
2,20 2,03 2,03 1,90 2,60 1,20 2,06 1,60 2,03 2,40 1,70 1,80 1,70 2,30 1,60 1,80 1,90 2,10 1,80 1,50 2,30

Cepa t/ha
5,50 5,00 5,00 4,70 6,50 3,00 5,10 4,00 5,00 6,00 4,20 4,50 4,20 5,50 4,00 4,60 4,75 5,30 4,50 3,75 5,80

Rama t/ha
14,20 15,07 11,60 12,00 17,50 7,00 14,75 9,50 11,00 13,20 7,50 10,00 9,00 14,70 9,50 14,70 10,70 8,50 10,00 10,00 14,50

kg 711,7
10,9 8,8 8,9 12,7 8,4 9,4 8,3 8,7 10,4 7,6 9,8 9,8 14,5 10,1 9,2 9,4 8,8 7,1 10,8 11,7

kg
5,70 6,03 4,60 4,80 7,03 2,80 5,90 3,80 4,40 5,30 3,06 4,00 3,60 5,90 3,80 5,90 4,30 3,40 4,05 4,03 5,80

kg
1,15 1,40 0,60 1,40 1,60 1,30 0,80 1,50 1,00 1,80 1,00 1,50 1,15 1,75 1,00 1,20 1,00 1,00 6,30 1,00 1,40

t/ha
2,75 3,50 1,50 3,50 4,00 3,25 2,00 3,75 2,50 4,50 2,50 3,75 2,75 4,25 2,50 3,00 2,50 2,50 15,70 2,50 3,50

27,66 27,33 22,16 22,33 31,83 21,66 23,50 21,80 21,90 26.10 19,00 24.60 24.50 36,40 25,30 23,10 23,50 22,10 19,00 27,00 29,40

96
Superfcie da pelcula R R R R L L R R R L L R L R L R L R R R R Cor da pelcula L L C RC L R C B RC C C R A R B Roxa L C C C R

C. M. M. de Arajo Tabela 7. Avaliao qualitativa das razes da macaxeira.


Tratamento Destac. da pelcula F F M M M D F F M F M M F M F F F M M F D Cor da casca ME ME MC ME C MC ME ME ME MC MC ME MC ME MC ME C ME ME ME ME Cor da polpa B C B B C C C A B B C C A B B B B B C B C Dimetro % de Amido 31,01 26,05 20,46 23,73 29,01 29,88 27,74 30,67 25,53 26,43 29,09 25,82 27,46 29,77 21,42 25,65 28,13 28,98 21,14 23,73 24,75 Teor de HCN 5 4 5 4 5 5 3 7 5 4 6 5 6 5 4 4 5 5 6 3 4

IM-927 IM-1426 IM-943 IM-1045 IM-1047 IM-922 IM-1427 IM-924 IM-1070 IM-942 IM-976 IM-286 IM-958 IM-1425 IM-952 IM-1064 IM-1043 IM-923 IM-948 IM-935 IM-1289

4,50 5,09 6,65 6,81 9,74 6,10 4,39 6,42 6,58 5,30 5,89 5,09 4,78 5,23 5,59 4,65 5,66 5,62 5,38 4,32 4,87

LEGENDA: (R) Rosa; (L) Laranja; (C) Creme; (B) Branco; (RC) Rosa Claro; (A) Amarelo; (Roxa); (F) Fcil; (M) Mdio; (D) Difcil; (ME) Marrom Escuro; (MC) Marrom Claro.

Tabela 8. Caractersticas organolpticas das razes de macaxeira.


Tratamento Tempo de cozimento (min) 15 30 19 30 30 20 30 30 30 30 30 30 16 26 30 30 30 27 30 30 30 Fibra Sabor Palatabilidade Textura Plasticidade Pegajosidade

IM-1427 IM-1064 IM-1047 IM-286 IM-1426 IM-1070 IM-922 IM-924 IM-1045 IM-1425 IM-948 IM-976 IM-927 IM-935 IM-958 IM-1043 IM-942 IM-923 IM-1289 IM-952 IM-943

1 2 2 2 2 1 1 3 3 3 3 2 1 2 2 1 2 1 2 2 2

2 2 1 2 3 2 1 1 2 1 2 1 3 3 1 3 3 3 3 2 2

1 2 4 1 2 1 3 4 2 3 2 1 2 2 4 2 2 2 2 2 2

2 2 2 2 2 1 1 2 2 2 2 2 1 2 2 2 2 2 2 2 2

3 2 2 3 3 2 2 3 3 3 2 4 3 3 1 4 2 4 4 3 2

1 4 3 3 2 4 2 2 2 4 2 4 2 1 4 4 2 2 1 3 2

Pragas e Doenas Durante todo o perodo de trabalho em campo, constatou-se a presena de insetos (mandarov, savas, mosca-do-broto, galhas e curculiondeos), que no prejudicaram os resultados, tanto pela qualidade dos materiais genticos utilizados, quanto pelos procedimentos tomados em cada caso. O mandarov foi combatido com controle manual, logo aps constatada sua presena em campo. As savas foram controladas com o uso de inseticidas apropriados. Quanto

mosca-do-broto, aps sua identificao e constatado o nvel de dano, acionava-se o alerta; contudo, durante todo o ciclo, no houve necessidade de se utilizar produtos qumicos. O mesmo procedimento e resultados foram adotados para os curculiondeos. A morte-das-ponteiras foi uma das principais manifestaes de pragas e doenas encontradas nas plantas, no entanto o surto foi identificado quando as plantas j se encontravam prximo do perodo de colheita, sem comprometer a avaliao final.

C. M. M. de Arajo

97

Agradecimentos
Ao tcnico Edmilson Ribeiro da Silva, pela colaborao durante a fase do projeto, e em memria do laboratorista Jos Soares Oliveira Filho.

HERNANDEZ, L. A. Evaluacion de nuevas variedades de yuca com la participacin de agricultores. In: HERNNDEZ, L. A. (Ed.). Unidade de aprendizage para la capacitacion en tecnologa de producion. Cali, Colombia: CIAT, 1991. 203 p. HERNNDEZ, L A. Participacin de los agricultores en la evaluacin de variedades de yuca. In: HERNNDEZ, L. A. (Ed.). Memrias de um Taller en el CIAT. Cali, Colombia: CIAT, 1992. p . 40-48. (CIAT. Documento de Trabalho, 9). KAWANO, K. et al. Factores affecting efficiency of hubridization and selection in cassava. Crops Science, v. 18, n. 3, p. 373376, 1978. XAVIER, J. J. B. N. Caracterizao agrobotnica de trs cultivares de mandioca (Manihot esculenta Crantz) nos ecossitemas de vrzea e terra firme no Amazonas. 1997. 267 f. Tese (Doutorado) - Instituto Nacional de Pesquisas da Amaznia, Universidade do Amazonas, Manaus.

Referncias Bibliogrficas
FUKUDA, C. Podrido das razes de mandioca. Cruz das Almas: EMBRAPA-CNPMF, 1991. No paginado. (EMBRAPA-CNPMF. Mandioca em Foco, 8). FUKUDA, W. M. G.; PORTO, M. G. M. A mandioca no Brasil. In: HERSHEY, C. H. (Ed). Mejoramiento genetico de la yucca en Amrica Latina. Cali, Colombia: CIAT, 1991. p. 15-42. FUKUDA, W. M. G.; SILVA, S. O. Melhoramento gentico de mandioca. In: CURSO INTENSIVO NACIONAL DE MANDIOCA, 7., 1990, Cruz das Almas. Apostila. Cruz das Almas: EMBRAPA-CNPMF, 1990. 20 p.

Caracterizao botnico-agronmica de mandiocaba nas condies de Manaus - AM


Isabel Oliva Valrio Lima Costa(1), Jos Jackson B. N. Xavier
(2)

e Miguel Costa Dias(2)

(1) Bolsista Pibic/CNPq, (2) Embrapa Amaznia Ocidental, Rodovia AM 010, km 29, Zona Rural, Caixa Postal 319, 69010-970. Manaus AM. E-mail: jjackson@cpaa.embrapa.br, miguel@cpaa.embrapa.br.

Resumo - Historicamente a raiz reserva da mandioca vem sendo utilizada para dois tipos de
aproveitamento bsico: a mandioca de mesa (consumo in natura) e a mandioca para indstria de farinha e fcula. Com as descobertas recentes de clones de mandioca com alto teor de acar livre (glicose e sacarose), carotenides (beta-caroteno, licopeno e luteina) e protenas, foram estabelecidas novas formas de aproveitamento da raiz para produtos, tais como: xarope de glicose natural, picles de mandioca colorida, tucupi em p e suplemento alimentar (cpsulas de antioxidante, suplementos vitamnicos e outros). O objetivo desta pesquisa foi caracterizar morfologicamente os acessos de mandiocaba provenientes de diferentes municpios do Estado do Amazonas, nas condies de Manaus - AM. O experimento foi composto de duas repeties com 16 plantas, sendo 4 teis, distribudas em blocos ao acaso. As informaes resultantes das caracterizaes, aliadas aos dados de passaporte dos acessos, permitiram agrupar as variedades semelhantes em relao aos descritores mnimos (Fukuda, 1995).

Termos para indexao: Cassava, Manihot esculenta Crantz.

Botanic-agronomic characterization in the conditions of Manaus AM


Abstract - History cally the root reserves of the cassava comes being used for two types of basic exploitation, or either, the cassava of table and cassava for industry of flour and starch. With the recent discoveries of clones of cassava with high content of free sugar (glucose and sacarose), carotenoids (beta-carothene, licopene and lutein) and proteins had been established new forms of exploitation of the root for products such as: natural glucose boiled must, picles of colored cassava, dry tucupi and alimentary supplement (vitaminic antirust substance capsules, supplements and others). The objective of this research was to characterize morphology the accesses of cassava proceeding from different regions of the Amazon State, in the conditions of Manaus - AM. The experiment was composed of two repetitions with 16 plants characterizing 4 useful ones in randomzed blocks. The resultant information of the characterizations, allied to the data of passport of the accesses, had allowed to group the similar varieties in relation to the minimum describers (Fukuda, 1995) Index terms: Cassava, Manihot esculenta Crantz.

Introduo
Das culturas que produzem razes e tubrculos usados na alimentao humana, a mandioca considerada uma das mais importantes em reas agrcolas, onde normalmente se cultivam espcies tradicionais que fazem parte da cesta bsica do brasileiro. Estudos socioeconmicos relatam que a mandioca uma cultura emergente no cenrio mundial, tornando-se uma "commodity" de segurana alimentar nas reas pobres do globo (Lynam, 1987). Dessa

maneira, as pesquisas para melhorar o cultivo da mandioca esto diretamente relacionadas com o desenvolvimento nacional e mundial para garantir alimentos s reas pobres do globo e aliviar as desigualdades sociais, bem como para proteger o ambiente. A mandioca tem importncia fundamental na cultura brasileira (Allem et al., 2000; Schaal & Carvalho, 1987), pois foi demonstrado que o centro de origem e domesticao dessa planta est na regio sudoeste da Amaznia (Cabral et al., 2000).

I. O. V. L Costa

99

O estudo sobre acmulo, regulao e modificao do amido em razes reserva de mandioca tem sido alvo de pesquisa, por meio de anlise de diversidade de germoplasma e estratgias com tecnologia de transgnico (Zakhia et al., 1994; Salehuzzaman et al., 1992). A proporo amilo/amilase fortemente influenciada pelo meio ambiente, e a regulao gentica dependente do estgio de desenvolvimento da raiz na colheita. O acmulo de grandes quantidades de glicose devido adaptao das clulas do parnquima de reserva, que antes acumulavam amido e passaram a acumular glicose, de grande importncia. Por meio de pesquisas realizadas pelo laboratrio de bioqumica e biofsica da Embrapa Recursos Genticos e Biotecnologia, novos produtos foram extrados da raiz reserva da mandioca, tais como o concentrado de glicose natural, obtido sem a necessidade da hidrlise de amido. Por no ser obtido por hidrlise, esse produto est livre de resduos e/ou contaminantes, que podem permanecer no alimento ou serem liberados para o meio ambiente, e do amido seroso, derivado das razes de mandioca com mutao natural que alteram amilase e amilopectina, acumulando um amido com contedo zero de amilase. O projeto caracterizou e avaliou agronomicamente a diversidade da cultura da mandiocaba no Amazonas e testou novos clones, visando produo de acares e amido, para oferecer ao produtor rural alternativas de explorao da cultura da mandiocaba para alimentao bsica e melhoria da renda.

kg/ha de K2O, fracionados em duas partes: a metade aos 90 dias aps o plantio e a outra metade aos 120 dias, respectivamente. O experimento foi estabelecido em blocos ao acaso com 16 plantas por parcela, sendo 4 teis, com duas repeties. Os descritores morfolgicos e agronmicos avaliados foram: cor da folha apical, pubescncia do broto, forma do lbulo central, cor do pecolo, cor do crtex, cor externa do caule, comprimento da filotaxia, florao, cor da folha desenvolvida, nmero de lbulos, cor da epiderme do caule, hbito de crescimento do caule, vigor inicial das plantas, cor dos ramos terminais, altura da planta e da primeira ramificao, presena de pednculo nas razes, constrio da raiz, cor da nervura foliar, posio do pecolo, proeminncia das cicatrizes foliares, hbito de ramificao, tipo de planta, reteno foliar, sinuosidade do lbulo, rendimento das razes, facilidade de colheita, teor de cido ciandrico (HCN) e de amido.

Resultados e Discusso
A caracterizao realizada nos acessos de mandiocaba IM- 1688, IM-1689 e IM-1690, caracterizados nas Tabelas 1, 2, 3 e avaliados em condies de terra firme, mostrou que os vinte e cinco descritores morfolgicos usados para identificar e diferenciar facilmente os acessos no campo, assim como os agronmicos utilizados, potencializaram, de forma preliminar, a possibilidade de adaptao e de produo dos gentipos, quando comparados com a produtividade mdia de razes no Amazonas (10 t/ha). Os trs acessos estudados apresentaram produes de razes por hectare acima de 45 t, o que demonstra o seu potencial. Observa-se, tambm, que o teor de amido e de HCN foi baixo. No acesso IM1688, no foi possvel determinar o teor de amido pelo mtodo da balana hidrosttica, modelo 1020, indicando a possibilidade de outros usos, como relata Albuquerque (1969).

Material e Mtodos
O experimento foi conduzido no Campo Experimental da Embrapa Amaznia Ocidental do Km 29 da AM 010, no Municpio de Manaus, Amazonas. O solo onde se estabeleceu o trabalho foi preparado mecanicamente, atravs de trator acoplado com arado e grade, respectivamente. Aps o preparo do solo e em funo da sua anlise, aplicou-se calcrio dolomtico na quantidade de 2 t/ha, aos 45 dias de antecedncia do plantio, e 60 kg/ha de P2O5 por ocasio do plantio. Em cobertura, colocaram-se 30 kg/ha de N, bem como 40

100

I. O. V. L Costa

Tabela 1. Caracterizao botnico-agronmica de acessos de mandiocaba coletados no Amazonas. Manaus - AM, condio de terra firme, 2003/2004.
Acesso Cor da folha Forma lbulo apical: central: 3.Verdeclara 5.Verdeescura 7.Verdearroxeada 9.Roxa Pubescncia do broto apical: Cor do pecolo: Cor do crtex do caule Cor externa do caule 3.Laranja 4.Verdeamarelada 5.Dourada 6.Marromclara 7.Prateada 8.Cinza 9.Marromescura Comprimento da filotaxia: Presena de pednculo: Cor da folha No de desenvolvida: lbulos:

1.Ovide 0.Ausente 2.Elptica1.Presente lanceolada 3.Obovadalanceolada 4.Oblongolanceolada 5.Lanceolada 6.Reta ou linear 7.Pandurada 8.Linearpiramidal 9.Linearpandurada 10.Linearhostatilobada 2 2 2 1 1 1

1.Verde1.Amarela amarelada 2.Verde-clara 2.Verde 3.Verde-escura 3.Verdeavermelhada 5.Vermelhoesverdeada 7.Vermelha 9.Roxa

1Curto(<8cm) 0.sssil 3.Verde-clara 1.trs 2.Mdio(8-5cm) 3.pedunculada 5. Verde3.cinco 3.Longo(>15cm) 5.misto 5.sete escuro 7.nove 7.verde9.onze arroxeado 9.roxo

IC-1688 IC-1689 IC-1690

3 3 3

3 7 4

2 2 2

6 6 4

5 7 5

5 3 0

5 5 5

5 5 5

Tabela 2. Caracterizao botnico-agronmica de acessos de mandiocaba coletados no Amazonas. Manaus - AM, condio de terra firme, 2003/2004.
Acesso Cor da epiderme do caule: Hbito de Vigor crescimento: inicial da planta: 1. Pouco 2.intermediario 3.vigoroso Cor dos Cor da ramos nervura terminais: foliar: 3. Verde 5. Verdearroxeada 7.roxa 3.verde 5.verde -vermelha em menos da metade do lbulo 7.verde -vermelha em mais da metade do lbulo 9.toda vermelha 3 5 5 Posio do peciolo: Proeminncia das cicatrizes foliares: 3.sem proeminncia 5.proeminente Habito de ramificao: Tipos de planta: Reteno foliar:

1.creme 1.Reto 2.marrom- 2.Ziguezague clara 3.marromescura 4.laranja

1.inclinada para cima 3.horizontal 5.inclinada para baixo 7.irregular

1.ereto 2.dicotmico 3.tricotmico 4.tetratocmico

1.compacta 2.aberta 4.cilndrica

1.boa 2.regular 3.m

IC-1688 IC-1689 IC-1690

4 2 2

1 1 1

3 3 3

3 3 3

3 1 5

5 5 5

3 2 2

1 2 1

1 1 1

Tabela 3.Caracterizao botnico-agronmica de acessos de mandiocaba coletados no Amazonas. Manaus -AM, condio de terra firme, 2003/2004
Acesso Sinuosidade do lbulo foliar: 3.liso 7.sinuoso IC-1688 IC-1689 IC-1690 7 3 3 1,72 1,80 1,73 Altura da planta Altura da (m) primeira ramificao Florao:. Rendimento das razes no comerciais (kg/ha) Teor de amido (%) Teor de HCN (mg/kg) Presena de pednculo nas razes

0.Ausente 1.presente 0 0 1 53,7 45,1 52 X 20,69 21,99 3 3 4 5 3 0

I. O. V. L Costa

101

Agradecimentos
Fundao de Amparo Pesquisa do Estado do Amazonas (Fapeam), pela concesso da Bolsa Pibic.

HENRY, G.; GOTTRET, V. Global cassava trends: reassessing the crop's future. Colombia: CIAT, 1995. 45 p. (CIAT. Working Document, 157). SALEHUZZAMAN, S. N. I. M. et al. Cloning and characterization of starch biosynthetic genes of cassava (Manihot esculenta Crantz). In: ROCA, W. R, THRO, A. M (Ed.). Proceedings of the First International Scientific Meeting of Cassava Biotechnology Network, 1992, Cartagena, Columbia. Cali, Columbia: CIAT, 1993. (CIAT. Working Document, 123). VISSER, R. G. F, JACOBSEN, E. Towards modifying plants for altered starch content and composition. Trends in biotechnology. p. 63-68, 1993. ZAKHIA, N. et al. In: THRO, A. M. The cassava biotechnology network: proceedings of the second int. Scientific meeting, 22., 1995, Bogor, Indonesia. Cali: CIAT, 1995. 823 p. (CIAT Working Document, 150).

Referncias Bibliogrficas
ALBUQUERQUE, M. de. A mandioca na Amaznia. Belm: SUDAM. 277 p. ALLEM, A. C. et al. The primary gene pool of cassava (Manihot esculenta Crantz). In: INTERNATIONAL SCIENTIFIC MEETING ON CASSAVA BIOTECHNOLOGY, 4., 1998, Salvador. Proceedings... Braslia, DF: Embrapa Recursos Genticos e Biotecnologia/CBN, 2000. p. 3-14. CABRAL, G. B.; CARVALHO, L. J. C. B.; SCHAAL, B. A. Braslia: Embrapa Recursos Genticos e Biotecnologia/CBN, 2000. p.3650. In: INTERNATIONAL SCIENTIFIC MEETING ON CASSAVA BIOTECHNOLOGY, 4., 1998, Salvador. Proceedings... Braslia, DF: Embrapa Recursos Genticos e Biotecnologia/CBN, 2000.

CL50 de permanganato de potssio e efeito da exposio concentrao subletal sobre o tambaqui (Colossoma macropomum)
Andr Luiz Ferreira da Silva(1) e Edsandra Campos Chagas(2)
Centro Universitrio do Norte, Av. Joaquim Nabuco 1.232, CEP 69020-031, Manaus, AM. E-mail: andre@cpaa.embrapa.br; Embrapa Amaznia Ocidental, Rodovia AM 010, km 29, Zona Rural, Caixa Postal 319, 69010-970. Manaus - AM.. E-mail: edsandra@cpaa.embrapa.br
(2) (1)

Resumo - O objetivo deste trabalho foi determinar a concentrao mdia letal (CL50) do permanganato de potssio (KMnO4 ) para o tambaqui (Colossoma macropomum) e analisar os nveis de estresse aps exposio concentrao subletal. Para isso foram efetuados testes de toxicidade (CL50-96h) em aqurios de vidro de 40 L e, aps determinar a CL50, foram avaliados os efeitos secundrios da exposio concentrao subletal por meio de ndices fisiolgicos. A CL50 de KMnO4 foi calculada em 8,60 mg/L. A exposio de tambaquis concentrao subletal de KMnO4 por 96 horas causou aumento significativo nos nveis de glicose, cloreto e sdio plasmtico, quando comparado aos valores do grupo controle. A concentrao subletal de KMnO4 causa discreta alterao na homeostasia do tambaqui, portanto no adequada para uso em exposies prolongadas, acima de 96 horas. Termos para indexao: toxicidade aguda, homeostasia, piscicultura.

LC50 of potassium permanganate and effects of subletal exposure on tambaqui (Colossoma macropomum)
Abstract - The objective of this work was to determine the LC50 of potassium permanganate for tambaqui (Colossoma macropomum) and analyze the stress levels after exposure to sub-lethal concentration. For this toxicological test (LC50-96h) were done in glass aquarium of 40L, and after LC50 determination were evaluated the secondary effects of sub-lethal exposure through physiological index. The LC50 of KMnO4 was calculated in 8.60 mg/L. The exposure of tambaqui to sub-lethal concentration of KMnO4 for 96 hours promoted a significant increase in the levels of glucose, chloride and sodium, when compared to control. The sub-lethal concentration of KMnO4 promoted a slight alteration in tambaqui homeostasis; therefore this is not adequate for use in prolonged exposures, up 96 hours.
Index terms:acute toxicity, homeostasis, fish culture.

Introduo
O tambaqui (Colossoma macropomum) uma espcie que vem apresentando bom desempenho em diferentes sistemas de criao intensiva, como viveiros, igaraps e tanques-rede (Merola & Cantelmo, 1987; Merola & Souza, 1988; Andrade et al., 1993; Chellapa et al., 1995; Melo et al., 2001; Arbelez-Rojas et al., 2002). Estudos conduzidos com tambaquis criados em tanques-rede mostram que os parasitas de maior ocorrncia so os monogenides Anacanthorus spathulatus e

Linguadactyloides brinkmanni (Varella et al., 2003). Altas infestaes de monogneas nas brnquias de tambaqui podem tornar-se um srio problema por impedir as trocas gasosas na superfcie das lamelas branquiais (Thatcher, 1981). Dessa forma, informaes sobre a tolerncia do tambaqui a tratamentos teraputicos utilizados para o controle de monogenides devem ser avaliadas para estabelecer protocolos eficazes e com boa margem de segurana para a espcie.

A. L. F. da Silva

103

Um dos qumicos teraputicos amplamente utilizados para o controle de monogneas o permanganato de potssio (KMnO4) (Kabata, 1985). O KMnO4 um agente de oxidao que tem sido usado, por muitos anos, na aqicultura para o controle de parasitas de brnquias, infeces bacterianas e fngicas (Wellborn, 1985; Lazur, 1992), sendo utilizado tanto com fins teraputicos quanto profilticos (Kabata, 1985; Scott, 1993). O KMnO4 tem sido administrado via banhos teraputicos em concentraes de 2 a 5 mg/L em banhos de longa durao (mnimo de 4 horas) (Kabata, 1985; Lazur, 1992; Scott, 1993). Contudo, limitada quantidade de informaes disponvel sobre a toxicidade do permanganato de potssio para os peixes, principalmente para o tambaqui. Marking & Bills (1975) determinaram que a toxicidade do KMnO4 maior a baixas temperaturas, a altos valores de pH e em guas duras. Segundo Tucker (1987), a toxicidade do KMnO4 para o bagre de canal (Ictalurus punctatus) foi fortemente relacionada com a demanda qumica de oxignio (DQO) da gua do tanque de cultivo. Por outro lado, alm do levantamento dos fatores que afetam a determinao da CL50, importante conhecer os efeitos subletais da exposio ao KMnO4 para avaliar a segurana do uso desse qumico no tratamento de doenas parasitrias em tambaqui. O objetivo deste trabalho foi determinar a CL50 de permanganato de potssio para o tambaqui e analisar os nveis de estresse aps exposio concentrao subletal.

Material e Mtodos
Juvenis de tambaqui (comprimento padro 11,80 0,05 cm e peso 59,10 1,34 g; mdia erro padro) foram adquiridos na Fazenda Santo Antnio (Rio Preto da Eva, AM). Em seguida, esses animais foram transportados para o campo experimental da Embrapa Amaznia Ocidental (Km 29, Rodovia AM 010), onde foram aclimatados 3 em tanques escavados de 200 m . Os peixes foram alimentados com rao comercial para tambaqui (36% PB) at a saciedade aparente, seis dias por semana, durante o perodo prexperimental. A alimentao dos animais foi suspensa 24 horas antes do incio dos testes

de toxicidade e durante estes. Os ensaios foram conduzidos em aqurios de vidro com volume fixo de 40 litros, com condies semi-estticas e dotados de aerao constante. Os testes foram efetuados com grupos de seis animais, trs repeties por tratamento, utilizando delineamento inteiramente casualizado. Os ensaios foram conduzidos em aqurios de vidro com volume fixo de 40 litros, com condies semi-estticas e dotados de aerao constante. Os testes foram efetuados com grupos de seis animais, trs repeties por tratamento, utilizando delineamento inteiramente casualizado. Depois de um perodo de aclimatao de 24 horas, os peixes foram expostos a um controle (sem adio de KMnO4) e sete concentraes de KMnO4 (6,5; 7,0; 8,0; 9,0; 10; 11,5 e 13 mg/L). As concentraes usadas foram escolhidas para alcanar entre 0% e 100% de mortalidade dos animaistestes, em 96 horas de exposio, baseadas em resultados de ensaios preliminares. Os parmetros fsico-qumicos da gua dos aqurios foram monitorados diariamente durante a execuo dos testes de toxicidade. Os valores de pH foram obtidos com auxlio de um pHmetro da marca YSI Environmental, modelo pH100, e as medidas de temperatura e oxignio dissolvido foram realizadas com o auxlio de um oxmetro da marca YSI, modelo 55. Os valores desses parmetros, registrados durante o perodo experimental, 0 foram 7,16 0,04 unidades, 26,70 0,11 C e 7,09 0,07 mg/L, respectivamente. O valor de CL50 (concentrao mdia letal) de KMnO4 foi determinado pelo mtodo Trimmed Spearman-Karber (Hamilton et al., 1977) utilizando a mortalidade mdia dos peixes. O ensaio de exposio concentrao subletal de KMnO4 durante 96 horas foi conduzido com grupos de seis animais (comprimento padro 11,68 0,05 cm e peso 52,27 1,01 g; mdia erro padro) por aqurio, com trs repeties por tratamento. Os tratamentos utilizados foram: controle (sem adio de KMnO4) e 50% da CL50 de KMnO4 (4,30 mg/L). Os valores dos parmetros de qualidade de gua, neste experimento, foram: pH 7,39 0,07 0 unidades, temperatura 25,67 0,13 C e oxignio dissolvido 7,66 0,11 mg/L.

104

A. L. F. da Silva

A toxicidade do KMnO4 para o tambaqui foi estudada por meio das mudanas nos parmetros fisiolgicos avaliados nos peixes expostos concentrao subletal. Para isso, com os peixes previamente anestesiados com 100 mg/L de benzocana (Gomes et al., 2001), procedeu-se coleta de sangue de seis peixes de cada repetio, mediante puno de vasos caudais, com seringas heparinizadas para determinao dos nveis de glicose, utilizando-se um monitor de glicose no sangue, o Advantage TM (Advantage TM, Boehringer Mannheim GmbH, Mannheim D68298, Germany). O sangue foi centrifugado a 3.500 rpm por cinco minutos, para obteno do plasma, visando determinao dos nveis de cloreto plasmtico, usando-se um "kit" comercial especfico (Doles, Gois, Brasil), e dos nveis de Na+ e K+ , com fotmetro de chama, marca Micronal, modelo B462. Os resultados obtidos esto expressos atravs de mdia erro padro da mdia

(SEM). A significncia das diferenas encontradas entre as mdias dos parmetros analisados em animais expostos concentrao subletal de KMnO4 e o grupo controle foi estimada por teste t de Student, assumindo o intervalo de confiana de 5% (P<0,05) (Zar, 1999).

Resultados e Discusso
Para as concentraes de KMnO 4 utilizadas nos ensaios, foi observado um aumento na taxa de mortalidade dos tambaquis diretamente proporcional ao aumento na concentrao de KMnO4 na gua (Figura 1). As maiores taxas de mortalidade ocorreram dentro de 24 horas, confirmando os estudos de Marking & Bills (1975), que determinaram a toxicidade de KMnO4 para dez espcies de peixes e relataram que a toxicidade do qumico muda pouco aps 24 horas.

100 90 80
Dados Funo I C - 95%

Mortalidade (%)

70 60 50 40 30 20 10 0 4 5 6 7 8 9 10 11 12 13 14

CL50 96 h - 8,6 mg/L

Permanganato de potssio (mg/L)

A. L. F. da Silva

105

Tambaquis expostos a concentraes acima de 6,5 mg KMnO4/L apresentavam-se agitados nas primeiras horas de exposio ao qumico, com intensa liberao de muco e alterao do batimento opercular. Aps 24 horas de exposio, comearam a apresentar letargia, perda de equilbrio e os olhos saltados. Esse mesmo padro de alterao comportamental foi observado por Straus (2004) para "Hybrid Striped Bass" (Morone chrysops x Morone saxatilis) expostos ao KMnO4 por 24 horas. A CL50-96 horas de KMnO4 para o tambaqui foi calculada em 8,60 mg/L. Para o bagre de canal (Ictalurus punctatus) e "striped bass" (Morone saxatilis), as estimativas de CL50-96 horas de KMnO4 foram de 4,5 e 4,0 mg/L, respectivamente (Hughes, 1971; Tucker, 1987). Portanto, comparado a outras espcies de peixes cultivados (Tabela 1), o tambaqui apresenta boa tolerncia ao KMnO4.
Tabela 1. Valores comparativos de CL50-96 horas de KMnO4 para Colossoma macropomum e outras espcies de peixes cultivadas.
Espcie CL50-96 horas (mg/L) 4,00 7,52 4,50 3,05 8,60 Referncias

Tabela 2. Valores de glicose, cloretos, sdio e potssio plasmtico de juvenis de tambaqui expostos por 96 horas concentrao subletal de permanganato de potssio. Parmetros Permanganato de potssio 0 mg/L 50,9 3,90 Glicose (mg/dL) Cloretos (mmol/L) 117,24 4,81 126,92 2,56 Sdio (mEq/L) 5,48 0,32 Potssio (mEq/L) 4,30 mg/L 63,5 3,44* 136,11 4,00* 136,10 2,54* 4,89 0,36

(1) Em cada linha, mdias seguidas por asterisco(*) apresentam diferena estatstica em relao ao controle, a 5% de probabilidade pelo teste t de "Student".

Morone saxatilis Anguilla rostrata Ictalurus puncatus Cyprinus carpio Colossoma macropomum

Hughes (1971) Hilton & Eversole (1980) Tucker (1987) Das & Kaviraj (1994) Presente estudo

Os testes de toxicidade crnica, que consistem em expor os organismos a concentraes subletais de um qumico, so importantes para entender como um organismo pode responder a uma perturbao (Heath, 1995). Para o tambaqui foi observado aumento significativo nos nveis de glicose, cloreto e sdio plasmtico aps exposio a 4,30 mg/L de KMnO4 comparados aos valores do grupo controle (0 mg/L) (Tabela 2); uma diminuio nos valores de potssio plasmtico, embora no significativa, foi observada para os peixes expostos ao KMnO4 (Tabela 2). Essa mudana nos nveis de glicose e cloreto plasmtico tambm foi evidenciada para bagres de canal (Ictalurus punctatus) expostos por 96 horas a 2,19 mg/L de KMnO4 (Griffin, 2002), caracterizando distrbio no equilbrio inico de ambas as espcies.

Os resultados obtidos para o tambaqui permitem caracterizar um quadro de estresse moderado, haja vista a alterao de alguns indicadores secundrios de estresse, como a glicose e ons plasmticos (aumento no Na+, Cl- e diminuio no K+). Hiperglicemia nos peixes, em situao de estresse, ocorre em razo da rpida mobilizao das reservas de energia, possibilitando ao animal resistir ao perodo de perturbao (Morgan & Iwama, 1997). Segundo Mazeaud & Mazeaud (1981), os distrbios nas concentraes de Na+ e Cl-, em situao de estresse, podeM se dar em funo dos aumentados nveis de adrenalina no sangue. A determinao da toxicidade de KMnO4 para o tambaqui importante para estabelecer os limites de tolerncia para o uso desse qumico, visto que o KMnO4 bastante empregado no tratamento de doenas parasitrias de peixes nas concentraes de 2 a 5 mg/L em banhos de longa durao (Kabata, 1985; Scott, 1993). Os resultados deste estudo mostram que a concentrao subletal de KMnO4 (4,30 mg/L) ativa alguns indicadores secundrios de estresse, provocando discreta alterao na homeostasia do tambaqui, portanto no adequada para uso em exposies prolongadas (acima de 96 horas). Essas informaes iro subsidiar os tcnicos responsveis pela conduo dos tratamentos de doenas em peixes a aplicarem uma taxa mais segura e efetiva de KMnO4.

106
Concluses

A. L. F. da Silva

World Aquaculture Society, v. 32, p. 426431, 2001. GRIFFIN, B. R. et al. Effect of exposure to potassium permanganate on stress indicators in channel catfish Ictalurus punctatus. Journal of the World Aquaculture Society, v. 33, p. 19, 2002. HAMILTON, M. A.; RUSSO, R. C.; THURSTON, R. V. Trimmed Spearman-Karber method for estimating median lethal concentration in toxicity bioassays. Environmental Science and Tecnology, v. 11, p. 714-719, 1977. Heath, A. G. Water pollution and fish physiology. Boca Raton, Florida: CRC Press Inc., 1995. 342 p. HILTON, M. J.; EVERSOLE, A. G. Toxicity and tolerance studies with yellow-phase eels: five chemicals. Progressive Fish-culturist, v. 42, p. 201-203, 1980. HUGHES, J. S. Tolerance of striped bass, Morone saxatilis (Walbaum), larvae and figerlings to nine chemicals used in pond culture. Proceedings of the 24th Anual Conference, Southeastern Association of Game and Fish Commissioners, v. 24, p. 431438, 1971. KABATA, Z. Parasites and diseases of fish cultured in the tropics. London: Taylor & Francis, 1985. 318 p. LAZUR, A. M. The use of potassium permanganate in fish ponds. Gainesville FL: IFAS University of Florida, 1992. 4 p. (Fact Sheet FA, 23). MARKING, L. L.; BILLS, T. D. Toxicity of potassium permanganate to fish and its effectiveness for detoxifying antimycin. Transactions of the American Fisheries Society, v. 104, p. 579-784, 1975. MAZEAUD, M.; MAZEAUD, F. Adrenergic responses to stress in fish. In: PICKERING, A. D. (Ed.). Stress and fish. New York: Academic Press, 1981. p. 49-75.

A CL50-96 horas de KMnO4 para o tambaqui foi calculada em 8,60 mg/L. A exposio de tambaquis concentrao subletal de KMnO4 (4,30 mg/L) promove aumento na glicose, cloreto e sdio plasmtico.

Agradecimentos
Ao Sr. Jos Pereira de Souza, da Embrapa Amaznia Ocidental, pelo auxlio na conduo dos experimentos, e ao projeto TANRE FINEP/FUCAPI, pelo apoio financeiro.

Referncias Bibliogrficas
ARBELEZ-ROJAS, G. A.; FRACALOSSI, D. M.; FIM, J. D. I. Composio corporal de tambaqui, Colossoma macropomum, e matrinx, Brycon cephalus, em sistemas de cultivo intensivo, em igarap, e semiintensivo, em viveiros. Revista Brasileira de Zootecnia, v. 31, p. 1059-1069, 2002. ANDRADE, P. C. M.; TOLENTINO, A. S.; FREITAS, C. E. C. Desenvolvimento de juvenis de tambaqui (Colossoma macropomum Cuvier, 1818) em gaiolas. Revista da Universidade do Amazonas: Srie Cincias Agrrias, v. 2, p. 21-30, 1993. CHELLAPA, S. et al. Growth and production of the Amazonian tambaqui in fixed cages under different feeding regimes. Aquaculture International, v. 3, p. 11-21, 1995. DAS, B. K.; KAVIRAJ, A. Individual and interactive letahal toxicity of cadmium, potassium permanaganate and cobalt chloride to fish, worm and plankton. Geobios, v. 21, p. 223-227, 1994. FRANCIS-FLOYD, R.; KLINGER, R. Use of potassium permanganate to control external infections of ornamental fish. Gainesville: University of Florida, 1997. 4 p. (Fact Sheet FA, 37). Gomes, L. C. et al. Efficacy of benzocaine as an anesthetic in juvenile tambaqui, Colossoma macropomum. Journal of the

A. L. F. da Silva

107

MELO, L. A. S.; IZEL, A. C. U.; RODRIGUES, F. M. Criao de tambaqui (Colossoma macropomum) em viveiros de argila/barragens no Estado do Amazonas. Manaus: Embrapa Amaznia Ocidental, 2001. 30 p. (Embrapa Amaznia Ocidental. Documentos, 18). MEROLA, N.; CANTELMO, O. A. Growth, conversion and mortality of cage-reared tambaqui, Colossoma macropomum, fed various dietary feeding regime sand protein levels. Aquaculture. v. 66, p. 223-233, 1987. MEROLA, N.; SOUZA, J. H. Cage culture of the Amazon fish tambaqui, Colossoma macropomum, at two stocking densities. Aquaculture. v. 11, p. 15-21, 1988. MORGAN, J. D; IWAMA, G. K. Measurements of stressed states in the field. In: IWAMA, G. D. et al. Fish stress and health in aquaculture.. England: Cambridge, 1997. p. 247-270. (Society for Experimental Biology Seminar. Series 62). SCOTT, P. Therapy in aquaculture. In: BROWN, L. (Ed.). Aquaculture for veterinarians: fish husbandry and medicine. Oxford: Pergamon, 1993. p. 131-152. STRAUS, D. L. Comparison of the acute toxicity of potassium permanganate to hybrid striped bass in well water and diluted well water. Journal of the World Aquaculture Society, v. 35, p. 55-60, 2004.

THATCHER, V. E. Patologia de peixes da Amaznia Brasileira. 1. Aspectos gerais. Acta Amaznica, v. 11, n. 1, p. 125-140, 1981. TUCKER, C. S. Acute toxicity of potassium permanganate to channel catfish fingerlings. Aquaculture, v. 60, p. 93-98, 1987. VARELLA, A. M. B; PEIRO, S. N.; MALTA, J. C. O.; LOURENO, J. N. P. Monitoramento da parasitofauna de Colossoma macropomum (Cuvier, 1818) (Osteichthyes: Characidae) cultivado em tanques-rede em um lago de vrzea na Amaznia, Brasil. In: URBINATI, E. C.; CYRINO, J. E. P. (Ed.). Anais do XII Simpsio Brasileiro de Aqicultura. Jaboticabal: AQUABIO, 2003. v. 2. p. 95106. WELLBORN, T. L. Control and therapy. In: PLUMB, J. A. (Ed.). Principal diseases of farm raised catfish. Auburn: Alabama Agricultural Experimental Station. Auburn, Alabama, USA, 1985. p. 50-70. ZAR, J. H. Biostatiscal analysis. 4. ed. New Jersey: Prentice Hall, 1999. 663 p.

Densidade de estocagem de juvenis de matrinx durante a recria em tanques-rede


Franmir Rodrigues Brando(1) e Levy de Carvalho Gomes(2)
Centro Universitrio Nilton Lins, Av. Prof. Nilton Lins 3.259, CEP 69058-040, Manaus, AM. E-mail: franmir@cpaa.embrapa.br; Embrapa Amaznia Ocidental, Rodovia AM 010, km 29, Zona Rural, Caixa Postal 319, 69010-970. Manaus - AM. E-mail: levy@cpaa.embrapa.br
(2) (1)

Resumo - O objetivo deste trabalho foi determinar a densidade de estocagem mais adequada para a fase de recria de matrinx (Brycon cephalus) em tanque-rede. Os peixes foram distribudos em 3 3 12 tanques-rede de 1m , nas densidades de 200, 300, 400 e 500 peixes/m , e alimentados com rao comercial contendo 34% de protena bruta (PB), durante 60 dias. Foram analisados os parmetros de crescimento e produtividade. No houve diferena no peso e comprimento aps 60 dias de criao. A produo por rea foi significativamente maior na maior densidade testada. 3 Dentre as densidades testadas, a de 500 peixes/m a mais adequada para recria de matrinx em tanque-rede. Termos para indexao: Brycon cephalus, piscicultura, produo, densidade de estocagem.

Stocking density during second growth phase of matrinxa Brycon cephalus in cages
Abstract - The objective of this work was to determine the adequate stocking density to second growth phase of matrinx in cage. Fish has been stocked in 12 cages with 1 m3 each one in four different densities 200, 300, 400 and 500 fish/m3. Fish were fed on commercial diets with 34% of crude protein during 60 days. Growth and productivity parameters were evaluated. After 60th days, there were no differences in weight and length. The production per area was significantly 3 higher in the highest densities. The density of 500 fish/m for matrinx was the most adequate to the second growth phase in cage. Index terms: Brycon cephalus, fish culture, production, stocking density.

Introduo
A criao de peixe vem sendo praticada em diversos pases durante muitos sculos. Em alguns pases asiticos a aquicultura uma atividade de mais de mil anos. No passado foi uma atividade de carter familiar, desenvolvida para produo de protena para a prpria famlia ou no mximo para uma pequena comunidade (Val & Honczaryk, 1995). A piscicultura uma das atividades zootcnicas mais promissoras para incrementar a produo de alimentos ricos em protenas (Galli & Torloni, 1989). Dentre as principais vantagens, destaca-se, pela sua repercusso econmica, o aproveitamento de reas improdutivas ou de baixo rendimento agropecurio (Galli & Torloni, 1989).

Existem diversos sistemas de criao de peixes, mas, na Regio Amaznica, o sistema de criao em tanques-rede o mais promissor, em razo, principalmente, da abundncia e disponibilidade de corpos de gua potencialmente utilizveis para a piscicultura, como lagos, rios, parans e igaraps. Os juvenis de espcies nativas, normalmente disponveis no mercado, so de tamanho inferior ao mnimo necessrio (15 cm) para povoamento de tanques-rede de engorda. Portanto, para que a criao de peixes em tanques-rede cresa no Brasil necessrio desenvolver um pacote de produo direcionado para recria, que a fase de engorda de um peixe de 2-5 cm at atingir 16 cm.

F. R. Brando

109

Para o desenvolvimento de um pacote de produo para uma espcie de peixe, o primeiro passo a determinao da densidade de estocagem ideal, a qual visa estabelecer os nveis timos de produtividade por rea. Jobling (1994) relata que a densidade de estocagem tem efeito na sobrevivncia e no crescimento, sendo uma possvel causa do fracasso na produo final de peixes. Normalmente, peixes criados em baixas densidades de estocagem apresentam boa taxa de crescimento e alta porcentagem de sobrevivncia, porm a produo por rea baixa (Gomes et al., 2000), caracterizando baixo aproveitamento da rea disponvel. Por sua vez, peixes mantidos em altas densidades tm menor crescimento (El-Sayed, 2000), ficam estressados (Iguchi et al., 2003) e esto sujeitos ao aparecimento de interaes sociais que levam produo de um lote de peixes com tamanhos heterogneos (Cavero et al., 2003) Esse insucesso em transformar juvenis I em juvenis II tem sido um obstculo ao desenvolvimento da atividade. Fica explcita, portanto, a necessidade de se produzir juvenis II para o povoamento em tanques-rede. A espcie escolhida para este projeto foi o matrinx (Brycon cephalus), que a segunda espcie mais criada na Regio Amaznica e com disponibilidade de juvenis. Segundo os fornecedores de juvenis, trata-se de uma das espcies mais procuradas para ser criada em tanques-rede na Amaznia. Como primeira etapa para gerar tecnologia de produo de juvenis II de matrinx, o objetivo deste projeto determinar a melhor densidade de estocagem desses peixes em tanques-rede. Para avaliar a melhor densidade, sero levados em considerao a sobrevivncia, o crescimento, a produtividade e a qualidade da gua.

Material e Mtodos
Juvenis de matrinx (4,110,05 cm e 0,560 0,0 g; mdia erro padro) foram obtidos na Fazenda Santo Antnio (Rio Preto da Eva, AM) e levados para 12 tanques-rede com 1 m3 de rea til e malha de 20 mm entrens, revestidos internamente por malha de multifilamento de 5 mm entrens. Os tanques foram instalados em um aude de 6 hectares abastecido por gua da chuva,

localizado no Pesque-Pague San Diego, Manaus, AM, com as seguintes caractersticas fsico-qumicas da gua: oxignio dissolvido (mg/L), 6,061,24; temperatura ( 0 C), 30,860,65; pH (unidades), 5,640,30; dureza (mg/L), 7,130,25, alcalinidade (mg/L), 8.31 0,46 e amnia total (mg/L), 0,2930,15. O aude era povoado por uma quantidade desconhecida de tambaqui, tucunar, jaraqui e matrinx destinados pesca esportiva. Nos tanques, os juvenis foram distribudos em delineamento experimental inteiramente casualizado com quatro diferentes densidades (trs repeties para cada densidade): 200, 300, 400 e 500 juvenis/m3 . O experimento teve durao de 60 dias, entre outubro e dezembro de 2003, e os peixes foram alimentados at a saciedade aparente trs vezes por dia, sete dias por semana, com rao comercial extrusada com 36% de protena bruta (PB). Aos 30 e 60 dias de criao, foram capturados 30 peixes de cada tanque-rede, os quais foram anestesiados com 50 mg/L benzocana, pesados e medidos. Com o resultado da biometria, foi possvel calcular o crescimento em peso e comprimento, o coeficiente de variao do comprimento [ C V = ( d e s v i o p a d r o d o comprimento/comprimento mdio )x 100] e a taxa de crescimento especfico (TCE= [(1n peso tempo 1-1n peso tempo 0)/tempo]x 100). Os parmetros de produtividade final avaliados foram: sobrevivncia (%), produo 3 por rea (peixe/m ), ganho de peso (GP = peso inicial-peso final) e converso alimentar aparente (CAA= consumo de rao/ganho de peso). O oxignio dissolvido e a temperatura foram avaliados seis vezes por semanas com oxmetro digital; a cada sete dias, o pH com um potencimetro digital; alcalinidade e dureza, por titulao (Boyd,1982); e a amnia total pelo mtodo do endofenol (Apha, 1992). Aos 60 dias de experimento, foi retirado sangue, por puno caudal, de trs peixes de cada tanque-rede para avaliar o estado fisiolgico dos animais. O indicador de estresse foi a glicose sangunea, medida com TM um leitor digital (Advantage ).

110

F. R. Brando

Os resultados obtidos foram comparados entre as densidades por anlise de varincia e teste de Tukey a 5% de probabilidade (Zar,1999).

Resultados e Discusso
Os parmetros de qualidade da gua, com exceo da dureza, no apresentaram diferena significativa entre as densidades (Tabela 1). As concentraes de oxignio dissolvido e temperatura no apresentaram diferena significativa entre as densidades testadas e esto dentro da faixa considerada tima para criao de peixes, segundo Boyd (1982). Os valores de dureza apresentaram diferena quando comparados s densidades de 200 e 500 peixes/m3. Na maior densidade a

dureza foi mais alta do que na menor, porm essa varivel no deve ter causado efeito negativo na produo de matrinx. Os valores da alcalinidade no apresentaram diferena significativa entre as densidades, estando esses valores abaixo do considerado adequado para a criao de peixes, porm as guas de ocorrncia natural da espcie e as utilizadas para criao de peixes na Amaznia normalmente apresentam baixas concentraes de sais dissolvidos (Izel, 1995; Arajo-Lima & Goulding, 1997). Portanto, essa varivel, mesmo estando abaixo do considerado ideal (entre 20 e 300 mg/L), no deve ter causado efeito negativo na produo de matrinx.

Tabela 1. Parmetros de qualidade da gua (mdia erro-padro) durante a recria de matrinx em tanques-rede, em diferentes densidades de estocagem(1). Densidade de estocagem (peixe/m3) Parmetros fsico-qumicos Oxignio dissolvido (mg/L) Temperatura (C) PH Alcalinidade (mg/L) Dureza (mg/L) Amnia total (mg/L) 200 5,940,21a 30,840,00a 5,620.01a 8,560,07a 6,270,10b 0,350,01a 300 5,880,23a 30,820,01a 5,620,04a 8,720,23a 6,820,15ab 0,320,01a 400 5,600,05a 30,840,02a 5,720,01a 8,800,07a 6,900,13a 0,370,01a 500 5,580,06a 30,840,01a 5,690,02a 8,640,16a 7,150,15a 0,350,01a

O pH no apresentou diferena significativa entre as densidades testadas. Segundo Val et al. (1995), considerada satisfatria para a piscicultura a gua que apresenta pH superior a 5 e inferior a 9. importante dizer que peixes criados em guas com o pH abaixo de 5 podem apresentar problemas na reproduo, m formao do esqueleto e crescimento lento. Larvas e alevinos geralmente morrem quando expostos a um pH abaixo de 5 e acima de 9. A amnia no apresentou diferena significativa entre as densidades testadas. Segundo Proena & Bittencourt (1994), acima de 0,5 mg/L tm-se nveis subletais, e abaixo de 0,05 mg/L, a concentrao ideal. O trabalho apresentou uma amnia entre 0,35 e 0,37 mg/L, obtendo-se, portanto, bons nveis para criao de peixe. A glicose um eficiente indicador de distrbio fisiolgico, por ser a principal fonte de energia utilizada pelos peixes para suportar

situaes desfavorveis (Morgan & Iwama, 1997). Segundo Procarione et al. (1999), densidades de estocagem extremas causam aumento na glicose sangunea e conseqente diminuio do crescimento, pois a energia destinada ao crescimento desviada para compensar a situao desfavorvel. No houve diferena significativa na glicose sangunea dos peixes entre as densidades, significando que nenhuma das densidades testadas fisiologicamente extrema para o matrinx (Figura 1). De acordo com Jobling (1994), altas densidades de estocagem ocasionam problemas de espao e afetam a taxa de crescimento. As variveis de crescimento avaliadas no apresentaram diferena significativa entre as densidades com 30 dias (Tabela 2), indicando que para esse tempo de criao a disponibilidade de espao no teve efeito adverso no crescimento dos peixes nas densidades testadas.

111
100 Glicose (mg/dL) 80 60 40 20 0 200 300 400 500 Densidade de estocagem (peixe/m3)

112

F. R. Brando

Tabela 3. Produtividade de juvenis de matrinx durante a recria em tanques-rede, em diferentes densidades de estocagem (1); os resultados so mdia erro-padro. Parmetros 200 Sobrevivncia (%) Converso alimentar aparente Produo por rea (peixes/m3) Ganho de peso (kg/m3)
(1)

Densidade de estocagem (peixe/m3) 300 400 89,89+4,16a 1,32+0,06a 269,67+12,47bc 18,20+0,66 b 77,75+3,17a 1,33+0,12a 311,0+12,66b 18,42+1,53b

500 83,33+8,02a 1,31+0,13 a 416,67+40,11a 25,71+2,52 a

92,00+4,09a 1,35+0,07a 184,0+8,17c 13,05+0,48b

Nas linhas, mdias seguidas pela mesma letra no diferem entre si pelo teste de Tukey a 5% de probabilidade.

A produo por rea foi significativamente 3 mais alta na densidade de 500 peixes/m quando comparada s densidades de 200, 300 e 400 peixes/m3. A produo na maior densidade foi de 416,6740,11 peixes/m 3.

of nile tilapia (Oreochromis nlotinus) fry. Aquaculture Research, v. 33, p. 621-626, 2002. ENGLE, C. R. Growth of fed bighead carp in cages at two stocking densities. Progressive Fish-Culturist, v. 44, n. 4, p. 216-217, 1982. ESQUIVEL, B. M.; ESQUIVEL, J. R.; ZANIBONI, E. Effects of stocking density on growth of channel catfish, Ictalurus punctatus, fingerlings in southern Brasil. Journal of Applied Aquaculture, v. 7, n. 3, p. 1-6, 1997. GALLI, L. F.; TORLONI, C. E. Criao de peixes. So Paulo: Nobel, 1989. 119 p. GOMES, L. C.; BALDISSEROTTO, B.; SENHORINI, J. A. Effect of stocking density on water quality, survival, and growth of larvae of matrinxa , Brycon cephalus (Characidade), in ponds. Aquaculture, v. 183, p. 73-81, 2000. IGUCHI, K.; OGAWA, K.; ITO, F. The influence of rearing density on stress response and disease susceptibility of ayu (Plecoglossus altivelis). Aquaculture, v. 202, p. 515-523, 2003. IZEL, A. C. U. A qualidade do solo e da gua. In: VAL, A .L.; HONCZARYK, A. Criando peixes na Amaznia. Manaus: INPA, 1995. p. 17-28. JOBLING, M. Fesh bioenergetics. London: Chapman & Hall, 1994. 294 p.

Concluses
A produo por rea em tanques-rede maior com o aumento da densidade de estocagem. A densidade de estocagem ideal para a fase de recria de matrinx em tanques-rede 3 de 500 peixes/m .

Referncias Bibliogrficas
ARNOLD, E. et al. Standard methods for the examination of water and wastewater. 18. ed. Washington, DC, American Public Health Association, 1992. v. 1. ARAJO-LIMA, C. R. M.; GOULDING, M. So fruitful fish: ecology, conservation, and aquaculture of the Amazon's tambaqui. New York: Columbia University Press, 1997. 157 p. BOYD,C.E. Water quality management for pond fish culture. Amsterdam: Elsevier Science, 1982. 317 p. CAVEIRO, B. A. S. et al. Efeito da densidade de estocagem na homogeneidade do crescimento de juvenis de pirarucu em ambiente confinado. Pesquisa Agropecuria Brasileira, v. 38, n. 1, p. 103-107, 2003. EL-SAYED, A. Effects of stocking density and feeding levels on growth and feed efficiency

F. R. Brando

113

MORGAN, J. D.; IWAMA, G. K. Measurements of stressed states in the fied. In: IWAMA, G. K. et al. Fish stress and health in aquaculture. Cambridge: Cambridge University Press, 1997. p. 247-270. (Society for Experimental Biology Seminar Series, 62). PROCARIONE, L. S.; BARRY, T. P.; MALISON, J. A. Effects of high rearing density and loading rates on the growth and stress responses of juvenile rainbow trout. North American Journal of Aquaculture, v. 61, p. 91-96, 1999. PROENA, C. E. M.; BITTENCOURT, P. R. L. Manual de piscicultura tropical. Braslia: IBAMA: DIREN: DEPAQ/DIPEA, 1994. 196 p.

RICKER, W. E. Handbook of computations for biological statistics of fishes populations. Ottawa: Fisheries Research Board of Canada, 1958. 300 p. SILVA, J. W. B. E. et al. Cultivo do pacu Piaractus mesopotamicos (Holmberg,1887) em duas densidades de estocagem no nordeste do Brasil. Boletim Tcnico do CEPTA, v. 10, n. 1, p. 61-70, 1997. VAL, A. L.; HONCZARYK, A . Criando peixes na Amaznia. Manaus: INPA, 1995. 160 p. ZAR, J. H. Biostatiscal analysis. 4. ed. Saddle River: Prentice Hall, 1999. 663 p.

Efeito da taxa e freqncia alimentar no crescimento e na produtividade do tambaqui na fase de recria em tanques-redes
Clichenner Rodrigues Silva(1) e Levy de Carvalho Gomes(2)
(1) Escola Superior Batista do Amazonas (Esbam), Rua Rio Javary, 278 - Conj. Ablio Nery - Adrianpolis, Manaus, AM. E-mail: clichenner@cpaa.embrapa.br; (2)Embrapa Amaznia Ocidental, Rodovia AM 010, km 29, Zona Rural, Caixa Postal 319, 69010-970. Manaus - AM. E-mail: levy@cpaa.embrapa.br

Resumo - O cultivo de tambaqui (Colossoma macropomum) em tanques-rede tem sido bastante difundido no Brasil. Portanto, este trabalho teve o objetivo de determinar a melhor taxa e freqncia alimentar para tambaquis cultivados em tanques-rede na fase de recria. Foram utilizados 12 tanques-rede, onde foram testadas 2 taxas alimentares (5% e 10% do peso vivo) e 2 freqncias alimentares (2 e 3 refeies/dia). O experimento teve durao de 45 dias, no qual foi avaliado o crescimento em peso (g); comprimento (cm) e produtividade, e feito o monitoramento dos parmetros fsico-qumicos da gua a cada 2 dias. A taxa de 10% com freqncia de 3 vezes ao dia se mostrou mais eficiente que as outras taxas e freqncias alimentares, diminuindo o desperdcio e aumentando o crescimento. Termos para indexao: desperdcio de rao, produo, manejo alimentar.

Effect of feed rate and frequency on growth and productivity of tambaqui during second growth phase
Abstract - Tambaqui culture in cages has been diffused in Brazil. Therefore the aim of this work is
establishment the optimal feed rate and frequency for tambaqui rearing in net cages during second growth phase. Twelve net cages where used to test two feed rate and two feed frequency during 45 days, were evaluated growth in weight (g); in length (cm) and production. Water physicalchemical parameter was monitored each two days. The 10% feed rate with 3 daily feed were the best treatment, reducing feed waste and increasing growth.

Index terms: feed waste, production, feed management; Colossoma macropomum.

Introduo
O sistema de cultivo em tanques-rede tem sido bastante difundido em todo o Brasil. Atualmente est em franca expanso e progresso tecnolgico, respondendo por cerca de 10% da produo mundial (Silva, 1997). Uma espcie que apresenta excelente potencial para a criao nesse sistema o tambaqui (Colossoma macropomum), por ter bom crescimento e resistncia a baixas concentraes de oxignio dissolvido (ArajoLima & Goulding, 1998). No Brasil o cultivo de tambaqui data de 1972, e as primeiras observaes realizadas em cativeiros mostram que a espcie apresenta enorme potencial para piscicultura (Arajo, 1989). A engorda do tambaqui

proporciona boa resposta socioeconmica, pois a espcie de fcil aceitao no mercado (Castagnolli, 1989). O tamanho do peixe, a espcie e as condies de criao so importantes para se determinar tima taxa e freqncia alimentar. Esses fatores podem afetar a eficcia dos nutrientes oferecidos na alimentao, prejudicando o desempenho do peixe (Cho et. al, 2003). Dessa forma estudos devem ser realizados para as diferentes fases de criao do tambaqui em tanques-rede: recria e engorda.

C. R. Silva

115

O balanceamento da alimentao muito importante no crescimento do peixe, principalmente na fase inicial (Cho et al., 2003). Alimentos de qualidade no podem ser produzidos sem ingredientes de boa qualidade. Nessa fase da criao necessrio acompanhar o crescimento evolutivo do cultivo (Silva, 1997). Muitas vezes, o desperdcio de rao, na hora da alimentao do peixe, pode deteriorar a qualidade da gua dos tanques-rede, assim como aumentar o custo de produo, em decorrncia do grande gasto com rao (Cho et al., 2003). Por isso importante determinar uma taxa de alimentao e uma freqncia alimentar para peixes na fase de recria, para minimizar o custo de produo e o impacto ambiental. O objetivo deste trabalho foi determinar a taxa e a freqncia alimentar para tambaquis cultivados em tanques-rede na fase de recria.

Material e Mtodos
Juvenis de tambaqui (2,671,13g; 4,861,76 cm; mdiadesvio padro) foram obtidos na Fazenda Santo Antnio (Rio Preto da Eva, AM) e levados para 12 tanques-redes de 1m3 de capacidade e malha de 20 mm entrens, revestidos internamente por uma malha de multifilamentos de 5 mm entrens. Os tanques-rede foram instalados em um aude de 6 hectares abastecido por um poo escavado e gua da chuva, localizado no pesque-pague San Diego, no Km 35 da AM 010, Manaus, AM. A gua do aude tinha as seguintes caractersticas fsico-qumicas: oxignio dissolvido (mg/L) 6,971,80; temperatura (C) 29,730,53; pH 5,860,53 (unidades); dureza total (mg/L) 7,150,38; alcalinidade total (mg/L) 8,450,54 e amnia total (mg/L) 0,260,17. Nos tanques, os juvenis foram distribudos na densidade de 80 peixes/m 3 em delineamento experimental fatorial 2 x 2, com duas taxas (5% e 10% do peso vivo) e duas freqncias alimentares (duas e trs refeies/dia), com trs repeties para cada tratamento. O experimento teve durao de 45 dias, entre maio e julho de 2004. Os peixes foram alimentados seis vezes por semana, com rao comercial extrusada com 34% de protena bruta (PB).

A cada 15 dias foi feito biometria para avaliar o crescimento em peso e comprimento. Para isso, foram capturados 16 peixes de cada tanque, anestesiados com 100 mg/L de benzocana (Gomes et al., 2001), pesados e medidos. Aps cada biometria era ajustada a quantidade de rao fornecida, a partir da mdia do peso de cada tanque. Com os resultados da ltima biometria foi possvel calcular o crescimento em peso e comprimento, o coeficiente de variao do comprimento [CV = (desvio-padro do comprimento / comprimento mdio)* 100] e a taxa de crescimento especfico {TCE = [ln tempo 1 ln do tempo 0] / tempo}. O oxignio dissolvido e a temperatura foram avaliados trs vezes por semana, sempre s oito horas da manh, com oxmetro digital. A cada sete dias foram avaliados o pH com potencimetro digital, a alcalinidade e dureza por titulao (Boyd, 1982) e a amnia total por endofenol, conforme APHA (1992). Os resultados foram analisados e comparados por uma ANOVA de dois fatores e teste de Tukey a 5% de probabilidade (Zar, 1999).

Resultados e Discusso
Os parmetros fsico-qumicos da gua do aude se mantiveram em timos nveis para a recria de tambaqui em tanque-rede, de acordo com Boyd (1978). A alcalinidade e a dureza estavam abaixo do considerado bom para criao de peixes, mas a gua em criaes na Amaznia apresenta baixas concentraes de sais dissolvidos (Izel, 1995; Arajo Lima, 1997), no causando efeitos negativos na produo. A amnia em concentraes de 0,6 a 2,0 mg/l txica para o peixe (Melo, 1990), contudo, como os resultados obtidos no aude conservaram-se abaixo dessas concentraes (0,260,17), conclui-se que essa varivel no teve efeito negativo sobre o crescimento e a produtividade dos peixes. Os parmetros fsico-qumicos da gua dos tanques-rede, neste trabalho, foram semelhantes aos obtidos por Brando et al. (2004), que utilizou o mesmo aude para o cultivo de tambaqui, para testar diferentes densidades de estocagem, mostrando que no houve efeito negativo na produo do tambaqui em tanques-rede durante a recria.

116

C. R. Silva

Os resultados de crescimento em comprimento (cm), peso (mg/L), coeficiente de variao (CV%) e taxa de crescimento especfico (TCE) esto sumarizados na Tabela

1. A sobrevivncia, converso alimentar aparente, ganho de peso e produo por rea, obtidas nos diferentes tratamentos testados esto na Tabela 2.

Tabela 1. Crescimento de juvenis de tambaqui durante a recria em tanques-rede sob diferentes taxas e freqncias alimentares. Taxa alimentar 5 5 10 10 Freqncia alimentar 2 3 2 3 Comprimento (cm) 10,46 0,54 9,47 0,19 11,29 0,32 12,42 0,25 Peso (g) 26,24 19,39 36,92 46,08 2,90 1,39 2,58 3,57 CV (%) 18,98 18,48 20,22 15,52 0,80 4,47 5,92 2,56

Tabela 2. Produtividade de juvenis de tambaqui durante a recria em tanques-rede sob diferentes taxas e freqncias alimentares. Taxa Alimentar 5 5 10 10 Freqncia Alimentar 2 3 2 3 +5g*gM 6b?? 6b?? g> ( 6b?? V V V V ;}v6n] < v i Mw v v L|$kC cj =iI z xz xv K+ z x-

_ _ _ _

Na taxa alimentar de 5% peso vivo e freqncia alimentar de duas e trs vezes ao dia, foi possvel observar que os peixes tiveram um resultado aparentemente satisfatrio, mas essa taxa no pareceu suprir os peixes, no havendo sobras de rao. A freqncia de duas vezes ao dia se mostrou mais eficiente do que a de trs vezes ao dia na taxa de 5% peso vivo. A taxa alimentar de 5% peso vivo, dividida pela freqncia alimentar de duas vezes ao dia, tornava a quantidade de rao maior para os peixes, podendo todos os peixes do tanque consumir a rao. A taxa alimentar de 5% peso vivo, dividida pela freqncia alimentar de trs vezes ao dia, no saciava os peixes, alm de haver a possibilidade de os peixes menores e mais fracos no se alimentarem. A taxa alimentar de 10% peso vivo e as freqncias alimentares de duas e trs vezes ao dia mostraram melhor resposta, parecendo nutrir todos os peixes. A taxa alimentar de 10% peso vivo, dividida pela freqncia de duas vezes ao dia, teve melhor resposta que a taxa alimentar de 5% peso vivo mais freqncia de duas e trs vezes ao dia. Mas foi observado que houve grande desperdcio de rao, bastante sobra, causado pelo excesso de rao ofertada aos peixes na freqncia de

duas vezes ao dia. A taxa alimentar de 10% peso vivo, dividida pela freqncia de trs vezes ao dia, se mostrou mais eficiente que a taxa alimentar de 5% peso vivo e freqncia alimentar de duas e trs vezes ao dia, havendo pouca sobra de rao, nas trs alimentaes oferecidas, parecendo saciar todos os peixes, com menor sobra de rao.

Concluses
A taxa alimentar de 10% do peso vivo e a freqncia alimentar de trs vezes ao dia foram mais eficientes para o desempenho dos peixes durante a recria em tanque-rede, pois aumentou o crescimento, no afetou a produo e diminuiu o desperdcio de rao.

Referncias Bibliogrficas
APHA. Standard methods for the examination of water and wastewater. 18. ed. New York: American Public Health Association, 1992. part 1000-10000. ARAJO-LIMA, C.; GOULDING, M. Os frutos do tambaqui: ecologia, conservao e cultivo na Amaznia. Braslia: Sociedade Civil Mamirau/CNPq, 1998, 186 p.

C. R. Silva

117

ARAJO, O. J. Situao do cultivo de (Colossoma) no Brasil. In: REUNION GRUPO DE TRABAJO TECNICO, 1., 1988, Pirassununga. Cultivo de Colossoma. Bogota: CEPTA, 1989. p. 207-218. BOYD, C. E. Water quality management for pond fish culture. Amsterdam: Elsevier Science Publishers, 1982. 317 p. BRANDO, F. R. et al. Densidade de estocagem de juvenis de tambaqui durante a r e c r i a e m t a n q u e s - r e d e s . Pe s q u i s a Agropecuria Brasileira, Braslia, v. 39, n. 4, p. 357-362, abr. 2004. CASTAGNOLLI, N. Pesquisas realizadas e em desenvolvimento na UNESP com o pacu (piaractus mesopotamicos, HOLBERG, 1887) (Colossoma mitrei, Berg, 1895). In: REUNION GRUPO DE TRABAJO TECNICO, 1., 1988, Pirassununga. Cultivo de Colossoma. Bogota: CEPTA, 1989. p. 223-228. CHO, S. H. et al. Effect of feeding rate and feeding frequency on survival, growth, and body composition of Ayu post-larvae Plecoglossus altivelis. Aquaculture, n. 1, v. 34, p. 85-91, 2003

GOMES, L. C. et al. Efficacy of benzocaine as anesthetic for tambaqui juveniles (Colossoma macropomum). Journal of the World Aquaculture Society, v. 31, p. 426-431, 2001. IZEL, A. C. U. A qualidade do solo e da gua. In: Val, A. L.; HONCZARYK, A. (Ed.). Criando peixes na Amaznia. Manaus: INPA, 1995. p. 17-28. MELO. J. S. C. Alimentao natural em viveiros. Manaus. IBAMA-CEPTA, 1990. 9 p. SILVA, A. L. N. Piscicultura em tanques-rede: princpios bsicos. Setor de processos tcnicos da BC/UFRPE, 1997. P.11-55. ZAR, J, H. Biostatiscal analysis. 4. ed. Saddler River: Prentice Hall, 1999. 663 p.

Toxicidade da formalina para o tambaqui (Colossoma macropomum)


Lucelle Dantas de Arajo (1), Edsandra Campos Chagas
(1)

(2)

e Jos Celso de Oliveira Malta(3)

Bolsista do PIBIC/CNPq. E-mail: lucelle@cpaa.embrapa.br; (2)Embrapa Amaznia Ocidental, Rodovia AM 010, km 29, Zona Rural, Caixa Postal 319, 69010-970. Manaus - AM. E-mail: edsandra@cpaa.embrapa.br; (3)Instituto Nacional de Pesquisas da Amaznia (INPA), Coordenao de Pesquisas em Biologia Aqutica, Av. Andr Arajo, 2936, Aleixo, Caixa Postal 478, CEP 69083-000, Manaus, AM. E-mail: jcmalta@inpa.gov.br

Resumo - O objetivo deste trabalho foi determinar a toxicidade da formalina para o tambaqui
(Colossoma macropomum) e sua efetividade no controle de monogenides. Para isso, foram efetuados testes de toxicidade (CL50-96h) em tanques de polietileno de 50 L e tambm avaliada a efetividade da formalina, em tempos de exposio de 15, 30, 45 e 60 minutos, no combate a monogenides por meio de testes in vitro. A taxa de mortalidade nos testes de toxicidade foi diretamente proporcional ao aumento da concentrao de formalina e a CL50-96 horas foi calculada em 106,96 mg/L para o tambaqui. Os testes in vitro conduzidos com formalina na concentrao de 250 mg/L mostraram maior efetividade para o controle de monogneas nas brnquias de tambaqui aps 60 minutos de exposio (84,04%). Os resultados indicam baixa toxicidade de formalina para o tambaqui e boa efetividade na reduo de parasitas monogenides.

Termos para indexao: CL50,monogenides, sanidade.

Toxicity of formalin to tambaqui (Colossoma macropomum)


Abstract - The objective of this study was to determine the toxicity of formalin to tambaqui (Colossoma macropomum) and their efficacy in the monogeneans control. Toxicity trials (CL5096h) were carried out in 50 L-tanks and the efficacy of formalin was evaluated, in exposures of 15, 30, 45 and 60 minutes, in the control of monogeneans by in vitro tests. The mortality rate in the toxicity tests was directly proportional to increase in the formalin concentration and the CL5096 hour was calculated in 106, 96 mg/L for tambaqui. in vitro trials with 250 mg/L of formalin showed the higher efficacy to monogeneans control in the tambaqui gills after 60 minutes of exposure (84, 04%). The results indicate a low toxicity of formalin to tambaqui and a good efficacy in the reduction of monogeneans. Index terms: LC50,monogeneans, sanity.

Introduo
O tambaqui, Colossoma macropomum, um peixe telesteo de gua doce pertencente ordem Characiformes, famlia Serrasalmidae (Gery, 1977), nativo das bacias do Amazonas, Orinoco e afluentes. Atinge a maturidade sexual entre o terceiro e o quarto ano de vida, apresenta desova total, alta fecundidade e ovos semipelgicos (ArajoLima & Goulding, 1998). Sua dieta natural inclui zooplncton, frutos e sementes, sendo considerado um onvoro com tendncia a frugvoro (Honda, 1974). uma espcie com excelente potencial para cultivo por apresentar bom crescimento, hbito gregrio, resistncia a baixos nveis de oxignio dissolvido e excelente utilizao de alimentos

(Saint-Paul, 1986; Val et al., 1998). O cultivo do tambaqui j vem sendo realizado em tanques-rede (Merola & Cantelmo, 1987; Merola & Souza, 1988; Andrade et al., 1993; Chellapa et al., 1995; Chagas et al., 2003) e essa espcie vem se mostrando adequada para esta tecnologia de criao. No sistema de criao de peixes em tanques-rede, classificado como um sistema intensivo de renovao de gua (Beveridge, 1996), muito pouco se sabe sobre os problemas relativos ao manejo inadequado, s questes nutricionais e s enfermidades infecciosas e parasitrias, devendo-se enfatizar os estudos relativos ao levantamento, caracterizao e tratamento de doenas.

L. D. de Arajo

119

A fauna parasitolgica do tambaqui cultivado em sistema de tanques-rede foi recentemente avaliada, cujos parasitas identificados foram: Henneguya sp. e Myxobolus (Myxozoa); Anacanthorus spathulatus e Linguadactyloides brinkmanni (Monogenoidea); Neoechinorhynchus buttnerae (Acanthocephala); Gamidactylus jaraquensis e Ergasilus sp. (Copepoda), sendo a maior intensidade mdia relatada para os monogenides (Varella et al., 2003). Dentre os tratamentos utilizados para o controle de monogenides em peixes, esto os banhos teraputicos com formalina, cuja soluo deve possuir 37% de formaldedo dissolvido em gua e 10% a 15% de metanol (Kabata, 1985; Pironet & Jones, 2000; Fajervila et al., 2003), sendo o uso deste produto liberado como parasiticida para aqicultura pelas agncias de sade dos Estados Unidos (Fajer-vila et al., 2003), porm no Brasil ainda no existe legislao especfica liberando o uso deste qumico para o tratamento de doenas em peixes tropicais. A concentrao de formalina, ou de qualquer outro qumico, a ser utilizada em tratamentos teraputicos determinada pelo perodo de tempo em que o peixe estar em contato com o qumico, pela temperatura da gua e pela condio de sade dos peixes (Kabata, 1985; Fajer-vila et al., 2003). Neste caso, os testes de toxicidade so essenciais por simularem a situao ambiental (caractersticas fsicoqumicas da gua) na qual os organismos so expostos a determinada substncia txica, no caso a formalina, durante curto espao de tempo (24 a 96 horas) (Bertoletti, 1990). O objetivo deste trabalho foi avaliar a toxicidade da formalina para o tambaqui (Colossoma macropomum) e sua efetividade no controle de monogenides.

Os parmetros de qualidade da gua foram avaliados diariamente durante a execuo dos testes experimentais. Os valores de pH foram obtidos com auxlio de pHmetro da marca YSI Environmental, modelo 100, e as medidas de temperatura e oxignio dissolvido foram realizadas com o auxlio de um monitor YSI 55. Os valores desses parmetros registrados durante o perodo experimental foram 7,40 0,07 unidades, 26,92 0,15 0C e 7,25 0,04 mg/L, respectivamente.

Determinao da concentrao mdia letal (CL50 - 96h) de formalina


A CL50 - 96 horas a concentrao de determinada substncia txica que promove a parada total dos movimentos respiratrios, da locomoo, perda de equilbrio e ausncia de respostas a estmulos de 50% dos animais expostos durante ensaios de 96 horas (Sprague, 1990). Para determinao da CL50 de formalina os exemplares de tambaqui, com peso de 45,23 0,43 g (mdia erro padro) e comprimento padro 11,91 0,08 cm, foram transferidos para tanques de polietileno com o volume fixo de 50 litros. Aps um perodo de aclimatao de 24 horas, foram expostos a diferentes concentraes de formalina por um perodo de 96 horas. A primeira concentrao testada de formalina foi referenciada pelo nvel mximo utilizado para o tratamento de doenas em peixes. A partir desse resultado foram estabelecidas as demais concentraes. Os tanques experimentais foram dotados de sistemas semi-estticos, com aerao constante. Os testes foram efetuados em triplicatas com grupos de oito animais, sendo a alimentao dos animais suspensa 24 horas antes do incio dos testes e durante estes. Os animais mortos durante os ensaios da CL50 foram contados e retirados a cada 24 horas. As taxas de mortalidade foram plotadas em funo da concentrao de formalina, e foi, ento, aplicado o programa JSpearman Test baseado no mtodo Trimmed Spearman Karber, sendo determinada a Cl50.

Material e Mtodos
Juvenis de tambaqui pesando aproximadamente 45 g foram adquiridos na fazenda Santo Antnio, Rio Preto da Eva, AM, e transportados para o campo experimental da Embrapa Amaznia Ocidental, localizado no km 29 da estrada Manaus-Itacoatiara, onde foram aclimatados em tanques escavados de 2 200 m durante todo o perodo prexperimental.

120

L. D. de Arajo

Teste in vitro contra monogenides


Uma amostra inicial de 25 peixes foi retirada para anlise parasitolgica com o objetivo de verificar a presena de monogenides nas brnquias de tambaqui antes da realizao dos testes in vitro. Na realizao dos testes in vitro foi utilizado um total de 24 peixes (comprimento padro de 9,22 0,13 cm e peso de 27,12 1,25 g ). A concentrao de formalina testada foi a de 250 mg/L, que o nvel mximo de formalina utilizada para o tratamento de doenas em peixes. O experimento consistiu em avaliar a eficcia da formalina no controle de monogenides em diferentes tempos de exposio: 15, 30, 45 e 60 minutos, com seis repeties. Para isso, os peixes foram sacrificados por comoo cerebral, as brnquias retiradas e ento os oito filamentos branquiais foram individualmente imersos em placas de Petri contendo 20 ml da soluo de formalina (250 mg/L), sendo este procedimento repetido para cada tempo de exposio. Aps o perodo de exposio, os filamentos branquiais foram transferidos para placas de Petri contendo gua destilada por

30 minutos e procedeu-se contagem das monogneas mortas em cada filamento branquial com o auxlio de um estereomicroscpio, sendo a monognea considerada morta quando estava imobilizada e opaca. As taxas de mortalidade dos diferentes tempos de exposio foram comparadas por anlise de varincia (one way ANOVA) e teste de Tukey, com 5% de probabilidade (Zar, 1999).

Resultados e Discusso
Concentrao mdia letal (CL50 - 96 h) de formalina
No controle e nas concentraes de 90 e 95 mg de formalina/L no foram registradas mortalidades durante o perodo de exposio de 96 horas. Por outro lado, nenhum peixe sobreviveu na concentrao de 120 mg/L (Figura 1). A taxa de mortalidade foi diretamente proporcional ao aumento na concentrao de formalina adicionada na gua dos tanques experimentais, demonstrando boa relao dose-resposta (Figura 1).

100

80

Mortalidade (%)

60

40

20

0 90 95 100 105 110 115 120

Formalina (mg/L)
Figura 1. Mortalidade percentual de tambaquis expostos a crescentes concentraes de formalina na gua.

L. D. de Arajo

121

A CL50-96 horas de formalina para o tambaqui foi calculada em 106,96 mg/L. Em geral, os testes de toxicidade com formalina indicam uma toxicidade relativamente baixa para peixes tropicais (Wellens, 1982; Fajervila et al., 2003). Para a espcie Sphoeroides annulatus, a CL50-72 h de formalina 79 mg/L (Fajer-vila et al., 2003), prxima a CL50-96 h (81 mg/L) encontrada para Anguilla americana (Hinton & Eversole, 1978). O tambaqui, comparado a outras espcies, apresentou boa tolerncia formalina (Tabela 1).
Tabela 1. Valores comparativos de CL50-96 horas de formalina para Colossoma macropomum e outras espcies de peixes cultivadas.
Espcie CL50-96 horas (mg/L) Referncias

Teste in vitro contra monogenides


Quando expostos concentrao de 250 mg de formalina/L, os exemplares de tambaqui reduziram significativamente o nmero de monogneas em suas brnquias com o aumento do tempo de exposio (Tabela 2). Em 60 minutos, a taxa de mortalidade de monogneas foi de 84,04%, mostrando a eficcia da aplicao deste produto para o controle de monogenides (Tabela 2).
Tabela 2. Testes in vitro para o controle de monogenides, expostas a concentrao de 250 mg/L em diferentes tempos de exposio(1).
Tempo de exposio (minutos) 15 30 45 60 Nmero de parasitas 175,83 168,17 171,67 297,33 58,92 37,34 40,67 52,60 a a a a Mortalidade (%) 38,43 6,36 a 76,62 4,28 b 78,03 13,51 b 84,04 9,30 b

Ictalurus punctatus Bills et al. (1977) 19,8 28,2 Geiger et al. (1990) Pimephales promelas 24,1 Bills et al. (1977) Oncorhynchus mykiss 58,7 Bills et al. (1977) Salmo salar 69,8 Anguiilla americana 81,0 Hinton & Eversole (1978) Presente estudo Colossoma macropomum 106,96

(1) Na coluna, mdias seguidas da mesma letra no diferem entre si, a 5% de probabilidade pelo teste de Tukey.

A determinao da CL50 - 96 horas de formalina para o tambaqui importante para estabelecer os limites de tolerncia para o uso deste qumico em tratamentos de doenas parasitrias. Em tratamentos de longa durao, as concentraes geralmente recomendadas para os banhos teraputicos so de 15 a 25 mg/L (Kabata, 1985), concentrao muito abaixo da tolerada pelo tambaqui em 96 horas de exposio, portanto incapaz de causar mortalidade dos animais durante o perodo de tratamento. De uma forma geral, tambaquis expostos a concentraes de formalina acima de 100 mg/L apresentavam-se agitados, com aumento na freqncia do batimento opercular e intensa liberao de muco aps 24 horas de exposio. Perda de equilbrio, olhos saltados e narinas hemorrgicas foram observados em tambaquis nas concentraes acima de 105 mg/L, aps o perodo de 48 horas. Para a espcie Sphoeroides annulatus foi observado, nas concentraes de 75 e 103 mg/L, hemorragia aps 20 horas de exposio (Fajer-vila et al, 2003). Em concentraes de 200 mg/L em 6 horas foi observada necrose e hipertrofia nas brnquias em Oncorhynchus tshawytscha e Salmo gairdneri (Wedemeyer & Yasutake, 1974).

O uso de formalina na concentrao de 250 mg/L, neste estudo, mostrou boa efetividade para o controle de monogneas nas brnquias de tambaqui, porm preciso dar continuidade a estes estudos para a determinao da concentrao mdia efetiva (EC50) que permite cruzar esses dados com a CL50-96 h obtida para o tambaqui e encontrar o ndice teraputico para o uso de formalina no tratamento de doenas causadas por monogenides. Em testes semelhantes com Sphoeroides annulatus, 225 mg de formalina/L em 30 minutos de exposio e 87 mg/L em 60 minutos, reduziram significativamente o nmero do parasita monogenide Heterobothrium ecuadori nas brnquias da espcie Sphoeroides annulatus (Fajer-vila, 2003). Apesar de apresentar boa efetividade no controle de monogenides, a concentrao de 250 mg de formalina/L em 60 minutos de exposio promove alterao na homeostase orgnica do tambaqui, conforme relatado por Arajo et al. (2004), embora os autores tenham relatado que os animais apresentam boa recuperao aps o perodo de 24 horas. Esses resultados reforam mais uma vez a importncia da realizao desses estudos visando contribuir para a determinao de um

122

L. D. de Arajo

ndice teraputico para o uso de formalina, bem como de outros qumicos teraputicos, sem ocasionar estresse fisiolgico e que apresente boa efetividade no controle de parasitas monogenides.

BILLS, T. D.; MARKING, L. L.; CHANDLER, J. H. Formalin: its toxicity to Nontarget Aquatic Organisms, Persistence, and Counteraction. U.S. Fish Wildl. Serv. Invest. Fish Control. 73:1-7 p. 1977. CASTAGNOLLI, N. Criao de peixes de gua doce. Jaboticabal: FUNEP, 1992. 189 p. CHAGAS, E. C. et al. Desempenho e estado de sade de tambaquis cultivados em tanquesrede sob diferentes densidades de estocagem. In: URBINATI, E. C.; CYRINO, J. E. P. (Ed.). Anais do XII Simpsio Brasileiro de Aqicultura. Jaboticabal, AQUABIO. v. 2, p. 83-93, 2003. CHELLAPA, S. et al. Growth and production of the Amazonian tambaqui in fixed cages under different feeding regimes. Aquaculture International, n. 3, p. 11-21, 1995. FAJER-VILA, E. J. et al. Toxicity of formalin to bullseye puffer fish (Sphoeroides annulatus Jenyns, 1843) and its effectiveness to control ectoparasites. Aquaculture, v. 223, p. 41-50, 2003. GEIGER, D. L.; BROOKE, L. T.; CALL, D. J. Acute toxicities of Organic Chemicals to Fathead Minnows (Pimephales promelas). Wisconsin: University of Wisconsin-Superior, 1990. v. 5, 332 p . GRY, J. Characoids of the world. Neptun City, NY: Tropical Fish Hobbyist, 1977. 672 p. HINTON, M. J.; EVERSOLE, A. G. Toxicity of ten commonly used chemicals to American eels. Proceedings Annual Conference Southeastern Association of Fish and Wildlife Agencies, v. 32, p. 599-604, 1978. HONDA, E. M. S. Contribuio ao conhecimento da biologia de peixes do Amazonas II: alimentao de tambaqui, Colossoma bidens (Spix). Acta Amazonica, Manaus, v. 4, p. 47-53, 1974. KABATA, Z. Parasites and diseases of fish cultured in the tropics. London: Taylor & Francis, 1985. 318 p.

Concluso
A CL50-96 horas de formalina para o tambaqui foi calculada em 106,96 mg/L. Em testes in vitro, 250 mg de formalina/L apresentaram boa efetividade no controle de monogenides, em 60 minutos de exposio.

Agradecimentos
Ao Sr. Jos Pereira (Cubio), pelo auxilio nos experimentos em campo; equipe do laboratrio de piscicultura da Embrapa Amaznia Ocidental e aos membros do laboratrio de parasitologia e patologia de peixes do Instituto Nacional de Pesquisa da Amaznia - Inpa.

Referncias Bibliogrficas
ANDRADE, P. C. M.; TOLENTINO, A. S.; FREITAS, C. E. C. Desenvolvimento de juvenis de tambaqui (Colossoma macropomum Cuvier, 1818) em gaiolas. Revista da Universidade do Amazonas: Srie Cincias Agrrias, v. 2, p. 21-30, 1993. ARAJO, L. D. et al. Efeito de banhos teraputicos com formalina sobre indicadores de estresse em tambaqui. Pesquisa Agropecuria Brasileira, v. 39, p. 217-221, 2004 . ARAJO-LIMA, C.; GOULDING, M. Os frutos do tambaqui: ecologia, conservao e cultivo na Amaznia. Braslia: Sociedade Civil Mamirau/CNPq, 1998. 186 p. BERTOLETTI, E. Toxicidade e concentrao de agentes txicos em efluentes industriais. Cincia & Cultura, v. 42, p. 271-227, 1990. BEVERIDGE, M. C. M. Cage aquaculture. Oxford: Fishing News Books, 1996. 346 p.

L. D. de Arajo

123

MEROLA, N.; CANTELMO, O. A. Growth, conversion and mortality of cage-reared tambaqui, Colossoma macropomum, fed various dietary feeding regime sand protein levels. Aquaculture. v. 66, p. 223-233. 1987. MEROLA, N.; SOUZA, J.H. Cage culture of the Amazon fish tambaqui, Colossoma macropomum, at two stocking densities. Aquaculture. v. 11, p. 15-21, 1988. PIRONET, F. N.; JONES, J. B. Treatments for ectoparasites and diseases in captive Western Australian dhufish. Aquaculture International. n. 81, p. 349-361, 2000. PORTELA, J, M. Efeito do pH, clcio e temperatura sobre a hoemostase inico de alevinos de tambaqui, Colossoma macropomum (Characiformes, Serrasalmidae). 1998. 41 f. Dissertao (Mestrado) Instituto Nacional de Pesquisas da Amaznia/ Fundao Universidade do Amazonas, Manaus. SAINT-PAUL, U. Potential for aquaculture of South American fresh water fishes: a review. Aquaculture, Baton Rouge, v. 54, p. 205240, 1986. SPRAGUE, J. B. Aquatic toxicology. In: SCHRENCH, C. B.; MOYLE, P. B. (Ed.). Methods for fish biology. Bethesda, Maryland: American Fisheries Society, 1990. p. 491-528. VAL, A. L.; SILVA, M. N. P.; ALMEIDA-VAL, V. M. F. Hypoxia adaptation in fish of the Amazon: a never-ending task. South African Journal of Zoology, Pretoria, v. 33, p. 107114, 1998.

VARELLA, A. M. B. et al. Monitoramento da parasitofauna de Colossoma macropomum (Cuvier, 1818) (Osteichthyes: Characidae) cultivado em tanques-rede em um lago de vrzea na Amaznia, Brasil. In: URBINATI, E. C.; CYRINO, J. E. P. (Ed.). Anais do XII Simpsio Brasileiro de Aqicultura. Jaboticabal, AQUABIO. v. 2, p. 95-106, 2003. YI, Y.; LIN, C.K. Effects of biomass of caged Nile tilapia (Oreochromis niloticus) and aeration on the growth and yields in an integrated cage-cum-pond system. Aquaculture, v. 195, p. 253-267, 2001. WEDEMEYER, G. A.; YASUTAKE, W. T. Stress of formalin treatment in juvenile spring chinook salmon (oncorhynchus tshawytscha) e stulhead trout salmo gairdneri. Fish Research. Board. Canad , v. 3, p. 179-184, 1974. WELLENS, H. Comparison of the sensitivity of the Brachydanio rerio and Leuciscus idus by testing the fish toxicity of chemicals and waste waters. Z. Wasser-Abwasser-Forsch, v. 15, p. 49, 1982. ZAR, J. H. Biostatiscal analysis. 4. ed. New Jersey: Prentice Hall, 1999. 663 p.

Produo de biomassa de caapeba, em funo de pocas de colheita, nas condies de Manaus - AM


Elder de Arajo Pena(1), Ana Cristina da Silva Pinto(1), Adrian Martin Pohlit(2) e Francisco Celio Maia Chaves(3)
(1) Bolsista Pibic/Fapeam; (3)Instituto Nacional de Pesquisas da Amaznia, CPPN, Av. Andr Arajo, 2.936, Petrpolis, 69083-000, Manaus, Amazonas, Brasil, ampohlit@inpa.gov.br; (3)Embrapa Amaznia Ocidental, Rodovia AM 010, km 29, Zona Rural, Caixa Postal 319, 69010-970. Manaus - AM. E-mail: celio@cpaa.embrapa.br

Resumo - Conhecida como caapeba, pariparoba, a espcie Pothomorphe peltata Miq. usada, popularmente, no tratamento de afeces do aparelho digestivo, insuficincia heptica e como antipirtica. diurtica, estomquica e carminativa. Apesar da sua importncia, praticamente no existem estudos agronmicos dessa espcie medicinal. O objetivo desta pesquisa foi analisar os efeitos de pocas de colheita na produo de biomassa, nas condies de Manaus - AM. Os tratamentos constaram de quatro pocas de colheita. As mudas foram produzidas em setembro/2003. O plantio (22/12/03) foi realizado na Embrapa Amaznia Ocidental, no espaamento de 1 x 1 m. Em 11/02, 12/04, 12/06 e 14/08 de 2004, foram realizadas colheitas de toda a planta com avaliaes da produo de folhas, caules, inflorescncias, razes e produo total, nmero de folhas e inflorescncias por planta e determinao da relao caule/folha. Em cada parcela foram avaliadas quatro plantas. Observou-se que, em todas as partes da planta, houve aumento no acmulo de biomassa em funo da idade da planta, com exceo para folhas, que decresceu na ltima avaliao. Termos para indexao: Pothomorphe peltata Miq., cultivo, metabolismo secundrio.

Biomass production during cultivation of Pothomorphe peltata (Piperaceae), in Amazonas State - Brazil
Abstract - The aim of this study was to evaluate the influence of harvest time on biomass
production for the native species Pothomorphe peltata in Manaus, Amazonas State, Brazil. At four different harvest times (February, Abril, June and August 2004) leaf, stem, root, flower, total and leaf/stem proportional biomass production were evaluated. The experimental design was in four randomized blocks, using a spacing of 1.0 x 1.0 m. Plots of 4 plants in four replications were analyzed. In almost all parts of the plants increase in the accumulation of biomass occurred as a function of plant age. An exception was leaves which, despite a general increase in the number of leaves with age, decreased biomass in the last evaluation period.

Index terms: Pothomorphe peltata Miq., medicinal plant, secondary metabolism, harvest times.

Introduo
A oferta de matria-prima de boa qualidade ao longo do ano requer prticas fitotcnicas adequadas a cada espcie de planta medicinal, que est sob a influncia das estaes climticas, poca de colheita, capacidade de rebroto, da absoro de nutrientes disponveis no solo, secagem e luminosidade. Nas condies brasileiras, a maioria das plantas medicinais no ainda

cultivada, mas coletada atravs do extrativismo, e a grande parte das espcies cultivadas encontra-se no estgio inicial de domesticao, sem estar sistematicamente investigada. Esse extrativismo dispensa os esforos e despesas com o cultivo, porm provoca a degradao do ecossistema, a baixa qualidade do material e diversificao de produto (Bustamante, 1993; Corra Jr, et al., 1996).

E. de A. Pena

125

A Amaznia o maior ecossistema de floresta tropical e considerada a maior reserva de plantas medicinais do mundo, a qual vem sendo explorada de forma desordenada, comprometendo todo o seu potencial de recursos genticos, principalmente as medicinais, das quais apenas 5% do total de espcies tem sido objeto de pesquisa (Matos, 1990), em sua maioria na rea qumica e farmacolgica, tanto para as espcies nativas e as introduzidas, sem levar em conta o devido suporte da rea agronmica, que pode aliviar a presso extrativista desorganizada sobre o ecossistema e permitir a obteno de material de qualidade superior. Dentre as espcies nativas encontra-se a Pothomorphe peltata Miq. (Piperaceae), pequena erva bianual ou semiperene, usada na medicina popular de quase todo o Brasil, empregando-se as folhas, hastes e razes. J foram identificados alguns metablitos secundrios, tais como leos essenciais, esterides, mucilagens, substncias fenlicas, pigmentos e tambm o 4nerolidilcatecol. considerada diurtica, antiepilptica, antipirtica, usada contra doenas do fgado, inflamaes das pernas, contra eripisela e filariose (Lorenzi e Matos, 2002). Somente para o composto 4nerolidilcatecol foi demonstrado atividade antimalrica, antitumoral, preveno espontnea de peroxidao de lipdios do crebro e tambm potencial antioxidante atravs de aplicao em formulaes cosmticas (Pinto, 2002). Este trabalho teve como objetivo determinar a melhor poca de colheita de biomassa de caapeba nas condies de Manaus, Amazonas.

preparou-se substrato com terrio + esterco de galinha - 2:1. Utilizaram-se sacos de polietileno preto com esse substrato, nos quais as sementes foram semeadas em 9/9//2003. As sementes foram coletadas no viveiro da Coordenao de Pesquisas de Produtos Naturais (CPPN) do Instituto Nacional de Pesquisas da Amaznia (Inpa), a partir de matrizes adultas de aproximadamente um ano de idade. A germinao ocorreu 30 dias aps, e em 2/11/2003 fez-se o desbaste e repicagem, deixando-se a planta mais vigorosa no saco. As plantas permaneceram sob irrigao diria at o plantio, em 22/12/2003. O experimento foi instalado em blocos ao acaso, com 4 repeties (16 plantas/repetio, colhendo-se as 4 centrais como rea til), adotando-se o espaamento de 1 x 1 m. Os tratamentos foram 4 pocas de colheita (fevereiro, abril, junho e agosto de 2004), a intervalos de 60 dias. Em cada poca de colheita foram avaliadas as seguintes variveis: folhas, caules, razes, inflorescncias e total, todas em base seca (duas amostras de 20 g/parcela), aps secagem em estufa a 65C, at peso constante. Os dados foram submetidos anlise de varincia pelo Teste F e as mdias submetidas ao ajuste de modelos de regresso.

Resultados e Discusso
Na Figura 1, observa-se que a produo de folhas aumentou at a terceira colheita (em torno de 94 g/pl) e decresceu a partir da. A fase reprodutiva, nas condies desse experimento, s evidenciou-se aps os 110 dias do transplantio, pois nessa poca de avaliao a produo foi apenas de 0,32 g/pl. Na avaliao seguinte, essa produo alcanou o valor de 59,75 g/pl (Figura 2). At ento, a planta, por ser mais jovem e conseqentemente se encontrar na fase vegetativa, investiu suas reservas para a produo de folhas. Observou-se tambm que, por ocasio da quarta colheita, houve decrscimo na produo de folhas. As produes de caules e razes (Figuras 3 e 5), por sua vez, foram crescentes desde a primeira colheita, embora a maior contribuio tenha sido dos caules, que alcanaram o valor de 148,56 g/pl, enquanto as razes situaram-se em torno de 43,06 g/pl.

Material e Mtodos
O experimento foi conduzido no Campo Experimental da Embrapa Amaznia Ocidental do Km 29, Rodovia AM 010. A coleta de solo foi realizada em setembro/2003 e encaminhada para anlise no Laboratrio de Anlises de Solos e Plantas - Lasp. Em virtude da recomendao de correo da acidez, foi feita a calagem, aplicando-se 4 t/ha de calcrio e incorporado (por gradagem) aps roo e arao da rea. No viveiro de plantas medicinais da Embrapa Amaznia Ocidental,

126

E. de A. Pena

Nas duas primeiras colheitas a produo de caules ficou abaixo da produo de folhas, com a planta direcionando suas reservas para as estruturas fotossintetizantes, para depois aumentar na formao de caules, que d sustentao por meio dos tecidos lignificados (Metcalfe & Chalk, 1985 e Cutter, 1986). Isso ficou bem evidenciado pela relao folha/caule (Figura 4), que decresceu em funo das pocas de colheita. Embora os nmeros de folhas e inflorescscias tenham sido crescentes com o avano da idade da planta (Figura 7), houve queda na produo de biomassa de folhas/pl. na ltima colheita (48,01 g/pl), e isso deve-se ao fato de que, na ltima avaliao (no ms de agosto), ocorreu baixa precipitao pluviomtrica, e o experimento no foi conduzido sob a condio de irrigao. Essas condies ambientais contriburam para a queda de folhas maduras, embora a produo total de biomassa (Figura 6) tenha sido crescente, mas essa resposta depende das outras estruturas. Nas condies em que o experimento foi desenvolvido houve aumento na produo de biomassa total, com contribuio menor das folhas na ltima colheita.
105 90 75 60 45 30 15 0
0 25 50 75 100 125

150 140 130 120 110 100 90 80 70 60 50 40 30 20 10 0 0 25

y = - 55,417+0,9293**x R2 = 0,88

Caules (g/pl)

50

75

100 125 150 175 Dias aps o transplantio Dias aps o transplantio

200

225

250

Figura 3. Produo de caules de caapeba, em funo a idade de colheita, nas condies de Manaus - AM. Manaus/AM, 2004.

6 5

Relao F/C

4 3 2 1 0 0 25 50 75 100 125

y = 5,5938-0,0256**x 2 R = 0,87

150

175

200

225

250

Dias aps o trransplantio aps o transplantio

Figura 4. Relao folha/caule de caapeba, em funo da idade de colheita, nas condies de Manaus - AM. Manaus/AM, 2004.

50 45 40 35 30 25 20 15 10 5 0 0 25 50 75 100 125 150 175 200 225 250


Dias aps o transplantio Dias aps transplantio

Folhas (g/pl)

2 y = - 65,915+ 1,5872x-0,0046**x

R2 = 0,71 150 175 200 225 250

Dias aps o transplantio aps o transplantio

Figura 1. Produo de folhas de caapeba, em funo da idade de colheita, nas condies de Manaus - AM. Manaus/AM, 2004.

Razes (g/pl)

y = - 14,097+0,2428**x R2 = 0,96

Figura 5. Produo de razes de caapeba, em funo da idade de colheita, nas condies de Manaus - AM. Manaus/AM, 2004.

70 65 60 55 50 45 40 35 30 25 20 15 10 5 0 0 25

y = - 26,148+0,3557**x R2 = 0,90

350 325 300 275 250 225 200 175 150 125 100 75 50 25 0 0 25

Inflorescncias (g/pl)

Total (g/pl)

y = - 98,348+1,8687**x R2 = 0,78

50

75

100

125

150

175

200

225

250

Dias aps o transplantio Dias aps transplantio

50

75

100

125

150

175

200

225

250

Dias aps o transplantio aps o transplantio

Figura 2. Produo de inflorescncias de caapeba, em funo da idade de colheita, nas condies de Manaus - AM. Manaus/AM, 2004.

Figura 6. Produo de biomassa total de caapeba, em funo da idade de colheita, nas condies de Manaus- AM. Manaus/AM, 2004.

E. de A. Pena

127
Referncias Bibliogrficas

50 45 40 35 30 25 20 15 10 5 0 0 25 50 75 100 125 150 175 200 225 250 y2 = - 19,871+0,2899**x R = 0,93


2

y1 = - 7,6483+0,2412**x R = 0,99
2

Nmero folhas/pl Nmero de folhas/pl Nmero de inflorescncia/pl Nmero de inflorescncias/pl

BUSTAMANTE, F. M. L. Plantas medicinales y aromaticas. Madrid: Mundi Prensa, 1993. p. 85-88. CORRA JR., C.; MING, L. C.; SCHEFFER, M. C. Cultivo de plantas medicinais, aromticas e condimentares. Jaboticabal: FUNEP, 1996. 62 p. CUTTER, E. G. Anatomia vegetal clulas e tecidos. 2. ed. So Paulo: Roca, 1986. pt. 1, 304 p. LORENZI, H.; MATOS, F. J. A. Plantas medicinais brasileiras: nativas e exticas. Nova Odessa, SP: Instituto Plantarum de Estudos da Flora, 2002. 543 p. MATOS, F. J. A. Plantas medicinais brasileiras um desafio para nossos qumicos orgnicos. Desafio, v. 3, p. 9, 1990. METCALFE, C. R.; CHALK, L. Anatomy of the dicotyledones. 2. ed. Oxford: Clarendon Press, 1985. 297 p. PINTO, A. C. S. Estudo fitoqumico e biolgico de Pothomorphe peltata (L.) Miquel (Piperacee). 2002. 156 f. Dissertao (Mestrado) Universidade Federal do Amazonas, Manaus.

Dias aps o transplantio

Figura 7. Nmero de folhas e inflorescncias de caapeba, em funo da idade de colheita, nas condies de Manaus - AM. Manaus/AM, 2004.

Concluses
Considerando as condies em que o experimento foi conduzido, pode-se concluir que a caapeba apresentou aumento de biomassa em todas as partes que compem a planta, em funo das pocas de colheitas avaliadas, com exceo para produo de folhas que reduziu na ltima colheita.

Agradecimentos
Fundao de Amparo Pesquisa do Estado do Amazonas (Fapeam), pela concesso da Bolsa Pibic; e Fundao BioAmaznia - Contrato Fepad/Basa, pelo suporte financeiro.

Estabilidade de agregados como indicador da qualidade fsica do solo em sistemas de uso de terra da Amaznia Ocidental
Cleideane Cunha Costa(1) e Gilvan Coimbra Martins
(2)

(1) Bolsista Pibic/CNPq. E-mail: (2) Embrapa Amaznia Ocidental, Rodovia AM 010, km 29, Zona Rural, Caixa Postal 319, 69010-970. Manaus - AM. E-mail:

Resumo - A estrutura do solo, sob o ponto de vista agrcola, uma propriedade fsica to importante quanto o pH. Entre os mtodos indiretos para avaliao da estrutura do solo, a estabilidade dos agregados se reveste de elevada importncia e significao, por ser esta resistente ao da gua, servindo como um dos principais indicadores da qualidade do solo para explorao agrcola e resistncia eroso. O objetivo deste estudo foi verificar o comportamento desse parmetro sob diferentes tipos de solo e manejo. Os resultados mostram diferenas significativas expressas pelo DMG (dimetro mdio geomtrico), sob diferentes manejos e estgios de degradao dentro dos Latossolos e entre as classes: Latossolos, Argissolos, Cambissolos e Gleyssolos. Os valores obtidos para esse parmetro serviro como valores referenciais em futuras determinaes, bem como sero observadas suas correlaes com outras propriedades fsicas. Termos para indexao: estrutura, agregados, indicadores, qualidade do solo.

Stability of aggregates as indicator of the physical quality of the soil in systems of use of earth of Western Amaznia
Abstract - Under an agricultural point of view, the soil physical structure property is as important
as the pH. Among the soil structure indirect evaluation methods, the aggregates stability is highly important and significant, because of its resistance to the water action, being one of the main indicators of soil quality for agriculture exploitation and erosion resistance. The present study objective was to verify this parameter behavior under different soil types and management. The results show significant differences of stability expressed by GMD (geometrical mean diameter) and degradation stages within Latossolos and between the classes: Latossolos, Argissolos, Cambissolos and Gleyssolos. The values obtained for this parameter will be useful as referential values in future determinations and its correlation with other physical properties will be observed as well.

Index terms: structure, aggregates, indicator, quality of soil.

Introduo
As partculas primrias do solo, em condies naturais, devido a processos fsicoqumicos, agrupam-se em unidades compostas chamadas de agregados ou unidades estruturais, as quais formam arranjamento com formas definidas, constituindo a estrutura do solo (Grohmann, 1972). O pr-requisito para que a agregao do solo ocorra que a argila esteja floculada e haja presena de substncias cimentantes. A formao de agregados no solo tem relao

direta com a dupla camada eltrica (Gavande, 1976), teor de carbono e complexo sortivo (Faccin, 1995), sistema de cultivo direto ou convencional (Campos et al., 1995; Roth et al., 1991; Derpsch et al., 1990; Eltz et al., 1989; Sidiras et al., 1984), xidos de ferro e alumnio (Kiehl, 1979; Veiga et al., 1993), clcio e matria orgnica, destacando-se a frao de cidos hmicos (Roth et al., 1991), rotao de culturas (Campos et al., 1995), atividade microbiana, principalmente hifas de micorrizas vesicular-arbuscular (Tisdall & Oades, 1989).

C. C. Costa

129

Entre os fatores que afetam a agregao do solo, citam-se: gua, sistema de cultivo e manejo da matria orgnica (MO), sendo que a maioria dos atributos do solo e do ambiente relacionados s funes bsicas do solo tem estreita relao com a MO (Doran, 1997). A rpida degradao do solo sob explorao agrcola, especialmente nos pases tropicais em desenvolvimento, despertou, nas ltimas dcadas, a preocupao com a qualidade do solo e a sustentabilidade da explorao agrcola (Sanches, 1976; Lal & Pirce, 1991). Em decorrncia do reduzido conhecimento do comportamento da estrutura dos agregados nas principais classes de solos e sistemas de uso na Amaznia Ocidental, surge a necessidade de uma caracterizao dos referidos solos e sistemas. O objetivo do presente estudo foi verificar a estabilidade de agregados como indicador da qualidade fsica do solo sob diferentes tipos de solo e/ou do mesmo tipo de solo submetido a diferentes formas de manejo.

A estabilidade de agregados expressa pelo DMG calculada pela seguinte frmula:

DMG = 10

( log ) X =

Onde o ponto mdio dos dimetros das peneiras e o peso dos agregados retidos nas peneiras aps o conjunto ser submetido a movimentos oscilatrios em gua por 15 minutos. A percentagem dos agregados maiores que 2 milmetros retidos tambm serve como estimativa da estabilidade dos agregados e a resistncia eroso.

Resultados e Discusso
A comparao entre o sistema de derruba e queima da capoeira, preparo tradicionalmente usado na Regio Amaznica (agricultura itinerante), com os sistemas alternativos: derruba e triturao do material vegetal, derruba e enleiramento e reas inalteradas de capoeira, atravs da mensurao da estrutura do solo pela DMG, pode ser observada na Tabela 1. O uso do fogo desestabiliza os agregados do solo, fato constatado por menores DMGs e percentagem retida dos agregados maiores que 2 milmetros significativamente diferentes ao corte e triturao, aps o primeiro ms de implantao dos tratamentos. No entanto, passado o primeiro ano, essas diferenas desaparecem, sugerindo boa recuperao da estrutura do solo, conferindo boa resilincia, isto , boa capacidade de recuperao da sua situao original, aps submetido a estresse, no caso, o fogo.
Tabela 1. Estabilidade de agregados expressa pelo DMG em um Latossolo Amarelo argiloso sob capoeira de 15 anos, submetido a manejos alternativos ao corte e queima.
Capoeira/ Manejo Triturada Inalterada Enleirada Queimada DMG (mm) Aps Aps 1 ms 1 ano 4,04 a 3,65 ab 3,07 b 2,84 b 3,44 3,47 3,54 3,13 a a a a Agr>2mm (%) Aps Aps 1 ms 1 ano 87,2 a 83,3 ab 75,2 b 73,1 b 83,5 82,1 82,5 76,7 a a a a

Material e Mtodos
Foram coletadas amostras na profundidade de 0-20 cm em forma de torres, nos seguintes locais: Campo Experimental da Embrapa do Km 29, em reas de Latossolo Amarelo muito argiloso, submetido a corte e queima, corte e enleiramento, corte e mulch (triturado), capoeira com 20 anos, em reas manejadas com leguminosas: Tefrosia e Puerria; Fazenda Jayoro, em Latossolo Amarelo muito argiloso, onde o preparo da rea para plantio e colheita de cana-de-acar foi realizado com mquinas e implementos pesados; Campo Experimental do Caldeiro - Iranduba, em Argissolo Vermelho-Amarelo - PV com A antrpico (Terra Preta do ndio - TPI) e em Gleyssolos e Base de Urucu Coari-AM em Cambissolo com horizonte A decapitado. Aps o clculo das planilhas e a tabulao dos dados, foram analisados em delineamento inteiramente casualizado (DIC), sendo os tratamentos os vrios tipos de solos e/ou os diversos manejos. As amostras foram processadas conforme (Embrapa, 1997) e (Kemper & Chepil, 1965) com adaptaes e analisadas no laboratrio de fsica do solo da Embrapa Amaznia Ocidental.

*Mdias seguidas de mesma letra no diferem estatisticamente pelo teste de Tukey ao nvel de 5% de probabilidade.

130

C. C. Costa

Observam-se, na Tabela 2, diferenas significativas no DMG quando se compara uma capoeira de 20 anos, com solos degradados e em recuperao, com manejos de leguminosas e solos intensivamente preparados com mquinas da Fazenda Jayoro, usadas no plantio de cana-de-acar. Observa-se ainda que a densidade do solo e o volume total de poros (VTP) no mostram grandes diferenas nesses sistemas, sugerindo que o DMG um parmetro bastante sensvel para detectar essas diferenas.
Tabela 2. Estabilidade de agregados em diferentes solos e manejos expressa pelo DMG e percentagem de agregados retidos e sua relao com o VTP e a densidade do solo.
Solo/Manejo Latossolo Capoeira - 20 anos Latossolo Puerria - 1 ano Latossolo Tefrsia - 1 ano Latossolo prep. mquina - 1 ano Latossolo prep. mquina - 10 anos Cambissolo Urucu Clareiras Aluvial Vrzea- Caldeiro DMG (mm) 4,05 a 2,84 b 2,03 bc 1,23 c 0,87 cd 0,25 d 0,21 Ds VTP Agr>2mm (g cm-3) (%) (%) 89,7 a 72,0 b 47,5 bc 34,0 c 21,6 cd 2,7 d 5,2 d 1,06 0,90 1,06 0,90 1,09 89,7 68,7 54,9 60,0 54,9 -

deposio de sedimentos e serem inundados periodicamente, no existindo tempo suficiente para a formao da estrutura dos agregados. A Tabela 3 apresenta os resultados da estabilidade dos agregados em um Argissolo com A antrpico - TPI. A rea representada por uma capoeira de 20 anos localizada no centro da mancha, uma rea cultivada ao lado e uma rea no limite com o Latossolo - Terra Mulata. Observam-se diferenas significativas no DMG e na percentagem dos agregados retidos na peneira de 2 milmetros, mostrando que esses indicadores so mais sensveis em detectar diferenas que a densidade do solo e a VTP.
Tabela 3. Estabilidade de agregados expressa pelo DMG e percentagem de agregados retidos, em um Argissolo com A antrpico -TPI submetido ao uso intensivo do solo e sua relao com outros parmetros fsicos.
Terra Preta do ndio Capoeira 20 anos Cultivada Rotavator Limite Terra Mulata DMG (mm) 1,3 a 0,5 b 0,4 b Ds Agr>2mm (g cm-3) (%) 59,9 a 15,1 b 10,0 b 1,28 a 1,36 a 1,32 a VTP (%) 50,0 a 48,0 a 47,9 a

*Mdias seguidas de mesma letra no diferem estatisticamente pelo teste de Tukey ao nvel de 5% de probabilidade.

*Mdias seguidas de mesma letra no diferem estatisticamente pelo teste de Tukey ao nvel de 5% de probabilidade.

Concluses
Os valores do DMG obtidos neste estudo sero considerados referncia para este parmetro, no entanto precisam ser repetidos e comprovados para serem usados como indicadores. O DMG tem se mostrado mais sensvel em detectar diferenas na estrutura do solo do que a densidade do solo e o volume total de poros.

O manejo com leguminosas mostra pequena recuperao da estabilidade quando comparado com as reas preparadas com mquinas e a capoeira de 20 anos. Os Cambissolos da Base de Urucu apresentaram-se naturalmente com pouca estabilidade de agregados, pois so reas de clareiras nas quais decapitou-se o horizonte A, orgnico. Neste caso, a amostragem foi realizada no horizonte B exposto, que apresenta estrutura macia e poucos poros. A falta de estrutura deste horizonte pode ser constatada em observaes de campo ao longo das estradas de acesso existentes na base, pois necessitam freqentemente de manuteno devido desagregao, mesmo nas reas j asfaltadas. Com relao ao Gleyssolo, observamos os menores DMGs, isto , no possuem estruturao. Esse fato pode ser explicado por serem solos aluvionais, formados por

Referncias Bibliogrficas
CAMPOS, B. C. de; REINERT, D. J; NICOLODI, R. Estabilidade estrutural de um latossolo vermelho escuro distrfico aps sete anos de rotao de culturas e sistemas de manejo de solo. Revista Brasileira de Cincia do Solo, v. 19, p. 121-126, 1995. DERPSCH, R. et al. Controle da eroso no Paran, Brasil: sistemas de cobertura do solo, plantio direto e preparo conservacionista do solo. Rossdorf: TZ-Verlagsgesellschaft, 1991. 268 p.

C. C. Costa

131

DORAN, J. W. Soil quality and sustainability. In: CONGRESSO BRASILEIRO DE CIENCIA DO SOLO, 26., 1997, Rio de Janeiro. Anais... Rio de Janeiro: SBCS, 1997. 1 CD-ROM. ELTZ, F. L. F.; PEIXOTO, R. T. G.; JASTER, F. Efeitos de sistemas de preparo do solo nas propriedades fsicas e qumicas de um latossolo bruno lico. Revista Brasileira de Cincia do Solo, v. 13, p. 259-267, 1989. EMBRAPA. Centro Nacional de Pesquisa de Solos. Manual de mtodos de anlise de solo. 2. ed. rev. atual. Rio de Janeiro, 1997. 212 p. (EMBRAPA-CNPS. Documentos, 1). FACCIN, O. P. Influncia das caractersticas qumicas, fsicas e mineralgicas sobre a estabilidade de agregados de diferentes grupamentos de solos. 1995. 67 f. Dissertao (Mestrado em Agronomia) Universidade Federal de Lavras, Lavras. GAVANDE, S. A. Fsica de suelos: pricipios e aplicaciones. Mxico: Limusa, 1976. 351 p. GROHMANN, F. Estrutura. In: MONIZ, A .C. Elementos de pedologia. So Paulo: Polgono, 1972. p. 101-110. KIEHL, E. J. Manual de edafologia. So Paulo: Agronmica Ceres, 1979. 262 p. KEMPER, W. D.; CHEPIL, W. S. Size distribution of aggregates. In: BLACK, C. A. et al. Methods of soil analysis: physical and mineralogical propeties, including statistics of measuremment and sampling. Part 1. Madison: American Society of Agronomy, 1965. p. 499-510.

LAL, R.; PIRCE, F. J. The vanishing resource. In: LAL, R.; PIRCE, F. J. (Ed.). Soil management for sustainability. Ankeny: Soil and Water Conservation Society, 1991. p. 15. ROTH, C. H.; CASTRO FILHO, C. de; MEDEIROS, G. B. de. Anlise de fatores fsicos e qumicos relacionados com a agregao de um latossolo roxo distrfico. Revista Brasileira de Cincia do Solo, v. 15, p. 241-248, 1991. SANCHEZ, P. A. Properties and management of soils in the tropics. New York: John Wiley, 1976. 618 p. SIDIRAS, N.; ROTH, C. H.; FARIAS, G. S. de. Efeito da intensidade de chuva na desagregao por impacto de gotas em trs sistemas de preparo de solo. Revista Brasileira de Cincia do Solo, v. 8, p. 251-254, 1984. TISDALL, J. M.; OADES, J. M. Stabilization of soil aggregates by the root systems of ryegrass. Aust. In: FORTUN, C.; FORTUN, A. Diversos aspectos sobre el papel de la materia organica humificada en la formacin y estabilizacion de los agregados del suelo. An. Edafol. Agrobiol. v. 48, p. 185-204, 1989. VEIGA, M. da; CABEDA, M. S. V.; REICHERT, J. M. Erodibilidade em entressulcos de solos do Rio Grande do Sul. Revista Brasileira de Cincia do Solo, v. 17, n. 1 p. 121-128, 1993.

Determinao da densidade de partculas de diferentes solos da Amaznia


Rodrigo Santana Macedo(1) e Wenceslau Geraldes Teixeira
(1)

(2)

Bolsista Pibic/CNPq. rmacedo@cpaa.embrapa.br; (2)Embrapa Amaznia Ocidental, Rodovia AM 010, km 29, Zona Rural, Caixa Postal 319, 69010-970. Manaus - AM. lau@cpaa.embrapa.br.

Resumo - As avaliaes foram realizadas no laboratrio de fsica do solo da Embrapa Amaznia


Ocidental, com objetivo de caracterizar a densidade das partculas de diferentes solos da Amaznia. As amostras foram coletadas em quatro localidades do Amazonas: Cacau Pirera, Coari, Iranduba e Manacapuru. A densidade das partculas (DP) foi determinada pelo mtodo do picnmetro. Os resultados encontrados evidenciaram que os valores da densidade de partculas refletem a composio orgnica e mineralgica do solo, no caso das amostras analisadas, praticamente caulinita e quartzo. Os baixos valores de desvio-padro encontrados demonstram a preciso do mtodo do picnmetro, mostrando este ser indicado quando necessita-se obter dados precisos e rigorosos.

Termos para indexao: picnmetro, matria orgnica, minerais.

Particles density determination in different Amazon soils


Abstract - The evaluations were made in Soil Physics Laboratory of Embrapa Western Amazon, with the objective of characterising particles density in different soils of Amazon. It was used soils samples from four regions in Amazonas State: Cacau Pirera, Coari, Iranduba and Manacapuru. The Particles Density (DP) was studied with the picnometer method. The results evidenced that particles density values were influenced organic composition and mineralogical of the soil - in this case - basically kaolinite and quartz. The low values obtained of the standard deviation demonstrate the precision of the picnometer method, suitable when is needed to obtain precise and rigorous data. Index terms: picnometer, organic material, and minerals.

Introduo
Com o intemperismo, as rochas transformam-se em material solto, no qual torna-se possvel a vida de plantas e da fauna, ao mesmo tempo que alguns dos minerais menos resistentes vo se transformando em minerais de argila (Lepsch, 2002). As informaes referentes a densidade de partculas so consideradas de grande importncia para o estabelecimento de estudos especficos para caracterizao do solo e para a determinao da porosidade das principais classes de solos da Amaznia Central. A inexistncia destas informaes, de forma direta, impossibilita a utilizao efetiva de modelos de estimativa de porosidade e conseqentemente de fluxos de gua e nutrientes no solo. A densidade de partculas (DP) a relao

existente entre a massa de uma amostra de solo e o volume ocupado por suas partculas slidas, sem considerar a porosidade, ou seja, a massa de uma unidade de volume de slido do solo. Tambm designada como densidade real e peso do volume dos solos, a densidade de partculas de um solo no varia com seu contedo de umidade, desde que se subtraia da massa o peso da gua contida (Kiehl, 1979). O conhecimento da densidade das partculas do solo importante para calcular: a porosidade total do solo, empregando tambm dados de densidade aparente; a concentrao de slidos para a avaliao da densidade de materiais em suspenso; e a velocidade de sedimentao das partculas em lquidos e gases. As partculas de um solo variam em sua composio e em sua densidade. A densidade da fase slida do solo

R. S. Macedo

133

igual massa total dos slidos dividida pelo volume destes (Forsythe, 1985). Na determinao da densidade das partculas necessrio obter o valor da amostra e depois o volume dos slidos presentes, onde a massa conhecida por meio de pesagem em balana analtica e o volume determinado pelo mtodo do picnmetro com gua (Kiehl, 1979). A densidade varivel, uma vez que os minerais constituintes do solo apresentam pesos diferentes (existem minerais mais leves e minerais mais pesados); o teor de matria orgnica varia de solo para solo, de acordo com a profundidade (a matria orgnica mais leve que os minerais) (Galeti, 1973). Os minerais predominantes no solo - quartzo, feldspatos, micas, silicatos coloidais -3 apresentam densidade mdia de 2,65 g cm (Donahue et al., 1983). Apesar de haver diferenas nas densidades das partculas dos solos minerais, os dados para a maioria dos solos variam em uma faixa entre 2,60 e 2,75 g cm-3, como observa-se na Tabela 1. Esporadicamente, quando h ocorrncia de quantidades excepcionais de minerais pesados, como magnetita, granada, epdoto, zirco e turmalina, a densidade das partculas pode -3 exceder 2,75 g cm (Deer, 1996). Por outro lado a matria orgnica, por pesar muito menos que os slidos minerais, afeta de maneira marcante a densidade das partculas do solo, fazendo com que os solos superficiais diminuam sua densidade real para baixos valores (Buckman & Brady, 1974). Um mtodo bastante seguro de determinao da densidade de partculas o mtodo do picnmetro, que se fundamenta no fato de que a amostra de solo adicionada ao picnmetro vai ocupar um volume que ser conhecido pela massa de gua deslocada, e conhecendo a massa de gua que corresponde ao volume da terra e sua densidade, tem-se o volume da amostra. Esse mtodo de grande preciso, sendo recomendado para a obteo de resultados rigorosos, pois um engano de pesagem de 1 mg em uma amostra de 10 g d um erro, no valor da densidade das partculas, de apenas 0,0003 g cm-3 (Buckman & Brady, 1974). Essas anlises fazem parte da etapa inicial do plano de trabalho, que visa determinao da porosidade e a caracterizao hdrica dos solos amaznicos, por meio de estimativas

indiretas realizadas pelo Programa Rosetta (Lab. de Solos Salinos - Riversede - USA), que uma ferramenta de Inteligncia Artificial. O desenvolvimento dessas investigaes, aliado aos estudos da condutividade hidrulica, alm de sua contribuio cientfica, certamente produzir resultados importantes para o melhor entendimento das propriedades, funes hdricas e comportamento dos solos da Amaznia. Nesse contexto, desenvolveu-se o presente trabalho com o objetivo de determinar a densidade de partculas de diferentes classes de solos do Estado do Amazonas.

Material e Mtodos
As anlises de densidade de partculas foram realizadas no laboratrio de fsica do solo da Embrapa Amaznia Ocidental. Foram utilizadas amostras de diferentes horizontes de solos provenientes de coletas feitas em perfis, nas localidades de Manacapuru, Iranduba, Cacau Pirera e Coari. O picnmetro vazio foi lavado e seco em estufa, pesado em balana analtica com preciso de 4 casas decimais (Pa) e em seguida, pesado juntamente com 10 g de Terra Fina Seca em Estufa (TFSE) em vidro de relgio (Ps). Logo aps completou-se o volume do picnmetro com gua destilada e desairada (gua sem ar, o ar retirado da gua em um dissecador acoplado a um dispositivo para bomba de vcuo), colocou-se a tampa e realizou-se nova pesagem (Pa). Em seguida, foi retirada metade da gua do picnmetro e passou-se, atravs de um funil, o solo para o seu interior. Depois de agitado, o picnmetro foi colocado no dissecador (ligado a fonte de vcuo) durante 20 minutos para extrair o ar aprisionado na amostra imersa na gua do picnmetro. Logo aps, completou-se o volume do picnmetro com gua, utilizando uma pipeta e feita outra pesagem (Psa). Finalizando, com auxlio do termmetro, mediu-se a temperatura da gua no momento da anlise (Dag), para posterior correo da densidade da gua em funo da temperatura. Estes valores so encontrados em tabelas nos livros de fsica.

134

R. S. Macedo

Sendo P o peso do picnmetro vazio, Ps o peso do picnmetro com 10 g de solo, Pa o peso do picnmetro com gua destilada sem ar, Psa o peso do picnmetro com gua e o solo e Dag a densidade da gua na temperatura da determinao (obtida em tabelas de densidade), calcula-se a densidade real (Dr) pela seguinte frmula:

Resultados e Discusso
Na Tabela 1, observa-se que a densidade de partculas dos solos da regio apresenta -3 densidade mdia de 2,65 g cm , refletindo basicamente a predominncia de partculas de caulinita e quartzo, que possuem densidades compreendidas nessa faixa.

Dr =

Dag ( Ps - P ) ( Ps + P ) - ( Psa - Pa )

Tabela 1. Densidade de Partculas de diferentes classes de solos da Amaznia. Classificao Antiga Classificao Atual Horizontes A 2,55 A 2,45 261 A 2,50 2,56 A 2,41 2,59 A 2,58 2,54 A 2,50 A 2,45 2,68 C 2,53 2,55 C 2,49 2,62 B 2,51 2,63 B 2,40 2,58 B 2,51 2,60 B 2,53 B 2,56 2,68

Areias quartzosas Glei pouco hmico Laterita hidromrfica Latossolo amarelo Latossolo vermelho amarelo Litlico Podzlico Vermelho amarelo

Neossolos quartzarnicos Gleissolos Plintossolos Latossolo amarelo Latossolo vermelho amarelo Neossolos litlicos Argissolos

Fonte: Projeto - Radam Brasil, Folha SB, 19 e 20 de 1978.

Na Tabela 2, observa-se que o Plintossolo apresenta em alguns horizontes valores de densidade de partculas bastante acentuados, relacionados com os seus elevados teores de ferro e de quartzo. O Espodossolo apresenta, no horizonte Bhs, baixo valor de densidade de partculas, devido ao elevado teor de carbono em sua composio. Da mesma forma, o Latossolo Amarelo, tpico da regio, apresenta a mesma peculiaridade, mas este perfil em particular, com um ltimo horizonte possuindo elevado valor de DP, em razo de ser aquele um horizonte plntico, constitudo de grande quantidade de ferro e quartzo e pobre em carbono. J a DP do Cambissolo e do Argissolo refletiram composio mineralgica do solo, no caso, caulinita e quartzo, com densidade de partculas mdia de 2,65 g cm-3 . Os baixos valores de desvio-padro indicam a preciso do mtodo do picnmetro, sendo este bastante robusto e indicado quando necessrio obter resultados precisos e rigorosos. Na Tabela 3, observa-se que as amostras

com elevado teor de matria orgnica apresentam densidade menor que as demais amostras. Isso demonstra que a matria orgnica (galhos, razes, folhas, insetos, etc.) que possui densidade menor que a dos minerais presentes no solo, quando em elevados teores, contribui para reduzir os valores da densidade de partculas de uma amostra de solo. Em amostras que possuem baixo teor de matria orgnica, foi observado que a sua densidade manteve-se compatvel com a DP dos solos caractersticos da regio -3 (2,65 g cm ) refletindo, assim, a predominncia de fraes minerais de caulinita e quartzo que apresentam densidade nessa faixa (Tabela 4). Como os resultados obtidos pelo mtodo do picnmetro foram confiveis, alm da importncia cientfica, atualmente esse mtodo adotado na rotina do laboratrio de fsica do solo da Embrapa, por ser mais preciso e econmico que o mtodo do balo volumtrico com lcool, utilizado anteriormente.

R. S. Macedo

135

Tabela 2. Caractersticas fsicas de alguns perfis de solos na Amaznia Central.


Classes de solos e Localizao

Horizonte A1 A2 Bc1 C A1 A2 AE E BH Bhs A B B/C C A A/B B BC Cpl A B1 B2 B3 B4 C C(m)

Dp1 g/cm3 2,730 2,750 2,780 2,750 2,310 2,700 2,623 2,656 2,636 2,553 2,663 2,663 2,683 2,693 2,686 2,720 2,753 2,763 2,966 2,660 2,686 2,703 2,723 2,733 2,690 0,060 0,045 0,045 0,001 0,337 0,085 0,020 0,055 0,066 0,051 0,025 0,032 0,005 0,032 0,041 0,010 0,005 0,005 0,057 0,020 0,011 0,028 0,005 0,005 0,010

Areia grossa

Areia Fina

Silte

Argila

Carbono

Plintossolo Manacapuru Cacau Pirera Km 73

360 332 239 443 823 727 713 707 553 626 614 562 559 545 297 257 178 139 304 29 13 12 10 14 4 4

205 189 143 117 143 208 232 258 2587 154 202 208 227 195 129 106 111 81 115 383 402 325 301 198 134 336

161 141 92 156 23 52 46 32 65 123 94 98 59 99 139 177 93 62 185 328 309 375 274 252 341 243

274 338 527 284 11 12 8 3 95 97 181 133 155 139 435 460 618 718 397 258 274 436 411 533 519 415

28,5 20,8 4,3 1,3 6,1 6,9 2,2 0,4 1,31 26,1 5,8 3,6 2,0 1,0 22,3 14,7 4,9 2,2 0,4 49 13 18 3 3 2 1

Espodossolo Lago do Limo Iranduba

Argissolo Manacapuru Novo Airo Km 8

Latossolo Amarelo Fazenda Sta Regina Manacupuru

Cambissolo Urucu Coari

DP: Densidade de Partculas

Concluses
Os valores de DP tendem a aumentar com a profundidade, devido reduo dos teores da matria orgnica. A matria orgnica contribui para baixar os valores de densidade de partculas. A maior uniformidade do material com a profundidade reflete-se na menor variabilidade dos valores de DP. Os valores de densidade de partculas refletem a composio orgnica e mineralgica do solo, no caso das amostras analisadas: caulinita e quartzo. Os baixos valores de desvio-padro indicam ser o mtodo do picnmetro robusto e preciso. Recomenda-se o uso do mtodo do picnmetro em anlises de rotina em laboratrios de fsica do solo por ser um mtodo relativamente simples e barato.

Agradecimentos
Ao Conselho Nacional de Desenvolvimento Cientfico e Tecnolgico (CNPq), pelo apoio financeiro para a realizao do trabalho; ao Dr. Wenceslau Geraldes Teixeira e aos tcnicos do Laboratrio de Fsica de Solo da Embrapa Amaznia Ocidental, pelo auxlio nas anlises das amostras.

Referncias Bibliogrficas
BUCKMAN, H. O.; BRADY, N. C. Natureza e propriedade dos solos. 3. ed. Rio de Janeiro: Freitas Bastos, 1974. 69 p. DEER, W. A. Minerais constituintes das rochas uma introduo. Lisboa: Fundao Calouste Gulbenkian, 1966. 260 p.

136

R. S. Macedo

DONAHUE, R. L.; MILLER, R. W.; SHICKLUNA, J. C. Soils: an introduction to soils and plant growth. 5. ed. New Jersey: Prentice-Hall. 1983. 57 p. FORSYTHE, W. Fisica de suelos manual de laboratorio. San Jos, Costa Rica: IICA, 1985. 28 p. GALETI, P. A. Conservao do solo: reflorestamento; clima. 2. ed. Campinas: Instituto Campineiro de Ensino Agrcola, 1973. p. 18-19. KIEHL J. E. Manual de edafologia. Relaes solo-planta. So Paulo: Agronmica Ceres, 1979. 264 p. LEPSH, I. F. Formao e conservao dos solos. So Paulo: Oficina de Textos, 2002. 19 p.

RADAMBRASIL. Departamento Natural da Produo Mineral. Folha SB. 19 Juru: geologia, geomorfologia, pedologia, vegetao e uso potencial da terra. Rio de Janeiro, 1977. RADAMBRASIL. Departamento Natural da Produo Mineral. Folha SA. 20 Manaus: geologia, geomorfologia, pedologia, vegetao e uso potencial da terra. Rio de Janeiro, 1978. RADAMBRASIL. Departamento Natural da Produo Mineral. Folha SB. 20 Purus: geologia, geomorfologia, pedologia, vegetao e uso potencial da terra. Rio de Janeiro, 1978.

Tabela 3. Dados de densidade de partculas (DP) e matria orgnica (MO) de algumas classes de solos da Amaznia Central.
Classe de Solo Horizonte A1 A2 BC1 C A1 A2 AE E BH BHs A B B/C C A AB B BC Cpl A B1 B2 B3 B4 C C(m) DP (g cm-3) 2,730 2,750 2,780 2,750 2,310 2,700 2,623 2,656 2,636 2,553 2,663 2,663 2,683 2,693 2,686 2,720 2,753 2,763 2,966 2,660 2,686 2,703 2,723 2,733 2,690 MO (%) 48,94 35,84 7,35 2,28 10,54 11,89 3,82 0,60 22,52 44,89 9.89 6.17 3.52 1.73 38,42 25,32 8,39 3,72 0,69 13,20 8,72 3,52 3,78 49,46 2,82 1,79

Plintossolo

Espodossolo

Argissolo

Latossolo Amarelo

Cambissolo

R. S. Macedo

137

Tabela 4. Densidade dos principais minerais dos solos amaznicos.


Mineral Densidade de partculas (g cm-3) 2,65 2,56 2,63 2,70 3,30 2,77 2,88 2,33 2,60 2,61 2,68 2,60 2,68 2,30 2,00 2,20

Quartzo Feldspato Biotita Moscovita Clorita Caulinita Ilita Esmectita Haloysita


Fonte: DEER, 1996.

Amaznia Ocidental