Você está na página 1de 69

Biologia Molecular

TRANSCRIÇÃO E TRADUÇÃO DE PROTEÍNAS

email: fabianak@ufpel.edu.br

FABIANA SEIXAS

ABORDAGENS...
1. Replicação do DNA

2. Célula Eucariótica X Célula Procariótica 3. Transcrição; 4. Tradução.

Replicação
DNA
Trasncrição Reversa

DNA
Transcrição RNA Tradução Proteína

Transcrição • É o processo pelo qual uma molécula de RNA é sintetizada a partir da informação contida na sequência de nucleotídeos de uma molécula de DNA de fita dupla .

“A Transcrição representa a diversidade e a complexidade da expressão dos genes contidos em um determinado genoma” “ É principalmente na transcrição que a célula exerce o controle da expressão gênica” .

DOGMA .

Célula Eucariótica .

Célula Procariótica .

PROCARIOTO X EUCARIOTO .

-A. .G.RNA -Fita Simples.Ribose .U.C.

Estrutura do RNA  mRNA – 1 a 5 % do RNA total  rRNA – 75 % do RNA total  tRNA – 10 a 15 % do total tRNA  hnRNA – RNA heterogêneo nuclear  snRNA – RNA pequeno nuclear rRNA .

• TERMINAÇÃO – quando seqüências no DNA são reconhecidas e a síntese é interrompida. reconhecimento de • ALONGAMENTO – quando os ribonucleotídeos são sucessivamente incorporados. .FASES DA TRANSCRIÇÃO • INÍCIO – quando ocorre seqüência específica no DNA.

RNA POLIMERASE  Fator  (sigma)     ’ Core  Haloenzima .

RNA POLIMERASE .

Fator sigma .

FATOR SIGMA .

Estrutura de um Gene Promotor DNA Região Codificadora Terminador Ribossomo RNA PROTEÍNA .

ESTRUTURA DE UM GENE DE EUCARIOTO DNA Promotor Região Codificadora Sítio de PoliA hnRNA RNA Intron AAAAAAAAAA Exon mRNA AAAAAAAAAA .

. coli -35 -10 +1 TTGACA .CARACTERISTICAS DE UM PROMOTOR DE E.TATAATATCGATTTAGATCCCATGAT • Região – 10: T A T A A T • Região – 35: T T G A C A • As duas regiões são separadas por 17±1 nucleotídeos • O primeiro nucleotídeo (+1) é geralmente uma purina (A ou G) ..

PROMOTORES DE GENES BACTERIANOS .

-10 9 nucleotídeos .

TRANSCRIÇÃO .

• Desnaturar o DNA expondo a seqüência a ser copiada.FUNÇÕES DA RNA POLIMERASE • Reconhecer o promotor. • Manter o híbrido DNA:RNA estável. . • Manter as fitas de DNA separadas na região da síntese. • Renaturar o DNA na região imediatamente posterior à síntese. • Terminar a síntese do RNA.

TRANSCRIÇÃO .

TRANSCRIÇÃO .

TRANSCRIÇÃO .

TÉRMINO DA TRANSCRIÇÃO • Independente da proteína rho () (90% dos casos) • Dependente da proteína rho () 5’ CCCAGCCCGCCTAAGCGGGCTTTTTTTTGAC 3’ 3’ GGGTCGGGCGGATTCGCCCGAAAAAAACTG 5’ Pareamento A-U .

.

ENZIMAS DE RESTRIÇÃO .

RNA MENSAGEIRO ANTISENSE .

DNA fita codificadora DNA fita molde RNA transcrito Animação replicação/transcrição .

Código Genético e Sintese de Proteínas .

CÓDIGO GENÉTICO • É a relação entre a seqüência de bases no DNA e a seqüência de aminoácidos na proteína .

CÓDIGO GENÉTICO UUU UUC UUA UUG CUU CUC CUA CUG AUU AUC AUA AUG GUU GUC GUA GUG Phe Phe Leu Leu Leu Leu Leu Leu Ile Ile Ile Met Val Val Val Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Ser Ser Ser Pro Pro Pro Pro Thr Thr Thr Thr Ala Ala Ala Ala UAU Tyr UAC Tyr UAA stop UAG stop CAU His CAC His CAA Gln CAG Gln AAU AAC AAA AAG Asn Asn Lys Lys UGU UGC UGA UGG CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Cys Cys stop Trp Arg Arg Arg Arg Ser Ser Arg Arg Gly Gly Gly Gly GAU Asp GAC Asp GAA Glu GAG Glu .

. • Utilização preferencial de códons (codon usage). • Degeneração – um mesmo aminoácido pode ser codificado por vários códons diferentes. • Universalidade – o código genético é o mesmo nos mais diversos organismos (exceção: protozoários ciliados e mitocondiras).CÓDIGO GENÉTICO Características • Pareamento códon:anticódon. • Não ambigüidade – cada códon corresponde a somente um aminoácido.

CÓDIGO GENÉTICO .

via RNAt. na sequência de aminoácidos que constituem a proteína. • Intervenientes: • • • • • RNAm RNAt Ribossomas (RNAr) Aminoácidos Sistemas enzimáticos .TRADUÇÃO • Consiste na transformação da mensagem contida no RNAm.

31 proteínas) • Total 70S • Eucariotos – Subunidade 40S (rRNA 18S) – Subunidade 60S (rRNA 28S.ESTRUTURA DOS RIBOSSOMOS • Procariotos – Subunidade 30S (rRNA 16S. 5. 21 proteínas) – Subunidade 50S (rRNA 23S e 5S.8S e 5S) • Total 80S .

ESTRUTURA DOS RIBOSSOMOS Ribossomos .

.

tRNA -Estrutura secundária com grampos e alças formando um trevo -Alto número de bases modificadas depois da sua transcrição .

tRNA .

tRNA .

.

Como é resolvida a questão dos 21 códons restantes? .Existem 61 códons e 40 tRNAs.

.

Trasncrição Tradução .

Iniciação – 2.Etapas da tradução • A síntese proteica ocorre em 3 etapas sucessivas: – 1. Alongamento – 3. Finalização .

.

.3’ RBS ou Seqüência Shine-Dalgarno (raramente GUG ou UUG) Códon de iniciação .RIBOSSOMAS Sítio de ligação do ribossomo e códon de iniciação 5’ ...AGGAGGxxxxxxxAUG..

Início da tradução .

tRNA Met-tRNA .AminoaciltRNAsintetase Aminoacil.

.

INICIAÇÃO .

INICIAÇÃO .

ALONGAMENTO Tradução .

ALONGAMENTO Tradução .

TERMINAÇÃO

Antimicrobianos
“Substância produzida por um organismo ou obtida sinteticamente que, em soluções diluídas, destrói as bactérias e outros microrganismos ou inibe o seu desenvolvimento.”
ANTIBIÓTICOS

Classificação dos Antimicrobianos
Com base no mecanismos de ação:
1. Parede bacteriana: inibição da síntese da parede; 2. Membrana celular: alteração da permeabilidade seletiva 3. Ribossomos: alteração na síntese ou interrupção da síntese protéica; 4. DNA e RNA: inibição da síntese do material genético; 5. Metabólitos: inibição da síntese de metabólitos essenciais.

Agentes Antimicrobianos .

Atua em Células em crescimento Penicilinas .Agentes Antimicrobianos 1. Inibição da Síntese de Parede Celular .Impedem a síntese completa da Peptideoglicana .

Agentes Antimicrobianos 1.Inibição da Síntese de Parede Celular Penicilinas .

Lesão na Membrana Plasmática  Ligação com fosfolipídeos  Alteração da Permeabilidade  Ruptura da Membrana Polimixina B .Agentes Antimicrobianos 2.

3. Ribossomos (inibição da síntese de proteínas) .

DNA e RNA: Inibição da replicação e transcrição Rifampicina e Quinolonas Podem interferir com DNA e RNA das células eucarióticas .Agentes Antimicrobianos 4.

Fólico Inibição Acidos Nucleicos Aminoácidos Sulfas . Paraminobenzóico) Enzima + antibiótico Ac.Agentes Antimicrobianos 5. Inibição da Síntese de Metabólitos Essenciais PABA (Ac.

Inibe a iniciação .Inibe a ligação do aminoacilRNAt ao sítio A do ribossoma . actuando como um análogo do aminoacilRNAt .Inibe a actividade da peptidil transferase .Provoca a terminação prematura da cadeia.Liga-se à subunidade 50S do ribossoma e inibe a translocação .Provoca erro na leitura do RNAm .Inibe a actividade da peptidil transferase Puromicina Cicloheximida Procariótica e Eucariótica Eucariótica .Antibióticos e Síntese Proteica Antibiótico Estreptomicina Tetraciclina Cloranfenicol Eritromicina Células-alvo Procariótica Procariótica Procariótica Procariótica Efeito .