Journal of Cereal Science 49 (2009) 254261

Contents lists available at ScienceDirect

Journal of Cereal Science

journal homepage: www.elsevier.com/locate/jcs

Novel allelic variants encoded at the Glu-D3 locus in bread wheat

M.-J. Appelbee a, b, *, G.T. Mekuria a, c, V. Nagasandra a, b, J.P. Bonneau d, H.A. Eagles a, c, R.F. Eastwood e, D.E. Mather a, c
a

Molecular Plant Breeding Cooperative Research Centre, Grain Quality Research Laboratory, GPO Box 397, Adelaide, SA 5064, Australia South Australian Research and Development Institute, Grain Quality Research Laboratory, GPO Box 397, Adelaide, SA 5064, Australia c Molecular Plant Breeding Cooperative Research Centre and School of Agriculture, Food and Wine, The University of Adelaide, PMB 1, Glen Osmond, SA 5064, Australia d Ecole Nationale dIngenieurs des Travaux Agricoles de Clermont Ferrand, BP 35, 63370 Lempdes, France e Australian Grain Technologies, PMB 260, Horsham, Vic 3400, Australia
b

a r t i c l e i n f o
Article history: Received 20 June 2008 Received in revised form 25 September 2008 Accepted 13 October 2008 Keywords: Glu-3 Glu-D3 Low-molecular weight glutenin Protein Wheat

a b s t r a c t
Low-molecular weight glutenin subunits (LWM-GS) are important components of wheat (Triticum aestivum L.) gluten, with important effects on end-use quality. The LMW-GS are encoded at Glu-3 loci (GluA3, Glu-B3 and Glu-D3, on the short arms of chromosomes 1A, 1B and 1D), each of which exhibits extensive allelic variation. Each locus encodes numerous LMW-GS, some of which have similar electrophoretic mobilities, making it difcult to distinguish among Glu-3 loci. Alleles of the Glu-D3 locus of bread wheat are considered the most problematic to assign. To date, six Glu-D3 alleles, designated a, b, c, d, e and f, have been reported. We report ve previously undescribed alleles (g, h, i, j and k), and describe a method for characterizing them using a combination of SDS-PAGE and multiplexed PCR-based DNA markers. This method could be used for accurate identication of Glu-D3 alleles, permitting the estimation of the effects of these alleles on end-use quality and the selection of desirable alleles and allelic combinations in wheat breeding. Crown Copyright 2008 Published by Elsevier Ltd. All rights reserved.

1. Introduction Polymeric glutenin of wheat (Triticum aestivum L.), when reduced by mercaptoethanol or an equivalent agent, produces two types of monomeric proteins, high molecular weight glutenin subunits (HMW-GS) and low-molecular weight glutenin subunits (LMW-GS) (Colot, 1990). These subunits are further classied into four subgroups corresponding to the A, B, C and D regions of electrophoretic mobility in SDS-PAGE (sodium dodecyl sulphatepolyacrylamide gel electrophoresis) (Gianibelli et al., 2001). The A group corresponds to the HMW-GS, with an apparent molecular weight range of 80130 kDa on SDS-PAGE (but 60 and 90 kDa based on derived amino acid sequences). The B (4251 kDa) and C (30 40 kDa) groups contain the predominant LMW-GS (about 60% of

Abbreviations: 4-VP, 4-vinylpyridine; DTT, dithiothreitol; HCl, hydrochloric acid; HMW-GS, high molecular weight glutenin subunits; LMW-GS, low-molecular weight glutenin subunits; PAGE, polyacrylamide gel electrophoresis; SDS, sodium dodecyl sulphate; Aril, Aroona recombinant inbred line; SA, single allele; EDTA, ethylene diamine tetraacetic acid. * Corresponding author. LongReach Plant Breeders, 13 Commercial Street, Marleston SA 5033, Australia. Tel.: 61 8 08 8293 4833; fax: 61 8 08 8293 4933. E-mail address: mappelbee@longreachpb.com.au (M.-J. Appelbee).

total glutenin), many of which, especially those in the C group, have amino acid sequences similar to those of g- and a-gliadins. The D group (about 58 kDa) contains highly acidic LMW-GS derived from modied u-gliadins (Gianibelli et al., 2001). Most of the B group LMW-GS, and some of the C group LMW-GS, are encoded by sets of closely linked genes at each of the Glu-A3, Glu-B3 and Glu-D3 loci on chromosomes 1AS, 1BS and 1DS, respectively (Gupta and Shepherd, 1988; Jackson et al., 1983; Masci et al., 2002). Early results based on protein-gel electrophoresis indicated that a single hexaploid wheat variety could have 716 LMW-GS (Colot, 1990; Payne et al., 1987). With N-terminal sequencing of protein subunits and Southern analysis using DNA, between 30 and 40 different LMW-GS have been detected in individual varieties (Cassidy et al., 1998; Cloutier et al., 2001; Lew et al., 1992). Allelic designations for LMW-GS are therefore assigned to clusters of genes encoded at the same locus. Identication of LMWGS alleles with protein electrophoresis is complicated by overlapping of subunits encoded at each of the Glu-3 and other minor loci, while the development of DNA markers for identication of LMW-GS alleles is complicated by the sequence similarity of LMWGS genes within and among loci. Signicant advances in the characterization of LMW-GS alleles occurred when Gupta and Shepherd (1988, 1990) studied

0733-5210/$ see front matter Crown Copyright 2008 Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.jcs.2008.10.011

M.-J. Appelbee et al. / Journal of Cereal Science 49 (2009) 254261

255

Table 1 Alleles present at high molecular weight glutenin loci Glu-A1, Glu-B1 and Glu-D1 and at the low-molecular weight glutenin loci Glu-A3, Glu-B3 and Glu-D3 in six single-allele (SA) wheatrye translocation lines, in Aroona and in four Aroona isolines (Aril), and the donor parents for the Glu-D3 alleles. Line SA D3a SA D3b SA D3c SA D3d SA D3h SA D3j Aroona Aril 30-1 Aril 33-1 Aril 35-1 Aril 36-2 Glu-A1 a c b b b a a a a a a Glu-B1 i i i i i i c c c c c Glu-D1 a a a a a a a a a a a Glu-A3 c c c c c Glu-B3 b b b b b Glu-D3 a b c d h j c a d h j Donor of Glu-D3 allele Chinese Spring Bungulla Aroona Jufy-1 India 115 Hira-1 Aroona Chinese Spring Jufy-1 India 115 Hira-2

a collection of 222 hexaploid wheats from 32 countries and documented the 20 different banding patterns (LMW-GS blocks) observed. This led to the production of wheatrye translocation lines for group-1 chromosomes (Gupta and Shepherd, 1993) which incorporated the different protein banding patterns from donor varieties. These lines provided a simplied electrophoretic pattern and allowed closer examination of individual LMW-GS alleles resulting in an unprecedented number of new LMW-GS allelic variants being accurately described. In total, 20 individual Glu-3 alleles were described (6, 9 and 5 allelic variants for Glu-A3, Glu-B3 and Glu-D3, respectively) and these, together with standard varieties, have been recorded in the Gene Symbols Catalogue (McIntosh et al., 2003). One aim of the work presented here is to report ve additional Glu-D3 allelic variants that we have identied so that the allelic designations can be formally assigned and recorded in the Gene Symbols Catalogue. This is very important because it enables standardized classication of Glu-D3 alleles and for future investigations to be reported accurately. The other aim was to describe a protocol for identifying the Glu-D3 alleles using a combination of SDS-PAGE, PCR and multiplexed PCR-based DNA markers. This method can be used to routinely genotype Glu-D3 alleles in wheat varieties and permits the estimation of their effects on end-use quality. Thus providing insight into which Glu-D3 alleles are desirable and should be selected as well as possible favourable allelic combinations in wheat breeding. In addition, since the new alleles Glu-D3g, i and k are present in recently released Australian varieties, estimation of their effects on end-product quality should be a priority.

2. Experimental 2.1. Plant material The plant materials used in this research included six wheatrye translocation lines, four Aril near-isogenic lines and their recurrent parent Aroona, and numerous named wheat varieties (Tables 1 and 3). The wheatrye translocation lines, developed by Dr. K.W. Shepherd (The University of Adelaide) have the short arms of wheat chromosomes 1A, 1B and/or 1D replaced by the short arm of chromosome 1R from Imperial rye, a variety that did not appear to have any LMW-GS. Lines with translocations on two of the chromosomes were selected. With such lines, the electrophoretic bands associated with the single LMW-GS allele on the remaining group-1 chromosome can be more readily identied, as they are not obscured by subunits encoded by loci on the other genomes. The wheatrye translocation lines used in this study all have translocations on chromosomes 1A and 1B but not 1D, making it possible to observe protein subunits encoded at Glu-D3 without interference from those encoded at Glu-A3 and Glu-B3. These single-allele lines are designated SA D3a to SA D3j (Table 1) and possess one of the following Glu-D3 alleles, Glu-D3a, Glu-D3b, Glu-D3c or Glu-D3d as described by Gupta and Shepherd (1993), or a previously undescribed allele, Glu-D3h or Glu-D3j. The Aril near-isogenic lines were derived by 5 backcrosses to Aroona, with selection for particular Glu-1 and Glu-3/Gli-1 alleles from donor varieties. Aroona (Glu-D3c) and four isolines with different Glu-D3 alleles (Glu-D3a, Glu-D3d and the previously undescribed alleles Glu-D3g, and Glu-D3h) were included in this study (Table 1). For the majority of named varieties seed was obtained from the Australian Winter Cereals Collection (Tamworth, NSW, Australia), however seed of Bolac and Ventura was provided by Australian Grain Technologies, seeds of Lincoln and Bullet were provided by LongReach Plant Breeders. Breeders and the EGA Burke sample was provided by the Queensland Department of Primary Industries and Fisheries (Table 3). 2.2. Sample preparation and extraction of DNA and proteins Flour samples from individual grains were prepared for DNA and protein extraction in two ways. When the embryo was to be retained for germination, the grain was cut in two using a scalpel and the non-embryo part was crushed with a hammer. The resulting our samples were transferred to individual wells within a 96-well extraction block. In other cases, entire individual grains were crushed using stainless-steel ball-bearings in 96-well extraction blocks on a MM300 Mixer Mill (Retsch, Haan, Germany). DNA was isolated using the method described by Fox et al. (2003). Protein was extracted from the our residue after DNA extraction.

Table 2 Primer pairs used in a multiplexed PCR assay to distinguish between various Glu-D3 alleles. Primer pair (5 / 3) 1* S13F2/S13R1 CAGCTAAACCCATGCAAGC CAATGGAAGTCATCACCTCAA 2* M2F12/M2R12 TTGGGCCTAATCGCTCGC TAGTCTCCATCTGCGCAATT 3 M4F1/M4R1 GCATCAAAACCAAGCAAAAG GGCTGAACAATAGGGATTTA 4* M4F3/M4R3 AAGTAGTTAGCACCAATCCAT CCTGTTGTTGTTGTTGTTGTT 5* wmc477F/wmc477R TGCGTCGAAAACCGTACACTCTCC CGCGAAACAGAATAGCCCTGATG Reference Zhao et al. (2007b) Concentration 0.2 mM

Zhao et al. (2007a)

0.2 mM

Zhao et al. (2007a)

0.3 mM

Zhao et al. (2007b)

NA

Somers et al. (2004)

0.08 mM

*: Indicates primer pairs included in multiplexed assay.

256

M.-J. Appelbee et al. / Journal of Cereal Science 49 (2009) 254261

Table 3 Wheat lines used in this study, their Glu-D3 allelic designations as determined here and PCR amplication results. Line Glu-D3 allele Primer pair S13F2 S13R1 SA D3a Aril 30-1 Bluebird Chinese Spring Cranbrook Excalibur Inia 66 Sinvalocho SA D3b Baxter Condor Gabo Galaxy Gallo Goldmark* H45 Janz Kukri Mira Nainari 60 Napo 63 Silverstar* Sonora 64A Sunco Suneca Tammin Wyalkatchem Yarralinka SA D3c Aroona Halberd Jaral 66 Lerma Rojo 64 Molineux Schomburgk Stylet Tobari 66 Trident a a a a a a a a b b b b b b b b b b b b b b b b b b b b c c c c c c c c c c U U U U U U U U U U M2F12 M2R12 U U U U U U U U U U U U U U U U U U U U U U U U U U U U M4F1 M4R1 U U U U U U U U U U M4F3 M4R3 SA D3d Aril 33-1 Burnside Calidad Orca Somerset Thatcher Aril 36-2 Burke* CD87-1 Chara-1 Diamondbird* Hartog* Houtman* Hira-1 Kalyansona Pavon F 76 Siete Cerros Sunstate* Rowan* Ventura* SA D3h Aril 35-1 India 115 Bolac Bullet CD87-2 Chara-2 SA D3j Hira-2 Brevor Norin 10 Brevor Penjamo 62 Emu S Lincoln Otane Rubric d d e e e e e g g g g g g g g g g g g g g h h h i i i i j j j j j k k k k Line Glu-D3 allele Primer pair S13F2 S13R1 U U U U U U U U U U U U U M2F12 M2R12 U U U U U U U U U U U U U U U U U U U U U M4F1 M4R1 M4F3 M4R3 U U U U U U U U U U U U U U U U U U U U U U U

*: Descendents of Pavon F 76.

Gliadins were removed by washing 3 times with 1 mL of 50% (v/v) propan-1-ol. Each wash step included 15 min in a sonication bath at 60  C and 10 min centrifugation (10,730g, Sigma 201_M) to pellet the our residue. The glutenin fraction was then extracted from pelleted our residue using 100 mL of 50% (v/v) propan-1-ol: 80 mM TrisHCl (pH 8.0) containing 1% (w/v) dithiothreitol (DTT) followed by 30 min in a 60  C sonication bath. To prevent disulde bonds from reforming and to improve band resolution, the protein subunits were alkylated for 15 min at 60  C sonication with 100 mL 50% propan-1-ol: 80 mM TrisHCl (pH 8.0) containing 1.4% (v/v) 4vinylpyridine (4-VP). This was followed by 10 min centrifugation (10,730g, Sigma 201_M) to pellet the our residue. A 60 mL aliquot of each reduced and alkylated glutenin protein extract was added to 80 mL of sample buffer (0.02% bromophenol blue; 80 mM TrisHCl (pH 8.0); 69 mM SDS) in corresponding micro-titre plate wells which were stored at 20  C prior to electrophoresis. 2.3. Protein electrophoresis SDS-PAGE was conducted according to the method of Singh et al. (1991) with minor modications, using a SE600 vertical

electrophoresis unit (Hoefer, San Francisco, CA USA), with 16 18 cm glass plates separated by a 1 mm spacer. The discontinuous polyacrylamide gel system of Singh et al. (1991) was modied to employ a 3% stacking gel and a 812% gradient acrylamide separating gel with 1.5% cross-linker concentration (bisacrylamide:acrylamide). Gels were loaded with 10 mL of sample and electrophoresis was carried out at approximately 10  C and 40 mA/gel for z3.5 h. Gels were stained overnight in Coomassie brilliant blue R-250 (Singh and Shepherd, 1988) and destained in water for 3 h, aided by the addition of Kimwipes (Kimberley-Clark Australia Pty. Ltd., Milsons Point, NSW, Australia). 2.4. Polymerase chain reaction (PCR) assays Thirteen pairs of oligonucleotide primers (D3F62/D3R66, D3F3/ D3R and D3F71/D3R8 from Table 1 of Zhao et al. (2006), S13F2/ S13R1, S1F1/S1R3, T1F4/T1R1 from Table 2 of Zhao et al. (2007a) and M2F2/M2R2, M2F3/M2R3, M2F12/M2R12, M3F1/M3R1, M3F2/ M3R2, M4F1/M4R1 and M4F3/M4R3 from Table 6 of Zhao et al. (2007b)) were used for PCR amplication. PCR was performed in 12.5-mL reaction volumes containing 100 ng genomic DNA, 1.5 mM

M.-J. Appelbee et al. / Journal of Cereal Science 49 (2009) 254261

257

Lane 250 kD 150

3 4

9 10 11 12 13 14

100

HMW-GS

75

50 D3a D3b D3c D3d D3h D3j

*
37 1DS LMW-GS

MgCl2, 0.25 mM of each primer, 200 mM dNTPs, 1 PCR reaction buffer and 0.5 U Taq polymerase (QIAGEN Pty Ltd, Australia). PCR amplication thermal cycling proles were as described by Zhao et al. (2007a,b), except that annealing temperatures of 62  C, 60  C and 58  C were used for primer pairs M2F12/M2R12, M4F1/M4R1 and M4F3/M4R3, respectively. PCR amplication products were separated by electrophoresis for 45 min at 100 V on 2% agarose gels. Gels were stained with ethidium bromide and visualized under ultraviolet light. A single-tube multiplex PCR assay was developed for simultaneous assay of three of the Glu-D3 markers, S13F2/S13R1, M2F12/ M2R12 and M4F3/M4R3, with a simple sequence repeat marker wmc477 (Somers et al., 2004) included as an internal control (Table 2). The PCR reagent mixture was the same as that described above for the single-marker assays, except that the nal concentrations of the primer pairs were adjusted as shown in Table 2. The thermal cycling prole involved 5 min at 94  C followed by 38 cycles of 94  C for 40 s, 58  C for 40 s, and 72  C for 90 s, and nal extension at 72  C for 5 min. The multiplexed PCR products were separated on 2.5% agarose gel at 100 V for 2 h and visualized under UV light after staining in ethidium bromide. 3. Results

Fig. 1. SDS-PAGE of 1AS and 1BS wheatrye translocation lines. Lanes 1 and 14: Molecular Weight Marker (Precision Plus, BioRad); Lanes 23: SA D3a; Lanes 45: SA D3b; Lanes 67: SA D3c; Lanes 89: SA D3d; Lanes 1011: SA D3h; and Lanes 1213: SA D3j. Filled arrowheads indicate subunits used to identify Glu-D3 alleles. Empty arrowheads indicate missing subunits indicative of Glu-D3h. Asterisk denotes a unique subunit in Glu-D3d.

3.1. LMW-GS characterization using SDS-PAGE SDS-PAGE of the LMW-GS from wheatrye substitution lines showed the different subunit banding patterns associated with six Glu-D3 alleles (Fig. 1), including two of the ve novel variants being described here for the rst time. It is also important to point out that other prolamins may be present in these lines. These include u- and g-gliadins encoded at the Gli-D1 locus, rye secalins encoded at the Sec1 locus as well as the Gli-2 (A, B and D) encoded a- and bgliadins. These proteins are not expected to interfere with LMW-GS resolution because they are extracted prior to the glutenins in SDSPAGE analysis. However, reports of gliadin-like LMW-GS, which appear to be mutated forms of a- and g-gliadins, thought to be encoded by genes either located within the Gli-1 loci or by unidentied loci tightly linked to the Gli-1, suggest that these additional subunits not encoded by the Glu-D3 may also be present in the wheatrye translocation lines (Anderson and Greene, 1997; DOvidio et al., 1995; Masci et al., 2002; Sreeramulu and Singh, 1997). In Fig. 1, lled arrowheads indicate bands that are inherited together and which have been routinely used for many years to identify Glu-D3 alleles in hexaploid wheat, while empty arrowheads indicate positions at which the absence of certain bands is considered indicative of a particular allele. The co-inheritance of the individual Glu-D3 subunits or lack there of, not only with each other but with Gli-D1 encoded u-gliadin subunits as well (not shown), indicates that the genes that encode the subunits of interest here, are on chromosome 1 and not distantly located (e.g. Gli-2 locus on chromosome 6). With the wheatrye translocation lines, Glu-D3d (Fig. 1, lanes 89) can be differentiated from Glu-D3b (Fig. 1, lanes 45) based on a lowmobility subunit (indicated by an asterisk, Fig.1, lanes 89). However, in a hexaploid wheat background, this subunit is obscured by LMW-GS that are encoded on the A and B genomes, so the SDS-PAGE pattern of Glu-D3d cannot be routinely distinguished from that of Glu-D3b. The allele that we are designating Glu-D3h (Fig. 1, lanes 1011) can be readily distinguished from other Glu-D3 alleles based on the absence of protein subunits at all three of the positions indicated by empty arrowheads in lanes 1011 of Fig. 1. In contrast, the allele that we are designating Glu-D3j (Fig. 1, lanes 1213) cannot be differentiated from Glu-D3a (Fig. 1, lanes 23) based on SDS-PAGE alone. Our designation of Glu-D3j as a distinct allele is based on

Lane

10 11 12

HMW-GS

D3c

D3i

D3a

D3g

LMW-GS

Fig. 2. SDS-PAGE showing the two glutenin biotypes present in the wheat variety, Chara, Chara-1 and Chara-2. Lanes 13: Banks (Glu-D3c); Lanes 46: Chara-2 (Glu-D3i); Lanes 79: Cadoux (Glu-D3a); and Lanes 1012: Chara-1 (Glu-D3g). Arrowheads indicate subunits indicative of Glu-D3 alleles.

258

M.-J. Appelbee et al. / Journal of Cereal Science 49 (2009) 254261

Lane 250 kD

10

11

12

13

14

15

150

100 HMW-GS

75

50
B3h B3h A3d A3d B3b D3k D3c A3d A3d B3h A3d D3k A3d D3i A3b B3b B3a D3c A3d A3b B3b B3h A3d

A3a

A3c B3c

37

LMW-GS

D3c

D3a A3d

D3k A3d

D3i A3d

D3i

D3a

A3d D3b D3c D3b

Fig. 3. SDS-PAGE of wheat varieties showing the LMW-GS protein banding patterns associated with Glu-D3i and Glu-D3k. Overlapping Glu-A3 and Glu-B3 subunits are in green. Overlapping Glu-A3 and Glu-D3 subunits are in red. Lane 1: Molecular Weight Marker (BioRad); Lanes 23: Era (Glu-3, ehc); Lanes 45: Bluebird (Glu-3, dha); Lanes 67: Lincoln (Glu-3, dbk); Lanes 89: Bullet (Glu-3, dhi); Lanes 1011: Bolac (Glu-3, bbi); Lane 12: Chinese Spring (Glu-3, aaa); Lane 13: Gabo (Glu-3, bbb); Lane 14: DA 5 10, B3c (Glu-3, ccc); and Lane 15: Wilgoyne (Glu-3, dhb). Filled arrowhead indicates Glu-D3a, Glu-D3k and Glu-D3i subunits. Empty arrowhead indicates Glu-D3b, Glu-D3c and Glu-A3d subunits. (For interpretation of the references to color in this gure legend, the reader is referred to the web version of this article.)

evidence from the use of PCR-based DNA markers, to be presented in Section 3.1 of this paper. The Australian variety Chara is known to be mixed at Glu-D3. It has been historically classied as either Glu-D3a or Glu-D3b, but closer analysis of the two Chara biotypes reveals that both of these assignments are incorrect. The Chara-2 biotype, which has generally been classied as Glu-D3a, actually carries an allele that has not been described before (Fig. 2, lanes 46), which will from now on be referred to as Glu-D3i. The protein subunits encoded by Glu-D3i include one with the same mobility as the one conventionally associated with Glu-D3a (the subunit indicated by lled arrowhead in lanes 46 and 79 of Fig. 2), but also one with the same mobility as a subunit present in either Glu-D3c, Glu-D3k or Glu-D3e. Similar Glu-D3c and Glu-D3i subunits are indicated by empty arrowheads in lanes 13 and 46 of Fig. 2. Notably, the Glu-D3c and Glu-D3e alleles cannot be differentiated from each other using SDS-PAGE (not shown). The Chara-1 biotype also contains a novel allele, designated Glu-D3g (Fig. 2, lanes 1012). Prior to its discovery the Glu-D3g allele would have been misclassied as Glu-D3b since SDS-PAGE alone cannot differentiate Glu-D3g from Glu-D3b or Glu-D3d. Much of what has been described above for the protein banding pattern associated with Glu-D3i also applies to Glu-D3k, another allele that has not been described before. The similar SDS-PAGE banding patterns for these two alleles can be seen in Fig. 3 (lanes 5 10). However, unlike Glu-D3i, the individual protein subunits used

to identify Glu-D3k are not clearly resolved. This is due to the glutenin background in which Glu-D3k was discovered and in particular to the presence of Glu-A3d. This may not be the case in an alternate background. Hence, at present it is not possible to reliably distinguish between the Glu-D3i and Glu-D3k alleles using only SDS-PAGE as it is described in this paper. The variety Hira, which was the donor for one of the wheatrye translocation lines (SA D3j, Fig. 1, lanes 1011) was also the donor for one of the Aril isolines (Aril 36-2, not shown), yet these two lines did not exhibit the same allelic pattern. We found that Hira contains two biotypes: Hira-1 (Fig. 4, lanes 89), which contributed the Glu-D3g allele to Aril 36-2, and Hira-2 (Fig. 4, lanes 23, which contributed the Glu-D3j allele to SA D3j). 3.2. Characterization of Glu-D3 alleles using PCR Of the 13 primer pairs assayed, S13F2/S13R1, M2F12/M2R12, M4F1/M4R1 and M4F3/M4R3 proved to be useful for classifying Glu-D3 alleles. With S13F2/S13R1, a 388-bp (Fig. 5(a)) product of the expected size was amplied from varieties carrying Glu-D3c, Glu-D3e, Glu-D3k and Glu-D3i alleles. With M2F12/M2R12, a product of the expected size (884 bp, Fig. 5(b)) was amplied from lines carrying Glu-D3a, Glu-D3b, Glu-D3d, Glu-D3g or Glu-D3j alleles. For M4F1/M4R1 and M4F3/M4R3 (Glu-D3c and Glu-D3i, Fig. 5(c)) and M4F3/M4R3 (Glu-D3g and Glu-D3i, Fig. 5 (d)), 773 bp and 413 bp products were amplied, respectively. With combined

M.-J. Appelbee et al. / Journal of Cereal Science 49 (2009) 254261

259

Lane 250 kD 150

2 3

7 8

10 11 12 13

100 HMW-GS 75

50

D3j

D3j

D3j

D3g

D3g

D3g

37

LMW-GS

respectively) resolved using gel electrophoresis. Since many of the alleles within these groups can be distinguished using SDS-PAGE when these primers and SDS-PAGE are both employed, it is possible to identify most of the known Glu-D3 alleles (not Glu-D3b from GluD3d and Glu-D3f was not in the present study). In our analysis of named varieties, we detected some alleles that differ from those that had previously been reported for the same varieties. The varieties Hartog, Houtman and Suneca have all been reported to carry Glu-D3e (Zhang et al., 2003; Zhao et al., 2007a,b), but we were unable to nd any evidence to substantiate this classication. Based on both SDS-PAGE and PCR amplication, Hartog and Houtman differ from Suneca and all three differ from the GluD3e standard varieties, Orca and Thatcher (McIntosh et al., 2003; Singh and Shepherd, 1988). We suggest that the Glu-D3 classication of Hartog and Houtman be changed to Glu-D3g and that of Suneca to Glu-D3b (Table 3). Both Hartog and Houtman are derivatives of the CIMMYT line, Pavon F 76, which also carries Glu-D3g allele. Other derivatives of Pavon F 76 included in this study were found to also contain the Glu-D3g allele. There are many descendants of Pavon F 76 among Australian varieties (Cane et al., 2004) but not all the progeny have been erroneously classied. Goldmark and Silverstar (Pavon F 76/TM56) obtained their Glu-D3b allele from TM56 (AUS10894/4*Condor). 4. Discussion

Fig. 4. SDS-PAGE of wheat varieties containing Glu-D3j and Glu-D3g alleles. Lane 1: Molecular Weight Marker (Precision Plus, BioRad); Lanes 23: Hira-2 (Glu-D3j); Lanes 45: Brevor (Glu-D3j); Lanes 67: Penjamo 62 (Glu-D3j); Lanes 89: Hira-1 (Glu-D3g); Lanes 1011: Hartog (Glu-D3g); and Lanes 1213: Chara (1) (Glu-D3g). Filled arrowheads indicate subunits used to identify Glu-D3 alleles.

use of all four primer pairs, it is therefore possible to classify varieties/cultivars as being either Glu-D3c, Glu-D3h or Glu-D3i, and to assign others into one of three groups: Glu-D3a, Glu-D3b or GluD3d, Glu-D3e or Glu-D3k and Glu-D3g or Glu-D3j (Table 4). As shown in Fig. 6, the primers S13F2/S13R1, M2F12/M2R12, M4F3/M4R3 and wmc477 can be assayed in a single multiplex PCR and the PCR products (884 bp, 413 bp, 388 bp and approximately 167 bp,

Alleles present at each of the Glu-1 and Glu-3 loci can have a large combined effect on dough properties and suitability for specic end-products (Appelbee, 2007; Eagles et al., 2006; Gupta et al., 1994). With correct classication of glutenin alleles, it is possible to improve wheat quality by selecting for alleles that exert favourable effects and allelic combinations that involve favourable epistatic interactions (Eagles et al., 2002). For Glu-D3, some research has shown only minor effects on end-use quality traits (Branlard et al., 2003; Eagles et al., 2002; Gupta et al., 1994) while other research has shown more signicant effects (Appelbee, 2007). This discrepancy may be due to difculties associated with the identication of Glu-D3 alleles, which could have led to

Fig. 5. PCR products indicative of Glu-D3 alleles using primer pairs S13F2/S13R1 (A); M2F12/M2R12 (B), M4F1/M4R1 (C) and M4F3/M4R3 (D). Lane M: Molecular size marker (100 bp, Genworks); Lane 1: Chinese Spring (Glu-D3a); Lane 2: Gabo (Glu-D3b); Lane 3: Jufy-1 (Glu-D3d); Lane 4: Aroona (Glu-D3c); Lane 5: Orca (Glu-D3e); Lane 6: Lincoln (GluD3k); Lane 7: Hartog (Glu-D3g); Lane 8: Brevor (Glu-D3j); Lane 9: India 115 (Glu-D3h); Lane 10: Bolac (Glu-D3i); Lane 11: control (no DNA added). PCR products were separated on 2% agarose.

260

M.-J. Appelbee et al. / Journal of Cereal Science 49 (2009) 254261

Table 4 Summary of PCR products obtained with primer pairs used to differentiate between certain Glu-D3 alleles. Glu-D3 alleles Primer pair and amplication product S13F2/S13R1 388 bp a, b and d c e and k g and j h i U U U M2F12/M2R12 883 bp U U M4F1/4R1 773 bp U M4F3/M4R3 413 bp U U

misclassication and a masking of the effects associated with them in the earlier work. The existence of 11 Glu-D3 alleles, each possessing at least 7 distinct protein subunits highlights the complexity of the Glu-D3 locus. This high degree of polymorphism is not surprising considering the locus contains numerous retroelements and is much larger than Glu-A3 and Glu-B3 (Huang and Cloutier, 2008). Here, ve new Glu-D3 allelic variants have been described and for each of these, weve also proposed varieties that would make suitable standards. For Glu-D3g, Hartog would be a suitable standard variety. A standard variety for Glu-D3j would be Brevor. India 115 can be used for Glu-D3h, while Bolac should be the standard for GluD3i, since it is not mixed at Glu-D3 and its Glu-A3 and Glu-B3 subunits do not obscure indicative subunits of Glu-D3i. For Glu-D3k, Lincoln could be used, but its Glu-A3 and Glu-B3 subunits interfere with subunit resolution. Perhaps, in future, an alternative standard can be found. We have shown that some Glu-D3 alleles can be distinguished by conducting PCR amplication with primers designed by Zhao et al. (2007a,b) and that three of the four informative markers can be multiplexed in a single PCR assay. The multiplexed assay provides a convenient tool for routine Glu-D3 screening of wheat germplasm. The inclusion of an internal control conrms PCR success in the absence of amplication products. This is particularly important since Glu-D3h is characterized by the absence of all three amplication products. Depending on the parentage of the

materials to be assayed, and hence the possible alleles expected, this may be all that is required. However, if it is necessary to differentiate Glu-D3a from Glu-D3b and Glu-D3d, to differentiate Glu-D3g from Glu-D3j, or to differentiate Glu-D3e from Glu-D3k, SDS-PAGE will also be needed. In practice, the combination of PCR amplication and SDS-PAGE works efciently, particularly if DNA is extracted from seed and protein is subsequently extracted from the our residue of the same seed sample. Use of a non-embryo portion of the seed can yield adequate DNA and protein for these assays, while still allowing for selected plants to be grown. Unfortunately, we were not able to distinguish Glu-D3d from Glu-D3b although gliadins (Gli-D1) may prove useful, in this study there was only one example variety so no conclusions could be drawn. The allele GluD3f (Ikeda et al., 2006) was not present in the materials used in this study, so it is not known whether it can be identied with the procedures used here. In Australia, Glu-D3 alleles are typically classied as Glu-D3a, Glu-D3b or Glu-D3c, yet we have also detected Glu-D3g, Glu-D3i and Glu-D3k in recently released Australian varieties. Incorrect identication of Glu-D3 alleles could have a signicant impact on wheat breeding programs, especially when the glutenin genotypes of potential parents are used to predict cross-outcomes and to design crosses and selection plans (Cornish et al., 2006; Eagles et al., 2006). For example, the Glu-D3g allele has typically been misclassied as Glu-D3b. A previous study in which Aroona isolines were used to investigate the effects of glutenin alleles on dough rheology found that Glu-D3g reduced the maximum resistance and extensibility of dough relative to Glu-D3a, Glu-D3c, Glu-D3d and Glu-D3h (Appelbee, 2007). Unfortunately, Glu-D3b was not included in that study, so it is not known how the effect of Glu-D3g compares to Glu-D3b. If these two alleles have different effects, then current estimates of the effect of Glu-D3b would be inaccurate. Similarly, Glu-D3i and Glu-D3k have in the past been erroneously classied as being either Glu-D3c or Glu-D3a. With the recent release of the varieties Bolac and Bullet (Glu-D3i) and Lincoln (GluD3k) by two wheat breeding companies, it seems likely that these alleles could increase in importance in commercially grown varieties. The effects of the newly described Glu-D3 alleles on wheat quality need to be estimated. This could be done using sister lines that differ at Glu-D3. We have already identied sister lines that will permit comparisons among Glu-D3b, Glu-D3g, and Glu-D3i, and plan to obtain or develop lines that will permit evaluation of the effect Glu-D3k. In addition, Glu-D3h (also previously undescribed) has been found to exert a signicantly positive effect on rheological quality parameters (Appelbee, 2007). As this allele is currently not present in Australian varieties, efforts have been initiated to increase its frequency in wheat germplasm adapted to Australia. Further, the development of new Aroona isolines designed to possess newly identied alleles, will allow us to compare their effects on quality parameters in a common background. While new wheatrye translocation lines will serve to provide insight into the individual genes, hence protein subunits, associated with each allele. Naturally, a more detailed characterization of the alleles would be obtained if these lines were analyzed using numerous other techniques and not just those used in this paper. Acknowledgments This research was supported by the South Australian Premiers Science and Research Fund and Research Fund and the Molecular Plant Breeding Cooperative Research Centre. The rst author is grateful to Dr. Ken Shepherd, University of Adelaide for developing the genetic stocks used in this study. The authors thank Dr. Bertus Jacobs of LongReach Plant Breeders for providing seed of Bullet and

Fig. 6. PCR products indicative of Glu-D3 alleles using a multiplexed PCR assay involving Glu-D3 primer pairs S13F2/S13R1; M2F12/M2R12 and M4F3/M4R3 and simple sequence repeat marker wmc477. Lane M: Molecular size marker (100 bp, Genworks); Lane 1: Chinese Spring (Glu-D3a); Lane 2: Gabo (Glu-D3b); Lane 3: Jufy-1 (Glu-D3d); Lane 4: Aroona (Glu-D3c); Lane 5: Orca (Glu-D3e); Lane 6: Emu S (GluD3k); Lane 7: Hartog (Glu-D3g); Lane 8: Brevor (Glu-D3j); Lane 9: India 115 (Glu-D3h); Lane 10: Bolac (Glu-D3i); Lane 11: control (no DNA added). For the internal control wmc477, Chinese Spring (Lane 1) has a 167 bp product. PCR products were separated on 2.5% agarose.

M.-J. Appelbee et al. / Journal of Cereal Science 49 (2009) 254261

261

Lincoln as well as Dr. Meiqin Lu of Australian Grain Technologies for seed of Ventura and Mr. John Sheppard of the Queensland Department of Primary Industries and Fisheries for seed of EGA Burke. References
Anderson, O.D., Greene, F.C., 1997. The a-gliadin gene family. II. DNA and protein sequence variation, subfamily structure, and origins of pseudogenes. Theoretical and Applied Genetics 95, 5965. Appelbee, M.-J., 2007. Quality Potential of Gluten Proteins in Hexaploid and Related Wheat Species. PhD thesis, University of Adelaide. Branlard, G., Dardevet, M., Amiour, N., Igrejas, G., 2003. Allelic diversity of HMW and LMW gluten subunits and omega-gliadins in French bread wheat (Triticum aestivum L.). Genetic Resources and Crop Evolution 50, 669679. Cane, K., Spackman, M., Eagles, H.A., 2004. Puroindoline genes and their effects on grain quality traits in southern Australian wheat cultivars. Australian Journal of Agricultural Research 55, 8995. Cassidy, B.G., Dvorak, J., Anderson, O.D., 1998. The wheat low-molecular-weight glutenin genes: characterization of six new genes and progress in understanding gene family structure. Theoretical and Applied Genetics 96, 743750. Cloutier, S., Rampitsch, C., Penner, G.A., Lukow, O.M., 2001. Cloning and expression of a LMW-i glutenin gene. Journal of Cereal Science 33, 143154. Colot, V., 1990. The genes encoding wheat storage proteins: towards a molecular understanding of bread-making quality and its genetic manipulation. In: Setlow, J.K. (Ed.), Genetic Engineering: Principles and methods. Plenum Press, New York, USA, pp. 225241. Cornish, G.B., Bekes, F., Eagles, H.A., Payne, P.I., 2006. Prediction of dough properties for bread wheats. In: Wrigley, C., Bekes, F., Bushuk, W. (Eds.), Gliadin and Glutenin: the Unique Balance of Wheat Quality. AACC International, St. Paul, MN, USA, pp. 243280. DOvidio, R., Simeone, M., Masci, S., Porceddu, E., Kasarda, D.D., 1995. Nucleotide sequence of a g-gliadin type gene from a durum wheat: correlation with a g-type glutenin subunit from the same biotype. Cereal Chemistry 72, 443449. Eagles, H.A., Hollamby, G.J., Gororo, N.N., Eastwood, R.F., 2002. Estimation and utilisation of glutenin gene effects from the analysis of unbalanced data from wheat breeding programs. Australian Journal of Agricultural Research 53, 367377. Eagles, H.A., Cane, K., Eastwood, R.F., Hollamby, G.J., Kuchel, H., Martin, P.J., Cornish, G.B., 2006. Contributions of glutenin and puroindoline genes to grain quality traits in southern Australian wheat breeding programs. Australian Journal of Agricultural Research 57, 179186. Fox, R.L, Warner, P., Eglinton, J.K., 2003. The application of rapid DNA extraction methods for MAS in barley and wheat improvement programs. In: Proceeding of the 53rd Australian Cereal Chemistry Conference, Glenelg, South Australia, pp. 5559. Gianibelli, M.C., Larroque, O.R., MacRitchie, F., Wrigley, C.W., 2001. Biochemical, genetic, and molecular characterisation of wheat glutenin and its component subunits. Cereal Chemistry 78, 635646. Gupta, R.B., Shepherd, K.W., 1988. Low-molecular-weight glutenin subunits in wheat: their variation, inheritance and association with bread-making quality. In: Miller, T.E., Koebner, R.M.D. (Eds.), Proceedings of the 7th International Wheat Genetics Symposium. England, Cambridge, pp. 943949. Gupta, R.B., Shepherd, K.W., 1990. Two-step one-dimensional SDS-PAGE analysis of LMW subunits of glutenin. 1. Variation and genetic control of the subunits in hexaploid wheats. Theoretical and Applied Genetics 80, 6574.

Gupta, R.B., Shepherd, K.W., 1993. Production of multiple wheatrye 1RS translocation stocks and genetic analysis of LMW subunits of glutenin and gliadins in wheats using these stocks. Theoretical and Applied Genetics 85, 719728. Gupta, R.B., Paul, J.G., Cornish, G.B., Palmer, G.A., Bekes, F., Rathjen, A.J., 1994. Allelic variation at glutenin subunit and gliadin loci, Glu-1, Glu-3 and Gli-1, of common wheats. I. Its additive and interaction effects of dough properties. Journal of Cereal Science 19, 917. Huang, X.-Q., Cloutier, S., 2008. Molecular characterization and genomic organisation of low molecular weight glutenin subunit genes at the Glu-3 loci in hexaploid wheat (Triticum aestivum L.). Theoretical and Applied Genetics 116, 953966. Ikeda, T.M., Araki, E., Fujita, Y., Yano, H., 2006. Characterization of low-molecularweight glutenin subunit genes and their protein products in common wheats. Theoretical and Applied Genetics 112, 327334. Jackson, E.A., Holt, L.M., Payne, P.I., 1983. Characterisation of high molecular weight gliadin and low-molecular-weight glutenin subunits of wheat endosperm by two-dimensional electrophoresis and the chromosomal localisation of their controlling genes. Theoretical and Applied Genetics 66, 2937. Lew, E.J.-L., Kuzmicky, D.D., Kasarda, D.D., 1992. Characterization of low molecular weight glutenin subunits by reversed-phase high-performance liquid chromatography, sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and Nterminal amino acid sequencing. Cereal Chemistry 69, 508515. Masci, S., Rovelli, L., Kasarda, D.D., Vensel, W.H., Laandra, D., 2002. Characterisation and chromosomal localisation of C-type low-molecular-weight glutenin subunits in the bread wheat cultivar Chinese Spring. Theoretical and Applied Genetics 104, 422428. McIntosh, R.A., Yamazaki, Y., Devos, K.M., Dubcovsky, J., Roders, W.J., Appels, R., 2003. Catalogue of gene symbols for wheat. In: Proceedings of the 10th International Wheat Genetics Symposium. Istituto Sperimentale per la Cerealicoltura, Rome, vol. 4, 34 pp. Payne, P.I., Nightingale, M.A., Krattiger, A.F., Holt, L.M., 1987. The relationship between HMW glutenin subunit composition and the bread-making quality of British-grown wheat varieties. Journal of the Science of Food and Agriculture 40, 5165. Singh, N.H., Shepherd, K.W., 1988. Linkage mapping of genes controlling endosperm storage proteins in wheat. I. Genes on the short arms of group 1 chromosomes. Theoretical and Applied Genetics 75, 628641. Singh, N.K., Shepherd, K.W., Cornish, G.B., 1991. A simplied SDS-PAGE procedure for separating LMW subunits of glutenin. Journal of Cereal Science 14, 203208. Somers, D.J., Isaac, P., Edwards, K., 2004. A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.). Theoretical and Applied Genetics 109, 11051114. Sreeramulu, G., Singh, N.K., 1997. Genetic and biochemical characterisation of novel low molecular weight glutenin subunits in wheat (Triticum aestivum L.). Genome 40, 4148. Zhang, W., Gianibelli, M.C., Ma, W., Rampling, L., Gale, K.R., 2003. Identication of SNPs and development of AS-PCR markers for g-gliadin alleles in Triticum aestivum. Theoretical and Applied Genetics 107, 130138. Zhao, X.L., Xia, X.C., He, Z.H., Gale, K.R., Lei, Z.S., Appels, R., Ma, W., 2006. Characterization of three low-molecular-weight Glu-D3 subunit genes in common wheat. Theoretical and Applied Genetics 113, 12471259. Zhao, X.L., Ma, W., Gale, K.R., Lei, Z.S., He, Z.H., Sun, Q.X., Xia, X.C., 2007a. Identication of SNPs and development of functional markers for LMW-GS genes at Glu-D3 and Glu-B3 loci in bread wheat (Triticum aestivum). Molecular Breeding 20, 223231. Zhao, X.L., Xia, X.C., He, Z.H., Lei, Z.S., Appels, R., Yang, Y., Sun, Q.X., Ma, W., 2007b. Novel DNA variations to characterise low molecular weight glutenin Glu-D3 genes and develop STS markers in common wheat. Theoretical and Applied Genetics 114, 451460.