Você está na página 1de 4

5) Uma mutao uma alterao na sequncia de nucleotdeos de um gene, um promotor ou um operador.

. Explique os efeitos de cada uma das mutaes abaixo no operon lac da Escherichia coli: a) Mutao no operador, impedindo a ligao do repressor; b) Mutao em lac i (gene regulador), impedindo a sua mutao; c) Mutao no promotor impedindo o acoplamento da RNA polimerase; d) Mutao em lac i, inibindo o acoplamento do repressor lactose; e) Mutao sem sentido em lac y; f) Mutao de localizao desconhecida, que impede a degradao de mRNA lac.

5.a) O operon expressa-se continuamente; b) Idem; c) O operon nunca se expressa; d) Idem; e) Ocorre sntese da beta-galactosidase, mas a cadeia da beta-galactosdeo permease sintetizada apenas at o ponto da mutao e no h sntese de beta- galactosdeo transacetilase; f) Acumulo de mRNA na clula, sempre degradando lactose.
2) O modelo do operon, formulado por Jacob e Monod, serve para explicar a regulao gnica das enzimas que degradam a lactose em E. coli. Explique o que ocorre se houvesse: a) A presena de triptofano no meio celular; b) Uma mutao do tipo substituio de bases silenciosa do gene operador (O); c) Uma mutao do tipo deleo de base nos genes estruturais (Z, Y, A); d) Presena de glicose no meio celular; e) Uma mutao de sentido errado no primeiro gene estrutura.

2.a) No operon Lac seria indiferente; b) Haver leitura dos genes Z, Y, A e degradao da lactose pois tanto o cdon mutante como o original codificam o mesmo aminocido no alterando a leitura. c) A lactose no ser degradada pois haver mutao de sentido errado no sendo formadas as enzimas Z, Y, A. d) O operon Lac no ser ativado e no haver produo das enzimas Z,Y, A. e) A lactose no ser degradada.
6) Diferencie repressores e indutores.

6. Repressor - uma protena sintetizada pelos genes reguladores e especfica para cada operon. A sua funo ligar-se ao stio operador inibindo a expresso do operon. Indutor - uma molcula efetora que atua nos sistemas de induo e, uma vez presente, forma um complexo com o repressor, impedindo a sua ligao ao operador, deprimindo assim o operon.
4) Os operons, que regulam eficientemente a expresso de conjuntos de genes estruturais relacionados entre si so comuns em bactrias, mas ausentes em eucariotos, isto implica que estes no controlam a expresso de seus genes? Justifique.

4. Os operons so sistemas de regulao que respondem a estmulos diretos do meio externo. Sendo eficientemente tamponados contra a maioria das influncias externas os eucariotos no necessitam de mecanismos de resposta direta mas, por outro lado, uma vez que comportam reaes metablicas muito mais complexas, tambm necessitam de

sistemas de regulao gnica muito mais elaborados, o que assegurado pelos chamados circuitos pr programados de expresso gnica. Nestes, que comportam vrios escales de genes, a ativao sempre ocorre em cadeia, e a regulao processa-se tanto a nvel de transcrio como de processamento de hnRNA.

1) Quais as principais diferenas entre a replicao, transcrio e a traduo de procariontes e eucariontes? 1. PROCARIONTES Replicao Realizada no nucleoplasma; Desenrrolamento do DNA por atuao de enzimas em uma ponta. Transcri A molcula de RNA se constitui mo mRNA o propriamente dito, sendo em seguida utilizada na sntese de protenas e posteriormente degradada. Traduo Enzimas especficas de iniciao, enlongamento e terminao prprios de procariotos. EUCARIONTES Realizada no ncleo; Incio em vrios pontos no mesmo momento; bem mais complexo, ocorrendo uma srie de modificaes do RNA antes que ele possa servir no incio do processo (introns e exons).

Enzimas especficas de iniciao, enlongamento e terminao prprios de eucariotos.

2) Considere o segmento de fita de DNA abaixo: 3' AAAGAACGATGATTTCGGATT 5' a) Qual a sequncia de bases do RNAm correspondente? b) Quantos tRNAs sero utilizados na sntese? c) Quais os anti-cdons dos tRNAs acima considerados? d) Quantos aminocidos podero ser codificados? e) Qual a sequncia de aminocidos codificados? f) Considere que esta sequncia sofra splicing e que os introns ocorram a cada 2 cdons no hnRNA, quais seriam as respostas para as perguntas acima?
2.a) 5 UUU CUU GCU ACU AAA GCC UAA 3 b) 7 c) 3 AAA GAA CGA UGA UUU CGG AUU 5 d) 3 e) LIS - GLU - ARG - FIM - FEN - ARG - ILE

fa) 5 UUU UUA AAC CA 3 fb) 3 fc) 3 AAA AAU UUG 5 fd) 3 fe) LIS - ASN - LEU

3) A taxa de replicao em bactrias corresponde a 450 nucleotdeos por segundo, enquanto que em mamferos de 45 nucleotdeos. Quais as concluses que podemos retirar desta informao?
3. O tamanho da molcula de DNA de uma bactria menor e menos condensada que o DNA de um mamfero sendo que esta leva mais tempo para desenrolar a mesma quantidade de nucleotdeos que o DNA de procariotos

4) Assumindo a sequncia de nucleotdeos no DNA: 3' GTC 5' 5' CAG 3' Onde GTC a fita molde: a) Que aminocido codificado por esta trinca? b) Se uma mutao ocorresse e como consequncia transformasse a adenina para a forma tautomrica na replicao, que aminocido seria codificado?
4.a) GLN b) PRO

5) Uma nica adio de nucleotdeos e uma deleo aproximadamente 15 pontos distantes do DNA causam a mudana na sequncia de uma protena de: LYS - SER - PRO - SER - LEU - ASN - ALA - ALA - LYS para LYS - VAL - HIST - HIST - LEU - MET - ALA - ALA - LYS a) Quais as sequncias de nucleotdeos do RNA velho e novo? b) Que tipo de RNA ? c) Qual o nucleotdeo que foi adicionado e qual foi deletado? 5.a) velho: AAA - AGU - CCA - UCA - CUU - AAU - GCU - GCU - AAA novo: AAA - GUC - CAU - CAC - UUA - AUG - GCU - GCU - AAA b) mRNA
c) Deleo de A na segunda trinca de nucleptdeos e adio de G na sexta trina de nucleotdeos.

6) Explique o processo de exciso de introns ou "SPLICING": 6. O mRNA produzido pela transio em eucariotos uma molcula com muito mais ribonucleotdeos que o necessrio para a sntese de uma protena ou enzima. O hnRNA, aps sua sntese sofre um processamento no qual sero cortadas as sequncias que no estaro no mRNA final (introns).

Os segmentos de DNA transcritos que estaro efetivamente presentes no mRNA final so denominados exons. 7) verdadeira a afirmao? "Existe 1 (um) cdon e anti-cdon especfico para cada tRNA". 7. Sim. Para cada um dos cdons presentes em uma molcula de mRNA encontra-se uma molcula de tRNA com um nico anti-cdon complementar. Cada anti-cdon especfico para um dado aminocido, embora cada aminocido possa ter 1 a 4 anti-cdons apropriados a ele. 8) Porque apenas 61 trincas (sequncias de nucleotdeos) codificam aminocidos? 8. Porque 3 trincas UAA, UAG, UGA, codificam o fim da sntese denominados sem sentido e no codificam nenhum aminocido. Em vez disso, so reconhecidos pelos fatores de liberao de protenas que promovem a ejeco das subunidades de ribossomos. Portanto seu significado exatamente o fim da sntese. 9) Voc est estudando em E. coli um gene que especifica uma protena. Uma parte de sua sequncia : - ALA - PRO - TRP - GLU - LIS - CIS - HIST Voc obtm, para este gene, uma srie de mutantes que no mostram atividade enzimtica. Isolando os produtos enzimticos mutantes, voc encontra as seguintes sequncias: MUTANTE 1 - ALA - PRO - TRP - ARG - GLU - LIS - CIS - HIST MUTANTE 2 - ALA - PRO MUTANTE 3 - ALA - PRO - GLY - VAL LIS - CIS - HIST Qual a base molecular para cada mutao? Qual a sequncia de DNA que especifica esta parte da protena? 9. Mutante 1: GCA - CCA - UGG - GAA - AAA - UGU - CAU (mutao de sentido errado com adio de uma trinca errada)
Mutante 2: GCA - CCA - UGA (mutao de ponto - transio) Mutante 3: GCA - CCA - GGG - GUG - AAA - UGU - CAU (mutao de ponto ocorrendo primeiro transverso no terceiro par de bases e, segundo, transverso no segundo par de bases)