RESEARCH
Genetic Diversity of a Maize Association
Population with Restricted Phenology
Candice N. Hansey, James M. Johnson, Rajandeep S. Sekhon, Shawn M. Kaeppler, and Natalia de Leon*
ABSTRACT
Association analysis to identify genes and
alleles underlying quantitative genetic variation
is growing in value as the density of genotypic
data increases. Association panels are often
chosen to maximize molecular and pheno-
typic diversity, but traits measured at harvest
require restricted phenology to obtain data on
plants that mature within a comparable interval.
The objective of this study was to characterize
a set of inbred lines that will mature reliably in
the upper midwestern United States for the pur-
pose of assessing traits relevant to grain and
stover yield as well as stover quality. A total of
1411 lines from the North Central Regional Plant
Introduction Station, our program, and contrib-
uted by collaborators were grown in observation
plots. A set of 627 lines were chosen based on
flowering within the desired interval, produc-
tion of viable seed, agronomic suitability, uni-
formity, and pedigree information. Flowering
time ranged from 944 to 1645 growing degree
days (GDD). Genotypic data for the 627 lines
was obtained using a 1536 Illumina Golden-
Gate assay. The panel offers deep replication
of most Midwest dent alleles. There is a lesser
representation of tropical alleles relative to other
association panels but includes some Germ-
plasm Enhancement of Maize (GEM)-derived
lines and early flowering lines of tropical origin.
The information described in this manuscript is
anticipated to facilitate the use of this material
for association genetic studies.
704
Dep. of Agronomy, Univ. of Wisconsin-Madison, Madison, WI 53706.
Received 29 Mar. 2010. *Corresponding author (ndeleongatti@wisc.edu).
Abbreviations: BSSS, Iowa Stiff Stalk Synthetic; GDD, growing degree
days; GEM, Germplasm Enhancement of Maize; LD, linkage disequilib-
rium; MDS, multidimensional scaling; NAM, nested association mapping;
NC7, North Central Regional Plant Introduction Station; NSS, Non-Stiff
Stalk Synthetic; PIC, polymorphism information content; QTL, quan-
titative trait loci; SNP, single nucleotide polymorphism; SSS, Stiff Stalk
Synthetic; UPGMA, unweighted pair group method with arithmetic mean.
G enetic dissection of quantitative traits is important for
improving the efficiency of breeding programs and as a dis-
covery tool to understand basic processes in plant development,
physiology, and biochemistry. Linkage mapping has traditionally
been used to identify quantitative trait loci (QTL) underlying phe-
notypic variation. Recently the use of linkage disequilibrium (LD)
mapping to dissect quantitative traits has dramatically increased.
Linkage disequilibrium mapping may have an advantage over tra-
ditional linkage mapping in increased resolution depending on the
species and population and has the ability to evaluate an array of
alleles in diverse germplasm without the need for structured popu-
lations. Elite breeding materials of many crop species have limited
diversity due to domestication and selection bottlenecks (Yama-
saki et al., 2007). To maximize assessment of allelic diversity, asso-
ciation mapping panels frequently utilize germplasm outside of
these elite materials. Knowledge of alleles from diverse material
associated with important agronomic traits is useful in the pro-
cess of developing improved germplasm. However, as genotypic
data availability increases the distinction between linkage (fam-
ily) and LD (population) mapping will dissolve and high quality
Published in Crop Sci. 51:704–715 (2011).
doi: 10.2135/cropsci2010.03.0178
Published online 10 Jan. 2011.
© Crop Science Society of America | 5585 Guilford Rd., Madison, WI 53711 USA
All rights reserved. No part of this periodical may be reproduced or transmitted in any
form or by any means, electronic or mechanical, including photocopying, recording,
or any information storage and retrieval system, without permission in writing from
the publisher. Permission for printing and for reprinting the material contained herein
has been obtained by the publisher.
WWW.CROPS.ORG CROP SCIENCE, VOL. 51, MARCH– APRIL 2011
phenotypic data on relevant germplasm will be the more
critical considerations (Myles et al., 2009). Technological
advances such as next generation sequencing are making it
possible to obtain large genotypic data sets, which facilitate
high-resolution mapping across diverse genotypes.
Association mapping has been used in various plant
species including barley (Hordeum vulgare L.) (Kraakman et
al., 2006; Stracke et al., 2009), soybean (Glycine max (L.)
Merr.) (Jun et al., 2008; Wang et al., 2008a), wheat (Triticum
aestivum L.) (Breseghello and Sorrells, 2006; Crossa et al.,
2007), sorghum (Sorghum bicolor (L.) Moench) (Casa et al.,
2008, Murray et al., 2009), rice (Oryza sativa L.) (Olsen and
Purugganan, 2002; Bao et al., 2006; Agrama et al., 2007),
sugarcane (Saccharum officinarum L.) (Wei et al., 2006), and
Arabidopsis thaliana (L.) Heynh. (Olsen et al., 2004; Aran-
zana et al., 2005; Ehrenreich et al., 2007; Zhao et al., 2007).
Many successful examples also exist for maize (Zea mays L.).
The first quantitative trait dissected using association map-
ping in maize was flowering time (Thornsberry et al., 2001;
Andersen et al., 2005; Camus-Kulandaivelu et al., 2006;
Salvi et al., 2007; Ducrocq et al., 2008). Beló et al. (2008)
used whole genome association mapping to identify associa-
tion between fatty acid desaturase 2 ( fad2) and increased oleic
acid levels in maize. Wilson et al. (2004) assessed the associ-
ation of genes in the starch biosynthetic pathway with ker-
nel composition and starch pasting properties by evaluating
candidate genes for their association with phenotype. Pres-
soir et al. (2009) employed a combined approach of link-
age analysis and LD methods to determine the importance
of barren inflorescence2 (bif2) in flowering time as well as a
wide range of maize architecture traits. Harjes et al. (2008)
identified the effect of alleles at the lycopene epsilon cyclase
(lcyE) locus on carotenoid accumulation in the endosperm
using a combined approach of linkage mapping and associa-
tion analysis. Szalma et al. (2005) showed that anthocyanin-
less1 (a1) and white pollen1 (whp1) are associated with maysin
synthesis in maize silks and identified epistatic interactions
among the alleles. Zheng et al. (2008) further dissected the
molecular basis of previously identified QTL qHO6 and
demonstrated the association of this QTL to natural varia-
tion in kernel oil and oleic acid content. This extensive list
demonstrates that mining of the genetic diversity in maize
can be accomplished via linkage mapping and association
analysis for many phenotypic traits using different sets of
genetic materials and various statistical approaches.
There are well-described, publicly available resources for
association mapping in maize. Phenotypic and genetic diver-
sity of a diverse set of 302 maize inbred lines was character-
ized (Liu et al., 2003; Flint-Garcia et al., 2005). Later, 25
lines from this set were used to develop a nested association
mapping (NAM) population aimed at maximizing diversity
(McMullen et al., 2009). A set of 375 diverse inbred lines
representing American and European diversity was described
and has been used in subsequent association mapping studies
CROP SCIENCE, VOL. 51, MARCH– APRIL 2011 WWW.CROPS.ORG
(Camus-Kulandaivelu et al., 2006; Ducrocq et al., 2008,
2009). A set of 632 temperate, tropical, and subtropical inbred
lines, and a core set of 60 lines representing 90% of the haplo-
type diversity of the larger set, has been described (Yan et al.,
2009). Wang et al. (2008b) characterized the genetic diver-
sity and LD for a set of 95 diverse Chinese inbred lines. In
another report, Xie et al. (2008) described population struc-
ture, kinship, and LD for a set of 187 Chinese maize inbred
lines. Genetic diversity of CIMMYT maize inbred lines and
open pollinated populations have also been characterized and
have been incorporated into diversity panels (Warburton et
al., 2002; Reif et al., 2004). While these resources capture
genetic variation in maize, adaptation and phenology of the
germplasm was not taken into account. For example, in tem-
perate regions, a significant portion of these diversity panels
will not flower and mature in their testing area thereby limit-
ing the use of these panels. A diversity panel with restricted
phenology that maintains genetic and phenotypic diversity
will allow relevant assessment of phenotypes in short-season
environments. Our objectives were to (i) identify a set of
diverse inbred genotypes that will mature in the upper Mid-
west region of the United States, (ii) evaluate the genetic and
phenotypic diversity in the diversity panel, (iii) determine
population substructure and familial relationships for use in
association mapping, (iv) compare the relationship between
pedigree and genetic relatedness, and (v) demonstrate the
utility of this population for association mapping using the
previously described Vgt1 loci as a proof of concept.
MATERIALS AND METHODS
Germplasm
A total of 1164 inbred lines were provided by Mark Millard at the
North Central Regional Plant Introduction Station (NC7; Iowa
State University, Ames, IA) based on information that they would
be likely to flower in 105 d or less. In addition, inbred lines were pro-
vided by University of Guelph (Dr. Elizabeth Lee, Department of
Plant Agriculture, University of Guelph, Guelph, ON), University
of Delaware (Dr. James Hawk, Plant and Soil Sciences, University
of Delaware, Newark, DE), Iowa State University (Committee for
Agricultural Development and Iowa Crop Improvement Associa-
tion, Iowa State University, Ames, IA), University of Pennsylvania
(John Shaffer, Department of Crop and Soil Sciences, Pennsylvania
State University, University Park, PA), North Carolina State Uni-
versity (Dr. Matthew Krakowsky, ARS Plant Science Research,
North Carolina State University, Raleigh, NC), and developmental
lines from our program at the University of Wisconsin (Dr. Nata-
lia de Leon, Department of Agronomy, University of Wisconsin,
Madison, WI) (Supplemental Table 1). Phenotypic assessment of
these 1411 inbred lines was performed during the summer of 2008
at the West Madison Agricultural Research Station in Madison,
WI. Highly related lines (e.g., single gene introgression lines) were
generally removed. A subset of 627 of the lines (hereafter referred
to as the Wisconsin diversity set) was selected based on flowering
within the desired interval, sufficient vigor for trialing, uniformity,
and pedigree information. A total of 216 lines from the Wisconsin
diversity set were in common with the Flint-Garcia et al. (2005)
705
diversity set (hereafter referred to as the Goodman-Buckler diver-
sity set) (Supplemental Table 1).
Pedigree
Pedigree information was compiled from multiple sources (Gerdes
et al., 1993; Liu et al., 2003; Flint-Garcia et al., 2005; Mikel,
2006; Mikel and Dudley, 2006; USDA, ARS, National Genetic
Resources Program [available at http://www.ars-grin.gov/cgi-bin/
npgs/html/tax_site_acc.pl?NC7%20Zea%20mays%20subsp.%20
mays; verified 6 Dec. 2010]) and restructured in a previously pro-
posed standard pedigree format (Purdy et al., 1968). Coefficients of
coancestry were calculated using the computer program RELATE
(Bernardo et al., 1997) to produce a relatedness matrix of all inbred
lines (Emik and Terrill, 1949). This program utilizes a modifica-
tion of the tabular method to calculate the coefficients. The tabular
analysis procedure was modified to account for full inbreeding of
individuals and unequal parental contributions. For lines derived
from sources of unknown origin, the parental contribution from
that source was considered zero. This will impact germplasm
derived outside of the United States more than U.S. germplasm
(Supplemental Table 1). Lines derived from open pollinated popu-
lations were assumed unrelated in the analysis due to the lack of
sufficient information regarding the degree of relatedness.
Molecular Marker Genotyping
Of the 627 lines included in this study, 411 were genotyped
using the Illumina GoldenGate high-throughput single nucleo-
tide polymorphism (SNP) assay (Fan et. al., 2006). Seedling leaf
tissue from five to ten plants was bulked for DNA extraction.
DNA was extracted using the cetyl(trimethyl)ammonium bro-
mide (CTAB) method (Saghai-Maroof et al., 1984). A set of 1536
SNP marker data points was obtained for each genotype. The
remaining 216 lines had already been genotyped using the same
Illumina GoldenGate high-throughput assay (McMullen et al.,
2009). Genotypic data of these inbred lines was obtained from
the website (http://www.panzea.org/lit/data_sets.html#genos
[verified 6 Dec. 2010]). A subset of the 1536 SNPs were origi-
nally designed to have a unique allele in inbred line B73 for map-
ping the NAM populations, which resulted in a bias toward B73.
The biased SNPs and those SNPs with inconsistent quality across
the samples were discarded. This resulted in a total of 511 high
quality unbiased SNP loci, which were used for the relationship
and structure analysis presented in this paper.
Molecular Statistical Analysis
Population substructure was determined using the STRUC-
TURE software (Pritchard et al., 2000). An admixture model
with a burn-in time and replication number set at 50,000 was
used for each run. Three runs were performed for each value
of K (number of populations) from one to ten. The run with
the maximum likelihood of the observed genotypes given the
number of subpopulations in the model was used to assign the
probability that a line belongs to each substructure group.
Summary statistics including total number of alleles, group
specific alleles, average number of alleles per locus, major allele
frequency, gene diversity, and polymorphism information con-
tent (PIC) were calculated using PowerMarker version 3.25 (Liu
and Muse, 2005). Gene diversity (expected heterozygosity) is the
706 WWW.CROPS.ORG
probability that two alleles randomly chosen from a population
are different. Gene diversity was calculated at each locus as:
k
∑ P
2
D̂ = (1 – u )/[1 – (1 + f )/n],
u =1
in which Pu is the frequency of the uth allele, n is the sample
size, and f is the inbreeding coefficient estimated from genotype
frequencies (Weir, 1996). Polymorphism information content
is another related measure of genetic diversity; for a given loci,
PIC was calculated as:
k k −1 k
∑ P ∑ ∑
2 2 2
n =1–
PIC – 2P uP v ,
u =1
u
u = 1v = u + 1
in which for genotype AuAv, Pu is the frequency of the uth allele
at Au and P v is the frequency of the vth allele at Av (Botstein et
al., 1980).
These summary statistics were calculated for the entire diver-
sity panel as well as specific subsets of the panel. The so-called “cate-
gory” subsets included genotypes unique to the Wisconsin diversity
set, genotypes from the Goodman-Buckler diversity set that meet
our phenology restrictions, genotypes from the Goodman-Buckler
diversity set that do not meet the phenology restrictions, and all
genotypes from the Goodman-Buckler diversity set. The “maturity
group” subsets were determined based on average flowering time
measurements from 2008 and 2009. Maturity groups correspond
to classic industry groupings in days after planting: time to flow-
ering is less than 75 d after planting (2008: 1210 growing degree
days [GDD]; 2009: 1046 GDD), 75 to 85 d after planting (2008:
1210–1430 GDD; 2009: 1046–1214 GDD), 85 to 95 d after plant-
ing (2008: 1430–1601 GDD; 2009: 1214–1410 GDD), 95 to 105
d after planting (2008: 1601–1789 GDD; 2009: 1410–1607 GDD),
and greater than 105 d after planting (2008: 1789 GDD; 2009: 1607
GDD). Population substructure groups were assigned as the sub-
structure group with the majority membership for each genotype.
If a genotype did not have greater than 50% majority membership
in any group it was assigned to a “mixed group” (group 9). This
membership threshold was used simply for illustration purposes.
PowerMarker was also used to calculate genetic relatedness
as pair-wise Rogers distances (Rogers, 1972) based on the 511
unbiased SNP markers. Rogers distances were calculated as:
m aj
DR = 1/ m ∑ ∑( p ij − qij )2 ,
j i
in which pij and qij are the frequencies of the ith allele at the jth
locus in each genotype, aj is the number of alleles at the jth locus,
and m is the number of loci examined. Unweighted pair group
method with arithmetic mean (UPGMA)-based phylogeny was
constructed using this Rogers distance matrix. FigTree version
1.2.3 was used to produce the UPGMA tree image (http://tree.
bio.ed.ac.uk/software/figtree [verified 6 Dec. 2010]). Multidi-
mensional scaling (MDS) analysis was performed using PROC
MDS in SAS (SAS Institute, 2003) to evaluate genetic relation-
ships using the Rogers dissimilarity matrix.
Field Evaluations
Trials were grown during the summer of 2008 at the West Madi-
son Agricultural Research Station in Madison, WI, and sum-
mer of 2009 at the Arlington Agricultural Research Station
in Arlington, WI, using a randomized complete block design
with two replications. The 2008 replicated trial contained 611
of the 1411 lines described above. In addition, all 1411 lines were
CROP SCIENCE, VOL. 51, MARCH– APRIL 2011

Figure 1. Comparison of growing degree day (GDD) accumulation
between 2008 and 2009. Data were collected at the West Madison
Agricultural Research Station (Madison, WI). Planting dates were
14 May 2008 and 8 May 2009.
evaluated in nursery plots in 2008. The 2009 replicated trial con-
sisted of the 627 lines in the final Wisconsin diversity set. The
final Wisconsin diversity set was also planted in single replicate in
2009 at the Madison location, where GDD to flowering time was
evaluated. All other phenotypic traits were measured on the rep-
licated trials at Madison and Arlington in 2008 and 2009, respec-
tively. The 2008 Madison replicated experiment was planted on
14 May. The 2009 Madison single replication experiment was
planted on 8 May and the 2009 Arlington replicated experiment
was planted on 23 May. The soil type at both locations is Plano
silt loam (fine-silty, mixed mesic Typic Arguidoll). Temperatures
in 2009 were below average resulting in slower accumulation of
GDD (Fig. 1). In 2008, genotypes were evaluated in one-row
plots (6.1 m long and 0.76 m apart) planted to a density of 79,000
plants ha−1. In 2009, genotypes at Arlington were evaluated in
two-row plots with the same parameters as in 2008. Genotypes
at Madison in 2009 were evaluated in one-row plots (3.8 m long
and 0.76 m apart) planted at a density of 61,000 plants ha−1.
The following phenotypic traits were measured: GDD to
flowering, stover yield on single-row plots (in t ha–1), 300 kernel
weight (in g), stalk diameter (in cm), plant height (in cm), leaf
number, internode length (in cm), ear height (in cm), upper-
most internode with a developed ear, number of elongated
internodes above the uppermost developed ear, last leaf with epi-
cuticular wax, percentage of leaves with epicuticular wax, num-
ber of leaves with no epicuticular wax, and percentage of leaves
with no epicuticular wax. Stover yield, 300 kernel weight, and
stalk diameter were only measured in 2008. Uppermost inter-
node with a developed ear and number of elongated internodes
above the uppermost developed ear were only measured in 2009.
Growing degree days to flowering, stover yield, and 300 kernel
weights were measured on a whole plot basis; all other traits were
measured on five representative plants per plot.
Growing degree days to midpollen and midsilk were calcu-
lated on a per-plot basis as the average of GDD when half of the
plants in the plot were shedding pollen and GDD when half of the
plants in the plot had exposed silks, respectively. Ears were stripped
from plants at physiological maturity averaged across the experi-
ment. Total biomass was harvested from each plot and whole plot
CROP SCIENCE, VOL. 51, MARCH– APRIL 2011 WWW.CROPS.ORG
wet weights were obtained using a John Deere (Deere & Com-
pany, Moline, IL) 5200 self propelled forage harvester converted for
experimental plot harvest. Approximately 500 g of biomass samples
was collected, weighed, and placed in a 55 C° drier for about 7 d.
Samples were then weighed again to calculate percent moisture in
the plot. Whole plot weights were adjusted for percent moisture.
Stalk diameter was measured on the first above-ground elon-
gated internode. Plant height was measured from the soil surface to
the node of the flag leaf. To determine total leaf number a hole was
punched in the fifth leaf of the plants before any leaf senescence. A
collar was then placed between the eighth and ninth leaves before
senescence of the fifth leaf. Internode length was calculated as plant
height divided by leaf number. Ear height was measured from the
soil surface to the node of the upper most developed ear. A devel-
oped ear was defined as one that contained at least five kernels.
Phenotypic Statistical Analysis
A mixed model analysis was performed using PROC GLM in
SAS (SAS Institute, 2003) to partition variation due to year,
replication, and genotype for each phenotypic trait. For traits
measured on two replications in 2008 and 2009, the model
included year, replication nested within year, genotype, and
year × genotype interaction. For traits measured on two replica-
tions in either 2008 or 2009, the model included replication and
genotype. For traits measured on one replication in 2008 and
2009, the model included year and genotype. In all models, all
sources of variation were considered random. All statistical tests
were conducted at a 5% level of significance. PROC CORR
was used to determine Pearson correlations across years.
Regression analysis using PROC REG in SAS (SAS Insti-
tute, 2003) was conducted to determine the amount of phe-
notypic variation explained by population substructure. The
proportion of membership values for each of the eight popula-
tion substructure groups was included in the regression model.
Association Analysis
An insertion or deletion (indel) marker at the Vegetative to generative
transition 1 (Vgt1) locus that was previously shown to be associated
with flowering time in maize (Salvi et al., 2007) was screened
on 534 of the lines in the diversity panel. The polymerase chain
reaction (PCR) primers used to amplify the polymorphic regions
were MITE-F (TGGAATGGATGTGAAGTGAG) and MITE-
R (GTACCAGCTCCCTCTGCTC) (Salvi et al., 2007). Poly-
merase chain reaction products were run on a 1% agarose gel to
score presence or absence of the mite insertion.
Association mapping was done using the TASSEL soft-
ware (Bradbury et al., 2007). A mixed linear model was tested
including the eight population substructure covariates and
appropriate actual proportion of membership in each group (Q
matrix) generated from STRUCTURE. The kinship matrix
was determined using Rogers (1972) distances.
RESULTS AND DISCUSSION
Choice of Inbred Lines
A collection of 1411 inbred lines that would flower in the
upper Midwest region of the United States was collected.
This set included 1164 lines from the NC7 as well as 247
additional lines from the Goodman-Buckler diversity set
707
Table 1. Phenotypic variation of morphological and developmental traits measured on the diversity panel. Values are based on N
inbred lines evaluated in two replications in 2008 (Madison, WI) and in 2009 (Arlington, WI) and one replication in 2009 (Madison, WI).
Genotypes unique to Genotypes in common Complete Wisconsin
Wisconsin diversity set with Goodman-Buckler diversity set diversity set
Phenotypic trait N Min.† Max.† Avg.† R2‡ N Min. Max. Avg. R2 Avg. R2
Days to flowering (growing 383 944.00 1644.90 1277.29 0.18 198 965.09 1644.90 1345.58 0.28 1300.56 0.22
degree days [GDD])§
Stover yield (t ha−1)¶ 338 0.21 4.37 1.69 0.17 190 0.13 3.96 1.99 0.28 1.80 0.20
300 kernel weight (g)§¶ 330 18.50 106.80 71.59 0.18 165 28.39 124.83 67.65 0.10 70.27 0.11
Stalk diameter (cm)¶ 338 1.29 3.10 2.32 0.16 190 1.85 3.25 2.42 0.15 2.36 0.15
Plant height (cm) 398 88.75 239.50 172.23 0.10 206 115.00 232.25 176.76 0.13 173.77 0.09
Leaf number 397 11.92 23.41 18.31 0.14 206 13.90 24.61 19.47 0.28 18.71 0.20
Internode length (cm) 397 5.93 12.82 9.46 0.04 206 5.55 11.75 9.14 0.05 9.35 0.05
Ear height (cm) 398 29.00 144.67 86.84 0.10 206 35.67 143.50 91.69 0.16 88.50 0.12
Uppermost internode with 365 7.50 21.00 13.23 0.14 189 9.20 17.33 13.86 0.21 13.44 0.16
developed ear#
Number elongated inter- 365 1.84 10.50 5.59 0.07 189 3.20 8.10 5.83 0.17 5.67 0.08
nodes above uppermost ear#
Last leaf with epicuticular 398 2.75 13.50 8.01 0.07 206 5.60 11.00 8.21 0.05 8.08 0.03
wax
Percentage of leaves with 397 17.98 70.51 44.14 0.11 206 24.44 64.71 42.70 0.25 43.65 0.13
epicuticular wax
Number leaves with no 397 3.85 17.78 10.31 0.13 206 5.44 17.30 11.27 0.36 10.64 0.20
epicuticular wax
Percentage of leaves with 397 29.49 82.02 55.86 0.11 206 35.29 75.56 57.30 0.25 56.35 0.13
no epicuticular wax
†
Averaged over replications and years.
‡
Phenotypic variation explained by population substructure.
§
Data measured only on one replication per year (all other traits were measured on two replications per year).
¶
Data collected only in 2008.
#
Data collected only in 2009.

and materials provided by the several collaborators. Lines
were visually evaluated in a single replication nursery dur-
ing the summer of 2008 at the West Madison Agricultural
Research Station in Madison, WI. A subset of 611 of those
lines was selected based on prior performance and pedigree
information and evaluated in a replicated trial at the Madi-
son location that same year. Based on the 2008 replicated
evaluation 548 of those lines were further selected to be part
of this diversity panel. Selections were based on maturity,
agronomic suitability, inbred uniformity, and seed supply.
An additional 79 lines were identified based on the single
replication nursery evaluation conducted during 2008 and
were added to the set of 548 lines for the 2009 evaluation.
The final Wisconsin diversity set therefore contains 627
lines (Supplemental Table 1). The entire Wisconsin diversity
set is available. Plant introduction information is provided
for the 606 (of the 627) lines available through the NC7.
Source information is provided for the 21 lines not currently
available through the NC7 (Supplemental Table 1).
Relationships by Pedigree
Many of the Wisconsin diversity set lines trace back to
eight open-pollinated populations including Iowa Stiff Stalk
Synthetic (BSSS), Minnesota No. 13, Reid Yellow Dent,
Lancaster Surecrop, Golden Glow, Funk Yellow Dent,
Pride of Saline, and Krug among others. In addition, this
diversity panel contains 15 lines derived from the Germ-
plasm Enhancement of Maize (GEM; Ames, IA) project
(Pollak, 2003). Fourteen of these lines were found to be, by
pedigree, 25% unadapted and 75% elite germplasm and one
line was 50% unadapted and 50% elite germplasm. When
assembling a diversity panel, it is important to have a diverse
set of germplasm as well as a balance of alleles. Having mul-
tiple genotypes derived from the same open pollinated pop-
ulation helps to maintain a balance of allele frequencies.
Phenotypic Diversity
Variation due to genotype was significant for all phenotypic
traits when the analysis included lines unique to the Wiscon-
sin diversity set, lines in common with the Goodman-Buckler
diversity set, and the complete Wisconsin diversity set (Table
1). Although the subset of the Goodman-Buckler diversity
set that was evaluated here is not representative of all pheno-
typic diversity in maize, it is representative of the phenotypic
diversity that exists in currently characterized inbred lines that
will mature in a short day growing environment. The lines
unique to this diversity panel expanded the range of pheno-
typic variation for many of these traits relative to the subset of
lines from the Goodman-Buckler diversity set that met our
phenology restriction. For instance, the current panel dramati-
cally enhanced the variability for last leaf with epicuticular
wax by decreasing the previous minimum by approximately

708 WWW.CROPS.ORG CROP SCIENCE, VOL. 51, MARCH– APRIL 2011

Table 2. Genetic diversity summary statistics based on 511 unbiased single nucleotide polymorphism (SNP) markers. Maturity
groups are based on average flowering time measurements from 2008 and 2009 (Madison, WI) when half of the plants in the
plot were shedding pollen and half of the plants in the plot had exposed silks. Population substructure was determined using
STRUCTURE (Pritchard et al., 2000). Lines in group 9 are mixed genotypes (less than 50% membership within one group).
Total Group Average Major Polymorphism
Set number specific number alleles allele Gene information
size alleles alleles per locus frequency diversity content (PIC)
Category group
Unique to Wisconsin diversity set 411 1008 0 1.9726 0.7857 0.2979 0.2423
Goodman-Buckler diversity set – early 216 1022 0 2.0000 0.7732 0.3163 0.2576
Goodman-Buckler diversity set – late 62 1015 0 1.9863 0.7861 0.3004 0.2448
Goodman-Buckler diversity set 278 1022 14 2.0000 0.7714 0.3197 0.2606
Complete Wisconsin diversity set 627 1022 7 2.0000 0.7796 0.3079 0.2509
Maturity group
1 (less than 75 days after planting) 60 1000 0 1.9569 0.7716 0.3096 0.2496
2 (75–85 days after planting) 201 1005 0 1.9980 0.7822 0.3029 0.2461
3 (85–95 days after planting) 307 1022 0 2.0000 0.7834 0.3036 0.2479
4 (95–105 days after planting) 32 1011 0 1.9785 0.7864 0.3009 0.2455
Population substructure group
1 (SSS† [B73 and B14]) 64 936 0 1.8317 0.8690 0.1792 0.1475
2 (popcorn, sweet corn, and flints) 41 973 0 1.9041 0.7975 0.2772 0.2244
3 (NSS‡ [Wf9]) 8 720 0 1.4090 0.8961 0.1429 0.1157
4 (SSS [B37]) 19 835 0 1.6341 0.8822 0.1677 0.1386
5 (NSS [Minnesota13]) 86 1000 0 1.9569 0.7959 0.2835 0.2301
6 (tropical) 59 1013 0 1.9824 0.7896 0.2939 0.2392
7 (NSS [Oh43 and Iodent]) 39 942 0 1.8434 0.8134 0.2507 0.2020
8 (NSS [Mo17]) 31 933 0 1.8258 0.8481 0.2171 0.1789
9 (mixed) 280 1020 0 1.9961 0.7799 0.3066 0.2494
Wisconsin Diversity set plus Goodman- 689 1022 NA§ 2.0000 0.7775 0.3113 0.2537
Buckler diversity set
†
SSS, Stiff Stalk Synthetic.
‡
NSS, Non-Stiff Stalk Synthetic.
§
NA, not applicable.

three leaves and increasing the previous maximum by 2.5
leaves. Among other traits, both the upper and lower limit of
variation were expanded for plant height, ear height, upper-
most internode with a developed ear, number of elongated
internodes above the uppermost ear, percentage of leaves with
epicuticular wax, number of leaves with no epicuticular wax,
and percentage of leaves with no epicuticular wax. The upper
limit of variation was expanded for stover yield and internode
length. The lower limit of variation was expanded for days to
flowering, 300 kernel weight, stalk diameter, and leaf number
(Table 1). A diversity panel intended for association mapping
should utilize the maximum phenotypic diversity possible.
This increase in phenotypic diversity of characterized inbred
lines that will mature in a short day growing environment
for all traits measured except flowering time will increase the
power to detect trait marker associations for researchers work-
ing in short day growing environments.
Genetic Diversity
Assignment into a maturity group was based on the average
days after planting (DAP) to flowering from 2008 and 2009.
The gene diversity was greatest in the earliest maturity group
and decreased in the later maturity groups (Table 2). There was
a similar trend for PIC across maturity groups. Maturity group
3 did not follow these trends, which is likely because there are
significantly more lines in this maturity group. Also, there was
a better balance of alleles in the earlier maturity groups. In the
later maturity groups the average major allele frequency across
all SNPs is greatest. Maximum power to detect trait loci asso-
ciation occurs when allele frequencies are balanced (Myles et
al., 2009). When alleles become rare (<0.05), they are often not
included in association mapping or are pooled with other rare
alleles. In regions where later maturing lines cannot be grown,
haplotypes from germplasm in the earlier maturity groups are
the most relevant. Addition of genetic diversity, as indicated by
gene diversity and PIC based on lines unique to this diversity
panel, was greater at early maturity groups and decreased at
later groups due to the consideration of phenology. Although
the phenology restricted diversity set overall presents a very
minor reduction in gene diversity (0.3197 to 0.3079) and PIC
(0.2606 to 0.2509) compared to the Goodman-Buckler diver-
sity set (Table 2), it will serve as an effective resource for its
intended use.
Genetic relatedness was calculated as 1 minus the pair-
wise Rogers dissimilarity distance (Rogers, 1972) based on
511 unbiased SNP markers (Supplemental Table 2). Only six

CROP SCIENCE, VOL. 51, MARCH– APRIL 2011 WWW.CROPS.ORG 709

Figure 2. Unweighted pair group method with arithmetic mean (UPGMA) tree of 689 diverse inbred lines based on 511 unbiased single
nucleotide polymorphism (SNP) markers. There are 411 genotypes unique to this diversity panel (blue lines), 216 lines from the Goodman-
Buckler diversity set that flower in the upper midwestern United States and are included in this diversity panel (yellow lines), and 62 lines
from the Goodman-Buckler diversity set that do not flower in the upper midwestern United States and are not included in this diversity
panel (red lines). Group labels are based on population substructure analysis. NSS, Non-Stiff Stalk Synthetic; SSS, Stiff Stalk Synthetic.

of the 474,721 pairs had genetic similarity distances less than
0.5 on a scale from 0 to 1. This is likely an artifact of the bial-
lelic assay used in this analysis. The UPGMA tree constructed
from these values shows that the current diversity set is repre-
sented on all major branches and most subbranches (the blue
and yellow lines in Fig. 2). Several primary branches contain
only lines unique to this diversity panel (the blue lines in Fig. 2)
indicating increased representation of many groups. Although
there is a branch consisting of predominantly red lines denot-
ing the genotypes from the Goodman-Buckler diversity set
that do not meet phenology restriction (the Tropical and Trop-
ical/Subtropical groups in Fig. 2), the presence of some yellow
lines in this branch indicate that this group is not completely
excluded in the current panel. Thus, while phenology restric-
tion did not result in complete loss of representation of late
maturity germplasm, it resulted in a major gain in diversity in
the areas that did not exist previously.
Genetic Structure
The STRUCTURE (Pritchard et al., 2000) run with the
maximum likelihood of the observed genotypes given the
number of subpopulations in the model had a K value of
eight. This run was used to assign the probability that a line
belongs to each substructure group based on membership
probability thresholds of 50%. By pedigree, groups 1 and
4 are primarily Stiff Stalk Synthetic (SSS) lines, group 2 is
primarily popcorn, sweet corn, and flint lines, groups 3,
5, 7, and 8 are majority Non-Stiff Stalk Synthetic (NSS),
and group 6 are tropical and subtropical lines (Fig. 2 and 3,
Supplemental Table 1, and Supplemental Fig. 1). The group
1 SSS lines are mostly B73 and B14 types and the group
4 SSS lines are mostly B37 type. Group 3 NSS lines are
mostly WF9 type, group 5 NSS lines are mostly Minnesota
13 type, group 7 NSS lines are mostly Oh43 and Iodent
types, and the group 8 NSS lines are mostly Mo17 type.
The ideal association mapping panel will have subtle pop-
ulation substructure and familial relatedness (Zhu et al., 2008).
False positive associations can be generated in LD analysis due
to the unequal distribution of alleles within subpopulations
(Flint-Garcia et. al., 2003; Yu et. al., 2006). Thus, it is impor-
tant to determine the genetic substructure and include it in the
model. In this diversity panel, population structure accounted

710 WWW.CROPS.ORG CROP SCIENCE, VOL. 51, MARCH– APRIL 2011

Figure 3. Graphical display of population substructure for 627 lines with restricted phenology at population size n = 8. There are 411
genotypes unique to this diversity panel and 216 from the Goodman-Buckler diversity set included in this diversity panel that have
genotypic data. Population substructure was determined using STRUCTURE (Pritchard et al., 2000) with 511 unbiased single nucleotide
polymorphism (SNP) markers. NSS, Non-Stiff Stalk Synthetic; SSS, Stiff Stalk Synthetic.

for between 3% (last leaf with epicuticular wax) and 22% (days
to flowering [GDD]) of the phenotypic variation (Table 1).
This moderate percentage of phenotypic variation explained
by population substructure is desirable.
Comparison between Pedigree
and Genetic Relatedness
Genotypes were grouped into NSS, SSS, tropical, popcorn,
and sweet corn by pedigree and are color coded on the MDS
plot (Fig. 4; Supplemental Table 1). The purpose of MDS plots
is to provide a visual representation of the pattern of related-
ness between inbred lines, such that closely related lines will
be placed near each other on the plot. The SSS, tropical, and
sweet corn classifications form relatively tight clusters on
the MDS plot. The popcorn lines included in this diversity
panel formed two distinct clusters, one cluster near the SSS
Figure 4. Multidimensional scaling plot of 313 lines based on
511 unbiased single nucleotide polymorphism (SNP) markers.
Inbred lines with mixed, unrelated, or unknown pedigree were not
included. Color coded classifications are based on pedigrees.
Coordinates were determined using PROC MDS in SAS (SAS
Institute, 2003) based on a matrix of Rogers distances (Rogers,
1972). NSS, Non-Stiff Stalk Synthetic; SSS, Stiff Stalk Synthetic.
group and one within the NSS cloud, consistent with previ-
ous observations in popcorn lines (Kantety et al., 1995). The
NSS lines did not form tight clusters, which is consistent with
the population substructure results. There are four population
substructures representing the NSS lines while there are only
two population substructures representing SSS. The MDS plot
generated from only NSS and SSS classified lines further dem-
onstrates this point (Fig. 5a). When only the NSS and SSS
lines are examined there is very little overlap between the NSS
groups. C103, Mo17, Oh43, Wf9, and PH207 appear in the
pedigrees of 58 of the 171 by pedigree NSS lines in this panel.
Lines that have one of these founder lines in common by pedi-
gree tend to cluster tightly by genetic distance (Fig. 5a). There
are also subgroups by pedigree that are maintained by genetic
distance within the SSS group (Fig. 5b). The SSS subgroups
overlap more than the NSS because B73, B37, and B14 were
all derived from BSSS. The pedigrees of the other SSS do not
trace back to BSSS; however, they do trace back to other Stiff
Stalk Synthetics. For example, there are seven GEM lines that
were crossed to unknown elite inbred lines classified as SSS.
These comparisons indicate that the same population stratifi-
cation observed in maize by pedigree is also observed at the
genetic level.
The relationship between pairs of inbred lines was
determined based on pedigree and genetic analysis. The
parental contribution by pedigree for lines with unknown
origin was considered zero for this analysis. In addition, lines
derived from open pollinated populations were assumed
unrelated due to the lack of sufficient information regarding
the degree of relatedness. This, however, resulted in biased
pair-wise relationships (Supplemental Table 2). To obtain a
correlation value between pedigree and genetic relationships
with minimal bias pair-wise comparisons with a pedigree
relationship of zero were removed from the analysis. The
correlation comparison between relatedness by pedigree
and relatedness by genotype show a relatively high Pear-
son correlation (R 2 = 0.4892; p < 1 × 10−4) (Fig. 6). There
are many reasons that the correlation between genetic and
pedigree distances is significantly less than 1.00. The pedi-
gree distances assume that there is no selection, mutation,

CROP SCIENCE, VOL. 51, MARCH– APRIL 2011 WWW.CROPS.ORG 711

Figure 5. Multidimensional scaling plot based on 511 unbiased single nucleotide polymorphism (SNP) markers. Color coded classifications
are based on pedigrees. Data points with multiple overlapping symbols indicate inbred lines with more than one founder inbred in the
pedigree. Coordinates were determined using PROC MDS in SAS (SAS Institute, 2003) based on a matrix of Rogers distances (Rogers,
1972). Data points with arrow and label indicate the position of the founder line for each subgroup. a) Plot of 266 lines classified by pedigree
as either Stiff Stalk Synthetic (SSS) or Non-Stiff Stalk Synthetic (NSS). Lines were further subdivided into groups based on their pedigree
relatedness to founder lines. b) Plot of 94 lines classified by pedigree as SSS. Lines were classified by pedigree relatedness to founder lines.

712 WWW.CROPS.ORG CROP SCIENCE, VOL. 51, MARCH– APRIL 2011

Figure 6. Correlation between pedigree and genetic relatedness for 2435 pair-wise relationship values. This is a subset of relationship
values from 689 genotypes having 237,016 pair-wise relationship comparisons. Relationships by pedigree with a value of zero were
removed from this plot. There are 411 genotypes unique to this diversity panel, 216 from the Goodman-Buckler diversity set included
in this diversity panel, and 62 lines from the Goodman-Buckler diversity set not included in this diversity panel. Pedigree relatedness
was determined using a modification of the tabular method for calculating coefficients of coancestry that accounts for full inbreeding of
individuals and unequal parental contributions. Genetic relatedness was calculated as pair-wise Rogers distances (Rogers, 1972) based
on 511 unbiased single nucleotide polymorphism (SNP) markers. If lines were derived from sources of unknown origin or open pollinated
populations, the parental contribution from that source was considered zero.

or drift when inbred lines are generated, the first of which
is obviously violated in any directed breeding program. In
addition pedigree distances rely solely on identity by descent
and disregard identity by state. Finally, the genetic distances
determined by a biallelic assay are likely to be inflated due
to the lack of allelic states. Although there were ambiguous
or unknown pedigrees for some genotypes in this diversity
panel this high correlation between genetic and a pedigree
distance suggests the available pedigree information is reli-
able for many of the lines (Supplemental Table 1).
Flowering Time Association Analysis
To demonstrate the utility of this diversity panel for
mapping, association analysis was conducted on a region
known to be linked with flowering time. The flowering
time trait was selected for this proof of concept to demon-
strate that the phenology restriction placed on the diversity
panel did not hinder its utility for association mapping.
It has been shown previously that multiple polymor-
phisms in Vgt1, a noncoding region upstream of ZmRap2.7,
are associated with flowering time in maize (Salvi et al., 2007;
Ducrocq et al., 2008). Ducrocq et al. (2008) reported that a
2-bp indel (CGindel587) showed the greatest association with
flowering time in this region. CGindel587 is in high LD with
a mite insertion that is also associated with flowering time
(Ducrocq et al., 2008). Due to the ease of genotyping, the mite
insertion was used rather than CGindel587. The mite insertion
was scored on 534 of the genotypes in this diversity panel.
Flowering time data were collected on one replication in both
2008 and 2009. While, genotype × environment interactions
could not be evaluated, highly significant Pearson correlation
between the 2008 and 2009 data (r = 0.7576; p < 1 × 10−4)
allowed us to use the average data across 2008 and 2009. Asso-
ciation analysis using a mixed model that accounts for both
population substructure and kinship relationships has been
shown to reduce both type I and type II error (Yu et al., 2006).
Using this method, the mite insertion was significantly associ-
ated with flowering time in this population (p = 3.08 × 10−6).
None of the 511 SNP analyzed showed any association with
flowering time. This result is expected given the relatively low
marker density in this study. This successful proof of concept
related to the mite insertion confirms the utility of this diversity
panel for association mapping and lack of any negative conse-
quences of phenology restrictions. With the added advantage
of inclusion of only those lines maturing in the target area of its
use, this panel will be an excellent resource for future associa-
tion studies.
CONCLUSIONS
Previously described diversity panels offered limited num-
ber of genotypes that mature in the upper Midwest region of
the United States. Herein, we have described an expanded

CROP SCIENCE, VOL. 51, MARCH– APRIL 2011 WWW.CROPS.ORG 713

set of diverse inbred lines selected based on restricted phe-
nology and demonstrated that this panel is highly effec-
tive in association mapping studies. Preservation of genetic
diversity despite the phenology restrictions coupled with
the addition of novel genetic and phenotypic variation not
previously utilized makes this diversity panel a valuable
resource to the maize breeding and genetics community.
Supplemental Information Available
Supplemental material is available free of charge at http://
www.crops.org/publications/cs.
Acknowledgments
The authors would like to acknowledge Dustin Eilert, Julianne
Smith, Bill Kojis, and Bob Vogelzang for technical assistance,
Ed Buckler and Jeff Glaubitz for their help in designing the
Illumina GoldenGate high-throughput assay, Rex Bernardo
for his help with the RELATE program, and Sherry Flint-
Garcia for thoughtful suggestions regarding this manuscript.
We are also grateful for support provided by the D.C. Smith
and Gabelman-Shippo Graduate Fellowship programs at the
University of Wisconsin – Madison. This work was supported
by the U.S. Department of Energy through the Great Lakes
Bioenergy Research Center Grant DE-FC02-07ER64494 and
USDA-Hatch projects WIS01330 and WIS01335.
References
Agrama, H., G. Eizenga, and W. Yan. 2007. Association mapping of
yield and its components in rice cultivars. Mol. Breed. 19:341–356.
Andersen, J.R., T. Schrag, A. Melchinger, I. Zein, and T. Lübber-
stedt. 2005. Validation of Dwarf8 polymorphisms associated
with flowering time in elite European inbred lines of maize
(Zea mays L.). Theor. Appl. Genet. 111:206–217.
Aranzana, M., S. Kim, K. Zhao, E. Bakker, M. Horton, K. Jakob,
C. Lister, J. Molitor, C. Shindo, C. Tang, C. Toomajian, B.
Traw, H. Zheng, J. Bergelson, C. Dean, P. Marjoram, and
M. Nordborg. 2005. Genome-wide association mapping in
Arabidopsis identifies previously known flowering time and
pathogen resistance genes. PLoS Genet. 1:E60.
Bao, J., H. Corke, and M. Sun. 2006. Microsatellites, single
nucleotide polymorphisms and a sequence tagged site in
starch-synthesizing genes in relation to starch physicochemi-
cal properties in nonwaxy rice (Oryza sativa L.). Theor. Appl.
Genet. 113:1185–1196.
Beló, A., P. Zheng, S. Luck, B. Shen, D. Meyer, B. Li, S. Tingey,
and A. Rafalski. 2008. Whole genome scan detects an allelic
variant of fad2 associated with increased oleic acid levels in
maize. Mol. Genet. Genomics 279:1–10.
Bernardo, R., A. Murigneux, J. Maisonneuve, C. Johnsson, and
Z. Karaman. 1997. RFLP-based estimates of parental contri-
bution to F2 - and BC1-derived maize inbreds. Theor. Appl.
Genet. 94:652–656.
Botstein, D., R. White, M. Skolnick, and R. Davis. 1980. Construc-
tion of a genetic linkage map in man using restriction fragment
length polymorphisms. Am. J. Hum. Genet. 32:314–331.
Bradbury, P., Z. Zhang, D. Kroon, T. Casstevens, Y. Ramdoss, and
E. Buckler. 2007. TASSEL: Software for association mapping of
complex traits in diverse samples. Bioinformatics 23:2633–2635.
714 WWW.CROPS.ORG
Breseghello, F., and M.E. Sorrells. 2006. Association mapping of
kernel size and milling quality in wheat (Triticum aestivum L.)
cultivars. Genetics 172:1165–1177.
Camus-Kulandaivelu, L., J. Veyrieras, D. Madur, V. Combes, M.
Fourmann, S. Barraud, P. Dubreuil, B. Gouesnard, D. Mani-
cacci, and A. Charcosset. 2006. Maize adaptation to temper-
ate climate: Relationship between population structure and
polymorphism in the Dwarf8 gene. Genetics 172:2449–2463.
Casa, A., G. Pressoir, P. Brown, S. Mitchell, W. Rooney, M.
Tuinstra, C. Franks, and S. Kresovich. 2008. Community
resources and strategies for association mapping in sorghum.
Crop Sci. 48:30–40.
Crossa, J., J. Burgueño, S. Dreisigacker, M. Vargas, S. Herrera-
Foessel, M. Lillemo, R. Singh, R. Trethowan, M. Warbur-
ton, J. Franco, M. Reynolds, J. Crouch, and R. Ortiz. 2007.
Association analysis of historical bread wheat germplasm
using additive genetic covariance of relatives and population
structure. Genetics 177:1889–1913.
Ducrocq, S., C. Giauff ret, D. Madur, V. Combes, F. Dumas, S.
Jouanne, D. Coubriche, P. Jamin, L. Moreau, and A. Char-
cosset. 2009. Fine mapping and haplotype structure analysis
of a major flowering time quantitative trait locus on maize
chromosome 10. Genetics 183:1555–1563.
Ducrocq, S., D. Madur, J. Veyrieras, L. Camus-Kulandaivelu, M.
Kloiber-Maitz, T. Presterl, M. Ouzunova, D. Manicacci, and
A. Charcosset. 2008. Key impact of Vgt1 on flowering time
adaptation in maize: Evidence from association mapping and
ecogeographical information. Genetics 178:2433–2437.
Ehrenreich, I., P. Stafford, and M. Purugganan. 2007. The genetic
architecture of shoot branching in Arabidopsis thaliana: A com-
parative assessment of candidate gene associations vs. quanti-
tative trait locus mapping. Genetics 176:1223–1236.
Emik, L.O., and C.E. Terrill. 1949. Systematic procedures for cal-
culating inbreeding coefficients. J. Hered. 40:51–55.
Fan, J., M. Chee, and K. Gunderson. 2006. Highly parallel
genomic assays. Nat. Rev. Genet. 7:632–644.
Flint-Garcia, S., J. Thornsberry, and E. Buckler. 2003. Structure
of linkage disequilibrium in plants. Annu. Rev. Plant Biol.
54:357–374.
Flint-Garcia, S., A. Thuillet, J. Yu, G. Pressoir, S. Romero, S. Mitch-
ell, J. Doebley, S. Kresovich, M. Goodman, and E. Buckler.
2005. Maize association population: A high-resolution platform
for quantitative trait locus dissection. Plant J. 44:1054–1064.
Gerdes, J., C. Behr, J. Coors, and W. Tracy. 1993. Compilation of North
American maize breeding germplasm. CSSA, Madison, WI.
Harjes, C., T. Rocheford, L. Bai, T. Brutnell, C. Kandianis, S.
Sowinski, A. Stapleton, R. Vallabhaneni, M. Williams, E.
Wurtzel, J. Yan, and E. Buckler. 2008. Natural genetic varia-
tion in Lycopene Epsilon Cyclase tapped for maize biofortifica-
tion. Science 319:330–333.
Jun, T., K. Van, M. Kim, S. Lee, and D. Walker. 2008. Associa-
tion analysis using SSR markers to fi nd QTL for seed protein
content in soybean. Euphytica 162:179–191.
Kantety, R., X. Zeng, J. Bennetzen, and B. Zehr. 1995. Assess-
ment of genetic diversity in dent and popcorn (Zea mays L.)
inbred lines using inter-simple sequence repeat (ISSR) ampli-
fication. Mol. Breed. 1:365–373.
Kraakman, A., F. Martínez, B. Mussiraliev, F. van Eeuwijk, and
R. Niks. 2006. Linkage disequilibrium mapping of morpho-
logical, resistance, and other agronomically relevant traits in
modern spring barley cultivars. Mol. Breed. 17:41–58.
Liu, K., M. Goodman, S. Muse, J. Smith, E. Buckler, and J. Doebley.
CROP SCIENCE, VOL. 51, MARCH– APRIL 2011
 2003. Genetic structure and diversity among maize inbred lines
as inferred from DNA microsatellites. Genetics 165:2117–2128.
Liu, K., and S.V. Muse. 2005. PowerMarker: Integrated analysis envi-
ronment for genetic marker data. Bioinformatics 21:2128–2129.
McMullen, M., S. Kresovich, H. Villeda, P. Bradbury, H. Li, Q.
Sun, S. Flint-Garcia, J. Thornsberry, C. Acharya, C. Bot-
toms, P. Brown, C. Browne, M. Eller, K. Guill, C. Harjes,
D. Kroon, N. Lepak, S. Mitchell, B. Peterson, G. Pressoir, S.
Romero, M. Rosas, S. Salvo, H. Yates, M. Hanson, E. Jones,
S. Smith, J. Glaubitz, M. Goodman, D. Ware, J. Holland, and
E. Buckler. 2009. Genetic properties of the maize nested asso-
ciation mapping population. Science 325:737–740.
Mikel, M.A. 2006. Availability and analysis of proprietary dent
corn inbred lines with expired U.S. plant variety protection.
Crop Sci. 46:2555–2560.
Mikel, M.A., and J.W. Dudley. 2006. Evolution of North Ameri-
can dent corn from public to proprietary germplasm. Crop
Sci. 46:1193–1205.
Murray, S., W. Rooney, M. Hamblin, S. Mitchell, and S. Kreso-
vich. 2009. Sweet sorghum genetic diversity and association
mapping for brix and height. Plant Gen. 2:48–62.
Myles, S., J. Peiffer, P. Brown, E. Ersoz, Z. Zhang, D. Costich,
and E. Buckler. 2009. Association mapping: Critical consid-
erations shift from genotyping to experimental design. Plant
Cell 21:2194–2202.
Olsen, K., S. Halldorsdottir, J. Stinchcombe, C. Weinig, J. Schmitt,
and M. Purugganan. 2004. Linkage disequilibrium mapping of
Arabidopsis CRY2 flowering time alleles. Genetics 167:1361–1369.
Olsen, K.M., and M.D. Purugganan. 2002. Molecular evidence on
the origin and evolution of glutinous rice. Genetics 162:941–950.
Pollak, L.M. 2003. The History and success of the public–private
project on germplasm enhancement of maize (GEM). Adv.
Agron. 78:45–87.
Pressoir, G., P. Brown, W. Zhu, N. Upadyayula, T. Rocheford, E.
Buckler, and S. Kresovich. 2009. Natural variation in maize
architecture is mediated by allelic differences at the PINOID
co-ortholog barren inflorescnece2. Plant J. 58:618–628.
Pritchard, J., M. Stephens, and P. Donnelly. 2000. Inference of
population structure using multilocus genotype data. Genet-
ics 155:945–959.
Purdy, L., W. Loegering, C. Konzak, C. Perterson, and R. Allan.
1968. A proposed standard method for illustrating pedigrees
of small grain varieties. Crop Sci. 8:405–406.
Reif, J., X. Xia, A. Melchinger, M. Warburton, D. Hoisington,
D. Beck, M. Bohn, and M. Frisch. 2004. Genetic diversity
determined within and among CIMMYT maize populations
of tropical, subtropical, and temperate germplasm by SSR
markers. Crop Sci. 44:326–334.
Rogers, J.S. 1972. Measure of genetic similarity and genetic dis-
tance. Studies in Genetics. VII. Univ. Tex. Publ. 7213:145–153.
Saghai-Maroof, M., K. Soliman, R. Jorgensen, and R. Allard.
1984. Ribosomal DNA spacer-length polymorphisms in bar-
ley: Mendelian inheritance, chromosomal location, and pop-
ulation dynamics. Proc. Natl. Acad. Sci. USA 81:8014–8018.
Salvi, S., G. Sponza, M. Morgante, D. Tomes, X. Niu, K. Fengler,
R. Meeley, E. Ananiev, S. Svitashev, E. Bruggemann, B. Li, C.
Hainey, S. Radovic, G. Zaina, J. Rafalski, S. Tingey, G. Miao, R.
Phillips, and R. Tuberosa. 2007. Conserved noncoding genomic
sequences associated with a flowering-time quantitative trait
locus in maize. Proc. Natl. Acad. Sci. USA 104:11376–11381.
SAS Institute. 2003. The SAS system for windows version 9.1. SAS
Inst, Cary, NC.
CROP SCIENCE, VOL. 51, MARCH– APRIL 2011 WWW.CROPS.ORG
Stracke, S., G. Haseneyer, J. Veyrieras, H. Geiger, S. Sauer, A.
Graner, and H. Piepho. 2009. Association mapping reveals
gene action and interactions in the determination of flower-
ing time in barley. Theor. Appl. Genet. 118:259–273.
Szalma, S., E. Buckler, M. Snook, and M. McMullen. 2005. Associa-
tion analysis of candidate genes for maysin and chlorogenic acid
accumulation in maize silks. Theor. Appl. Genet. 110:1324–1333.
Thornsberry, J., M. Goodman, J. Doebley, S. Kresovich, D. Nielsen,
and E. Buckler. 2001. Dwarf8 polymorphisms associate with
variation in flowering time. Nat. Genet. 28:286–289.
Wang, J., P. McClean, R. Lee, J. Goos, and T. Helms. 2008a.
Association mapping of iron deficiency chlorosis loci in soy-
bean (Glycine max L. Merr.) advanced breeding lines. Theor.
Appl. Genet. 116:777–787.
Wang, R., Y. Yu, J. Zhao, Y. Shi, Y. Song, T. Wang, and Y. Li.
2008b. Population structure and linkage disequilibrium of a
mini core set of maize inbred lines in China. Theor. Appl.
Genet. 117:1141–1153.
Warburton, M., X. Xianchun, J. Crossa, J. Franco, A. Melchinger,
M. Frisch, M. Bohn, and D. Hoisington. 2002. Genetic char-
acterization of CIMMYT inbred maize lines and open pol-
linated populations using large scale fi ngerprinting methods.
Crop Sci. 42:1832–1840.
Wei, X., P. Jackson, C. McIntyre, K. Aitken, and B. Croft. 2006.
Association between DNA markers and resistance to diseases
in sugarcane and effects of population substructure. Theor.
Appl. Genet. 114:155–164.
Weir, B.S. 1996. Genetic data analysis II. Sinauer Associates, Sun-
derland, MA.
Wilson, L., S. Whitt, A. Ibáñez, T. Rocheford, M. Goodman, and
E. Buckler. 2004. Dissection of maize kernel composition and
starch production by candidate gene association. Plant Cell
16:2719–2733.
Xie, C., M. Warburton, M. Li, X. Li, M. Xiao, Z. Hao, Q. Zhao,
and S. Zhang. 2008. An analysis of population structure and
linkage disequilibrium using multilocus data in 187 maize
inbred lines. Mol. Breed. 21:407–418.
Yamasaki, M., S. Wright, and M. McMullen. 2007. Genomic
screening for artificial selection during domestication and
improvement in maize. Ann. Bot. (London) 100:967–973.
Yan, J., T. Shah, M. Warburton, E. Buckler, M. McMullen, and J.
Crouch. 2009. Genetic characterization and linkage disequi-
librium estimation of a global maize collection using SNP
markers. PLoS One 4:E8451.
Yu, J., G. Pressoir, W. Briggs, I. Bi, M. Yamasaki, J. Doebley, M.
McMullen, B. Gaut, D. Nielsen, J. Holland, S. Kresovich, and
E. Buckler. 2006. A unified mixed-model method for associa-
tion mapping that accounts for multiple levels of relatedness.
Nat. Genet. 38:203–208.
Zhao, K., M. Aranzana, S. Kim, C. Lister, C. Shindo, C. Tang, C.
Toomajian, H. Zheng, C. Dean, P. Marjoram, and M. Nord-
borg. 2007. An Arabidopsis example of association mapping in
structured samples. PLoS Genet. 3:E4.
Zheng, P., W.B. Allen, K. Roesler, M.E. Williams, S. Zhang, J.
Li, K. Glassman, J. Ranch, D. Nubel, W. Solawetz, D. Bhat-
tramakki, V. Llaca, S. Deschamps, G.-Y. Zhong, M.C. Tarc-
zynski, and B. Shen. 2008. A phenylalanine in DGAT is a key
determinant of oil content and composition in maize. Nat.
Genet. 40:367–372.
Zhu, C., M. Gore, E. Buckler, and J. Yu. 2008. Status and pros-
pects of association mapping in plants. Plant Gen. 1:5–20.
715