Você está na página 1de 4

Universidade Federal do Rio de Janeiro Departamento de Bioqumica Prof Rodrigo Volcan Almeida Lista de Exerccios Bioqumica Escola de Qumica

Estrutura e Replicao 1. Quais so os grupos bsicos formadores de uma molcula de nucleotdeo? 2. Baseado nos conhecimentos sobre a estrutura do DNA e conhecendo uma das fitas (ATG AAT CGC), determine a sua fita complementar. 3. Quantas pontes de hidrognio so formadas entre as bases A.T e G.C. De posse desta resposta explique o porqu de microrganismos hipertermoflicos possurem em geral (mas nem sempre) altos ndices de G+C. 4. Qual a diferena bsica entre a estrutura do DNA e do RNA? Por que o RNA mais instvel? 5. O que Erwin Chargaff observou sobre a composio das bases no DNA? 6. Faa um resumo do artigo publicado por Watson e Crick, na Nature, em 1953, que se encontra disponvel em http://www.nature.com/nature/dna50/watsoncrick.pdf . 7. Quais as principais diferenas entre os tipos de DNA descritos e em que condies podem ser encontrados nas clulas? 8. Faa um resumo de como ocorre o processo de replicao de DNA em procariotos, salientando: o mecanismo de reao e as diferenas entre a cpia das duas fitas de DNA. 9. Como foi visto na aula, a replicao do DNA exige um complexo mecanismo de reparo de nucleotdeos erroneamente pareados. Explique, em poucas palavras, o que poderia acontecer se a replicao no contasse com estes mecanismos. 10. Comente, passo a passo, a experincia de Meselson e Sthal a partir da animao disponvel no stio http://www.dnaftb.org/dnaftb/20/concept/index.html .

Transcrio e Traduo
1. De posse da sequncia do exerccio 2 abaixo, faa os seus respectivos RNAs. Observando os RNAs formados, o que voc diria das protenas que sero formadas: sero iguais ou diferentes?

2. Indicar as regies 10 e 35 e o nucleotdeo de iniciao na fita senso do promotor da tRNA Tyr de Escherichia coli, apresentado abaixo.

5 CAACGTAACACTTTACAGCGGCGCGTCATTTGATATGATGCGCCCCGCTTCCCGATA 3 3 GTTGCATTGTGAAATGTCGCCGCGCAGTAAACTATACTACGCGGGGCGAAGGGCTAT 5 3. Introns so lixo gentico? Por que? 4. A figura apresentada abaixo uma micrografia eletrnica e uma interpretao esquemtica de um hbrido entre a fita anti-senso do gene da ovoalbumina de galinha e seu correspondente mRNA, resultante dos estudos do grupo de Pierre Chambon, que mostrou a existncia de introns neste gene. A existncia destas seqncias intervenientes foi demonstrada independemente por Phil Sharp e Rich Roberts, em 1977, apesar da idia parecer inicialmente estranha! A partir disto, identifique os smbolos e nmeros indicados na figura e explique por que processo eles so formados.

5. Especifique a protena codificada na seqncia de DNA da fita anti-senso que

est mostrada abaixo. Assuma que a traduo inicia no primeiro cdon da sequncia. 5 TCTGACTATTGAGCTCTCTGGCACATAGCA 3 Se o DNA acima for uma seqncia da fita senso, a protena codificada ser diferente? Explique e determine a protena, caso ela seja diferente. 6. Indique os stios de controle da traduo e a seqncia de aminocidos especificada no mRNA procaritico apresentado abaixo. 5 CUGAUAAGGAUUUAAAUUAUGUGUCAAUCACGA

AUGCUAAUCGAGGCUCCAUAAUAACACUUCGAC 3 7. Como vimos, os mRNAs de bactrias so geralmente policistrnicos, isto , cada mRNA codifica mais de uma protena. Considere um mRNA que codifica duas protenas e que contm uma seqncia interna no codificante. Sabendo como opera o processo de transcrio e traduo, explique por que o resultado final da traduo deste mRNA policistrnico seria duas protenas separadas ao invs de uma nica protena mutante hbrida. 8. Clulas da bactria Escherichia coli foram cultivadas em meios com diferentes fontes de carbono (glicose e lactose), com concentraes iniciais conhecidas dos acares no meio de cultivo. Aps crescimento da bactria at sua fase exponencial, duas alquotas de clulas de cada um dos meios foram coletadas, centrifugadas, lavadas e ressuspensas em diferentes frascos contendo apenas tampo fosfato e com a presena de glicose na primeira alquota e lactose na segunda, para as clulas cultivadas nas duas fontes de carbono. Note que as clulas inicialmente cultivadas em glicose so submetidas a diferentes meios, ou com glicose ou com lactose, em condies que no permitem a represso catablica nem a induo de sntese protica, e o mesmo feito com as clulas inicialmente cultivadas em lactose. Que resultados so esperados em termos de consumo de acar contido no tampo nas quatro diferentes condies experimentais? Explique as bases para a sua proposta. Lembre-se que as enzimas da via glicoltica, para degradao de glicose a piruvato, so constitutivas. 9. Um organismo selvagem foi exposto radiao ionizante e seu DNA foi sequenciado, sendo observadas mutaes em um gene responsvel pela codificao de uma enzima da rota de sntese de um aminocido essencial, que originaram cepas com genes mutantes diferentes, que so mostrados abaixo. 5 ATGATTGCGGTGTTACGCGGATGGTGCTTATTATGA 3 (cepa selvagem) 5 ATGATTGCGGTGTTGCGCGGATGGTGCTTATTATGA 3 (cepa mutante 1) 5 ATGATTGCGGTGTTCCGCGGATGGTGCTTATTATGA 3 (cepa mutante 2)

Quando estes mutantes foram colocados em um meio de cultivo sem a presena deste aminocido essencial, observou-se que somente uma delas cresceu e a outra no. Determine a estrutura primria das protenas das trs cepas e explique o resultado obtido. Observe que as sequncias apresentadas so da fita senso. Considere que a traduo comea no primeiro cdon. 10. Por que a maioria dos organismos possuem em torno de 45 tRNAs quando temos uma combinao de 61 cdons possveis? 11. Qual a importncia do conhecimento da frequncia do uso de cdons de um gene a ser clonado e do hospedeiro, quando busca-se obter um organismo geneticamente modificado. Tecnologia do DNA recombinante

1. Procure na internet os mapas dos plasmdeos pGEM-T, pET28a, e pBAD. Identifique nestes mapas os principais componentes destes plasmideos (i.e. origem de replicao, marca seletiva, etc...) 2. No exerccio 1 foram indicados vrios plasmdeos de clonagem, todos comerciais e patenteados. Sob o ponto de vista da engenharia, vivel desenvolver/implementar um processo que empregue vetores comerciais? Discuta (livremente) esta questo. 3. Voc pretende clonar o gene do Fator VIII humano. Enumere a estratgia de clonagem desde o mtodo de isolamento do gene, passando pelo vetor de expresso, purificao e hospedeiro. 4. Como voc faria para estudar a localizao de uma protena utilizando as ferramentas de biologia molecular? 5. Explique passo a passo a reao de PCR. 6. Explique passo a passo o sequenciamento de DNA.