Practice Questions for Cancer and Technique Presentations April 2009

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) Which cellular component is most likely coded for by proto-oncogenes? A) signal transduction proteins B) histone proteins C) mitochondrial proteins D) ribosomal proteins E) nuclear membrane proteins 2) p53 can be best classified as A) a tummor suppressor gene 1)

B) an oncogene

2)

3) A study of malignant neoplasms reveals that some of them have a greater potential for invasion and metastases. Analysis of the cells of cancers that have metastasized reveals a mutation which results in decreased cell surface expression of E-cadherin. Which of the following genes is most likely mutated to produce these findings? A) Beta-catenin B) Ras C) BRCA-2 D) Rb E) Cyclin D 4) 5'-ACG_____-3' is half of a palindromic restriction site. What is the complete sequence? A) 5'-ACGCGT-3' B) 5'-ACGACG-3' C) 5'-ACGTGC-3' D) 5'-ACGGCA-3' 5) Identify the appropriate chromosomal transloction that is most frequently found with Chronic myelogenous leukemia A) t(8;14)(q24;q32) B) t(14;18) (q32;q21) C) t(11;14)(q13;q32) D) t(9;22) (q34;q11) 6) A 28-year-old woman goes to her physician for a routine examination. She is sexually active. Pelvic examination reveals no abnormalities. A Pap smear is obtained. The cytopathology report indicates the presence of severely dysplastic cells. A biopsy of the cervix is performed, and on microscopic examination shows cervical intraepithelial neoplasia III (CIN III). Infection with which of the following organisms is most likely to cause her disease? A) Epstein-Barr virus B) Herpes simplex virus infection C) Human papillomavirus 7) The sputum (fluid coughed up from the lungs) of many smokers contain cells with mutations (errors) in the genes for p53. The smoking induced mutations appear to be an early signal showing that cancer of the lungs will follow. What is the likely relationship between early p53 mutation and the development of lung cancer? A) Mutations in p53 would prevent abnormal cells from dying by apoptosis. B) Mutant p53 triggers the M phase of the cell cycle leading to abnormal cell division C) p53 causes a cell to enter G2, blocking cell division. D) p53 with a mutation directly stimulates the growth of cancer cells.

3)

4)

5)

6)

7)

8) What method is employed to verify the transcript size of a gene? A) Allele-specific oligonucleotide (ASO) hybridization B) Polymerase chain reaction C) Southern blot analysis D) Western blot analysis E) Northern blot analysis 9) Southern Blotting is a technique that: A) Uses antibodies to detect proteins B) Sorts RNA molecules by size C) Uses lectins to detect carbohydrates D) Uses DNA probes to detect DNA fragments 10) Identify the appropriate chromosomal transloction that is most frequently found with Follicular B-cell lymphoma. A) t(8;14)(q24;q32) B) t(9;22) (q34;q11) C) t(14;18) (q32;q21) D) t(11;14) (q13;q32) 11) A loss of heterozygosity in a cell that gives rise to a tumor A) Refers to activation of an oncogene B) Refers to loss of hybrid vigor C) Refers to homozygous presence of a mutant allele in tumor cells that is heterozygous in normal cells D) Refers to uniparental disomy E) Refers to the loss of mis-match repair in DNA 12) You have referred one of your patients to an oncologist because of a breast tumor.The oncologist decides to treat the patient with a combination of 5-fluorouracil and Taxol. The mechanism of action of the antitumor drug Taxol involves A) Binding to intermediate filament dimers B) Specific binding to actin filaments C) Interference with the folic acid pathway D) Alkylation of DNA E) Stabilization of microtubules

8)

9)

10)

11)

12)

13) A husband (H2) knows that his wife (W2) had an affair with her best friend's husband (H1). Husband (H2) fears that he might not be the biological father of their 7-month-old child (C2). Restriction fragment length polymorphism (RFLP) analysis is performed on DNA samples from the two couples and from their two children (each couple has one child). The results are shown below. Which conclusion can be drawn from these results?

13)

A) Husband 1 is the father of child 1 B) Husband 2 is the father of child 2 C) Husband 1 is the father of child 2 D) Husband 1 is the father of both children E) Husband 2 is father of child 1 14) Many different classes of drugs are used as anti-tumor agents. The rationale for each different drug takes advantage of a particular property of tumor cells compared to normal cells. Recently, inhibition of angiogenesis has become an important potential avenue of cancer chemotherapy. Inhibition of angiogenesis could result in inhibiting tumor growth by blocking A) metastasis directly B) new blood vessel formation C) telomerase activity D) tumor cell proliferation directly E) stimulation of the immune system 15) A polymerase chain reaction can increase the sensitivity of certain genetic tests. Which of the following characteristics applies to polymerase chain reaction? A) Multiple cycles lead to the rapid linear amplification of the DNA B) Addition of a heat-resistant restriction endonuclease is required C) The DNA to be amplified is denatured in the presence of an equimolar ratio of primers D) The sequence of the segment of DNA to which the primers will bind must be known 16) Identify the gatekeeper gene: A) Rb B) PMS2 14)

15)

C) MLH1

D) MSH2

16)

17) A woman was diagnosed with breast cancer at the age of 40. Her father had breast cancer and her paternal grandmother had ovarian cancer. Which gene is most likely to be mutated in affected members of the family? A) APC B) BRCA2 C) PTEN D) FAS E) MSH2 18) A 26-year-old female is found positive for occult blood in her stool sample. A colonoscopy is performed. It shows numerous polyps, numbering well over 200, ranging in size from 1-5 cms. One polyp is resected. Histologically, the polyp shows the features of tubular adenoma. There is no invasion. Molecular analysis of patient's fibroblasts show mutation in APC gene. The most likely diagnosis in this case is A) Hereditary nonpolyposis colon cancer B) Familial gastric cancer C) Familial adenomatous polyposis D) Melanoma E) Peutz-Jeghers 19) A particular RFLP is diagrammed below. 'E' represents invariant EcoRI restriction sites. '*' represents polymorphic EcoRI sites. The dark box represents the location of a particular DNA probe 'A'. What are all the possible alleles (i.e. size of bands) seen on a Southern blot probed with 'A'?

17)

18)

19)

A) 1 kb, 2 kb, 3 kb, 4 kb and 6 kb B) 3 kb, 4 kb, 6 kb C) 2 kb, 3 kb and 6 kb D) 1 kb, 3 kb, 4 kb and 6 kb E) 1 kb 20) In the Sanger method of DNA sequencing, incorporation of the nucleotides stops because A) the dideoxynucleotide analogs have no 2'-OH group to continue DNA synthesis. B) the dideoxynucleotide analogs have no 5'-OH group to continue DNA synthesis. C) the dideoxynucleotide analogs are in greater concentration than the actual nucleotides. D) the mixture is heated to 92C to stop DNA synthesis at specific time intervals. E) the dideoxynucleotide analogs have no 3'-OH group to continue DNA synthesis. 21) A collection of plasmids containing foreign DNA fragments representing the entire genome of an organism is called a(n) A) cDNA B) clone C) vector D) library E) transgenic 20)

21)

22) Spinobulbar muscular atrophy (SMA) is an X-linked recessive motor neuron disease, arising from a mutation in the androgen receptor gene. The normal allele of the gene has 10 adjacent glutamine codons (CAG) in exon 1, whereas the SMA allele has 40 of these CAG repeats in the same region (a mutation referred to as triplet repeat expansion). The most appropriate DNA-based test to detect this mutation would utilize PCR primers: A) Flanking the CAG repeat followed by a dot-blot using a CAG repeat-specific DNA probe B) Complementary to the CAG repeat followed by a dot-blot using a CAG repeat-specific DNA probe C) Flanking the CAG repeat followed by a Southern blot using a CAG repeat-specific DNA probe D) Complementary to the CAG repeat followed by a Southern blot using a CAG repeat-specific DNA probe. 23) Identify the caretaker gene: A) BRCA1 B) Rb

22)

C) NF1

D) p53

E) MSH2

23)

24) A patient has a disorder that is inherited as a dominant trait. Penetrance is incomplete. The doctor discovers that the disease is caused by a mutation in a tumor suppressor gene. The gene mutated regulates G1 to S phase transition. What disorder does this patient have? A) Familial Breast Cancer B) Cowden syndrome C) Retinoblastoma D) Neurofibromatosis Type 1 E) Li-Fraumeni Syndrome 25) A 40-year-old male has started to notice he is becoming easily fatigued and frequently feels weak. He has experienced weight loss as well. He sees his family doctor. Extensive history, physical, and laboratory work is done. He is found to have the Philadelphia chromosome. What is the most likely diagnosis? A) Chronic myelogenous leukemia B) Follicular B-cell lymphoma C) Cowden syndrome D) Burkitt's lymphoma E) Wilm's tumor 26) Which of the following sequences is recognized and cleaved by the restriction enzyme EcoR I? A) 5'-CACACA-3' B) 5'-CGCGAA-3' C) 5'-CCTTAA-3' D) 5'-CGTGAA-3' E) 5'-GAATTC-3' 27) A proto-oncogene may be activated by any of the following mechanisms EXCEPT A) point mutation B) chromosome rearrangement C) placing it under the control of another promoter D) deletion E) amplification

24)

25)

26)

27)

28) Marked microsatellite instability is a feature of: A) Familial adenomatous polyposis. B) Von Hippel-Lindau C) Hereditary non-polyposis colon cancer (HNPCC). D) Neurofibromatosis 1. E) Multiple endocrine adenomatosis type 2. 29) Western Blotting is a technique that: A) Sorts DNA fragments by size B) Uses antibodies to detect proteins C) Uses DNA probes to detect DNA fragments D) Uses DNA probes to detect RNA fragments 30) Dideoxynucleotides, such as dideoxycytidine and dideoxyinosine, directly inhibit A) cDNA synthesis B) mRNA synthesis C) poliovirus genomic replication D) tRNA synthesis E) rabies virus genomic replication 31) A cell culture of a tumor biopsy is suspected of containing a ras oncogene. Which of the following proteins should an analyed to confirm this diagnosis? (What type of protein is ras?) A) Nuclear transcription factor B) Cyclin C) Growth factor receptor D) Growth factor E) G protein 32) Which primers will amplify my favorite gene if it is in the context below? 5'-GGTACAGTC-MY FAVORITE GENE-CTAGATCAT-3' A) 5'-GGTACAGTC-3' and 5'-CTAGATCAT-3' B) 5'-GACTGTACC-3' and 5'-CTAGATCAT-3' C) 5'-GGTACAGTC-3' and 5'-ATGATCTAG-3' D) 5'-GACTGTACC-3' and 5'-ATGATCTAG-3' E) 5'-GGTACAGTC-3' and 5'-GACTGTACC-3' 33) Tumors originating in the mesenchymal tissue, such as bone muscle or connective tissue are referred to as: A) Sarcomas B) Lymphomas C) Carcinomas D) Leukemias 34) Which of the following vectors can accept the largest DNA fragments in cloning experiments? A) Bacteriophage lambda B) Cosmids C) Plasmid D) Phage P1 E) YACs

28)

29)

30)

31)

32)

33)

34)

35) The mold Aspergillus flavus oryzae produces aflatoxin B1, one of the most potent carcinogenic compounds known. What form of cancer is linked to dietary exposure of aflatoxin B1 from Aspergillus flavus growing on grains and nuts in tropical climates? A) Autoimmune lymphoproliferative syndrome B) Burkitt lymphoma C) Nonpolyposis colon cancer D) Hepatocellular carcinoma E) Wilms' tumor 36) Chromosome abnormalities that develop in association with neoplasms often involve all of the following EXCEPT A) oncogene activation B) clonal evolution C) loss of tumor suppressor genes D) transmission to the offspring of an affected individual 37) Which of the following enzymes synthesizes DNA from a single-stranded RNA template? A) Endonuclease B) DNA polymerase C) Reverse transcriptase D) Ligase E) RNA polymerase 38) The rate at which a DNA fragment moves in an electrophoretic gel is primarily a function of the fragment's A) degree of methylation B) adenine content C) radioactivity D) double helical structure E) length 39) Cancer cells undergo many phenotypic and genetic changes compared to their normal counterparts. Immortalization of cells is specifically associated with the tumor cell phenotype. A specific enzyme, telomerase, has been shown to be involved in this immortalization. The enzyme telomerase has catalytic properties similar to the enzyme A) DNA polymerase B) Reverse transcriptase C) Restriction endonuclease D) Topoisomerase E) DNA methylase 40) Breast cancer caused by mutations in the BRCA1 gene is characterized by: A) relatively early age of onset of the disease B) increased incidence of breast cancer in males C) increased risk of ovarian cancer D) increased risk of small cell lung cancer E) Both (A) and (C)

35)

36)

37)

38)

39)

40)

41) A renal transplantation patient returns for followup renal biopsy. The medical team wishes to conduct gene expression analysis of the biopsy specimen. Which process do they use? A) Linkage analysis B) DNA sequencing C) DNA microarray analysis D) Polymerase chain reaction E) Comparative genomic hybridization 42) Evidence that the development of malignancy is a multistep process includes A) the occurrence of retinoblastoma at a younger age when the disease is sporadic rather than when it is inherited B) the observation that certain tumor suppressor genes and oncogenes are involved in a sequential manner in the development of colon cancer C) the fact that c-oncogenes are widely conserved through evolution D) the observation that normal tissues are usually of clonal origin, whereas, adjacent tumor tissue develops from multiple progenitor cells E) the development of neoplasia as a result of activation of a single oncogene by any of a variety of different mechanisms 43) A gene product thought to be involved in the down-regulation of fetal hemoglobin expression is being investigated. Samples of primary tissue cultures of fetal, neonatal, and adult liver and bone marrow, as well as adequate amounts of a DNA probe believed to contain the studied gene, are provided. The best method for determining which of the tissue culture samples expresses the studied gene is A) DNA sequencing B) Southern Blot C) Western Blot D) Polymerase chain reaction (PCR) E) Northern Blot 44) Metastasis involves: A) adding telomeres to the center of the chromosomes B) the ability of cancer cells to enter body fluids (blood) and travel to distant sites, where they may form tumors C) the need for a surface in order to proliferate and survive D) the tendency to grow in a confined local area E) increased normal cellular differentiation of the primary tumor 45) A 28-year-old woman and a 25-year-old man present for genetic counseling. Both are white and have one sibling affected with cystic fibrosis. The most appropriate method to assess the risk of transmitting cystic fibrosis to a potential child would be A) Karyotype analysis B) Western Blot C) Biochemical testing D) Fluorescence in situ hybridization (FISH) E) Polymerase chain reaction (PCR)

41)

42)

43)

44)

45)

46) You have just started a rotation in a genetics lab focused on screening DNA samples from patients of Eastern European Jewish decent for the most common mutation in the Hexosaminidase A gene. The most common mutation in this population is a four base pair insertion which causes a frameshift (see sequences below). The mutation can easily be detected by PCR amplification followed by gel electrophoresis. You need to design PCR primers to selectively amplify this region of the Hexosaminidase A gene to detect the insertion. Wild Type: 5'-CTGCCCCCTGGTACCTGAACCGTATATCCTATGGCCCTGACTGGAAGGATTTCTACGTAG -3'
4 Base pair frameshift mutation (underlined and bold): 5'-CTGCCCCCTGGTACCTGAACCGTATATCTATCCTATGGCCCTGACTGGAAGGATTTCTAC GTAG-3' Which pair of primers should you use for PCR amplification of this region? A) 5'-GACGGGGGACCATGGACTTG-3' and 5'-CTGGAAGGATTTCTACGTAG-3' B) 5'-GTTCAGGTACCAGGGGGCAG-3' and 5'-CTGGAAGGATTTCTACGTAG-3' C) 5'-CTGCCCCCTGGTACCTGAAC-3' and 5'-CTACGTAGAAATCCTTCCAG-3' D) 5'-CTGCCCCCTGGTACCTGAAC-3' and 5'-CTGGAAGGATTTCTACGTAG-3' E) 5'-GTTCAGGTACCAGGGGGCAG-3' and 5'-CTACGTAGAAATCCTTCCAG-3'

46)

47) Which of the following best describes the "soil and seed" hypothesis? A) the method in which blood transports cancerous cells B) the method in which some tissues provide optimal growth conditions for cancerous cell metastasis C) a description of the spread of malignant tumors through the lymph system 48) This technique is used usually to detect an allelic version that is a common cause of the disease and results from a point mutation in the gene. What is the method? A) Northern blot analysis B) Allele-specific oligonucleotide (ASO) hybridization C) Western blot analysis D) Polymerase chain reaction E) Southern blot analysis 49) A 30-year-old woman is diagnosed with cervical intraepithelial neoplasia with a previous viral infection. Which of the following viral products is (are) implicated in producing this type of dysplasia? A) EBNA proteins B) Large tumor antigen C) E6 and E7 proteins D) E1A and E1B proteins 50) The Ames test is a screening test used to predict whether a chemical is likely to cause __________ in human cells. A) recombination B) cancer C) resistance to antibiotics D) auxotrophic mutations

47)

48)

49)

50)

51) A 45-year-old male patient previously treated for colon cancer, was recently diagnosed with metasized tumors in his liver. Which drug can he take that will selectively interfere with angiogenesis by targeting VEGF? A) Interleukin-2 B) Herceptin C) Avastin D) Fluorouracil E) Gleevec 52) N-myc can be best classified as A) a tummor suppressor gene

51)

B) an oncogene

52)

53) Which of the following disorders involve an altered interaction of gene product with beta-catenin? A) Sickle-cell disease B) Tay-Sachs disease C) Alpha-1 antitrypsin deficiency D) Familial adenomatous polyposis coli E) Obesity 54) The characteristic translocation in Burkitt lymphoma A) involves the abl oncogene and bcr (break cluster region) B) involves the myc oncogene and an immunoglobulin locus. C) is t(8;22) D) involves the ras oncogene and bcr (break cluster region) E) is t(9;22) 55) Which of the following inducers of angiogenesis is both an endothelial mitogen and an endothelial motogen? A) Transforming growth factor beta B) Vascular endothelial growth factor-A C) Fas ligand D) Platelet-derived endothelial cell growth factor E) Angiogenin 56) Which of the following genes is responsible for Familial Polyposis Coli? A) APC B) BRCA1 C) NF2

53)

54)

55)

D) MLH1

56)

57) Identify the appropriate chromosomal transloction that is most frequently found with Burkitt lymphoma. A) t(11;14) (q13;q32) B) t(14;18) (q32;q21) C) t(9;22) (q34;q11) D) t(8;14)(q24;q32) 58) Restriction enzymes have which one of the following characteristics? They A) can cleave only circular DNA B) cleave different DNA's randomly C) can cleave different DNAs only once D) generate either staggered (sticky) or blunt ends upon cleaving DNA E) can cleave both DNA and RNA

57)

58)

10

59) Which one of the following statements best describes most malignant neoplasms? A) They are due to an inherited mutation of an oncogene B) Most are of multifactorial origin C) They are associated with constitutional chromosomal abnormalities D) They result from activation of tumor suppressor genes E) None of the above 60) Restriction fragment length polymorphisms are caused by variations in A) the methylation pattern of the DNA B) the splicing of mRNA C) which nucleotide changes eliminate restriction sites in the genome D) which the promoter affinities are affected E) amino acid sequences within populations 61) An enzyme used to covalently join DNA segments to form recombinant DNA molecules is called a A) Helicase B) Reverse transcriptase C) Restriction endonuclease D) DNA polymerase E) Ligase 62) DNA fragments migrate in an electric field because DNA molecules A) Are neutral in charge B) Are double stranded C) Are positively charged D) Are negatively charged E) Contain numerous covalent bonds 63) In order for a tumor to grow beyond a certain size, new blood vessels must be formed to provide the tumor cells with the required nutrients. many new antitumor strategies are being developed to try to block the formation of these new blood vessels. The process by which new blood vessels form from existing capillaries is called A) metastasis B) capillophoresis C) differentiation D) angiogenesis E) hematopoiesis 64) Which of the following accounts for the increased risk for skin cancer in patients with Xeroderma Pigmentosum? A) Their cells are deficient in mismatch repair. B) Their cells are deficient in nucleotide excision repair of UV-induced DNA lesions. C) Their cells are deficient in transcription-coupled repair of UV-induced DNA lesions. D) Their cells are sensitive to crosslinking agents. E) They inherit one mutation in a DNA repair gene and there is a high rate of loss of the second copy.

59)

60)

61)

62)

63)

64)

11

65) A researcher is trying to identify a specific protein within a mixture. He subjects the mixture to gel electrophoresis and then transfers the separation to nitrocellulose filters. The filters are incubated with antibody to the specific protein, and the excess antibody is washed off. The antibody-protein complex is then incubated with a radiolabeled protein that binds to the antibody. Autoradiography is performed to detect the presence of the protein. The technique represents A) Northern blotting B) Western blotting C) Southwestern blotting D) Southern blotting 66) Which of the following is true about PTEN Hamartoma Tumor Syndrome? A) The mutation in PTEN prevents PI3 kinase activation B) The mutation in PTEN inhibits its phosphatase activity C) The mutation in PTEN prevents AKT activation D) The mutation in PTEN causes the lipid PIP3 levels to decrease rapidly 67) Recent evidence indicates that there are a number of mechanisms which can transform a normal cell into a cancer cell. Many of these involve genetic mutations leading to altered expression or function of a protein. Proteins can also mutate and lose functions. Among these proteins are a class called tumor suppressor genes. These tumor suppression genes function as inhibitors of A) Protein synthesis B) Cell proliferation C) Retroviral replication D) RNA transcription E) Cellular differentiation 68) Sickle cell anemia is caused by a missense mutation in codon 6 of the -globin gene. Normal allele: 5'- CCT GAG GAG AAG -3' Mutant allele: 5'- CCT GTG GAG AAG -3'
A man with sickle cell disease and his phenotypically normal wife request genetic testing because they are concerned about the risk for their unborn child. DNA samples from the men and the woman and from fetal cells obtained by amniocentesis are analyzed using the PCR to amplify exon 1 of the -globin gene. You need to analyze the amplified material under stringent conditions using allele-specific oligonucleotide probes. Which 12-base oligonucleotide sequence will you most likely use as a specific probe complementary to the coding strand of the sickle cell allele? A) 5'-GGACACCTCTTC-3' B) 5'-CCTCACCTCAGG-3' C) 5'-CCTGTGGAGAAG-3' D) 5'-CTTCTCCACAGG-3' E) 5'-CTTCTCCTCAGG-3'

65)

66)

67)

68)

12

69) Columnar epithelial cells from the colonic mucosa are studied to identify abnormalities in cell signaling pathways. Abnormal epithelial cells from colonic adenocarcinoma are shown to have a mutation that blocks hydrolysis of GTP-bound active RAS. Normal columnar cells have active RAS protein that undergoes hydrolysis to the inactive GDP-bound form. Which of the following signaling pathways is most likely abnormally stimulated in the carcinoma cells? A) Cyclic AMP B) BCR-ABL C) Nf-KB D) MAP kinase E) JAK/STAT 70) The most common genetic change that occurs in the development of tumors is A) inactivation or loss of the p53 gene by somatic mutation B) activation of the c-myc gene by chromosome rearrangement C) inherited inactivation or loss of the p53 gene D) activation of the c-myc gene by somatic mutation E) inherited activation of the c-myc gene 71) Adult glandular tissues, such as those found in the breast, prostate, and intestine, tend to develop cancer more often than certain other tissues like muscle and brain. Why? A) Brain and muscle cells divide more often than glandular cells. B) DNA of brain and muscle cells is more intrinsically resistant to damage. C) Normal glandular cells lack DNA repair systems. D) Normal brain and muscle cells have more DNA repair systems than do glandular cells. E) Glandular cells replicate their DNA more often than do brain and muscle cells. 72) Analysis of a tumor biopsy revealed the absence of any Rb protein. However, genetic analysis of the tumor confirms that the both Rb alleles are normal and are transcriptionally active with normal levels of wild-type mRNA produced. What is the most likely reason that this patient's tumor lacks Rb protein but has normal Rb mRNA levels? A) Overexpression of oncomir miR-106a B) p53 induced gene expression of the p21 inhibitor C) The Rb gene locus at 13q14 is transcriptionally inactivated by spontaneous methylation of the local chromatin D) Decreased expression of oncomir miR-21 E) The histones associated with the Rb gene locus are deacetylated

69)

70)

71)

72)

13