UNIÃO DINÂMICA DE FACULDADES CATARATAS Curso: Medicina VeterináriaPeríodo: 1º e 2º Período Disciplina: Genética e Evolução Professor: Sandra Regina de Souza

ACADÊMICO(S): ESTUDO DIRIGIDO

DNA, REPLICAÇÃO, TRANSCRIÇÃO E TRADUÇÃO 1. Qual a importância do antiparalelismo da dupla-hélice do DNA? 2. Explique o que são códons e anticódons. 3. Explique o que são stop códons e sua importância. 4. Fale sobre o “dogma central da biologia”. 5. O vírus fX174 de Escherichia coli guarda sua informação genética numa fita simples de DNA. Quando o DNA foi extraído das partículas do vírus e analisado, 21% das bases encontradas eram resíduos de guanina. Com essa informação, é possível determinar que porcentagem de bases desse DNA é timina? Explique. 6. RNA foi extraído de partículas de TMV (vírus de Tobacco) e encontrou-se 20% de citosina. Baseado nessa informação, é possível predizer que porcentagem de bases no MTV é adenina? Explique. 7. Indique se cada uma dessas afirmações a respeito da estrutura do DNA é falsa ou verdadeira: a) A + T = G + C b) A = G; C = T c) A/T = C/G d) T/A = C/G e) A + G = C + T f) G/C = 1 g) A = T dentro de cada fita simples h) Quando separadas, as duas fitas de uma dupla-hélice são idênticas. i) Uma vez conhecida a seqüência de bases de uma fita de um DNA dupla-hélice, a seqüência da segunda fita é deduzível. j) Cada par de nucleotídeo contém dois grupos fosfato, duas desoxirriboses e duas bases.

8. Com a tabela do código genético (códons-aminoácidos), traduza a seguinte sequência de DNA. Lembre-se: o código genético relaciona RNA com proteína, então você primeiro precisará transcrever essa fita de DNA em um RNA complementar a ele. ACCCTAGATGCTAGATCGAATGCTAGGATT 9. A fita de DNA acima sofreu uma mutação e a sequência ficou como abaixo. Transcreva o RNA e traduza novamente. ACCCTAGATGCTAGGTCGAATGCTAGGATT

O que a falta de RNA polimerases poderia acarretar a um organismo? .10. 13. Identifique três tipos de RNA que estão envolvidos na tradução e liste as características e função de cada um deles. Indivíduo 1 – ATCCTAGATGCTAGATCGAATGCTAGGATT Indivíduo 2 – ACCCTCGATGCTAGATCGAATGCTAGGATT 11. o trecho de DNA acima sofreu mutações diferentes. Repita a operação. Muitos genes eucariontes possuem regiões não codificadoras que separam regiões codificadoras dos genes. Em duas outras pessoas. Em que estágio durante a expressão desses genes estas regiões não codificadoras são removidas? 12.

Sign up to vote on this title
UsefulNot useful