Você está na página 1de 151

Ana Lcia Brunialti Godard

Monograas SBG
A clonagem posicional uma abordagem para o estudo do genoma funcional

2008, dos autores Direitos reservados desta edio


Sociedade Brasileira de Gentica

Diagramao, reviso, capa e projeto grfico


cubo multimidia

Editora SBG

Sociedade Brasileira de Gentica Ribeiro Preto, SP

Godard, Ana Lcia Brunialti A clonagem posicional - uma abordagem para o estudo do genoma funcional. / Ana Lcia Brunialti Godard - Ribeiro Preto: SBG, 2008. 151p. ISBN - 978-85-89265-04-1 I. Autor. II. Ttulo.

Sumrio
INTRODUO ............................................................................................ 11 A anlise da funo gnica atravs da estratgia descendente ................ 12 A anlise da funo gnica pela estratgia ascendente ........................... 13 MODELO ANIMAL ..................................................................................... 14 Vantagens de se utilizar o camundongo como modelo animal .................. 15 O genoma murino..................................................................................... 17 Para onde vamos agora?............................................................................ 20 A MUTAO PROGRESSIVE MOTOR NEURONOPATHY (pmn) ................. 24 Descrio clnica ...................................................................................... 24 Dados anatomopatolgicos ....................................................................... 24 Msculos e nervos perifricos .............................................................. 24 Medula Espinal .................................................................................... 25 O PRINCPIO GERAL DA CLONAGEM POSICIONAL .................................. 28 O mapeamento gentico ........................................................................... 30 O mapeamento da mutao sobre um cromossomo particular............. 30 A construo de um mapa gentico de alta densidade e de alta resoluo ao redor do gene mutado .................................................................... 31 Microssatlites X SNPs (Single Nucleotide Polymorphisms) .................. 38 O mapeamento fsico ................................................................................ 39 A eletroforese em campo pulsado ........................................................ 40 Os PAC, YAC e BAC ............................................................................ 41

Salto e caminhada sobre o cromossomo: chromosome jumping e chromosome walking .......................................................................................... 42 Isolamento das seqncias codicadoras .................................................. 43 Conservao ao longo da evoluo: Zooblots ...................................... 44 A anlise de Northern blot ................................................................... 44 A amplicao de xons ou Exon trapping........................................... 45 A captura do DNA por afinidade ou DNA affinity capture ou DNA selection .............................................................................. 45 A sondagem de biblioteca de cDNA .................................................... 46 Os mtodos baseados na anlise das ilhas CpG ................................... 47 O sequenciamento genmico .............................................................. 49 As outras tcnicas ................................................................................ 49 A identicao direta do cDNA candidato ................................................ 50 Isolamento de um mensageiro completo ................................................... 51 A identicao do bom candidato ............................................................ 52 A clonagem posicional nos tempos atuais ................................................. 53 ESTUDO DE CASO ...................................................................................... 56 Mapeamento gentico do lcus pmn ........................................................ 56 Localizao cromossmica da mutao pmn (BRUNIALTI et al., 1995) 56 Mapa gentico humano ....................................................................... 58 Construo de um contig contendo o lcus pmn ...................................... 58 Isolamento e caracterizao preliminar dos YAC que contm D13Mit215, D13Mit305, D13Mit115, Gli11 e Gli20 ................................................. 59

Isolamento e caracterizao preliminar dos BAC contendo os marcadores D13Mit215, Gli11, Gli20 e D13Mit115 .................................................. 60 Mapa fsico ao redor do lcus pmn ........................................................... 61 Isolamento e caracterizao dos xons a partir do DNA do contig ............ 63 As EST ...................................................................................................... 64 A MUTAO pmn: UM MODELO DE NEUROPATIAHUMANA .................. 66 pmn: um modelo potencial para a patologia neuromuscular humana ........ 66 pmn: uma mutao de efeitos independentes ...................................... 66 pmn no o lcus homlogo ao lcus responsvel pela amiotroa espinal do tipo Werdnig Hoffmann humana .................................................... 66 pmn: um bom modelo anlogo s amiotroas espinais ............................. 67 pmn, onde est o mal? ......................................................................... 68 A etapa seguinte ....................................................................................... 69 Podemos denir o perl de um gene candidato? ....................................... 70 FINAL DA HISTRIA.................................................................................... 72 MATERIAL E MTODOS UTILIZADOS NO ESTUDO DA MUTAO pmn .. 73 Origem dos alelos mutantes e das linhagens utilizadas .............................. 73 Protocolos experimentais utilizados no estabelecimento do mapa gentico .....74 Cruzamentos realizados ....................................................................... 74 Extrao do DNA ................................................................................ 74 Reao em cadeia da polimerase (PCR) ............................................... 75 Iniciadores .................................................................................... 75

Condies de amplicao ........................................................... 75 Anlise dos produtos de PCR......................................................... 76 Anlise do polimorsmo dos microssatlites pela SSCP ................. 76 Anlise dos resultados ................................................................... 77 A coleo de DNA do EUCIB ................................................................... 77 Protocolos experimentais utilizados no estabelecimento do mapa fsico.... 77 Preparao do DNA de levedura em blocos de agarose (adaptado de BIRREN at al., 1993) ....................................................................77 Eletroferese e campo pulsado e hibridizao........................................ 78 Isolamento das extremidades dos cromossomos articiais de levedura pela PCR-inversa (adaptado de ARVEILER; PORTEUS, 1991) ........................ 79 Mapa de restrio do contig de YAC .................................................... 80 Preparao do DNA genmico a partir do BAC ................................... 81 Isolamento e caracterizao das seqncias codicadoras ........................ 82 RT-PCR ................................................................................................ 82 Amplicao dos xons ...................................................................... 83 O vetor pSPL3 ............................................................................... 83 Transfeco das clulas COS-7 ...................................................... 84 Isolamento do RNA citoplasmtico ................................................ 84 Amplicao e clonagem dos xons capturados ............................ 84 Sequenciamento ....................................................................................... 86 Mtodos .............................................................................................. 86

Anlise das seqncias ........................................................................ 86 REFERNCIAS BIBLIOGRFICAS.................................................................. 87 ANEXO I- FIGURAS ................................................................................... 107 ANEXO II- TABELAS ................................................................................... 148

Lista de Figuras
Figura 1: As estratgias da clonagem ........................................................... 107 Figura 2: Mutao alcaptonria (aku). ......................................................... 108 Figura 3: Animal modelo da fenilcetonria (PKU) humana. ......................... 109 Figura 4: Relaes evolutivas entre os modelos mais utilizados em laboratrio. ..110 Figura 5: Oxford Grid. ..................................................................................111 Figura 6: A mutao pmn ............................................................................112 Figura 7: Cortes histolgicos. ........................................................................113 Figura 8: Nervo frnico. ..............................................................................114 Figura 9: Fentipo obeso. ............................................................................115 Figura 10: Principio da clonagem posicional. ................................................116 Figura 11: Tipos de cruzamentos utilizados nos projetos de mapeamento. ....117 Figura 12: Estratgias do mapeamento. ........................................................118 Figura 13: rvore filogentica da ordem muridae. ........................................119 Figura 14: Ilustrao do principio de RFLP (Polimorfismo de Comprimento de Fragmentos de Restrio. .......................................................................... 120 Figura 15: Meios microssatlites e sua deteco............................................121

Figura 16: SSCP - Alelos e sua deteco. .................................................... 122 Figura 17: Mapa comparativo das regies de ortologia entre o cromossomo 13 murino ( direita) e os segmentos cromossmicos 1, 3, 5, 6, 7, 9 e 10 humanos. ............123 Figura 18: Princpio da clonagem em YAC. ...................................................124 Figura 19: Construo do vetor BAC. .......................................................... 125 Figura 20: Ilustrao da tcnica do salto no cromossomo. ............................126 Figura 21: A marcha sobre o cromossomo. ...................................................127 Figura 22: Princpio da amplificao dos xons internos ou xon-Trapping. ...128 Figura 23: Captura de cDNA por afinidade ................................................. 130 Figura 24: Principio da RACE. ......................................................................131 Figura 25: Identificao da mutao. ..........................................................132 Figura 26: Hapltipo. .................................................................................. 134 Figura 27: Cruzamento intra-especifico.........................................................135 Figura 28: Mutao Extra-toe e o estoque balanceado. ............................ 136 Figura 29: Localizao precisa dos marcadores microssatlites no cromossomo 13 murino. ........................................................................................................137 Figura 30: Mapa gentico parcal da regio cromossmica de interesse. ....... 138 Figura 31: Anlise pela eletroforese em campo pulsado dos YAC Y902.2, Y903.1 e Y13.115. ...................................................................................................... 139 Figura 32: Organizao dos YAC. ................................................................ 140 Figura 33: Anlise por Southern blot da extremidade esquerda do clone Y902.2. .... 141 Figura 34: Mapa de restrio do contig de YAC que cobre a regio pmn. .... 142 Figura 35: Localizao dos xons e das ESTs. ............................................... 143

Figura 36: Anlise pela PCR das EST humanas E7 (A006127) e E2 (WL9635). ... 144 Figura 37: Isolamento das extremidades do YAC atravs da PCR inversa. ..... 145 Figura 38: Principio da amplificao dos xons internos ou xon-Trapping. .. 146 Figura 39: O vetor de expresso pSPL3. .......................................................147

Lista de Tabelas
Tabela 1...................................................................................................... 148 Tabela 2...................................................................................................... 149 Tabela 3...................................................................................................... 149 Tabela 4...................................................................................................... 150 Tabela 5...................................................................................................... 150 Tabela 6...................................................................................................... 150 Tabela 7...................................................................................................... 150 Tabela 8.......................................................................................................151

APRESENTAO
Tese de Doutorado apresentada no Programa de Ps-Graduao em Gentica Humana da Universidade Pierre e Marie Curie Paris VI Frana, sob a orientao do Dr. Jean-Louis Gunet.

INTRODUO
Para que um dia se possa conhecer a funo da totalidade dos genes que compem o genoma humano e dos mamferos, os geneticistas modernos possuem, de forma geral, duas estratgias (Figura 1). A primeira, a qual podemos chamar de estratgia descendente, consiste em recuperar as seqncias codicadoras de um gene, seja pelo seqenciamento direto do DNA, seja pelas seqncias codicadoras do produto de transcrio. Em seguida, uma vez identicadas, tais seqncias so modicadas de maneira a inativar a funo do gene correspondente. Essa estratgia consiste na induo de uma mutao, que, em geral, acarreta o aparecimento de um alelo nulo no-funcional de uma seqncia codicadora desconhecida e, por meio do estudo dos efeitos provocados por essa mutao, poderemos compreender, enm, a funo desse gene. A segunda estratgia, dita ascendente, consiste, ao contrrio da primeira, em analisarem-se as conseqncias de uma alterao que apareceu de forma espontnea para podermos chegar ao gene responsvel. Essa estratgia tambm chamada de gentica inversa ou clonagem posicional. Ela possibilita um estudo aprofundado de uma mutao qualquer, visto que podemos obter sua localizao gentica, e, como trabalhamos com um fentipo anormal, podemos efetuar anlises detalhadas sobre vrios aspectos que nos conduzem ao gene responsvel. Justica tal estratgia a possibilidade de se obter um animal de laboratrio com uma mutao que apresente fortes semelhanas aos de uma doena humana geneticamente determinada. Esse animal passa, ento, a ser considerado um modelo dessa sndrome humana e, com o estudo dele, poderemos adquirir rapidamente informaes preciosas e transponveis ao homem. Essas duas estratgias so teoricamente opostas, mas, como veremos mais adiante, elas acabam se complementando.

11

Introduo

A anlise da funo gnica atravs da estratgia descendente


O seqenciamento sistemtico do genoma, o qual j foi realizado para vrios microorganismos, culminando com o genoma humano em 2001 (VENTER et al., 2001; LANDER et al., 2001) e com o dos camundongos em 2002 (WATERSTON et al., 2002), representa um empreendimento facilmente automatizvel e apresenta a vantagem de nos levar diretamente ao conhecimento profundo e ntimo da estrutura genmica do organismo estudado. Infelizmente, essa estratgia extremamente cara para um organismo de grande complexidade como o homem, por exemplo, no qual a proporo de seqncias codicadores innitamente minoritria em relao s demais. A construo de bibliotecas de cDNA a partir de molculas de RNA mensageiro transcritas num tecido ou rgo em particular representa uma vantagem considervel em relao ao seqenciamento direto, mas ela no permite a identicao de todos os genes. Ns sabemos que, em mdia, 20% dos genes transcritos num dado tecido aparecem na forma de mRNA em populaes minoritrias e, portanto, de difcil acesso. Sabemos, igualmente, que vrios genes so transcritos durante um perodo de tempo muito curto e que o isolamento desses genes numa biblioteca de cDNA completamente aleatrio. Enm, no podemos nos esquecer dos genes constitutivos (ou genes de manuteno), transcritos o tempo todo, os quais acabam atrapalhando o isolamento dos outros genes. Porm, mesmo com todos esses inconvenientes, vrios programas para a identicao e o seqenciamento destas seqncias codicadoras foram lanados e ns observamos que, desde 1997, mais de 16.500 EST (Expressed Sequence Tag) foram localizadas no genoma humano e, entre elas, apenas 2.600 j eram conhecidas. Uma vez identicadas essas seqncias transcritas, podem elas ser mapeadas, servindo de marcadores moleculares, a m de se densicar um mapa gentico, e, enm, no isolamento do

12

Introduo

cDNA completo. A partir deste, as vias esto abertas a todas as manipulaes para se conhecer a funo do gene por meio da sua invalidao.

A anlise da funo gnica pela estratgia ascendente


Como j foi mencionado anteriormente, essa estratgia consiste na identicao de genes a partir de mutaes espontneas ou induzidas que so identicadas por seus efeitos fenotpicos. Essa estratgia, a qual tambm podemos chamar de gentica inversa ou de clonagem posicional, demanda um grande nmero de cruzamentos envolvendo os animais portadores das mutaes para os estudos. Primeiramente, comeamos com o estudo de ligao ou mapeamento gentico da patologia de alta densidade e preciso; em seguida, estabelecemos um mapa fsico da regio mapeada. Tal estratgia s permite a identicao de um nmero minoritrio de genes que, quando mutados, levam ao aparecimento de um fentipo facilmente observado ab tero. Em compensao, ela oferece a vantagem de partir de um fentipo que pode ser analisado sob vrios aspectos anatmico, histolgico, siolgico, molecular, etc , para podermos chegar ao gene responsvel. Essa estratgia particularmente justicada quando possumos uma mutao observada no animal de laboratrio, na qual os efeitos patolgicos apresentam analogias com aqueles observados numa doena gentica humana, pois, nesse caso, o animal considerado um modelo potencial para a patologia humana. O estudo e a clonagem do gene no animal, sendo mais rpidos, nos permitiriam, ento conhecer facilmente o gene responsvel pela doena no homem (exemplos nas Tabelas 1 e 2).

13

MODELO ANIMAL
Como foi citado anteriormente, a estratgia da clonagem posicional particularmente interessante quando temos um modelo animal de uma patologia humana. Entretanto, antes de considerarmos um organismo como um modelo, devemos saber o que exatamente um animal modelo. Modelos animais so preparaes experimentais desenvolvidas em determinada espcie com o propsito de se estudarem fenmenos que ocorrem em uma outra espcie (MCKINNEY, 1984). Estes so vlidos se apresentarem as mesmas estruturas envolvidas no comportamento ou na patologia humana em estudo (KAPLAN, 1973). Geralmente, os modelos animais aparecem como resultado de mutaes, espontneas ou induzidas, que levam a uma alterao fenotpica em decorrncia de um produto protico no-funcional ou ausente. Uma grande coleo de mutaes foi obtida ao longo da histria da gentica de camundongos, cobrindo alteraes em quase todas as classes fenotpicas. Entre elas, podemos citar mutaes produzindo obesidade, malformaes no sistema auditivo, perda de plos e mudana de sua estrutura, nanismo, anemia, desordens metablicas e imunolgicas com nveis de severidade variveis, entre outras (GODARD; GUNET, 1999). Uma grande quantidade desses mutantes apresenta fentipos que se assemelham fortemente queles observados em certas doenas humanas, podendo essas homologias se estender ao nvel molecular (GODARD; GUNET, 1999). A importncia desses modelos reside na possibilidade de se proporcionar uma melhor compreenso das patologias humanas, servindo como ferramentas para se tentar elucidar as vias bioqumicas e siolgicas envolvidas nas doenas e possibilitando uma identicao de alvos que permitam o desenvolvimento de drogas teraputicas (MOORE, 1999). Muitos modelos j foram obtidos em vrios laboratrios. Entre eles, podemos citar a descoberta do modelo murino, que apresenta caractersticas fenotpicas bastante semelhantes

14

Modelo Animal

s da alcaptonria humana (Figura 2), o que permitiu o mapeamento da mutao homloga (simbolizada por aku) no cromossomo 16 de camundongo e, por ortologia, a localizao marcadores humanos no cromossomo 3 ligados ao gene do cido homogentsico oxidase. Um segundo modelo aquele que apresenta uma distroa muscular ligada ao cromossomo X decorrente de uma mutao espontnea no gene mdx, levando os animais a apresentar nveis elevados de creatina cinase e piruvato cinase no plasma. O lcus mdx se mostrou homlogo ao gene que codica a distrona. No homem, mutaes nesse gene podem levar Distroa Muscular de Duchenne ou Becker. Esses mutantes foram de extrema importncia porque permitiram a demonstrao de que a falta de distrona no era a principal causa da doena humana. Outro exemplo o modelo que apresenta a Sndrome da Hiperfenilalaninemia (HPH) (Figura 3) associada com a mutao hph1, que leva a uma ausncia de guanosina trifosfato ciclohidrolase (GTP-CH). Esse mutante considerado o modelo da fenilcetonria humana (PKU). Vrios alelos deletrios no lcus da fenilalanina hidroxilase (Pah) responsveis por levar a sndromes com diferentes nveis de gravidade foram isolados em camundongos. Estes possibilitaram pela primeira vez uma explicao molecular para o fenmeno de expressividade varivel na fenilcetonria humana. O mutante Clock, isolado por Vitaterna em 1994, permitiu um estudo inicial sobre um ritmo circadiano especco envolvido na atividade locomotora, resultando no isolamento do gene candidato Clock, por clonagem posicional.

Vantagens de se utilizar o camundongo como modelo animal


Entre todos os organismos modelos conhecidos atualmente, o camundongo o escolhido por apresentar vrias caractersticas peculiares que o colocam frente em relao a outros modelos animais. A primeira dessas caractersticas diz respeito ao fato de o camundongo possuir um tempo de gerao curto (um lhote recm-nascido pode se tornar um adulto em idade reprodutiva em 11 semanas) e bastante

15

Modelo Animal

prolco. As fmeas podem carregar muitos embries por gestao, e a possvel morte de algum deles no compromete o desenvolvimento dos outros e no pe m gravidez. Em laboratrio, fcil a manipulao e criao dessa espcie, alm de ser possvel realizao de cruzamentos controlados com o intuito de promover endogamia como, por exemplo, cruzamentos do tipo irmos versus irms. Isso leva, ao longo das geraes, ao aparecimento de populaes extremamente homogneas do ponto de vista gentico, isto , os animais so como clones e so virtualmente homozigotos para todos os loci, caracterizando as linhagens isognicas (GUNET, 1998). Como mencionado por Silver (1995), o perodo de divergncia evolutiva entre o homem e o camundongo, h cerca de 60 milhes de anos, o mais recente em relao aos outros modelos animais disponveis, como Xenopus, Drosophila melanogaster e C. elegans (Figura 4). Assim, a enorme homologia existente tanto no nvel genotpico quanto no fenotpico (siologia, patologia, vias metablicas) entre as duas espcies justica fortemente a escolha desta em relao s outras para o isolamento de modelos. O DNA codicador do camundongo possui uma homologia em relao ao do humano que pode variar de 70 a 90% (STRACHAN; REED, 2002), maximizando as chances de se encontrarem genes ortlogos (mesmo gene em diferentes espcies) nas duas espcies. A relao entre os loci ortlogos do camundongo e os do homem pode ser mais bem visualizada pelo Oxford Grid (Figura 5), desenvolvido inicialmente por John Edwards em 1991 (LYON, 2002) e que atualizado diariamente. Em consulta realizada no MGI em 04 de agosto de 2003, mais de 9.800 regies de homologia entre o camundongo e o homem estavam disponveis no banco de dados. E esse nmero continua crescendo. Depois do homem, o camundongo o mamfero que possui o genoma mais bem estudado e conhecido, devido grande quantidade de marcadores genticos e de mutaes j isoladas e da possibilidade de se obterem proles viveis e frteis a partir de cruzamentos interespeccos, permitindo a

16

Modelo Animal

observao da segregao de polimorsmos de vrias classes (GUNET, 1998).

O genoma murino
Em 2002 foi publicado o sequenciamento completo do genoma de camundongos (WATERSTON et al., 2002). A comparao dos mapas gentico das duas espcies indica que mais de 90% dos dois genomas podem ser posicionados em regies conservadas de sintenia, nas quais a ordem dos genes foi conservada em ambas as espcies. J ao nvel do nucleotdeo, aproximadamente 40% do genoma humano pode ser alinhado ao genoma do camundongo. Um esboo da seqncia genmica do camundongo, representando 96% do genoma da eucromatina j est disponvel (Tabela 3). Atravs da anlise destas seqncias podemos constatar que os genes, como esperado dos estudos precedentes, representam somente uma parcela pequena dos genomas de mamferos. No camundongo, o nmero de genes codicadores de protenas foi estimado entre 30.000 40.000, mesmo nmero que no homem. A anlise da seqncia indica que h uma correlao positiva entre a densidade de genes e o contedo (G+C), com 75-80% dos genes que residem nas regies do genoma ricas em (G+C). O catlogo dos genes murino contm 29.201 transcritos preditos que correspondem a 22.011 genes que contm aproximadamente 213.562 xons distintos. Muitos genes detectados no genoma do camundongo so novos e no foram identicados previamente. H tambm 9.785 transcritos preditos que no correspondem a cDNAs conhecidos. Aproximadamente 99% de genes do camundongo tm um homlogo no genoma humano e para 80% destes genes, a correspondncia no genoma humano encontra-se em um intervalo conservado de sintenia. Isto indica que os genes ortlogos provavelmente descendem de um gene ancestral comum. No existe gene predito ortlogo humano em menos

17

Modelo Animal

de 1% (118 genes) dos genes preditos no camundongo. Alguns destes genes foram perdidos simplesmente porque foram deletados em um genoma ou no outro. Tambm possvel que as evidncias nas quais as predies dos genes foram baseadas estejam incorretas. Os genomas dos mamferos tambm codicam muitos RNAs que no so traduzidos em protenas. Estes incluem RNAs envolvidos no processamento do mRNA e na traduo (rRNAs e tRNAs). Recentemente foi descoberto RNAs envolvidos no regulamento da expresso gnica e em outras funes (tais como micro RNAs) e muitos novos RNAs cujas identicaes computacionais so difceis. Aproximadamente 37% do genoma do camundongo (comparado a 46% do genoma humano) consiste em repeties intercalares resultante das inseres de elementos de transposio (transpsons) e estes talvez sejam a principal causa da diferena no tamanho dos dois genomas (2,5 Gbp para o camundongo contra 2,9 Gbp para o homem). Entretanto, o camundongo tem as mesmas quatro classes de elementos de transposio que o homem: i) elemento nuclear intercalar longo (LINE); ii) elemento intercalar nuclear curto (SINE); iii) retrotranspson viral com repeties terminais longas (LTRs); e iv) transposns de DNA. Como na maioria das espcies de mamferos, o genoma do camundongo tambm possu seqncia de repeties simples (SSRs), consistindo em curtas repeties em tandem perfeitas ou quase perfeitas. Estes SSRs tm sido particularmente importantes na gerao de marcadores genticos utilizados nos estudos de ligao, pois oferecem um polimorsmo de cumprimento e so facilmente amplicados pela PCR. Neste sentido, o camundongo parece representar uma exceo dentre os mamferos, pois tem 2/3 mais SSRs que o homem. Entre estes SSR, os seis di -, tri- e tetrmeros (AG, AAG, AGG, AAAG, AAGG, AGGG), cpias com ao menos 20 bp so dez vezes mais comuns no camundongo do que no genoma humano. Alm disso, nas

18

Modelo Animal

SSRs que possuem numa ta um intervalo rico em purina e na outra ta um intervalo rico em pirimidina muito mais comum e extenso no camundongo do que no homem. Os polimorsmos de nucleotdeos nicos (SNPs) tambm so comuns no camundongo ao longo das diferentes linhagens e estes SNPs so observados tanto nas regies codicadoras como fora delas. A densidade mdia de SNPs entre a linhagem C57BL/6 e a linhagem BALB/c ou C3H/He est na escala 1 a cada 500-700 pares de bases, porm a distribuio de SNPs no uniforme nas linhagens de laboratrio. Nestas podemos observar regies ricas em SNPs (40 SNPs para 10 Kb) enquanto outras extremamente pobres em SNPs (0,5 SNP para 10 KB). 80% de protenas do camundongo parecem ter ortlogos estritos de 1:1 no genoma humano. O restante pertence s famlias dos genes que foram submetidos expanso diferencial em um dos dois genomas. Como exemplo dessa expanso, podemos citar a famlia dos genes dos receptores de olfato, onde as diferenas no nmero e na seqncia podem explicar os diferentes graus de deteco dos odores existentes entre os camundongos e os seres humanos. Um outro exemplo, a famlia do gene do citocromo P450, envolvida no metabolismo de compostos xenobiticos. No geral, as famlias de genes so signicativamente mais expandidas no camundongo do que no homem. As comparaes de 95 regies reguladoras bem conhecidas no genoma do camundongo permitiu estabelecer que a distribuio desses elementos era: 10% nos ntrons, 85% na vizinhana imediata (< 2 kb) dos promotores e 5% mais distais dos promotores. Aproximadamente 19% sobrepem-se a uma ilha CpG. A extenso da conservao destas regies consideravelmente mais baixa do que em regies codicadoras, mas ainda muito mais alta do que a taxa mdia atravs do genoma. Nestas regies, o contedo (G+C) tambm substancialmente mais elevado do que para o genoma como um todo.

19

Modelo Animal

O sequenciamento de outras linhagens de camundongos, que so comumente utilizadas pelas pesquisadores, tambm ser realizado em breve, bem como a anotao progressiva desses genomas. Estas etapas so de extrema importncia e, sem dvida alguma, nos ajudar na anlise das doenas complexas ou aqueles determinadas por vrios genes (QTLs).

Para onde vamos agora?


O futuro da genmica e da gentica do camundongo na era ps sequenciamento pode ser facilmente vislumbrada pelos cientistas. O acesso livre e irrestrito s seqncias depositadas nos bancos de dados e a contnua melhora na qualidade dessas seqncias proporcionam a realizao de comparaes interespeccas. Por exemplo, podemos comparar as seqncias no codicadoras conservadas (SCCs) entre vrias espcies, tais como, camundongo, rato, chipanz, homem e bovino e cruz-las com a expresso de genes em diferentes tecidos (transcriptoma). As informaes que podero surgir dessas comparaes, sero teis no entendimento da regulao gnica. Na era ps-sequenciamento, as mutaes sero teis e podero contribuir de forma eciente na anotao dos genes pela comparao da alterao no DNA que gerou a mutao e seu respectivo fentipo. De outra forma, atravs do isolamento do gene que causou o fentipo alterado estaremos entendendo a funo deste, ou seja, estaremos estudando e tendo acesso s funes dos genes que compem o genoma atravs de suas disfunes. Existe um abismo entre os mutantes disponveis e a quantidade total de fentipos essenciais para podermos explorar totalmente o camundongo como um organismo modelo e, assim, dissecarmos as funes primrias da totalidade dos genes que compem nosso genoma (GUNET, 2006). Ao examinarmos cuidadosamente os camundongos portadores de mutaes neurolgicas encontramos apenas cinco mutantes [wasted (wst), progressive motor neuropathy (pmn), neuromuscular

20

Modelo Animal

degeneration (nmd), wobbler (wr) e motor neurone degeneration 2 (mnd2)] que so modelos potenciais de doenas dos neurnios motores (LUDOLPH, 1996). Esses cinco mutantes obviamente representam uma pequena frao do nmero de genes envolvidos nas funes neuronais e motoras. Por outro lado, nenhum destes mutantes foi identicado como modelo homlogo de doenas humanas e, as para as duas mutaes no homem que afetam os nuernios motores, no foi encontrado modelo murino (BRUNIALTI et al.,1995). Da mesma forma muitas mutaes dos camundongos que conduzem surdez vem sendo identicadas no homem, estas so associadas com o sacudir a cabea e movimento circular. Com essas mutaes pde-se entender muito sobre o desenvolvimento do ouvido interno humano, mas nenhuma mutao em camundongo foi identicada levando perda progressiva da audio, o que uma caracterstica comum em certas pessoas idosas (STEEL et al., 1997). A expanso da coleo de camundongos mutantes se faz necessria para identicar e descrever de novos genes e para uma melhor compreenso da ao destes genes no metabolismo geral, permitindo um maior domnio na compreenso da funo gnica em mamferos (WELLS & BROWN, 2000). O domnio de tcnicas moleculares que criam mutaes (ENU, animais knock-in e knockout e mutantes condicionais), aliado existncia das mutaes espontneas, acelerou o andamento de estudos sobre o fentipo, isto , como o impacto genotpico de diferentes mutaes atua na funo normal de genes crticos. Mesmo com os inmeros mutantes j isolados e descritos, o termo gap (buraco) fenotpico bem empregado para expor um estado de carncia de animais mutantes, o que leva ao sub-aproveitamento do camundongo como organismo modelo. Para maximizar as potencialidades do camundongo como modelo, ainda necessrio isolar mais mutantes para os loci j conhecidos e tambm gerar mutaes em loci ainda desconhecidos (BROWN & PETERS, 1996).

21

Modelo Animal

Apostando nesta estratgia, muitos laboratrios se interessam pela abordagem fenotpica, isolando mutantes induzidos pela ao alquilante do mutgeno ENU (etil-nitrosouria). Este agente mutagnico possui um radical etil transfervel a oxignios ou nitrognios presentes nas bases nitrogenadas do DNA (NOVEROSKE et al., 2000). Os stios de alquilao esto presentes em todas as bases do DNA e foram identicados tanto in vivo quanto in vitro. Estes stios incluem os resduos N1, N3 e N7 da adenina; O6, N3 e N7 da guanina; O2, O4 e N3 da timina e O2 e N3 da citosina. A base transformada, ento, passa a mimetizar uma outra base durante a replicao da dupla-ta de DNA, fazendo com que a mutao se xe no genoma aps dois ciclos de replicao celular, j que o mecanismo impede a ao eciente do sistema de reparo celular. O ENU gera mutaes de ponto (alm de pequenas delees e inseres) em todo o genoma. Comparativamente s outras drogas mutagnicas, como, por exemplo, clorambucil, ENU apresenta a maior taxa de mutao, da ordem de 1,5-6 x 10-3. De todas as mutaes induzidas por ENU e que foram seqenciadas, foram detectadas mutaes de sentido trocado (64%), mutaes sem sentido (10%) e erros de splicing (26%) (JUSTICE et al., 2000). Os animais tratados com ENU (geralmente machos, pois toleram bem o tratamento e geram uma grande quantidade de espermatognias mutantes) so cruzados para observao dos mutantes na prole, que sero posteriormente caracterizados fenotpica e geneticamente. Sendo o ENU um alquilante que age aleatoriamente no genoma, conseqentemente pode induzir mutaes em qualquer ponto de determinado gene, permitindo a avaliao de todo um espectro de alteraes na seqncia (BEIER, 2000). Muitos projetos buscaram recuperar alelos mutantes especcos induzidos por ENU no genoma murino. Em um deles, metade da ninhada obtida dos casais onde o macho foi tratado com ENU apresentou mutaes recessivas que segregavam de forma mendeliana (KASARKIS et al., 1998). Em outro, foi utilizado um sistema de sensibilizao da prole com injees de fenilalanina para evidenciar mutantes em genes na via

22

Modelo Animal

metablica da fenilalanina (SYMULA et al., 1997). Um terceiro projeto conseguiu com a administrao de ENU obter uma srie allica para o locus quaking (qk), essencial na mielinizao axonal e importante em processos embriognicos iniciais (COX et al, 1998). Ainda, outro projeto teve como interesse principal isolar fentipos oculares mutantes e anormalidades na viso causadas por mutaes induzidas por ENU, sendo que 25 linhagens murinas mutantes puderam ser isoladas (THAUNG et al., 2002). Dentre estas mutaes, algumas foram mapeadas em regies do genoma que no possuem genes candidatos, indicando a presena de novos genes. Projetos em larga escala tambm foram realizados por vrios laboratrios que tm como especialidade gerar mutantes. Analisando 26.000 tratados com ENU, Nolan e colaboradores (NOLAN et al., 2000) puderam isolar 500 mutaes novas envolvendo problemas nos membros, malformaes caudais e craniofaciais. Outro grupo isolou mutaes dominantes e recessivas aps anlise de 14.000 animais da prole de intercruzamentos e retrocruzamentos envolvendo animais tratados com ENU, o que possibilitou a identicao de 182 novas mutaes em diversos fentipos (de ANGELIS et al., 2000). Apenas cerca de 5% dos estimados 30.000-40.000 genes que compe o genoma murino possuem mutaes isoladas, a maioria destas sendo mutaes dirigidas por processo de recombinao homloga em clulas tronco embrionrias (PERKINS, 2002). A abordagem fenotpica que utiliza ENU como agente mutagnico aposta no isolamento de alelos mutantes de interesse e no estabelecimento de linhagens mutantes modelo para doenas humanas. Hoje, virtualmente todos os projetos de induo de mutaes com agentes qumicos utilizam preferencialmente ENU aos outros compostos (WILLIAMS, 2003). A enorme coleo de mutaes j isoladas, mapeadas e estudadas, aliada ao potencial j demonstrado do camundongo como organismo modelo, vem permitindo aos especialistas vasculhar cada detalhe gentico envolvido nos processos metablicos de vertebrados. Certamente, este maior entendimento da funo gnica vem do estudo de mutantes (Soewarto et al., 2000).

23

A MUTAO PROGRESSIVE MOTOR NEURONOPATHY (pmn)


Descrio clnica
A mutao progressive motor neuronopathy (pmn) foi observada pela primeira vez pelo pesquisador Dr. Schmalbruch, em 1988, no Instituto de Panum, em Copenhagem, numa criao de camundongos com um background gentico desconhecido (NMRI) (SCHMALBRUCH; SKOVGAARD JENSEN, 1990). Desde sua descoberta, essa mutao considerada o modelo animal de uma amiotroa espinal humana (SCHMALBRUCH et al., 1991). Essa patologia transmitida de modo autossmico recessivo. Os animais homozigotos pmn/pmn so identicados entre 15 a 18 dias aps o nascimento por meio de uma locomoo incerta e pelo comeo de uma atroa muscular dos membros posteriores e da cintura plvica. Quando levantamos os animais doentes pela cauda, estes no tm o reflexo de esticarem as patas traseiras como o fazem os animais normais (Figura 6). Aps alguns dias de evoluo da doena, os msculos das patas anteriores cam igualmente atroados e os animais morrem entre a 6 e a 7 semana de vida, provavelmente de uma paralisia respiratria (relacionada ao problema envolvendo o diafragma descrito logo em seguida) ou, em alguns casos, por desnutrio, pois so incapazes de se locomoverem at o local da rao. Quando os sinais clnicos de fraqueza muscular posterior esto claramente visveis, os animais mutantes tm um peso inferior a 40% do normal. Entretanto, nunca foi observada tremedeira ou cimbra durante a evoluo da doena.

Dados anatomopatolgicos
Msculos e nervos perifricos Os msculos dos membros posteriores dos camundongos homozigotos (pmn/pmn) com idade de cinco semanas mostram

24

A Mutao Progressive Motor Neuronopathy (pmn)

uma atroa neuronal dos grupos de bras angulares (Figura 7a). A presena de bra hipertroada rara. Os msculos dos membros anteriores desses camundongos apresentam pouqussimas bras atroadas. As junes neuromusculares esto cobertas de terminaes axonais degeneradas ou por clulas de Schawnn isoladas (Figura 7b; c). Os axnios terminais esto inchados e as vesculas das sinapses no esto presentes. O nervo citico mostra sinais de degenerao axonal (Figura 7d). Nos animais mutantes com 5 a 6 semanas de idade, o nmero de axnios mielinizados no nervo bular comum inferior a 30% com relao aos animais normais. Algumas anomalias podem ser visualizadas no nervo frnico desde a quarta semana aps o nascimento dos animais mutantes. Nesses animais, esse nervo mais no e encontrado um grande nmero de axnios degenerados (Figura 8a, b). A perda das bras no nervo frnico sugere que o diafragma tambm sofra de tal perda desde a quarta semana, o que causaria a morte dos animais por parada respiratria. Medula Espinal Nos animais mutantes, tanto a medula espinal cervical como a lombar parecem normais. O nmero e a repartio das clulas na corno ventral tambm so normais. Tambm no foi observada nenhuma degenerao acompanhada ou no de uma proliferao de clulas gliais. Durante a quinta semana de vida, uma pequena quantidade de axnios degenerados pode ser visualizada na regio supercial do funculo ventral e, no decorrer da sexta semana, quando, ento, os animais esto na fase terminal da doena, observam-se bras degeneradas no fascculo grcil e no fascculo prprio lateral e fascculo prprio dorsal. No crebro dos animais mutantes no foi observada nenhuma anomalia, exceto pelo seu peso, que 30% inferior ao peso do crebro de um animal normal.

25

A Mutao Progressive Motor Neuronopathy (pmn)

Resumidamente, podemos dizer que essa doena, primeiramente, apresenta uma fraqueza muscular dos membros posteriores e da cintura plvica; o dcit do nmero de bras no nervo bular comum chega a 30% na quinta semana. Entretanto, desde a quarta semana, pode-se notar uma anomalia no nervo frnico, provavelmente devida a sua desmielinizao (perda de 69% em mdia de bras). Essa degenerao provavelmente a causadora da morte dos animais, pois pode levar a uma insucincia respiratria. No foi observada nenhuma diminuio no nmero de bras nas razes nervosas ventrais, nem no nmero de neurnios motores. Nenhuma vacuolizao do corpo celular dos neurnios motores foi observada. Em contrapartida, foi observada uma cromatlise das clulas da corno ventral por microscopia eletrnica. A grande bra dessa regio da medula espinal tem um tamanho inferior ao normal, pois est desconectada dos neurnios motores e seus alvos. A conservao na quantidade de corpos celulares na crnea anterior sugere que a doena pmn causada por um processo de morte retrgrada, em que os problemas se iniciam nas terminaes nervosas e progridem ao longo do axnio em direo ao corpo celular, sem jamais atingir esse ltimo, pois, talvez, os animais morram antes. Essa mutao foi utilizada para testar a ecincia de algumas tentativas de terapia gnica. A administrao do CNTF (ciliary neorotrophic factor), sintetizado por broblastos geneticamente modicados e transplantados no incio da doena, diminui a velocidade da evoluo da enfermidade, mas no chega a par-la completamente (SAGOT et al., 1995b; SENDTNER et al., 1992). A superexpresso do proto-oncgeno Bcl-2 nos animais doentes no altera a evoluo da doena nem sua gravidade; ela no impede a degenerao axonal, mas reduz a perda neuronal no ncleo facial (SAGOT et al., 1995b). A administrao de um fator neurotrco como o GDNF produz efeitos similares ao Bcl-2 (SAGOT et al., 1996). Esses resultados tendem a provar que, nessa mutao, o processo patolgico no um problema primrio no corpo celular. A mutao levaria a

26

A Mutao Progressive Motor Neuronopathy (pmn)

uma neuropatia, e no a uma axonopatia. Alm disso, os estudos mostram que (1) os mecanismos que levam a uma axonopatia so independentes daqueles que causam uma neuropatia; (2) os fatores neurotrcos agem de forma diferente uns dos outros.

27

O PRINCPIO GERAL DA CLONAGEM POSICIONAL


A estratgia da clonagem posicional (COLLINS, 1992), tambm chamada gentica inversa ou reversa (RUDDLE, 1984; ORKIN, 1986), consiste em se isolar um gene identicado unicamente por um fentipo mutante por meio da identicao do menor fragmento de DNA que o contenha e, em seguida, identicarem-se, nesse fragmento, suas seqncias codicadoras. Para essa estratgia, a priori, no se faz necessrio um conhecimento prvio do produto do gene procurado nem do tecido em que ele seja expresso. Entretanto, ca claro que, quanto menos informaes tivermos do gene procurado, mais a tarefa da clonagem promete ser difcil e longa. A clonagem posicional foi utilizada pela primeira vez por Bender e seus colaboradores para isolar o complexo bithorax de drosla (1983). Em 1995, j possuamos 65 genes humanos (COLLINS, 1995) e cerca de 30 genes murinos foram isolados por meio dessa estratgia. Entre os inmeros sucessos podemos citar, no homem, a clonagem do gene responsvel pela doena chamada Distroa Muscular de Duchenne, que codica a protena distrona (MONACO et al., 1986), a clonagem do gene responsvel pela Coria de Huntington (THE HUNTINGTONS DISEASE COLLABORATIVE RESEARCH GROUP, 1994), a clonagem do gene de susceptibilidade ao cncer de seio (BCRAI, MIKI et al., 1994), a do gene responsvel pelos trs tipos de amiotroa espinal humana (LEFEBVRE et al., 1995) e, enm, a clonagem de uma helicase responsvel pela Sndrome de Werner (YU et al., 1996), para a qual foi preciso seqenciarem-se mais de 650.000 pares de bases e testarem-se inmeros genes candidatos para se chegar ao gene responsvel. Nos camundongos, a clonagem mais sensacional foi a do gene responsvel pela mutao obese (ob) (Figura 9), que se tornou um modelo da obesidade humana de carter autossmico recessivo (ZHANG et al., 1994). Outros sucessos foram registrados, como o gene shaker-1 (sh1) (GILSON et al., 1995) e beige (bg) (BARBOSA et al., 1996), o qual se revelou um modelo da doena de Chediak-Higashi humana.

28

O Princpio Geral da Clonagem Posicional

A clonagem posicional de um gene acontece em trs etapas. Em um primeiro momento, efetuamos o mapeamento gentico da mutao estudada, ou seja, localizamos o cromossomo que carrega o lcus responsvel pela mutao. Para tanto, na grande maioria das vezes, precisamos efetuar cruzamentos especiais para alcanarmos tal objetivo. Esse cruzamento envolve a linhagem na qual a mutao apareceu e uma outra, a m de mobilizarmos um alto grau de polimorsmo, essencial ao trabalho de mapeamento. Nessa fase, tentamos encontrar os dois marcadores mais prximos do lcus mrbido e calculamos a distncia gentica (centiMorgan, cM) que os separa. Desde que tenhamos conseguido restringir ao mximo o intervalo gentico que contenha a mutao, comeamos, ento, o que chamamos marcha sobre o cromossomo. Nessa etapa, ns iremos construir o mapa fsico da regio cromossmica estudada. Para tanto, fragmentos de DNA clonados so alinhados uns aps os outros, formando o que chamamos de um contig da regio. A caracterizao desse contig dene a construo do mapa fsico, em que as distncias entre os marcadores sero medidas em pares de bases de nucleotdeos. As extremidades do contig correspondem aos dois marcadores que englobam o lcus da mutao, denido pelo estabelecimento do mapa gentico concludo na primeira etapa do trabalho de clonagem posicional. Enm, passamos fase de recuperao das seqncias codicadoras contidas no DNA do contig. Essas seqncias so, em seguida, caracterizadas para que possamos denir o perl de um gene que ser, ento, nosso gene candidato. Ateno, aqui estamos isolando a cpia normal do gene responsvel pela mutao, o que diferente da fase de mapeamento, quando, ento, localizamos a verso mutante do gene. As etapas da clonagem posicional esto ilustradas na Figura 10 e sero detalhadas a seguir.

29

O Princpio Geral da Clonagem Posicional

O mapeamento gentico
O objetivo do mapeamento gentico denir a ordem linear dos genes sobre os cromossomos e denir as distncias que os separam. O mapa gentico que deve ser estabelecido na primeira fase da clonagem posicional construdo atravs da procura de ligao entre o lcus mutante e marcadores genticos vizinhos previamente localizados sobre os cromossomos. Para tanto, identicamos primeiramente o cromossomo que porta a mutao e, em seguida, devemos anar esse mapeamento. Nessa fase do trabalho, a descoberta de alguma anomalia citogentica (translocao, deleo) associada doena pode facilitar, e muito, o desenrolar da clonagem. O mapeamento da mutao sobre um cromossomo particular O primeiro passo para o mapeamento da mutao , como j foi mencionado anteriormente, identicar o cromossomo que a contenha. Atualmente, os cruzamentos realizados nos laboratrios so altamente polimrcos e os marcadores utilizados so, na maior parte das vezes, moleculares. Essa primeira etapa , ento, confundida com a segunda, a qual consiste em gerar um mapa gentico de alta resoluo em torno do lcus mutante localizado. Na poca em que os marcadores utilizados no mapeamento eram, eles mesmos, mutaes identicveis unicamente por um fentipo anormal, muitas vezes inviveis ou infrteis, precisvamos realizar inmeros cruzamentos e gerar um enorme nmero de animais para conseguirmos, s vezes, identicar um possvel cromossomo interessante. Dois tipos de cruzamento so geralmente realizados nessa primeira etapa (GREEN, 1995): o retrocruzamento e o intercruzamento. Os princpios desses dois cruzamentos esto ilustrados na Figura 11. Se considerarmos vrios marcadores quaisquer a, b, c, d, ... , j localizados sobre o mapa gentico dos camundongos, e m, o alelo mutante a ser localizado, o tipo de cruzamento a ser

30

O Princpio Geral da Clonagem Posicional

estabelecido , quase sempre, imposto por razes prticas. Em geral, cruzamos uma linhagem de camundongo homozigota para os marcadores polimrcos com a linhagem em que a mutao m est sendo mantida. Caso a mutao seja compatvel com a fertilidade, ao menos em um dos dois sexos, ns utilizamos um animal homozigoto m/m para produzir a gerao F1, depois a F2, cruzando-se os F1 entre si. No caso em que os animais homozigotos mutantes forem incompatveis com a reproduo, o que acontece na maior parte do tempo, o procedimento um pouco mais complicado: precisamos cruzar os animais heterozigotos portadores do alelo mutante +/m com a linhagem de camundongo homozigota (aquela que porta os marcadores moleculares a, b, c, d, ..., no estado homozigoto) e, em seguida, recruzar os animais F1 entre si at que o fentipo mutante reaparea na gerao F2 (animais homozigoto m/m). Evidentemente, para esse caso, no qual no podemos contar com os animais homozigotos, muitos cruzamentos sero realizados sem interesse cientco, pois iro associar, aleatoriamente, um parceiro +/m com um outro +/+ e mesmo dois parceiros +/+. Enm, o DNA dos animais F2 mutantes extrado e tipado para os marcadores moleculares repartidos sobre todos os cromossomos. Com os mtodos modernos disponveis para o mapeamento como, por exemplo, a reao em cadeia da polimerase (PCR), so necessrias apenas algumas semanas para tipar mais de 50 marcadores moleculares distribudos de forma homognea por todo o genoma animal. A descoberta de uma ligao ca evidenciada quando um ou mais marcadores se encontram constantemente, ou muito freqentemente, associados mesma fase (em unio ou em repulsa) do fentipo mutante. Isso quer dizer que o marcador tipado pela PCR e o alelo mutante m fazem parte do mesmo hapltipo. A construo de um mapa gentico de alta densidade e de alta resoluo ao redor do gene mutado O objetivo dessa segunda parte do mapeamento gentico do gene de interesse determinar os dois marcadores mais

31

O Princpio Geral da Clonagem Posicional

prximos do lcus da doena e que o enquadrem no menor intervalo cromossmico possvel para podermos ter a certeza de que o encurralamos. O tamanho do intervalo a ser determinado depende da quantidade de marcadores polimrcos disponveis na regio. A preciso com a qual essa dimenso apreciada depende do nmero de meioses analisadas. indispensvel a elaborao, no incio do trabalho, de um cruzamento altamente polimrco e a anlise de um grande nmero de meioses (vrias centenas), se quisermos estabelecer o mapeamento com preciso. A Figura 12 mostra como proceder para identicar os animais, ditos informativos, no caso de um retrocruzamento, atravs da genotipagem com dois marcadores que enquadram o intervalo gentico crtico que contm o lcus mutado. Desde que nenhum evento de recombinao tenha sido observado em n meioses analisadas, podemos calcular que o limite superior do intervalo de conana r da distncia entre dois marcadores, com o risco de primeira espcie p, dado pela frmula:

r=1n p

com: p: rico de primeira espcie n: nmero de meioses r: distncia entre os marcadores Dessa forma, podemos calcular que, para 1.000 meioses analisadas, o fato de no obtermos recombinantes entre dois marcadores indica que a distncia gentica que os separa inferior a 0,3 cM, com um risco de 5%. Esta distncia de 0,3 cM corresponde a, aproximadamente, 600 kb de DNA dos camundongos1. As linhagens de camundongos utilizadas nos cruzamentos devem ser escolhidas de forma adequada a m de se obter um bom compromisso entre o grau de polimorsmo e a taxa de reproduo. Os cruzamentos intraespeccos, feitos entre as

32

O Princpio Geral da Clonagem Posicional

linhagens isognicas tradicionais, as quais foram derivadas de uma mesma espcie selvagem Mus musculus domesticus, so fceis de serem realizados; entretanto, o grau de polimorsmo mobilizado relativamente baixo e, na maior parte das vezes, no permite o estabelecimento de um mapa gentico denso. Bonhomme e Gunet (1979 e 1982) (Figura 13) foram os primeiros que contornaram essa situao ao mostrarem que poderamos estabelecer cruzamentos entre camundongos de espcies diferentes como, por exemplo, espcies Mus musculus domesticus (linhagem de laboratrio) e Mus spretus (linhagem selvagem). Com esse tipo de cruzamento, muito embora envolva espcies diferentes, possvel a obteno de hbridos viveis nas condies de laboratrio. Dada a divergncia evolutiva que as separa, o grau de polimorsmo mobilizado alto e facilmente identicvel (GUNET; BONHOMME, 2003)2. Entretanto, os cruzamentos implicando a espcie Mus spretus tm dois inconvenientes: o primeiro diz respeito ao fato de os animais F1 s poderem ser obtidos atravs do pai selvagem Mus spretus, pois o cruzamento recproco muito difcil de ser realizado. O segundo inconveniente refere-se ao fato de os animais machos F1 serem estreis (efeito Haldane).

1. De acordo com as estimativas mais recentes, o mapa gentico dos camundongos tem 1600 cM e seu genoma contm, como no homem, 3 X 10 9 pares de bases. Ns consideramos que, em mdia, 1 cM equivale a 1,8 Mb. Essa extrapolao deve ser vista com muito cuidado, pois, embora o evento de recombinao seja definido como um fenmeno aleatrio, ele no ocorre de maneira homognea por todo o genoma. Desde que a recombinao ocorra com uma alta freqncia numa determinada regio genmica, nessa regio as distncias genticas so maiores que as distncias fsicas. Essa situao favorvel na clonagem posicional. No caso contrrio, a situao muito mais complexa. Devemos notar que o homem recombina duas vezes mais que o camundongo, e seu mapa gentico tem 2100 cM. 2. Experimentos de seqenciamento mostraram que, em mdia, uma base a cada 30 eram diferentes entre animais da linhagem C57BL/6, derivada principalmente da espcie Mus musculus domesticus, e animais SEG, derivados da espcie Mus spretus. Tal densidade polimrfica permite, teoricamente, a realizao de mapas genticos muito densos.

33

O Princpio Geral da Clonagem Posicional

As vantagens desses cruzamentos intraespeccos e interespeccos podem ser acumuladas utilizando-se linhagens consmicas nas quais um nico cromossomo do tipo Mus spretus. Nesse caso, podemos obter resultados muito prximos aos dos cruzamentos interespeccos, eliminando as diculdades de reproduo e conservando o alto grau de polimorsmo (FLETCHER et al., 1991). Quando um cruzamento for estabelecido para o mapeamento de uma mutao, importante que possamos identicar, sem nenhuma ambigidade, os animais homozigotos mutantes na descendncia. Isso, infelizmente, nem sempre o caso. Freqentemente, uma mutao pode ter efeitos variveis em gravidade ao passo que os animais de gentipo mutante podem ter caractersticas de animais de fentipo normal (penetrncia incompleta) ou nveis variados de expresso da patologia (expressividade varivel). Nesse caso, devemos considerar unicamente os animais cujo fentipo tenha sido estabelecido com segurana para serem utilizados no mapeamento; entretanto, o clculo da distncia gentica ca comprometido. O clculo das distncias genticas, baseado na identicao de gentipos recombinantes, necessita do reconhecimento da origem de cada um dos alelos do marcador testado nos animais N2 (backcross) ou F2 (intercross). Sabemos tambm que essa identicao s possvel se existir um polimorsmo entre as duas linhagens utilizadas no cruzamento inicial. Os primeiros polimorsmos moleculares identicados foram os polimorsmos de comprimento de fragmentos de restrio ou RFLP (Restriction Fragment Length Polymorphism; BOSTEIN et al., 1980). Os RFLP so causados pela variao na seqncia de DNA, de forma que um stio de restrio, talvez ausente numa linhagem de camundongo, esteja presente numa outra. Quando da anlise por Southern, uma sonda molecular do gene analisado revela fragmentos de tamanhos diferentes nas

34

O Princpio Geral da Clonagem Posicional

duas linhagens, identicando, assim, a origem de cada um dos dois alelos (Figura 14). Os microssatlites ou seqncias simples repetitivas (LOVE et al., 1990) correspondem a seqncias repetidas (de 10 a 40 vezes) de di, tri ou tetra nucleotdeos, sendo a seqncia mais freqente a do tipo CA. Existem muitos microssatlites, relativamente estveis e distribudos aleatoriamente ao longo de todo o genoma humano e de camundongos (cada um conta com mais de 100.000 microssatlites), exceo feita ao cromossomo X, no qual encontramos um nmero pequeno desse tipo de seqncia (DIETRICH et al., 1994). Os microssatlites so muito polimrcos entre uma espcie e outra pelo seu motivo repetido em tandem. A abundncia, a estabilidade e a repartio desses microssatlites fazem deles uma excelente ferramenta no mapeamento gentico: as diferenas de comprimento do nmero de repeties so facilmente evidenciadas pela reao em cadeia da polimerase (PCR), atravs de iniciadores correspondentes s seqncias que flanqueiam os microssatlites (Figura 15). O grupo de Lander (Whitehead/MIT) construiu um mapa gentico de camundongos unicamente com os microssatlites do tipo (CA)n repartidos sobre a totalidade de cromossomos murino. Em junho de 1994, mais de 4.000 microssatlites j tinham sido mapeados com uma resoluo de um marcador a cada 0,35 cM (DIETRICH et al., 1992, DIETRICH et al., 1994). Hoje mais de 13.000 marcadores esto disponveis com uma resoluo de 0,1 cM, ou seja, um marcador a cada 560 Kb. Mais de 1.200 RFLP inicialmente mapeados foram integrados a esse mapa, que pode ser acessado no endereo eletrnico www. genome.wi.mit.edu/cgi-bin/mouse/index. Os minissatlites (JEFFREYS et al., 1985) ou VNTR (nmero varivel de repeties em tandem) so formados a partir de um grande nmero de repeties de uma seqncia de aproximadamente 50pb, que so marcadores igualmente polimrcos e distribudos de forma aleatria por todo o genoma. Como so muito grandes para serem amplicados pela PCR, so muito pouco utilizados.

35

O Princpio Geral da Clonagem Posicional

Em 1995, McCarthy e seus colaboradores identicaram e mapearam mais de 450 novos marcadores polimrcos, os quais foram isolados pela amplicao (PCR) das seqncias nicas compreendidas entre as seqncias longas repetitivas (LINE) ou seqncias curtas repetitivas (SINE) do genoma animal. Esses marcadores so diferentes dos microssatlites e RFLP e, dessa forma, completaram o mapa gentico estabelecido por Lander. A tcnica de anlise pela SSCP (polimorsmo de conformao de DNA de ta simples) (ORITA et al., 1989) permite a deteco de diferenas acontecendo em uma nica base nas duas tas de DNA. Essa tcnica detecta 70 a 90% de mutaes nos fragmentos de DNA de 200pb ou mais. A sensibilidade de tal mtodo diminui com o aumento do tamanho do produto a ser analisado. Essa estratgia, ilustrada na Figura 16, muito til na deteco de polimorsmos ou de mutaes pontuais entre um DNA mutante e um normal. Para a gentica de camundongos existem mapas genticos de referncia, que so regularmente atualizados e publicados nas revistas cientcas Mammalian Genome e Mouse Genome, bem como bases de dados acessveis via Internet: MGD (Mouse Genome Database) www.informatics.jax.org. Todos os genes ou marcadores localizados no mapa gentico podem ser utilizados como fonte de marcadores polimrcos. O estabelecimento de uma ligao gentica para uma dada mutao permite, muitas vezes, prever sua localizao no mapa gentico da espcie humana. Para tanto, s precisamos consultar os mapas de homologia de sintenia j estabelecidos e publicados (PETERS and SEARLE, 1996). Falamos de conservao ou de homologia de sintenia quando dois (ou mais) pares de marcadores homlogos esto presentes num mesmo segmento cromossmico em duas (ou mais) espcies diferentes. Por exemplo, a comparao dos mapas genticos humano e murino indica que vrios genes localizados sobre o cromossomo 13 de camundongos se encontram nos cromossomos 1, 3, 5, 6, 7, 9, ou 10 humanos. Caso a ordem de posio dos marcadores

36

O Princpio Geral da Clonagem Posicional

tambm seja conservada, haver, ento, sintenia (Figura 17).

conservao de

Quando uma ligao for estabelecida numa regio pobre em marcadores podemos obter outros marcadores por meio da tcnica de microdisseco do DNA da regio localizada, amplic-la pela PCR com a ajuda de oligonucleotdeos degenerados e, em seguida, clonar os produtos amplicados (SCALENGHE et al., 1981, LUDECKE et al., 1990, TELENIUS et al., 1992). A microdisseco foi utilizada para os camundongos, na produo de novas sondas da regio do complexo T/t do cromossomo 17 (ROHME et al., 1984). Antes de concluirmos a seo que concerne ao estabelecimento de um mapa gentico de alta densidade na vizinhana do gene que desejamos clonar, temos de falar de um ponto importante relativo ao princpio do estabelecimento dos mapas genticos, os quais so graduados em unidade de recombinao, ou seja, em centiMorgan (cM). Sabemos, entretanto, que no existe nenhuma relao linear entre a freqncia de recombinao, que nos indica a distncia gentica, e a distncia fsica real entre os marcadores, a qual estabelecida em pares de base. Em alguns casos, a freqncia de recombinao alta e a distncia gentica equivale a uma distncia fsica pequena. Em outros casos, a recombinao rara e a distncia gentica corresponde a uma grande distncia fsica. Geralmente, a freqncia de recombinao depende do sexo no qual a meiose ocorreu (no caso dos camundongos, na maior parte das vezes, estamos analisando a meiose do sexo masculino) e, de qualquer maneira, ela no a mesma de um segmento cromossmico a outro. Temos que saber igualmente que rearranjos estruturais dos cromossomos (delees, translocaes, inverses, etc) modicam consideravelmente a freqncia de recombinao (HERMANN et al., 1987). Um mapa gentico de alta densidade estabelecido numa regio de alta freqncia de recombinao simplicar muito a tarefa da clonagem posicional. De forma inversa, a co-segregao de um marcador com o lcus do gene a ser clonado no

37

O Princpio Geral da Clonagem Posicional

necessariamente um sinal de que haja uma grande proximidade fsica. Microssatlites X SNPs (Single Nucleotide Polymorphisms) A introduo dos marcadores microssatlites no incio dos anos 90 possibilitou aumentar dramaticamente a ecincia dos estudos genticos. O mapeamento alta resoluo passou a ser uma realidade. O mapeamento gentico de microssatlites, baseado na diferena (polimorsmo) do nmero de unidades de repetio encontrada nas linhagens de camundongos, facilmente realizado atravs da tcnica da reao em cadeia da polimerase (PCR). Mais de 6000 microssatlites so comumente usados no mapeamento gentico em camundongos. Estima-se que os tamanhos gentico e fsico do genoma dos camundongos sejam, respectivamente, 1500 cM e 3000 Mb (3X109 pb). Assim, o espao mdio entre os microssatlites pode ser availado em 0,25 cM ou 500 Kb. Isto um clculo aproximado, visto que, as distncias genticas nem sempre refletem as distncias fsicas, pois sabemos que determinadas regies do genoma sofrem um maior nmero de eventos de recombinao que outras. De qualquer forma, o mapeamento atravs dos microssatlites pode oferecer uma considervel resoluo, porm no necessariamente a exigida para a clonagem posicional. Deve se lembrado que, embora tenhamos 6000 microssatlites disponveis, nem todos so polimrcos entre todas as linhagens de camundongo. Assim, existe a necessiadade de outros tipos de marcadores polimrcos que possam auxiliar no mapeamento alta resoluo. Com o sequenciamento de vrios genomas, um novo tipo de marcador molecular fez sua apario, os SNPs (Single Nucleotide Polymorphisms, para polimorsmo de nucleotdeo nico. Como o nome indica, um SNP envolve a mudana em um nico nucleotdeo. Geralmente uma substituio, mas tambm pode ser uma deleo ou insero. J foram identicados mais de 4 milhes de SNPs no genoma humano e eles esto distribudos pelo genoma, fornecendo marcadores extremamente teis para o mapeamento alta resoluo e tambm para os estudos de

38

O Princpio Geral da Clonagem Posicional

associao procura de loci que conferem susceptibilidade a doenas comuns. Para o genoma murino o nmero de SNPs disponveis ainda bem modesto, um pouco mais de 3000 no banco de dados do MIT, porm o potencial da existncia de SNPs entre as linhagens isognicas enorme. Como o sequenciamento de diversas linhagens de camundongo est sendo realizado, hoje j temos os dados de 15 delas, podemos armar que a situao desses marcadores vai melhorar e muito. A previso para breve da disponibilidade de 1 milho de SNPs distribudos ao longo de todo o genoma murino, o que signica uma densidade de 1 SNP a cada 3 Kb. Podemos, desta forma, prever que esses marcadores iro substituir os microssatlites num futuro bem prximo.

O mapeamento fsico
Quando dois marcadores genticos muito prximos do gene de interesse foram isolados, o segmento de DNA situado entre esses dois marcadores, no qual o gene em questo dever estar contido, dever, ento, ser isolado sicamente. Para tanto, as tcnicas de clonagem clssicas que se servem de plasmdios, fagos lambda ou cosmdios no so adequadas. Na realidade, tais tcnicas s permitem a manipulao de pequenos fragmentos de DNA, algumas dezenas de Kb no mximo. Se considerarmos que o intervalo gentico denido na etapa anterior da ordem de 1cM, ou seja, por volta de 1.700pb nos camundongos, no podemos ter a certeza, a priori, de que os stios de clonagem esto repartidos de tal maneira que faam com que todo DNA contido no segmento possa ser clonado. O que vimos que a clonagem posicional s pde progredir denitivamente aps a construo de ferramentas adequadas e que, sem a eletroforese em campo pulsado, sem o desenvolvimento dos cromossomos articiais de levedura (YAC) e sem a descoberta dos marcadores microssatlites, essa estratgia de clonagem no teria conhecido o sucesso de que desfruta hoje em dia.

39

O Princpio Geral da Clonagem Posicional

A eletroforese em campo pulsado A eletroforese em agarose ou em poliacrilamida clssica permite a separao de fragmentos de DNA graas ao papel das malhas que formam o gel. Sob a ao do campo eltrico, algumas molculas de DNA migram entre todos os poros, enquanto que outras molculas maiores no podem migrar entre alguns dos poros e vo levar um tempo maior para percorrer o mesmo percurso. As grandes molculas de DNA (de mais de 20Kb) so maiores que todos os poros de resoluo do gel. Sob a ao do campo eltrico, essas molculas sofrem uma modicao estrutural de maneira a migrar em bloco nos interstcios maiores. Esses fragmentos migram todos na mesma velocidade, independentemente do tamanho, e no existe mais separao alguma. A eletroforese em campo pulsado resolveu esse problema por meio da modicao peridica da orientao do campo eltrico. A molcula deve mudar sua conformao e se reorientar paralelamente ao campo. Para esquematizar, podemos dizer que uma molcula de DNA muito longa (1.000Kb) precisa de muito tempo para se reorientar e ela tem pouco tempo para migrar, enquanto que uma molcula menor (100Kb) necessita de pouco tempo para se reorientar e consagra a maior parte do seu tempo a migrar. Trs sistemas so utilizados: OFAGE (Orthogonal-Field Alternating Gel Eletrophoresis) (SCHUWARTZ; CANTOR, 1984): nesse caso os eletrodos esto orientados a 90 e geram dois campos eltricos alternados e no homogneos; CHEF (Contour Clamped Homogenous Field) (CHU et al., 1986): o sistema mais utilizado. Nele, os eletrodos esto arrumados regularmente ao longo de um circuito em forma de um hexgono. O campo eltrico uniforme para todo o gel, mas a orientao periodicamente modicada de 120. Esse sistema foi utilizado neste trabalho; FIGE (Field Inversion Gel Eletrophoresis) (CARLE et al., 1986): neste caso, o campo eltrico uniforme e invertido de 180.

40

O Princpio Geral da Clonagem Posicional

Uma descrio mais detalhada da eletroforese em campo pulsado pode ser obtida no artigo Towards a molecular description of pulse-eld gel electrophoresis, de Bustamante e outros, publicado em 1993. Os PAC, YAC e BAC Os cosmdios permitem a clonagem de segmentos de DNA de at 40Kb. O bacterifago P1, aliado ecincia de infeco dos bacterifagos e simplicidade de manipulao dos plasmdios, pode conter inseres de at 100Kb (STERNBERG, 1990). Um enorme avano para o mapeamento fsico foi a descoberta de que grandes fragmentos de DNA de at 2.000Kb poderiam ser propagados sob a forma de cromossomos articiais de levedura ou YAC (BURKE et al., 1987). O princpio da clonagem est ilustrado na Figura 18. Os YAC permitem, alm da clonagem de grandes fragmentos de DNA, a de fragmentos de DNA os quais no tinha sido possvel isolar de E. coli. Por exemplo, as regies de DNA do cromossomo 7 humano que no puderam ser clonadas em E. coli (ROMMENS et al., 1989) foram facilmente clonadas sob a forma de cromossomo articial de levedura em Saccharomyces cerevisiae (GREEN; OLSON, 1990). Infelizmente, os YAC apresentam um alto grau de quimerismo (de at 60% em alguns casos), resultante da maneira como so realizadas as clonagens. Eles so igualmente instveis e de manipulao relativamente difcil. O quimerismo caracterizado pela presena, num mesmo YAC, de segmentos de DNA provenientes de cromossomos diferentes, resultado de uma co-ligao no momento da construo da biblioteca ou da recombinao dos clones nas etapas posteriores (GREEN et al., 1990). Alguns YAC so instveis e tambm podem deletar fragmentos de seus insertos, mas essa instabilidade pode ser reduzida no momento da construo da biblioteca pela escolha de uma linhagem de levedura deciente em gene de recombinao (CHARTIER et al., 1992). A manipulao dos YAC sempre necessita do recurso

41

O Princpio Geral da Clonagem Posicional

da eletroforese em campo pulsado e difcil consegui-lo na sua forma pura, desprovida do DNA de levedura. Os BAC (Bacterial Articial Chromosomes; SHIZUYA et al., 1992) (Figura 19) permitem a clonagem de fragmentos que podem chegar at 350kb. Os fragmentos so propagados na bactria E. coli, dentro de um vetor de clonagem derivado do fator F. O vetor est presente em pequeno nmero de cpias nas clulas hospedeiras, o que de certa forma confere uma relativa estabilidade aos insertos. Na realidade, a porcentagem de clones quimricos no ultrapassa 5%. Podemos armar que esse sistema uma alternativa interessante ao do YAC, para aplicaes que requerem a clonagem de grandes fragmentos de DNA. Vrias bibliotecas de PAC, YAC e BAC humanas e dos camundongos esto atualmente disponveis comercialmente. Os clones de interesse podem ser isolados dessas bibliotecas por meio da PCR e hibridizao atravs dos marcadores moleculares utilizados no mapeamento gentico. Salto e caminhada sobre o cromossomo: chromosome jumping e chromosome walking O jumping, ou salto sobre o cromossomo (COLLINS; WEISSMAN, 1984, POUTSKA; LEHRACH, 1986), consiste na obteno da justaposio, dentro de um mesmo clone, de duas seqncias de DNA situadas nas extremidades de um grande fragmento de restrio. O princpio dessa tcnica est apresentado na Figura 20. Essa tcnica, que pouco utilizada depois do desenvolvimento dos cromossomos articiais de levedura, permite efetuar vrias centenas de Kb. O walking, ou a marcha sobre o cromossomo, consiste em construir um conjunto de clones contnuos, ou contig. As extremidades do primeiro clone so utilizadas para isolar o clone seguinte, e assim por diante (Figura 21). A marcha sobre o cromossomo foi aplicada pela primeira vez por Steinmetz (STEINMETZ et al., 1982), que clonou um grande fragmento de

42

O Princpio Geral da Clonagem Posicional

DNA na regio do complexo major de histocompatibilidade na forma de cosmdios superpostos. Quando no temos informaes sucientes, preciso, ento, marchar nas duas direes, a partir do primeiro clone isolado, at encontrarmos uma informao (recombinao ou rearranjo cromossmico), permitindo, assim, saber se o gene de interesse foi alcanado ou no. O desenvolvimento do YAC permite a construo de contigs que se estendem por grandes regies. Por exemplo: um contig de 8Mb foi reunido na regio Xq24-q28 do cromossomo X humano (LiITTLE et al., 1992). Um outro foi construdo e cobre a totalidade da regio 21q humana (CHUMAKOV et al., 1992). Em 1995, Lander e sua equipe no MIT comearam a construo de contigs de YAC que cobririam integralmente o genoma de camundongos (DIETRICH et al., 1995). Esse mapa fsico, bem como o realizado com o BAC, est disponvel no endereo eletrnico www.genome.wi.mit.edu/cgi-bin/mouse/index. Quando o mapa gentico sucientemente denso, ns podemos, ao menos em teoria, utilizar os marcadores que flanqueiam o gene que desejamos clonar para isolar os clones de YAC e tentar organizar um contig da regio. Fica claro que, nessa etapa do trabalho, temos todo interesse em isolar o maior nmero possvel de YAC e, se possvel, a partir de bibliotecas diferentes, garantir uma melhor cobertura da regio.

Isolamento das seqncias codificadoras


A identicao das seqncias codicadoras contidas no DNA do contig constitui uma das principais diculdades da clonagem posicional. As seqncias codicadoras representam apenas uma pequena frao da totalidade do genoma: 5 a 10%. Alm disso, as seqncias codicadoras esto dispersas e separadas por ntrons de tamanhos variveis. Um exemplo extremo disso , sem dvida, o da distrona que se estende sobre 2,3Mb com um RNA mensageiro de 14Kb compreendido dentro de 79 xons (ROBERTS et al., 1992). Vrios mtodos foram desenvolvidos todos possuem vantagens e desvantagens, nenhum totalmente ecaz e, na prtica, convm realizar uma

43

O Princpio Geral da Clonagem Posicional

combinao de alguns deles para se obter o gene procurado (BRENNAN; HOCHGESCHWENDER, 1995). Conservao ao longo da evoluo: Zooblots A tcnica do zooblot (MONACO et al., 1986) consiste em hibridizar um fragmento do DNA candidato ao DNA de diferentes espcies por meio da tcnica de Southern blot. Se no DNA candidato existem seqncias codicadoras, podemos observar, quase sempre, uma reao cruzada entre as diferentes espcies representadas no zooblot. Tal fato pode ser explicado, pois a seqncia dos xons diverge muito menos que as seqncias dos ntrons ao longo da evoluo. Essa tcnica no permite isolar seqncias codicadoras, mas pode ser usada para se saber se o DNA que estamos analisando possui ou no tais seqncias. Esse DNA pode ser utilizado, em seguida, no isolamento de mais seqncias a partir de uma biblioteca de cDNA ou mesmo servir de ingrediente para outras tcnicas. A anlise em zooblot de cosmdios inteiros teve um papel importantssimo no gene que causa a brose cstica humana (ROMMENS et al., 1989) e no gene da obesidade nos camundongos (ZHANG et al., 1994). A anlise de Northern blot A hibridizao das seqncias candidatas com os RNA mensageiros sobre um ltro permite determinar o tamanho do mensageiro procurado. As sondas moleculares utilizadas na hibridizao podem ser cDNA, xons, mas tambm os cosmdios (ZHANG et al., 1992) ou mesmo os YAC inteiros (MARSHALL et al., 1993). Nesse ltimo caso, podemos determinar o nmero de mensageiros presentes na regio cromossmica estudada e o tamanho deles. Tais mensageiros podem ser provenientes de vrios genes diferentes ou corresponderem a um nico. A deteco de vrios mensageiros codicados por um mesmo gene pode ter-se originado do fenmeno chamado recomposio alternativa (splicing alternativo), dos stios de poliadenilao diferentes ou mesmo da utilizao de diferentes promotores. A tcnica apresenta baixa sensibilidade, pois muito dependente

44

O Princpio Geral da Clonagem Posicional

do grau de expresso gnica. Entretanto, a utilizao de RNA poliadenilado, enriquecido em RNA mensageiros, permite o aumento da sensibilidade. A amplificao de xons ou Exon trapping A tcnica de amplicao de xons foi proposta por Duyk em 1990 e Buckler em 1991. Ela foi aplicada com sucesso em vrios casos, por exemplo, no isolamento dos genes shaker-1 (GIBSON et al., 1995) e Bcg (VIDAL et al., 1993) nos camundongos e do gene responsvel pela Coria de Huntington humana (The Huntingtons Disease Collaborative Research Group, 1994). Essa tcnica permite isolar xons presentes nos fragmentos de DNA genmico clonados (cosmdio, YAC, BAC) graas presena do stio doador e aceptor de splicing funcionais. O princpio do exon trapping est ilustrado na Figura 22. A amplicao dos xons independente do nvel de expresso dos genes procurados ou do tecido no qual eles so expressos, uma vez que trabalhamos unicamente com material genmico. A tcnica relativamente eciente se no contarmos com o problema do splicing crptico (splicing de seqncias reconhecidas como xons, mas que, na realidade, no o so). Os genes que no possuem xons, raros nos eucariotos, no podero ser isolados via tal mtodo. Podemos citar o exemplo do gene SRY, que possui um nico xon (GOODFELLOW; LOVELL-BADGE, 1993). Caso as seqncias isoladas no dem resultados quando da hibridizao em Northern blot, uma RT-PCR baseada na reao de transcrio inversa do RNA, seguida de uma amplicao com oligonucleotdeos especcos para cada uma das seqncias estudadas, permite vericar se estas so ou no verdadeiros xons (KAWASAKI, 1990). A captura do DNA por afinidade ou DNA affinity capture ou DNA selection Tcnica desenvolvida por Lovett e Parimoo em 1991 e, em seguida, adaptada por em Tagle 1993, permite isolar

45

O Princpio Geral da Clonagem Posicional

os cDNA codicados por grandes fragmentos de DNA tais como os YAC, cosmdios, BAC ou fagos. O mtodo consiste na hibridizao do DNA genmico biotinilado (YAC, etc) com os cDNA em soluo. Em seguida, capturam-se os complexos DNA genmico-cDNA com a ajuda de bilhas magnticas cobertas de estreptovidina (Figura 23). Construmos, assim, uma biblioteca de cDNA enriquecida de seqncias codicadoras provenientes do YAC ou cosmdio utilizado no incio. O enriquecimento pode ser aumentado em at 100.000 vezes, efetuando-se vrias rodadas sucessivas de seleo. O sucesso dessa estratgia depende da relativa abundncia de cDNA na biblioteca utilizada para a seleo. A tcnica pode tambm conduzir ao isolamento de cDNA vindo de outras regies do genoma, caso exista um pseudogene no fragmento de DNA genmico analisado. Outros problemas podem ser encontrados e dizem respeito ao vis criado pela PCR, que prefere a amplicao de fragmentos de pequenos tamanhos (ou cDNA pequenos) e a diculdade de eliminar completamente as seqncias repetitivas do DNA genmico inicial. Essas seqncias podem ser eliminadas pela desnaturao e re-hibridizao do DNA genmico inicial na presena de DNA enriquecido em seqncias repetitivas. A diculdade reside na escolha do tempo ideal de incubao que permita a renaturao unicamente das seqncias repetitivas, e no das seqncias nicas. Se, aps a incubao, ainda existir seqncia repetitiva no DNA genmico, possvel que um cDNA contendo tais seqncias seja isolado, pois esses elementos repetitivos constituem uma certa proporo de cDNA (at 10%). Embora apresente todas essas diculdades, a tcnica de captura de cDNA contribuiu para a construo de mapas transcricionais de vrias regies cromossmicas (KORN et al., 1992). A sondagem de biblioteca de cDNA A utilizao de YAC inteiro para sondar bibliotecas de cDNA foi descrita pela primeira vez por Wallace, em 1990,

46

O Princpio Geral da Clonagem Posicional

quando da identicao do gene causador da neurobromatose do tipo I. Em 1993, Geragthy e seus colaboradores, utilizando essa mesma estratgia, isolaram seqncias de cDNA do cromossomo X humano a partir de YAC de 480kb. Essa tcnica, mesmo permitindo isolar diretamente cDNA (em comparao com aquela de captura e amplicao dos exons), apresenta inmeros inconvenientes: devido complexidade da sonda, as hibridizaes inespeccas so comuns, o que diculta o reconhecimento dos sinais positivos; tambm muito difcil marcar um YAC inteiro com uma atividade especca durante um tempo sucientemente longo que permita sua recuperao aps hibridizao. A taxa de falsos positivos , portanto, muito alta e est estimada em 40%. As seqncias repetitivas so difceis de ser eliminadas completamente da sonda e podem conduzir ao isolamento de seqncias repetitivas transcritas(GERAGTHY et al., 1993). Podemos concluir, ento, que falta sensibilidade a essa tcnica. A sondagem de bibliotecas de cDNA atravs dos cosmdios inteiros oferece menos problemas, pois a sonda utilizada j no to complexa (ZHANG et al., 1992). Enm, qualquer que seja a sonda utilizada, a ecincia da sondagem depende da representao dos genes procurados e, conseqentemente, do grau de expresso destes. Os mtodos baseados na anlise das ilhas CpG As ilhas CpG (ou HTF para HpaII Tiny Fragments) so denidas como segmentos de DNA de 500pb a 2Kb que tm uma porcentagem de guanina + citosina (G+C) superior a 50% e uma grande quantidade de duplos CpG no metilados, enquanto que o restante do genoma caracterizado por uma porcentagem G+C menor (mdia de 40%) e pela metilao da citosina em 5 da maior parte dos duplos CpG (LINDSAY e BIRD, 1987). Um estudo publicado por Larsen em 1992 (LARSEN et al., 1992a) mostrou que, entre 375 genes repertoriados no GenBank, todos os genes com expresso constitutiva (housekeeping function) e em mdia 40% dos genes com expresso tissular especca contm uma ilha CpG. Essa ilhas, geralmente, cobrem a regio do

47

O Princpio Geral da Clonagem Posicional

promotor do gene e de 1 a 3 xons. Raramente esto localizadas na poro 3 ou no interior mesmo das seqncias transcritas. Num estudo similar, Antequera e Bird (1993) estimaram que dos 22.000 genes constitutivos, 55,9% dos genes humanos e 46,9% dos genes de camundongos esto associados a essas ilhas CpG e que mais de 40% dos 60.000 genes tecidos especcos estariam no mesmo caso. Craig e Bickmore (1994) mostraram que tais ilhas no estariam repartidas de maneira homognea ao longo do genoma, mas que estariam concentradas em domnios cromossmicos particulares, no nvel das bandas R, onde se encontram os genes que so expressos. Todos esses dados reunidos indicam que as ilhas CpG so bons marcadores para se identicarem genes. Visto que essas ilhas so formadas por uma alta densidade de dinucleotdios CpG no metilados, elas podem ser detectadas por enzimas de restrio sensveis metilao e que contenham o dinucleotdio CpG nos seus stios de reconhecimento. Na Tabela 4 so mostradas as enzimas de restrio mais utilizadas na deteco das ilhas CpG (de acordo com Bickmore e Bird, 1992). O grupamento de vrios stios reconhecidos por essas enzimas numa curta regio de DNA (alguns Kb) um indicativo da presena de uma ilha, que, na prtica, identicada pela construo de um mapa de restrio da regio estudada e analisada pela eletroforese em campo pulsado. A presena de uma ilha CpG prxima da sonda molecular detectada pelo fato de essa sonda reconhecer fragmentos de mesmo tamanho aps digesto do DNA genmico por diferentes enzimas de restrio, em particular as citadas na Tabela 4. Duplas digestes utilizando uma combinao dessas enzimas permitem conrmar se tais stios esto agrupados no genoma (o tamanho dos fragmentos detectados deve ser o mesmo para as digestes simples ou duplas). A localizao das ilhas CpG foi til na clonagem do gene brachyury (T) (HERRMANN et al., 1990) e na do gene da brose cstica (CFTR) (ROMMENS et al., 1989). Essas ilhas podem facilmente ser clonadas a partir de um YAC ou cosmdio (ELVIN et al., 1992; VALDES et al., 1994) e utilizadas, em seguida, para sondar bibliotecas de cDNA.

48

O Princpio Geral da Clonagem Posicional

O sequenciamento genmico Ao longo dos ltimos anos, as tcnicas de sequenciamento foram consideravelmente melhoradas e, sobretudo, automatizadas, graas ao desenvolvimento de seqenciadores automticos (SMITH et al., 1986). Paralelamente a esse progresso, os programas de comparao de seqncias e os que permitem identicar seqncias codicadoras num segmento de DNA annimo tambm foram aperfeioados. Uberbacher e Mural (1991) desenvolveram o programa GRAIL, que possibilita a identicao de xons a partir de uma seqncia de DNA com uma delidade de 80% e com baixa taxa de falsos positivos. O programa BLAST (ALTSCHUL et al., 1990) permite comparar rapidamente uma seqncia s bases de dados clssicas como, por exemplo, GenBank, EMBL, etc. Os dados contidos em tais bancos so cada vez mais numerosos, graas, principalmente, ao Projeto Genoma Humano, que busca o sequenciamento da totalidade do genoma, e tambm ao sequenciamento em larga escala de cDNA (VENTER et al., 2001; LANDER et al., 2001). Uma boa introduo a esses programas pode ser encontrada no Guide to Human Genome Computing (1994). Uma ilustrao da utilizao dessas tcnicas apresentada por Seto (1994) no estudo dos receptores de linfcitos T humanos. As outras tcnicas Citaremos a tcnica desenvolvida por Lui e seus colaboradores (1989) a qual permite isolar os genes humanos transcritos numa linhagem celular hbrida hmster-homem (contendo um nico cromossomo humano) e as tcnicas baseadas na recombinao homloga entre o DNA analisado e uma biblioteca de cDNA (KURNIT; SEED, 1990). Entretanto, essas tcnicas, relativamente fastidiosas, no obtiveram sucessos em vrios projetos de clonagem posicional. O que nos aparece, em denitivo, que a procura de xons e o sequenciamento direto so as duas tcnicas mais utilizadas na clonagem posicional de um gene; porm, logo que levamos em conta as dimenses considerveis do genoma humano ou

49

O Princpio Geral da Clonagem Posicional

do camundongo, tais tcnicas se tornam extremamente pesadas, fastidiosas e, sobretudo longas. O ideal seria podermos dispor de uma espcie relativamente prxima dos mamferos, mas que possusse um genoma compacto, sem (ou com poucos e pequenos) ntrons. A levedura (14Mb), a bactria Escherichia coli (4.7Mb) ou a drosla (165Mb) so espcies muito distantes do ponto de vista logentico para serem utilizadas, mesmo se vrias seqncias forem conservadas em todos esses genomas. Entretanto, um genoma desse tipo existe no peixe tetrodontide Fugu rubripes (BRENNER et al., 1993). O sequenciamento sistemtico dos 400Mb do genoma deste peixe mostrou que 90% deste correspondem a seqncias nicas e que seu repertrio em genes muito anlogo ao humano. Trower e seus colaboradores, em 1996, encontraram uma conservao de sintenia entre o genoma do Fugu e uma regio do cromossomo 14 humano (14q24.3) que est associada Doena de Alzheimer (lcus AD3). O estudo do genoma do Fugu pode, ento, ajudar na clonagem posicional dos genes de mamferos. A partir do momento em que conhecemos um ntron procedente de um grande genoma, poderemos utiliz-lo como sonda para a clonagem das suas regies vizinhas no Fugu e retornar, em seguida, ao genoma estudado.

A identificao direta do cDNA candidato


Nestes ltimos anos assistimos a uma revoluo no que diz respeito gentica humana: um consrcio de cinco laboratrios ingleses, americanos e franceses (Gnethon) que interpuseram o mapeamento de dezenas de milhares de cDNA, identicadas por sua etiquetas, s chamadas EST (Expressed Sequence Tag). A primeira verso do Gene Map do genoma humano que foi estabelecido pelo consrcio internacional das EST apareceu em 1996 (SCHULER et al., 1996), incluindo mais de 16.000 genes mapeados com relao a 1.000 marcadores genticos polimrcos (Todos esses dados podem ser acessados no endereo www.ncbi.nlm.nih.gov/SCIENCE96/). O mapeamento dessas milhares de seqncias no homem pode, evidentemente, servir clonagem de mutaes

50

O Princpio Geral da Clonagem Posicional

nos camundongos, pois sabido que 80% dos cromossomos humanos tm uma homologia conhecida, com um segmento cromossmico murino. O mapeamento preciso das EST no homem oferece, levando-se em conta o jogo das homologias, um grande nmero de candidaturas para os genes a serem clonados no camundongo. bem provvel que essa estratgia seja muito explorada para a clonagem das mutaes dos camundongos que tenham sido localizadas com preciso.

Isolamento de um mensageiro completo


A maior parte das tcnicas descritas at agora no permite isolar um mensageiro completo, e a soluo mais evidente para solucionar esse problema busc-lo em bibliotecas de cDNA. Vrias bibliotecas desse tipo esto disponveis comercialmente e, em geral, so de boa qualidade. Entretanto, o trabalho de procura de uma seqncia completa de cDNA muito cansativo e necessita da presena de sondas de alta qualidade. A utilizao de sondas obtidas atravs da amplicao de xons delicada, pois essas sondas so, geralmente, pequenas podendo gerar muitos falsos positivos. A sondagem dessas bibliotecas pela tcnica de PCR (ALFANDARI; DARRIBRE, 1994; AMARACADI; KING, 1994) uma alternativa sondagem por hibridizao. O isolamento da extremidade 5 dos mensageiros pela sondagem de bibliotecas de cDNA sempre causa problemas. Tais clones so, na realidade, muito pouco representados por causa da diculdade encontrada pela transcriptase reversa de copiar na ntegra o mensageiro at 5. Uma estratgia complementar sondagem de bibliotecas de cDNA a tcnica chamada RACE (Rapid Amplication of cDNA Ends, FROHMAN et al., 1988), que amplica uma seqncia de RNA compreendida entre uma pequena seqncia j conhecida (por exemplo, um xon) e a extremidade, seja 5 ou 3, do RNA correspondente. O princpio da tcnica de RACE est ilustrado na Figura 24. O RACE normalmente mais rpido que a sondagem de bibliotecas de cDNA que podem necessitar de meses de trabalho antes que se consiga isolar um mensageiro completo. Entretanto, a tcnica do

51

O Princpio Geral da Clonagem Posicional

RACE pouco eciente para se isolar a poro 5 dos grandes mensageiros. A conexo entre xons pela RT-PCR permite igualmente isolar fragmentos de mensageiros sem ser preciso passar pela sondagem de cDNA. Aps a retro-transcrio do mRNA, o cDNA amplicado pelos oligonucleotdeos especcos dos dois xons conhecidos. Se eles pertencem ao mesmo transcrito e se os oligonucleotdeos foram denidos na boa orientao, todos os xons localizados entre esses dois sero amplicados.

A identificao do bom candidato


Uma primeira seleo pode ser feita considerando-se que o gene candidato deve apresentar um perl de expresso compatvel com o fentipo. Ns podemos efetivamente pensar que um gene no qual o efeito esteja se manifestando essencialmente no sistema nervoso central deva, a priori, corresponder a um mensageiro transcrito principalmente no crebro. Entretanto, preciso que seja identicada uma mutao associada ao fentipo na seqncia candidata. Uma deleo na seqncia transcrita descoberta no animal mutante e ausente no controle permite validar facilmente o gene em questo como um bom candidato. Foi o que ocorreu com a clonagem do gene Brachyury (HERRMANN et al., 1990) e com a do gene da distrona (MONACO et al., 1986). Infelizmente, as mutaes so, na maior parte das vezes, mais discretas e, portanto, mais difceis de ser detectadas. Pode agir-se, por exemplo, a partir de mutaes que afetem a recomposio dos xons (detectvel pelo Northern blot), como para a -talassemia (VIDAUD et al., 1989), de mutaes pontuais que levem mudana de um aminocido por outro (mutao de sentido trocado), como, por exemplo, no caso do gene Bcg (VIDAL et al., 1993), ou ainda, como no caso da mutao spastic (spa), pode ocorrer a intercalao de uma seqncia do tipo LINE dentro de um ntron que altera o stio de recomposio ou que crie outros alternativos (KINGSMORE et al., 1994). Vrias so as mutaes que s foram descobertas pelo seqenciamento completo

52

O Princpio Geral da Clonagem Posicional

do gene, caso em que a mutao se traduz pela substituio de um aminocido por outro. Aqui a questo saber se essa substituio realmente responsvel pelo fentipo ou se no se trata de apenas um polimorsmo associado. As presunes so um pouco reforadas quando a verso normal do cromossomo onde a mutao apareceu acessvel, pois, nesse caso, existe uma referncia precisa. As presunes so ainda mais reforadas se j existirem vrios alelos mutantes e que cada um mostre uma alterao diferente na seqncia. Foi assim que Balling e colaboradores em 1996 mostraram que o lcus undulated (un Cromossomo 2), identicado por trs alelos, era na realidade o gene Pax1 (WALLIN et al., 1996). Se o gene estudado s for conhecido por duas formas allicas, uma normal e outra patolgica, a prova de que o gene candidato isolado o bom no pode ser obtida seno por dois meios: reproduzindo-se a mutao pela inativao do gene in vivo (camundongo Knock-out) ou, ao contrrio, corrigindo-se os efeitos da mutao nos camundongos pela adio de um transgene correspondente a uma cpia normal do gene (complementao transgnica). A construo desses camundongos representa uma tarefa pesada, sobretudo quando se trabalha com grandes genes (cf. FRAZER et al., 1995), e raramente foi realizada na prtica.

A clonagem posicional nos tempos atuais


Para aqueles organismos cujos genomas foram seqenciados, a clonagem posicional mudou muito. Porm, para aqueles que ainda no possuem seus genomas completamente seqenciados e disponveis, o princpio da clonagem posicional permanece o mesmo. Para os genomas seqenciados, as mutaes so identicadas por uma combinao de mapeamento e sequenciamento (Figura 25) (KILE & HILTON, 2005). Para o mapeamento nada mudou, mesmo com o sequenciamento completo do genoma murino. Assim, o objetivo principal desta

53

O Princpio Geral da Clonagem Posicional

etapa continua sendo o de identicar marcadores polimrcos com localizao cromossmica conhecida que estejam ligados ao lcus responsvel pelo fentipo alterado estudado. O mapeamento, assim como antes do sequenciamento, pode ser dividido e dois grandes nveis: o mapeamento a baixa resoluo, no qual a mutao localizada no interior de um grande intervalo cromossmico; e o mapeamento de alta resoluo, onde o tamanho do intervalo reduzido de forma que o sequenciamento direto dos genes contidos neste intervalo possa ser iniciado. O nmero de meioses, para ambos os nveis, tambm no mudou, ou seja, para o mapeamento baixa resoluo 20 a 100 animais so necessrios para a genotipagem com 40 a 100 marcadores distribudos ao longo de todo o genoma. Para o estgio seguinte, de 100 a 1000 meioses so necessrias e analis-se todos os marcadores polimrcos existentes no interior do intervalo cromossmico denido no 1 nvel do mapeamento. Durante o processo de mapeamento, o intervalo cromossmico candidato vai sendo denido e detalhado a ponto de permitir o incio de sequenciamento. No existe regras estritas que denem quando comear esta nova etapa da clonagem. A deciso deve ser tomada levando-se em conta vrios fatores: o quo pequeno o intervalo cromossmico e a possibilidade de diminu-lo ainda mais, possibilidade esta que est vinculada a existncia ou no de marcadores polimrcos na regio; a densidade gnica na regio, esta pode ser avaliada diretamente no banco de dados do genoma murino (Ensembl: http://www.ensembl.org/index.html); o custo e disponibilidade para o sequenciamento comparado ao custo de se gerar e analisar mais animais. Na prtica, o renamento do intervalo gentico denido geralmente acompanhado pelo sequenciamento. Assim que a deciso de sequenciar estabelecida, a questo passa a ser O que sequenciar?. Levando-se em conta que, a grande maioria das mutaes pontuais clonadas no camundongo, foram identicadas nas regies codicadoras

54

O Princpio Geral da Clonagem Posicional

dos genes ou nas junes xons-ntrons, certamente o incio do sequenciamento deve ser focado nessas regies. A disponibilidade da seqncia completa do genoma murino nos bancos de dados facilita a identicao dos xons dos diferentes genes contidos no intervalo. Estes xons podem ser amplicados e isolados a partir do DNA genmico e sequenciados diretamente. Em seguida, caso no seja encontrado mutaes nessas regies prioritrias, deve-se pensar em sequenciar os ntrons, as regies 3 e 5 no traduzidas, a regio promotora e, por m, as regies intergnicas. A escolha do gene a ser sequenciado deve ser sempre combinada com o mapeamento alta resoluo. Por qual gene comear uma outra questo. Deve-se investigar detalhadamente a mutao estudada do ponto de vista siopatolgico. A escolha do gene candidato posicional pode ser influenciada pelos dados clnicos da mutao como, por exemplo, processos bioqumicos afetados, tecidos afetados, mutao com fentipo semelhante existentes na mesma regio cromossmica mapeada e as homologias inter-espcies, principalmente entre o homem e o camundongo. A identicao da mutao ou do gene mutado no intervalo cromossmico no signica, necessariamente, que esta seja a mutao primria que levou a apario da doena. Em muitos casos, evidncias indiretas so necessrias para provar tal hiptese. Por exemplo, traar um paralelo entre o fentipo observado quando o gene do camundongo est mutado e os fentipos quando o gene ortlogo est mutado em outros organismos como no rato, homem, drosla, etc; ou mesmo a similaridade fenotpica, no prprio camundongo, quando outros genes cujas funes so conhecidas e que participam da mesma via biolgica do gene candidato em questo. Outra evidncia inclui o estudo da expresso ou atividade do gene mutado nos tecidos afetados na patologia. Por outro lado, a evidncia direta da causa do fentipo mutado requerida. Assim podemos falar da gerao de animais mutantes transgnicos que recuperam o fentipo normal ou a gerao de animais mutantes nocautes de gene identicado.

55

ESTUDO DE CASO
Mapeamento gentico do lcus pmn
Localizao cromossmica da mutao pmn (BRUNIALTI et al., 1995) Um estudo recente utilizou metodologia da clonagem posicional para o mapeamento gentico do lcus pmn em camundongos. Neste estudo 63 animais N2 homozigotos pmn/ pmn foram obtidos a partir das 12 fmeas F1 interespeccas +/ pmn foram cruzadas com os machos +/pmn do estoque original, tiveram seu DNA extrado de acordo com a metodologia de AUSUBEL ET AL. (AUSUBEl et al., 1993) e forma analisados por um painel de microssatlites. Foram selecionados 37 marcadores moleculares do tipo microssatlites distribudos sobre a totalidade dos cromossomos murinos e que revelaram um polimorsmo entre as linhagens que foram utilizadas no cruzamento interespecco (AITMAN et al., 1991; CORNALL et al., 1991; DIETRICH et al., 1992; HEARNE et al., 1991; LOVE et al., 1990; MONTAGUTELLI et al., 1991). Esses marcadores foram utilizados na tipagem, pela PCR, dos 63 DNA dos animais pmn/pmn, e a anlise da segregao dos hapltipos foi realizada atravs do programa GeneLink (Montagutelli et al., 1990). Desse modo, foi observado observar um desequilbrio de ligao entre o lcus pmn e vrios marcadores situados sobre o cromossomo 13 de camundongo (D13Mit80, D13Mit215, D13Mit115, D13Mit3, D13Mit16, D13Mit154 e D13Mit61). Os marcadores mais prximos do lcus pmn foram D13Mit215 e D13Mit115. A ordem mais provvel desses loci do cromossomo 13 : D13Mit80, D13Mit215, pmn, D13Mit115, D13Mit3, D13Mit16, D13Mit154 e D13Mit61.Uma anlise detalhada dos hapltipos est apresentada na Figura 26. Para conrmar essa localizao cromossmica do lcus pmn, dois outros cruzamentos foram estabelecidos utilizando marcadores fenotpicos facilmente reconhecidos (Figura 27).

56

Estudo de Caso

Foram construdos dois estoques balanceados Xt +/+ pmn e pe +/+ pmn cujos resultados foram: de 641 animais nascidos do cruzamento entre animais do tipo Xt +/+ pmn (o que representa 1.282 meioses) no foi encontrado nenhum recombinante (Figura 27). Nessas condies estimou-se que a distncia gentica mxima entre o lcus pmn e os marcadores Extra-toe (Xt) certamente inferior a 1 cM, com um risco de 5%. A mutao Extra-toe equivale a uma deleo da regio 5 do gene Gli3 (zinc nger gene Gli3) (VORTKAMP et al., 1992) e, no homem, corresponde sndrome de Greig cefalopolisindactilia. O estoque balanceado Xt +/+pmn de extrema importncia, pois permite diagnosticar o fentipo do animal desde o nascimento. Observando-se minuciosamente os recm-nascidos, possvel distinguir os camundongos que iro desenvolver o fentipo pmn daqueles que permanecero normais: estes possuem um dedo extranumerrio sendo do tipo Extra-toe (Xt/+) (Figura 28); dos 212 animais produzidos a partir do cruzamento entre os animais pe +/+ pmn (424 meioses) foram encontrados 10 recombinantes, ou seja, animais do tipo pe pmn/pe pmn que apresentam, ao mesmo tempo, os fentipos pmn e uma colorao clara da pelagem. Esse resultado colocou pmn a 42 cM do lcus pe. O prximo passo, seguindo a estratgia da clonagem posicional, foi o de densicar o mapa gentico vizinho ao lcus pmn. Densicar o mapa gentico consiste na localizao do maior nmero possvel de marcadores genticos vizinhos ao lcus pmn e, para que essas distncias genticas possam ser calculadas com grande preciso, preciso analisar o maior nmero possvel de meioses. Para tanto, um conjunto de DNA originados do retrocruzamento chamado EUCIB, implicando as linhagens de camundongos C57BL/6 e SEG/Pas (BREEN et al., 1994), foi utilizado. Atravs deste painel de DNA foi possvel localizar com preciso o gene Gli3 utilizando-se para este m o fragmento

57

Estudo de Caso

molecular do gene Gli3, chamado Gli20 (VORTKAMP et al., 1992), o qual revelou-se polimrco (RFLP) entre as duas linhagens utilizadas no EUCIB. Com este mesmo painel de DNA procedeu-se a localizao de 30 marcadores existentes no cromossomo 13 na regio de mapeamento do lcus pmn (Figura 29). Mapa gentico humano Da comparao do mapa gentico humano com o dos camundongos observa-se grupos de homologia de sintenia entre o cromossomo 13 animal e os cromossomos 1, 3, 5, 6, 7, 9 e 10 humanos (Figura 17). A mutao pmn foi descrita como o modelo animal da amiotroa espinal do tipo I (Werdnig-Hoffmann), a expresso aguda da SMA (SCHMALBRUCH et al., 1991) e que foi localizada no cromossomo 5q11.2-q13.3 humano (BRZUSTOWICZ et al., 1990; MELKI et al., 1990). Com o intuito de conrmar tal hiptese foi isolado um fragmento de DNA animal possuindo 95% de homologia com o gene humano causador da SMA e chamado SMN (Survival Motor Neuron) (LEFEBVRE et al., 1995; VIOLLET et al., 1997). Atravs desse fragmento realizou-se a SSCP com os DNA dos animais pmn/pmn do primeiro cruzamento, tendo encontrado 11 recombinantes sobre 55 animais testados. Esse resultado separou o lcus pmn do lcus Smn de 20 cM e colocou este numa regio mais distal, homloga regio 5q13 humana. Conclui-se que pmn no era o modelo animal de SMA, pois este recombina com o lcus Smn causador da doena. A Figura 30 representa o mapa gentico da regio cromossmica contendo pmn, no qual observa-se que pmn est localizado numa regio cromossmica compreendida entre 0 a 1 cM (intervalo de conana de 95%) do lcus Xt (Gli3). Tais distncias so compatveis com a construo de um contig cobrindo a regio.

Construo de um contig contendo o lcus pmn


Dando prosseguimento clonagem posicional do lcus pmn, a etapa seguinte consistiu no isolamento da regio

58

Estudo de Caso

cromossmica contendo o lcus pmn na forma de um conjunto de clones contguos tambm chamado do contig. Num primeiro momento os cromossomos articiais de levedura (YAC) foram utilizados, estes podem conter grandes fragmentos clonados (de mais de centenas de Kb). O mapa gentico da regio onde se localiza pmn indicava cinco marcadores particularmente interessantes: os microssatlites D13Mit215, D13Mit305 e D13Mit115 e as sondas moleculares Gli11 e Gli20, que correspondem respectivamente s extremidades 5 e 3 do gene Gli3 (Xt). Esses marcadores foram usados na seleo dos YAC. Mais adiante, tambm foi estabelecido o contig de cromossomos articiais de bactrias (BAC). Isolamento e caracterizao preliminar dos YAC que contm D13Mit215, D13Mit305, D13Mit115, Gli11 e Gli20 Os YAC selecionados a partir dos marcadores Gli11 e Gli20 foram isolados da biblioteca do Imperial Cncer Research Fund; os selecionados a partir dos outros marcadores foram isolados no Gnthon, que possui as bibliotecas oriundas do MIT/ Princeton (KUSUMI et al., 1993), que cobre 4 vezes o genoma animal; ICFR (LARIN et al., 1991), que cobre 3 vezes o genoma de camundongos; St. Marys Hospital (CHARTIER et al., 1992), que cobre 3,5 vezes o genoma de camundongos. Essas bibliotecas esto organizadas em pools e superpools de YAC, podendo ser explorados pela PCR. Desse trabalho foi possvel isolar 28 clones. Para a determinao do tamanho dos fragmentos contidos em cada YAC isolado o DNA de alto peso molecular desses clones foi preparado em blocos de agarose e os cromossomos de levedura foram separados pela eletroforese em campo pulsado. O DNA, assim preparado, foi transferido sobre uma membrana de Nylon N+ e hibridizado com uma sonda radioativa correspondente ao gene URA3 da levedura. O tamanho dos

59

Estudo de Caso

fragmentos dos YAC foi determinado pela comparao com os tamanhos dos cromossomos endgenos de levedura. (Um exemplo de hibridizao pode ser visto na Figura 31 e na Tabela 5 esto representados os resultados obtidos.) Essa etapa possibilitou a vericao de quais clones eram estveis, ou seja, aqueles que nos deram como resultado da hibridizao duas bandas, uma que corresponde ao gene URA3 endgeno, e outra correspondente ao YAC. Da mesma forma, foi testada a presena dos marcadores D13Mit215, D13Mit305 e D13Mit115, utilizamos o mtodo da PCR com uma alquota de cada cultura diluda 100 vezes. J para os clones isolados a partir das sondas moleculares Gli11 e Gli20 uma membrana foi preparada e hibridizada com essas sondas. Dentre os clones estveis, foram identicados aqueles que continham ao menos dois marcadores que serviram no isolamento destes e foi estado a presena de todos os marcadores microssatlites que haviam sido mapeado na regio do lcus pmn. Os marcadores INHBA (PANG et al., 1992) e GCK para o gene da glucocinase (SANTOSH et al., 1992), que correspondem aos iniciadores que amplicam o DNA humano e que esto localizados no cromossomo 7 humano (na regio homloga ao cromossomo 13 animal, ao redor do lcus pmn), tambm foram utilizados nessa etapa da clonagem posicional. Os resultados dessa etapa esto representados na Figura 32. Dessa fase clonclui-se que o YAC Y902.2 revelou ser o clone mais interessante, pois ele continha trs marcadores moleculares - Gli11, Gli20 e GCK - e sabendo-se que pmn est a uma distncia inferior a 1 cM (risco de 5%) do lcus Xt (gene Gli3), o que representa, em mdia, 1.800 Kb. Isolamento e caracterizao preliminar dos BAC contendo os marcadores D13Mit215, Gli11, Gli20 e D13Mit115 Esses marcadores serviram no isolamento dos BAC de uma biblioteca construda a partir do DNA genmico de

60

Estudo de Caso

camundongo. Desde processo resultou o isolamento de 3 BAC a partir do marcador Gli11, 7 clones com o marcador Gli20, um nico com o marcador D13Mit215 e um outro com o marcador D13Mit115. O DNA desses clones foi extrado de acordo com o protocolo estabelecido no Research Genetics (descrito em Material e Mtodos), em seguida, foi vericada a presena dos marcadores que foram utilizados para o isolamento atravs de hibridizaes com os marcadores Gli11 e Gli20 e pela PCR com os demais marcadores. Esses clones foram utilizados na procura de seqncias codicadoras que se encontram nessa regio (Tabela 6).

Mapa fsico ao redor do lcus pmn


A etapa seguinte da clonagem posicional consiste na construo de um mapa de restrio do contig, que deve evidenciar possveis rearranjos ocorridos com os insertos contidos nos YAC (inseres, delees), permitindo localizar os genes candidatos na regio de interesse. Ela tambm serve como referncia para a construo do mapa fsico da regio genmica correspondente. Esse mapa foi construdo com 3 YAC Y902.2, Y903.1 e Y13.305.2 , permitindo a deteco de todos os rearranjos neles existentes, sendo que seria pouco provvel que trs clones independentes apresentassem as mesmas anomalias. As enzimas de restrio que cortam raramente o genoma e que esto associadas s ilhas CpG (veja explicao na Introduo) foram utilizadas na construo de tal mapa. Todos os stios de restrio foram identicados para as enzimas BssHII, EagI, MluI, NotI, NruI, SacII e SmaI. Foram realizadas digestes parciais pelas enzimas citadas acima com o DNA do YAC preparados em blocos de agarose. Os fragmentos foram, em seguida, separados por eletroforese

61

Estudo de Caso

em campo pulsado. O DNA foi transferido para uma membrana de Nylon N+ e esta foi hibridizada sucessivamente com: 1. um fragmento do pBR322, que corresponde ao brao direito do pYAC4; 2. um fragmento do pBR322, correspondendo ao brao do pYAC4. Tal procedimento permitiu determinar a posio de cada stio de restrio com relao extremidade direita ou esquerda do vetor pYAC4 (mtodo adaptado de SMITH; BIRNSTEIL, 1976). A extremidade esquerda do inserto contido no clone Y202.2 foi isolado atravs da tcnica de PCR inversa RsaI. O fragmento de 500 pb foi seqenciado e denominado extremidade 11, este foi utilizado na construo do mapa de restrio do contig. Esse fragmento, presente nos YAC Y902.2, Y903.1 e Y13.305.2 (Figura 33), corresponde a uma EST de camundongo isolada de uma biblioteca de cDNA construda a partir de um tecido de corao hipertroado. Os fragmentos de DNA Gli20 e Gli11, que correspondem ao gene Gli3, foram igualmente utilizados na construo do mapa de restrio do contig e suas localizaes foram determinadas atravs de hibridizaes sobre as membranas de nylon construdas para este m. A comparao do resultado de hibridizao para cada um dos fragmentos permitiu a localizao precisa dos marcadores e conduziu ao estabelecimento do mapa de restrio do contig, representado na Figura 34. As pores quimricas dos YAC puderam ser determinadas atravs da comparao entre os mapas de restrio estabelecidos para cada clone. Por exemplo: o YAC Y301.1 quimrico; atravs do mapa de restrio desse clone identicou-se todos os stios de restrio comuns com os clones Y902.2 e Y13.305.2 e que no so quimricos.

62

Estudo de Caso

Esse contig cobre uma distncia de aproximadamente 2 Mb entre a extremidade proximal do clone Y902.2 e distal do clone Y13.305.2. Nenhum rearranjo ou deleo maior foi observado no YAC Y902.2. Se nenhum recombinante foi encontrado entre pmn e Xt (gene Gli3) chegou-se a concluso que o YAC 902.2 representava o principal clone para a procura de seqncias codicadoras existentes nessa regio. O resultado deste trabalho foi a identicao de pelo menos trs ilhas CpG potenciais presentes nesses clones: 2 ilhas nos YAC Y902.2 e Y13.305.2, entretanto no foi possvel determinar se esses stios so metilados in vivo nos camundongos. O status dessas ilhas CpG deveria, ento, ser conrmado pelo mapeamento da regio genmica correspondente. Entretanto, Larsen e outros (1992b) mostraram que, desde que 3 ou mais stios dessas enzimas que cortam raramente o genoma coincidam com o nvel do DNA do YAC, esses stios devem estar associados aos genes ao menos em 90% dos casos.

Isolamento e caracterizao dos xons a partir do DNA do contig


Com o objetivo de identicar as seqncias codicadoras a partir do contig foi utilizada a tcnica de amplicao dos xons, sendo que, contig de BAC estabelecido na regio de interesse foi o escolhido para este m. Os experimentos foram realizados com os BAC isolados a partir dos marcadores moleculares Gli20, Gli11, D13Mit215 e D13Mit115, respectivamente os clones 283E20, 12P11, 388A11 e 496K2 (Tabela 6). Na primeira etapa, aps clonagem no vetor pAMP10, foram eleiminados os clones que continham insertos muito pequenos (< 100 pb), pois seria muito complicado escolher iniciadores para a PCR a partir de fragmentos de pequeno tamanho.

63

Estudo de Caso

No foi possvel isolar seqncias codicadoras a partir dos clones 388A11 e 496K2. Os resultados apresentados correspondem, pois, aos insertos isolados a partir dos clones 283E20 e do clone 12P11. Foram obtidas 115 colnias; destas, 47 foram eliminadas, pois continham insertos de tamanho inferior a 100 pb; 50 colnias continham apenas as seqncias do vetor. Na verdade, como foi descrito na seo Material e Mtodo, o DNA genmico a ser analisado clonado dentro de um ntron do gene tat de HIV. A presena de um stio crtico de recomposio dentro desse ntron pode, em parte, ser o responsvel pelo isolamento dos falsos positivos contendo seqncias derivadas do vetor. Enm, 10 colnias, correspondentes s seqncias provenientes dos marcadores Gli11 e Gli20, foram isoladas. A Tabela 7 e a Figura 35 indicam os resultados das 8 colnias restantes nas quais as seqncias correspondem s seqncias de genes conhecidos ou no e s seqncias das EST humanas. No total, foi possvel explorar 260Kb, nas quais foram encontrados 8 fragmentos correspondentes a 8 genes potenciais. Dessa forma, estimou-se que na regio do cromossomo 13 de camundongos contendo o lcus pmn, a densidade gnica mdia deve ser de um gene a cada 33 Kb.

As EST
As EST humanas, das quais o mapeamento cromossmico foi publicado (SCHULER et al., 1996), oferecem uma ferramenta na clonagem dos genes de camundongos levando-se em conta as homologias de sintenia conhecidas entre essas duas espcies. Neste sentido, foram selecionadas as EST humanas localizadas na regio 7p vizinhas ao gene Gli3 e, dessa primeira seleo, priorizou-se aquelas EST que no tinham homologia de seqncia com um gene j conhecido.

64

Estudo de Caso

Assim, 15 dessas EST (Tabela 8) e seus iniciadores foram testados pela PCR sobre o DNA de todos os nossos clones YAC e BAC (Figura 35), sobre o DNA genmico e cDNA (RT-PCR do fgado) dos animais de fentipo pmn, Xt e selvagem (+), o que permitiu o reconhecimento da existncia de uma ou mais EST localizadas nessa regio do cromossomo 13 de camundongos e, atravs da tcnica da RT-PCR foi possvel evidenciar uma possvel diferena de amplicao entre trs cDNA testados (Xt, pmn e selvagem). O DNA genmico serviu como controle da amplicao. A Tabela 8 mostra a totalidade dos resultados obtidos. Ainda que a maior parte das EST testadas nos tenha dado resultados positivos para a RT-PCR, nenhuma delas permitiu detectar uma diferena no tamanho do produto amplicado pela PCR entre os animais Xt, pmn ou selvagem (um exemplo disso est mostrado na Figura 36). Tal armao mostra o poder dessa ferramenta na clonagem dos genes murinos.

65

A MUTAO pmn: UM MODELO DE NEUROPATIA HUMANA


pmn: um modelo potencial para a patologia neuromuscular humana
pmn: uma mutao de efeitos independentes O estudo de caso apresentado ilustrou a tentativa de clonagem posicional de um gene responsvel pela mutao de camundongos cujos efeitos so principalmente neuropatolgicos, os quais podem ser observados no nvel dos neurnios motores na medula espinal. Essa neuropatia causada por um processo de morte retrgrada (dying back neuronopathy), durante o qual a patologia comea nas terminaes nervosas e progride ao longo do axnio em direo ao corpo celular. Esse esquema patolgico j conhecido no homem e pode ser encontrado nas diversas formas de amiotroas espinais. A mutao descrita tem penetrncia completa, pois aparece em 100% dos indivduos homozigotos, e o desenvolvimento da doena totalmente homogneo em relao ao tempo e gravidade qualquer que tenha sido a linhagem de camundongo na qual a mutao tenha segregado. Essa armao extremamente interessante, pois, contrariamente a outras mutaes neurolgicas dos camundongos como, por exemplo, wobbler (wr - crom. 11 DESPORTES et al., 1994), ela mostra que o processo patolgico que leva os animais pmn/pmn a morte sem dvida alguma controlado pelo nico gene pmn. pmn no o lcus homlogo ao lcus responsvel pela amiotrofia espinal do tipo Werdnig Hoffmann humana Ao longo do trabalho tambm foi mostrado que, a despeito de fortes semelhanas anatomopatolgicas, a mutao pmn no correspondia ao homlogo murino da amiotroa espinal do tipo Werdnig Hoffmann humana. Este gene (Smn), que agora est clonado, foi mapeado a, mais ou menos, 20 cM do lcus pmn na regio telomrica do cromossomo 13 de

66

A Mutao pmn: Um Modelo de Neuropatia Humana

camundongos, exatamente no ponto em que no era esperado, ou seja, na regio de homologia com o cromossomo 5 (5q11.2q13.3), onde o gene humano SMN foi mapeado. At o presente momento no existe nenhum alelo mutante espontneo do lcus Smn e espera-se que esta seja produzida in vitro, por recombinao homloga nas clulas ES, quando, ento, talvez seja revelada a funo desse gene nos camundongos. Poder-se-, dessa forma, medir o quo as sndromes humanas podem ser semelhantes umas s outras. Essa ausncia de homologia entre pmn e Smn no representa um caso isolado. Ao olharmos as Tabelas 1 e 2 percebemos que grande parte dos genes recuperados nos camundongos e que tm efeitos deletrios sobre o sistema neuromuscular no possuem homlogos conhecidos na espcie humana, e vice-versa. Assim, podemos dizer que nesse estudo de caso o homlogo humano da sndrome pmn ainda no conhecido. Talvez a hiptese mais plausvel para explicar tal observao, seja o fato de que dispomos, at o presente momento, de somente uma pequena amostra dos mutantes potenciais de camundongos. Nesse contexto, os grandes projetos mundiais de induo de novas mutaes atravs de agentes qumicos, como o Etil-nitroso-uria (ENU), abrem sem dvida algumas perspectivas muito interessantes.

pmn: um bom modelo anlogo s amiotrofias espinais


Outro fato relatado neste estudo de caso e que vale a pena salientar foi o sistema de manuteno da mutao desenvolvido. Este consistiu no cruzamento dos indivduos duplos heterozigoto Xt e pmn entre eles (Xt +/ + pmn), o qual possibilita o reconhecimento, desde o nascimento, dos animais que desenvolvero a doena pmn antes mesmo que os primeiros sinais da patologia apaream. Tal modelo de manuteno permitiu que a mutao pmn fosse utilizada para testar a ecincia de

67

A Mutao pmn: Um Modelo de Neuropatia Humana

certas estratgias teraputicas atravs de substncias biolgicas ou qumicas conhecidas por suas atividades na sobrevivncia dos neurnios motores. Foi demonstrado, por exemplo, que a administrao do CNTF (Ciliary Neurotrophic Factor), sintetizado por broblastos geneticamente modicados e enxertados no comeo da doena, diminui a velocidade da evoluo da doena, mas no consegue par-la denitivamente (SAGOT et al., 1995b; SENDTNER et al., 1992). Da mesma forma, foi demonstrado que a superexpresso do proto-oncogene Bcl-2 (que secreta uma substncia anti-apopttica) nos homozigotos pmn/pmn no age na progresso, to pouco na expresso da doena e tambm no impede a degenerao axonal. Entretanto, foi estabelecido que ela reduz a perda neural no ncleo facial (SAGOT et al., 1995a). Enm, a administrao do fator neurotrco GDNF (Glial cell line Derived Neurotrophic Factor) produz resultados similares ao CNTF (SAGOT et al., 1996). Esses resultados levam-nos a pensar que, para essa mutao, o processo patolgico fundamental no um problema do corpo celular, mas, ao contrrio: que ela leva a uma neuropatia secundria, e no a uma axonopatia. Alm disso, esses estudos mostraram que (1) os mecanismos que levam a uma axonopatia so independentes daqueles que causam as neuropatias e (2) que os fatores neurotrcos tm mecanismos de ao muito especcos e que so diferentes uns dos outros. pmn, onde est o mal? O estudo anatomopatolgico dos camundongos homozigotos para a mutao pmn mostrou claramente que somente uma parte dos neurnios motores afetada e degenera, enquanto que a outra parte, aparentemente, sobrevive normalmente. As razes dessa heterogeneidade no so conhecidas, mas, com certeza, a elucidao dessa diferena poder ser de grande importncia na compreenso da siopatologia da doena. Poderamos imaginar que a populao de neurnios motores, como a populao de linfcitos, ainda que homogneos do ponto de vista morfolgico, na realidade composta de vrias famlias, cada uma respondendo a fatores

68

A Mutao pmn: Um Modelo de Neuropatia Humana

trcos diferentes. Nesse caso, pmn afetaria somente uma nica subpopulao de neurnios motores. Contrariamente, tambm poderamos pensar que todos os neurnios motores pertencem a uma mesma famlia e que a degenerao de alguns deles nos animais pmn, num estado precoce, seria apenas o resultado de um evento j programado, mas que nesses animais estaria acontecendo prematuramente. Alguns trabalhos realizados com os fatores de crescimento dos neurnios motores (HENDERSON, 1995) tendem a aceitar a hiptese da existncia de uma heterogeneidade populacional.

A etapa seguinte
A despeito dos esforos realizados, no foi possvel identicar genes candidatos para o lcus pmn, mas, graas ao contig de YAC e BAC construdo, sabe-se que o gene est mega pares de bases que foram clonados. Vrias estratgias podero ser seguidas na continuao deste trabalho, quais sejam: realizao um enorme trabalho de subclonagem dos clones do contig e, em seguida, um sequenciamento sistemtico, como vem sendo feito classicamente no homem; recuperao dos cDNA candidatos atravs da hibridizao in situ ou a cDNA selection, mas, como j foi dito anteriormente, esta uma tcnica difcil de se colocar em prtica; na realidade, tendo em vista o atual estado dos conhecimentos e dos meios disponveis, o mais astucioso e o menos oneroso consiste, sem dvida alguma, em utilizar as EST j mapeadas na regio homloga humana, que estejam sobre o cromossomo 13 murino e que etiquetem um novo gene. Entretanto, certamente sero encontrados novos marcadores moleculares que permitiro melhorar a resoluo do nosso mapa fsico. Uma concluso tirada da clonagem posicional que, contrariamente ao que a maioria acredita, ela , na prtica, mais

69

A Mutao pmn: Um Modelo de Neuropatia Humana

difcil de ser concluda nos camundongos do que no homem. No caso descrito, chegou-se muito perto do lcus pmn, j que foi possvel criar a quantidade de animais desejados e realizar, dessa forma, um mapa muito preciso em volta do lcus pmn. Entretanto, existe apenas um nico alelo mutante para ser comparado ao alelo normal e, caso esta seja uma mutao de ponto, o seqenciamento de todo o gene deve ser considerado um fato para, quem sabe, identicar a anomalia. Em humanos, ao contrrio, os genes que foram clonados o foram porque existia, na maior parte das vezes, uma grande variedade de alelos (os geneticistas humanos falam de famlias), os quais s vezes estavam associados a rearranjos cromossmicos mais ou menos importantes (translocaes, inverses, etc.), e sabemos que esses rearranjos so tidos como marcadores de proximidade e ajudam muito no trabalho dos pesquisadores. Nos camundongos, podemos encontrar rapidamente a ordem linear dos genes dentro de um segmento cromossmico, mas eles no permitem identicar facilmente um gene que s possui um nico alelo mutante. O fato de que o lcus pmn no recombina jamais com o lcus Xt pode, de certa forma, confundi as idias, pois exatamente o que esperado na medida em que o marcador Xt representa uma pequena deleo. Espera-se colocar no futuro o lcus pmn na frente de um segundo alelo Xt (Pdn, por exemplo), o qual no possui uma deleo, mas corresponde a um pequeno rearranjo cromossmico. Alm disso deve-se pensar em refazer o mapa gentico da regio a partir de um cruzamento envolvendo um cromossomo normal, pertencente a uma outra linhagem de camundongo, e que possua vrios marcadores que estejam em repulso com relao a pmn.

Podemos definir o perfil de um gene candidato?


Atualmente, vrias mutaes que levam a morte dos neurnios motores foram identicadas pela clonagem posicional humana ou nos camundongos ou, o que mais freqente, pelo knock-out de um gene cuja funo era total ou parcialmente desconhecida. Os resultados obtidos no permitem denir um

70

A Mutao pmn: Um Modelo de Neuropatia Humana

perl de uma protena candidata para o produto do gene pmn. Genes to diferentes como Sod1 (Superoxyde dismutase), Il3 (Interleukina 3) ou Nfh (Neurolament heavy protein) conduzem todos os trs a uma amiotroa espinal com comprometimento dos neurnios motores e suas seqncias nucleotdicas no tm nenhuma homologia. Nesse ponto admiti-se ainda que os genes que codicam protenas que tm receptores na superfcie das clulas-alvo produziro o mesmo tipo de mutao que os genes que codicam para o ligante. Infelizmente, pouqussimas so as mutaes nos camundongos que afetem principalmente o neurnio motor (conhecemos oito mutantes desse tipo). Alm disso, para nenhuma delas o gene est clonado ou possui um equivalente conhecido no homem (BRUNIALTI et al., 1995), o que quer dizer que, no nal, ao menos oito novas protenas sero descobertas, todas com um papel importante na manuteno da integridade do neurnio motor... certamente deve existir muito mais que isso!

71

FINAL DA HISTRIA
O gene responsvel pela mutao pmn foi nalmente clonado em 2001 (MARTIN et al., 2002). Para tanto, foi necessrio analisar 902 animais F2 mutantes, ou seja, 1804 meioses para, assim, obter-se um mapeamento gentico e fsico alta resoluo (MARTIN et al, 2001). Um BAC foi isolado contendo o lcus pmn, o qual foi, ento, totalmente seqenciado, sendo possvel evidenciar o gene Tbce (tubulin-specific chaperone e) como um forte candidato para a mutao pmn. Aps anlises de expresso e seqenciamento do gene nos animais normais e mutantes foi identicado que a mutao levando ao fentipo pmn era uma substituio de um aminocido triptofano para uma glicina na posio 524 (Trp524Gly), correspondendo ao ltimo aminocido da protena chaperone e tubulina-especca (Tbce). Essa substituio levou queda na estabilidade da protena. Foi levantada a hiptese de que, em camundongos, a protena Tbce teria um papel fundamental na manuteno da integridade celular dos neurnios motores, provavelmente agindo sobre a estabilidade ou sobre a dinmica de polimerizao destes. Finalmente, o gene Tbce murino tem seu ortlogo humano TBCE localizado no cromossomo 1. No homem, uma mutao nesse gene causa a Sndrome Kenny-Caffey (PARVARI et al., 2002), cujo fentipo totalmente diferente daquele observado nos animais pmn. Essa constatao pode signicar que a protena codicada pelo gene TBCE esteja atuando em diversos tecidos e que mutaes diferentes podem ter conseqncias distintas levando a diferentes fentipos.

72

MATERIAL E MTODOS UTILIZADOS NO ESTUDO DA MUTAO pmn


Origem dos alelos mutantes e das linhagens utilizadas
O alelo mutante pmn utilizado no estudo de caso apresentado foi importado do Instituto Panum, em Copenhague, onde foi descoberto num estoque de camundongos da linhagem NMRI/Pan (SCHAMALBRUCH et al., 1991). Machos heterozigotos +/pmn oriundos do estoque de origem foram retrocruzados inmeras vezes com fmeas da linhagem 129/ Sv-Pas, que corresponde a uma linhagem isognica mantida no Instituto Pasteur, na Frana com o objetivo de aumentar o prolicidade dos animais mutantes. Os alelos mutantes Extra-toes (Xt) e pearl (pe) foram importados do Mammalian Genetic Unit, do M.R.C., Harwell, UK (cortesia dos doutores A. G. Searle e M. F. Lyon). Esses alelos tambm foram transmitidos para o background gentico do tipo 129/Sv-Pas, da mesma forma como foi feito para o alelo mutante pmn. A mutao Extra-toe (Xt) autossmica dominante e caracteriza-se, do ponto de vista fenotpico, pela presena de um dedo extra-numerrio na face interna das patas posteriores (Figura 28). A mutao pearl (pe) autossmica recessiva e caracteriza-se por uma forte diluio da colorao da pelagem que pode ser mais bem observada em animais cujo background gentico Agouti-Black (A/-; B/-). Para o estabelecimento da localizao gentica da mutao pmn foi utilizado camundongos da linhagem SEG/ Pas e STF/Pas, linhagens parcialmente isognicas derivadas da espcie Mus spretus.

73

Material e Mtodos Utilizados no Estudo da Mutao pmn

Protocolos experimentais utilizados no estabelecimento do mapa gentico


Cruzamentos realizados Para realizar o mapeamento gentico da mutao pmn, foram realizados dois tipos de cruzamentos. O primeiro cruzamento foi do tipo retrocruzamento interespecco implicando as linhagens SEG/Pas e STF/Pas, as quais correspondem s linhagens moderadamente isognicas provenientes da espcie Mus spretus. Esse retrocruzamento interespecco foi construdo para o mapeamento do lcus pmn atravs da utilizao de marcadores moleculares do tipo microssatlites, que so muito polimrcos entre as linhagens derivadas das espcies Mus spretus e as linhagens de laboratrio. Alm disso, os microssatlites so facilmente utilizveis, permitindo assim localizar o lcus pmn relativamente rpido. Vrias fmeas heterozigotas +/pmn foram cruzadas com machos +/+ STF/Pas ou SEG/Pas para a produo de fmeas F1 +/ pmn? (os machos F1 oriundos desse cruzamento so estreis). As fmeas F1 interespeccas foram retrocruzadas com os machos +/pmn do estoque de origem. Os animais mutantes pmn/pmn foram coletados e utilizados para a anlise dos hapltipos. O segundo cruzamento foi um intercruzamento, realizado com os animais portadores dos marcadores fenotpicos Extra-toe (Xt) e pearl (pe). Esses cruzamentos foram realizados para (1) conrmar a localizao cromossmica da mutao pmn estabelecida com a anlise do resultado do cruzamento interespecco descrito acima e (2) para integrar o lcus pmn num mapa consenso do cromossomo 13 de camundongos, considerando que a mutao Xt tambm pode ser identicada molecularmente atravs da sonda Gli20. Extrao do DNA O bao e, em alguns casos, o crebro e os rins dos animais homozigotos para a mutao pmn foram coletados e

74

Material e Mtodos Utilizados no Estudo da Mutao pmn

congelados imediatamente no nitrognio lquido. Esses rgos foram, em seguida, triturados no nitrognio lquido, e o p obtido foi dissolvido em 5ml de tampo de lise (50mM Tris pH 8; 100mM EDTA pH 8; 1% Sarcosyl). Aps 1 hora de incubao a 55C, foram acrescentados a esse tubo 15l de proteinase K (20 mg/ml) para cada ml de tampo de lise. A mistura obtida foi incubada a noite toda a 55C. Aps esse tempo, foram adicionados ao tubo 20l de RNAse (10mg/ml). Depois de uma incubao a 37C durante 30 minutos, 4 extraes sucessivas foram realizadas (2 de fenol, 1 de fenol/ clorofrmio e 1 de clorofrmio). A soluo de DNA obtida foi, em seguida, submetida a uma dilise (tampo de dilise: 10mM Tris pH 4,7; 0,1mM EDTA) duas vezes durante 24 horas numa temperatura de 4C. A qualidade do DNA extrado foi vericada atravs de um gel de agarose 0,3%. O peso molecular mdio obtido foi julgado satisfatrio quando superior a 40Kb. A concentrao do DNA foi calculada pela medida da densidade tica a 260 nm e o grau de pureza foi apreciado pela comparao com a densidade tica a 280 nm. Reao em cadeia da polimerase (PCR) Iniciadores Os dados relativos aos marcadores microssatlites testados (seqncias, motivos de repetio, condies de amplicao, tamanho do fragmento amplicado) foram descritos em diversas publicaes: AITMAN et al., 1991; CORNALL et al., 1991; DIETRICH et al., 1992; HEARNE et al., 1991; LOVE et al., 1990; MONTAGUTELLI et al., 1991. Condies de amplificao De forma geral, as reaes de amplicao foram efetuadas em 25ml com as concentraes nais seguintes: 10mM Tris pH 8,4; 50mM KCL; 0,1% Tween 20; 200mM de dATP, dCTP, dGTP, dTTP (Pharmacia). A concentrao ideal de Mg2+ foi determinada para cada par de iniciadores. 100ng de DNA e 0,6 U de Taq Polimerase (Amersham) foram utilizados para

75

Material e Mtodos Utilizados no Estudo da Mutao pmn

cada reao. As reaes foram efetuadas nos termocicladores LEP PREM III e TECHNE PHC-3, seja em tubos (40 tubos), seja em placa de Elisa (96 poos). Trs programas diferentes foram utilizados de acordo com os iniciadores: 40 ciclos (1 a 94C, 1 a 55C, 30 a 72C) precedidos por uma desnaturao de 3 a 94C e seguidos de uma extenso nal de 3 a 72C; 10 ciclos (130 a 92C, 1 a 55C, 30 a 72C), 40 ciclos (130 a 94C, 1 a 55C, 30 a 72C), o todo precedido de uma desnaturao, seguida de uma extenso nal; 35 ciclos (45 a 94C, 130 a 55C) precedidos por uma desnaturao de 3 a 94C e seguidos de uma extenso nal de 3 a 72C. Anlise dos produtos de PCR Os produtos das diferentes reaes de amplicao foram separados num gel de agarose 4% (1% agarose, 3% Nusieve) no tampo TBE (90mM Tris, 90mM cido brico, 2mM EDTA) e visualizados na presena de brometo de etdio ou em de gel de acrilamida a 8% a m de melhorar a resoluo das bandas. Anlise do polimorfismo dos microssatlites pela SSCP Para tanto, as reaes de PCR foram feitas num volume de 10l, a composio e concentraes dos reagentes foram as mesmas, a no ser pelo dCTP frio, que foi substitudo pelo dCTP radioativo 33P (0,05mM concentrao nal). Os produtos de PCR foram diludos em EDTA 20mM e SDS 0,1%. Uma amostra de 2l de cada diluio foi misturada a 2ml do tampo de parada do seqenciamento (blue stop). Essas amostras foram, em seguida, desnaturados a 90C durante 5 minutos e colocadas, imediatamente, no gelo. Logo depois, as amostras foram separadas num gel de acrilamida no desnaturante (acrilamida 6%) e visualizados por auto-radiograa.

76

Material e Mtodos Utilizados no Estudo da Mutao pmn

Anlise dos resultados Para cada marcador microssatlite foi examinado a distribuio dos heterozigotos (dois produtos de amplicao de tamanhos diferentes) e a dos homozigotos (um nico produto de amplicao). Os resultados foram analisados por meio de um programa chamado GENE-LINK (MONTAGUTELLI, 1990), que calcula, para cada caso, as probabilidades de ligao entre os loci.

A coleo de DNA do EUCIB


Para estabelecer um mapa gentico de alta resoluo em torno do lcus pmn, utilizou-se a coleo de DNA do European Collaborative Interspecific Backcross. Essa coleo de DNA formada por 982 amostras, ou seja, 982 meioses originou-se de dois cruzamentos em retorno interespeccos complementares: um do tipo (C57BL/6 x Mus spretus) F1 x C57BL/6 e outro do tipo (C57BL/6 x Mus spretus) F1 x Mus spretus. Todas essas amostras foram utilizadas no mapeamento dos marcadores microssatlites disponveis localizados no cromossomo 13. Dessa forma, o mapeamento da sonda Gli20, que corresponde ao lcus Gli3 o qual cosegrega constantemente com pmn (maiores detalhes no estudo de caso), possibilitou integrar o lcus pmn num mapa molecular consenso e de alta resoluo.

Protocolos experimentais utilizados no estabelecimento do mapa fsico


Preparao do DNA de levedura em blocos de agarose (adaptado de BIRREN at al., 1993) O DNA de levedura foi preparado a partir dos esferoplastos com o uso de Novozyme, os quais foram lisados com o dodecil sulfato de ltio. Essa tcnica, que nos permite obter cromossomos de levedura intactos, com cada bloco chegando a conter entre 1 e 2g de DNA, tem um princpio bem simples: uma colnia inoculada num meio seletivo, sem triptofano nem uracila (meio

77

Material e Mtodos Utilizados no Estudo da Mutao pmn

AHC, Current Protocols in Human Genetics, 5.5.7.), e cultivada a 30C. Uma parte dessa pr-cultura foi transferida para um meio rico (YPD, Current Protocols in Human Genetics, 5.5.8.) para a obteno de uma cultura prxima saturao, no dia seguinte (D.O. 600nm = +/- 3). A cultura, em seguida, foi centrifugada e o pellet ressuspenso em uma soluo contendo 10mM Tris-HCl pH 7,5, 50mM EDTA pH 7,5 e lavado uma segunda vez em 10ml de SCE (1 M sorbitol; 0,1 M citrato de sdio pH 5,8; 10 mM EDTA pH 7,5). Aps centrifugao, as clulas foram ressuspendidas num volume de SCE tal que a concentrao em clulas fosse a de 4 x 109 clulas por ml. Acrescentou-se, ento, um volume igual de agarose Seaplaque GTG (FMC) 1,5 % preparada no SCE e contendo 8 mg/ml de Novozyme (Sigma, L3768), e o todo foi conservado a 50C. A mistura foi rapidamente colocada em formas de Plexiglas para formar blocos. Para a formao de esferoplastos, os blocos foram transferidos para uma soluo de SCE contendo 10 mM de DTT e incubados 2 horas a 37C. A lise das clulas foi realizada numa soluo contendo 1% de dodecil sulfato de ltio, 100 mM EDTA e 100 mM Tris-HCl pH 8 durante 16 horas. Os blocos foram, em seguida, lavados no TE (10mM Tris-HCL pH 8; 1 mM EDTA pH 8) e conservados em 10 mM Tris e 10 mM EDTA a 4C. Alguns lotes de Novozyme no so, porm, totalmente puros e podem conter DNAse. Cada lote desse produto deve, ento, ser testado individualmente. Eletroferese e campo pulsado e hibridizao Com a utilizao do aparelho CHEF DR II (Biorad), o qual produz um campo eltrico homogneo a partir de um dispositivo hexagonal de 24 eletrodos, estes so ativados de tal forma que produzem alternativamente dois campos eltricos, nos quais os vetores de corrente formam um ngulo de 120 um em relao ao outro. A concentrao da agarose, a concentrao e a temperatura do tampo, a voltagem, a durao das pulsaes e a durao total da eletroferese so fatores que afetam o resultado nal da migrao (BIRREN et al., 1993).

78

Material e Mtodos Utilizados no Estudo da Mutao pmn

Na prtica, as eletroforeses so realizadas na agarose Seakem GTG (FMC) a uma concentrao de 1% em 0,5 x TBE. As condies da eletroforese so adaptadas ao tamanho do DNA que ser separado, seguindo-se as recomendaes de Birren e Lai (1993). A quantidade de DNA depositada em cada pista no deve ultrapassar 10 mg. Foram utilizados como marcadores de peso molecular os cromossomos de Saccharomyces cerevisiae (16 cromossomos de 225 a 1900 Kb; Yeast chromosome PFG Marker, New England Biolabs) e um padro de concatmeros de fagos Lambda (padro de 48,5 Kb a 1018 Kb, Lambda Ladder PFG Marker, new England Biolabs). Para a anlise em Southern, o DNA, aps a migrao, foi transferido para uma membrana de Nylon N+ da seguinte maneira: aps colorao no brometo de etdio, o DNA foi depurinado em HCl 0,25 N durante 8 minutos; em seguida, foi neutralizado por 30 minutos em 0,5 M Tris-HCl pH 7. A transferncia para a membrana foi realizada em 1,5 M NaCl; 0,5 M NaOH, durante toda a noite. Aps esse tempo, a membrana foi neutralizada em Tris-HCl 0,5 M pH 7 e, em seguida, foi lavada em 2 x SSC (0,33 M NaCl; 0,03 M Na3 -citrato-2H2O). As hibridizaes foram realizadas na presena do tampo de hibridizao Church, a 65C, a noite toda. Aps a hibridizao, os ltros foram lavados no SSC 0,1%, SDS, a 65C. Isolamento das extremidades dos cromossomos artificiais de levedura pela PCR-inversa (adaptado de ARVEILER; PORTEUS, 1991) O DNA do YAC foi digerido por uma enzima cujo stio de restrio est presente no vetor. O DNA digerido foi, em seguida, religado sobre si mesmo. Entre as molculas circulares, algumas possuem um fragmento do vetor flanqueando uma extremidade do YAC. Utiliza-se, em seguida, iniciadores especcos do vetor para amplicar a extremidade do YAC (Figura 37). Na prtica, meio bloco de DNA de levedura (0,5 a 1 ng de DNA) foi digerido durante 3 horas por enzimas apropriadas

79

Material e Mtodos Utilizados no Estudo da Mutao pmn

(brao esquerdo: TaqI, RsaI, EcoRV; brao direito: PstI, RsaI, EcoRV). Recomenda-se acrescentar soro de albumina bovina (BSA) e espermidina. Aps digesto, os blocos foram lavados em 10 mM Tris-HCl pH 7,5 e em 10 mM EDTA e colocados dentro de 200 a 400 l (1/2 ou 1 bloco) do tampo de ligao 1X. Aps incubao durante 10 minutos a 65C, o ATP foi acrescentado a uma concentrao nal de 1 mM, 2 unidades de B-agarose (Calbiochem) e 40 unidades de ligase (Biolabs). A mistura foi incubada durante 2 horas a 37C, seguida de uma hora temperatura ambiente e, nalmente, a noite toda a 14C. Dessa mistura, 5 l foram utilizados para a PCR. A reao de amplicao foi realizada em 100l com 100 ng de cada iniciador: Brao esquerdo: 1. GAATTGATCCACAGGACGGG 2.GCCAGTTGGTTTAAGGCGC Brao direito: 1. GGAAGAACGAAGGAAGGAGC 2. GCCCGATCTCAAGATTACG Condio de amplicao: 95C, 5 minutos, seguido de 30 x 94C 45 segundos; 60C, 1 minuto; 72C, 2 minutos. Os produtos foram analisados em gel de agarose e clonados. Mapa de restrio do contig de YAC O mapa de restrio do contig foi construdo atravs da execuo de digestes totais e parciais do DNA dos YAC. Na prtica, os blocos so lavados quatro vezes durante 30 minutos no TE a 40C e equilibrados no tampo de restrio 1X durante 60 minutos no gelo (utilizar 300 l nais para cada bloco de 100ml). O tampo de restrio 1X , em seguida, substitudo por uma soluo de digesto completa, ou seja, tampo de restrio 1X, soro de albumina bovina 500 mg/ml, espermidina nas respectivas concentraes (5 mM para os tampes de restrio cuja concentrao em sal seja de 50-100 mM; 10 mM para

80

Material e Mtodos Utilizados no Estudo da Mutao pmn

aqueles cuja concentrao em sal seja superior a 100 mM), 1 mM de DTT e um nmero adequado de unidades de enzima. No se deve colocar a espermidina nas digestes com a enzima SfiI. A reao colocada um hora no gelo antes da incubao temperatura adequada. As digestes completas so realizadas a noite toda. Para reaes parciais, utiliza-se o mesmo nmero de unidades de enzima colocado na digesto completa, porm o tempo de incubao modicado. Em geral, tempos de incubao entre 8 a 20 minutos so sucientes para se obterem bons resultados na digesto parcial (HAMVAS et al., 1994). As condies de digesto parcial devem ser testadas para cada preparao de DNA em bloco de agarose. As reaes so paradas acrescentando-se ao tubo 500l de EDTA 500mM no gelo. Recomenda-se lavar os blocos no tampo de eletroforese antes de carregar o gel. Aps a eletroforese e transferncia na membrana de Hybond-N+, os produtos de digesto parcial so revelados atravs da sonda de um fragmento do DNA que reconhea ou o brao direito do pYAC4 (fragmento PvuII/ SalI de 1.4 Kb proveniente da digesto do plasmdio pBR322) ou o brao esquerdo do pYAC4 (fragmento PvuII/ EcoRV de 2,3 Kb proveniente da digesto do plasmdio pBR322). Os fragmentos provenientes da digesto total so revelados com o DNA genmico de camundongos ou o DNA Cot-1 (Life Technologies). Preparao do DNA genmico a partir do BAC A preparao do DNA genmico a partir do BAC idntica a uma miniprep de DNA a partir das bactrias. As clulas cultivadas durante toda a noite a 37C no meio LB + cloramfenicol so centrifugadas por 30 minutos (1,5 ml de clulas). O meio descartado e o pellet ressuspendido em 100 l da soluo I (50 mM glucose; 20 mM Tris-HCl pH 8; 10 mM EDTA pH 8). Os tubos so, ento, colocados no gelo e a eles so acrescentados 200 l da soluo II (0,2 N NaOH; 1% SDS), agitando-os de 7 a 9 vezes, quando so recolocados no gelo.

81

Material e Mtodos Utilizados no Estudo da Mutao pmn

Acrescentam-se, em seguida, 150 l da soluo III (acetado de potssio 3 M pH 4,8) e os tubos so agitados novamente. Seguese uma centrifugao temperatura ambiente durante 1 minuto e o sobrenadante transferido para um novo tubo. Segue-se uma precipitao com etanol. Os pellets so ressuspendidos em 20 l de TE e so pegos 5 l para a digesto enzimtica. A migrao em campo pulsado foi feita durante 18 horas. A durao das pulsaes foi estabelecida em 5 segundos durantes 6 horas no comeo; em seguida, ela passou a 10 segundos durantes 6 horas e, nalmente, 15 segundos durantes 6 horas. Para essa migrao utilizou-se um gel de agarose 1% e 0,5 x TBE a 14C.

Isolamento e caracterizao das seqncias codificadoras


RT-PCR O RNA total foi extrado utilizando-se o mtodo de uma nica etapa descrito por Chomcznski e Sacchi (1987) e adaptado pela Biolabs. As reaes de RT-PCR foram realizadas essencialmente como descritas por Kawasaki e outros (1990). Dois mg de RNA total foram tratados com uma unidade de DNAseI (Life Technologies) durante 30 minutos temperatura ambiente. A reao foi parada acrescentando-se ao tubo 2 mM de EDTA e incubado durante 10 minutos a 65C. Essa tcnica tambm pode ser iniciada utilizando-se 200 ng de RNA poly(A+), o que evita o tratamento posterior com a RNAse. A primeira ta de cDNA sintetizada atravs da transcriptase reversa Superscript II (Life Technologies): 200 unidades de Superscript so colocadas ao RNA na presena de 10 picomoles de hexmeros aleatrios e 10 picomoles de cada dNTPs. A reao de transcrio realizada a 37C (ou 42C) durante 30 minutos num volume nal de 20 l. Dois l da reao so utilizados para a amplicao pela PCR com iniciadores especcos do lcus estudado. Toda reao de transcrio reversa do RNA deve ter uma reao de PCR controle que no contenha a RT-PCR. Os produtos de amplicao so

82

Material e Mtodos Utilizados no Estudo da Mutao pmn

revelados pela hibridizao atravs de uma sonda especca, aps migrao em gel de agarose e transferncia em membrana de nylon Hynbond-N+. Amplificao dos xons O princpio da captura dos xons foi apresentado na introduo e pode ser visualizado na Figura 38. O vetor pSPL3 O vetor de expresso pSPL3 (Figura 39) contm uma origem de replicao para a bactria E. coli, um gene de resistncia a ampicilina e um segmento do vrus SV40 para replicao e transcrio das clulas eucariotas COS-7. Um stio de clonagem mltipla foi inserido no ntron do gene Tat do HIV. Esse ntron est cercado pelos stios doador e aceptor de emenda. Esse conjunto, por sua vez, est cercado das seqncias exnicas do gene Tat e do gene da -globina. Um dos inconvenientes desse vetor a presena de um stio crtico de splicing. Caso ocorra um processamento dos ntrons atravs deste stio, o resultado ser um xon dito quimrico. Os produtos dos processamentos das seqncias do vetor sozinho, das seqncias desprovidas de xon genmico e tambm daquelas provenientes do processamento quimrico, podem ser eliminados atravs de uma digesto enzimtica. Para a clonagem no vetor pSPL3, o DNA do BAC digerido pela enzima de restrio BamHI e BglIII (ou somente BamHI) e ligado ao vetor que foi igualmente digerido por BamHI e desfosforilado. Um controle realizado ligando-se o vetor a ele mesmo, sem inserto. Aps eletroporao, 100 l da reao so semeados no meio de cultura LBA, o restante da soluo de clonagem utilizado na cultura lquida. Avaliamos a qualidade da clonagem comparando a ecincia, ou seja, o nmero de colnias obtidas entre a clonagem-teste e o controle. Uma

83

Material e Mtodos Utilizados no Estudo da Mutao pmn

clonagem considerada eciente quando o nmero de colnias obtidas na clonagem-teste 10 vezes superior ao do controle. Transfeco das clulas COS-7 As clulas COS-7 so originadas dos rins de um macaco verde, as quais foram transformadas, por derivado do SV40 defeituosos, no stio correspondente origem de replicao. Essas clulas assim modicadas permitem a replicao ativa do vetor que, como o pSPL3, contm as seqncias ARS do SV40 ausentes nas clulas hospedeiras. Para tanto, 1l do DNA plasmidiano transferido para as clulas COS-7 atravs do mtodo de lipotransfeco, de acordo com o protocolo da empresa (reativo Lipofectase, Life Technologies). Observamos que qualquer contaminao das clulas COS por micoplasmas responsvel pela perda total do experimento. Dessa forma, de suma importncia que seja vericado regularmente se essas clulas no esto contaminadas pelos micoplasmas. Para tanto, o kit comercial Mycoplame PCR Primer Set (Stratagene) permite o controle delas via PCR. Isolamento do RNA citoplasmtico O RNA citoplasmtico isolado 48 a 72 horas aps a transfeco pelo mtodo de extrao utilizando o agente qumico tiocianato de guanidina e fenol-clorofrmio (CHOMCZYNSKI; SACCHI, 1987). Amplificao e clonagem dos xons capturados Os RNA produzidos pela transcrio do vetor pSPL3 podem ser amplicados pelos iniciadores especcos do vetor (SA2, SD6, dUSD2 e dUSA4, Figura 39). As seqncias de cada um deles so as seguintes: SA2: ATCTCAGTGGTATTTGTGATC (complementar s bases 3245 a 3275 do vetor pSPL3)

84

Material e Mtodos Utilizados no Estudo da Mutao pmn

SD6: TCTGAGTCACCTGGACCACC (complementar s bases 607 a 626 do vetor pSPL3) dUSD2: CUACUACUACUAGTGAACCTGCACTGTTGACAAGCT (complementar s bases 651 a 671 do vetor pSPL3) dUSA4: CUACUACUACUACACCTGAGGAGTGAATTGGTCG (complementar s bases 3178 a 3199 do vetor pSPL3) A sntese da primeira ta de cDNA realizada utilizando-se o iniciador SA2. Aps tratamento da ta de RNA com RNAaseH, a ta simples de DNA convertida em dupla por um pequeno nmero de ciclos de PCR atravs dos iniciadores SA2 e SD6. Para serem eliminados os produtos oriundos do processamento somente do vetor ou os produtos falsos positivos (processamento quimrico), necessrio proceder a uma digesto completa com a enzima BstXI. Nessa etapa, a qualidade da enzima fundamental para a ecincia do experimento. Uma parte do produto de digesto , em seguida, utilizado numa segunda amplicao pela PCR com os iniciadores internos dUSD2 e dUSA4, que contm dUMP, para posterior clonagem no vetor pAMP10 (Life Technologies), o qual permite a clonagem dos produtos de PCR sem passar pela etapa de puricao. Se os clones obtidos possuem insertos maiores que 177 pb, o que corresponde distncia entre os iniciadores dUSD2 e dUSA4, eles possuem a priori um xon. Freqentemente observamos a produo de clones contendo fragmentos do vetor (seqncias do HIV e globina), talvez em razo do stio crtico presente no vetor pSPL3. Por isso, antes de se proceder ao estudo dos xons amplicados, uma sondagem atravs de hibridizao com sondas de fragmentos de HIV e do vetor pSPL3 realizada nos xons obtidos. Aqueles que reagirem positivamente hibridizao so eliminados.

85

Material e Mtodos Utilizados no Estudo da Mutao pmn

Sequenciamento
Mtodos As reaes de seqenciamento foram realizadas de acordo com o mtodo de Sanger, atravs do kit comercial Sequenase II (USB), para um seqenciamento manual. Anlise das seqncias As seqncias obtidas foram introduzidas num programa chamado Genework. Cada seqncia foi comparada s j existentes no banco de dados via BLAST, acessvel por email no National Center for Biological Information, NCBI (blast@ncbi. nlm.nih.gov). Algumas das seqncias tambm foram analisadas com o programa GRAIL, tambm acessvel pela Internet, que prediz a existncia de seqncias codicadoras.

86

REFERNCIAS BIBLIOGRFICAS
AITMAN T.J.; HEARNE C.M.; MCALEER M.A.; TODD J. A. (1991). Mononucleotide repeats are an abundant source of length variants in mouse genomic DNA. Mammalian Genome, 1: 206-210. ALFANDARI D.; DARRIBRE T. (1994). A simple PCR method for screening cDNA libraries. PCR Methods Applic., 4: 46-49. ALTSCHUL S.F.; GISH W.; MILLER W.; MYERS E.W.; LIPMAN D.J. (1990). Basic local alignment search tool. J. Mol. Biol., 215: 403-410. AMARACADI L.; KING M. (1994). A rapid and efcient, nonradioactive method for screening recombinant DNA libraries. BioTechniques, 16: 98-103. ANTEQUERA F.; BIRD A. (1993). Number of CpG islands and genes in human and mouse. Proc. Natl. Acad. Sci. USA, 90: 11995-11999. ARVEILER B.; PORTEOUS D. J. (1991). Amplication of end fragments of YAC recombinants by inverse-polymerase chain reaction. Technique, 3: 24-28. AUSUBEL, F. M.; BRENT, R.; KINGSTON, R. E.; MOORE, D. D.; SEIDMAN, J. G.; SMITH, J. A.; STRUHL, K. (1993). Current Protocols in Molecular Biology. Wiley Interscience, New York. BARBOSA MD; NGUYEN QA; TCHERNEV VT; ASHLEY JA; DETTER JC; BLAYDES SM; BRANDT SJ; CHOTAI D; HODGMAN C; SOLARI RC; LOVETT M ; KINGSMORE SF (1996). Identication of the homologous beige and ChediakHigashi syndrome genes. Nature, 382 (6588): 262-5.

87

Referncias Bibliogrficas

BEIER DR. Sequence-based analysis of mutagenized mice (2000). Mammalian Genome, 11: 594-597. BENDER W.; SPIERER P.; HOGNESS D. (1983). Chromosomal walking and jumping to isolate DNA from the Ace and rosy loci and the bithorax complex in the Drosophila melanogaster. J. Mol. Biol., 168: 17-33. BICKMORE W.A.; BIRD A.P. (1992). The use of restriction endonucleases to detect and isolate genes from mammalian cells. Methods Enzymol., 216: 224-243. BIRREN B.; LAI A. P. (1993). Pulsed eld gel electrophoresis a practical guide. Academic Press, San Diego, CA. BONHOMME F. ; BENMEDHI J. ; BRITTON Davidian J. ; MARTIN S. (1979). Analyse gntique de croisements interspciques Mus musculus L. x Mus spretus Lataste: liaison de Adh-1 avec Amy-l sur lc chromosomc 3 et de Es-14 avec Mod-1 sur le chromosome 9, C. R. Acad. Sci. Paris, 289: 545-548. BONHOMME F. ; GUNET J.L. ; CATALAN J. (1992). Prsence dun facteur de strilite male, hst-2, sgrgeant dans les croisements interspciques Mus musculus L x Mus spretus et li Mod-1 et Mpi sur le chromosome 9, C. R. Acad. Sci. Paris, 294: 691-693. BOSTEIN D.; WHITE R.; SKOLNICK M. (1980). Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet, 32: 314-331. BREEN, M.; DEAKIN, L.; MACDONALD, B.; MILLER, S.; SIBSON, R.; TARTTELIN, E.; AVNER, P.; BOURGARD, F.; GUNET, J. L.; MONTAGUTELLI, X.; POIRIER, C.; SIMON, D.; TAILOR, D.; BISHOP, M.; KELLY, M.; RYSAVY, F.; RASTAN, S.; NORRIS, D.; SHEPHERD, D.; ABBOTT, C.; PILZ, A.; HODGE, S.; JACKSON, I.; BOYD, Y.; BLAIR, H.; MASLEN, G.; TODD, J. A.; REED, P. W.; STOYE, J.; ASHWORTH, A.; MCCARTHY, L.; COX, R..; SCHALWYK, L.; LEHRACH,

88

Referncias Bibliogrficas

H.; KLOSE, J.; GANGADHARAN, U.; BROWN, S. (1994). Towards high resolution maps of the mouse and human genomes - a facility for ordering markers to 0.1 cM resolution. Hum. Mol. Genetics, 3: 621-627. BRENNAN M.; HOCHGESCHWENDER U. (1995). Commentary: so many needles, so much hay. Hum. Mol. Genel, 4: 153156. BRENNER S.; ELGAR G.; SANDFORD R.; MACRAE A.; VENKATESH B.; APARICIO S. (1993). Characterization of the puffersh (Fugu) genome as a compact model vertebrate genome. Nature, 366: 265-268. Brown SDM, Peters J. Combining mutagenesis and genomics in the mouse closing the phenotype gap (1996). TRENDS in Genetics, 12(11): 433-435. BRUNIALTI A.L.; POIRIER C.; SCHMALBRUCH H.; GUNET J.L. (1995). The mouse mutation Progressive Motor Neuronopathy (pmn) maps to chromosome 13. Genomics, 29: 131-135. BRZUSTOWICZ, L. M.; LEHNER, T.; CASTILLA, L. H.; PENCHASZADEH, G. K.; WILHELMSEN, K. C.; DANIELS, R.; DAVIES, K. E.; LEPPERT, M.; ZITER, F.; WOOD, D.; DUBOWITZ, V.; ZERRES, K.; HAUSMANOWAPETRUSEWICZ, I.; OTT, J.; MUNSAT, T. L.; GILLIAM, T.C. (1990). Genetic mapping of chronic childhood-onset spinal muscular atrophy to chromosome 5q11.2-13.3. Nature, 344: 540-541. BUCKLER A. J.; CHANG D. D.; GRAW S.L.; HARBER D. A.; SHARP P. A.;HOUSMAN D.E. (1991). Exon amplication: a strategy to isolate mammalian genes based on RNA splicing. Proc. Natl. Acad. Sci. USA, 88: 4005-4009. BURKE D.T.; CARLE C.F.; OLSON M.V. (1987). Cloning of large segments of exogenous DNA into yeast by means of articial chromosome vectors. Science, 236: 806-812.

89

Referncias Bibliogrficas

BUSTAMANTE C.; GURRIERI S.; SMITH S. (1993). Towards a molecular description of pulse-eld gel electrophoresis. Trends Biotech, 11: 23-30. CARLE G.; FRANK M.; OLSON M. (1986). Electrophoretic separation of large DNA mulecules by periodic inversion of the electric eld. Science, 232- 65-68. CHARTIER F.; KEER J.; SUTCLIFFE M.; HENRIQLLES D.; MILEHAM P.; BROWN S. (1992). Construction of a mouse yeast articial chromosome library in a recombination-decient strain of yeast. Nature Gene, 1: 132-136. CHOMCZYNSKI P.; SACCHI N. (1987) Single-step method of DNA isolation by acid guadinium thiocyanate-phenolchlorophorm extraction. Anal. Biochem, 162: 156-159. CHU G.; YOLLRATH D.; DAVIS R. (1986). Separation of large DNA molecules by contour-clamped homogenous electric elds. Science, 234: 1582-1585. CHUMAKOV I.; RIGAULT P.; GUILLO S. et al. (1992). Continuum of overlapping clones spanning the entire human chromosome 21q. Nature, 359: 380-386. COLLINS F. (1995) Positional cloning moves from perditional to traditional. Nature Genet, 9: 347-350. COLLINS F.; WEISSMAN S. (1984). Directional cloning of DNA fragments at a large distance from an initial probe a circularization method. Proc. Natl. Acad. Sci. USA, 81; 6812 6816. COLLINS P. (1992). Positional cloning: lets not call it reverse anymore, Nature Genet,1: 3-6. COPELAND N.; JENKINS N.; GILBERT D. et al. (1993). A genetic linkage map of the mouse: current applications and future prospects. Science, 262: 57-66.

90

Referncias Bibliogrficas

CORNALL, R. J.; AITMAN, T. J.; HEARNE C. M. and TODD, J. A. (1991). The generation of a library of PCR-analysed microsatellite variants for genetic mapping of the mouse genome. Genomics, 10: 874-881. COX R, HUGILL A, SHEDOVSKY A, NOVEROSKE J, BEST S, JUSTICE M, LEHRACH H, DOVE W (1998). Contrasting effects of ENU induced embryonic lethal mutations of the quaking gene. Genomics, 57: 333341. CRAIG J.; BICKMORE W. (1994). The distribution of CpG islands in mammalian chromosomes. Nature Gene., 7: 376-382. DE ANGELIS MH, FLASWINKEL H, FUCHS H, RATHKOLB B, SOEWARTO D, MARSCHALL S, HEFFNER S, PARGENT W, WUENSCH K, JUNG M, et al. (2000). Genome-wide, largescale production of mutant mice by ENU mutagenesis. Nature Genetics, 25: 444-447. DES PORTES V. ; COULPIER M.; MELKI J., DREYFUS P.A. (1994). Early detection of mouse woobler mutation: a model of pathological motoneuro death. Neuroreports, 5: 1861-1864. DIETRICH W.; MILLER J.; STEEN R. et al. (1994). A genetic map of the mouse with 4006 simple sequence length polymorphisms. Nature Genet, 7: 220-225. DIETRICH W.F.; KATZ H.; LINCOLN S.E.; SHIN H.S.; FRIEDMAN J.; DRACOPOLI N.; LANDER E.S. (1992). A genetic map of the mouse suitable for typing intraspecic crosses. Genetics, 131: 423-448. DIETRICH, W.; H. KATZ; S. E. LINCOLN; H. S. SHIN, J. FRIEDMAN, N. C. DRACOPOLI and E. S. LANDER. (1992). A genetic map of the mouse suitable for typing intraspecic crosses. Genetics, 131: 423-447. DIETRICH WF, COPELAND NG, GILBERT DJ, MILLER JC, JENKINS NA, LANDER ES. (1995). Mapping the mouse

91

Referncias Bibliogrficas

genome: current status and future prospects. Proc Natl Acad Sci USA., 92(24): 10849-53. DOOLITTLE D.P.; DAVISSON M.T.; GUIDI J.N.; GREEN M.C. (1996). Catalog of mutant genes and polymorphic loci. Genetic Variants and Strains of the Laboratory Mouse, Third Edition, Oxford Press, Oxford, pp. 1256-1311. DUYK G.; KIM S.; MYERS R.; COX D. (1990). Exon trapping: a genetic screen to identify candidate transcribed sequences in cloned mammalian genomic DNA. Proc. Natl. Acad. Sci. USA, 87: 8995-8999. ELVIN P.; BUTLER R.; HEDGE P. (1992). Transcribed sequences within YACs: HTF island cloning and cDNA library screening, dans: Techniques for the analysis of complex genomes. Editado por R.Anand, Academic Press, London, pp 155-171. FLETCHER C.; NORMAN D.; HEINTZ N. (1991). Genetic mapping of meander tail, a mouse mutation affecting cerebellar development. Genomics, 9: 647 655. FRAZER K.; NARLA G.; ZHANG J.; RUBIN E. (1995). The apolipoprotein(a) gene is regulated by sex hormones and acute-phase inducers in YAC transgenic mice. Nature Genet, 9: 424-431. FROHMAN M.A.; DUSH M.K.; MARTIN G.R. (1988). Rapid production of full-length cDNAs from rare transcripts: amplication using a single gene-specic oligonucleotide primer. Proc. Natl. Acad. Sci. USA, 85: 8998-9002. GERAGTHY M.; BRODY L.; MARTIN L.; MARBLE M.; KEARNS W.; PEARSON P.; MONACO A.; LERACH H.; VALLE D. (1993). The isolation of cDNAs from OATLI at Xp11.2 using a 480 kb YAC. Genomics, 16: 440-446. GIBSON F.; WALSH J.; MBURU P.; VARELA A.; BROWN K.; ANTONIO M.; BEISEL K.; STEEL K.; BROWN S. (1995).

92

Referncias Bibliogrficas

A type VII myosin encoded by the mouse deafness gene shaker-l. Nature, 374: 62-64. GODARD A.L.B.; GUNET J. L. (1999). Modelos animais de doenas humanas. Bio Tecnologia Cincia & Desenvolvimento, 9: 96-100. GOODFELLOW P.; LOVELL-BADGE R. (1993). SRY and sex determination in mammals. Ann. Rev. Gen., 27: 71-92. GREEN E.; OLSON M. (1990). Chromosomal region of the cystic brosis gene in yeast articial chromosomes: a model for human gene mapping. Science, 250: 94-98. GREEN E.; RIETHMAN H.; DUTCHIK J.; OLSON M. (1990). Detection and characterization of chimeric yeast articialchromosome clones. Genomics, 11: 658-669. GREEN M. (1995). Gene Mapping. The mouse in biomedical research, vol. I, Academic Press, p. 105-117. GREEN, E. (1993). Physical mapping of human chromosomes: generation of chromosome specic sequence-tagged sites. Methods in molecular genetics: gene and chromosome analysis (Part A), vol. 1, Academic Press, New York, p. 192210. GUNET J. L. (1998). Wild mice as a source of genetic polymorphism. Pathol Biol., 46 (9): 685-8. GUNET J. L. (2006). The mouse genome. Genome Research, 15(12):1729-1740. GUNET J. L.; BONHOMME F. (2003). Wild mice: an everincreasing contribution to a popular mammalian model. Trends Genet, 19(1): 24-31. GUIDE TO HUMAN GENOME COMPUTING (1994). Editado por Bishop M., Academic Press.

93

Referncias Bibliogrficas

HAMVAS R.; FRANCIS F.; COX R.; NIZETIC D.; GLODSWORTHY M.; BROWN S.; LENRACH H. (1994). Papid restriction analysis of YAC clones. Nucleic Acids Res, 22: 1318-1319. HEARNE, C. M.; MCALEER, M. A.; LOVE, J. M.; AITMAN, T. J.; CORNALL, R. J.; GHOSH, S.; KNIGHT, A. M.; PRINS, J. B.; TODD, J. A.. (1991). Additionnal microsatellite markers for mouse genome mapping. Mammalian Genome, 1: 273-282. HERRMANN B.; BARLOW D.; LEHRACH H. (1987). An inverted duplication of more than 650 kbp in mouse chromosome 17 mediates unequal but homologous recombination between chromosomes heterozygous for a large inversion. Cell, 48: 813-825. HERRMANN B.; LABEIT S.; POUTSKA A. M.; KING T.; LEHRACH H. (1990). Cloning of the T gene required in mesoderm formation of the mouse. Nature, 343: 617-657. JEFFREYS A.; WILSON V.; THEIN S. (1985). Hypervariable minisatellite regions in human DNA. Nature, 314 67-73. JUSTICE MJ, CARPENTER DA, FAVOR J, NEUHUSER-KLAUS A, ANGELIS MH, SOEWARTO D, MOSERA, CORDES S, MILLER D, CHAPMAN V, WEBER JS, RINCHIK EM, HUNSICKER PR, RUSSEL WL, BODE VC. Effects of ENU dosage on mouse strains (2000). Mammalian Genome, 11: 484-488. KAPLAN A. (1973). The Conduct of Inquiry. Methodology for Behavioral Sciences. Aylesbury, Buckinghamshire: International Textbook Company, In: Belzung C.; Griebel G. (2001). Measuring normal and pathological anxiety-like behavior in mice: a review. Behavioral Brain Research, 125: 141-149. KASARSKIS A, MANOVA K, ANDERSON K (1998). A phenotypebased screen for embryonic lethal mutations in the mouse. Proceedings of National Academy of Sciences, 95: 7485 7490.

94

Referncias Bibliogrficas

KAWASAKI E. S. (1990). Amplication of RNA, dans: PCR protocols: a guide to methods and applications. M.A. Innis et al., Academic Press, San Diego, CA, p. 21-27. KILE B. T.; HILTON D. J. (2005). The art and design of genetic screens: mouse. Nature Reviews Genetics, 6(7):557-567. KINGSMORE S.F.; GIROS B.; SUH D.; BIENIARZ M.; CARON M.G.; SELDIN, M.F. (1994). Glycine receptor bete-subunit gene mutation in spastic mouse associated with LINE-1 element insertion. Nat. Genet, 7: 136-141. KORN B.; SEDLACEK Z.; MANCA A.; KIOSCHIS P.; KONECKI D.; LEHRACH H.; POUSTKA A. (1992). A strategy for the selection of transcribed sequences in the Xq21 region. Hum. Mol. Genet, 1: 235-242. KRIZMAN D. B.; BERGET S. M. (1993). Efcient selection of 3terminal exons from vertebrate DNA. Nucleic Acids Res., 21: 5198-5202. KURNIT D.; SEED B. (1990). Improved genetic selection for screening bacteriophage libraries by homologous recombination in vitro. Proc. Natl. Acad. Sci. USA, 87: 3166-3169. KUSUMI K.; SMITH J.; SEGRE J.; KOOS D.; LANDER E. (1993). Construction of a large insert yeast artitial chromosome (YAC) library of the mouse genome. Mamm. Genome, 4: 391-392. LANDER E. S.; LINTON L. M. et al. (2001). Initial sequencing and analysis of the human genome. Nature, 409: 860-921. LARIN Z.; MONACO A. P.; LEHRACH H. (1991). Yeast articial chromosome libraries containing large inserts from mouse and human DNA. Proc. Natl. Acad. Sci. USA, 88: 41234127.

95

Referncias Bibliogrficas

LARSEN F.; GUNDERSEN G., LOPEZ R., PRYDZ H. (1992.a). CpG island as gene markers in the human genome. Genomics, 13: 1095-1107. LARSEN F., GUNDERSEN G.; PRYDZ H. (1992.b). Choice of enzymes for mapping based on CpG islands in the human genome. Genet. Anal. Tech. Appl., 9: 80-85. LEFEBVRE, S.; BRGLEN, L.; REBOULLET, S.; CLERMONT, O.; BURLET, P.; VIOLLET, L.; BENICHOU, B.; CRUAUD, C.; MILLASSEAU, P.; ZEVIANI, M..; LE PASTILIER, D.; FRZAL, J.; COHEN, D.; WIESSENBACH, J.; MUNNICH, A.; MELKI, J. (1995). Identication and characterization of a Spinal Muscular Atrophy. Determining Gene. Cell 80: 1-20. LINDSAY S.; BIRD A. P. (1987). Use of restriction enzymes to detect potential gene sequences in mammalian DNA. Nature, 327: 336-338. LITLE R.; PILIA G.; JONHOSON S.; ZUCCI I.; DURSO M.; SCHLESSINGER D. (1992). Yeast articial chromosomes spanning 8 Mb and 15 cM of human cytogenetic band Xq26. Proc. Natl. Acad. Sci. USA, 89 177-181. LIU P.; LEGERSKI R.; SICILLIANO M. (1989). Isolation of human transcribed sequence from human-rodent somatic cell hybrids. Science, 246; 813-815. LOVE, J. M.; KNIGHT, A. M.; MCALEER, M. A.; TODD, J. A. (1990). Towards construction of a high resolution map of the mouse genome using PCR-analysed microsatellites. Nucleic Acids Res, 18 (14): 4123-4130. LOVETT M.; KERE J.; HINTON L. M. (1991). Direct selection: a method for the isolation of cDNAs encoded by large genomic regions. Proc. Natl. Acad. Sci. USA, 88: 96289632.

96

Referncias Bibliogrficas

LDECKE H. J.; SENGER G.; CLAUSSEN U.; HORSTHEMKE R. (1990). Construction and characterization of band-specic DNA libraries. Hum. Genet., 84: 512-516. LUDOLPH A. C. (1996). Animal models for motor neuron diseases: research directions. Neurology, 47(6 Suppl 4):S228-S232. LYON M. F. (2002). A Personal History of the Mouse Genome. Annual Reviews in Genomics and Human Genetics, 3: 1-16. MARSHALL B.; TAY G.; MARLEY J.; ABRAHAM L.; DAWKINS R. (1993). Analysis of MCH genomic structure and gene content between HLA-B and TNF using yeast articial chromosomes. Genomics, 17:435-441. MARTIN N.; JAUBERT J.; GOUNON P.; SALIDO E.; HAASE G.; SZATANIK M.; GUNET J. L. (2002). A missense mutation in Tbce causes progressive motor neuronopathy in mice. Nat Genet., 32(3): 443-7. MARTIN N.; JAUBERT J.; GLASER P.; SZATANIK M.; GUNET J.L. (2001). Genetic and physical delineation of the region overlapping the progressive motor neuropathy (pmn) locus on mouse chromosome 13. Genomics, 75(1-3): 9-16. MAULE J. ; PORTEUS D. ; BROOKES A. (1994). An improved method for recovering intact pulsed eld gel puried DNA, of at least l.6 megabases. Nuclcic Acids Res., 22: 32453246. MCCARTHY L.; HUNTER K.; SCHALKWYK L.; RIBA L.; ANSON S.; MOTT R.; NEWELL W.; BRULEY C.; BAR I.; RAMU E.; HOUSMAN D.; COX R.; LEHRACH H. (1995). Efcient high resolution genetic mapping of mouse IRS-PCR products, towards integrated genetic and physical mapping of the mouse genome, Proc. Natl. Acad. Sci. USA, 92: 5302-5306. MCKINNEY, W.T. (1984). Animal models of depression: an overview. Psychiatric Development, 2: 77-96, In: Belzung

97

Referncias Bibliogrficas

C.; Griebel G. (2001). Measuring normal and pathological anxiety- like behavior in mice: a review. Behavioral Brain Research, 125: 141-149. MELKI, J.; ABDELHAK, S.; SHETH, P.; BACHELOT, M. F.; BURLET, P.; MARCADET, A.; AICARDI, J.; BAROIS, A.;CARRIRE, J. P.; FARDEAU, M.; FONTAN, D.; PONSOT, G.; FERRIRE, G.; LANZI, G.; OTTOLINI, A.; BABRON, M. C.; COHEN, D.; HANAUER, A.; CLERGET-DARPOUX, F.; LATHROP, M.; MUNNICH, A; FRZAL, J. (1990). Gene for chronic proximal spinal muscular atrophies maps to chromosome 5q. Nature, 344: 767-768. MIKI Y.; SWENSEN J.; SHATTUCK-EIDENS D. et al. (1994). A strong candidate for the breast and ovarian cancer susceptibility gene BCRA1. Science, 266: 66-71. MONACO A.; LARIN Z. (1994). YACs, BACs, PACs and MACs: articial chromosomes as research tools. Trends Biotech., 12: 280-286. MONACO A.; NEVE R.; COLLETTI-FEENER C.; BERTELSON C.; KURNIT D.; KUNKEL L. (1986). Isolation of cDNAs for portions of the Duchenne muscular dystrophy gene. Nature, 323: 646-650. MONTAGUTELLI, X. (1990). Gene-Link: A program in Pascal for backcross genetic linkage analysis. J. Heredity, 81: 490-491. MONTAGUTELLI, X.; T. SERIKAWA; J. L. GUNET. (1991). PCRanalysed microsatellites: data concerning laboratory and wild-derived mouse inbred strains. Mammalian Genome, 1 : 255-259. MOORE, K. J. (1999). Utilization of mouse models in the discovery of human disease genes. Drug Discovery Today, 4(3): 123-128. NOLAN P, PETERS J, VIZOR L, STRIVENS M, WASHBOURNE R, HOUGH T, WELLS C, GLENISTER P, THORNTON C,

98

Referncias Bibliogrficas

MARTIN J, FISCHER E, ROGERS D, HAGAN J, REAVILL C, GRAY I, WOOD J, SPURR N, BROWNE M, RASTAM S, HUNTER J, BROWN SDM (2000). Implementation of a large-scale ENU mutagenesis program: towards increasing the mouse mutant resource. Mammalian Genome, 11: 500-506. NOVEROSKE JK, WEBER JS, JUSTICE MJ (2000). The mutagenic action of N-ethyl-N-nitrosourea in the mouse. Mammalian Genome: 11, 478-483. ORITA, M.; IWAHANA, H.; KANAZAWA, H.; HAYACH, K.; SEKIYA, T; (1989). Detection of polymorphisms of human DNA by gel electrophoresis as single-strand conformational polymorphism. Proc. Natl. Acad. Sci. USA, 86; 2766-2770. ORKIN, S. H. (1986). Reverse genetics and human disease. Cell, 47(6): 845-50. PANG, Z.; PARDINAS, J.R.; DERMODY, J.; OZER, H. L. (1992). Dinucleotide repeat polymorphism in the INHBA gene. Hum. Mol. Genet., 2 (11): 1982. PARIMOO, S.; PATANJALI, S. R.; SHUKLA, H.; CHAPLIN, D. D.; WEISSMAN, S. M.; (1991). cDNA selection: efcient PCR approach for the selection of cDNAs encoded in large chromosomal DNA fragments. Proc. Natl. Acad. Sci. USA, 88; 9622-9627. PARVARI, R.; HERSHKOVITZ, E.; GROSSMAN, N.; GORODISCHER, R.; LOEYS, B.; ZECIC, A.; MORTIER, G.; GREGORY, S.; SHARONY, R.; KAMBOURIS, M.; SAKATI, N.; MEYER, B. F. (2002). Mutation of TBCE causes hypoparathyroidism-retardation-dysmorphism and autosomal recessive Kenny-Caffey syndrome. Nature Genet., 32: 448-452. PERKINS AS (2002). Functional Genomics in the mouse. Functional Integrated Genomics, 2: 81-91.

99

Referncias Bibliogrficas

PETERS, J.; SEARLE, A. G. (1996). Linkage and synteny homologies in mouse and man. Genetic Variants and Strains of the Laboratory Mouse, Third Edition, Oxford Press, Oxford, p. 1256-1311. POUSKA, A.; LEHRACH, H.; (1986). Jumping libraries and linking libraries the next generation of molecular tools in mammalian genetics. Trends Genet., 2: 174- 179. RILEY, J.; BUTLER, R.; OGILVIE, D.; FINNIEAR, R.; JENNER, D.; POWEL, S.; ANAND, R.; SMITH, J.; MARKHAM, A.; (1990). A novel, rapid method for the isolation of terminal sequences from yeast articial chromosome (YAC) clones. Nucleic Acids Res., 18: 2887-2890. ROBERTS, R.; COFFEY, A.; BOBROW, M.; BENTLEY, D.; (1992). Determination of the exon structure of the distal portion of the dystrophin gene by vectorette PCR. Genomics, 13: 942-950. RHME, D.; FOX, H.; HERMANN, B.; FRISCHAUF, A. M.; EDSTM, J.; MAINS, P.; SILVER, L.; LEHRACH, H. (1984). Molecular clones of the mouse t complex derived from microdissected metaphase chromosomes, Cell, 36: 783-788. ROMMENS, J.; IANNIZZI, M.; KEREM, B.; DRUMM, M.; MELMER, G.; DEAN, M.; ROZMAHEL, R.; COLE, J.; KENNEDY, D.; HIDAKA, N.; ZSIGA, M.; BUCHWALD, M.; RIORDAN, J.; TSUI, L.; COLLINS, F.; (1989). Identication of the cystic brosis gene: chromosome walking and jumping. Science, 242: 1059-1065. RUDDLE, F. H. (1984). The William Allan memorial award address: reverse genetics and beyond. Am. J. hum. Genet., 36: 944-953. SAGOT, Y.; DUBOIS-DAUPHIN, M.; TAN, S.A.; BILBAO, F.; AEBISCHER, P.; MARTINOU, J-C.; KATO, A. C.; (1995a). Bcl-2 overexpression prevents motoneurone cell body

100

Referncias Bibliogrficas

loss but not axonal degeneration in mouse model of a neurodegenerative disease. J. Neurosci, 15: 7727-7733. SAGOT, Y.; TAN, S. A.; BAETGE, E.; SCHMALBRUCH, H.; KATO, A. C.; AEBISCHER, P.; (1995b). Polymer encapsulated cell lines genetically engineered to release ciliary neurotrophic factor can slow down progressive motor neuronopathy in the mouse. Eur. J. Neurosci., 7: 1313-1322. SAGOT, Y.; TAN, S. A.; HAMMANG, J. P.; AEBISCHER, P.; KATO, A.C.; (1996). GNDF slows loss of motoneurones but not axonal degeneration or premature death of pmn/pmn mice. J. Neurol. Sci., 16: 2335-2341. SANTOSH, K. M.; HELMS, C.; DORSEY, D.; PERMUTT, A. M.; DONIS-KELLER, H.; (1992). A 2-cM genetic linkage map of human chromosome 7p that includes 47 loci. Genomics, 12: 326-334. SCALENGHE, F.; TURCO, E.; EDSTOM, J.; PIROTTA, V.; MELLI, M. (1981). Microdissection and G1 cloning of DNA from a specic region of Drosophila melanogaster polytene chromosome. Chromosoma, 82: 205-216. SCHMALBRUCH, H.; SKOVGAARD JENSEN, H. J.; (1990). Progressive motor neuronopathy (pmn), a new neurological mutant in the mouse. Mouse Genome, 87: 113. SCHMALBRUCH, H.; SKOVGAARD JENSEN, H. J.; BJAERG, M.; KAMIENIECKA, Z.; KURLAND, L.; (1991). A new mouse mutant with progressive motor neuronopathy. J. Neuropathol. Exp. Neurol. 50: 192-204. SCHULER, G. D.; BOGUSKI, M. S.; STEWARD, E. A.; STEIN, L. D.; GYAPAY, G.; RICE, K.; WHITE, R. E.; RODRIGUEZTOM, P.; AGGARWAL, A.; BAJOREK, E.; BENTOLILA, S.; BIRREN, B. B.; BUTLER, A.; CASTLE, A. B. et al. (1996). A gene map of the human genome. Science, 274: 540-546.

101

Referncias Bibliogrficas

SCHUWARTS, D. C.; CANTOR, R. D. (1984). Preparation of yeast chromosome-sized DNAs by pulsed eld gel electrophoresis, Cell, 37; 67-75. SENDTNER, M.; SCHMALBRUCH, H.; STOCKLI, K. A.; CARROLL, P.; KREUTZBERG, G. W.; THOENEN, H.; (1992). Ciliary neurotrophic factor prevents degeneration of motor neurons in mouse mutant progressive motor neuronopathy. Nature, 358: 502-504. SETO, D.; KOOP, B.; DESHPANDE, P.; HOWARD, S.; SETO, J.; WILK, L.; WANG, K.; HOOD, L. (1994). Organization, sequence, and function of 34.5 kb of genomic DNA encompassing several murine T-cell receptor a/b variable gene segments. Genomics, 20: 258-266. SHIZUYA, H.; BIRREN, B.; KIM, U.; MANCINO, V.; SLEPAK, T.; TACHIRI, Y.; SIMON, M.; (1992). Cloning and stable maintenance of 300-kilohase-pair fragment of human DNA in Escherichia coli using an F-factor-based vector. Proc. Natl. Acad. Sci. USA, 89: 8794-8797. SILVER, L. M. (1995) Mouse Genetics Concepts and Applications. Oxford University Press, New York. SIMMLER, M. C.; COX, R.; AVNER, P. (1991). Adaptation of the interspersed repetitive sequence polymerase chain reaction to the isolation of mouse DNA probes from somatic cell hybrids on a hamster background. Genomics, 10: 770-778. SMITH, H.; BIRNSTEIL, M. (1976). A simple method for DNA restriction site mapping. Nucleic Acids Res., 3: 2387-2398. SMITH, L.; SANDERS, J.; KAISER, R.; HUGUES, P.; DODD, C.; CONNELL, C.; HEINER, C.; KENT, S.; HOOD, L. (1986). Fluorescence detection in automated DNA sequence analysis. Nature, 321: 674-679. SOEWARTO D, FELLA C, TEUBNER A, RATHKOLB B, PARGENT W, HEFFNER S, MARSCHALL S, WOLF E, BALLING R, DE

102

Referncias Bibliogrficas

ANGELIS MH (2000). The large-scale Munich ENU-mousemutagenesis screen. Mammalian Genome, 11: 507-510. STEEL K. P.; MBURU P.; GIBSON F.; WALSH J.; VARELA A.; BROWN K.; SELF T.; MAHONY M.; FLEMING J.; PEARCE A.; HARVEY D.; CABLE J.; BROWN S. D. (1997). Unravelling the genetics of deafness. Ann Otol Rhinol Laryngol, 168:59-62. STEINMETZ, M.; MINARD, K.; HORVATH, S.; MCMICHOLAS, J.; SRELINGER, J.; WAKE, C.; LONG, E.; MACH, B.; HOOS, L.; (1982). A molecular map of the immune response region from the major histocompatibility complex of the mouse. Nature, 300 35-42. SYMULA D.; SHEDLOVSKY A.; GUILLERY E.; DOVE W.(1997). A candidate mouse model for Hartnup disorder decient in neutral amino acid transport. Mammalian Genome, v.8, p.102107. STRACHAN, T.; REED, A.P. Gentica Molecular Humana. 2.ed. Porto Alegre (RS): ArtMed, 2002. STERNBERG, N. (1990). Bacteriophage P1 cloning system for the isolation, amplication and recovery of DNA fragments as large as 100 kilobase pairs. Proc. Natl. Acad. Sci. USA, 87: 103-107. SYMULA D, SHEDLOVSKY A, GUILLERY E, DOVE W (1997). A candidate mouse model for Hartnup disorder decient in neutral amino acid transport. Mammalian Genome, 8: 102107. TAGLE, D.; SWAROOP, M.; LOVETT, M.; COLLINS, F. (1993). Magnetic bead capture of expressed sequences encoded within large genomic segments. Nature, 3361: 751-753. TELENIUS, H.; CARTER, N. P.; BEBB, C. E.; NORDENSKJLD, M.; PONDER, B. A.; TUNNACLIFFE, A. (1992). Degenerate

103

Referncias Bibliogrficas

oligonucleotide primed PCR: general amplication of target DNA by a single degenerate primer. Genomics, 13: 718-725. THAUNG C, WEST K, CLARK BJ, MCKIE L, MORGAN JE, ARNOLD K, NOLAN PM, PETERS J, HUNTER AJ, BROWN SDM, JACKSON IJ, CROSS SH (2002). Novel ENU-induced eye mutations in the mouse: models for human eye disease. Human Molecular Genetics, 11(7): 755-767. THE HUNTINGTONS DISEASE COLLABORATIVE RESEARCH GROUP (1993). A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntingtons disease chromosomes. Cell, 72: 971-983. TROWER, M. K.; ORTON, S. M.; PURVIS, I. J.; SANSEAU, P.; RILEY, J.; CHRISTODOULOU, C.; BURT, D.; SEE, C. G.; ELGAR, G.; SHERRINGTON, R.; ROGAEV, E. I.; GEORGE-HYSLOP, P. St.; BRENNER, S.; DYKES, C. W. (1996). Conservation of syntenie between the genome of the puffersh (Fugu rubripes) and the region of human chromosome 14 (14q24.3) associated with familial Alzheimer Disease (AD3 locus). Proc. Natl. Acad. Sci. USA, 93: 1366-1369. UBERBACHER E. C.; MURAL, R. J.; (1991). Locating protein coding regions in human DNA sequences by a multiple sensorneural network approach. Proc. Natl. Acad. Sci. USA, 88: 11261-11265. VALDES, J.; TAGLE, D.; COLLINS, F. (1994). Island rescue PCR: A rapid and efcient method for isolating transcribed sequences from yeast articial chromosomes and cosmids. Proc. Natl. Acad. Sci. USA, 91: 5377-5381. VENTER, G.; ADAMS, M. D. et al. (2001). The sequence of the human genome. Science, 16; 291: 1304-1351. VIDAL, S.; MALO, D.; VOGAN, K.; SKAMENE, E.; GROS, P. (1993). Natural resistance to infection with intracellular

104

Referncias Bibliogrficas

parasites: isolation of a candidate for Bcg. Cell, 73; 469485. VIDAUD, M.; GATTONI, R.; STEVENI, J. et al. (1989). A 5 spilceregion G to C mutation in exon 1 of the human beta-globin gene inhibits pre-mRNA splicing: a mechanism of beta+ thalassemia. Proc. Natl. Acad. Sci. USA, 86: 1041-1045. VIOLLET, L.; BERTRANDY, S.; BRUNIALTI, A. L. B.; LEFEBVRE, S.; BURLET, P.; CLERMONT, O.; CRUAUD, C.; GUNET, J. L.; MUNNICH, A.; MELKI, J. (1997). cDNA isolation, expression, and chromosomal localization of the mouse Survival motor neuron gene (Smn). Genomics, 40: 185-88. VITATERNA, M. H.; KING, D. P.; CHANG, A.M.; KORNHAUSER, J. M.; LOWREY, P.L.; MCDONALD J. D.; DOVE, W. F.; PINTO, L. H.; TUREK, F. W.; TAKAHASHI, J. S.; (1994). Mutagenesis and Mapping of a mouse gene, Clock, essential for circadian behavior. Science, 264: 719-725. VORTKAMP, A.; FRANZ, T.; GESSLER, M.; GRZESCHIK, K. H.; (1992). Deletion of Gli3 supports the homology of the human Greig cephalopolysyndactyly syndrome (GCPS) and the mouse mutant extra toes (Xt). Mammalian Genome, 3:461-463. WALLACE, M.; MARCHUK, D.; ANDERSON, L. et al. (1990). Type I neurobromatosis gene: identication of a large transcript disrupted in three NFl patients. Science, 249; 181-186. WALLIN, J.; EIBEL, H.; NEUBUSER, A.; WILTING, J.; KOSEKI, H.; BALLING, R.; (1996). Pax1 is expressed during development of the thymus epithelium and is required for normal T-cell maturation. Development, 122: 23-30. WATERSON, R.H.; LINDBLAD-TOH, K. et al. Mouse Genome Sequencing Consortium (2002). Initial sequencing and comparative analysis of the mouse genome. Nature, 420 (6915): 520-62.

105

Referncias Bibliogrficas

Wells C, Brown SDM (2000). Genomics meets genetics: towards a mutant map of the mouse. Mammalian Genome, 11: 472-477. Williams RW, Flaherty L, Threadgill DW (2003). The math of making mutant mice. Genes, Brain and Behaviour, 2: 191-200. YU, C.; OSHIMA, J.; FU, Y.H.; WIJSMAN, E. M.; HISAMA, F.; ALISCH, R.; MATTHEWS, S; NAKURA, J.; MIKI, T.; OUAIS, S.; MARTIN, G. M.; MULLIGAN, J.; SCHELLENBERG, G. D. (1996). Positional cloning of the Werners syndrome gene. Science, 272: 258-62. ZHANG, J.; YANG-FENG, T.; MULLER, U.; MOHANDAS T., de Jong P., Lau Y. (1992). Molecular isolation and characterization of an expressed gene from human Y chromosome. Hum. Mol. Genet., 1: 717-726. ZHANG, Y.; PROENCA, R.; MAFFEI, M.; BARONE, M.; LEOPOLD, L.; FRIEDMAN, J.; (1994). Positional cloning of the mouse obese gene and its human homologue. Nature, 372: 425-432.

106

Anexos

ANEXO I- FIGURAS
Doena Doena

Mapeamento

Funo

Mapeamento

Funo

Gene

Gene

Clonagem pela Funo


Figura 1: As estratgias da clonagem

Clonagem Posicional

Ilustrao das duas estratgias de que dispomos para conhecer a funo de um gene qualquer.

107

Anexos

Figura 2: Mutao alcaptonria (aku). A urina do animal doente torna-se escura aps o contato com o ar aps o processo de oxidao. Na foto, o animal afetado est direita; e esquerda, o normal.

108

Anexos

Figura 3: Animal modelo da fenilcetonria (PKU) humana. Os camundongos pertencem mesma linhagem (BTRB). A despigmentao observada no animal de cor marrom ( direita) um componente da sndrome da feniltonria.

109

Anexos

Humans Mice Xenopus

D. Melagonaster C. elegans 900 800 700 600 500 400 300 200 100 0
myr bp

Figura 4: Relaes evolutivas entre os modelos mais utilizados em laboratrio. Os tempos aproximados em divergncias evolutivas entre organismos citados e seus ancestrais comuns esto indicados ao longo de uma linha do tempo, numa escala de milhes de anos (SIILVER, 1995).

110

Anexos

Total Orthologies: 10137 Total mapped in booth species: 9677 mouse, laboratory
1 2 3 4 5 6 7 8
4 32 81 76 211 10 1 2 2 34 127 1 45 72 15 1 79 1 10 1 257 1 1 2 1 13 11 1 1 1 1 5 34 21 29 1 1 1 2 275 98 37 76 1 1 1 1 105 140 19 1 80 1 128 9 579 3 96 205 19 34 140 22 1 195 171 1 1 8 1 36 205 36 3 158 2 157 1 207 99 82 44 1 1 79 3 33 118 4 1 1

9 10 11 12 13 14 15 16 17 18 19 X Y XY UN MT
12 2 2 15 41 50 1 107 159 112 2 33 41 15 3 1 59 112 5 43 1 106 3 10 132 148 1 1 1 48 60 1 16 104 45 92 20 111 45 1 1 1 370 7 1 1 1 54 44 1 2 62 135 5 1 10 134 248 5 1 58 39 23 11 14 20 20 16 12 16 32 21 8 12 13 11 25 6 28 11 3 7 1 12

1 2 3 4 5 6 7 8 9 10 11 h 12 u 13 14 m 15 a 16 n 17 18 19
20 21 22

274 3 282 355 10 249 124 1 3 18 1 79 1 1 104

18 1 191 61

41 12 50

h u m a n

X Y
XY UN MT X; Y

3 1

1 1

3 1

20 37

mouse, laboratory
Figura 5: Oxford Grid. Cada clula representa uma comparao entre dois cromossomos um do camundongo e outros do homem. O nmero de ortologias aparece entre cada clula (Cinza 1; Azul 2-10; Verde 11-25; Alaranjado 26-50; Amarelo 50 ou mais). FONTE: MGI ( www.informatics.jax).

111

Anexos

Figura 6: A mutao pmn A fraqueza dos animais pmn ( direita na foto) caracteriza-se pela incapacidade de esticar os membros posteriores quando so erguidos pela cauda.

112

Anexos

Figura 7: Cortes histolgicos. (a) Corte do msculo sleo de um animal homozigoto com quatro semanas, j apresentando uma atrofia neural. A largura das fibras normal. (b) (c) so terminaes nervosas do mesmo msculo. O axnio terminal (A) apresenta-se inchado e no possui vesculas sinpticas (b), ou estas esto diminudas (c). (d) Corte longitudinal de um nervo plantar de um camundongo mutante de cinco semanas. As mielinas restantes tm formato redondo ou oval, indicando um processo de degenerao axonal. Barras: 50mm (a, d) e 1mm (b, c) .

113

Anexos

a
Figura 8: Nervo frnico.

Corte do nervo frnico de um animal normal (a) e de um animal mutante, ambos com quatro semanas. Pode-se notar uma abundante perda dos axnios mielinisados.

114

Anexos

Figura 9: Fentipo obeso. O animal na parte superior da foto obeso, conferido por uma mutao espontnea no gene da leptina. A leptina (Lep) uma protena envolvida na regulao dos lipdeos. Ela est presente predominantemente nos tecidos adiposos. Nos camundongos homozigotos para mutao obese, o gene Lep est mutado e a leptina est ausente. Esses animais ingerem uma quantidade excessiva de alimentos (hiperfagia) e possuem diabete, intolerncia glicose e uma concentrao de insulina plasmtica elevada.

115

Anexos

10 Mb (5-10 c M)

A B

D C A

B 100 Kb

ntron

xon

10 Kb

...TAGCTGCTAGCTA... ...TAGCTGGTAGCTA...

Figura 10: Principio da clonagem posicional. O esquema acima representa uma clonagem, utilizando-se os clones do tipo YAC (Yeast Artificial Chromosome). O mesmo pode ser feito com os BAC (Bacterian Artificial Chromosome). Nesse esquema, a mutao que levou ao aparecimento do fentipo anormal uma transio de uma citosina para uma timina, o que causou a troca de um aminocido leucina por um cdon de parada, caracterstico de uma mutao de sentido trocado.

116

Anexos

Camundongo A Linhagem BLACK

Camundongo B Linhagem WHITE

F1 Hbrido

Retrocruzamento

Intercruzamento

N2

F2

Figura 11: Tipos de cruzamentos utilizados nos projetos de mapeamento. O intercruzamento, utilizado em mapeamentos de mutaes recessivas, produz dois cromossomos informativos (resultantes dos eventos de recombinao para cada indivduo Fl do casal estabelecido). O retrocruzamento pode ser utilizado, tanto para o mapeamento de mutaes ou traos recessivos como de dominantes; o que varia o parental utilizado no cruzamento com Fl. Nesse tipo de esquema, produzido apenas um cromossomo informativo (resultante dos eventos de recombinao do indivduo Fl utilizado).

117

Anexos

retrocruzamento

locus 1 n N

m +

locus 2 r X R

n n

m m

r r

anlise de 1000 descendentes

gamentas do heterozigoto descendentes hapltipos no informativos gentipos para os locus 1 mutao locus 2 fenotipagem dois marcadores N + R N/n [+] R/r n m r n/n [m] animais no r/r N + R N/n informativos [+] m n r R/r [m] n/n r/r hapltipos informativos n m R n N N + + m R R R

[m] [+] [+] [m]

n/n R/r n/n R/r N/n r/r N/n r/r

animais informativos (genotipados com outros marcadores)

Figura 12: Estratgias do mapeamento. Identificao dos animais informativos para refinar a localizao da mutao (no caso de um retrocruzamento).

118

Anexos

1
domesticus musculus molossinus castaneus bacterianus spretus spicilegus macedonicus fragilicauda famulus caroll cooki cervicolor dunni Pyromys Coelomys Nannomys
Mus musculos

TRENDS in Genetcs

Subgenus Mus Other subgenera

Figura 13: rvore filogentica da ordem muridae. Por meio da anlise de dados moleculares coletados a partir da comparao das seqncias de DNA mitocondrial e genmico, ns podemos reconhecer vrias espcies diferentes de camundongos pertencentes ao gnero Mus. FONTE: Gunet et Bonhomme, Trends in genetics, vol. 19, pp. 20-31, 2003.

119

Anexos

Alelo 1 R1 R2
locus A

Alelo 2 R3 R1
locus A

R3

sonda linhagem 1

sonda linhagem 2

Figura 14: Ilustrao do principio de RFLP (Polimorfismo de Comprimento de Fragmentos de Restrio.

120

Anexos

Alelos #1 CACACACACACACA

#2

CACACACACACACACACA

#3

CACACACACACACACACACACA

Gentipos 1/1 2/2 3/3 1/2 1/3 2/3

Figura 15: Meios microssatlites e sua deteco. Trs alelos diferentes de um locus microssatlite composto de repeties CA. As setas representam os iniciadores locus especfico utilizados na amplificao. No esquema que se segue est representado um gel de eletroforese com os padres que seriam observados para os diferentes alelos.

121

Anexos

DNA fita dupla

CGTAGCTGATCGATGC Fita 1 Amostra A GCATCGACTAGCTACG Fita 2 CGTAGCTGGTCGATGC Fita 1 Amostra B GCATCGACCAGCTACG Fita 2 Desnaturao e Resfriamento

Corrida no gel Amostra A Amostra B Sentido da migrao do DNA

Figura 16: SSCP - Alelos e sua deteco. A conformao tridimensional assumida pela fita simples de DNA aps resfriamento interfere diretamente na velocidade de migrao no gel. A conformao dependente da seqncia que a fita apresenta. Sendo assim, seqncias diferentes (mesmo em apenas uma base) tero diferentes velocidades de migrao. Neste esquema esto ilustradas duas amostras com uma base de diferena em suas seqncias; aps desnaturao e resfriamento a conformao que cada fita assume; em seguida um gel revelando o polimorfismo existente

122

Anexos

Cr. 13 7 10 cM 9 6

1 10 3 5

Figura 17: Mapa comparativo das regies de ortologia entre o cromossomo 13 murino ( direita) e os segmentos cromossmicos 1, 3, 5, 6, 7, 9 e 10 humanos. Os histogramas representados do lado direito do cromossomo 13 murino correspondem aos cromossomos humanos homlogos. O nmero de cada cromossomo est indicado acima do histograma. O tamanho de cada uma das barras posicionadas nos histogramas indica o nmero de genes ortlogos entre o homem e o camundongo localizados naquela regio. Fonte: www.informatics.jax.org.

123

Anexos

Stio de clonagem
DNA genmico Vetor pYAC

TEL

TEL O vetor digerido de tal forma que libere os dois braos Digesto parcial (produo de fragmentos de vrias centenas de Kb

Brao esquerdo TEL

Brao direito TEL

Ligao

Tranformao de esferoplastos e propagao na Saccharomyces cerevisiae

TRP ARS

CEN URA

Figura 18: Princpio da clonagem em YAC. O vetor de clonagem (pYAC) digerido de maneira a produzir dois braos. O brao esquerdo contm a regio denominada ARS (origem de replicao autnoma), um centrmero (CEN), uma seqncia que permite a formao de um telmero funcional in vivo (TEL) e um marcador de seleo (TRP). O brao direito contm a seqncia TEL e um segundo marcador de seleo (URA). A ligao desses braos a grandes fragmentos de DNA genmico (humano, animal, etc) obtidos pela digesto parcial conduz formao do cromossomo artificial de levedura (YAC), o qual introduzido dentro do organismo Saccharomyces cerevisiae. Nele, o YAC capaz de se replicar (graas seqncia ARS), de estabilizar sua extremidades (graas s seqncias TEL) e de se repartir de maneira correta entre as clulas filhas no momento da diviso celular (graas s seqncias CEN).

124

Anexos

Hind III

Bam HI

Xmal, Smal, Notl, Bgll, Sfil

Nat I Eag I

loxP

promotor T7

promotor Sp6

Sacl Sal I cosN Sacl Sal I

CM

par
pBAC108L

A par

repE
Figura 19: Construo do vetor BAC. O vetor BAC um derivado do epsomo F e possui os genes oriS e repE que regulam a replicao e os genes parA e parB que controlam o nmero de cpias do plasmdio ( uma ou duas) na bactria. CMR o gene de resistncia ao antibitico cloramfenicol. No sitio de clonagem, o vetor BAC possui: (i) os stios cosN e loxP do bacterifago lambda e (ii) dois stios de clonagem (HindIII e BamHI). As seqncias dos promotores T7 e SP6 servem para o seqenciamento da poro de DNA inserida na juno vetor- inserto.

125

ori S

Anexos

DNA genmico de alto peso molecular

Digesto e fragmentao de grandes fragmentos de DNA (vrias centenas de Kb)

Ligao na presena de um marcador de seleo e em baixa concentrao de DNA

Circularizao dos fragmentos de DNA

Digesto

Fragmento de juno Clonagem dos fragmentos de DNA no vetor adequado, por exemplo, um bacterifago Banco de fragmentos de jumping Sondagem de uma biblioteca atravs do

Figura 20: Ilustrao da tcnica do salto no cromossomo. O DNA genmico digerido e os produtos so ligados na presena de um marcador de seleo por exemplo, o gene supF cuja presena deste marcador permite selecionar os clones de juno (aqueles que contm os fragmentos de DNA que normalmente estariam distantes um do outro no genoma de origem). As molculas de DNA circular so, em seguida, digeridas por uma endonuclease compatvel com a clonagem em um vetor adequado. A maior parte das molculas obtidas correspondem ao DNA contguo e apenas uma pequena poro de fragmentos pertencem ao DNA de juno. Uma biblioteca ento construda, utilizando, por exemplo, um bacterifago. O fago s poder se propagar se tiver o marcador de seleo supF. Isso quer dizer que apenas os clones que contm o fragmento de juno estaro presentes na biblioteca. Um fragmento de DNA pode ser isolado pela sondagem da biblioteca por meio de uma sonda de DNA, mesmo localizado a vrias dezenas ou centenas de Kb daquela sonda.

126

Anexos

contig n

BAC n1

seqenciamento da extremidade do BACn1 definio de uma STS Busca de novo BAC portando tal STS (sondagem de biblioteca)

BAC n2 BAC n3 marcha sobre o cromossomo

seqenciamento da extremidade do BACn2 definio de uma STS sondagem de biblioteca intervalo entre dois contigs est definido

contig n+1 DNA cromossmico contig n contig n+1

Figura 21: A marcha sobre o cromossomo. O sequenciamento da extremidade do BAC n 1 fornece uma sequncia nica amplificada pela PCR (STS). Um BAC portador desta sequncia procurado numa biblioteca genmica. Este BAC permite aumentar a regio clonada. Pode-se igualmente utilizar a outra extremidade do BAC n 1 para marchar sobre o cromossomo para o outro lado.

127

Anexos

Fragmento genmico contendo um xon SA SD xon ntron SD SA xon stio de poliadenilao

Vetor de expresso Tranfeco em clular de mamferos Transfeco dos mRNA Emenda Extrao do RNA citoplasmtico mRNA AAAAAAAAAAA Retrotranscrio cDNA PCR

PCR = xon cerdado pelas seqncias do vetor


Figura 22: Princpio da amplificao dos xons internos ou xonTrapping. Os genes, nos organismos eucariotos, apresentam-se em forma de mosaicos, em que as seqncias codificantes (xons) so interrompidos por seqncias no codificantes (ntrons). Os ntrons so transcritos antes de serem eliminados num processo denominado de emenda (splicing). Quatro seqncias de DNA tm papel importante nesse processo: o stio

128

Anexos

doador de emenda (SD) em 5 do ntron, o stio aceptor de emenda (SA) em 3 do ntron, o stio de juno e uma regio de resduos pirimidinas. Na amplificao do xon, o DNA genmico a ser analisado clonado num vetor de expresso. O stio de clonagem est localizado dentro de um ntron de um dado gene e , portanto, enquadrado pelos stios doador e aceptor de emenda. Em seguida, a construo colocada para propagao dentro da bactria E. coli. O DNA ento isolado e transfectado nas clulas eucariotas. Caso o DNA analisado contenha um xon e que este tenha sido inserido na orientao correta, ou seja, de 5 para 3, ocorrer emenda entre as seqncias do vetor e do inserto. O produto final dessa emenda ser um RNAm quimrico que possui a seqncia do xon do DNA testado, enquadrado pela seqncias dos xons do vetor. Tais molculas de RNA so extradas e convertidas em cDNA pelo mtodo de RT-PCR (retrotranscrio). As molculas de cDNA so, ento, amplificadas pela PCR atravs dos oligonucleotdios especficos do vetor. Caso o produto de amplificao seja maior em pb que a distncia que separa os oligonucleotdios no vetor, um forte indicativo de que um xon foi clonado.

129

Anexos

Digesto do DNA genmico (YAC, ...) + adaptador + iniciador biotinilado

PRC Biblioteca de DNA

Hibridizao em meio lquido

Captura do hbrido sobre as bilhas de estreptavidina

bilha magntica + estreptavidina

Educao do cDNA Amplificao Clonagem

Figura 23: Captura de cDNA por afinidade O DNA genmico digerido e ligado aos adaptadores. A construo ento amplificada atravs de oligonucleotdios biotinilados e especficos dos adaptadores. O DNA amplificado , em seguida, hibridizado, em condio de alta estringncia, a molculas de cDNA. Os hbridos cDNA-DNA genmico biotinilado so recuperados por meio de bilhas magnticas cobertas de estreptavidina. Os cDNA no especficos so eliminados por meio de lavagem. Os cDNA especficos restantes so eludados, amplificados e clonados.

130

Anexos

3 RACE
mRNA 5
AAAAAAAAAAAAAAAAA3 TTTTTTT

5 RACE
mRNA 5 GSP
AAAAAAA3

Adaptador cDNA
TTTTTTT

cDNA GSP1
TTTTTTT

GSP Iniciador complementar ao adaptador


TTTTTTT

(dC)n CCCCCCCCCC

Acrscimo de uma cauda poli (dC)

GSP

GSP2

Iniciador complementar ao adaptador

(dC)n CCCCCCCCCC GGGGG (dG)n

GSP

Figura 24: Principio da RACE. Para obter as extremidades 3 (3RACE), o RNA retrotranscrito atravs de um oligonucleotdio constitudo de resduos dT e de uma seqncia adaptadora. As amplificaes so realizadas atravs de um oligonucleotdio derivado do gene de interesse (GSP1, GSP = gene specific primer) e de um outro complementar ao adaptador. Uma segunda amplificao realizada com oligonucleotdios especficos internos (GSP2) e aquele complementar seqncia adaptadora. Utilizando-se a mesma estratgia, pode-se obter a extremidade 5 (5RACE). A retrotranscrio feita atravs de um GSP. Uma cauda poli(C) acrescentada ao cDNA fita simples. A amplificao realizada por meio de um oligonucleotdio poli(G) e de um outro especfico GSP1. Uma segunda amplificao , ento, realizada com um oligonucleotdio complementar ao adaptador e um outro especfico mais interno.

131

Anexos

Fentipo Genotipagem ~20 animais afetados ~80 marcadores Cromossomos


A2 A3 B1 B2 B3 C1 C2 C3 D1D2 D3 E F1 F2

Marcadores
A B C D E F G H Afetado 438 No Afetado 2 73 2 1 1 2 Linhagem 2 2

Mb
35,410,613 35,426,474 36,034,000 36,149,287 37,125,950 37,963,422 38,061,429 38,079,638

Mapeamentos alta resoluo 100-1000 meioses SSLPs/SNPs

Intervalo com o Gene Candidato Sequenciamento

Linhagem 1

Mutao

Figura 25: Identificao da mutao. Assim que uma mutao isolada (parte de cima da figura, aqui representada por um fentipo afetando a colorao da pelagem), os estudos genticos comeam atravs de cruzamentos que gerem recombinantes que serviro na genotipagem. A genotipagem realizada atravs de marcadores moleculares polimrficos entre as duas linhagens utilizadas no cruzamento. Geralmente estes marcadores so os microssatlites (SSLPs) ou SNPs. Este processo leva a identificao do cromossomo portador do lcus mutado (o esquema apresentado meramente ilustrativo), geralmente determinado num intervalo candidato entre 10 20Mb (Mega pares

132

Anexos

de bases). O passo seguinte refinar a regio candidata mapeada atravs do mapeamento lata resoluo. Para tanto, preciso aumentar o nmero de meioses analisadas, este nmero pode variar dependendo do nmero de marcadores polimrficos disponveis na regio e da densidade gnica (de 100 a 1000 meioses). Ao final, o intervalo candidato delimitado ficar entre 1-2 Mb. No exemplo da figura, a mutao recessiva induzida na linhagem C57BL/6 foi mapeada alta resoluo usando animais cruzados com a linhagem 129SvEv. Aqui, 529 animais foram genotipados com 8 marcadores distribudos ao longo dos 4,6 Mb que compem a regio candidata e 10 recombinantes foram encontrados. Estes animais ou meioses recombinantes possibilitaram redefinir a regio, a qual foi reduzida para 1,8 Mb. Nesta altura do trabalho, o sequenciamento dos genes candidatos posicionais pode comear, aqui a mutao apresentada a transverso da citosina (C) para a guanina (G).

133

Anexos

Marcadores

Hapltipos

D13Mit80 D13Mit215 pmn D13Mit115 D13Mit3 D13Mit16 D13Mit154t D13Mit61 Nmeros 46 2 1 1 1 2 6 4

Figura 26: Hapltipo. O esquema representa os hapltipos dos animais obtidos a partir do retrocruzamento interespecifico entre a linhagem da espcie Mus spretus e a linhagem de laboratrio, na qual o alelo pmn est segregando. Os DNA desses 63 animais N2 pmn/pmn foram tipados com os marcadores do tipo microssatlite. Os retngulos brancos indicam que o marcador homozigoto para o alelo Mus musculus domesticus (alelo de laboratrio originrio do alelo pmn). Os retngulos pretos indicam que o hapltipo heterozigoto para os alelos Mus spretus e Mus musculus domesticus. O nmero embaixo de cada coluna representa o nmero total de animais por hapltipo. O resultado mostra que o lcus pmn se encontra entre os marcadores D13Mit215 e D13Mit115.

134

Anexos

P
Xt + / + +

X
+ + / + pmn

F1
Xt + / + pmn

X
Xt + / + pmn

F2
[Xt] [pmn] 211 [Xt pmn] 0 [+] 0

Nmero de animais

430

Figura 27: Cruzamento intra-especifico. Ns obtivemos 641 animais provenientes do intercruzamento Xt +/ + pmn, o que representa 1.282 meioses. Nenhum recombinante foi encontrado. Esses resultados indicam que o lcus pmn encontra-se a uma distncia compreendida entre O a 1 cM do lcus Xt, com risco de 5% e a uma distncia de O a 1,5cM com risco de 1%. O mesmo tipo de cruzamento foi realizado entre pmn e pe. Ns obtivemos 116 (232 meioses) animais, a partir do intercruzamento de animais pe +I + pmn, e encontramos 6 recombinantes pe pmn/pe pmn. Esse resultado coloca pmn a, aproximadamente, 4 3 cM do lcus pe.

135

Anexos

Figura 28: Mutao Extra-toe e o estoque balanceado. Os animais mutantes (+/Xt) representados esquerda na figura, apresentam um dedo extranumrico visvel na pata posterior, porm ausente na pata posterior do animal pmn/pmn ( direita). A presena desse marcador permite identificar os animais homozigotos pmn/pmn desde o nascimento, pois estes no possuem o dedo extranumrico e tambm permite eliminar os animais que no so portadores do alelo pmn, pois, nesse caso, a condio Xt/Xt letal in utero. O estoque balanceado Xt +1 + pmn de grande importncia, pois permite o reconhecimento precoce dos animais que se tornaro doentes.

136

Anexos

Cr. 13
5 10 15 20 25 30 35 40 45 50 55 60 65 70

D13Mi158 D13Mi80 D13Mit173 D13Mit162 D13Mit207 D13Mit57 D13Mit174 D13Mit206 D13Mit218 D13Mit56 D13Mit215 D13Mit Gli20 D13Mit305 D13Mit115 D13Mit17 D13Mit3 D13Mit133 D13Mit16 D13Mit154 D13Mit81 D13Mit61 D13Mit10 Msx2 D13Mit13

D13Mit21 S3S5.ex2

Cf2R D13Mit28 D13Mit47 D13Mit32

75

Figura 29: Localizao precisa dos marcadores microssatlites no cromossomo 13 murino. Esse mapa foi estabelecido, utilizando-se a coleo de DNA do EUCIB. Os genes G1i20 (BRUNIALTI et al., 1995), Msx-2 (ROBERT; BRUNIALTI, 1995), Cf2r (POIRIER et al., 1996) e Smn (S3S5.ex2) (VIOLLET et al., 1997) tambm foram localizados nesse mapa.

137

Anexos

D13Mit80 (3,35 +/- 0,57 cM) D13Mit173 D13Mit218 D13Mit154 1q Xt 7p Gli3 D13Mit115 D13Mit3 D13Mit133 D13Mit16 (2,43 +/- 0,48 cM) D13Mit154 (1,32 +/- 0,36 cM) (0,8 +/- 0,28 cM) (0,4 +/- 0,23 cM)

(1,82 +/- 0,42 cM)

Figura 30: Mapa gentico parcal da regio cromossmica de interesse. Mapa gentico do cromossomo 13 (parcial) de camundongos indicando a regio onde se encontra o gene pmn (retngulo pontilhado). Esse mapa foi estabelecido, utilizando-se a coleo de DNA do EUCIB (N=982) e os marcadores moleculares em torno do lcus G1/3. A localizao do lcus pmn foi definida levando-se em conta os resultados apresentados nas figuras 26 e 27. Os retngulos esquerda da figura indicam as regies de homologia entre o cromossomo 13 murino e os cromossomos 1 e 7 humanos.

138

Anexos

AB1380 URA3 endogne 1640 Kb 1095 Kb 840 Kb

AB1380 1640-10951120-1130 Kb 980-950 Kb 680 Kb 590 Kb 440 Kb 350 Kb

Figura 31: Anlise pela eletroforese em campo pulsado dos YAC Y902.2, Y903.1 e Y13.115. Quatro culturas independentes de cada clone foram analisadas. A eletroforese em campo pulsado foi realizada em agarose Seake GTG 1%; 0,5 X TBE, a 190 volts. Os tempos dos pulsos so de 45 segundos durante 24 horas (foto da esquerda). Aps transferncia para membrana de Nylon 1\1 pelo mtodo de Southern blot, os cromossomos artificiais de levedura foram revelados pela hibridizao de um fragmento do gene URA3 de levedura (foto da direita). Essa sonda reconhece o gene endgeno e o gene presente no vetor YAC. AB1380 uma linhagem de levedura (Saccharomyces cerevisiae).

Y902.2

Y903.1

Y13.115

Y902.2

Y903.1

Y13.115

139

Anexos

Y13.305.2 (1250 Kb)

D13Mit305

D13Mit115 INHBA

496K2 (140 Kb) 388A11 (140 Kb) 283E20 (160 Kb) 12P11 (100 Kb)

Gli3 GCK

pmm

D13Mit215

Y.903.1 (840 Kb)

Y.902.2 (1095 Kb)

Figura 32: Organizao dos YAC. Esta organizao contm os marcadores D13Mit215, D13Mit305 e D13Mit115 e o gene Gli3 (sondas Glill e G1i20) na forma de um contig. Os traos descontnuos correspondem s regies quimricas. Os BAC obtidos a partir dos marcadores D13Mit215 (388A11), G1i20 (283E20), Glill (12P11) e D13Mit115 (496K2) esto igualmente representados embaixo da figura. Os marcadores GCK e INHBA so dois genes humanos que ns localizamos pela PCR nos YAC.

140

Y.13.215 (1200 Kb)

Cr.13

Y13.115.1 (1640 Kb)

Anexos

Y902.2 Y13.115 Y13.215 Y13.305 AB1380 Y903.1

Figura 33: Anlise por Southern blot da extremidade esquerda do clone Y902.2. Os cromossomos de levedura foram separados pela eletroforese em um gel de agarose Seaken GTG 1%;0,5 X TBE a 9C, a 190 volts. Os tempos dos pulsos foram de 45 segundos durante 24 horas. O DNA foi, ento, transferido e fixado sobre uma membrana de nylon N+. A membrana foi hibridizada com um fragmento de DNA marcado com radioatividade e que correspondia extremidade esquerda do YAC Y902.2. Na figura, pode-se ver que esse fragmento est presente nos clones Y903.1, Y13.305.2 e reconhece tambm o DNA do clone do qual foi isolado. AB1380 uma linhagem de levedura (Saccharomyces cerevisiae).

141

Anexos

100 Kb

Gli3 I CpG CpG CpG

D13Mit305

M NN B S

EN R

E R

E E N EE M N BR N Sa SaM SM

RE N E R

Y903.1 Y902.2 D Y13.305.2

D G D

Figura 34: Mapa de restrio do contig de YAC que cobre a regio pmn. D e G representam as extremidades direita (lado URA3 do vetor pYAC4) e esquerda (lado TRP do vetor pYAC4), respectivamente. Os crculos cheios correspondem s extremidades dos clones provenientes da regio pmn. Os crculos vazios correspondem s extremidades quimricas (a extenso da regio quimrica est representada pelas linhas pontilhadas). As ilhas CpG, definidas pelo agrupamento de 3 ou mais enzimas de restrio que cortam raramente o genoma, esto igualmente representadas. B: BssHII, E: Eagl, M: Mlul, N: Notl, R: Nru, S: Sall, Sa: Sacll, SM: Smal.

142

Anexos

Gli3 CL9 CL14 CL30 CL34

D13Mit305 D13Mit115 E7 E10


RE N E R

100 Kb

E1 E2
M NN B S EN R E R

E13 CL10 E3 CL20 E11

E E N EE M N BR N Sa SaM SM

Y903.1 Y902.2 D Y13.305.2

12P11 283E20 D G D

496K2 G G

Figura 35: Localizao dos xons e das ESTs. Localizao dos fragmentos dos genes isolados pela tcnica da amplificao dos xons internos (CL) e localizao das EST humanas (E) no mapa de restrio do contig de YAC e BAC.

143

Anexos

H2O

Xt pmn + B6

M Xt pmn + B6

220 pb

H2O

E7

E2

317 pb

Figura 36: Anlise pela PCR das EST humanas E7 (A006127) e E2 (WL9635). O cDNA dos animais de fentipo Xt, pmn e selvagem (+) foram testados para cada conjunto de oligonucleotdios. O DNA genmico da linhagem C57BL/6 e gua foram utilizados para o controle da amplificao. O DNA genmico no foi amplificado com os oligonucleotdios provenientes da EST E7. Esse resultado indica a existncia de seqncia intrnica entre os oligonucleotdios, o que, provavelmente, tornou a amplificao impossvel. J para a EST E2, foi obtido um produto de amplificao para o DNA genmico, indicando a inexistncia de um ntron entre os oligonucleotdios. No foi encontrada diferena de tamanho do produto amplificado entre os animais Xt, pmn e +. (M) Marcador de peso molecular 100pb Ladder (Pharmacia).

144

Anexos

Taql EcoRl

Taql

Hindlll

Pstl

EcoRl

Pstl

Hindlll

1 T2 E Ligao E P T Ligao H P E E H P H Ligao

T E PCR 1 E 2 3 E 3 E 4 P PCR 5 H E PCR

PCR 1 E T 2 PCR 4 P

PCR E 3 PCR 5H

PCR E 3 PCR

TEL

TRP1

ARS1

CEN4

SUP4

Figura 37: Isolamento das extremidades do YAC atravs da PCR inversa. O DNA do YAC foi digerido por uma enzima cujo stio de restrio est presente no vetor. O DNA digerido foi, em seguida, religado sobre si mesmo. Entre as molculas circulares, algumas possuem um fragmento do vetor flanqueando uma extremidade do YAC. Utiliza-se, em seguida, iniciadores especficos do vetor para amplificar a extremidade do YAC.

145

Anexos

Fragmento genmico contendo um xon SA SD xon ntron SD SA xon stio de poliadenilao

Vetor de expresso Tranfeco em clular de mamferos Transfeco dos mRNA Emenda Extrao do RNA citoplasmtico mRNA AAAAAAAAAAA Retrotranscrio cDNA PCR

PCR = xon cerdado pelas seqncias do vetor

Figura 38: Principio da amplificao dos xons internos ou xonTrapping. Legenda detalhada na Figura 22.

146

Anexos

Bstx I Meio-stio 607-626 Sd6 P xon Sv40 dUSD 2 654-671 698 Sdv

Stio de clonagem Sdc Mltipla 1134

Bstx I Half-site 3095 Sav 3245-3265 Sa2


xon

dUSA 4 3178-3199

1009 EcoR I Bstx I

Sst I

1056 BanH I EcoR v Bstx I

CCAGAATTCTGGAGCTCGAGCGGCCGCTGCAGGATCCCAGATATCTGG

Xho I Xma III Pst I

Stio de clonagem mltipla 1000 N de l 1119

Blos l SDv689 862 Xba I 681 Sal 687 BsaA I IEco 721674 Esp I641 Avt II 324 Sfr I270

Nhel 1976 2000

6000 on Drd I 5743

Dra IIIStu I 13111548 Pvu III 1799 Ban II Cfno I 1157 Mam I 2271 Acc I 6871020 Mun I 2371 Dsal IN oo I 491 Ava I 1023 Hind Acc 485 III 34 0 Slu I321 Dra III 2815 Bgl I271 Sph I 140 Sph I 68 Dsa I IN co I pSPL3 Hind III 2857 Pvu HaeII II 1 231 603 1 bp Aval 3107 5977 Hae II 5607 Mam I 3494 Mun I 3406

EcoNl 2348

3000 Msc l 3231 SAv 3095 Hpa l 3395

Ban II 3774 BspH I 5131 Cfno I 4878 Bgl I 4839 BspH I 4123 Apa l 3774 Ap Xcm l 3906 4000 5000 Bsa X mm l 4359 Eamll051l 4891 Pvu l 4591 4958 Fsp l Bcg l BsaHl 4422 4738 4436

Figura 39: O vetor de expresso pSPL3. A parte superior do esquema representa os ntrons e xons do gene tat do HIV-1, tendo nas bordas as seqncias exnicas da B-globina. P = promotor SV40; SDv = stio doador de emenda; SDc = stio crptico de emenda; e SDa = stio aceptor de emenda. Os oligonucleotdios utilizados na PCR tambm esto indicados. A parte inferior da figura representa o mapa circular do plasmdio.

147

Anexos

ANEXO II- TABELAS


Tabela 1. Doenas Humanas Mapeamento Referncia Modelo animal Mapeamento (camundongo) ou gene homlogo Musculatura Referncia

Miotroa espinal distal Miotroa espinal (Tipos 1, 2 e 3) Distroa muscular (SCARMD) Distroa muscular congenital merosina negativa Distroa muscular de cinturas (LGMD2B) Distroa muscular de cinturas (LGMD2A) Distroa muscular de cinturas (LGMD1A) Distroa muscular fcio-escpulohumeral Distroa muscular culofaringeal Distroa muscular de Duchenne Miopatia distal autossmica dominante Sndrome de Schwartz-Jampel Adrenoleucodistroa

7p 5q11-q13 17q12-q21.33 6q22-q23

Hum. Mol. Genet., 1995, 4:1629-32 Cell, 1995, 80:155165 Cell, 1994, 78:10-20 Hum. Mol. Genet., 1994, 3:1657-61 Genomics, 1995, 27:192-95 Cell, 1995, 81:1-20 Am.J.Hum. Genet., 1992, 50: 1211 Lancet, 1990: 336365 Hum.Mol.Genet., 1995, 4: 429-434 Nature, 1992, 300:6971 Am.J.Hum. Genet., 1995, 50:422-427 Hum.Mol.Genet., 1995, 4:1633-36

Smn

13

Genomics, 1997,

mutante distroa muscular (dy)

10

J.Bio.Chem., 1994, 269:13729-32

2p 15q15.1-q15.3 5q 4q35

calpana 3 (Canp3)

3 ou 4

Mamm. Genome, 1996, 7:377-379

14q1 1.2-q13 Xp21.2 14q

muscular dystrophy (mdx)

EMBO J., 1988, 7:3017-3021

1p34-p36.1

Sistema nervoso
Xq28 Nature, 1993:726-730 adenocortica lipid depletion (ald) Am.J.Hum.Genet., 1995, 56:1443-1449 Nature Genetics, 1995, 9:141-145 Genomics, 1995, 25:433-435 1 Acta Pathol. Microbiol. Scan., 1963, 58:212-218

Ataxia cerebelosa peridica familiar Ataxia de Friedreich com dt isolado em vitamina E Ataxia espinocerebelosa autossmica dominante (SCA2) Ataxia espinocerebelosa autossmica dominante (SCA3) Ataxia espinocerebelosa autossmica dominante (SCA5) Ataxia espinocerebelosa com incio na infncia (IOSCA) Ataxia espinocerebelosa do tipo I (SCAI) Epilepsia noturna frontal autossmica dominante Hidrocefalia ligada ao cromossomo X Doena de Alzheimer familiar Doena de Alzheimer precoce (locus AD3) Doena de CharcotMarie-Tooth tipo 1A Doena de CharcotMarie-Tooth tipo 2 Doena de CharcotMarie-Tooth tipo 4A Doena de MachadoJoseph Malformaes cavernosas do crebro Neurobromatose do tipo 2 Neuropatia axonal moto-sensorial Paraplegia espasmdica familiar autossmica dominante Retardo mental ligado ao X Esclerose lateral miotrca juvenil recessiva Sndroeme de Cohen Sndroeme de Kallmann Sndrome do X frgil

19p13 8q

12q23-24.1

14q24.3-q32.2

Am.J.Hum.Genet., 1995, 56:193-201

11cen

Nature Genetics, 1994, 8:280-284

10q23.3-q24.1

Am.J.Hum.Genet., 1995, 56:1088-1095 Nature Genetics, 1993, 4:221 Nature Genetics, 1995, 10:117-118 HGM, 1991, 11, Abstract:234 Science, 1995, 269:970-977 Hum.Mol.Genet., 1995, 4:1355-1364 HGM, 1991, 11, Abstract:12 Am.J.Hum.Genet., 1995, 57:853-858 Mol.Genet., 1993, 2:1625-1628 J.Med.Genet., 1995, 32:25-31 Genomics, 1995, 28:311-314 Nature, 1993, 363:515-521 Genomics, 1995, 29:409-412 Am.J.Hum.Genet., 1995, 56:183-187 ScadI 13 Genomics, 1992, 12:818-821 Am.J.Hum.Genet., 1995, 56:289-293

6p22-p23

20q13.2

Acra4

Xq28 1q31-42 14q24.3-q32.2 17p11.2 1p35-p36 8q13-21.1 14q24.3-q32.2 7q 22q12 Xq24-q26 14q

camundongo transgnico

Nature Genetics, 1995, 9:21-30

mutante trembler (Tr)

11

PNAS, 1992, 89:4382-6

Xp22 2q33-q35

Am.J.Hum.Genet., 1994: 581-585 Nature Genetics, 1994, 7:425-428 Nature Genetics, 1994, 7:201-204 Cell, 1991, 67:423435 Am.J.Hum.Genet., 1991, 38:336-342

8q Xp22.3 Xq27-q28

camundongo transgnico (Fmr-1)

Genomics, 1992, 12:818-821

Anexos
Tabela 2. Mutao
arrested development of righting response agitans ataxia bouncy cribriform degeneration dystonia musculorum ducky dystrophia muscularis gracile axonal dystrophy gray tremor hotffot jimpy jittery lethargic lumbosacral neuroaxonal dystrophy Lurcher motor neuron degeneration motor neuron degeneration 2 motor end plate desease muscle decient muscular dystrophy with myositis X-linked muscular dystrophy myodystrophy opisthotonos progressive motor neuronopathy quaking quivering shiverer spastic staggerer swaying tipsy tippy tottering Trembler Trembly-like twitcher vibrator wabbler-lethal wasted weaver wobbler

Smbolo
adr ag ax bc cri dt du dy gad gt ho jp ji lh lnd Lc mnd mnd2 med mdf mdm mdx myd (fg) opt pmn qk qv shi spa sg sw ti tip tg Tr Tyl twi vb wl wst wv wr

Cromossomo
14 18 18 18 4 1 9 10 5 5 6 X 10 2 7 6 8 6 15 19 2 X 8 6 13 17 7 18 3 9 15 11 9 8 11 X 12 11 14 2 16 11

Modo de transmisso
recessiva recessiva recessiva recessiva recessiva recessiva recessiva recessiva recessiva recessiva recessiva recessiva recessiva recessiva recessiva semidominante recessiva recessiva recessiva recessiva recessiva recessiva recessiva recessiva recessiva recessiva recessiva recessiva recessiva recessiva recessiva recessiva recessiva recessiva recessiva semidominante recessiva recessiva recessiva recessiva recessiva recessiva

Tabela 3. Sites na Internet Gentica de camundongos


www.informatics.jax.org/mgihome/ Mouse Genome Informatics o centro de bioinformtica do Jackson Laboratory, Maine (USA). So encontrados dados sobre a gentica, genmica e biologia dos camundongos de laboratrio.

Comentrios

Anlise do genoma do camundongo


http://www.ensembl.org/Mus_musculus/ http://www.ncbi.nlm.nih.gov/genome/guide/mouse/ http://www.genome.ucsc.edu/ http://www.mgu.har.mrc.ac.uk/mutabase/ http://www.gsf.de/ieg/groups/enu-mouse.html Todos os trs sites oferecem banco de dados hierrquico da sequncia murina.

Centros de mutgnenese e descries de mutantes


Todos os sites apresentam o fentipo dos mutantes obtidos nos centros de pesquisa: Harwell (Inglaterra) Munique (Alemanha) Banco de dados que apresenta a expresso dos genes humanos e dos camundongos. Site apresenta um atlas tridimensional do desenvolvimento embrionrio do camundongo, bem como o perl de expresso dos genes ao longo da embriognese. Site apresenta imagens de microscopia eletrnica de camundongos normais e mutantes.

Informao sobre a expresso dos genes


http://bodymap.ims.u-tokyo.ac.jp/

Embriologia e anatomia patolgica dos camundongos


http://genex.hgu.mrc.ac.uk/ http://www.med.unc.edu/embryo_images/

Anexos
Tabela 4. Grupo Nmero de CpG
I 2

Contedo de G+C
8/8

Enzimasa
NotI AscI BssHII EagI SstII/SacII NaeI NarI SmaI MluI NruI PvuI SplI SalI XhoI HhaI HpaI

Stio
GCGGCCGC GGCGCGCC GCGCGC CGGCCG CCGCGG GCCGGC GGCGCC CCCGGG ACGCGT TCGCGA CGATCG CGTACG GTCGAC CTCGAG GCGC CCGG

Nmero de stios/ilhab Esperado Observado


0.14 0.14 1.68 1.68 1.68 1.68 1.68 1.68 0.42 0.42 0.42 0.42 0.42 0.42 46.2 46.2 0.35 0.27 2.11 1.17 1.89 1.14 1.65 2.14 0.03 0.11 0.08 0.03 0.14 0.43 21.86 20.35

Estimativa de todas os stios na ilhas


93

II

6/6

76

III

6/6

41

IV

4/6

Vc

4/6

VI

26

a b

Todas as enzimas listadas so bloqueadas pela metilao.

O tamanho mdio assumido para as ilhas de 1.4 Kb. Esta estimativa baseada nas 37 primeiras ilhas CpG descritas em humanos.
c

Existe vrias enzimas neste grupo, porm aqui esto listadas as mais comuns.

Tabela 5. Clones de YAC utilizados na construo do contig. Lcus


D13mit215 GLI20 Gli11 D13Mit305 D13Mit115

YAC
Y13.215 Y902.2 Y903.1 Y13.305.2 Y3.115.1

Tamanho em Kb
1000 1095 1000 1200 1640

Tabela 6. Clones de BAC utilizados na procura de seqncias codificadoras. Lcus


D13Mit215 Gli20 Gli11 D13Mit115

BAC
388A11 282K20 12P11 496K2

Tamanho em Kb
140 160 100 140

Tabela 7. Clone Origem Tamanho (pb)


350 pb 300 pb 150 pb

Localizao nos YAC/ BAC


nenhuma Y902.2; 283E20 Y903.1; Y13.305.2; 12P11 nenhuma Y902.2; 283E20 Y903.1; Y13.305.2; 12P11 Y902.1; 283E20 Y902.1; 283E20

RT-PCR

Homologia

Nmero de Acesso (Genebank)


M65033 AA029228

CL25 CL9 CL10

AEI, BAC 282E20 AEI, BAC 282E20 AEI, BAC 12P11 AEI, BAC 282E20 AEI, BAC 12P11 AEI, BAC 12P11 AEI, BAC 282E20 AEI, BAC 282E20

positiva negativa positiva

gene Fabpi (exons 1-4) cDNA humano nenhuma homologia

CL12 CL14 CL20

400 pb 200 pb 500 pb

positiva positiva positiva

protena P42685 tirosina cinase EST humana F12060 (clone c-35c03) EST humana R60817 (clone 42061) nenhuma homologia EST rato

CL30 CL34

330 pb 310 pb

positiva positiva

H32240 (EST107143)

Anexos
Tabela 8. EST
stSG1827 (E1)

Iniciadores para a PCR

Tamanho produto de PCR (pb)


149 pb 317 pb 179 pb 107 pb 133 pb 201 pb 220 pb 206 pb 178 pb 160 pb 107 pb 205 pb 158 pb 123 pb 138 pb

Localizao nos YAC/ BAC


Y902.2 Y902.2 Y903.1; Y13.305.2 nenhuma nenhuma nenhuma Y13.115.1; Y903.1 nenhuma nenhuma Y13.115.1; 496K2 Y903.1; Y13.305.2 nenhuma 12P11 nenhuma nenhuma

RT-PCR
positiva positiva positiva negativa negativa negativa positiva negativa negativa positiva positiva positiva positiva negativa negativa

1.ACTGGCTGCTCTTGTCTTGGT 2.CCTCTTCTGACCTGCTTTG WI.9635 (E2) 1.GTGCTTGGTGTGGTTGTGG 2.AAGGAGCTGGAATAGCTTTGC WI.11127 (E3) 1.CTCACGACTGTTCTGGAAAGG 2.CCCACAAATAAAAAGCAAGTTG WI.6721 (E4) 1.TGAGGCATTATCAGGAAATGC 2.ATGCTCAGCAGTACAAAATAGATCC WI.8128 (E5) 1.CGACTCCACCTCCAAACTGT 2.GATGCATTTCCCCCACATAC WI.9547 (E6) 1.AACCCAGTTTTCCAGCCAC 2.AATTCTGATTCCTTTTATCATGTGC A006I27 (E7) 1.AGTTAGTCATAGGAGACAGT 2.CCTTGTACTGTTGTTATACA A006J31 (E8) 1.AACAGACCTCTAGGGTTC 2.GTACATTAAGACATTGAATG SHGC.8675 (E9) 1.TCAGGCGGTTCAAGGCAG 2.GTGTCCATCATCAGGGGAAG SHGC.5634 (E10) 1.GGAGCTGAGCACATTGTGG 2.ATTCTGTTGTCAAGGGGCAAG WI.16185 (E11) 1.GGGTCACTTGGCCTCTTCTA 2.TTTGCAGTCAGGACAAGCCT WI.6581 (E12) 1.AGCCCTCCTGAGGTTGTTG 2.GGGGCAGCTAAAATTTTTATTC stG3118 (E13) 1.GAGTTGGTGCCAGATGGG 2.TTTAAATGTTGGCTCCCTGG stG4037 (E14) 1.TGCAAGGACAGCAGAGGAC 2.TGGGGCCAGTTAGAAGAGG stG4087 (E15) ATGTATCCATTTCAAAGGCCC 2.GCCATGTTAAAATAGGAGTGCC