Você está na página 1de 58

Epidemiologia Molecular e Evoluo do Vrus da Bronquite Infecciosa

HELIO JOS MONTASSIER Lababoratrio de Virologia e Imunologia FCAV UNESP - Jaboticabal


unesp

IMUNOVIR

heliojm@fcaqv.unesp.br

INTRODUO

Epidemiologia Molecular de RNA VRUS


Gentica Molecular Clnica e Patologia Pesquisa Epidemiolgica Tradicional

Epidemiologia Molecular
Fundamenta-se ppalte. na anlise das sequncias gnicas (PCR; RTPCR; RFLP; Seq. NCLS)

Auxlio para definir os problemas de sanidade animal e trazer solues para determinada regio

The Central Dogma

Adaptado de:- Computational Aspects in Dengue Vaccine Research, Celia Aurora T. Torres

The Genetic Code

Adaptado de:- Computational Aspects in Dengue Vaccine Research, Celia Aurora T. Torres

Mutaes e o Fluxo da Informao Gentica


Genotyping Mutations
Vertebrate Hosts / DNA Eukariotic / Prokariotic Pathogens

Genotyping Mutations
RNA - Virus

Detection with antibodies, mass spectometry, proteomics

DNA

RNA

PROTEIN

Transcription

Translation

Adaptado de:- Lecture III: Molecular and Genetic Measures, Jan 20, 2009, Joe Wiemels

Como as mutaes e os polimorfismos afetam a funo dos genes e no curso das doenas?
Mutations in GENES can result in altered protein structure and Biological Activities Example of a missense base pair change M P N S G N V ATGTTTAATAGCGGTAATGTT ATGTTTAATAGCAGTAATGTT M P N S S N V
- Protena Parental - Gene Parental - Gene Mutante - Protena Mutante

This is a G->A Single Nucleotide Polymorphism (SNP) which results in a mutation


Adaptado de:- Lecture III: Molecular and Genetic Measures, Jan 20, 2009, Joe Wiemels

From gene sequence to protein function


Function Structure Amino acid sequence
Antigens Enzymes Structural Proteins

Gene sequence

In other words, theoretically, you can surmise the function of proteins from their genetic sequence!de:- Computational Aspects in Dengue Vaccine Research, Celia Aurora T. Torres Adaptado

Epidemiologia Molecular de RNA VRUS

Epidemiologia Molecular de RNA VRUS


1. Tipificao Gentica (Genotipagem) de diferentes estirpes ou isolados virais. 2. Determinar as relaes entre (Sorotipos; Protectotipos) Virais Genotipos e Imunotipos

3. Determinar as relaes entre Genotipos e Patotipos Virais. 4. Detectar a ocorrncia de processos de recombinao gnica 5. Determinar a origem de novos isolados virais. 6. Caracterizar a ocorrncia de processos de seleo purificadora, ou de seleo positiva, nos genes, ou regies gnicas importantes de um patgeno viral. 7. Predizer e/ou determinar a evoluo viral. 8. Conhecer a geo-epidemiologia e a eco-epidemiolgia de gentipos e de fentipos de isolados / estirpes virais.

Epidemiologia Molecular de RNA VRUS


rvore Filogentica Analisa a histria evolutiva de uma dada espcie de vrus

Inferncias da Epidemiologia Molecular

Sntese em rvores ou Dendrogramas

Genealogia revela a histria da segregao do polimorfismo gentico em populaes


(graficamente representada tb. por rvores)

Identificao da ocorrncia de Seleo Purificadora ou de Seleo Positiva

Epidemiologia Molecular de RNA VRUS


A variao nas taxas de substituio de nucleotdeos ao longo do genoma viral pode trazer respostas a uma srie de questes epidemiolgicas: Regies Hipervariveis do genoma viral esto evoluindo mais rapidamente e so mais informativas para estudar a evoluo viral no contexto de um isolado / estirpe, ou ento para identificar a origem de um patgeno viral que est causando ou causou um surto de uma doena infecciosa. Regies mais Conservadas do genoma viral so mais apropriadas para se fazer inferncias filogenticas, ao analisar melhor os genotipos virais dentro de cada espcie ou famlia viral.

Epidemiologia Molecular e Evoluo do Virus da Bronquite Infecciosa

PROPRIEDADES MAIS MARCANTES DO VBI


MUTACO

ALTA CAPACIDADE DE VARIAO GENTICA


RECOMBINAO

ALTA CAPACIDADE DE VARIAO FENOTPICA - Sorotipos (+20) Lee &Jackwood, 2000 - Grande N de Estirpes Variantes Antignicas - Protectotipos Diferentes VARIAO DE PATOTIPOS
-Tropismos Diferentes p/ Tecidos / rgos - Virulncia / Atenuao Diferentes manifestaes clnicas patolgicas da infeco pelo VBI em galinhas, ou frangos de corte, ou at outras sps. de aves (galiformes ou no) por exemplo estirpes patognicas dos tratos respiratrio, genital, ou ainda, nefropatognicas.

VARIAO ANTIGNICA

Epidemiologia / Transmisso do VBI


(VBI)

Gld Harder Gnadas Rins

Traquia Replicao Primria / Doena

Ave doente Rins Tonsila Cecal Ave persistentemente Perodo de infectada Eliminao (VBI)
do VBI???

Transmisso rpida

Aves silvestres infectadas

Ave sadia

DISTRIBUIO DO VRUS DA BRONQUITE INFECCIOSA 2008

CLASSIFICAO DO VRUS DA BRONQUITE INFECCIOSA


Ordem: Nidovirales Famlia: Coronaviridae Gnero: Coronavirus (Grupo 3)

CAVANAGH, 2005)

ORGANIZAO GENMICA E ESTRUTURAL DO VBI 5


UTR

1
S1

2
S2

3 a
E

4 5

6
UTR

1a

Replicase 1b

Ma b b N

3 (A)n

15 16 NSPs Patogenicidade 4 Protenas Estruturais

Tropismo Celular

S Eptopos Acs-VN Eptopos Acs-HI M N E


3a / 3b e 5a / 5b = Protenas Acessrias
Armesto et al., 2009; Ammayappan et al., 2009, Cavanagh, 2007, Lai and Cavanagh, 1997

ORGANIZAO GENMICA E ESTRUTURAL DO VBI

5
UTR

1
S1

2
S2

3 a
E

4 5

1a

Replicase 1b

Ma b b N

3 UTR (A)n

15 Protenas No estruturais so Codificadas pelo Conjunto de Genes da Replicase do VBI e esto relacionados a Patogenicidade Viral.
Ammayappan et al., 2009

SINGULARIDADE NA TRANSCRIO E TRANSLAO DO GENOMA DE CORONAVRUS


Sequncias reconhecidas pela RNA-Pol. Viral p/ fuso da sequncia L com a sequncia IG do RNA subgenmico

(L)
5-

L L
mRNAs

-3

RNA genmico / Polimerase mRNA subgen / S

L L L

mRNA subgen / NS mRNA subgen / NS mRNA subgen / M mRNA subgen / N


(LAI & CAVANAGH, 1997)

subgenmicos

Co-Infeco e Recombinao entre Estirpes do VBI


Estirpe A do VBI de Campo / Vacinal Atenuada Estirpe B do VBI de Campo / Vacinal Atenuada

VBI REC.

MUTAO EM ESTIRPES DO VBI: Stios de Maior Variabilidade e Mais Conservados


1 5 L
S1

2
S2

3 a
E

4 M a

6 3 N

1a

1b 1

b 5 a b

Estirpe-Mutante -1

5 L
S1

2
S2

3 a
E

4 M

6 3 N

1a

1b

Estirpe- Mutante-2

MUTAES EM PONTO, INSERES E DELEES NO GENE DA GLICOPROTENA S1 EM DIFERENTES SOROTIPOS DO VBI - I

Mutaes em Ponto Inseres / Delees Moore et al., 1998

MUTAES EM PONTO, INSERES E DELEES NA GLICOPROTENA S1 EM DIFERENTES SOROTIPOS DO VBI

ANLISE FILOGENTICA DO GENE DA GLICOPROTENA S1 EM DIFERENTES SOROTIPOS DO VBI

Estirpes Americanas

Estirpes Australianas

Estirpes Europias

Estirpes Americanas

(Lee, 2002)

Co-Infeco e Induo da Recombinao entre Estirpes do VBI


Estirpe A de Campo / Vacinal do VBI Estirpe B de Campo / Vacinal do VBI

VBI REC.

RECOMBINAO ENTRE ESTIRPES DO VBI


1 1a 1
S1

5 L 5 L 5 L 5 L 1a 1a 1a

2 1b
S1

3
S2

6 3

S 2

S2

1b 1
S1

S 2
S2

a bE Ma b N Estirpe-P1 3 4 5 6 3 a E Ma b b N
Recomb-1x2

3 a
E

6 3

1b 1
S1

S 2

Ma b b NRecomb-2x1 3 4 5 6
Estirpe-P2

1b

S2

a bE Ma b N

CONSEQUNCIAS DA RECOMBINAO ENTRE ESTIRPES DO VBI


Gene S1 Gene M Gene N

Adaptado de Lee, 2002

Epidemiologia Molecular e Evoluo do Virus da Bronquite Infecciosa no Brasil

Brasil x IBV
Primrdios - I A primeira notificao de isolamento de VBI no Brasil foi em 1957 (Hiplito, 1957). A introduo oficial da vacinao contra BI se deu em 1979 sendo a vacina constituda pelas estirpes H52 e/ou H120, mas os surtos de infeco pelo VBI continuam a ocorrer (Ito, 2006). A maior parte dos isolados de campo brasileiros at o final da dcada de 80 foram classificados como sorotipo Mass (Ito, 2006). A partir da aparecem isolados brasileiros com caractersticas antignicas diferentes do sorotipo Mass.

Brazil x IBV
Tempos + Recentes - II Meados Final dos anos 80 (VBI): Embrapa/CNPSA: isolados brasileiros (*regio Sul do pas) diferentes perfis de reao em prova de soroneutralizao cruzada com relao s estirpes de referncia do VBI. Branden et al (1986): demonstram a presena da amostra Arkansas no Brasil. Problemas crescentes de sintomatologia respiratria. Perodo de 1990 a 1995 (VBI / VBI-Like): 15 isolados de frangos de corte, poedeiras comerciais, reprodutoras e codornas de diferentes regies - diferentes perfis de reao na prova de soroneutralizao cruzada, porm com > similaridades em testes de proteo traqueal. Isolamento e caracterizao de VBI / VBI-Like de galinhas-dangola
(ITO et al, 1991, BYRON, 2002); DI FABIO et al, 2000

Brasil x IBV
Tempos + Recentes - II

Mais recentemente (2000/06), tm sido reportado a presena de um significante nmero de isolados de campo brasileiro do VBI, apresentando diferenas acentuadas nos genes codificadores das protenas estruturais S1, N ou ainda de protenas no estruturais das estirpes vacinais da Amrica, Europa, Australia ou eventualmente estirpes Asiticas, em lotes comerciais.

(Abreu et al., 2006a/b, , Brentano et al., 2006, Montassier et al., 2006, Villarreal et al., 2007a/b).

Anlises filogenticas do Gene S1 de Isolados do VBI de Surtos a Campo no Brasil entre 2002 e 2006 - I

Casos de Enterite

Casos de Orquite
Villarreal et al., 2007 a/b

Anlises filogenticas do Gene N de Isolados do VBI de Surtos a Campo no Brasil entre 1972 e 1989 - II

ABREU et al., 2006,

Presena de Isolados do VBI de Surtos a Campo na Argentina entre 2001 e 2008 filogeneticamente Relacionados com os Isolados variantes Autctones do VBI no Brasil
Argentina

Rimondi et al., 2009

Vias Possveis de Evoluo e Criao de uma Nova Variante (Sorotipo) do VBI


1. Infeco IBV Estirpe Parental / Vacinal IBV Quasiespcie Genoma Predominante IBV Antigenicamente diferente da estirpe parental / vacinal

2. Replicao

IBV Antigenicamente relacionado a estirpe parental / vacinal

3. Evoluo

1- Presso Imune Induzida pela Vacina 2- Co-infeco (Recombinao) 3- Outras restries (gargalos de seleo)

4. Seleo

Seleo Seleo Seleo Recombinao Negativa Purificadora Positiva Vivel

Nova Variante VBI Adaptado de Lee, 2002

Comparao da Evoluo de Duas Estirpes do VBI Submetidas a Diferentes Situaes de Seleo Imune

Estirpe do VBI Presso Imune Tendncia das Mutaes Taxa de Mutao

Estirpe A do VBI Com Vacinao Progressiva e Fixas >>>(1,5% ao ano)

Estirpe B do VBI Sem Vacinao Ao Acaso <<<(0,3 % ao ano)

Adaptado de Lee, 2002

VARIAO GENTICA Coronavrus Avirios (VBI)

MUTAO

RECOMBINAO

ESTIRPE PARENTAL quasispecies genoma predominante

PRESSO SELETIVA Sistema Imune, Cels. Tecidos, Organismos Hospedeiros s Sps.

ESTIRPES VARIANTES

ESTIRPE VIRAL VARIANTE MAIS ADAPTADA GENOMA PREDOMINANTE (Quasi-species)

Isolados Autctones Variantes do VBI no Brasil

Figura 2. Alinhamento mltiplo das seqencias nucleotdicas da poro 5-proximal do gene S1, obtidas de isolados de campo no Brasil, adicionadas das seqencias das estirpes de referncia obtidas de banco de dados genticos. Os resduos de nucleotdeos idnticos so representados por pontos (.) e as posies das delees so representadas por traos (-).

ANLISE DA VARIABILIDADE NUCLEOTDICA NAS SEQENCIAS PARCIAIS DO GENE S1 Mutaes Sinnimas Mutaes No Sinnimas
A
H120 e M41 + 15

B
HVR-1 HVR-2

IBVPR03 IBVPR07 IBVPR08 IBVSC01 IBVSC03 IBVSP01 IBVSP03 IBVSP04

HVR-1

HVR-2

C
IBVPRB01 IBVPR01 IBVPR02 IBVPR05 IBVPR06 IBVSC02 IBVSP02

Figura 3e 4. Variao da diversidade nucleotdica (parmetro Pi) das mutaes no sinnimas e mutaes sinnimas em relao a posio de nucleotdeos da seqencia 5-terminal do gene S1 de trs grupos de estirpes e isolados brasileiros de campo do VBI. (A) seqencias nucleotdicas dos 15 isolados mais as estirpes do gentipo Massachusetts (H120, M41); (B) Oito isolados brasileiros de campo mais relacionados ao gentipo Massachusetts e (C) sete isolados brasileiros de campo com maior variabilidade e menos relacionados ao gentipo Massachusetts.

Montassier et al, 2006; Montassier, 2008

RELAES FILOGENTICAS BASEADAS NAS SEQENCIAS DE NUCLEOTDEOS DA PORO 5-PROXIMAL DO GENE DA GLICOPROTENA S1 DE 15 ISOLADOS BRASILEIROS DO VBI ESTIRPES DE REFERNCIA DO G. BANK
99 99 99 624

IBVSC01-S1-PARC IBVSC03-S1-PARC IBVPR08-S1-PARC IBVPR07-S1-PARC IBVSP01-S1-PARC

RFLP
G1 M41
I =97,96%

Gen. MASS

97

94 57

AY561712-M41-S1-gene IBVSP04-S1-PARC DQ487085-Egypt-F-03-S1-GENE AY561713-Ma5-S1-gene

83 81 98 63 85

IBVSP03-S1-PARC AF352315-H52-S1-gene M21970-H120-s1-gene IBVPR03-S1-PARC L18990-CONN-S1-GENE


99 63 83 76

G2 H120
I =97,69%

Gen. MASS

IBVSC02-S1-PARC AY839144-Jilin-S1-gene IBVSP02-S1-PARC

G3

CONN I =99,44%

Gen. D

DQ458218-AL7149/00-S1-gen AF006624-ARK-DPI-S-1-gene DQ167143CKCHLHN00I-S1-gene IBVPR01-S1-PARC

G4 ARK / CHINA
I =99,5%

99

Gen. A Gen. C

80

99

IBVPR02-S1-PARC IBVPRB01-S1-PARC

1988

99 98 91 99

IBVPR05-S1-PARC IBVPR06-S1-PARC

2001/2006

G5

ISOLADOS - BR*** I =94,27%

Gen. B

DQ448275-BR-USP-10-S1-gene DQ355995-BR-USP-01-S1-gene AY587882-TGEV-HN2002-S-GENE

Montassier et al, 2006; Montassier, 2008

99 99 99 624

IB VS C01-S 1-P A RC IB VS C03-S 1-P A RC IB VP R08-S 1-P A RC IB VP R07-S 1-P A RC IB VS P 01-S 1-P A RC

I =95,98%
35 91 74 99

G1

A Y561712-M 41-S 1-gene IB VS P 04-S 1-P A RC DQ487085-E gy pt-F -03-S 1-GE NE IB VS P 03-S 1-P A RC

99

I =98,15%

98 39 3 86

A Y561713-M a5-S 1-gene A F352315-H52-S 1-gene M 21970-H120-s 1-gene IB VP R03-S 1-P A RC L18990-CONN-S 1-G ENE

G2

G3

I =99,4%
61 34

99 42

IB VS C02-S 1-P A RC A F006624-A RK -DP I-S -1-gene IB VS P 02-S 1-P A RC A Y839144-Jilin-S 1-gene DQ458218-A L7149/00-S 1-gen DQ167143CK CHLHN00I-S 1-gene

I =98,87%

G4

99

69 89 99

IB VP R01-S 1-P A RC IB VP R02-S 1-P A RC IB VP RB 01-S 1-P ARC

I =90,11%

99 91 56 90

IB VP R05-S 1-P A RC IB VP R06-S 1-P A RC DQ448275-B R-US P -10-S1-gene DQ355995-B R-US P -01-S1-gene A Y587882-TGE V -HN2002-S -GENE

G5

A identidade mdia das sequncias de aminocidos dos isolados variantes autctones em relao a das estirpes classificadas nos grupos Mass de 67,4% Montassier et al, 2006; Montassier, 2008

ALINHAMENTO MLTIPLO DAS SEQENCIAS DEDUZIDAS DE AMINOCIDOS DA PORO AMINO-TERMINAL DA GLICOPROTENA S1 DE ISOLADOS DO VBI NO BRASIL
HVR-1 HVR-2

Grupo MASS Grupo CONN Grupo ARK

Grupo Isolados Brasileiros

Mutaes em Ponto Grupo MASS Grupo CONN Grupo ARK Grupo Isolados Brasileiros Inseres / Delees Motifs Caracts. de AAs

Montassier et al, 2006; Montassier, 2008

ANLISE DA ESTRUTURA SECUNDRIA DA GLICOPROTENA S1 DE ISOLADOS DO VBI NO BRASIL

Montassier et al, 2006; Montassier, 2008

PRESENA DE ALTERAES NOS STIOS DE GLICOSILAO DA GLICOPROTENA S1 DE ISOLADOS DO VBI NO BRASIL

H120

H120

IBVPR01 / IBVPRB01 / IBVPR02

IBVSC02

IBVPR05 / IBVPR06 IBVSP02

Montassier et al, 2006; Montassier, 2008

ALTERAES NOS STIOS DE ANTIGENICIDADE NA EXTREMIDADE AMINOTERMINAL DA GLICOPROTENA S1 DE ISOLADOS DO VBI NO BRASIL

> Hidrofilicidade

IBVPR06

H120
IBVPR06

IBVSC02

IBVSP02

H120
IBVPR01

< Hidrofilicidade HVR I Stio Ag VN - D HVR II Stio Ag- VN - E

Montassier et al, 2006; Montassier, 2008

ALINHAMENTO MLTIPLO DAS SEQENCIAS DEDUZIDAS DE AMINOCIDOS DA PORO CARBXI-TERMINAL DA NUCLEOPROTENA N DE ISOLADOS DO VBI NO BRASIL

P/T R/K P/S N/S T/G-A-S e S/N

Figura 12. Alinhamento mltiplo das sequncias de aminocidos da extremidade carbxi-terminal da nucleoprotena N (B), obtidas dos isolados de campo do VBI no Brasil, adicionadas das sequncias das estirpes de referncia provenientess do banco de dados genticos. Os resduos de aminocidos idnticos so representados por (.) e as posies das delees so representadas por traos (-).

ALTERAES NOS STIOS DE ANTIGENICIDADE NA EXTREMIDADE CARBXI-TERMINAL DA NUCLEOPROTENA N DE ISOLADOS DO VBI NO BRASIL

> Hidrofilicidade
IBVPR01 IBVPR05

H120

H120

IBVPR01 IBVPR05

< Hidrofilicidade

Eptopo Linf. B

Eptopo Linf. B

Eptopo CTL (SEO et al., 1997)

Avaliao da especificidade dos fragmentos de anticorpos scFv-N e scFv-S1 anti H120 frente a estirpes homlogas e variantes do VBI
Deteco das estirpes virais do VBI utilizando o framento de anticorpo scFv-N
3 DOs obtidas 2,5 2 1,5 1 0,5 0 Soro policlonal (1:100) scFv-N (1:20) scFv-N (1:40)

02

05

01

12 0

01

M 41

an sa s

PR

PR

PR

IB V

IB V

IB V

IB V

SC

Estirpes avaliadas

Ar k

LC

Deteco das estirpes virais do VBI utilizando o fragmento de anticorpo scFv-S1


2,5 DOs obtidas 2 1,5 1 0,5 0 Soro policlonal (1:100) scFv-S (1:20) scFv-S (1:40)

02

05

01

12 0

01

M 41

an sa s

PR

PR

PR

IB V

IB V

IB V

IB V

SC

Estirpes avaliadas

Figura Reatividade dos fragmentos de anticorpos monoclonais contra a protena N e contra a protena S do VBI com estirpes homlogas e heterlogas nos testes de SELISA.
Caetano et al, 2009

Ar k

LC

OCORRNCIA DE SELEO NAS SEQENCIAS PARCIAIS DO GENE S1 E N DE ISOLADOS DO VBI NO BRASIL G1- Gentipo Massachusetts - H120, H52,M41 e Ma5

G2 - Isolados com maior similaridade -IBVPR03, IBVPR07, IBVPR08, IBVSC01, IBVSC03, IBVSP01, IBVSP03, e IBVSP04. G3 - Isolados com maior variabilidade- IBVPR01, IBVPRB01, IBVPR02, IBVPR05 IBVPR06, IBVSC02 e IBVSP02 Ocorrncia de seleo POSITIVA - dNS>dS PARA O GENE S1 Ocorrncia de seleo DEPURADORA - PARA O GENE N

Teste Z, com nvel de 0,5% de probabilidade, usando o mtodo de Nei-Gojobori integrado ao programa MEGA verso 4 (Tamura et al., 2007).

Aparecimento e Evoluo Novas Variantes do VBI na Argentina e no Brasil

Estirpe do VBI Parental?


???
Variantes Arg. Antigas do VBI ???

Vacinas Atuais Sorotipo Mass Seleo Imune e ??? pouca ou ausente proteo Variantes Br Antigas do cruzada!!!

Estirpe do VBI Parental?


VBI (1988)

???

Variantes Arg. Recentes do VBI (2000)

Variantes Br Recentes do VBI (2000)

?
Variantes Arg. Atuais do VBI

?
Variantes Br Atuais do VBI

Riscos e Custo - Benefcio da Introduo de Novas Vacinas contra a VBI na Argentina e Brasil

Estirpe do VBI Parental???


???
Variantes Arg. Antigas do VBI???

??? Novas Vacinas Estirpes Vacinais Heterlogas Atenuadas Imunidade ??? / Risco de Recombinao???

Estirpe do VBI Parental???


???
Variantes Br Antigas do VBI (1988)

???
Variantes Arg. Recentes do VBI (2000)

?
Variantes Br Recentes do VBI (2000)

?
Variantes Arg. Atuais do VBI

?
Variantes Br Atuais do VBI

PERSPECTIVAS E IMPORTNCIA DE SE CONTINUAR INVESTIGANDO AS NOVAS VARIANTES DO VBI NO BRASIL E SE DEFINIR ESTRATGIAS MAIS EFICIENTES PARA O CONTROLE DESSES NOVOS VRUS

Jang et al, 2007

Dolz et al, 2008

Jackwood et al, 2009

McKinley et al, 2008

COMENTRIOS FINAIS
As ferramentas da Epidemiologia Molecular podem trazer contribuies de grande importncia para a caracterizao gentica e molecular de novos isolados do VBI, bem como para estimar / predizer quais so as consequncias que essas alteraes tero sobre as propriedades fenotpicas, particularmente sobre as propriedades dos antgenos mais relevantes desse vrus (Glicoprotena S1 e a Nucleoprotena N), possibilitando que sejam triadas e selecionadas estirpes virais de referncia com maior potencial de conferir imunidade cruzada em testes de desafio e proteo. No entanto, os testes biolgicos de proteo cruzada no devem ser descartados, pois a avaliao definitiva do estado de imunidade efetiva conferida, deve ser avaliada em testes de proteo em aves SPF vacinadas com a estirpe selecionada e depois desafiadas com o novo isolado do VBI. A introduo de novas estirpes vacinais atenuadas pode compor e direcionar o processo de evoluo viral. A maioria dos novos isolados do VBI no Brasil precisam ter caracterizada a sua patogenicidade em aves, para que se tenha disponvel um inculo viral de desafio para os futuros testes de proteo ao desafio de futuras estirpes candidatas para comporem uma nova vacina.