Você está na página 1de 137

ASSOCIATION OF MARKERS IN THE VITAMIN D RECEPTOR WITH MHC CLASS II EXPRESSION AND MAREK'S DISEASE RESISTANCE

Dana Praslickova

Department of Animal Science McGill University Montreal Canada

December, 2007

A thesis submitted to McGill University in partial fulfilment of the requirements of the degree of Doctor of Philosophy

Dana Praslickova, 2007

1*1

Library and Archives Canada Published Heritage Branch


395 Wellington Street Ottawa ON K1A0N4 Canada

Bibliotheque et Archives Canada Direction du Patrimoine de I'edition


395, rue Wellington Ottawa ON K1A0N4 Canada

Your file Votre reference ISBN: 978-0-494-50980-7 Our file Notre reference ISBN: 978-0-494-50980-7

NOTICE: The author has granted a nonexclusive license allowing Library and Archives Canada to reproduce, publish, archive, preserve, conserve, communicate to the public by telecommunication or on the Internet, loan, distribute and sell theses worldwide, for commercial or noncommercial purposes, in microform, paper, electronic and/or any other formats. The author retains copyright ownership and moral rights in this thesis. Neither the thesis nor substantial extracts from it may be printed or otherwise reproduced without the author's permission.

AVIS: L'auteur a accorde une licence non exclusive permettant a la Bibliotheque et Archives Canada de reproduire, publier, archiver, sauvegarder, conserver, transmettre au public par telecommunication ou par Plntemet, prefer, distribuer et vendre des theses partout dans le monde, a des fins commerciales ou autres, sur support microforme, papier, electronique et/ou autres formats.

L'auteur conserve la propriete du droit d'auteur et des droits moraux qui protege cette these. Ni la these ni des extraits substantiels de celle-ci ne doivent etre imprimes ou autrement reproduits sans son autorisation.

In compliance with the Canadian Privacy Act some supporting forms may have been removed from this thesis. While these forms may be included in the document page count, their removal does not represent any loss of content from the thesis.

Conformement a la loi canadienne sur la protection de la vie privee, quelques formulaires secondaires ont ete enleves de cette these. Bien que ces formulaires aient inclus dans la pagination, il n'y aura aucun contenu manquant.

Canada

MOTTO

"...for it is not the rock that is the most solid and it is not steel that is the most firm. In fact, it is an ordinary Joe whose endurance is greatest."

J. C. Hronsky: Jozef Mak. Published in Czechoslovakia by Tatran, 1965, p. 271

This is dedicated to my beloved daughter Zuzana for being supportive and patient throughout all these years...

Contents

TABLE OF CONTENTS Page TABLE OF CONTENTS ABSTRACT RESUME ACKNOWLEDGEMENTS LIST OF TABLES LIST OF FIGURES ABBREVIATIONS STATEMENT OF ORIGINALITY CONTRIBUTION OF CO-AUTORS TO MANUSCRIPTS FOR PUBLICATION CHAPTER 1 - INTRODUCTION 1.1 GENERAL INTRODUCTION 1.1.1 Hypothesis 1.1.2 Objective 1.1.3 Experimental model 1.2 OVERVIEW OF THESIS CONTENT 1.3 REFERENCES CHAPTER 2 - LITERATURE REVIEW 2.1 GENERAL DESCRIPTOPN OF MAREK'S DISEASE 2.1.1 Marek's disease virus 2.1.2 Phatogenesis 2.1.3 Immune response of the organism 2.1.4 Diagnosis of Marek's disease 2.2 CONTROL STRATEGY 2.2.1 Vaccination 2.2.2 Genetic resistance 2.2.3 Major histocompactibility complex genes 2.2.4 Non-major histocompactibility complex genes xix 1 1 2 2 3 3 4 5 5 5 7 10 12 13 13 15 16 16 i v vii ix xi xii xiv xvii

2.3 GENES USED IN OUR STUDY 2.3.1 Growth hormone 2.3.2 Growth hormone receptor 2.3.3 Macrophage inflammatory protein 3a 2.3.4 Vitamin D 2.4 REFERENCES CONNECTING STATEMENT I CHAPTER 3 - SEQUENCE VARIATIONS IN GENES ENCODING ENZYMES INVOLVED IN THE VITAMIN D METABOLISM AND ASSOCIATION WITH SUBCLASSES OF PERIPHERAL BLOOD MONONUCLEAR CELLS IN CHICKENS 3.1 ABSTRACT 3.2 INTRODUCTION 3.3 MATERIALS AND METHODS 3.3.1 Strains of chickens and data collection 3.3.2 Flow cytometry 3.3.3 Genetic analysis 3.3.4 Statistics and graphics 3.4 RESULTS 3.4.1 Determination of blocks of co-segregating SNP 3.4.2 Association of single genes with the cell differentiation antigens on peripheral blood mononuclear cells 3.4.3 Gene interaction 3.4.4 Correlation with production traits 3.5 DISCUSSION 3.6 ACKNOWLEDGEMENTS 3.7 REFERENCES CONNECTING STATEMENT II

17 17 18 19 20 23 35

36 37 38 39 39 39 40 41 41 41

42 43 43 44 47 60 63

CHAPTER 4 - EFFECT OF MARKER ASSISTED SELECTION ON INDICATORS OF MAREK'S DISEASE IN A VACCINATED COMMERCIAL WHITE LEGHORN STRAIN 4.1 ABSTRACT 4.2 INTRODUCTION 4.3 MATERIALS AND METHODS 4.3.1 Strains of chickens and selection strategy 4.3.2 Markers selection 4.3.3 Challenge 4.3.4 Apramycin treatment 4.3.5 Viral titers in feather tip extracts 4.3.6 Statistical analysis 4.4 RESULTS 4.4.1 Efficacy of vaccination 4.4.2 Effect of selection trial on viral titers 4.4.3 Survival analysis 4.4.4 Necropsy analysis 4.4.5 Effect on body weight, spleen weight and bursal weight 4.5 DISCUSSION 4.6 REFERENCES CONNECTING STATEMENT III CHAPTER 5 - ASSOCIATION OF A MARKER IN THE VITAMIN D RECEPTOR GENE WITH MAREK'S DISEASE RESISTANCE IN POULTRY 5.1 ABSTRACT 5.2 INTRODUCTION 5.3 MATERIALS AND METHODS 5.3.1 Strains of chickens and challenge test 5.3.2 DNA extraction and viral titration 5.3.3 Genetic analysis of the VDR gene 90 91 92 93 93 93 94 73 73 86 89 64 65 66 68 68 68 69 69 69 70 70 70 71 71 72

Contents

5.3.4 Statistical analysis 5.4 RESULTS 5.4.1 Association with viral proliferation 5.4.2 Association with MD lesions, mortality and weight of the bursa 5.5 DISCUSSION 5.6 REFERENCES CHAPTER 6 - GENERAL CONCLUSION APPENDIX

94 95 95

95 96 106 109 113

Abstract

ABSTRACT Vaccination, biosecurity and selection for genetic resistance are used world-wide in the poultry industry against the threat of Marek's disease (MD). Unfortunately there are new outbreaks of MD that cause serious economic problems. Scientists are therefore searching for new and more effective ways to improve existing controls of the disease. Knowledge of the chicken genome and progress in the study of the molecular biology of the MD virus are providing new approaches to MD control. A particularly useful strategy is the identification of genes that affect viral and tumor susceptibility. Genetic markers in the growth hormone receptor (GHR), the growth hormone (GH) and the chemokine MIP3 a that are associated with MD resistance have previously been identified in our laboratory. In this thesis we identified additional candidate genes by analyzing genes of the vitamin D metabolism; conducted a large scale challenge experiment with Marek's disease virus and tested genes encoding enzymes involved in vitamin D metabolism for association with disease resistance. The first manuscript describes the analysis of three genes of the vitamin D metabolism for sequence variability and their association with the proportion of peripheral blood mononuclear cells (PBMC) that display the surface antigens LYB, MHC II, CD3, CD4, CD8, TCR1 (Ty8) and TCR2 (Tap1). We identified a genetic marker in the vitamin D receptor (VDR) gene that affected the frequency of the MHC class II expressing leukocytes (P=0.0007), and a marker in the vitamin D binding protein gene that (DBP SIP 15) affected the expression of TCR1. The goal of the second study was to conduct selection in a commercial strain of White Leghorns for markers in the GH, GHR and MIP-3a genes that had previously been associated with MD resistance and to compare the resistance of the selected and nonselected commercial cross. We conducted two challenge experiments three months apart with 100 chickens from the selected and 100 chickens from a non-selected population in each challenge. To maintain similarity in poultry management, we followed a commercial vaccination procedure. A database was compiled that comprised measurements of the viral titers in extracts of feather tips on a weekly basis up to 8 weeks post infection, a record of mortality and a necropsy analysis of all chickens, including those that died

Abstract

during the experiment. The outcome in challenge 1 differed from challenge 2. In challenge 1 the selected population had a two-fold lower viral load than the non-selected control population (P= 10") while in challenge 2 the situation was reversed (P=T0"). A comparison of the effect of the challenge on the two populations shows that the titers in the non-selected population in the two challenges were similar, while the titers in the selected population differed by a factor of four. Hence the challenges were reproducible for the non-selected population but not for the selected population. The same conclusion was reached when other indicators of MD, such as mortality, frequency of proliferative lesions, loss of body weight or atrophy of the bursa were measured. The source of the different behaviors is unknown, but it raises the possibility that immune compromising factors such as stress, nutritional status, maternal antibodies or infections may compromise the response to MD infection in a manner that is dependent on the genetic background. In the third manuscript we used the database we had created to analyze the influence of three markers in the chicken VDR gene on MD resistance. We found that the marker that had been found to be associated with MHC class II was also associated with a reduced viral titer (P=0.002). The effect of the genotypes was additive with a 50% difference between the two homozygotes. It was independent of the population as well as the challenge. Other indicators of MD behaved concordantly. The result is the first evidence that genetic variants in genes encoding enzymes involved in vitamin D metabolism may affect MD resistance in chickens.

Resume

RESUME

La vaccination, la biosecurite et la selection pour une resistance genetique sont utilisees mondialement dans l'industrie avicole contre le danger impose par la maladie de Marek (MD). Malheureusement, il y a des nouvelles apparences de MD qui causent de graves problemes financiers. Des scientifiques sont en train de chercher de nouvelles et meilleures facons d'ameliorer les methodes de controles presentement utilises contre le MD. Une strategie particulierement utile consiste a identifier les genes qui affectent l'hypersensibilite virale et tumorale. Les marqueurs genetiques trouves dans le recepteur de 1'hormone de croissance (GHR), l'hormone de croissance (GH) et le chemokine MIP3a, qui sont associes avec la resistance contre la MD, ont deja ete identifies dans notre laboratoire. Dans cette these on a identifie d'autres genes candidats en analysant les genes du metabolisme de la vitamine D. Pour accomplir cette tache, on a cree une experience scientifique, effectuee sur une grande echelle, avec le virus de la maladie de Marek, et on a teste les genes du metabolisme de la vitamine D associes avec la resistance contre la maladie. Dans le premier manuscrit on a decrit 1'analyse des trois genes du metabolisme de la vitamine D pour la variability dans leur sequence genetique et leur association avec la proportion des cellules mononuclees du sang peripherique (PBMC) qui exposent les antigenes de surface: LYB, MHC II, CD3, CD4, CD8, TCR1 (TyS) et TCR2 (Tap). On a identifie un marqueur genetique dans le gene du recepteur de la vitamine D qui a un effet sur la frequence des leucocytes exprimant des MHC II (P=0.0007), et un autre marqueur dans le gene de la proteine fixant vitamine D (DBP S1P15) qui a un effet sur l'expression deTCRl. Le but de la deuxieme etude etait d'effectuer une selection dans la lignee commerciale de White Leghorns pour des marqueurs genetiques dans les genes GH, GHR, et MIP-3a qui ont deja ete associes avec l'hormone de croissance, et de comparer la resistance des volaille commerciale selectionnes et non-selectionnes. On a prepare deux defis avec trois mois d'ecart et avec 100 individus selectionnes et 100 individus non-selectionnes dans chaque defi. Pour atteindre une coherence dans la gestion des volailles, on a suivi la procedure pour la vaccination commerciale. Une base de donnees

vii

Resume

a ete compilee, contenant les mesures des titres viraux venant des extraits de bout de plumes qui ont ete preleves chaque semaine pendant huit semaines apres l'infection, et les analyses d'autopsie de toutes les volailles, y compris celles qui sont mortes pendant la manipulation. Les resultats du premier defi etaient differents du second. Dans le premier defi, la population selectionnee avait une charge virale deux fois moins de celle de la population non-selectionnee (P=10~5), tandis que cette situation etait inversee lors du deuxieme defi (P=10"3). Une comparaison de l'effet du defi sur les deux populations demontre que les titres de la population non-selectionnee sont similaires dans les deux defis, pendant que les titres de la population selectionnee different d'un facteur de quatre. Ainsi, les defis etaient reproductibles pour la population non-selectionnee et non pour la population selectionnee. La meme conclusion a ete atteinte quand les autres indicateurs de MD, telles que la mortalite, la frequence des lesions proliferatives, la perte de poids, ou l'atrophie de la bourse ont ete mesurees. La source des differents comportements est inconnue, mais ceci donne la possibility que les facteurs qui compromettent les defenses immunitaires comme le stress, l'etat nutritionnel, et les anticorps materaels, ou les infections peuvent compromettre la reponse a l'infection de MD d'une maniere qui depend du contexte genetique. Dans le troisieme manuscrit, on a utilise la base de donnees qu'on a creee dans le but d'analyser l'influence des trois marqueurs du gene VDR des volailles sur la resistance contre la maladie de Marek. On a trouve que le marqueur deja associe avec MHC classe II etait aussi associe avec un titre viral reduit (P=0.002). L'effet des genotypes etait additif, avec une difference de 50% entre les deux homozygotes. Cet effet se manifestait independamment de la population et du defi. D'autres indicateurs de la maladie de Marek se sont conduits en consequence. Le resultat est la premiere indication que les variables genetiques des genes du metabolisme de la vitamine D peuvent influencer la resistance contre les maladies des volailles.

V1U

Acknowledgements

ACKNOWLEDGEMENTS I wish to extend my sincere gratitude and appreciation first of all to my supervisor Dr. Urs Kiihnlein. His wonderful guidance, encouragement, research suggestions and daily discussions have made my work in the laboratory very enjoyable. His feelings of excitement and joy towards science and novel research will always remain etched in my mind. I will remember everything, and if I ever have my own students I wish they will have the same feelings about me, as I have about this extraordinary man. Thank you Dr. Kiihnlein! My gratitude also belongs to Dr. David Zadworny, my first supervisor and mentor at the Department of Animal Science, for his guidance and support, and for encouraging me in my further studies. I wish to thank Dr. Al Kulenkamp and Dr. George Ansah from the Shaver Poultry Breeding farms Ltd. Cambridge, ON and Dr. Shayan Sharif, A.J. Sarson, M.F. AbdilCareem from the department of the Pathobiology, Veterinary School, University of Guelph, ON for carrying out the breeding and the Marek's disease challenge experiments and for their advise in the writing of my thesis. I wish to acknowledge a very special man who is no longer with us. His rich life was broken by cancer and I could not be there to express my gratitude. His name is Jozef Cerman M.D. (Institute of Parasitology, Slovak Republic, Europe), and I thank him for opening the door for me to the world of science by encouraging my curiosity. His patience and teachings have taught me how important it is to be organized and to maintain clear and detailed records of every step made, including mistakes. I wish to thank Dr. Chadee and Kathy Keller at the Institute of Parasitology, McGill University, for helping me when I first arrived to Canada in 1999. Particularly Kathy, she was my voice when I could not speak English. I wish to thank Dr. Xin Zhao, Dr. Roger Buckland and Dr. Ciro Riuz-Feria, for acting as my committee members and for always having time to answer my questions. My sincere thanks go to Alejandra Burchard-Levine, Myriam Fenina and Jean Daniel Lalande, summer students of Dr. Kiihnlein and Dr. Zadworny, for their help with DNA extraction in my project. I believe that the amount of feathers that passed trough our

ix

Acknowledgements

hands could provide a few of pairs of the wings for Daedalus and Icarus to escape from the Crete. I am thankful to Barbara, Cindy and Sandra, our secretaries for being so friendly and supportive. Especially for Barbara's advice of an Iron treatment when I was feeling ill, for Cindy's smile and helpful advice in parenting, and for Sandra's amicable and cheerful personality. I want to thank my school mates Katja, Susana, Jimmy, Babu, Reza, Marilyn, Jovette, Benoit, Nabil, Juliette, Ming-Kai, Stephanie, Gen, Yonju Ha, Vinay, Marsha, Deeni, Audrey, Jessica, Fadi and Jose for making my everyday life in the department a bearable one, for introducing me to their different cultures, for making me laugh and for the many social activities behind the walls of the University. I would like to thank Charles-Olivier Basile for his tireless effort in correcting my English. Last but not least, I would like to thank my loving husband Jan and my family for the unconditional support they provided me throughout all these years. Especially to my mother for her boundless love and for her complete understanding when I could not be with her during her heart surgery. Thank you mamicka!

List of Tables

LIST OF TABLES Page Table 3.1 Primers used to amplify segments of the VDR, DBP and Cyp24 genes Table 3.2 Table 3.3 Distribution of the polymorphisms Identification of groups of co-segregating markers in he genes encoding the DBP Table 3.4 Association of single and pairwise combinations of marker genotypes with cell surface antigens on leukocytes Table 3.5 Table 3.6 Spearman rank correlation between FACS counts Correlation between egg quality trails and leukocyte cell surface antigens Table 4.1 Influence of selection on the genotype distribution Table 4.2 Comparison of the cumulative viral titer at 3 and 5 weeks postinfection Table 4.3 Frequency of lesions among chickens for various tissues in trial 1 and 2 Table 4.4 Effect of lesions on viral load, body, spleen and bursa weight in surviving chickens Table 5.1 GLM analysis of the dependence of the integrated viral titers on trial, population and VDR S1P4 genotype Table 5.2 Mean viral load for different VDR S1P4 genotypes 99 100 77 77 76 54 76 52 53 50 48 49

List of Figures

LIST OF FIGURES

Page Figure 2.1 Marek's disease virus Figure 2.2 Pathogenesis of Marek's disease Figure 2.3 Immune responses to Marek's disease virus Figure 2.4 The sources and metabolism of vitamin D Figure 3.1 Association of VDR genotypes with the MHC class II count and the CD8/CD3 ratio Figure 3.2 Mean of TCR1 counts for different genotype combinations of the marker S1P3 in the Cyp24 gene and S1P15 in the DBP gene Figure 3.3 Interactive effect between the DBP gene and the Cyp24 gene on the TCR1 ratio Figure 4.1 Mating strategy to produce the commercial strain 123 Figure 4.2 Protective effect of vaccination on MD mortality Figure 4.3 Effect of vaccination on the viral load integrated over the first 3 weeks post infection Figure 4.4 Time course of viral proliferation Figure 4.5 Percentile distribution of the viral load to 3 weeks in dependence of trial and population Figure 4.6 Survival curve of the two populations S and U in trial 1 and 2 Figure 4.7 Percentile distribution of the bursa-body weight ratio among the survivors of the challenge experiment Figure 4.8 Relationship between the mean bursa weight and mean of the log transformed viral load to 35 dpi among survivors of the challenge experiment Figure 5.1 Map of the VDR gene Figure 5.2 Time course of viral titers in feather tips for different VDR S1P4 genotypes Figure 5.3 Tissue distribution of proliferative and inflammatory lesions Figure 5.4 Survival and hazard rate for different VDR SIP4 genotypes 102 103 104 85 101 84 82 83 80 81 58 78 79 57 55 5 9 10 22

List of Figures

Figure 5.5 Relationship between the proportion of MHC class II positive peripheral leucocytes and mortality, the viral load to 21 dpi, and the frequency of lesions/chicken 105

Abbreviations

ABBREVIATIONS AEV ANOVA APC bp Ca2 + CCL20 CCR6 CD3 CD4 CD5 Cyp24 DBP DNA DNAman dpi EARCs EDTA et al. EWT FP-SBE F2 g GH GHR GHBP GLM HTV IBD ICP4 IGF Avian Encephalomyelitis Virus Analyses of Variance Antigen Presenting Cells Base Pair Calcium Ions Chemokine (C-C Motif) Ligand 20 CC Chemokine Receptor 6 Cluster of Differentiation 3 (Accessory Molecules for T Cell) Cluster of Differentiation 4 (Accessory Molecules for T Cell) Cluster of Differentiation 4 (Accessory Molecules for T Cell) Vitamin D 24-hydroxylase Vitamin D Binding Protein Deoxyribonucleic Acid Sequence Analysis Software for Windows and Macintosh Day Post Infection Ellipsoid Associated Reticular Cells Ethylene Diamine Tetraacetic Acid et alia, Latin for "and others" Egg Weight in Specific Period Fluorescence Polarization - Single Base Extension Second Filial Generation Gram Growth Hormone Growth Hormone Receptor Growth Hormone Binding Protein General Linear Model Herpes Turkey Virus Infectious Bursal Disease Infected Cell Protein 4 Insulin Like Growth Factor

Abbreviations

IgGl INFy Log k LYB LTD mRNA MD MDV MHCII N NaCl NCSS NIH NK NO ODC P-value pH PBMC PBS PCR PEPCK-C Per RB1B RFLP PFU S SDS SLD SNP

Immunoglobulin G Interferon Gamma Logarithm Haplogroup Pan-B cell Monoclonal Antibody Laron Type Dwarfism Messenger Ribonucleic Acid Marek's Disease Marek's Disease Virus Major Histocompatibility Complex Class Two Number of Observations Sodium Chloride Number Cruncher Statistical System National Institutes of Health Natural Killer Cells Nitric Oxide Ornithine Decarboxylase Probability Negative Logarithm of the Hydrogen Ion Concentration Peripheral Blood Mononuclear Cells Phosphate Buffered Saline Polymerase Chain Reaction Cytosolic form of Phosphoenolpyruvate Carboxykinase Period Very Virulent Strain of MDV Restriction Fragment Length Polymorphism Plug of Units Selected Population Sodium Dodecyl Sulfate Sex Linked Dwarfism Single Nucleotide Polymorphism

Abbreviations

SPG T TCR1 (TyS) TCR2 (Tap) Tris-HCl VD VDR VMRD U USDA l,25-(OH)2D 25-OHD

Egg Specific Gravity Trial T Cell Receptor (Distinct Chains) T Cell Receptor (Distinct Chains) Trishydroxymethylaminomethane Hydrochloride Vitamin D Vitamin D Receptor Veterinary Medical Research and Development Unselected Population United States Department of Agriculture 1,25 Dihydroxyvitamin D3 25 Hydroxyvitamin D3

Statement of Originality

STATEMENT OF ORIGINALITY 1) In chapter 3 (manuscript #1) the genetic variations in three genes of the vitamin D metabolism were analyzed. Arbitrarily chosen markers were tested for an association with differences in the profile of peripheral blood leukocytes. A marker in the vitamin D binding protein and a marker in the vitamin receptor were found to affect the proportion of TCR1 (TCRyS) and MHC class II expressing leukocytes, respectively. This is the first report of an association of markers in genes of the vitamin D metabolism with immune parameters in chickens.

2) Chapter 4 (manuscript #2) is the first report on DNA based selection for the markers associated with Marek's disease resistance in poultry. Two hatches of a control population and a population enriched for markers located in the growth hormone receptor, the growth hormone, and the macrophage inflammatory protein 3a (MIP-3a) were compared. Although the results in the two hatches were contradictory, it makes an important point. Extraneous factors such as stress or the health status of the chickens may affect the course of a disease and may reverse the effects of genetic markers on disease resistance.

3) The challenge test was conducted in 400 vaccinated chickens, is larger and more complete than those found in the literature. In particular, the database included a profile of viral proliferation over 8 weeks, a record of mortality, measurements of the body weight, spleen weight and bursa weight and extensive necropsy data. Furthermore, it is the first such database established in vaccinated chickens. This database will be useful for the identification of markers associated with Marek's disease in commercial population that are usually vaccinated.

4) In chapter 6 (manuscript #3) we used our database to test the association of three markers in the vitamin D receptor gene with disease resistance. The marker that had been found to affect the expression of MHC class II was found to be associated with Marek's disease susceptibility. All the other markers had no effect. This is the first report of

xvii

Statement of Originality

showing that the chicken segregates for vitamin D receptor variants that affect Marek's disease susceptibility. Besides a recent report that the vitamin D receptor affects susceptibility of humans to the hepatitis virus B, it is the first documentation of the vitamin D receptor to have an impact on a viral disease.

XVUl

Contributors

CONTRIBUTION OF CO-AUTHORS TO MANUSCRIPTS FOR PUBLICATION The thesis follows the form of manuscripts according to the "Guidelines concerning Thesis Preparation" of the faculty of Graduate Studies and research. The thesis consists of three manuscripts that are under review. Each manuscript has several co-authors. The description of their contribution in the articles, and their corresponding address are mentioned below. Dana Praslickova4, (Ph.D. Candidate), conceptualized the project, conducted the laboratory experiments, gathered and analyzed the data collected, and wrote the first and subsequent drafts of all three manuscripts for scientific publication. Urs Kuhnlein4 (Professor), supervisor of the Ph.D. candidate, provided invaluable guidance on the experimental design, advised throughout the project, the data analysis, the interpretation and the editing for the scientific publication and theses. David Zadworny4 (Associate Professor), provided laboratory supplies and financial support. Dr. All Kulenkamp1 (Research Scientist) and Dr. George Ansah1 (Research Scientist) carried out breeding and selection of the White Leghorn strains and vaccination. M. Lessard 2 (Research Scientist) provided database for the analysis of immune traits. Dr. Shay an Sharif3 (Associate Professor), Aimee J. Sarson3 (Graduate student), Mohamed Faizal Abdul-Careem3 (Graduate student), carried out the Marek's disease challenge experiments, necropsy analysis and valuable advises in the writing of my thesis.

Four different institutions were involved in this study:


1

Shaver Poultry Breeding Farms Ltd. 500 Franklin Boulevard, Cambridge, ON, Canada, N1R8G6.

Contributors

Dairy and Swine research and development Centre, Agriculture and Agri-Food Canada, Lennoxville, QC, Canada, JIM 1Z3. Department of the Pathobiology, Veterinary School, University of Guelph, Guelph, ON, Canada, NIG 2W1. Department of Animal Science McGill University, 21-111 Lakeshore Road, Ste. Anne de Bellevue. QC, Canada, H9X 3V9.

Chapter 1

CHAPTER 1 INTRODUCTION 1.1 GENERAL INTRODUCTION Fossil records indicate that birds separated from mammals about 310 million years ago (Furlong, 2005). The birds that we know as domestic poultry descended from the Red Jungle Fowl (Gallus gallus). They were domesticated about 8000 years ago in South East Asia (Kaul et al., 2004), and over the years have evolved into many different breeds. In recent years selection by the poultry industry has been very extensive, using various crossbreeding strategies to increase rate of growth, body weight, egg production, and other traits aimed at increasing production. New horizons, emerged, when the National Human Genome Research Institute (NHGRI) announced the first draft of the chicken genome in 2004 (International Chicken Genome Sequencing Consortium, 2004). Composed of about 1 billion base pairs of sequence, the chicken genome was the first non-mammalian vertebrate, and the first agricultural animal genome to be sequenced. The sequencing of the chicken genome was accelerated because of outbreaks of avian flu that emphasized the need to learn more about the chicken genome, and how genetic variation may play a role in the susceptibility to the disease. Identification of genetic variations that are involved in resistance, susceptibility or tolerance to diseases such as salmonellosis, coccidiosis, lymphoid leucosis, Marek's disease, ascites, sudden death syndrome, and infectious bursal disease will make it feasible to select for disease resistance in poultry. Our laboratory focused on the study of variation in the genes influencing the resistance of chickens to Marek's disease (MD). Marek's disease is a highly contagious, lymphoproliferative, re-emerging, and economically important disease in the poultry industry. It is caused by an avian herpes virus. The continual evolution of MD virus (MDV) towards greater virulence, and the evidence of reoccurrence of MD in vaccinated flocks in the last decade, suggests that future outbreaks of MD could cause serious problems. As a consequence, there has been a renewed effort to improve existing control of the disease. Such control strategies are effective vaccination, good biosecurity, and

Chapter 1

selection for genetic resistance (Gimeno, 2004). It is also very important to note that the economic impact of MD on the world poultry industry is thought to be in the range of US$1-2 billion annually (Morrow and Fehler, 2004). Genetic resistance is a reliable, long lasting, and environmentally sound solution. The essential strategy is to identify the presence of variations in specific regions of the genome (termed "marker") which affect viral and tumor susceptibility. We have identified variations in the growth hormone receptor (GHR) gene, the growth hormone (GH) gene (Kuhnlein et al, 1997; Feng et al, 1998) and the macrophage inflammatory protein 3a (MIP-3a, CCL20, ahl89) gene (Masilamani, 2003) that were associated with MD resistance. The search for genetic variants that affect disease resistance is a continuous process and the first manuscript in this thesis describes the association of three genes of the vitamin D metabolism with changes in the immune response. In the second manuscript we describe marker assisted selection for the three genes described above. This experiment also provided us with a database to test the association of markers with resistance. In the last manuscript, we used this database to analyze the effect of a marker of the vitamin D receptor gene that we had found to be associated with a reduced expression of MHC class II antigen on peripheral blood leukocytes.

1.1.1 Hypothesis 1) Similar to humans, chickens are segregating for variants in genes of the vitamin D metabolism that affect the cognate immune system. 2) Selection for the favorable alleles can be used to improve disease resistance for MD in commercial strains of the chicken. 3) Genes of the vitamin D metabolic pathway that affect the immune response will also affect MD.

1.1.2 Objective 1) Characterization of genes encoding enzymes in the vitamin D pathway. Search for markers that affect the profile of peripheral blood leukocytes. Such markers will provide us with candidate markers for MD resistance.

Chapter 1

2) Conduct marker assisted selection in a commercial cross to improve Marek's disease resistance (MDR) using markers previously associated with MDR and to simultaneously create a database for the detection of additional resistance associated markers. 3) Test the genetic variations in the genes of vitamin D pathway that affect immune traits for association with resistance to MD.

1.1.3 Experimental model A strain of White Leghorn chickens was used in our study, a non-inbred experimental strain that was developed and maintained at Agriculture Canada (Ottawa, Ontario), and a commercial strain that was developed by Shaver Poultry Breeding Farms Ltd. (Cambrige, Ontario). The genes we chose for selection in our experiment were candidate genes (GH, GHR and MIP-3a) involved in growth and immune responsiveness. The genetic variation of the genes were previously identified in our laboratory as being associated with resistance to MD. The genes of the vitamin D metabolism were chosen on the basis of their association with immune responsiveness and disease resistance in humans. Breeding was carried out by the Shaver Poultry Breeding Farms Ltd. (Cambridge, ON) and the challenge by the Dept of Pathobiology of the Ontario Veterinary School, of the University of Guelph (ON). The project was approved by the Animal Care Committee of that department. They are an accredited institution specialized in poultry breeding with personal and/or animal protective equipment, animal housing in standard cages, and environmentally safe procedures that avoid exposure with (and/or inactivate) all of the potential pathogens.

1.2 OVERVIEW OF THE THESIS CONTENT There are six chapters in this thesis, beginning with the introduction describing the hypothesis and the objective of this study, followed by a literature review. The literature review contains a general description of Marek's disease, control strategies of the poultry industry and a characterization of the genes used in our study. Chapter 3, 4 and 5 are manuscripts describing our results, including the references specific to each manuscripts. Chapter 6 contains the conclusion.

Chapter 1

1.3 REFERENCES Feng, X.P., Kuhnlein, U., Fairfull, R.W., Aggrey, S.E., Yao, Y. and Zadworny, D. (1998) A genetic marker in the growth hormone receptor gene associated with body weight in chickens. J. Hered., 89: 355-359 Furlong, R.F. (2005) Insights into vertebrate evolution from the chicken genome sequence. Genome Biol, 6:207 Gimeno, I.M. (2004) Future strategies for controlling Marek's disease. Marek's disease: An Evolving problem. Elsevier Academic press, London, UK, pp. 186-199 International Chicken Genome Sequencing Consortium (2004) Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution. Nature 432: 695-716 Kaul, R., Shah, J.N. and Chakrabarty, B. (2004) An assessment of important physical traits shown by captive Red Jungle Fowl in India. Curr. Sci., 87:1498-1499 Kuhnlein, U., Ni, L., Weigend, S., Gavora, J.S., Fairfull, W. and Zadworny, D. (1997) DNA polymorphisms in the chicken growth hormone gene: Response to selection for disease resistance and association with egg production. Anim. Genet., 28: 116123 Masilamani, T.J. (2003) Identification of genetic markers associated with Marek's disease in chickens. M.Sc. Thesis, McGill University Morrow, Ch., and Fehler, F. (2004) Marek's disease: a worldwide problem. Marek's disease: An Evolving problem. Elsevier Academic press, London, UK, pp. 49-61

Chapter 2

CHAPTER 2 LITERATURE REVIEW 2.1 GENERAL DESCRIPTION OF MAREK'S DISEASE Marek's disease was first described by Jozef Marek in 1907 (Marek, 1907). It is characterized by paralysis, as a result of lymphoid infiltration into peripheral nerves, lymphomas in various organs, skin lesions, immunosuppression and blindness accompanied by non-specific signs such as weight loss and pallor (Zelnik, 2004). It is caused by a herpesvirus, the Marek's disease virus (MDV). An important step forward in the study of the disease was the isolation of MDV from a chicken kidney tumor cell culture by Churchill and Biggs, (1968) and independently from cultured duck embryo cells by Nazerian et al. (1968) and Solomon et al. (1968).

2.1.1 Marek's disease virus MDV (Figure 2.1) is a member of the Alphaherpesvirinae subfamily of the Herpesviridae (Cantello et al, 1991). Herpesviridae genomes are double stranded linear DNA molecules that range in size from 108 - 230 kbp (Davison, 2002).

Figure 2.1 Marek's disease virus (Shumacher, 2001).

Chapter 2

Three MDV serotypes have been identified, of which only serotype 1 (MDV-1) is pathogenic, whereas MDV serotype 2 (MDV-2) and serotype 3 (herpesvirus of turkeys, HVT) are not pathogenic or only weakly pathogenic and non-oncogenic in chickens (Tischer et al, 2002). All three serotypes have been sequenced and it has been shown that the gene contents and linear arrangements are similar but they vary in the content of guanine and cytosine (GC): 44.1 %, 53.2 % and 47.2 % in MDV-1, MDV-2 and HTV, respectively (Lee et al, 2000). Genome comparisons suggest that the three viruses have evolved in parallel from different viral species (Fragnet et al, 2003). The virus genome is comprised of a long unique sequence (UL) and short unique sequence (Us) each of which is bracketed by inverted internal (IRL, IRS) and terminal repeats (TRL, TRS) (Nair et al, 2004). A total of 103 (MDV-1), 102 (MDV-2) and 99 (HTV) genes have been identified. The putative oncogene for MDV1 is MDV EcoRI-Q (meq) (Brown et al, 2006). Other important genes associated with pathogenicity of MDV are phosphoprotein 38 (pp38) and viral interleukin 8 (vIL8). MDV EcoRI-Q and pp38 both play important roles in latency and tumor formation (Ross et al, 1997), and vIL8 (Parcells et al, 2001) attracts lymphocytes and plays a role in oncogenesis (Sick et al, 2000). An important immediate-early (IE) gene expressed early after infection is ICP4 (infected cell polypeptide 4) which regulates aspects of viral replication (DeLuca and Schaffer, 1985). Another group includes the genes that code for the proteins involved in MDV replication and infection of cells. For example, the capsid protein VP5 and the tegument proteins VP11/12, VP13/14, VP16 play important roles in MDV growth in cells (Lupiani et al, 2001), and the tegument protein VP22 is required for virus replication and virus transmission between cells (Dorange et al, 2002). MDV membrane glycoproteins gE and gl are absolutely required for MDV replication (Schumacher et al, 2001). The gC gene encodes antigen A, which is expressed on the cell surface and in the cytoplasm of infected cells (Coussens et al, 1989), but does not appear to be oncogenic (Calnek and Witter, 1997). More research is needed to study genes that are involved in MDV replication and pathogenesis to better understand and control MD.

Chapter 2

2.1.2 Pathogenesis Marek's disease spreads by horizontal infection. Sources of infectious virus are dust and dander shed from the feather follicle epithelium. The virus can then be inhaled and enter the respiratory tract. Although most chickens develop symptoms of the disease, many are carrier of the virus. Contaminated poultry units may be infectious for several months at 20 to 25 C and for several years at 4 C (Calnek, 1980). Marek's disease progresses through four sequential stages of infection: an early cytolytic phase, a latent phase, a late cytolytic phase and transformation (Figure 2.2). MDV is carried by macrophages from the pulmonary epithelium into the bloodstream and enters primary (thymus and bursa) and secondary (spleen) lymphoid tissues. The peak viral titer in these tissues is observed at 4 days post infection (dpi). It is likely that these tissues become infected synchronously. Recent studies show that MDV also replicates cytolytically in macrophages (Barrow et al, 2003). The open-ended capillaries of the spleen are surrounded by ellipsoid-associated reticular cells (EARCs). The EARCs can phagocytose the virus and present MDV antigens in the early stages of the disease (Jeurissen et al, 1989). Macrophages and EARCs play important roles in the transfer of MDV to the primary targeted cells: B lymphocytes. This stage is characterized as an early cytolytic infection (Shek et al, 1983). The pathogenicity of the infecting virus and the resistance of the host may affect the severity of the early cytolytic infection in terms of the extent of lymphoid organ atrophy and early mortality (Witter et al, 1980). As immune responses of the host develop around 6-7 dpi, the disease enters into the latent stage. Latency is characterized by the infection of activated T lymphocytes. Resting T cells cannot be infected, but cytolytic infection of B cells activates T cells and they become susceptible to infection (Calnek et al, 1984). Some latently infected T cells may become transformed; the exact reasons and time for the switch between the latent and transformed stage is not fully understood (Baigent and Davison, 2004). In genetically resistant chickens, MDV infection does not progress past latency, although viral particles continue to be shed from the feather follicle epithelium (Calnek and Witter, 1997). In susceptible birds, a late cytolytic infection (14-21 dpi) occurs simultaneously with permanent immuno-suppression. Focal necrosis in the tissues of epithelial origin and in visceral organs occurs, and inflammatory reactions develop. Lymphoproliferative

Chapter 2

changes lead to the final stage of the infection. Lymphomas generally consist of neoplastic, inflammatory and immunologically active cells. Activated T helper lymphocytes are the primary targets for transformation (Schat et al, 1991). Transmission of the virus to the environment is through the feather-follicle epithelium. The virus is carried to the skin by latently infected peripheral blood lymphocytes (10-12 dpi) that aggregate around the infected follicles. At around 13 dpi, virus replication is fully productive, resulting in cell cytolysis and release of enveloped cell-free virus. The amount of the shed virus increases until 21 dpi and then decreases (Kiihnlein, 2006). All chicken strains can be infected by MDV but infection differs on the basis of their susceptibility.

Chapter 2

PATHOGENESIS
Inhalation. Enveloped MD virus MDV infected cells

W LUNG.

Bursa Spleen Thymus

Productive

infection

Productive

cytolytic
Death infection

Latent infection

, Transformation

Lymphoma Tumor cells

Figure 2.2 Pathogenesis of Marek's disease. Marek's disease virus is inhaled by the chicken. It is phagocytized by macrophages and transported to the primary and secondary lymphoid tissues where it infects B and activated T lymphocytes and replicates cytolytically (early cytolytic stage). As a reaction to the immune response of the organism, disease enters a latent stage at 6 -7 dpi. Around 14-21 dpi because of the inflammatory changes in the lymphoid organs, cytolytic replication resumes (late cytolytic infection). Some of the infected T and B-cells infiltrate the feather follicles and infect epithelial cells that produce infectious enveloped viruses that are shed into the environment. Some T-cells become transformed and infiltrate a diverse array of tissues, leading to inflammatory and proliferative leasions and death (Calnek, 1986).

Chapter 2

2.1.3 Immune response of the organism Non-specific (innate) and specific (humoral and cell-mediated immunity, also called aquired immunity) immune response control virus infections (Schat and Markowski-Grimsrud, 2001) (Figure 2.3).

Figure 2.3 Immune responses to Marek's disease virus. The line at the bottom of the figure represents dpi starting at day 0 (day of the infection). After MDV enters the lungs, macrophages phagocytose MDV particles and transport them to lymphoid tissues where they infect B cells and activated T cells (early cytolytic infection). Natural killer cells play an important role in the innate defense against herpesviruses by killing infected cells. The acquired immune response involving the activation of CD4+ cells and CD8+ cells develops around 6-7 dpi disease. The infected cells then enter the latent stage when no further viral replication takes place. Two to three weeks later, the cytolytic stage resumes in the susceptible chickens (late cytolytic phase). Lesions and tumors appear and death may occur.

10

Chapter 2

Innate immunity is the first line of defense against invading pathogens. MDV enters the narrows of the lung parabronchi capillaries where it is ingested by macrophages. Macrophages carry the virus from the pulmonary epithelium to the primary and secondary lymphoid tissues where lymphocytes become infected and the virus begins to replicate. Macrophages play an important role in the development of the adaptive immune response by acting as antigen presenting cells (APC). They express MDV antigens ICP4, pp38 and gB (Barrow et al, 2003) and release a variety of cytokines as well as nitric oxide (NO) which can inhibit replication of MDV (Xing and Schat, 2000). Cytokines attract natural killer (NK) cells of the innate immune system. They are non-phagocytic but are able to kill virus-infected and tumour cells (Cerwenka and Lanier, 2001). NK cells produce cytokines that regulate some of the functions of T lymphocytes, B lymphocytes, and macrophages. They are the major source of interferon gama (IFN-y). The level of IFN-y is higher in resistant chickens and increases with maximal activity at 7 dpi (Heller and Schat, 1987). NK cells also play a critical role in the defense against MDV (Davison and Kaiser, 2004). The major histocompactibility complex (MHC) proteins play important roles in the response of an organism to infection. The MHC class I complex presents antigens to cytotoxic T cells, thus offering targets for cytolysis (Ambagala et.al, 2005). The MHC class II complex activates T helper cells (CD4) by displaying antigenic peptides (LeibundGut-Landmann et.al, 2004). In the past it was shown that herpesviruses downregulate expression of MHC class I and II on the cell surface. However, Niikura, (2007) published new findings which suggest possible up-regulation of MHC class II by MDV in in vitro studies in MDV-infected chicken embryo fibroblasts as well as in vivo in infected lymphocytes. MacLea and Cheng (2007) suggested that MDV increases expression of MHC class II proteins to promote cytolytic infection of CD4 cells, as a strategy that enables the virus to spread faster. The specific immune response requires the activation of the B and T lymphocytes to produce antibodies and cytotoxic T lymphocytes (CD8+). Antibodies delay development of clinical signs of MD, tumor formation, and mortality (Calnek, 1972). It is difficult to study the role of B and T lymphocytes in the defense against MDV because the cells themselves become infected.

11

Chapter 2

The role of the cytokines in the immune response of an organism with MD were poorly understood, but the development of a comprehensive panel of chicken cytokine reagents by Secombes and Kaiser, (2003) made it possible to identify their function and expression profile. The TH1 cytokines INF-y, interleukins (IL-2, IL-12, IL-18), the proinflammatory cytokines (IL-1(3, IL-6, IL-15) from resistant and susceptible chicken have been sequenced and studied. Expression of INF-y in all infected birds was associated with increased MDV loads. Differences were found in the expression of IL-6 and IL-8. Susceptible birds over-express these cytokines while resistant chickens express neither of them (Kaiser et al, 2003). In addition the immune defense mechanism of the host, the transfer of maternal antibodies by the vaccinated hens (maternal antibodies) has also been shown to reduce the severity of the disease (Chubb and Churchill, 1969).

2.1.4 Diagnosis of Marek' s disease Marek's disease virus was first identified by electron microscopic observations (Nazerian et al, 1968). Chicken kidney cells or duck embryo fibroblasts are commonly used for in vitro propagation of MDV and can be used to titrate MDV on the basis of plaque formation (Churchill and Biggs, 1967). Three serotypes can be identified based on the morphological characteristics of the plaques (Witter, 1983). Today electron microscopy techniques are used mainly to study MDV morphology, physiology and tissue distribution of the virus during infection (Zelnik, 2004). Progress in immunological and molecular biology has enabled faster, more accurate and more sensitive methods to detect MDV. Ideally, two independent techniques for detection of MDV should always be included. Laboratory diagnosis of MD involves mostly the isolation of the virus, followed by identification and characterization using DNA analysis, antigen and antibodies. Viral antigens can be detected in feather follicle epithelium from feather tips, infected lymphoid tissues, or infected cell cultures by fluorescent antibody tests (FA) (Spencer and Calnek, 1970), agar gel precipitation tests (AGP) (Haider et al, 1970) and enzyme-liked immunosorbent assays (ELISA) (Cheng et al, 1984). Use of these tests is

12

Chapter 2

limited because MD antigen containing cells are rare in the lymphomas and latently infected tissues. FA, AGP and ELISA can also be used for the detection of antibodies in the chicken sera (Sharma, 1989). The polymerase chain reaction (PCR) introduced in the 1980s has revolutionized the detection and quantification of MDV. PCR can also be used to differentiate between pathogenic and attenuated (Silva, 1992), and oncogenic and non-oncogenie (Zhu et al., 1992) strains of MDV. Attenuated, non-oncogenic strains of serotype MDV-1 contain multiple copies of a 132 base pair repeat; pathogenic strains contain one to three copies of the same repeat sequence. After PCR, this difference is effectively visualized by electrophoresis (Hirai et al, 1984). Complete DNA sequences of the MDV-1, MDV-2 and HTV genomes are available (Kingham et al, 2001) which allowed us to design primers that can differentiate among MDV serotypes. Another application of PCR is the quantification of the viral titer in samples (Bumstead et al, 1996). Absolute

quantification of viral DNA in a sample can be achieved by competitive PCR using viral DNA of known concentration as an internal standard (Reddy et al., 2000; Linher, 2000). 2.2 CONTROL STRATEGY Various factors can affect resistance of a chicken organism to MD. Some of these factors include different methods of exposure to the virus (either by direct contact or injection), gender (females are more susceptible to the disease than males) (Grander et al, 1972), genetic background of the host, and the environmental factors. In general, strategies to prevent MD in poultry include proper management to avoid exposure to the virus (biosecurity), stress, prevention to infection by other pathogens that suppress the immune system, vaccination and selection for disease resistance.

2.2.1 Vaccination Vaccination is the primary control strategy for MD in the poultry industry. Churchill et al. (1969) described the first vaccine against MD. The vaccination strategy involves intramuscular or subcutaneous administration of the vaccine to one-day-old chicks, or the automated delivery of the vaccine in ovo to the amniotic fluid at

13

Chapter 2

embryonation day 18 (Sharma and Ricks, 2002). Other protocols include vaccination in ovo followed by revaccination on the day of hatch or vaccination at hatch followed by revaccination after 4-12 hours or at 7, 18, 21 days of age (Gimeno, 2004). Four general types of MD vaccines are commercially available, HTV alone, HTV combined with MDV serotype 2, CV1988 (also known as Rispens) alone or combined with MDV serotype 2 or 3 (Witter, 1998), and the new MDV-1 vaccine (strain BH16) introduced by Karpathy et al. (2002, 2003). New vaccines (recombinant vaccines) and adjuvants to enhance the immune response are under trial (Gimeno, 2004). Recombinant vaccines are individual viral proteins (i.e., not the whole virus) produced in yeast or bacteria. In studies that compared different recombinant vaccines such as gB, gC, gD, gE, gl, gH (viral membrane glycoproteins), the best level of protection was shown by gB recombinant vaccine (Heine et al, 1997; Lee et al, 2003). Vaccination can prevent mortality by reducing viral proliferation several fold and by decreasing formation of tumors and clinical signs. Vaccination success depends on the proper handling of the vaccine, strain of chicken, time between vaccination and exposure, stress, and immune status of the chicken (Calnek and Witter, 1997). Continual evolution of MDV towards greater virulence and recurrence of MD in vaccinated flocks (vaccine failures) in the last decade suggest that future outbreaks of MD can cause serious problems. The latest information about the occurrence of the disease was an outbreak in six districts in vaccinated flocks in Haryana state in India (Kamaldeep et al, 2007). In 73,300 chickens of different production types (layer, broiler, and breeder) and age, the morbidity and mortality ranged from 0.66% - 4.44% and 0.24% -1.00% respectively. As a consequence, there is a great need to improve existing control of the disease (Witter, 2001; Morrow and Fehler, 2004). There is therefore a renewed interest in host genetic resistance. The genetic background of the host affects pathogenicity (Smith and Calnek, 1974) as well as vaccine efficacy (Spencer et al, 1974). The mechanism by which genetic background affects these processes remains to be elucidated (Calnek et al, 1988).

14

Chapter 2

2.2.2 Genetic resistance The importance of genetic resistance in the control of MD was reported several years ago, and it was used as the sole method of prevention prior to vaccine development. The application of phenotypic selection in the poultry industry is impractical because it requires exposure of the chicken to the pathogens with the danger of contaminating the environment (Asmudson and Biely, 1932; Hutt and Cole, 1947; Cole, 1968). Identification of genetic markers appears to be a more feasible strategy for improving disease resistance. The first genes identified as being associated with MD resistance were those involved in the immune response of the chicken organism (Keller and Sevoian, 1981; Calnek and Witter, 1997). These included the MHC genes, which regulate antigen processing and presentation of antigenic peptides on the cell surface (Kaufman and Venugopal, 1998). Selection for MHC haplotypes with resistance to MD has been used in the poultry industry. However, since MHC genes are specific for peptides, it is feared that such selection may reduce the repertoire of antigen recognition and render chickens more susceptible to other infectious diseases. There is evidence for variation in other genes that affect disease resistance; either by modifying immune responsiveness or through other biological pathways (Fredericksen et al, 1977; Bacon et al., 2001). We provided evidence for variations in genes of the growth hormone axis (Kuhnlein et al, 1997), the macrophage inflammatory receptor 3a (MIP-3a), ornithine decarboxylase (ODC) (Aggrey et al, 1996; Masilamani, 2003) and mitochondrial phosphoenolpyruvate carboxykinase (PEPCKM) (Li et al, 1998a, 1998b). Although we originally thought that these genes were unrelated to immune responsiveness, recent evidence indicated that these genes have a general effect on immune responsiveness. It reflects how extensively genes interact with each other. The genes associated with genetic resistance can be divided into MHC and nonMHC genes (Bacon et al, 2001).

15

Chapter 2

2.2.3 Major histocompactibility complex genes The chicken MHC molecules are divided into three classes: class I, class II and class IV. Based on similarity to mammals, class I molecules are present in all cell types while class II are expressed by antigen presenting cells (APC). The MHC class II molecules play an important role in APC - B cells - T cells interaction. Class IV molecules are unique to avian species (Sander, 1993). They are expressed on erythrocytes, liver cells, bursa and thymic lymphoblasts, and intestinal epithelial cells. These molecules function in the antibody response of the organism, and they might be involved in the enteric mucosal immunity against viruses and other pathogens (Zekarias et al, 2002). Chicken MHC was originally described as the blood group system B (chickens have four blood groups: A, B, C, and E) (Plachy et al, 2003). Certain haplotypes of the MHC gene have been associated with resistance to MD (Bacon, 1987; Zekarias et al, 2002). It was demonstrated that the B 21 haplotype is associated with resistance to MDV, while the B 19 haplotype is associated with susceptibility to MDV tumor development (Hansen et al, 1967). Kaufmann et al (1995) found a correlation between the level of
91

MHC class 1 expression and resistance to MD. The B haplotype expresses the lowest level of MHC class 1 and has the highest degree of resistance. The possible explanation of this mechanism is that low levels of MHC class I molecules lowers cytotoxic T cell activity, and maximizes activity of NK cells (Zekarias et al, 2002; Plachy et al, 2003). Selection for resistance associated with MHC haplotypes is used in the poultry industry. MHC haplotypes also influence the efficacy of the response to MD vaccines depending on the serotype used for the vaccination (Bacon and Witter, 1992, 1994).

2.2.4 Non-major histocompactibility complex genes Evidence for the importance of non-MHC genes in disease resistance has been known for more than two decades but was not well studied (Gimeno, 2004). This changed when the sequence of the chicken genome was published by the National Human Genome Research Institute (NHGRI) in 2004 (International Chicken Genome Sequencing

16

Chapter 2

Consortium, 2004). The availability of the chicken genome offers great opportunities to expand studies of genes and genetic resistance. Non-MHC markers for genetic resistance may be present in a variety of genes. The genes may either be directly involved in the immune response or they can be unrelated or only indirectly involved with the immune system (Fredericksen et ah, 1997; Bacon et ah, 2001). The proliferation and pathogenicity of MD virus involves the interaction of many genes encoded by the viral genome with host genes. It is therefore expected that multiple host genes will affect disease resistance (Witter, 1997). Such genes may affect the course of the disease at the level of viral proliferation, oncogenic transformation, the viral antigens that are recognized by the humoral and innate immune system, or the general resilience of the host to MD (Calnek, 2001).

2.3 GENES USED IN OUR STUDY 2.3.1 Growth hormone Growth hormone (GH), also known as somatotropin, is a protein hormone synthesized and secreted in the anterior pituitary gland by somatotrophs. GH is also produced in neural tissue, immune cells and reproductive tissue (Harvey and Hull, 2003). These extrapituitary tissues also have GH receptors and are target sites for GH action. It is therefore possible that the local production of GH has paracrine and autocrine actions in addition to the endocrine actions of pituitary GH (Harvey et ah, 2000). GH is obligatory for growth and also plays an important role in the regulation of the metabolism of many cells. GH has direct and indirect effects. Direct effects are mediated by GH binding to a specific receptor on a target cell. For example, GH suppresses the ability of adipocytes to absorb lipids (Richelsen, 1997). Indirect effects on a cell are mediated by another endocrine factor, insulin-like growth factor-I (IGF-I), whose production is stimulated in other cells by GH. Insulin-like growth factor-I stimulates the proliferation and differentiation of chondrocytes (cartilage cells) resulting in bone elongation (Baker et ah, 1993).

17

Chapter 2

The GH promotes growth of the thymus, a gland responsible for the maturation of T cells. For this purpose it is used in the treatment of HIV positive patients (Napolitano et al, 2002). Cytokines such as interleukin-1 (IL-1) and interleukin-6 (IL-6) stimulate the secretion of GH during the immune response (Koyu et al, 1999). The GH gene in the chicken has been analyzed for its association with egg production, age at first egg, egg weight in layers, gain in body weight, and feed conversion in the broilers. Kuhnlein et al. (1997) and Feng et al. (1997) showed the association of polymorphisms in the chicken GH gene with production traits. Linher (2000) identified a marker in the GH gene that was associated with MDV proliferation in lymphoid tissue (spleen). The same marker had been previously shown to be co-selected with selection for MD resistance (Kuhnlein et al, 2006). Liu et al. (2001) confirmed the association of this GH marker with MD resistance and showed that GH and the MDV protein SORF2 (found only in serotype MDV-1) bind to each other.

2.3.2 Growth hormone receptor The GHR is one of several members in the family of hematopoietin receptors (Moutoussamy et al, 1998). It has three domains, a ligand binding domain, a single hydrophobic trans-membrane domain and an intracellular domain. Although GHR is expressed in a number of tissues (Hughes and Fiessen, 1985; Isaksson et al, 1985), the highest concentration of receptors is found in the liver, where GH induces synthesis and secretion of IGF-I (Isaksson et al, 1985). Growth hormone exerts its effect by binding to the GHR resulting in the dimerization of the GHR and recruitment of the cytoplasmatic tyrosine kinase named Janus Associated Kinase 2 (JAK-2) and its phosporylation. Phosporylation of JAK-2 can be detected within a few minutes of exposure the targeted cells to the extracellular stimulation of GH. Activated JAK-2 phosporylate tyrosines on transcription factor proteins (STATs). STATs will form dimmers and undergo translocation into the nucleus where they act as transcriptional regulatory proteins. JAK-2 also activates mitogenactivated protein kinase (MAPK) pathways affecting gene regulation (Alberts et al, 2002).

18

Chapter 2

In chickens, Vanderpooten et al. (1993) reported that the level of hepatic GHR expression is affected by selection for growth or feed efficiency. A marker in the GHR gene has been shown to be associated with juvenile body weight in strain 7 and strain 9 of White Leghorn chickens (Feng et al, 1998). Variants of the GHR may affect interaction with GH and, ultimately, the cellular response. Laron-type dwarfism (LTD) in humans and sex-linked dwarfism (SLD) in the chickens are examples of disorders involving defects in the GHR. LTD caused by a deletion in the GHR gene is characterized by high levels of GH and low levels of IGF-I in the circulation (Godowski et al, 1989). SLD has a similar profile and the mutation caused 30-40 % reduction in body weight, shortened long bones, lower basal metabolism and greater accumulation of body fat (Burnside et ah, 1991).

2.3.3 Macrophage inflammatory protein 3a MIP-3a, also known as a CCL20, LARC or EXODUS, is a chemokine involved in attracting cells of the immune system (lymphocytes and dendritic cells) to sites of inflammation and to facilitate their entry into the tissue. Chemokines are categorized by the number and position of the conserved cysteine residues. Four groups are distinguished: C, CC, CXC, and CXXXC (Sick et al, 2000). Chemokines have small molecular weights (8-14 kDa). They regulate immune responses by binding to seven-transmembrane G-protein-coupled receptors on the surface of leukocytes (Giansanti et al., 2006). Chemokines are induced by proinflammatory cytokines, extracellular proteins that regulate the intensity of the immune response by stimulating or inhibiting the activation, proliferation, and/or differentiation of various cells, and by regulating the secretion of antibodies or other cytokines. The only known receptor for MIP-3a is the CC-chemokine receptor 6 (CCR6) which is expressed on resting memory T cells, B cells and dendritic cells. This suggests that the complex of CCR6 and MIP-3a plays a role in the physiology of resting memory T cells, B cells and dendritic cells, and the interaction among these cells (Liao, 1999; Wang, 2005). MIP-3a and CCR6 participate in morphogenesis and hematopoiesis (Sick et al., 2000). The human alveolar epithelium is an important source of MIP-3a and may play a critical role in the control of the movement of dendritic cells through the lung

19

Chapter 2

under normal and inflammatory conditions (Thorley, 2005). They therefore may also play an important role in the host defense against MD infection. Studies indicate that MIP-3a is overexpressed in pancreatic tumors (Kleeff et al, 1999) and hepatocellular carcinomas (Yamauchi et al., 2003), but very little is known about the connection between cancer and the expression of the chemokines in the avian species. Hughes et al. (2001) isolated cDNA clones of three chicken chemokines belonging to the CC group. The three clones identified were ah 189, ah 294 and ah 221 with EMBL accession numbers AY037861, AY037859 and AY037860 respectively. According to Hughes et al. (1985), ahl89 showed 58% homology to human MIP-3a. In our laboratory, Masilamani (2003) reported the association of Hin6l RFLP in the MIP-3a (ahl 89) gene with the viral titer in MD challenged non-vaccinated chickens.

2.3.4 Vitamin D Vitamin D is a steroid hormone that must undergo metabolic alteration before being biologically active. Vitamin D has a wide spectrum of actions that include the regulation of the levels of calcium and phosphorus, the growth and differentiation of cells and the modulation of the immune system. There are two sources of vitamin D, dietary intake and activation of an endogenous precursor by solar radiation (Figure 2.4). The dietary sources of vitamin D are ergocalciferol from plants (vitamin D2) (Windaus et al, 1930) and cholecalciferol (vitamin D3) from animal sources (Brockmann, 1936). In poultry, the vitamin D binding protein (DBP) does not bind vitamin D2 effectively; therefore this form of vitamin D2 cannot be used as a feed additive (Soares et al, 1995). Cholecalciferol is generated in epidermal skin cells by ultraviolet light induced conversion of 7-dehydrocholesterol, a derivative of cholesterol (Goldblatt and Soames, 1923). Vitamin D3 is transported by DBP to the liver, where it is hydroxylated to 25-hydroxy vitamin D3. This form of vitamin D3 is then transported to the kidney where it is converted to the most active form of vitamin D3, 1,25-dihydroxy vitamin D3, by the enzyme 1-alpha hydroxylase. The cellular effects of vitamin D3 are mediated by the vitamin D receptor (VDR) (Kato, 2000; Marcinkowska, 2001). VDR has two cellular locations, the nucleus and the cellular matrix. The nuclear VDR acts as a transcription factor, while the membrane located

20

Chapter 2

receptor mediates the immediate actions of vitamin D3 via a signaling pathway. The chicken VDR was isolated and characterized by Zhongjian et al. (1997, 2000). Vitamin D within physiological concentrations has a positive effect on human health. One of these effects is an attenuation of the immune system, thus preventing autoimmune diseases (Deluca and Cantorna, 2001). In mouse model systems it was shown that 1,25-dihydroxyvitamin D3 can either prevent or markedly suppress model autoimmune disorders such as autoimmune encephalomyelitis, multiple sclerosis, rheumatoid arthritis, systemic lupus erythematosus, type I diabetes, and inflammatory bowel disease. The mechanism may be explained by the stimulation of transforming growth factor (TGFP-1) and interleukin 4 (IL-4) productions which in turn may suppress inflammatory T cell activity. Vitamin D also has antiseptic functions. Wang et al. (2004) reported its ability to increase the expression of catathelicidin antimicrobial peptide (camp) in human neutrophils. In addition to its effect on the immune response, vitamin D also affects other human diseases. McGrath et al. (2004) reported an association between vitamin D and a reduced risk of schizophrenia. Intake of vitamin D by males in the first year of their life may help prevent schizophrenia, but no similar pattern was found for women. Vitamin D has protective effects against certain cancers. Epidemiological studies in humans demonstrated a correlation between low levels of vitamin D intake and an increased risk of several cancers. Kallay et al. (2005) reported that 1,25-dihydroxy vitamin D3 decreased the expression of p21 protein (regulating intestinal cell proliferation, maturation and tumorigenesis), and thus led to hyperproliferation in the ascending colon. In poultry, vitamin D has mostly been studied for its metabolic and physiological effects when added as a feed component. Interestingly, feeding studies in poultry showed that 25-hydroxy vitamin D3, but not 1,25-dihydroxy vitamin D3> has a positive effect on fertility and hatchability (Soares et al., 1995). Increasing levels of 1,25-dihydroxy vitamin D3 for a long period of time even showed toxic effects. Harms et al. (1988) reported a decrease in egg production, egg weight, and feed consumption in laying hens that were fed high levels of 1,25-dihydroxy vitamin D3. Atencio et al. (2005) compared different levels of vitamin D3 and 25-hydroxy vitamin D3 fed to the broiler breeder hens, and it was found that 25-hydroxy vitamin D3 had a greater potency than vitamin D3 but

21

Chapter 2

only at very low levels of supplementation. Levels of 25-hydroxy vitamin D3 can be easily manipulated through dietary supplements.

Sunshine

Vitamins D, and D, Liver *"

Vitamin D,

25-hydroxyvitamin D2 or 25-hudroxyvitamin D3

1
Kidney 1,25-dihydroxyvitamin D2 *~ or 1,25- dihydroxyvitamin D3 * 24,25-dihydroxyvitamin D2 or24,25-dihydroxyvitamin D3

Acts on the intestine to Increase calcium absorption

Role uncertain

Figure 2.4 The sources and metabolism of vitamin D (Nelson, 2000).

22

Chapter 2

2.4 REFERENCES Aggrey, S.E., Lessard, M., Hutchings, D., Joseph, S., Feng, X.P., Zadworny, D. and Kuhnlein, U. (1996) Association of genetic markers with immune traits. Proceedings of the 5th International symposium on Marek's disease, pp. 80-85 Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K., Walter, P. (2002) Molecular biology of the Cell. Fourth edition. Garland Science, New York 10001-2299, pp.884-886 Ambagala, A.P., Solheim, J.C., Srikumaran, S. (2005) Viral interference with MHC class I antigen presentation pathway: the battle continues. Vet. Immunol.

Immunopathol., 107:1-15 Asmudson, L.D. and Biely, J. (1932) Inheritance of resistance to flow paralysis (neurolymphomatosis gallinarum). I. Differences in susceptibility. Can.J.Res., 6: 171-176 Atencio, A., Pesti, G.M. and Edwards, H.M. Jr. (2005) Twenty-five hydroxycholecalciferol as a cholcalciferol substitute in broiler breeder hen diets and its effect on the performance and general health of the progeny. Poultry Sci., 84: 1277-1285 Bacon, L.D. (1987) Influence of major histocompactibilyty complex on disease resistance and productivity. Poultry Sci., 66: 802- 811 Bacon, L.D. and Witter, R.L. (1992) Influence of turkey herpesvirus vaccination on the B-haplotype effect on Marek's disease resistance on the 15.B congenic chickens. Avian Dis., 36:378-385 Bacon, L.D. and Witter, R.L. (1994) B haplotype influence on the relative efficacy of Marek's disease vaccines in commercial chickens. Poultry Sci., 73: 481-487 Bacon, L.D., Hunt, H.D. and Cheng, H.H. (2001) Genetic resistance to Marek's disease. Curr. Top. Microbiol. Immunol, (ed. Hirai, K.), Springer-verlag, Berlin, Germany, pp. 121-142 Baigent, S.J. and Davison, F. (2004) Marek's disease virus: biology and life cycle. Marek's disease: An Evolving problem. Elsevier Acad, press, London, UK, pp. 62 -77

23

Chapter 2

Baker, J., Liu, J.P., Robertson, E.J., Efstratiadis, A. (1993) Role of insulin-like growth factors in embryonic and postnatal growth. Cell, 75: 73-82 Barrow, A.D., Burgess, S.C., Baigent, S.J., Howes, K., Nair, V.K. (2003) Infection of macrophages by a lymphotropic herpesvirus: a new tropism for Marek's disease virus. J. Gen. Virol, 84: 2635-2645 Brockmann, H. (1936) Die Isolierung des antirachitischen Vitamins aus Thunfischleberol. H.-S.Zeit. Physiol. Chem., 241:104-115 Brown, A.C., Baigent, S.J., Smith, L.P., Chattoo, J.P., Petherbridge, L.J., Hawes, P., Allday, M.J. and Venugopal, N. (2006) Interaction of MEQ protein and Cterminal-binding protein is critical for induction of lymphomas by Marek's disease virus. PNAS, 103:1687-1692 Bumstead, N.J., Sillibourne, M. Rennie, N., Ross, L.J.N, and Davison, F. (1996)

Quantification of Marek's disease virus in avian lymphocytes using the polymerase chain reaction. In R.F. Silva, H.H. Cheng, P.M. Coussens, L.F., Lee, and L.F. Velicer (eds.). Current research on Marek's Disease. Am. Assoc. Avian Pathol., Kennett Square, Pennsylvania, pp. 322-327 Burnside, J., Liou, S.S. and Cogburn, L.A. (1991) Molecular cloning of the chicken growth hormone receptor complementary deoxyribonucleic acid: mutation of the gene in sex linked dwarf chickens. Endocrinology, 128: 3183-3192 Cantello, J. L., Anderson, A. S., Francesconi, A. and Morgan, R. W. (1991) Isolation of a Marek's disease virus (MDV) recombinant containing the lacZ gene of Escherichia coli stably inserted within the MDV US2 gene. J.Virol., 65:1584-1588 Calnek, B.W. (1972) Antibody development in chickens exposed to Marek's disease virus. In: P.M. Biggs, G. de-The and L.N. Payne Editors, Oncogenesis and herpesviruses, International Agency for Research on Cancer, Lyon, France, pp. 129-136 Calnek, B.W. (1980) Marek's disease virus and lymphoma. In F.Rapp (ed.) Oncogenic herpesviruses. CRC Press, Boca Raton, FL, pp. 103-143 Calnek, B.W., Schat, K.A., Ross, L.J.N., Shek, W.R. and Chen, L.H. (1984) Further characterization of Maker's disease virus-infected lymphocytes. 1. In vivo infection. Int. J.Cancer, 33: 389-398

24

Chapter 2

Calnek, B.W. (1986) Marek's disease - a model for herpesvirus oncology. CRC Crit.Rev.MicrobioL, 12:293-319 Calnek, B.W, Adene, D.F., Schat, K.A. and Abpianalp H. (1988) Immune response versus susceptibility to Marek's disease. Poultry Sci., 68:17-26 Calnek, B.W. and Witter R.L. (1997) Marek's disease. In B.W. Calnek and R.L. Witter (eds.) Diseases of Poultry, 10l ed. Iowa State University Press, Ames, Iowa, pp. 369-413 Calnek, B.W. (2001) Pathogenesis of Marek's disease virus infection. Curr. Top. Microbiol. Immunol., 255: 25-55 Cerwenka, A. and Lanier, L.L. (2001) NK cells, viruses and cancer. Nat. Immun. Rev., 1: 41-49 Cole, R.K. (1968) Studies on genetic resistance to Marek's disease. Avian Dis., 12: 9-28 Cheng, Y.Q., Lee, L.F., Smith, E.J. and Witter, R.L. (1984) An enzyme-linked immunosorbent assay for the detection of antibodies to Marek's disease virus. Avian Dis., 28:900-911 Chubb, R.C. and Churchill, A.E. (1969) Effect of maternal antibody on Marek's disease. Vet. Record, 85: 303-305 Churchill, A.E. and Biggs, P.M. (1967) Agent of Marek's disease in tissue culture. Nature, 215: 528-530 Churchill, A.E. and Biggs, P.M. (1968) Herpes-type virus isolated in cell culture from tumors of chickens with Marek's disease. II. Studies in vivo. J. Natl. Cancer Inst., 4: 951-956 Churchill, A.E., Payne, L.N. and Chubb, R.C. (1969) Immunization against Marek's disease using a life attenuated virus. Nature, 221: 744-747 Coussens, P.M., Wilson, M.R., Roehl, H., Isfort, R.J. and Velicer, L.F. (1989) Nucleotide sequence analysis of the Marek's disease herpesvirus strain GA and herpesvirus of turkey stain PCI26 gp 57-65 (A antigen) genes. In S. Kato, T. Horiuchi, T. Miteami and K Hirai (eds.) Advances in marek's Disease research. Japanese Association on marek's Disease, Osaka, Japan, pp. 99-106 Davison, A. (2002) Comments on the phylogenetics and evolution of herpesviruses and other large DNA viruses.Virus Res., 82: 127-132

25

Chapter 2

Davison, F. and Kaiser, P. (2004) Immunity to Marek's disease. In: Marek's disease, an evolving problem. F. Davison F. and V. Nair eds. Elsevier Academic Press. London,UK, pp. 126-141 DeLuca, N. A., and Schaffer, P.A. (1985) Activation of immediate-early, early, and late promoters by temperature-sensitive and wild-type forms of herpes simplex virus type 1 protein ICP4. Mol. Cell. Biol, 5: 1997-2008 Deluca, H.F. and Cantorna, M.T. (2001) Vitamin D: its role and uses in immunology. FASEB J., 15:2579-2585 Dorange, F., Tischer, B.K., Vautherot, J.F. and Osterrieder, N. (2002) Characterization of Marek's disease virus serotype 1 (MDV-1) deletion mutants that lack UL46 to UL49 genes: MDV-1 UL49, encoding VP22, is indispensable for virus growth. J. Virol., 76: 1959-1970 Feng, X,P., Kuhnlein, U., Aggrey, S,E Gavora, J.S. and Zadworny, D. (1997) Trait association of genetic markers in the growth hormone and growth hormone receptor gene in a white Leghorn strain. Poult Sci., 76:1770-1775 Feng, X.P., Kuhnlein, U., Fairfull, R.W., Aggrey, S.E., Yao, Y. and Zadworny, D. (1998) A genetic marker in the growth hormone receptor gene associated with body weight in chickens. J. Hered., 89: 355-359 Fragnet, L., Blasco, MA, Klapper, W., Rasschaert, D. (2003) The RNA subunit of telomerase is encoded by Marek's disease virus. J. Virol., 77: 5985-5996 Fredericksen, T.N., Longenecker, B.M., Pazderka, F., Gilmour, D.G. and Ruth, R.F. (1997) A T-cell antigen system of chickens: Ly-4 and marek's disease. Immunogenetics, 5: 535-552 Giansanti, F., Giardi, M.F. and Botti, D. (2006) Avian Cytokines - An overview. Curr. Parm. Des., 12:3083-3099 Gimeno, I.M. (2004) Future strategies for controlling Marek's disease. Marek's disease: An Evolving problem. Elsevier Academic press., London, UK, pp. 186-199 Godowski, P.J., Leung, D.W., Meacham, L.R., Galgani, J.P., Hellmis, R., Keret, R., Parks, J.S., Laron, Z. and Wood, W.I. (1989) Characterization of the human growth hormone receptor gene and demonstration of a partial gene deletion in two patients with Laron-type dwarfism. Proc. Natl. Acad. Sci. USA, 86: 8083-8087

26

Chapter 2

Goldblatt, H. and Soames, K.N. (1923) A study of rats on normal diet and irradiated daily by the mercury vapor quartz lamp or kept in darkness. Biochem. J., 17: 294-297 Grander, A.A., Jeffers, T.K., Spencer J.L., Robertson, A. and Speckman, G.W. (1972) Resistance of strains of chickens to Marek's disease. Can. J. Anim. Sci., 52: 1-10 Haider, S.A., Lapen, R.F. and Kenzy, S.G. (1970) Use of feathers in a gel precipitation test for marek's disease. Poultry Sci., 49: 1654-1657 Harms, R.H., Wilson, H.R. and Miles, R.D. (1988) Influence of 1,25-dihydroxy vitamin D3 on the performance of commercial laying hens. Poultry Sci., 67: 1233-1235 Harvey, S., Azumaya, Y., Hull, K.L. (2000) Pituitary and extrapituitary growth hormone: Pit-1 dependence? Can. J. Physiol. Pharmacol., 78: 1013-1028 Harvey, S. and Hull., K.L. (2003) Growth hormone: An update. J. Mol. Neurosci. 20:1-14 Heine, H.G., Foord, A.J., Young, P.L., Hooper, PT. and Lehrbach, P.R. (1997) Recombinant fowl pox virus vaccines against Australian virulent Marek's disease virus: gene sequence analysis and comparison of vaccine efficacy in specific pathogen free and production chickens. Virus Res., 50: 23-33 Heller, E.D. and Schat, K.A. (1987) Enhancement of natural killer cell activity by Marek's disease vaccines. Avian Pathol., 16:51-60 Hintze, L. (1997) NCSS, Kaysville. Utah Hirai, K., Ikuta, K. and Kato, S. (1984) Evaluation of DNA homology of Marek's disease virus, herpesvirus of turkey and Epstein-Barr virus under varied stringent hybridization conditions. J. Biochem., 95: 1215-1218 Hughes, J.P and Friessen, H.G. (1985) The nature and regulation of the receptors for pituitary growth hormone. Am. Rev. Physiol., 47: 469-482 Hugher, S., Haynes, A., O' Regan, M. and Bumstead, N. (2001) Identification, maping and phylogenetic analysis of three novel chicken CC chemokines.

Immunogenetics, 53: 674-683 Hutt, F.B. and Cole, R.K. (1947) Genetic control of lymphomatosis in the Flow. Science, 106: 379-384 International Chicken Genome Sequencing Consortium (2004) Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution. Nature, 432: 695-716

27

Chapter 2

Isaksson, O.G.P., Eden, S. and Jansson, J.O. (1985) Mode of action of piruitary growth hormone on target cells. Annu. Rev. Physiol., 47: 482-499 Jeurissen , S.H.M., Janse, E.M., Kok, G.L. and De Boer, G. F. (1989) In situ detection by monoclonal antibody D-35.1 of cells infected with Marek's disease virus that interact with splenic ellipsoid-associated reticulum cells. Avian Dis., 33: 657-663 Kaiser, M.H., Underwood, G. and Davison, F. (2003) Differential cytokine responses following Marek's disease virus infection in chicken genotypes differing in resistance to Marek's disease. J. Virol., 77: 762-768 Kallay, E., Bises, G., Bajna, E., Bieglmayer, Ch., Gerdenitsch, W., Steffan, I., Kato., Sh., Armbrecht, J. and Cross, H.S. (2005) Colon-specific regulation of vitamin D hydroxylasesa possible approach for tumor prevention. Carcinogenesis, 26: 1581-1589 Kamaldeep, P.C., Sharma, N., Nrang, G., Narang, J. (2007) Occurrence of Morek's disease in Vaccinated Poultry Flocks of Haryana (India). Int. J. Poultry Sci., 6:372-377 Karpathy, R.C., Firth, G.A. and Tannock, G.A. (2002) Derivation, safety and efficacy of a Marek's disease vaccine developed from an Australian isolate of very virulent Marek's disease virus. Austr. Vet. J., 80: 61-66 Karpathy, R.C., Firth, G.A. and Tannock, G.A. (2003) Field evaluations of safety and efficacy of an Australian Marek's disease vaccine. Austr. Vet. J., 81: 222-225 Kato, S. (2000) The function of vitamin D receptor in vitamin D action. J. Biochem., 127: 717-722 Kaufman, J.F. and Venugopal, K. (1998) The importance of MHC for Rous sarcoma virus and Marek's disease virus - some Payne - full considerations. Avian Pathol., 27:S82-87 Keller, L.H. and Sevoian, M. (1981) Studies of histocompactibility and immune response of chickens selected for resistance and susceptibility to Marek's disease. Avian Dis. 27:7-20 Kleeff, J., Kusama, T., Rossi, D.L. (1999) Detection and localization of MIP3a/LARC/Exodus, a macrophage proinflammatory chemokine, and its CCR6 receptor in human pancreatic cancer. Int. J. Cancer, 81: 650-657

28

Chapter 2

Kingham, B.F., Zelnik, V., Kopacek, J., Majerciak, V., Ney, E., and Schmidt, C.J. (2001) The genome of herpesvirus of turkeys: comparative analysis with Marek's disease viruses. J. Gen. Virol., 82: 1123-1135 Koyu, A., OzgUner, M.F., Caliskan S., Akdogan, M. and Koylu, H.(1999) Changes in blood levels of prolactin, growth hormone and immunoglobulins during immune response. East. J. Med., 4: 70-72 Kuhnlein, U., Ni, L., Weigend, S., Gavora, J.S., Fairfull, W. and Zadworny, D. (1997) DNA polymorphisms in the chicken growth hormone gene: Response to selection for disease resistance and association with egg production. Anim. Genet., 28: 116123 Kuhnlein, U.,Spencer, J.L., Chan, M., Praslickova, D., Linher, K., Kulenkamp., A. and Ansah, G. (2006) Relationship between Marek's disease and the time course of viral genome proliferation in feather tips. Avian Dis., 50:173-178 Lee, L.F., Wu, P., Sui, D., Ren, D., Kamil, J., Kung, H.J. and Witter, R.L. (2000) The complete unique long sequence and the overall genomic organization of the GA strain of Marek's disease virus. Proc. Natl. Acad. Sci. USA, 97: 6091-6096 Lee, L.E., Witter, R.L., Reddy, S.M., Wu, P., Yanagida, N., and Yoshida, S. (2003) Protection and synergism by recombinant fowl pox vaccines expressing multiple genes from Marek's disease virus. Avian Dis., 47: 105-114 LeibundGut-Landmann, S., Waldburger, J.M., Krawczyk, M., Otten, I.A., Suter, T., Fontana, A., Acha-Orbea, H., Reith, W. (2004) Specificity and expression of CUTA, the master regulator of MHC class II genes. Eur. J. Immunol. 34:15131525 Li, S., Aggrey, S.E., Zadworny, D., Fairfull, W. and Kuhnlein, U. (1998a) Evidence for genetic variation in the mitochondrial genome affecting traits in White Leghorn chickens. J. Hered., 89: 222-226 Li, S., Zadworny, D., Aggrey, S.E. and Kuhnlein, U. (1998b) Mitochondrial PEPCK: A highly polymorphic gene with alleles co-selected with Marek's disease resistance in chickens. Animal Genet., 29: 395-397 Liao, F., Rabin, R.L., Smith, C.S., Sharma, G., Nutman, T.B. and Farber, J.M. (1999) CCChemokine Receptor 6 Is Expressed on Diverse Memory Subsets of T Cells and

29

Chapter 2

Determines Responsiveness to Macrophage Inflammatory Protein 3a. J. Immunol., 162: 186-194 Linher, K. (2000) Association of markers in genes of the growth hormone axis with the viral load in lymphoid tissues of chickens with Marek's disease virus. M. Sc. Thesis, McGill University Liu, H.C., Kung, H.J., Fulton, J.E., Morgan, R.W. and Cheng, H.H. (2001) Growth hormone interacts with Marek's disease virus SORF2 protein and is associated with disease resistance in chicken. Genetics, 98: 9203-9208 Lupiani, B., Lee, L.F. and Reddy, S.M. (2001) Protein coding content of the sequence of the Marek's disease virus type 1. Curr. Top. Mycrobiol. Immunol., 255: 159-190 MacLea, K.A. and Cheng, H.H. (2007) The treat of Marek's Disease Virus Is Expanding. Microbe, 2:238-243 Marcinkowska, E. (2001) A run for a membrane vitamin D receptor. Biol. Sign. Rec, 10:341-349 Marek, J. (1907) Multiple nervenentzunendung (polyneuritis) bei Huhnern. Deutsche Tieraerztliche Wochenschreibung, 15: 417-421 Masilamani, T.J. (2003) Identification of genetic markers associated with Marek's disease in chickens. M.Sc. Thesis. McGill University McGrafh, J., Saari, K., Hakko, H., Jokelainen, J., Jones, P., Jarvelin, M.R., Chant, D. and Isohanni, M. (2004) Vitamin D supplementation during the first year of life and risk of schizophrenia: a Finnish birth cohort study. Schizoph. Res., 67: 237-245 Morrow, Ch. And Fehler, F. (2004), Marek's disease: a worldwide problem. Marek's disease: An Evolving problem. Elsevier Acad. Press, London, UK, pp. 49-61 Moutoussamy, S., Kelly P.A. and Finidori, J. (1998) Growth hormone-receptor and cytokine receptor-family signaling. Eur. J. Biochem., 255: 1-11 Nair, V. and Kung, H.J. (2004) Marek's disease virus oncogenicity: molecular mechanisms. Marek's disease: An Evolving problem. Elsevier Acad. Press, London, UK, pp. 32-48 Napolitano, L.A., Lo, J.C., Gotway, M.B., Mulligan, K., Barbour, J.D., Schmidt, D., Grant, R.M., Halvorsen, R.A., Schambelan, M. and McCune, J.M. (2002)

30

Chapter 2

Increased thymic mass and circulating naive CD4+ T-cell counts in HIV-1infected adults treated with growth hormone. AIDS, 16:683-692 Nazerian, K., Soloman, J.J. Witter, R.L. and Burmester, B.R. (1968) Studies on the etiology of Marek's disease. II. Finding of a herpesvirus in cell culture. Proc. Soc. Exp. Biol. Med., 127: 177-82 Nelson, D.L and Cox, M.M. (2000) Lehninger Principles of Biochemistry. Third edition Worth Publishers, New York, USA, pp. 722-734 Niikura, M., Kim, T., Hunt, H.D., Burnside, J., Morgan, R.W., Dodgson, J.B. and Cheng, H.H. (2007) Marek's disease virus up-regulates major histocompatibility complex class II cell surface expression in infected cells. Virol., 359: 212-219 Parcells, M. S., Lin, S.-F., Dienglewicz, R. L., Majerciak, V., Robinson, D. R., Chen, H.C, Wu, Z., Dubyak, G. R., Brunovskis, P., Hunt, H. D., Lee, L. F., Kung, H.-J. (2001), Marek's Disease Virus (MDV) Encodes an Interleukin-8 Homolog (vIL8): Characterization of the vIL-8 Protein and a vIL-8 Deletion Mutant MDV. J. Virol, 75: 5159-5173 Plachy, J., Kaiser, P. and Hala, K. (2003) Genetics of the immune System. Poultry Genetics, Breeding and Biotechnology, CABI Publishing, Cambridge, USA, pp. 293-309 Richelsen, B. (1997) Action of growth hormone in adipose tissue. Horm. Res., 48: 105-10 Reddy, S.M., Witter, R.L. and Gimeno, I. (2000) Development of a quantitativecompetitive polymerase chain reaction assay for serotype 1 Marek's disease virus. Avian Dis., 44: 770-775 Ross, N., O'Sullivan, G., Rothwell, C , Smith, G., Burgess, S.C., Rennie, M., Lee, L.F. and Davison, T.F. (1997) Marek's disease virus EcoRI-Q gene (meq) and a small RNA antisense to ICP4 are abundantly expressed in CD4+ cells and cells carrying a novel lymphoid marker, AV37, in Marek's disease lymphomas. J. Gen. Virol., 78:2191-2198 Sander, J.E. (1993) The major histocompatibility complex and its role in poultry production. World Poultry Sci. J., 49: 132-138 Schat, K.A., Chen L.H., Calnek B.W. and char D. (1991) Transformation of Tlymphocyte subsets by Marek's disease herpesvirus. J. Virol., 65: 1408-1413

31

Chapter 2

Schat, K.A. and Markowski-Grimsrud, C.J. (2001) Immune responses to Marek's disease virus infection. Curr. Top. Microbiol. Immunol., 255: 91-120 Schumacher, D., Tischer, B.K., Reddy, S.M., Osterrieder, N. (2001) Glycoproteins E and I of Marek's disease virus serotype 1 are essential for virus growth in cultured cells. J. Virol., 75: 11307-11318 Sick, C , Schneider, K., Staeheli, P. and Weining, K.C. (2000) Novel chicken cxc and cc chemokines. Cytokine, 12: 181-186 Silva, R.F. (1992) Diterentiation of pathogenic and non-pathogenic serotypes 1 Marek's disease viruses (MDV's) by the polymerase chain reaction amplification of the tandem direct repeats with the MDV genome. Avian Dis., 36: 521-528 Secombes, C.J. and Kaiser, P. (2003) The phylogeny of cytokines. In: The Cytokine Handbook, 4th ed. A. Thomson and M.T. Lotze (eds.) London: Acad. Press, pp. 57-84 Sharma, J.M. (1989) Marek's disease. In H.G. Purchase, L.H. Arp, C.H. Domermuth and J.E. Pearson (eds.) A laboratory manual for the isolation and identification of avian pathogens, 3 rd ed. American association of pathologists. New Bolton centre, PA, pp. 89-94 Sharma, J.M. and Ricks, C. (2002) In ovo technology - future directions. Proceedings of the American association of Avian Pathologists Symposium, Nashville, Tennessee, AAAP, Kennett Square, Pennsylvania Shek, W.R., Calnek, K.A., Dchat, K.A. and Chen, L.H. (1983) Characterization of Marek's disease virus-infected lymphocytes: discrimination between cytolytically and latently infected cells. J. Natl. Cancer Inst., 70: 485-491 Smith, M.W. and Calnek, B.W. (1974) High virulence marek's disease virus infection in chickens previously infected with low-virulence virus. J. Natl. Cancer Inst., 52: 1595-1603 Soares, J.H. Jr., Kerr, J.M. and Gray, R.W. (1995) 25-hydroxycholecalciferol in poultry nutrition. Poultry Sci., 74: 1919-1934 Solomon, J.J., Witter, R.L., Nazerian, K. and Burmester, B.R. (1968) Studies on the etiology of Marek's disease. I. Propagation of the agent in cell culture. Proc. Soc. Exp. Biol. Med., 127: 173-177

32

Chapter 2

Spencer,

J.L.

and

Clanek,

B.W.

(1970)

Marek's

disease:

Application

of

immunofluorescence for detection of antigen and antibody. Am. J. Vet. Res., 21: 993-1010 Spencer, J.L., Gavora, J.S., Grander, A.A., Robertson, A. and Speckman, G.W. (1974) Immunization against marek's disease: Influence of strain of chickens, maternal antibody, and type of vaccine. Avian Dis., 18: 3-44 Thorley, A.J., Goldstraw, P., Young, A. and Tetley, T.D. (2005) Primary Human Alveolar Type II Epithelial Cell CCL20 (Macrophage Inflammatory Protein-300Induced Dendritic Cell Migration. Am. J. Respir. Cell Mol. Biol., 32: 262-267 Tischer, B.K., Schumacher, D., Beer M., Beyer, J., Teifke, J.P., Osterrieder, K., Wink K, Zelnik V, Fehler F, Osterrieder N. (2002) A DNA vaccine containing an infectious Marek's disease virus genome can confer protection against tumorigenic Marek's disease in chickens. J. Gen. Virol., 83: 2367-76 Vanderpooten, A., Janssens. W., Buyse, J., Leenstra, F., Berghman, L., Decupere, E. and Kuhn, E.R. (1993) Study of the hepatic growth hormone receptor at different ages in chickens selected for a god feer conversion and fast weight gain. Dom. Anim. Endocrinology, 10: 199-206 Wang, T., Nestel, F.P., Bourdeau, V., Nagai, N., Wang, O., Liao, J., Tavera-Mendoza, L., Lin, R., Hanrahan, J.H., Mader, S. and White, J.H. (2004) Cutting edge: 1,25dihydroxyvitamin D3, is a direct inducer of antimicrobial peptide gene expression. J. Immunol., 173: 2909-2912 Wang, J., Adelson, D.L., Yilmaz, A., Sze, S-H., Jin, Y. and Zhu, J.J. (2005) Genomic organization, annotation, and ligand-receptor inferences of chicken chemokines and chemokine receptor genes based on comparative genomics. BMC Genomics., 6: 45 Witter, R.L., Sharma, J.M. and Fadley, A.M. (1980) Pathogenicity of variant Marek's disease isolants in vaccinated and unvaccinated chickens. Avian Dis., 24: 210-232 Witter, R.L. (1983) Characteristic of Marek's disease viruses isolated from vaccinated commertial chicken floks: Association of viral pathotype with lumphoma frequency. Avian Dis., 27:113-132

33

Chapter 2

Witter, R.L. (1997) Marek's disease: an evolving poultry pathogen. Current and future strategies for its control. PSA Ancillary Scientists and AAAP Symposium: Infectious Poultry Dis., Athens, GA Witter, R. L. (1998) Control strategies for Marek's disease: a perspective for the future. Poultry Sci., 77:1197-1203 Witter, R. L. (2001) Protective efficacy of Marek's disease vaccines. Curr. Top. Microbiol. Immunol., 255: 57-90 Xing, Z. and Schat, K.A. (2000) Inhibitory effects of nitric oxide and gamma interferon on in vitro and in vivo replication of Marek's disease virus. J. Virol., 74: 36053612 Yamauchi, K., Akbar, F., Horiike, N., Michitaka, K. and Onji, M. (2003) Increased serum levels of macrophage inflammatory protein-3a in hepatocellular carcinoma: Relationship with clinical factors and prognostic importance during therapy. Int. J. Mol. Med., 11:601-605 Zelnik, V. (2004) Diagnosis of Marek's disease. Marek's Disease: An Evolving problem. Elsevier Acad. Press., London, UK, pp. 156-167 Zekarias, B., Ter Hurne, A.A.H.M, Landman, W.J.M., Rebel, J.M.J., Pol, J.M.A., Gruys, E. (2002) Immunological basis of differences in disease resistance in the chicken.Vet. Res., 33: 109-125 Zhongjian, L., Hanson, K. and DeLuca, H.F. (1997) Cloning and origin of the two forms of chicken vitamin D receptor. Arch. Biochem. Bioph., 339: 99-106 Zhongjian L., Jehan, F., Zierold, C. and DeLuca, F.H. (2000) Isolation and

Characterization of the Chicken Vitamin D receptor gene and its promoter. J. Cell. Biochem., 77: 92-102 Zhu, G.S., Ojima, T., Hironaka, T., Ihara, T., Mizukoshi, N., Kato, A., Ueda, S. and Hirai, K. (1992), Differentiation of oncogenic and non-oncogenie strains of Marek's disease virus type 1 by using polymerase chain reaction DNA amplification. Avian Dis., 36: 637-645

34

Chapter 3

CONNECTIVE STATEMENT I Our overall goal is to identify non-MHC genes that segregate for variants that affect disease resistance to Marek's disease in chickens. As discussed in the previous chapter, vitamin D metabolism is an important modulator of the immune system as shown in mice models and epidemiological studies in humans. We chose to analyze the variability of three genes of the vitamin D metabolism in a non-inbred strain of chickens for which a set of immune parameters had been measured. It showed that all three genes were highly variable. Some non-redundant markers were then screened in the entire database for association with cell surface markers of peripheral blood leukocytes. Since the vitamin D metabolism can be modulated by dietary means, the identification of associated markers may not only provide means to improve disease resistance by selection, but also by feed additives.

35

Chapter 3

CHAPTER 3

Sequence Variations in Genes Encoding Enzymes Involved in Vitamin D Metabolism and Association with Subclasses of Peripheral Blood Mononuclear Cells in Chickens

Dana Praslickova ', Martin Lessard2, Donna L. Hutchings 3, David Zadworny1, Urs Kiihnlein l

department of Animal Science, McGill University, 21-111 Lakeshore Road, Ste. Anne de Bellevue, QC, Canada, H9X 3V9
2

Dairy and Swine Research and Development Centre, Agriculture and Agri-Food Canada,

Lennoxville, QC, Canada, JIM 1Z3


3

Canadian Food Inspection Agency,Veterinary Biologies Section,Ottawa, ON, Canada,

K1A 0Y9

Corresponding author: Urs Kiihnlein Tel: (514) 398 7799 Fax:(514)398 7964 e-mail: urs.Kuhnlein@mcgill.ca
36

Chapter 3

3.1 Abstract The sequence variability of three genes involved in VD metabolism was analyzed in a non-inbred White Leghorn strain. The genes were vitamin D 24-hydroxylase (Cyp24), vitamin D receptor (VDR) and vitamin D binding protein (DBP). For each gene two segments of about lkb each were sequenced in 20 individuals and the minimal number of segregating haplotypes was determined. Intron variability was similar in all three genes and ranged from 2.0 to 2.6 SNP per 100 bp. However, the number of segregating haplotypes varied with the VDR being the most variable with a minimum of 15 haplotypes, followed by the Cyp24 and DBP with 7 and 5, respectively. Blocks of co-segregating SNP in each gene were determined by aligning the genotypes of the 20 individuals. Two SNP belonging to different blocks were analyzed for association with the proportion of peripheral blood mononuclear cells (PBMC) that displayed the surface antigens LYB, MHC class II, CD3, CD4, CD8, TCR1 (Ty5) and TCR2 (Tap). The proportion of subsets of PBMC characterized by these antigens varied significantly between genotypes defined by single markers or pairs of markers. The only exception was the proportion of cells displaying the B-cell marker LYB. The results indicate that genetic variations in genes that regulate vitamin D metabolism affect the differentiation of cells of the immune system, in particular the proportion of cells that express MHC class II and TCR1. Similar to mammals, such genetic variants may therefore also be associated with disease resistance in poultry.

Keywords: vitamin D, vitamin D 24-hydroxylase, vitamin D binding protein, single nucleotide polymorphisms, haplotypes, chickens, lymphocyte subclasses, TCR1, class II MHC

37

Chapter 3

3.2 Introduction Accessibility to the annotated chicken genome sequence has greatly facilitated the genetic dissection of phenotypic traits. Primers to amplify DNA segments of known location can be identified by inspecting the genome sequence; genotypes can be classified and diagnostic markers analyzed for trait associations. It will lead to an understanding of the complex dynamics of the genotype-phenotype relationship and enable us to conduct selection at the DNA level. Such selection can be used as an adjunct to phenotypic selection and may be particularly important for developing disease resistant strains of poultry. In this communication we analyzed variability of three genes associated with vitamin D (VD) metabolism in chickens. It has been shown in humans and mice that VD status is associated with the innate and adaptive immune response, in addition to its classical role in the regulation of Ca2+ and PO4 " homeostasis. In particular, VD reduces the susceptibility to cancer, to auto-immune disorders and to infection by Mycobacterium tuberculosis (van Etten and Matthieu, 2005; Liu et ah, 2006; Wee-Chian et ah, 2005; Agoston et ah, 2006). Genes that regulate vitamin D metabolism are therefore functional candidate genes for variants that affect the immune response and hence disease resistance. Clarification of the interrelationship between vitamin D metabolism and immune response may provide rationales for improving disease resistance by dietary means in addition to selection for appropriate alleles. Three genes were analyzed, the vitamin D binding protein (DBP), the 24hydroxylase (Cyp24) and the vitamin D receptor (VDR). VDR is a transcription factor that binds to VDR response elements. When activated by binding to 1,25-hydroxy VD3 (l,25-(OH)2D), it modulates gene transcription (Uitterlinden et ah, 2004). Cyp24 plays a pivotal role in the control of levels of l,25-(OH)2D by inactivating 25-hydroxy VD3 and l,25-(OH)2D through hydroxylation at the 24 position (Masuda et ah, 2006). It is itself under the transcriptional control of a VDR response element. DBP has multiple roles, some of which are unrelated to VD metabolism (Gomme and Bertolini, 2004; Speeckaert et ah, 2006). It serves as a transport protein of VD and fatty acids, acts as an extracellular actin scavenger, and is involved in macrophage chemotaxis.

38

Chapter 3

The chicken strain analyzed had been founded from 4 North American commercial White Leghorn strains in 1958 and was propagated as a closed breeding population while maintaining a large effective population size (Gowe et ah, 1959, 1993). A database consisting of production traits and immune traits had been established in 1995. It provides us with the opportunity to analyze variability within or between genes, and to correlate such variants with production traits and immune traits.

3.3 MATERIALS AND METHODS

3.3.1 Strains of chickens and data collection Chickens were from strain 7, a strain that was established by mating 4 commercial North American White Leghorn strains in 1958 (Gowe et al.,1959; Gowe et ah, 1993). It was propagated by pedigreed random mating using 100 sire families and mating one sire to two females in every generation. At the time of data collection, the inbreeding coefficient was estimated to be 0.026 (Kiihnlein et ah, 1990). The collection of production traits in this strain has been described previously (Parsanejad et ah, 2002).

3.3.2 Flow cytometry All birds were immunized between 8-10 month of age with vaccines against Marek's disease virus (MDV), infectious bronchitis disease (IBD) and avian encephalomyelitis virus (AEV). Twelve days after the MDV, IBD and AEV injections, blood samples were taken to evaluate cell mediated immunity and characterize different populations of leukocytes by flow cytometry. Peripheral blood mononuclear cells (PBMC) were prepared from heparinized blood samples as described by Lessard et al. (1993). Briefly, whole blood samples were layered onto Lymphocyte-H (Cederline Laboratories, Hornby, Ontario, Canada) and centrifuged. The PMBC were harvested and washed three times in Hank's basal salt solution and adjusted to 5 x 106 cells/ml in PBS, pH 7.2. Monoclonal antibodies specific for the T-cell surface antigens CD3, CD4 and CD8 and the T-cell receptors TCR1 (Ty8) and TCR2 (Ta|3) were purchased from Southern Biotechnologies Associates (Birmingham, AL 35226). Pan-B cell monoclonal antibody (LYB) directed against Bu-la cell surface antigen was provided by Dr. Ratcliffe

39

Chapter 3

(McGill University, Montreal, Ca) and antibody against MHC class II antigen by H. Lillehoj (USDA, Agricultural Service, Livestock and Poultry Sciences Institute, Beltsville, MD 20705). PBMC were stained with 1:100 dilutions of the monoclonal antibodies and goat anti-mouse IgG-FITC conjugate as previously described (Griebel et al, 1987; Lillehoj et al, 1988). Data from 10,000 cells were collected on a FACScan (Becton Dickinson, Missasuaga, Ontario, Canada) and two-parameter analysis of forward-angle light scatter was used to channel the lymphocyte population to fluorescence analysis. The percentage of positive cells was determined and corrected for the percentage of PBMC that stained with mouse monoclonal antibody specific for the CD5 marker on equine leukocytes (HT23A monoclonal IgGl class; VMRD at Pullman, WA).

3.3.3 Genetic analysis DNA was extracted from erythrocytes of 20 unrelated males of strain 7. Blood samples were lysed, digested with proteinase K, extracted with phenol-chloroform and ethanol precipitated following standard procedures. Primers for two DNA segments in each gene were designed using the NIH database and the DMAman for Windows (Lynnon Bio Soft, Vaudreuil, Quebec, Canada). Initially we used the cDNA sequences to search for homology with unassembled genomic clones. At a later date we used the assembled and annotated chicken genomic sequence (http://www.ncbi.nlm.nih). The primers used to amplify gene segments are listed in Table 3.1. Amplification conditions were as described previously (Parsanejad et al, 2004). The reverse and forward sequences of the amplified products were determined by Genome Quebec (McGill University and Genome Quebec Innovation Centre, Montreal, Quebec, Ca) using the amplification primers as sequence primers. SNPs and indels were read by visual inspection of the sequence traces. In clean runs there were no difficulties in reading heterozygotes. Two SNPs of each gene were chosen and genotyped by primer extension in the entire database using either Fluorescence polarization - single base extension (FPSBE) genotyping or the GenomeLab SNPstream Genotyping System (formerly Orchid SNPstream UHT).

40

Chapter 3

3.3.4 Statistics and graphics For statistical evaluations and graphs we used the NCSS software (Hintze, 2004). Association analyses were conducted by GLM procedures. Linkage disequilibria between pairs of marker genotypes were analyzed by exact tests without breaking up the genotypes at individual loci (Lewis and Zaykin, 2001). The frequency of doubleheterozygotes within a gene was estimated by using Hill's iteration method, a procedure that assumes Hardy-Weinberg equilibrium (Hill, 1974). 3.4 RESULTS

3.4.1 Determination of blocks of co-segregating SNP Two randomly chosen sections of each gene were sequenced in 20 chickens (Table 3.2). On average 2 to 2.6 variants per 100 nucleotides were observed in introns, a frequency that was similar to that observed previously for ornithine decarboxylase (ODC) in the same set of individuals (Parsanejad et al, 2004). Although there was no difference of the overall density of variants in the different genes, there were considerable differences within intronic regions of the same gene, indicating sequence conservation. As an example, in the DBP gene, 19 variants were observed in 530 bp of segment 1, but none in 448 bp of segment 2. Only four mutations were observed in exons, three of which were synonymous substitutions (Table 3.2). Blocks of co-segregating markers in the population of interest were determined by aligning the genotypes and sorting the markers by zygocity. The minimal requirement for markers to co-segregate is that they have the same zygocity among all individuals and that the homozygotes are in phase (e.g. if in one individual the genotype at PI is A/A and at P2 is C/C then it has to be so in all homozygotes). Table 3.3 shows the DBP gene as an example. In this gene a total of 19 markers were identified. Based on the observed genotypes, markers co-segregated in a minimum of five blocks. In the Cyp24 gene, 29 markers were observed, forming 7 blocks and in the VDR gene 14 markers forming 11 blocks. By first defining blocks, redundant genotyping can be avoided. The number of blocks is also an indicator of the minimal number of haplotypes. Assuming maximal

41

Chapter 3

parsimony, markers in a single block define 2 haplotypes and each additional block adds a haplotype. Hence k blocks will give rise to a minimum of k+1 haplotypes. Additional haplotypes are to be expected if markers were scrambled by historical recombination or gene conversion. Indeed, inspection of the marker genotypes of the three genes analyzed here indicates that the linkage disequilibrium between markers is not maximal and hence additional haplotypes must have been formed by past recombination (Table 3.3). The k+1 haplotypes can combine to form (k+1) (k+2)/2 different genotypes. Hence the minimal number of genotypes expected to segregate in strain 7 ranges from 21 for the VDB gene to a staggering 71 for the VDR gene. Two markers from different blocks were chosen in each gene and genotyped in the entire population. As expected in a randomly mated population, genotypes defined by single markers did not deviate significantly from Hardy-Weinberg disequilibrium (0.21<P<0.89). Linkage disequilibria between markers in the same gene were significant (P<10~6). However, as already inferred from the sequence analysis of a sub sample, the linkage disequilibrium although significant, was not maximal; reflecting historical recombination, gene conversions or reoccurrence of identical mutations. Markers located in different genes were not at disequilibrium (P>0.28), with the exception of the marker S1P1 in the Cyp24 gene and the marker S2P2 in the VDR gene (P=0.009).

3.4.2 Association of single genes with cell differentiation antigens on peripheral blood mononuclear cells Genotypes defined by single markers or pairs of markers in the same gene were analyzed for association with the distribution of PBMC classified by cell surface antigens (Table 3.4). The cell surface antigen measured were the T-cell receptors TCR1 and TCR2, the T-cell surface markers CD3, CD4 and CD8, the B-cell antigen LYB and the MHC class II antigen. Since proportions rather than the absolute titers of cells on different PBMC classes were measured, the values are highly correlated (Table 3.5). As an example LYB is negatively associated with all markers on T-cells, while all the T-cell markers are positively associated with CD3, an antigen common to all T-cells.

42

Chapter 3

Analysis of genotypes defined by single markers revealed associations between DBP S1P15 and the frequency of TCR1 positive cells (P=0.0082) and between VDR S1P4 and the frequency of MHC class II positive cells (P=0.0007). A finer subdivision of the genotypic classes can be achieved by considering two markers simultaneously. Two markers from different blocks will yield a total of 4 different haplotype groups and hence 10 different genotypic subgroups. Such an analysis is shown for the VDR gene (Figure 3.1). Combining the genotypic groups that occur at frequencies of less than 10, significant associations are observed for the CD8/CD3 ratio in addition to MHC class II as already observed for one of the single marker genotypes. It is noteworthy that there is no common association pattern for these two phenotypes. Hence some genotypes have differential effects on the frequency of MHC class II positive cells and on the CD8/CD3 ratio.

3.4.3 Gene interaction Gene interaction was observed for all three genes under analysis, affecting TCR1, TCR2, MHC class II and CD4 (Table 3.5). An example is the TCR1 counts for combinations of marker genotypes of S1P3 in the Cyp24 gene and SIP 15 in the DBP gene (Figure 3.2). It shows that the contrast between the genotypic classes A/A and G/A in the vitamin D binding protein is only significant different when the S1P3 marker genotypes in the Cyp24 gene is A/A, but not when it is G/A. The probability distributions for these four genotypes indicate not only differences in the mean, but also in the variance, perhaps reflecting the presence of additional phenotypically different genotype subgroups or differences in the buffering capacity of the genotype classes towards genetic variations in other genes (Figure 3.3).

3.4.4 Correlation with production traits The number of cells in different PBMC classes was not correlated with body weight measurements, rate of egg-laying or sexual maturity (data not shown). However, correlations were significant for egg specific gravity (SPG) and the ratio between egg weight and specific gravity (an approximate measure of egg calcium) (Table 3.6). Contrary to expectation, these traits were not associated with any of the markers analyzed

43

Chapter 3

here. An exception may be an interactive effect (P=0.05) of the marker genotypes DBP S1P4 and VDR S1P4 on the ratio EWT/SPG, a marker combination that was not associated with any of the PBMC counts. 3.5 DISCUSSION The main purposes for identifying markers associated with quantitative traits in chickens are (1) to gain information about gene function and (2) to apply selection at the DNA level. In the former case the main focus is on genes that have strong effects on the trait of interest. In a randomly mated population, individuals with such genes are outliers of the trait distribution. When the focus is on marker assisted selection, genes that are frequent but have relatively minor phenotypic effects are equally important. Selection for such genes is less likely to destroy the fabric of gene interaction that had been established by long-term historical selection. Association analysis, that is the association of markers with traits in a randomly propagated population, is an approach geared towards identifying such markers. In a randomly mated population, associations will only be observed for markers that are closely linked to the putative trait mutation. It is therefore logical to analyze markers in candidate gene, i.e. genes that are biologically relevant for the trait of interest. An obvious source are genes that affect similar traits in other species. A search for such markers may be conducted in elements of a gene that are suspected to affect gene function, such as exons or elements that regulate gene expression. However, our understanding of gene regulation is incomplete, and the choice of regions for marker analysis is far from obvious. Indeed, in our analysis we found genomic regions with no apparent function that had low variability, indicating evolutionary constraints. We therefore focused our analysis on intronic sequences that are more variable. Sequence differences enable us to delineate the major haplotypes (blocks of SNP) that segregated in the population of interest. Putative quantitative trait mutations are expected to cosegregate with one of these haplotypes. For the delineation of genotypes we decided to use direct sequencing of PCR amplified genomic segments. It has the disadvantage over subcloning that indelheterozygotes are difficult to read and that double-heterozygotes are not resolved. Despite

44

Chapter 3

these drawbacks, direct sequencing of PCR products is less labor intensive, it doubles the sample size and blocks of co-segregating markers can still be discerned. Despite domestication and intensive selection, chickens have a surprisingly polymorphic genome whose nucleotide diversity is about 5-10 times greater than that of the human genome (International Chicken Polymorphism Consortium, 2004; Tishkoff and Verrelli, 2003). Further, for all three genes analyzed here (and for genes previously analyzed), we found that the Red Jungle fowl haplotype as defined by the NIH database, was still present in the sample of 40 White Leghorn genomes. It indicates that in contrast to humans, chickens have not gone through a genetic bottle neck and that the intensive selection since domestication of the chickens has not led to a loss in genetic diversity. Such a conclusion has also been reached on the basis of genome wide comparison of the SNP spectra in a wide variety of chicken breeds (International Chicken Genome Sequencing Consortium, 2004). Selection may actually have contributed to the maintenance of genetic diversity through selective advantage of hybrids or gene interaction (Kuhnlein et al., 1989). However, in contrast to the average nucleotide diversity, the number of haplotypes varied considerably, ranging from 3 for ornithine decarboxylase (ODC) (Parsanejad et al, 2004) to more than 15 for the VDR receptor. It indicates that there was selection pressure on some of the genes. Maintenance of the nucleotide diversity but reduction in the number of haplotypes may reflect that some haplotypes may be phenotypically equivalent despite being genetically distant from each other. The significance of associations is critically dependent on the sample size. Because of the extensive genotypic variation, the number of observations within genotypic classes defined by haplotypes may be small. It is therefore necessary to consider only one or two markers at a time. A single marker will subdivide the data set into three groups corresponding to the three marker genotypes, while two markers will yield 9 groups. By analyzing markers diagnostic for different sets of haplotypes, the partitioning that yields the largest contrast can be determined and the haplotype that harbors a putative quantitative trait mutation can be identified. Similar considerations apply to the analysis of gene interaction, where in most cases only two markers can be included in the statistical analysis.

45

Chapter 3

Associations were observed for most PBMC surface antigens and/or ratios, reflecting the general effect of VD on the proportion of cell types of the immune system. The pattern of associations varied with different genotypes, indicating qualitatively different responses to different genetic variants. Whether this is a reflection of differences in the regulation of VD or whether the enzymes studied here may have alternative functions is unknown. Such alternative functions are known for DBP, a protein that regulates VD transport, is involved in actin metabolism and serves as a chemokine. We observed the most significant effects of genetic variants on the proportions of MHC class II and TCR1 (Ty8) positive cells. The majority of MHC class II positive leukocytes in peripheral blood are cells of the monocytes/macrophages lineage and Bcells. VD may affect the former cell type, since there was no significant effect on the proportion of the LYB antigen presenting cells. Little is known about the biological function of TCR1 positive cells in chickens. They are predominantly CD4", CD8" and the y8 receptors which are less diverse than the aP receptors of the TCR2 cells (Chen et al, 1988; Dieterlen-Lievre, 1994). They have regulatory, cytotoxic and possibly also antigen presenting functions. In the murine species and mammals they have been shown to have antimicrobial and antitumor properties. In our genetic analysis, the DBP appears to be a determinant of the proportion of TCR1 positive cells. The molecular mechanism of this relationship is unknown, but may be related to the chemotactic properties of the protein rather than to its involvement in VD metabolism. The complexity of the cross-talk between cells of the immune system renders it difficult to predict the outcome of genetic selection for different marker genotypes in terms of disease resistance. As an example, selection for the marker A3 of the VDR gene (Figure 3.1) would optimize the number of MHC class II positive cells, but will lead to an overall reduction of the CD8/CD3 ratio in the strain of interest. Hence this genotype may promote the humoral immune response while reducing the cell mediated immune response. The effect of such variations on the resistance to pathogens has to await experimental selection and challenge tests.

46

Chapter 3

3.6 ACKNOWLEDGMENTS This work was supported by grants from the Natural Sciences and Engineering Council of Canada, the Poultry Industry Research Council of Canada and Shaver Poultry Research Farms Ltd.

47

Table 3.1 Primers used to amplify segments of the VDR, DBP and Cyp24 genes.

VDR Segment 1

F: gctgggaggagaaaggagtgtt R: aacgcacgcacttctcagga

VDR Segment 2

F: gctggggagggaagattgagag R: agcttctggatcatcttggcgt

DBP Segment 1

F: taagaaaggtcactggacgg R: cctgcagcaaagtccttcg

DBP Segment 2

F: agaggatgcgcggctgagatgt R: ctctgttcccatttgctgtcg

Cyp24 Segment 1

F: tccaactccctgctttcttcc R: gtggtggtttcctcagaagc

Cyp24 Segment 2

F: ggtaagatgtggctgtgggt R: tgagcagattgtgtggcagg

48

Chapter 3

Table 3.2 Distribution of the polymorphisms.


Gene and Chromosome location Start of sequence Intron Exon Unique Genotypes SNP or indel 1 0 lb 0 0
3C

Blocks

DNA sequenced VDR Chr.Un DBP Chr.4* Cyp24 Chr. 20 SI: 2841 S2 24727 SI: 20712134 S2:20709442 Sl:n.d.
d

Number of SNP or indel 12 2 19 0 19 7

DNA sequenced 79bp a 223 bp 250 bp 350 bp 97 bp 245 bp

468 bp 241 bp 530 bp 448 bp 617 bp 384 bp

13 4

11 5

S2: n.d.

Non-coding exon Synonymous codon change for leucine (TTG<-^CTG) Two mutations were codon changes for glutamine and isoleucine, respectively. A third

mutation led to a change of histidine to leucine The genome sequence needs to be clarified. Exons and introns were determined by hybridization with mRNA sequence (GenBank accession number AF428109). The assembly of the Red Jungle Fowl genomic sequence for this region needs to be revised. The cDNA and our two sequences hybridize to contig NW-06081.1 (chromosome location unknown) and NW-606635.1 (chromosome 20). * contig NW-0603457.1

49

Chapter 3

Table 3.3 Identification of groups of co-segregating markers in the genes encoding the DBPa.

Marker

Genotype and number of observations (N) #1 (N=16) #2 (N=2) C C G C C G G G A G T/C A/G T/C A/G T/C T in A/G T/C #3 (N=l) C C G C C G G G A G T/C A/G T/C A/G T/C T/G in/del G C #4 (N=l) T/C T/C A/G T/C T/C A/G A/G A/G A/C A/G T/C A/G T/C A/G T/C T in A/G T RJ
b

Block

P-2 P-l P5 P7 P8 P9 PlOa Pll P12 P19 PI P2 P3 P4 P10 P6 P14 P13 P15
a

C C G C C G G G A G T A T A T T inc A T

T T A T T A A A C A C G C G C T in G T 2 2 2 2 2 3 3 4 5

Two segments of the gene were sequenced in 20 individuals. Only one of the segments

was polymorphic (see Table 1). The different genotypes were identified (columns) and the markers sorted on the basis of zygocity at the individual markers (rows). The markers formed 3 groups with 10, 5 and 2 markers whose alleles' co segregated, respectively, and two groups of single markers that did not co-segregate with any of the other markers. Pair-wise comparison of markers indicated that with the exception of PI5 all were at maximal linkage disequilibrium (i.e. one of the four possible combinations was missing). PI5 was not at maximal disequilibrium with markers in group 2. The genotypes at PI and
50

Chapter 3

PI5, for example, can only be explained if of all four allelic combinations (i.e. T-T, T-C, C-C and C-T). Marker genotype of the red jungle fowl according to the NCBI database. Genotype #4 can be explained as a heterozygote between alleles of RJ allele and genotype #1
c

Insertion of ATTTC

51

Chapter 3

Table 3.4 Association of single and pairwise combinations of marker genotypes with cell surface antigens on leukocytes a. Vitamin D receptor VDR-S1P3 CD4 TCR1/CD3 VDRS5P2 CD4 MHC class II CD4/CD3 n.s.

Cyp24 -S1P1

Vitamin D 24hydroxylase Cyp24Cyp24S1P1 S1P3 TCR1/ CD8/CD3 TCR2

Vitamin D binding protein DBPDBP-SlP15b S1P4 TCR2 n.s.

Cyp24 -S1P3

n.s.

n.s.

TCR1 TCR1/CD3

TCR1

DBPS1P4 DBPS1P15

n.s.

n.s. TCR1 TCR1/CD3 TCR1/TCR2

TCR1/CD3 n.s.

n.s. n.s.

VDRS1P3 VDRS5P2

MHC class II

CD8/CD3 n.s.

The surface antigens analyzed were CD3, CD4, CD8, LyB and MHC class II. The

analysis included the direct FACS counts and the ratios CD4/CD3, CD8/CD3, TCR1/CD3, TCR2/CD3 and TCR1/TCR2. Analysis was by GLM. Single marker effects or significant marker interaction within a gene are indicated in italics. Significant interactive terms that were significant (P<0.05) are indicated in regular script. The rare genotype A/A was omitted from the analysis

52

Chapter 3

Table 3.5 Spearman rank correlation between FACS counts.

CD3 CD3 CD4 CD8 TCR1 TCR2 MHCII LyB

CD4 0 37***

CD8 0.30*** 0.18*

TCR1
0 41 ***

TCR2 0 44***

MHCII -0.16* 0.17* 0.07

LYB -0.43*** -0.36*** -0.13 -0.24** -0.26** 0 37***

-0.30*** 0.75*** -0.04

0.33***

37*** -0.11 0

0.08

*P<0.05; **P<0.01; ***P<0.001 N=182

53

Chapter 3

Table 3.6 Correlation between egg quality traits and leukocyte cell surface antigens.

Spearman-rank correlation coefficient Surface antigen and significance (N=145) EW SPG Shell densityb CD3 CD4a CD8 TCR1 TCR2 TCR1/CD3 TCR2/CD3 TCR1/TCR2 -0.09 0.06 0.05 -0.16* 0.09 -0.01 0.17* -0.17* -0.24** -0.07 -0.04 -0.16* -0.03 -0.07 0.11 -0.08 -0.23** 0.03 0.00 -0.26** 0.09 -0.19* 0.24** -0.22**

MHCII LYB

0.17* 0.07

0.10 0.22**

0.22** 0.20*

* PO.05 **P<0.01
a b

No significant associations were observed for the ratios CD4/CD3 and CD8/CD3 The shell density is approximated as (SPG minus 1) (EW) (Parsanejad et al, 2004).

54

Chapter 3

9.0

8.0

b
CO

7.0

to

%
O X

6.0 5.0

I
_1 _ T A1/A1 A1/A3 A1/A2 A3/A3 A2/A3 VDR genotype

I
other

4.0

0.4

.o
i<

03
i CO

8
oo O O

0.3

I
0.2

A1/A1 A1/A3 A1/A2 A3/A3 A2/A3 other VDR genotype

55

Chapter 3

Figure 3.1 Association of VDR genotypes with the MHC class II count and the CD8/CD3 ratio. The two markers S1P4 and S2P2 in the VDR gene defined four different haplotype groups (Al: A-G; A2: G-G; A3: G-A; A4: A-A). These haplotypes in turn define 10 different genotypes. The haplotype frequencies estimated by the EM algorithm (Hill, 1974) were Al: 0.43; A2: 0.18; A3: 0.34; and A4: 0.05. Two genotypes (A1/A3 and A2/A4) are not distinguishable. However, the expected frequency of the genotype A2/A4 was only 0.02 as compared to 0.29 for the genotype A1/A3. These two genotypes were therefore designated as A1/A3. Rare genotypes (<10) are grouped as "other". They comprise A2/A2, A1/A4 and A3/A4. The genotype A4/A4 was not observed in the data set of 166 individuals. ANOVA indicate the MHC class II counts (upper panel) and CD8/CD3 ratio (lower panel) differed significantly at P=0.0007 and 0.015, respectively. Comparison of groups showed a higher MHC class II counts for genotypes A3/A3 than for any other any other genotypic class. It indicates that A3 is a recessive haplotype for a high MHC class II titer. For the CD8/CD3 ratio significant contrasts were A1/A2>A1/A1, A1/A3 or A3/A3 as well as A1/A3 < A1/A2, A2/A3 or "other".

56

Chapter 3

28.0

25.0

I I I

O o
CD

19.0

16.0

A/A A/A

A/A G/A

G/A A/A

G/A G/A

G/G A/A

Cyp24 S1P3 genotype DBP S1P15 genotype

Figure 3.2 Mean of TCR1 counts for different genotype combinations of the marker S1P3 in the Cyp24 gene and S1P15 in the DBP gene. Three genotypic combinations that were not observed or only represented once (G/G-A/A; G/G-G/A, G/A-G/G) were omitted from the analysis. The numbers of observation in the order listed on the ordinate were 38, 12, 36, 14 and 11. Contrasts were significant at P=0.023. Pair wise contrasts indicated that the GAGA genotypes had a TCR1 count that was significantly higher than in all other genotypic classes.

57

Cyp24S1P3=G/A
40.0

30.0

DBPS1P15 A GA O AA
A A

cE o
cc

hco 20.0 o

4 A

43X0

cP

10.0

0.0

Hiiiiiir*-iiiiiiii

0.0

0.3

0.7

1.0

Percentile

Cyp24S1P3=A/A
40.0

30.0

DBPS1P15 AA A GA

a: o
w 20.0
CO

LL

10.0

0.0 0.0 0.3 0.7

Percentile

58

Chapter 3

Figure 3.3 Interactive effect between the DBP gene and the Cyp24 gene on the TCR1 ratio. Upper panel: Percentile distribution of the DBP SIP 15 genotypes G/A and A/A when the Cyp24 S1P3 genotype is G/A. The two distributions are different (KolmogorovSmirnoff test for unequal distributions, P=0.009). Differences are more pronounced at the lower end of the distribution, resulting in an unequal variance (Variance-ratio equal variance test, P=0.045). Lower panel: Percentile distributions for the DBP S1P15 genotypes G/A and A/A when the Cyp24 S1P3 genotype is A/A. The two distributions do not differ significantly.

59

Chapter 3

3.7 REFERENCES Agoston E.S., Hatcher M.A., Kensler T. W. and Posner G. H. (2006) Vitamin D analogs as anti-carcinogenic agents Anticancer Agents Med. Chem ., 6: 53-71 Dieterlen-Lievre (1994) Hemopoiesis during avian ontogeny. Poultry Sci. Rev., 5: 273305 Chen, C.L., Cihak J., Losch U. and Cooper M.D. (1988) Differential expression of two T-cell receptors, TCR1 and TCR2 on chicken lymphocytes. Eur. J. Immunol., 18: 539-43 Gomme, P. and Bertolini, T. (2004) Therapeutic potential of vitamin D-binding protein. Trends Biotech., 22: 340-345 Gowe, R.S., Fan-full, R.W, McMillan, I. and Schmidt, G.S. (1993) A strategy for maintaining high fertility and hatchability in a multi-trait egg-stock selection program. Poultry Sci., 72:1433-1448 Gowe, R.S., Robertson, A. and Latter, B.D.H. (1959) Environment and poultry breeding problems . 5. The design of poultry control strains. Poultry Sci., 38:462-471 Griebel, P.J., Qualtiere, L., Davis, W.C., Lawman, M.J., Babiuk, L.A. (1987) Bovine peripheral blood leukocyte subpopulation dynamics following a primary bovine herpes virus-1 infection. Viral Immunol., 1: 267-286 Hill, W. G. (1974) Estimation of linkage disequilibrium in randomly mating populations. Heredity, 33:229-239 Hintze, J. (2004) NCSS and Pass. Number Cruncher Statistical Systems. Kaysville, Utaj. www.NCSS.com International Chicken Polymorphism Consortium (2004) A genetic variation map for chicken with 2.8 million single-nucleotide polymorphisms. Nature, 432: 717-721 Kuhnlein, U., Zadworny D., Dawe Y., Fairfull R.W., and Gavora J.S. (1990). Assessment of inbreeding by DNA fingerprinting: Development of a calibration curve using defined strains of chickens. Genetics, 125: 161-165 Kuhnlein, U., Sabour J., Gavora J.S., Fairfull R.W. and Bernon D.E. (1989) Influence of selection for egg production and MD resistance on the incidence of endogenous viral genes in White Leghorns. Poultry Sci., 68:1161-1167

60

Chapter 3

Lessard, M., Yang, W.C., Elliot, G. S., Deslaurier, N., Brisson, G.J., Van Vleet, J.F. and Schultz, R.D. (1993) Suppressive effect of serum from pigs and dogs fed a diet deficient in vitamin E and selenium on lymphocyte proliferation. Vet. Res., 24: 291-303 Lewis, P. O., and Zaykin, D. (2001) Genetic Data Analysis: Computer program for the analysis of allelic data. Version 1.0 (dl6c). Free program distributed by the authors over the internet from http://lewis.eeb.uconn.edu/lewishome/ software.html Lieu, P. T., Stenger, S., Li, H., and Wenzel, L., Tan, B.H., Krutzik, S., Ochoa, M.T., Schauber, J., Wu, K., Meinken, Ch., Kamen, D.L., Wagner, M., Bals, R., Steinmeyer, A., ZUgel, U., Gallo, R.L., Eisenberg, D., Hewison, M., Hollis, B.W., Adams, J.S., Bloom, B.R. and Modlin, R.L. (2006) Toll-like receptor triggering of a vitamin D-mediated human antimicrobial response. Science, 311: 1770-1773 Lillehoj, H.S., Lillehoj, E.P., Weinstock, D. and Schat, K.A. (1988) Functional and biochemical characterization of avian T-lymphocyte antigens identified by monoclonal antibodies. Eur. J. Immunol., 18: 2059-2065 Masuda, S., Byford, V., Arabian, A., Sakai, Y., Demay, M.B., St.-Arnaud R. and Glenville, J. (2004) Altered pharmacokinetics of la,25-dihydroxyvitamin D3 an 25-hydroxyvitaminD-24-hydroxylase (Cyp24al) Endocrinology, 146: 825-834 Parsanejad, R., Praslickova, D., Zadworny, D. and Kiihnlein, U. (2004) Ornithine decarboxylase: haplotype structure and trait associations in White Leghorn chickens. Poultry Sci., 83:1518-23 Parsanejad, R., Torkamanzehi, A., Zadworny, D. and Kuhnlein, U. (2003) Alleles of cytosolic phosphoenolpyruvate carboxykinase (PEPCK): trait association and interaction with mitochondrial PEPCK in a strain of White Leghorn chickens. Poultry Sci., 82:1708-15 Parsanejad, R., Zadworny, D., and Kunhlein, U. (2002) Genetic variability of the cytosolic phosphoenolpyruvate carboxykinase gene in White Leghorn chickens. Poult Sci., 81:1668-70

61

Chapter 3

Uitterlinden, A. G., Fang, Y., Van Meurs, J.B., Pols, H.A., Van Leeuven, J.P. (2004) Genetics and biology of vitamin D receptor polymorphisms. Gene, 338: 143-156 Ren, S., Nguyen, L., Wu, S., Encinas, C., Adams, J.S., and Hewison, M. (2005) Alternative splicing if vitamin D-24-hydroxylase. J. Biol. Chem., 280: 2060420611 Speeckaert, M., Huang, G., Delanghe, J. R. and Taes, Y. E. (2006) Biological and clinical aspects of the vitamin D binding protein (Gc-globulin) and its polymorphism. Clin. Chim, Acta, 372: 33-42 Tishkoff, S., and Verelli, B.C. (2003) Patterns of human genetic diversity: Implications for human evolutionary diversity. Annu. Rev. Hum. Genet., 4: 293-340 Van Etten , E. and Mathieu, C. (2005) Immunoregulation by 1,25-dihydroxyvitamin D3: basic concepts. J. Steroid Biochem. Mol. Biol.., 97: 93-101 Wee-Chian, L., Hanauer, S. B. and Li, Y. C. (2005) Mechanisms of disease: vitamin D and inflammatory bowel mdisease. Nature Clin. Pract. Gastroenterol and Hepatol., 2:308-315

62

Chapter 4

CONNECTIVE STATEMENT II Based on previous research that indicated an association of variants in the GH gene, the GHR gene and the chemokine MIP-3a with Marek's disease resistance, we wanted to conduct DNA based selection in commercial White Leghorn chickens. In contrast to previous studies, we used vaccinated chickens to make our study more relevant to the commercial situation. This study also provided us with a database to analyze the association of markers in other genes with disease resistance.

63

Chapter 4

CHAPTER 4

Effect of Marker Assisted Selection on Indicators of Marek's Disease in a Vaccinated Commercial White Leghorn Strain

Dana Praslickova1, Shayan Sharif2, Aimie J. Sarson2, Mohamed Faizal Abdul-Careem2, David Zadworny , Al Kulenkamp , George Ansah and Urs Kuhnlein

'Dept. of Animal Science, McGill University, 21111 Lakeshore Rd., Ste. Anne de Bellevue, Qc, Canada, H9X3V9
2

Department of Pathobiology, Ontario Veterinary College, University of Guelph, Guelph,

On, Canada, NIG 2W1


3

Shaver Poultry Breeding Farms Ltd., 500 Franklin Boulevard, Cambridge, On, Canada,

N1R 8G6

Corresponding author: Urs Kuhnlein Tel.: (514) 398 7799 Fax:(514)398 7964 e-mail: urs.Kuhnlein@mcgill.ca

64

Chapter 4

4.1 ABSTRACT A commercial strain of chickens was selected for markers located in the GH gene, the GH receptor gene and the gene for the chemokine MIP-3a . Female offspring of the selected and a control population were vaccinated with HVT at hatch and challenged by intraperitoneal injection of 250 PFU of the RB-1B strain of the MD virus at 5 days of age. Two challenge tests were conducted in hatches collected three month apart and the course of MD monitored for 8 weeks. The MD indicators measured were the viral titers in feather-tips, mortality, presence and organ distribution of MD lesions, body weight, spleen weight and bursa weight. Analysis by ANOVA or non-parametric statistics showed significant interaction between population and trial. Specifically, in trial 1 the viral titer in the selected population was 2 fold lower than in the control, while in trial 2 the situation was reversed. Similar observations were made for other MD associated parameters. Further, the organ distribution indicated a different course of the disease in the two trials. The results indicate that the effect of genes on MD may depend on environmental factors.

Keywords: Marek's disease, disease resistance, marker associated selection, survival, distribution of MD lesion, bursa weight

65

Chapter 4

4.2 INTRODUCTION Marek's disease (MD) is a highly contagious, re-emerging and economically important disease in the poultry industry. Marek's disease is caused by an avian herpesvirus. It is characterized by paralysis, as a result of lymphoid infiltration into peripheral nerves or inflammation of the brain, lymphomas in various organs including the skin, immunosuppression, and blindness accompanied by non-specific signs such as weight loss (Zelnik, 2004). The economic impact of MD on the world poultry industry is thought to be in range of US$1-2 billion annually (Morrow and Fehler, 2004). Control of MD is based on effective vaccination, proper biosecurity and selection for genetic resistance. But MD herpesvirus (MDV) can evolve towards greater virulence and the occurrence of MD in vaccinated flocks indicates that MDV can bypass current methods of disease control (Gimeno, 2004). Genetic resistance to MD has been known for more than 60 years (Calnek, 1985). Resistance has been usually assessed based on the mortality or the development of lesions. Asmundson and Biely (1932) first demonstrated significant differences among families. Cole (1968) extended this knowledge by comparing susceptibility and/or resistance of different commercial families challenged by MDV. Later viral titration by plaque assays or the polymerase chain reactions in various organs has been added as an indicator for the presence of the disease (Baigent et al, 2005). The first genes that were shown to affect MD resistance were genes involved in the immune response. Hansen et al. (1967) found an association of resistance with blood group B haplotypes (Keller and Sevoian, 1983; Calnek and Witter, 1997). The blood group B locus is closely linked to the major histocompatibility locus (MHC) that regulates the processing and presentation of antigens (Drof, 1981; Briles, et al, 1983; Kaufman and Venugopal, 1998). Haplotypes B13, B15, and B19 were associated with susceptibility, whereas the B21 haplotype was associated with resistance to MD (Bacon et al, 2001). Selection for B haplotypes has been used in the poultry industry and several mechanisms have been proposed to explain the association between B-complex variation and resistance to MD (Kaufman and Salomonsen, 1997). However, since MHC genes are specific for peptides, it is feared that such selection may reduce the repertoire of antigen recognition and render chickens more susceptible to other infectious diseases.

66

Chapter 4

In addition to MHC, other genes may have a strong influence on disease resistance as exemplified by the two inbred lines 63 and I2 that differ in MD resistance, but are homozygous for the same B haplotype. Analysis of F2 crosses between these two lines revealed the presence of 14 chromosomal regions that were associated with MD resistance (Vallejo et al; 1998; Yonash et al, 1999). Taking into account that the genetic effects were measured against the relatively narrow genetic background determined by these two inbred lines, it is likely that that the number of genes that affect MD resistance in non-inbred strains is quite large. More recently, the strategy for gene mapping has shifted towards the more pragmatic association analysis of variations in candidate genes with traits of interest. Such candidate genes can be chosen on the basis of position, biological properties, co-selection with disease resistance, and differential expression in strains with contrasting susceptibility, or association with disease resistance in other species. Even when the causative mutations or genes have not been identified, selection for linked markers may improve resistance. Here we report the outcome of a marker selection experiment in a commercial line of chickens, following a commercial breeding strategy. The challenge was carried out in vaccinated chickens to mimic the normal commercial situation, and MD susceptibility was assessed from mortality, necropsy observations and the measurement of the viral titers in feather-pulp. The selected markers were located in the genes encoding growth hormone (GH), growth hormone receptor (GHR) and chemokine macrophage inflammatory protein-3a (MIP-3a). The GH gene had been implicated in MD resistance, and immune responsiveness in several laboratories (Kuhnlein et al, 1997; Linher et al, 2000; Liu et al, 2001). Similar to alleles of the GH gene, alleles of the GHR gene are co-selected with selection for MD resistance and are associated with differences in the immune responsiveness (Feng et al, 1998; Kuhnlein et al, 2003). CCL20 is a chemokine that attracts activated T-cells and B-cells and has been implicated in the control of Salmonella dissemination in mice (Williams, 2006; Kaiser et al, 2005; Fahy et al, 2004). A preliminary MD challenge experiment in a closely related commercial population indicated that the three alleles that were chosen for selection were associated with a reduced titer of MD virus in the spleen and/or thymus (Masilamani, 2003).

67

Chapter 4

4.3 MATERIALS AND METHODS 4.3.1 Strains of chickens and selection strategy All strains used were White Leghorn strains of Shaver Poultry Breeding Farms Ltd. What is referred to as the commercial line is the offspring of three pure lines using the mating strategy outlined in Figure 4.1. Two grandparent lines were used to produce the dams which where mated with sires from a third pure line to yield the commercial dams. Selection for the desired markers was carried out in two generations on the dam side (line 2 and 3 and 23) and over one generation in the sire line 1 (Figure 4.1). In the final cross, 10 sires were crossed with 10 females each to produce the offspring used in the challenge experiment. In each cross, selection was based on the genotypes of 250 individuals of each parental line. The standard commercial line was used as a control population. To produce this population, twelve pools of semen of four males were prepared and 17 females were inseminated with each pool. The offspring of the commercial line were reared without tracking parentage. The challenge tests (trials) were conducted in populations hatched three months apart. In the selected population (S) the same sires and dams were used. Hence the offspring were full-sibs. In the control population the same females were used in the two hatches, but the semen pools were prepared from different sires of the same generation as in the first challenge test. Hence, the offspring were half-sibs.

4.3.2 Marker selection The restriction fragment polymorphisms (RFLP) alleles selected for were GH Sacl+ , GHR HindHl+ , and MIP-3a Hin6l- (Kuhnlein et al., 1998; Feng et al., 1998; Masilamani, 2003). While RFLP measurements were used during selection, the final progeny was genotyped by primer extension (Genome Quebec, FP-SBE platform, Molecular Devices, Sunnyvale, CA; or SNP Stream Genotyping System, Beckman
TM

Coulter ). The genotypic frequencies in the selected and control population are shown in Table 4.1.

68

Chapter 4

4.3.3 Challenge Chickens were hatched at Shaver Breeding Farms Ltd. (Cambridge, ON), vaccinated with the herpes virus of turkeys (HVT) using the dose recommended by the supplier (Merial Canada Inc., Baie d'Urfe, QC), and immediately shipped to the University of Guelph. At 5 days of age, the chickens were challenged by intraperitoneal injection with 250 PFU of the MD virus strain RB1B. MDV strain RB1B (passage 9) was provided by Dr. K.A. Schat (Cornell University, NY, USA) (Schat et al, 1982). In each of the two trials 100 selected and 100 non-selected female chickens were randomly assigned to 3 isolation units. The chickens were observed daily and those who showed signs of disease such as wing droopiness, huddling or limping due to paralysis were euthanized. The experiments were terminated at 8 weeks post-infection. All chickens, including those that that died or had to be euthanized during the experiment were subjected to necropsy.

4.3.4 Apramycin treatment In the first trial seventeen chickens, nine of the selected and eight of the nonselected group, died before or within 48 hours of challenge. Necropsy indicated septicemia and tissue swaps revealed the presence of Escherichia coli. The isolated strain was sensitive to apramycin and the chickens were subsequently treated with this antibiotic. After the beginning of the treatment two more chickens, one from each group, died from septicemia during the first week post infection. In the second trial, similar symptoms (acytes, airsaculitis) were observed in two chickens from each group that died between 21 and 25 dpi. The chickens were subsequently also treated with apramycin although no Escherichia coli infection was observed.

4.3.5 Viral titers in feather tip extracts Feathers were plucked at weekly intervals post-infection and stored frozen at 80C. For DNA extraction, the tips at the bottom of the feather were cut into small pieces with sterile scissors and placed in 1.5 ml tubes with 400 ul of extraction buffer containing 2% 2-mercaptoethanol, 10 mM Tris-HCL at pH 8.0, 100 mM NaCl, 10 mM EDTA at pH 8.0 and 0.5% SDS. After an incubation for 30 minutes at 50C, proteinase K (Gibco BRL)

69

Chapter 4

was added to a final concentration of 200 ug/ml and the incubation at 50C continued overnight. DNA was extracted with phenol:chloroform:isoamyl alcohol (25:24:1)

(BioShop Canada Inc.) and precipitated with an equal volume of ice-cold 100% ethanol. The pellets were rinsed with 500 ul 70% ethanol, air-dried and dissolved in 300 ul of deionized water. The DNA concentrations were measured using the NanoDrop ND-1000 Spectrophotometer (Nanodrop Technologies). The DNA concentration was adjusted to lOOng/ul and the samples were stored at -20 C. Viral titers were determined by

competitive PCR as described previously (Kuhnlein et al., 2006). We adhered to this method since it was reliable and less costly than the real-time PCR methodologies that have been developed in the mean time (Baigent et al, 2005).

4.3.6 Statistical analysis Survivorship plots, hazardplots and associated statistics were generated using the Kaplan-Meier limit estimate. Viral titers were exponentially distributed and were either analyzed by non-parametric statistics, or parametrically after log transformation. All analyses and graphics were carried out using the NCSS 2004 software (Hintze, 2004). Analysis by GLM using the trial as a random variable indicated that the effect of selection on parameters of Marek's disease was not significant. However, subsequent analysis revealed that the progression of the disease differed in the two trials. The trial was subsequently treated as fixed effect and the analysis focused on a comparison of the relationship between indicators the four groups defined by selection and trial. There was no significant effect of housing on the viral titers or the tumor frequency. Sire information was only available for the selected population. Using the trial as a fixed variable and the sires nested within the trial indicates again that SI is significantly smaller than S2.

4.4 RESULTS

4.4.1 Efficacy of vaccination A pretrial was conducted to verify that our viral stock and challenge conditions were adequate. In particular, since we had chosen the time course of viral proliferation in feather pulp as an endpoint we wanted to avoid excess mortality. The pretrial also enabled

70

Chapter 4

us to test the protective effect of vaccination on mortality and viral proliferation in feather pulp. Forty chickens were divided into four groups, group A (vaccination/challenge), group B (no vaccination/challenge), group C (vaccination/ no challenge) and group D (no vaccination/ no challenge). As expected no mortality was observed in groups C and D. In group B, signs of Marek's disease were observed starting from 25 dpi and at 41 dpi all chickens had either died or had to be euthanized (Figure 4.2). Necropsy revealed multifocal tumors in various organs in all 10 chickens. In group A, one chicken died at 2 dpi without displaying any MD lesions. Two additional chickens died in the 5 l and 6* week, respectively. Necropsy revealed multifocal tumors in both of these and in one additional chicken among the survivors at 56 dpi. Hence, vaccination was very effective in reducing MD mortality. Viral titers was measured in extracts from feather tips taken on a weekly basis. The vaccinated group revealed a bell shaped curve with a peak at 3 weeks post-infection and a declining phase between week 3 and 4. In the non-vaccinated chickens the high mortality precluded reliable assessment of the viral titers at 3 and 4 dpi. We therefore integrated the viral titers over the first three weeks as a measure of early viral proliferation (Figure 4.3). Vaccination reduced the early viral load by a factor of two. The viral titer in the vaccinated control group C was 50 times lower than in group B and presumably represented background amplification of the HVT used for vaccination. No positive samples were detected in the unvaccinated control group.

4.4.2 Effect of selection and trial on viral titers The time dependence curve of the viral titers was bell shaped in both trials and populations, with the maximal titer observed at 21dpi (Figure 4.4). However, the relative response of the two populations in the two trials was reversed. In trial 1 the selected population (S) had a consistently lower titer than the control population (U), while in trial 2 the situation was reversed. For statistical evaluation we summed the viral titer up to 21 dpi, the starting point of mortality (see below). Similar to the titers at individual time-points, the distribution of this measure of the viral load was exponentially distributed and could be

71

Chapter 4

normalized by log transformation. Analysis by GLM revealed that the control population (U) had similar viral loads in both trials, while the viral load in the selected population (S) differed by a factor of 3.8 between the trials. The same response was observed for the total viral load of the survivors at five weeks post infection (Figure 4.5; Table 4.2).

4.4.3 Survival analysis In contrast to the viral titers, the survival curves in the two trials differed for the control population, but were similar for the selected population. (Figure 4.6). Cumulative mortalities for population U at the end of the trials were 40% and 22%, respectively, while the cumulative mortalities for the population S were 22% and 23%, respectively (chi-sq=9.46, df=3, P=0.023). The death rate curves had distinct shapes that appeared to be characteristic of the population and were similar in both trials. In the population U the death rate increased until 30 dpi, was followed by a decrease, and then again an increase towards the end of the experiment. In contrast, the death rate for the selected population (S) increased steadily with the time post-infection in both trials.

4.4.4 Necropsy analysis Necropsy revealed that 82% of the chickens that died or were euthanized had tumors ranging from the size of pinpoints to several cm in diameter. Among the survivors the percentage of chickens that had tumor-like lesions ranged from 18% to 31%. The frequency of chickens with tumor-like lesions did not differ significantly among the two populations and the two trials (chi-square test). The same was true when discoloration or enlargement of organs were included in the analysis. The most frequent lesions (36%) were observed in the spleen, ranging from an enlargement and discoloration to pinpoint lesions and tumors. The frequency of lesions in other organs were 28% in the kidney, 26% in the ovary, 25% in the liver, 18% in the proventriculus, 13% in the muscle and 6.4% in the heart. Although the frequency of chickens with lesions was similar in the two trials; the distribution of lesions among organs differed significantly (Table 4.3). Specifically, in trial 1 there were significantly more lesions found in the muscle, the proventriculus and the heart. No differences were found when the two populations were compared.

72

Chapter 4

4.4.5 Effect on body weight, spleen weight and bursal weight Among the survivors, there was a significant effect of the presence of lesions on the body weight, the bursal weight and the spleen weight. Chickens that displayed lesion had a reduced body weight and bursal weight. In contrast, the spleen weight was higher in chickens with lesions, presumably reflecting infiltration of the spleen by transformed cells or B-cell proliferation (Table 4.4). Analysis of the influence of population and trial on these three parameters revealed a significant effect of the trial on the bursal weigh (P<10~6), a marginally significant interactive effect on body weight (P=0.05) and no effect on the spleen weight. The three variables are confounded, but a rather specific role has been assigned to the atrophy of the bursa as an indicator of viral replication. Since the bursa is also expected to be influenced by the body weight, we reanalyzed the influence of the population and trial on the bursal weight with the body weight as a covariant. It indicated significant effects of the trial and the interaction between trial and population (Figure 4.7). A comparison of the mean of the bursal weights and the viral titers in the four different groups indicates that the two measures are equivalent (Figure 4.8).

4.5 DISCUSSION Quantitatively, MD resistance may be defined as the probability of a chicken to survive when exposed to MD virus. It is dependent on environmental and genetic factors and their interactions. The genetics of survival to MD is therefore expected to be complex and involve many different genes. In addition, the shape of survival curve (i.e. the hazard rate) is difficult to assess and relate to genetic and environmental variations. It is therefore customary to analyze other manifestation of MD, such as survival to a fixed amount of time, the frequency of MD lesions, viral proliferation, or changes in the body weight or organs. Viral proliferation in the epithelium of feather-tips where infectious virus is formed is arguably the most important. Lack of formation of infectious virus would entail that an infected chicken is unable to transmit the virus, such curtailing the spread of the virus within a flock.

73

Chapter 4

Of these parameters, survival, MD lesions and viral proliferation were correlated, with the highest correlation being observed between the survival and the presence of MD (lesions data not shown). It reflects that all chickens that died before the end of the experiment had MD lesions, suggesting that MD lesions were the ultimate cause of death. Whether some of the surviving chickens that had MD lesions would have recovered from MD is unknown. The chickens in this challenge experiment were still in the growing phase. Hence analysis of the relationship between MD and body weight, spleen weight and bursa weight required age matched chickens. Since body weight was only measured at the end of the experiment, the analysis was restricted to the survivors. Among these, chickens with MD lesions had a higher viral load, a higher spleen weight and a reduced body weight and bursal weight. It indicated that weight measurement were also indicators of MD. In the case of body weight, it would have been worthwhile to extend the measurement of body weight gain over the entire period of the experiment. The distribution of lesions in the two trials differed indicating a different course of the disease. Differences were also evident from measurements of most other parameters of MD. In particular, there were significant differences in the viral titer in feather tips, the survival, and the body and organ weights. The reason for the lack of reproducibility is unknown. The observation of inflammatory lesions early in trial 1 and at about 3 weeks post infection in trial 2 and subsequent treatment with apramycin is a possible factor. Other possibilities are differences in the exposure to stress during shipment of the chickens prior to exposure or parental age differences. No untoward symptoms were observed in the parents or in littermates that were maintained at the breeding facility. It is disquieting that in the two trials the relative order of incidence of MD in the two populations was reversed. Regardless of the MD associated parameter that was measured, the selected population S was more resistant than population U, while in trial 2 the control population U was more resistant. Markers that had been identified in a single challenge test as being associated with disease resistant may under certain environmental situations confer susceptibility. In its early stage of infection, MDV replicates cytolytically in B and T-cells, cells that also determine the efficacy of HVT vaccination. Some genes may affect both, the

74

Chapter 4

immune response and viral replication and lead to an unstable response to MDV infection.

75

Chapter 4

Table 4.1 Influence of selection on the genotype distribution

Marker MIP-3a Hindi GH Sacl GHR Hindm


3 b

Selected Control Selected Control Selection Control

Frequency of genotypes +/+ +/-/0 0.368 0.6323 0.319 1 0.658 0.822 0.582 0.529 0 0.312
-

0.152 0 0 0.178 0.418

Genotypes selected for are indicated in bold The GHR gene in female chickens is haploid.

Table 4.2 Comparison of the cumulative viral titer at 3 and 5 weeks post-infectiona. Significant contrasts0 Control (U2) 7.98 9.38 SK(U1,U2)<S2 SK(U1,U2)<S2

Cumulative Trial 1 viral load to


a

Trial 2 Selected (S2) 13.24 18.33

Selected Control (SI) 3.43b 5.13 (Ul) 6.97 9.63

3 weeks 5 weeks
a

For analysis the weekly viral titers (virus/cell) were summed to 3 and 5 weeks,

respectively. The data was normalized by log transformation values and analyzed by GLM using population (P) and trial (T) as independent variables. The variables T and the interaction PxT were significant (P<10~5).
b

Back-transformed means of the log-transformed values.

Contrast were analyzed for significance using the Tukey-Kramer multiple comparison test.

76

Chapter 4

Table 4.3 Frequency of lesions among chickens for various tissues in trial 1 and 2a. Tissue Lesion Frequencyb Trial 1 Spleen Liver Muscle Proventriculus Ovary Kidney Heart Other All tissues
a

ChiSquare 1.89 0.69 8.33 13.55 1.29 0.44 16.17 0.89 0.01

P-valuec

Trial 2 33% 23% 9% 12% 24% 27% 2% 13% 46%

27% 27% 19% 26% 29% 30% 12% 9% 45%

n.s. n.s. 4x10"3 2x10"4 n.s. n.s. 6x10"5 n.s. n.s.

The selected and non-selected population did not differ. Percentage of chickens with one or more lesions.

The cut-off of significance after Bonferroni adjustment is 6x10

Table 4.4 Effect of lesions on viral load, body, spleen and bursa weight in surviving chickens Lesions Present (N=63) Viral load to 5 weeks Body weight (g) Bursal weight (g) Spleen weight (g) 17.01.1 619 7 2.02 0.14 3.48 0.12 Absent (N=226) 6.1 1.2 709 14 2.99 0.07 2.06 + 0.06 P-value <10"6 <10"6 <10"6 <10"6

Chapter 4

Sire line

Dam line

A
/ ?
123

23

Figure 4.1 Mating strategy to produce the commercial strain 123. Selection for desired genotypes was conducted in strains 1, 2, 3 and 23.

78

Chapter 4

1.000-j A B

0.800-

0.600-

0.400-

0.200-

O.OOOH

r~,

ri

rrrT!

r,

ri

1 1

0.0

15.0

30.0

45.0

60.0

Days Post-Infection

Figure 4.2 Protective effect of vaccination on MD mortality. The survival curves of group A (vaccinated/challenged) and group B (not vaccinated/challenged) differed significantly (log-rank test, P=10"4).

Chapter 4

2.5n

CD O

1.6*

A B C

Q. TJ
CM O T3 CO O CO

0.8-

-0.1-

>

-1.00.0

~l

0.3

0.5

0.8

1.0

Percentile

Figure 4.3 Effect of vaccination on the viral load integrated over the first 3 weeks post infection. A percentile plot of the log-transformed sum of viral titers over the first three weeks is shown. The groups are A: challenged/no vaccination; B, challenge/ vaccination and C: no challenge/vaccination. The means were mutually different from each other (Bonferroni multiple comparison test).

80

Chapter 4

4.5 4 -

Trial 1

3.5

Median Viral"
iZ

3 -

2.5
2 -

1.5 1 -

0.5 0 -

Week Post-Infection

9 8
'>;:

" "Trial 2 ~
f - - ~

Media Viral Titer

6 5 4 3
2-

" ' ''''.;

" ~"~ " "

__

| "

zi ' .
1

fr
:
:.

1
>

'-rk

I
1
''*.;?

.. _

~ ~

..

%.
0

I I< I
>- ': ,*;.! '
:

u '/

^i

V ek Post-l ifection Ve

Figure 4.4 Time course of viral proliferation. The median viral titer, expressed as viral genome equivalent, is plotted in dependence of time post-infection.

81

Chapter 4

CD

CM

o
-I

CO

o >

CD

0.5

Percentile

Figure 4.5 Percentile distribution of the viral load to 3 weeks in dependence of trial and population.

82

Chapter 4

1 .UUU'

0.025!

"\. h _
0.900* - n-

S1

- S2

>^7~L,

Survivoi

v>

0.800-

0.700

0.6001

0.500-

0.0

15.0

30.0

45.0

60.0

Days Post-Infection

15.0

30.0

45.0

Days Post-Infection

1.000

0.020H

0.900

U2 U1
ard Rate
t o

0.016

0.800

0.012

G O

0.700

0.008

0.600

0.004

0.500 0.0

0.000 15.0 30.0 45.0 60.0 15.0 30.0 45.0

Days Post-Infection

Days Post-Infection

Figure 4.6 Survival curve of the two populations S and U in trial 1 and 2. The four survival curves differ significantly at P=0.018 (LOGRANK test). Pair-wise comparisons indicate that survival curve for Ul (population U in trial 1) differed significantly from the other three survival curves, while the differences between U2, SI and S2 were not significant. The hazard rate functions appear to have shapes characteristic of the two populations 1 and 2.

83

Chapter 4

X3 O CO

CD

<n

IS a:

0.0

0.5

Percentile

Figure 4.7 Percentile distribution of the bursa-body weight ratio among the survivors of the challenge experiment. SI, and S2 designates the population S in trail 1 and trial 2; Ul and U2 designate the population U in trial 1 and 2. GLM analysis of the bursa weight with population (P) and trial (T) as independent variables and the body weight as a covariant indicated significant effects for T (P=10~6), the interaction PxT (P=0.0003) and the covariant(P=l(T6).

84

Chapter 4

0.5

0.7

0.9
Viral Load (log)

1.1

1.3

Figure 4.8 Relationship between the mean bursa weight and mean of the log transformed viral load to 35 dpi among the survivors of the challenge experiment. Linear regression of the mean bursa weight on the mean viral titer was significant at P=0.011. The Spearman rank-correlation between individual measurements was -0.349 (N=243,P<10"6).

85

Chapter 4

4.6 REFERENCES

Asmundson, V.S., and Biely, J. (1932) Inheritance of resistance to paralysis (neurolymphomatosis gallinarum) I. Differences in susceptibility. Can. J. Res., 6:171176 Bacon L.D., Hunt, H.D. and Cheng, H.H. (2001) Genetic resistance to Marek's disease Curr. Top. Microbiol. Immun., 255: 121-141 Baigent, S.J., Petherbridge. L.J., Howes, K., Smith, L.P., Currie, R.J.W. and Nair, V.K. (2005) Absolute quantification of Marek's disease virus genome copy number in chicken feather and lymphocyte samples using real-time PCR. J. Virol. Meth., 123:53-64 Briles ,W.E., Briles, R.W., Tafs, R.E. and Stone, H.A. (1983) Resistance to a malignant lymphoma in chickens is mapped to subregion of major histocompatibility (B) complex. Science, 219: 977-979 Calnek, B.W. (1985) Genetic resistance. In: Marek's diseasescientific basis and methods of control. L.N.Payne ed. Martinus Nijhoff, Boston, pp. 293-329 Calnek, B.W. and Witter, R.L. (1997) Marek's disease. In: Diseases of Poultry, 10th ed. B.W. Calnek and R.L. Witter eds. Iowa State University Press, Ames, pp. 369-413 Cole, R.K. (1968) Studies on genetic resistance to Marek's disease. Avian Dis., 12: 9-28 Drof, M.E. (1981) The role of the major histocompactibility complex in immunology. Garland Press, New York, NY Fahy, O. L., Townley, A.L., Coates, N.J., Ckark-Lewis, I. and McColl, S.R. (2004) Control of Salmonella dissemination in vivo by macrophage inflammatory protein (MIP)-3a/CCL20. Lab. Invest., 84: 1501-1511 Feng, X.P., Kuhnlein, U., Fairfull, R.W., Aggrey, S.E., Yao, Y. and Zadworny, D. (1998) A genetic marker in the growth hormone receptor gene associated with body weight in chickens. J. Hered., 89: 355-359 Fredericksen, T.N., Longenecker, B.M., Pazderka, F., Gilmour, D.G. and Ruth, R.F. (1977) A T-cell antigen system of chickens: Ly-4 and Marek's disease. Immunogenetics, 5: 535-552

86

Chapter 4

Gimeno, I. M. (2004) Future strategies for controlling Marek's disease. Marek's disease: In: Marek's disease: an evolving problem. F. Davison and V. Nair, eds. Elsevier, London, UK, pp. 186-199 Hansen, M.P., van Zandt, J.N., and Law, G.R.J. (1967) Differences in susceptibility to Marek's disease in chickens carrying two different B locus blood group alleles. Poultry Sci., 46: 1268 Hintze, J. (2004) NCSS and Pass. Number Cruncher Statistical Systems. Kaysville, Utaj. www.NCSS.com Kaiser, P., Poh, T.Y , Rothwell, L.S., and Avery, A. (2005) A genomic analysis of chicken cytokines and chemokines. J. Interferon & Cytikine Res., 25: 467-484 Kaufman, J., and Salomonsen, J. (1997) The "minimal essential MHC" revisited: both peptide-binding and cell surface expression level of MHC Molecules are polymorphisms selected by pathogens in chickens. Hereditas, 127: 67-73 Kaufman, J.F. and Venugopal, K. (1998) The importance of MHC for Rous sarcoma virus and Marek's disease virus - some Payne - full considerations. Avian Pathol., 27: S 82-87 Keller L.H. and Sevoian M. (1983) Studies of histocompactibility and immune response of chickens selected for resistance and susceptibility to Marek's disease. Avian Dis., 27: 7-20 Kuhnlein, U., Spencer, J.L., Chan, M., Praslickova, D., Linher, K., Kulenkamp, A. and Ansah, G. (2006) Relationship between Marek's disease and the time course of viral genome proliferation in feather Tips. Avian Dis., 50: 173-178 Kuhnlein, U., Ni L., Weigend, N.L.S., Gavora J.S., Fairfull W. and Zadworny D (1997) DNA polymorphisms in the chicken growth hormone gene: response to selection for disease resistance and association with egg production. Anim. Genet., 28: 116123 Kuhnlein, U., Aggrey, S.E. and Zadworny,D. (2003) Progress and prospects in resistance to disease. In: Poultry genetics, breeding and biotechnology. W. M. Muir and S.E. aggrey, eds. CABI Publishing, Wallingford, UK, pp. 283-292

87

Chapter 4

Li, S., Zadworay, D., Aggrey, S.E. and Kiihnlein ,U. (1998) Mitochondrial PEPCK: A highly polymorphic gene with alleles co-selected with Marek's disease resistance in chickens. Anim. Genetics, 29: 395-397 Linher, K., Aggrey, S.E., Spencer, J.L., Zadworny, D. and Kiihnlein, U. (2000) Effect of selection for markers in the growth hormone and growth hormone on early viremia in chickens infected with Marek's disease virus. In: Proceedings of the v6th international symposium on Marek's disease. Montreal, pp. 80-85 Liu, H.C., Kung, H.J., Fulton, J.E., Morgan, R.W. and Cheng, H.H. (2001) Growth hormone interacts with the Marek's disease virus SORF2 protein and is associated with disease resistance in chicken. Proc. Natl. Acad. Sci. USA, 98: 9203-9208 Masilamani T.J. (2003) Identification of genetic markers associated with Marek's disease in chickens. M.Sc. Thesis. McGill University Morrow, C. and Fehler, F. (2004) Marek's disease: a worldwide problem. In: Marek's disease: an evolving problem. F. Davison and V. Nair, eds. Elsevier, London, UK, pp. 49-61 Stone, H.A. (1975) Use of Highly inbred chickens in research. U. S. Department of Agriculture, ARS, Washington DC, Technician Bulletin, 1514: 1-22 Thoday, J.M. (1961) Location of polygenes. Nature, 191: 363-370 Vallejo, R. L., Bacon, L.D., Liu, H.C., Witter, R.L., Groenen, M.A., Hillel, J. and Cheng, H.H. (1998) Genetic mapping of quantitative trait loci affecting susceptibility to Marek's disease virus induced tumors in F2 intercross chickens. Genetics, 148: 349-360 Williams, I. R. (2006) CCR6 and CCL20: partners in intestinal immunity and lymphorganogenesis. Ann. N.Y. Acad. Sci., 1072: 52-61 Yonash, N., Bacon, L.D., Witter, R.L. and Cheng, H.H. (1999) Higher resolution

mapping and identification of quantitative trait loci (QTL) affecting susceptibility to Marek's disease. Anim. Genet., 30: 126-135 Zelnik, V. (2004) Diagnosis of Marek's disease. In: Marek's disease: an evolving problem. F. Davison and V. Nair, eds. Elsevier, London, UK, pp. 156-167

88

Chapter 5

CONNECTIVE STATEMENT III In the first manuscript of this thesis we found that one of three markers in the vitamin D receptor gene was associated with the expression of the MHC class II antigen on peripheral blood leukocytes. In this manuscript we used the database for MD susceptibility that we had described in the previous chapter to analyze whether the three markers in the VDR gene were associated with MD resistance. Only the marker that had been found to be associated with MHC class II expression levels was associated with resistance. It indicates that MHC class II expression may be the link between vitamin D metabolism and MD resistance.

89

Chapter 5

CHAPTER 5

Association of a marker in the Vitamin D receptor gene with Marek's disease resistance in poultry

Dana Praslickova1, Shayan Sharif2, Aimie J. Sarson2, Mohamed Faizal Abdul-Careem2, David Zadworny , Al Kulenkamp , George Ansah and Urs Kuhnlein

Dept. of Animal Science, McGill University, 21111 Lakeshore Rd., Ste. Anne de

Bellevue, Qc, Canada, H9X3V9


2

Department of Pathobiology, Ontario Veterinary College, University of Guelph, Guelph,

On, Canada, NIG 2W1


3

Shaver Poultry Breeding Farms Ltd., 500 Franklin Boulevard, Cambridge, On, Canada,

N1R 8G6

Corresponding author: Urs Kuhnlein Tel: (514) 398 7799 Fax:(514)398 7964 e-mail: urs.Kuhnlein@mcgill.ca

90

Chapter 5

5.1 ABSTRACT A genetic marker in the vitamin D receptor gene that had previously been associated with changes in the proportion of MHC class II antigen positive peripheral blood cells (PBC) was analyzed for association with Marek's disease resistance. The database consisted of 400 commercial White Leghorn chickens that were vaccinated with herpes turkey virus and challenged by intraperitoneal injection of the virulent Marek's disease virus (MD) RB1B. Viral proliferation in feather tips was determined at weekly intervals for eight weeks, mortality was recorded and necropsy analyses preformed in all chickens. The marker had an additive effect on viral load (integration of the viral titer over time) (P=3xl0~3) with the two homozygotes differing by a factor of 2. Consistent with resistance to MD, the genotype with the lowest viral load also had the lowest score for MD lesions and the lowest mortality. There was no effect on the tissue distribution of MD lesions. The genotype associated with the highest proportion of MHC class II positive PBCs was associated with the highest degree of resistance.

Keywords: Vitamin D, vitamin D receptor, viral proliferation, Marek's disease resistance, MHC class II expression

91

Chapter 5

5.2 INTRODUCTION Vitamin D is an essential nutrient that in addition to its classical role in calcium and phosphate metabolism affects the proliferation, differentiation and function of many different cell types, including the cells of the immune system. Epidemiological studies and studies in mice support the importance of Vitamin D in the susceptibility to colorectal cancer (Lamprecht and Lipkin, 2003), autoimmune diseases such as insulin dependent diabetes mellitus (Zella and DeLuca, 2003), multiple sclerosis (Ascherio and Munger, 2007), rheumatoid arthritis (RA) (Cantorna, 2000), and Crohn's disease (Simmons et al, 2000). In addition, the vitamin D status is thought to modulate the susceptibility to infectious diseases such as pulmonary tuberculosis (Selvaraj et al, 2003; Wilbur et al, 2006; Liu et al, 2006), influenza (Cannel et al, 2006), hepatitis B virus (Suneetha et al, 2006) and leprosy (Roy et ah, 1999). The association of the vitamin D status with the incidence of autoimmune and infectious diseases in man prompted us to search for variants in genes of the vitamin D metabolism that affect the immune response and disease resistance in chickens. In a previous study (see manuscript #1) we studied genetic variation in three genes of vitamin D metabolism in White Leghorn strain. The three genes analyzed were the vitamin D binding protein (DBP), the vitamin D receptor (VDR) and 25-hydroxyvitamin D-24-hydroxylase (Cyp24). DBP is the main transporter of vitamin D to target cells, VDR is the receptor that mediates the effect of vitamin D on gene transcription and Cyp24 a major regulatory enzyme that inactivates vitamin D by hydroxylation (Dusso et al, 2005; Omdahl et al, 2002). Non-redundant markers in these genes were identified in a non-inbred strain and tested for association with the proportion of peripheral leukocytes classified on the basis of the cell surface markers CD3, CD4, CD8, MHC class II and lyB (manuscript #1). The most significant effect was found for a marker in the VDR that affected the proportion of MHC class II positive cells. MHCII mediates the display of antigens on antigen presenting cells, thus stimulating effector cells of the immune system. MHC class II expression may be an important modulator of MD, since it is up-regulated in various cell types in response to viral infection (Niikura et al, 2007). It prompted us to analyze whether markers of the vitamin D receptor affect MDV proliferation. The database used

92

Chapter 5

to test for such an association was a commercial White Leghorn strain that had been intraperitoneally infected with MDV and has been described previously (manuscript #2). 5.3 MATERIALS AND MEHTODS

5.3.1 Strains of chickens and challenge test We used a database of 400 female commercial White Leghorn chickens from two different populations that had been intraperitoneally infected with MDV. The origin of these two populations and the challenge protocol had been described previously (manuscript #2). Briefly, the first population (S) was generated by mating two lines of chickens that had been selected for markers in the GHR , the GH and the chemokine MIP-3a. Ten sires were mated to ten females each. The second population (U) was the standard commercial cross of the non-selected parental strains used to generate population S. It was generated by pooling semen from 4 males per pool and inseminating 17 females with each semen pool. Two challenge tests were conducted in two hatches spaced three month apart. For the population S the same parents in both hatches. For the generation U different pools of semen were used, but the inseminated females were the same. For the challenge, 100 female chickens of each strain were hatched, vaccinated with HTV, banded, intermingled and transported from the hatchery to the University of Guelph. They were housed intermingled and challenged at 5 days of age.

5.3.2 DNA extraction and viral titration Feather samples were collected from the wings of the chickens on 7, 14, 21, 28, 35, 42, 49, 56 dpi and shipped from the University of Guelph to our laboratory for analysis. Extraction of the DNA from feather tips was carried out using a protocol adapted from Kuhnlein et al. (2006). Feather tips were cut into small pieces with sterile scissors and placed into 1.5 ml tubes containing 400 ul of extraction buffer (2% 2mercaptoethanol, 10 mM Tris HCL at pH 8.0, lOOmM NaCl, 10 mM EDTA at pH 8.0 and 0.5% SDS). After an incubation period of 30 minutes proteinase K (Gibco BRL) was added to a final concentration of 200 (J-g/ml, and the incubation was continued at 50C for 16 hours. DNA was extracted with phenol:chloroform:isoamyl alcohol (25:24:1)
93

Chapter 5

(BioShop), precipitated with an equal volume of ice-cold 100% ethanol and rinsed with 500 ul 70% ethanol. The samples were air-dried and the DNA dissolved in 300 \xl of deionized water. The DNA concentration was measured by spectrophotometry (NanoDrop ND-1000 Spectrophotometer). The samples were diluted to 100 ng/ul and 2ul per each reaction were used in the competitive quantitative polymerase chain reaction (PCR). The competitive PCR to quantitate viral DNA has been described (Kuhnlein et ah, 2006).

5.3.3 Genetic analysis of the VDR gene The VDR gene had been analyzed in strain 7, a non-inbred White Leghorn strain that had been generated by mating 4 North American commercial strains in 1955 and was propagated by pedigreed random mating without selection using 100 sires mated to 2 dams each. Genetic variations were assessed by sequencing two segments of 20 offspring from different sire families. The locations of the two segments and the polymorphisms within the VDR gene are shown in Figure 5.1. The 14 SNP in these two segments required at least 10 taggers for complete characterization of the haplotypes. For budgetary reasons we restricted our analysis to the three taggers VDR S1P4, VDR SI PI 2 and VDR S2P2. The marker VDR S1P4 was associated with variations in the number of peripheral blood cells expressing the MHC class II antigen. These three markers also segregated in the commercial population that was subjected to the challenge test. They were genotyped by the McGill University and Quebec Genome Innovation Center by fluorescence polarization detection of single base extension (FP-SBE) using a Analyst HT reader (Molecular Devices, Sunnyvale, CA) and/or by the GenomeLab SNP Stream Genotyping System (Beckman Coulter ).

5.3.4 Statistical analysis The statistical evaluation and graphical illustration were conducted with the NCSS software (Hintze, 2004). Association analyses were conducted by using general linear model procedures (GLM). Survival and hazard rates were analyzed using the KaplanMeier procedure.

94

Chapter 5

5.4 RESULTS 5.4.1 Association with viral proliferation The time course of viral proliferation in feathertips was bell-shaped with a peak observed at 21 dpi with the on-set of mortality (Kuhnlein et al, 2006). The profiles for the genotypes of the marker VDR S1P4 are shown in Figure 5.2. At each time point the lowest median viral titer was observed for the genotype AA, followed by AG and GG. The profiles for the markers VDR SIP 12 and VDR S2P2 were similar for all genotypes (data not shown). For statistical analysis we summed the weekly viral load prior to the onset of mortality (the viral load to 21 dpi) and to 35 dpi (viral load to 35 dpi). The latter measure includes only the chickens that were still alive at 35 dpi. Significant single variable effects were observed for the VDR S1P4 genotype and the trial (Table 5.1). The interaction term between the population and the trial was also significant as reported previously (manuscript #2). It reflects that the two populations were differentially affected in the two trials. However, the interactions of the VDR genotypes with both trial and population were not significant, indicating that the effects of the VDR genotype were independent of the population and trial. The mean viral loads for the different VDR S1P4 genotypes are shown in Table 5.2. A comparison of the means indicates additivity for the VDR locus with the viral load differing between the homozygotes by a factor of 2. The two other markers in the VDR gene, VDR SIP 12 and VDR S2P2 had no effect on the proportion of leukocyte subtypes, and in the previous analysis they also had no significant effect on the viral titer in feather tips (data not shown).

5.4.2 Association with MD lesions, mortality and weight of the bursa Other indicators of MD are the frequency of chickens with MD lesions, the cumulative mortality and the bursa weight. These parameters were not significantly dependent on the VDR S1P4 genotype (Table 5.2). However, the ranking by the three genotypes was consistent with the ranking of the viral titers. The magnitude of the means again indicated an additive effect of the VDR polymorphism.

95

Chapter 5

The frequency of chickens with lesions categorized by tissue is shown in Figure 5.3. For each tissue the frequency of chickens that had lesions was lowest for the genotype AA, followed by genotype AG and GG. Hence, the ranking of the genotypic classes on the basis of the presence of one or more lesions is concordant. The ranking of the tissues by the genotypic classes is also concordant, indicating that the tissue distribution of lesions is not significantly influenced by the VDR receptor genotype. An analysis of the time course of mortality suggests that the VDR S1P4 genotype may affect the time dependence of the rate of mortality (Figure 5.4). In genotype AA chickens the mortality rate peaked at 28 dpi. This peak was shifted by one week in genotype GG chickens. The mortality rate curve in genotype AG chickens was between the curves for the two homozygotes.

5.5 DISCUSSION In the present study we screened a population of 400 White Leghorns chickens for the association of Marek's disease resistance with three polymorphisms in the VDR gene. Only one of the markers, VDR S1P4 that had previously been found to be associated with the frequency of MHC class II positively expressing leukocytes in peripheral blood leukocytes had a significant effect. The effect of this marker on MD resistance was additive, similar to the effect on MHC class II expression that had been measured in a different strain of White Leghorn chickens. MD resistance was assessed using three different indicators, viral titers in feather pulp, survival to 56 dpi, the frequency of MD lesions and the weight of the bursa. A significant effect of the VDR marker VDR S1P4 on MD resistance was only observed for the viral titer in feather tips. However, the other indicators behaved concordantly as expected from the relationship of mortality, frequency of lesions and viral titer in feather tips (manuscript #2). The ranking of the number of lesions on the basis of the three genotypes was the same in each of 8 groups of tissues and was concordant with the effect of VDR S1P4 genotype on the viral titer (AA<AG<GG). Similarly, the ranking of lesions was consistent for each genotype, indicating that there were no tissue specific effects of the VDR genotype on the distribution of lesions.

96

Chapter 5

The VDR may affect the level of cell transformation and of viral proliferation independently. In humans mutations in the VDR gene leading to the hereditary vitamin D resistant rickets (HVDRR), have been shown to be associated with hair-loss (alopecia) (Malloy et al, 1999). Similarly, VDR-null mice display alopecia, presumably due to a defect in keratinocyte stem cell function that is essential for hair follicle homeostasis leading to the absence of the initiation of new hair growth cycles (Clanferroti et al, 2007; Demay et al, 2007). Viral proliferation of MDV in the epithelial cells of feather tips may be dependant on a normal progression of cell differentiation in feather follicles. In particular, the transient viral proliferation we observed in our challenge tests may not reflect the course of the disease, but may be related to the age dependent development of feather follicles. Vitamin D has also antiproliferative actions (Bouillon et al, 2006). VDR-KO mice are more prone to develop tumor when exposed to oncogenes or carcinogens and epidemiological studies indicate that there is an inverse relationship between UV-B exposure and the incidence of colorerectal, breast and prostate cancer. Hence, VDR may affect tumor formation and survival independently of its effect on viral proliferation. Alternatively to a pleiotropic action on several manifestations of MD, l,25(OH)2D may exert its effect on MD via its impact on the immune system. Virus proliferation in feather tips is thought to be mediated by sustained contact of epithelial cells with infected B and T lymphocytes that infiltrate the feather follicles. The infiltration rate and hence the number of infected lymphocytes may therefore be rate limiting for viral titers in feather tips. Cytolytically infected lymphocytes are also the precursors of latently infected B and T cells that may infiltrate different tissues and give rise to the proliferative lesions characteristic of MD. Vitamin D affects many cells of the cognate and innate immune system (Griffin et al, 2003). In general it exerts an inhibitory effect on the immune system by attenuating the differentiation and proliferation of cells of the immune system. Specifically, it has been reported to reduce the surface expression of MHC class II and other co-stimulatory ligands on dendritic cells, and to induce a shift of the immune response of Thl profile to the Th2 profile of the immune system (Chen et al, 2007; Overbergh et al, 2000). The association of autoimmune diseases with vitamin D deficiency is thought to be due to a

97

Chapter 5

relatively high Thl response that leads to the activation of CTLs and subsequent tissue damage. However, an inhibitory effect of l,25(OH)2D on the B-cell maturation, proliferation and IgE production has also been reported (Chen et al, 2007). An example of the effect of vitamin D on the innate immune system is the upregulation of the VDR and vitamin D-l hydroxylase in response to activation of Toll-like receptors, leading to the induction of the antimicrobial peptide cathelicidin (Liu et al, 2006). MD resistance is affected by the innate immune system as well as the Thl and Th2 branches of the cognate immune system (Davison and Kaiser, 2004). A general attenuation of the response of the immune system by vitamin D would be expected to increase the susceptibility to MD. Indeed, most viruses down regulate the immune system as part of their strategy to escape immune surveillance. The most important pathways are the inhibition of the expression of MHC class II genes by blocking the pathway that induces the expression of the MHC class II transactivator and the inhibition of the MHC class II antigen presenting pathway (Hegde et al, 2003). Surprisingly, Marek's disease virus does not subscribe to this strategy. To the contrary, it up-regulates the MHC class II cell surface expression in response to MDV infection, apparently by an INF-y mediated pathway (Niikura et al, 2007; Gimeno et al, 2001). The VDR S1P4 marker that we have found to be associated with MD resistance has previously found to be associated with the proportion of MHC class II expressing cells in peripheral blood leukocyte. Paradoxically, the chickens of the genotype associated with the highest proportion of MHC class II expressing lymphocytes were the most resistant to MD (Figure 5.5). Since the association of the VDR marker with the MHC class II positive peripheral leukocytes, it is expected to reflect the proportion of leukocytes that constitutively express MHC class II antigen. Whether the VDR polymorphism has an effect on the induction of MHC class II antigen expression by viral infection remains to be determined. Further, it has to be considered that our challenge test was conducted in chickens vaccinated with HVT, an attenuated virus of the Mardi virus family. The association of the VDR polymorphism with susceptibility to MD may therefore reflect an effect of VDR on the response to vaccination (Ivanov et al, 2006).

98

Chapter 5

Table 5.1 GLM analysis of the dependence of the integrated viral titers on trial, population and VDR S1P4 genotype. Source Viral load to 21 dpi (log) Mean square3 VDR Population (P) Trial (T) VDRxP VDRxT PxT Residual
a

Viral load to 35 dpi (log) Mean square P-value 2 -10"5 0.40 7 -10"5 0.06 0.96 <10"6

P-value 3 -10"4 0.73 <10'6 0.19 0.20 <10'


6

1.64 0.02 8.80 0.33 0.32 5.49 0.20

2.71 0.18 4.01 0.68 0.01 7.03 0.25

The parameters VDR, P and T and their interactions accounted for 22% of total sum of

squares. VDR alone accounted for 3.7% of the total sum of squares. The parameters VDR, P and T and their interactions accounted for 20% of total sum of squares. VDR alone accounted for 5.6 % of the total sum of squares

99

Chapter 5

Table 5.2 Mean viral load for different VDR S1P4 genotypes VDR S1P4 genotype3 Indicators of MD Viral load to 21 dpib Viral load to 35 dpi Cumulative mortality (%)c Chickens with proliferative lesions (%)c Frequency of proliferative lesions/chicken Bursa weight (g)
c

AA (N=48) 4.69 1.18 5.00 1.21 19.3 27.3 0.473 2.89 0.18

AG(N=175) 6.49 1.09 9.62 1.10 24.5 38.8 0.776 2.80 0.10

GG(N=135) 9.07 .1.10 13.20 1.12 30.6 43.0 0.915 2.70 0.12

The total number of chickens that had been genotyped and assayed is indicated. The mean and standard error were computed from the log transformed values of the sum

of the viral titers measured at 7, 14 and 21 dpi (viral load to 21 dpi) and day 7, 14, 21, 28 and 35 dpi (viral load to 35 dpi). The values indicated were back-transformed.
c

Not significant, but concordant with the ranking by viral load.

100

Chapter 5

Exon 1 Exon 2

Exon 3

Exon 4 Exon 5

Exon 6 Exon 7

-H-

-H
Segment 2

2000bp

0 Segmentl

PI

P2 P3

P4 P5 P7 \ \ , b /P8P9

P10

Pll P12

J
50bp

iL
A
Exon 2 A 5 4 1

snaEXOn6

464 # Exon 7

Figure 5.1 Map of the VDR gene. The arrows indicate the position of the markers VDR S1P4, VDR S1P12 and VDR S2P2 that were analyzed. The association with the viral load was significant for P4 in segment 1.

101

Chapter 5

-AA -AG -GG

14

21 Days post infection

28

Figure 5.2 Time course of viral titers in feather tips for different VDR S1P4 genotypes. The mean viral titers (viral genome equivalent/ cellular genome equivalent) from the population U in trial 1 are plotted for each week post-infection. The profiles for the population U in trial 2 and the population S in both trials were similar, with the genotype AA being associated with the lowest and GG with the highest titers.

102

Chapter 5

40

to

30

IS r\f\

AG GG
20 4

o
'to

5 w c
0) J*

10 4

o O

Spleen

Liver

Muscle

Prov

Ovary

Kidney

Heart

Misc

Figure 5.3 Tissue distribution of proliferative and inflammatory lesions. The bars represent the frequency of chickens that had proliferative lesions in the tissues indicated. The ranking of the tissues by the genotypes was concordant (Kendall coefficient of concordance W=l, P=3T0"5). Similarly, the ranking of the three genotypes by the tissues was significant (W=l, P=0.006).

103

Chapter 5

AA AG GG

15.0 30.0 45.0 Days Post-Infection

60.0

15.0 30.0 45.0 Days Post-Infection

Figure 5.4 Survival and hazard rate for different VDR S1P4 genotypes. The genotypes AA and GG are associated with the lowest and highest viral loads, respectively.

104

Chapter 5

Mortality A Viral load O Lesions/chicken

MHC class II titer (%) Figure 5.5 Relationship between the proportion of MHC class II positive peripheral leukocytes and mortality, the viral load to 21 dpi, and the frequency of lesions/chicken. The values were plotted for each of the genotypes of the three markers in the VDR gene.

105

Chapter 5

5.6 REFERENCES Ascherio, A. and Munger, K.L. (2007) Environmental risk factors for multiple sclerosis. Part II: Noninfectious factors. Ann Neurol., 61: 504-13 Association of vitamin D receptor gene variants of BsmI, Apal and Fokl polymorphisms with susceptibility or resistance to pulmonary tuberculosis. Curr. Science, 12: 1564-1568 Bouillon, R., Eelen, G., Verlinden, L., Mathieu, C , Carmeliet, G., Verstuyf, A. (2006) Vitamin D and cancer. J. Steroid Biochem. Mol. Biol., 102: 156-62 Cannell, J.J., Vieth, R., Umhau, J.C., Holick, M.F., Grant, W.B., Madronich, S., Garland, C.F., Giovannucci, E.(2006) Epidemic influenza and vitamin D. Epidemiol Infect., 134: 1129-40 Cantorna, M.T. (2000) Vitamin D and Autoimmunity: Is Vitamin D Status and Enviromental Factor Affecting Autoimmune Disease Prevalence? P.S.E.B.M., 233: 230-233 Cianferotti, L., Cox, M., Skorija, K., Demay, M.B. (2007) Vitamin D receptor is essential for normal keratinocyte stem cell function. Proc. Natl. Acad. Sci. USA, 104: 9428-33. Chen, S., Sims, G.P., Chen, X.X., Gu, Y.Y., Chen, S. and Lipsky, P.E. (2007) Modulatory effects of 1,25-dihydroxyvitamin D3 on human B cell differentiation. J. Immunol., 179:1634-47 Davison, F. and Kaiser, P. (2004) Immunity to Marek's disease. In: Marek's disease, an evolving problem. F. Davison F. and V. Nair eds. Elsevier Academic Press. Amsterdam, pp. 126-141 Demay, M.B., MacDonald, P.N., Skorija, K., Dowd, D.R., Cianferotti, L. and Cox, M. (2007) Role of the vitamin D receptor in hair follicle biology. J. Steroid Biochem. Mol. Biol, 103:344-346 Dusso, A.S., Brown, A.J. and Slatopolsky, E. (2005) Vitamin D. Am. J. Physiol. Renal. Physiol., 289: F8-F28 Gimeno, I.M., Witter, R.L., Hunt, H.D., Lee, L.F., Reddy, S.M. and Neumann, U. (2001) Marek's disease virus infection in the brain: virus replication, cellular infiltration,

106

Chapter 5

and major histocompatibility complex antigen expression. Vet. Pathol., 38: 491503 Gowe, R.S., Fairfull, R.W., McMillan, I. and Schmidt G.S. (1993) A strategy for maintaining high fertility and hatchability in a multi-trait egg-stock selection program. Poultry Sci., 72: 1433-1488 Hegde, N.R., Chevalier, M.S. and Johnson, D.C. (2003) Viral inhibition of MHC class II antigen presentation. Trends Immunol., 24: 278-85 Griffin, M.D., Xing, N. and Kumar, R.(2003) Vitamin D and its analogs as regulators of immune activation and antigen presentation. Annu. Rev .Nutr., 23: 117-45 Hintze, J. (2004) NCSS and Pass. Number Cruncher Statistical Systems. Kaysville, Utaj. www. NCSS.com. Ivanov, A.P., Dragunsky, E.M., Chumakov, K.M . (2006) 1,25-dihydroxyvitamin d3 enhances systemic and mucosal immune responses to inactivated poliovirus vaccine in mice. J. Infect. Dis., 193: 598-600 Kiihnlein, U., Spencer, J.L., Chan, M., Praslickova, D., Linher, K., Kulenkamp, A. and Ansah, G. (2006) Relationship between Marek's disease and the time course of viral genome proliferation in feather tips. Avian Dis., 50: 173-178 Lamprecht, S.A. and Lipkin, M.(2003) Chemoprevention of colon cancer by calcium, vitamin D and folate: Molecular mechanisms. Nature reviews, 3: 601-614 Liu, P.T, Stenger, S., Li, H., Wenzel, L., Tan, B.H., Krutzik, S.R., Ochoa, M.T., Schauber, J., Wu, K., Meinken, C , Kamen, D.L., Wagner, M., Bals, R., Steinmeyer, A., ZUgel, U., Gallo, R.L., Eisenberg, D., Hewison, M., Hollis, B.W., Adams, J.S., Bloom, B.R. and Modlin, R.L. (2006) Toll-like receptor triggering of a vitamin D-mediated human antimicrobial response. Science, 311: 1770-1773 Malloy, P.J., Pike, J.W. and Feldman, D. (1999) The vitamin D receptor and the syndrome of hereditary 1,25-dihydroxyvitamin D-resistant rickets. Endocr. Rev., 20: 156-88. Niikura, M., Kim, T., Hunt, H.D., Burnside, J., Morgan, R.W., Dodgson, J.B. and Cheng, H.H. (2007) Marek's disease virus up-regulates major histocompatibility complex class II cell surface expression in infected cells. Virology, 359: 212-219

107

Chapter 5

Omdahl, J.L., Morris, H.A. and May, B.K. (2002) Hydroxylase enzymes of the vitamin D pathway: expresion, function, and regulation. Annu. Rew. Nutr. 22: 139-166 Overbergh, L., Decallonne, B., Waer, M., Rutgeerts, O., Valckx, D., Casteels, K.M., Laureys, J., Bouillon, R. and Mathieu, C. (2000) lalpha,25-dihydroxyvitamin D3 induces an autoantigen-specific T-helper 1/T-helper 2 immune shift in NOD mice immunized with GAD65 (p524-543).Diabetes, 49: 1301-1307 Roy, S., Frodsham, A., Saha, B., Hazra, S.K., Mascie-Taylor, C.G. and Hill, A.V. (1999) Association of vitamin D receptor genotype with leprosy. J. Infect. Dis., 179: 187191 Selvaraj, P., Chandra, G., Kurian, S.M., Reetha, A.M. and Narayanan, P.R. (2003) Simmons, J.D., Mullighan, C, Welsh, K.I. and Jewell, D.P. (2000) Vitamin D receptor gene polymorphism: association with Crohn's disease susceptibility. Gut, 47: 211214 Suneetha, P.V., Sarin, S.K., Goyal, A., Kumar, G.T., Shukla, D.K. and Hissar, S. (2006) Association between vitamin D receptor, CCR5, TNF-alpha and TNF-beta gene polymorphisms and HBV infection and severity of liver disease. J. Hepatol. 44: 856-863 Wilbur, A.K., Kubatko, L.S., Hurtado, A.M., Hill, K.R. and Stone, A.C. (2007) Vitamin D receptor gene polymorphisms and susceptibility M. tuberculosis in native Paraguayans. Elsevier Ltd., Tuberculosis 2007 Zella, J.B. and DeLuca F. (2003) Vitamin D and autoimmune diabetes. J. Cell. Biol. 88: 216-222

108

CHAPTER 6 GENERAL CONCLUSIONS

The primary interest of the poultry breeding industry is to develop healthy chickens that can produce eggs and meat economically and in a sustainable fashion. Among the factors that disrupt sustainable production are viral diseases, including Marek's disease, which drives researchers to look for ways to enhance existing control. Viral diseases are not only causing losses due to direct effects, but also because they weaken the immune system and render chickens susceptible to other diseases. An adjunct to vaccination and proper management is the selection for genes that improve the disease resistance. Efforts in the past decade have been focused on identifying such genes. The general approach was to construct a genetic map of the chicken genome and to map loci by conducting segregation analyses. Map construction has culminated in the sequencing of the entire genome. However, identification loci that affect resistance using segregation analysis have to some extent been disappointing. This is mainly due to an unforeseen genetic diversity of the chicken genome, which is still present despite extensive selection since the domestication of the chicken. Our analysis of the VD receptor is a case in point. A second problem is that disease resistance appears to be a quantitative trait, determined by many partially redundant pathways. It is therefore difficult to conduct mapping of loci with sufficient precision to identify genes and to generalize findings from the analysis of inbred lines or families to the population at large. To this one has to add the tremendous costs in whole genome scans. The same is to some extent true in human genetic studies. The paradigm has therefore shifted to analyzing the association between traits and genetic variations in candidate genes, i.e. genes that are thought to be involved in a trait on the basis of their biological properties and gene location (if data is available). It has led to an explosion of data relating genetic variations with human genetic disorders. With the availability of the chicken genomic sequence, the same approach can be applied to chickens. The limited resources available in poultry research require a judiciary approach when selecting candidate genes. One possibility is to concentrate on genes that had preciously associated with disease resistance in human and/or mice studies. The argument

109

is that if genetic variations that affect disease resistance have survived human and/or mouse evolution, they may also have survived evolution of the chicken. We therefore chose to analyze markers in three genes of the vitamin D metabolism. Vitamin D metabolism has been shown to be an important modulator of the innate and cognitive immune system and several of its genes have been shown to be associated with disease resistance in humans. In the first manuscript we identified sequence variations in the three genes of the vitamin D pathway (DBP, VDR, Cyp24), and their association with disease resistance in vaccinated, Strain 7 of White Leghorn chickens. Two randomly selected sections for each of the following genes: DBP, VDR and Cyp24 were sequenced to establish genetic variations and to determine the blocks of the co-segregating SNPs. The analysis demonstrated the high degree of genetic variability still present in White Leghorn chickens despite the high degree of selection. Of particular interest is the VDR gene that, similar to the human gene, shows a low degree of linkage disequilibrium between markers, indicative of a high degree of historical recombination. Two to three non redundant markers in each gene were analyzed for associations with peripheral blood mononuclear cells (PBMC). There was significant association between a marker in the VDR gene and a marker in the DBP gene and the proportion the MHC class II and TCR1 positive cells, respectively. None of these markers affected egg production traits. There was significant interaction between markers, indicating that they are part of the same pathway. In the second manuscript we conducted DNA based selection for RFLP markers in the GHR, GH1, and MIP-3a. These markers were chosen as candidate genes on the basis of their function and/or co-selection with selection for resistance to MD virus. Marker assisted selection, apart from selection for MHC class II haplotypes, has not yet been conducted in poultry. Besides testing the usefulness of a putative resistance marker in breeding, it provides us with a database for future marker identification. Two populations were created, a selected population and a non-selected control population. The challenge was conducted in two hatches, three months apart. The strain to develop the selected and non-selected population was a commercial White Leghorn strain and was vaccinated to mimic normal commercial conditions. As an endpoint of resistance

110

we measured a series of parameters that included the viral load in feather tips, the survival, the frequency of MDV induced tumors and the atrophy of the bursa. The outcome was clear. In the first trial the selected population was more resistant than the non-selected population, indicating that the marker based selection for resistance was successful. In the second trial the outcome was reversed with the same clarity. What went wrong? The chickens were hatched and vaccinated at Shaver Poultry Farms Ltd., a company that has developed and marketed poultry strains since many years. The chickens in each of the two trials were intermingled immediately after hatch and the parents showed no signs of ill health or reduced production. Necropsy indicated that the course of the disease differed in the two trials. Specifically, the tissue distribution of the MD lesions in the two trials differed significantly. Every living organism can develop different manifestations of the disease with different magnitudes of infection. This depends on the virulence of the virus, the quality of the vaccine batch, the environment, the genetic background, the parental age, the body condition and the infection by other pathogen. During trial 1, nine of the S and eight of the U chickens died before or within 48 hours post infection. The necropsy analysis indicated septicemia and tissue swabs confirmed the presence of infection with Escherichia coli sensitive to apramycin. The chickens were therefore immediately treated with apramycin. In trial 2, ascites and airsaculitis were observed in two chickens from each group; these chickens died within 2 1 - 2 5 dpi. Again apramycin treatment was commenced, but Escherichia coli was not detected. The comparison of the selected and non-selected population in two trials revealed contradicting results, both at a high level of significance. It may reflect that in one of the trials the two populations were exposed to different extraneous factors or that the two populations differed in their response to a common factor, reflecting a destabilizing effect of selection. Although we cannot distinguish between these two possibilities, our results indicate that it is important to test the effect of marker assisted selection under a variety of conditions before applying it at the industrial level. The challenge experiment provided us with an excellent database consisting of two populations tested for resistance to MD in two different trials. We used this database to test whether or not the marker genotypes of the vitamin D receptor gene that we had

111

analyzed in the first chapter were associated with MD resistance. Among the three markers only the one that had been found to affect the proportion of peripheral blood leukocytes expressing the MHC class II antigen was found to be associated with MD resistance. The marker associated with the presence of high levels of MHC class II expressing cells was associated with high resistance to MDV. It consistently reduced the viral load, mortality, lesion frequency and bursal atrophy independent of population and trial. Hence, selection for this marker may lead to a reproducible improvement of MD resistance. In summary, we showed that genetic variance in the genes used in our study have an effect on the susceptibility of chickens to MDV. By having built a valuable database of the DNA from two, vaccinated, and challenged populations, we have created a possibility not only to study the effect of the genetic markers that were used for the selection, but also to look for new candidate genes to be used for future selections.

112

APPENDIX

113