Você está na página 1de 43

AULA 6:

SÍNTESE PROTÉICA
O Fluxo da Ação Gênica
1. A Síntese Protéica

Introdução: A necessidade de síntese das células

• A Síntese Protéica depende dos genes presentes no DNA de cada


célula e de todo um aparato enzimático necessário para a
transcrição e tradução.
• No processo de diferenciação celular, fatores de crescimento e
diferenciação, hormônios, neurotransmissores e fatores da matriz
extracelular podem induzir uma cascata de sinais intracelulares que
alteram a expressão gênica da célula.
• Isso é controlado por fatores de transcrição que ativam ou
reprimem diferentes genes.
• Assim, após esse processo, um hepatócito expressará genes
diferentes daqueles expressos em um neurônio.
• A transcrição depende de enzimas que produzirão o RNA
mensageiro a partir do DNA. O RNA mensageiro migrará através do
complexo de poros nucleares para o citoplasma, onde ocorrerá a
síntese protéica.
Ação gênica:

Replicaçã DNA
o
Transcriçã Transcriçã
o o
Reversa
RNA
Replicação
do RNA
Traduçã
o

Proteína
• Replicação: síntese de DNA;

• Transcrição: síntese de RNA, 1 fita cópia do DNA;

• Tradução: síntese de polipeptídio, ditada pela seqüência de nucleotídeio da


molécula de RNAm.
Ação gênica:

GENÓTIP
O

FENÓTIP
O
O DNA contém desoxinucleotídeos de

A denina, C itosina, G uanina e T imidina.


RNA

• É uma macromolécula de ácido nucléico de longa cadeia, mas difere do DNA


em três propriedades:
• O açúcar presente é a ribose em vez da desoxirribose
• A base nitrogenada do RNA é a URACILA, (que se liga com a adenina)
• É formado por uma fita única
Transcrição : síntese de RNA

Os nucleotídeos de RNA se unem pelo fosfato e pela ribose.


À medida que a molécula de RNA vai sendo construída e se afasta da cadeia ativa
do DNA que serviu de molde, a molécula de DNA se reconstitui.
Três tipos de RNA fazem parte do processo de síntese de
proteínas:

• RNA mensageiro – envolvido com o processo de transcrição


(moldado pelo DNA)
- transporta a informação genética do DNA até os ribossomos

• Ribossomos = RNA + proteínas = RNA ribossômico

• RNA transportador - tem a função de traduzir a seqüência de


nucleotídeos do RNAm em uma seqüência de aminoácidos na
proteína. O RNAt carrega os aminoácidos até os ribossomos,
onde eles serão ligados a um polipeptídeo em crescimento.
Tradução
O DNA guarda as informações para a síntese protéica;
• O RNA leva estas informações para o citoplasma, local onde
ocorre efetivamente a síntese das proteínas.

• A ordem dos aminoácidos ao longo da cadeia protéica determina a


função desta nova proteína; portanto o mecanismo que mantém
esta ordem durante a síntese é crítico.

• A síntese protéica ocorre de modo semelhante em todas as


células;
• Três tipos de RNA desempenham um papel cooperativo;
• RNA mensageiro codifica a informação genética (contida no DNA),
sob a forma de uma sequência de bases que por sua vez
especifica uma sequência de aminoácidos;
• A síntese, ou tradução protéica, é um processo que requer um
filamento de RNA mensageiro (RNAm), RNA´s transportadores e
subunidades ribossômicas.

• As subunidades ribossômicas associam-se ao RNAm, formando o


Polirribossoma, estrutura composta de uma fita de RNAm e cerca de
15 ribossomos aderidos, que possibilita a síntese de um grande
número de moléculas protéicas ao mesmo tempo.
Tradução: síntese de proteínas

• Os aminoácidos constituintes da proteína nascente são capturados no meio através dos


RNA transportadores, que possuem os anti-códons, que são trincas de bases
nitrogenadas que se paream com os códons presentes na molécula de RNA mensageiro.
• Uma vez incorporado o aminoácido na nova proteína, o RNA transportador se separa da
maquinaria de síntese protéica.
Papel adaptador dos tRNAs:
• RNA transportador é a chave para o código: os aminoácidos
especificados pela sequência de bases do mRNA são
carregados e depositados na extremidade em crescimento
da cadeia polipeptídica por moléculas específicas de tRNA;
O RNAm leva para o citoplasma o código genético contido no DNA, que é o responsável pela
sequência de aminoácidos na proteína.
O RNAt tem como função identificar e transportar os aminoácidos até os ribossomos.
• RNA ribossômico se combina com um conjunto de proteínas para
formar os ribossomos, que tem sítios para ligação de todas as
moléculas que devem interagir durante o processo de síntese proteíca
(fatores proteícos, mRNA e tRNA)

• Os ribossomos ligados aos tRNAs e proteínas específicas podem se


mover, fisicamente, sobre moléculas de mRNA para traduzir as
informações codificadas.

• Tradução: refere-se a todo o processo pelo qual a sequência de bases


de um mRNA é usada para unir aminoácidos para a formação de uma
proteína.
Linguagem Genética:
• Informação genética
• seqüência de nucleotídeos relacionada à
expressão de um fenótipo qualquer

• Código Genético
• modo pelo qual os nucleotídeos e os
aminoácidos se relacionam

• GENE: sequência de nucleotídeos organizada,


contendo elementos de iniciação, terminação,
íntrons e exons, de modo que após a
transcrição e a tradução produzem uma
sequência protéica funcional.
Linguagem Genética:
• Sinais genéticos
– seqüências especiais de nucleotídeos
• sinais de transmissão da informação genética:
– origem de replicação - oriC
– região do centrômero (segregação dos cromossomos)

– Sinais de expressão da informação genética


• regiões promotoras – TATA boxes
• regiões de regulação – códons de término

• Os sinais genéticos não são universais, variam


com o tipo de organismos considerados
Código Genético:
• Decifração - NIREMBERG et al. (1961)

• Códons de 3 nucleotídeos (letras) do RNAm que


determina cada aminoácido da sequência protéica a
ser sintetizada.
– Existem 64 combinações de bases possíveis
– Existe + de um códon para o mesmo aa (degeneração)
• Anti-códon: é a sequência de pareamento de
nucleotídeos do RNAt que se combina com o RNAm
trazendo o aa específico para cada códon.
Código Genético

• A constituição da proteína sintetizada depende diretamente do


código genético, revelado no RNA pela sequência de códons.

• Códons são trincas (tríplets) (UAA, UGA ou UAG) de


nucleotídeos que se relacionam especificamente com os 20
aminoácidos usados na síntese de proteínas.

• O número de códons na fita de RNAm determina o tamanho da


proteína. Existem, ao todo, 64 códons. Como existem mais
códons (64) que aminoácidos (20), quase todos os aminoácidos
podem ser reconhecidos por mais de um códon, isso porque
algumas trincas de nucleotídeos atuam como sinônimos.

• O local onde ocorre a síntese protéica está relacionado com o


destino da proteína produzida.
• Existem 20 aminoácidos diferentes na
composição das células.

• Estes quatro nucleotídeos não podem


especificar o arranjo de 20 aminoácidos
existentes, mas grupos de bases
nucleotídicas podem simbolizar cada
aminoácido.

• Se um grupo de três nucleotídeos fosse


usado para cada aminoácido, então 64 (43)
grupos seriam formados, de modo que
haveria um número mais que suficiente
para codificar os 20 aminoácidos.

• Cada grupo de três nucleotídeos é


chamado de códon.
• Como há 61 códons para 20 aminoácidos, muito aminoácidos
são codificados por mais de um códon. De fato a leucina,
serina e arginina tem 6 códons cada.

• Os códons diferentes para um mesmo aminoácido são


chamados de sinônimos, e o código é dito regenerado, o que
significa que há redundância.

• Todas as proteínas de procariotos e eucariotos começam


com um mesmo aminoácido - a metionina, cujo códon é AUG.

• Um mRNA especifica uma cadeia linear precisa de


aminoácidos em uma proteína e também sinaliza onde
começar e onde parar a síntese da cadeia polipeptídica.
Código Genético
Descrição das degenerações
O Código Genético
mutações nos códons

alterações nas 3ªs


letras não gera
substituções

alterações nas 1ªs Códons de


Terminação
letras geram
substituições de aa
com propriedades
físico-químicas
semelhantes

alterações nas 2ªs


letras geram
substituições de aa
não relacionados
Códon de
iniciação
Propriedades:
• Código não universal
– exceções à universalidade:
• códon UAG
– procariotos – códon de termino
– eucariotos – codifica para triptofano

• códon CUN
– procariotos – codifica para treonina
– eucariotos – codifica para leucina
Propriedades:
• códons especiais

– AUG – codifica para fMET – o aa iniciador

– UAG, UAA, UGA – códons de término


para procariotos
Propriedades:
• perda de fase (frameshift): quando há modificação na sequência de leitura do
DNA pela inserção ou deleção de pb.

– deleções ou inserções de bases


• ex:

normal – AUGGCUUCUGCGCAGAUUAGGCAC ...


mutant – AUGGCUU CUGCGGCAGAUUAGGCAC ...
A

Inserção
A
a. Regulação da Síntese Protéica
A síntese de proteínas pode ser dividida em três etapas:

• A etapa de iniciação é regulada por proteínas citosólicas denominadas fatores de


iniciação agem no reconhecimento do RNAm pelo subunidade menor do
ribossomo, e sua ligação ao RNAm. Um outro fator de iniciação, media a ligação
das duas subunidades ribossômicas no RNAm, ao final da etapa de iniciação,
após o desligamento dos outros IF´s.

• A etapa de elongamento começa quando o segundo RNAt se aproxima do sítio A


do ribossomo, se unindo ao RNAm. Esta reação é mediada por um fator de
elongamento, e consome energia. Um outro fator de elongamento, é responsável
pela translocação, isto é, o deslocamento do ribossomo pelo RNAm.

A etapa de terminação determina a conclusão da síntese da proteína, quando o
ribossoma atinge o códon de terminação (UAA, UGA ou UAG). Isto faz com que o
sítio A seja ocupado por um fator de terminação: impedindo a ligação de um
outro RNAt. Depois disto ocorre o desprendimento do polipeptídeo, que
depende de outro fator de terminação.
Transcrição:
• Maturação de mRNAs

– adição do capacete G
(RNA primário)

– adição do poli – A e
retirada dos íntrons:
“splicing” (RNA
maduro)
“Splicing” do gene de ovoalbumina

1 a 7 = íntrons A a G = éxons

CAP G

Clivagem dos Poli A


íntrons

RNA maduro
Transcrito primário

• procariotos

DNA
Transcrito primário

• eucariotos
b. Síntese de proteínas destinadas ao RER

• As primeiras etapas da síntese de uma proteína ocorrem sempre em


ribossomas livre no citosol, mesmo se ela for destinada ao RER.

• A ligação do ribossoma ao RER se dá logo após o início da tradução,


quando emerge, da proteína em construção, um peptídeo sinal. Este
direciona e possibilita, através de sua ligação à partícula de
reconhecimento do sinal, a união do complexo ribossomo-proteína ao
RER.

• Desta forma, toda proteína que contém um peptídeo sinal é liberada


na luz do RER, depois de concluída a sua síntese.
As proteínas destinadas à inserção na membrana do RER também
possuem sinais específicos. Além do peptídeo sinal, possuem um ou
mais sinais adicionais, que possibilitam a ancoragem (sinal de
ancoragem) e a situação destas proteínas transmembranas.

• De acordo com a natureza da proteína, ela permanecerá na membrana


do RER, ou passará, através do sistema de vesículas, para outra
organela (CG, endossoma) ou à MP.
• Um Peptídio Sinal, pequena sequência de aminoácidos na porção N-terminal
ou C-terminal da proteína, vai endereçar a proteína a diferentes locais das
células.
- Assim, proteínas destinadas ao núcleo celular, às mitocôndrias e aos
peroxissomos são sintetizadas em Polirribossomas livres.
- As proteínas que precisam ser empacotadas e enviadas para fora da célula
(proteínas de superfície da Membrana Plasmática, ou que constituirão o
conteúdo dos lisossomas e de outros componentes do sistema de
endomembranas) serão sintetizadas no RER.
Variação Genética
Se todos os membros de uma espécie têm o mesmo conjunto de
genes, como pode haver variação genética?
R.: Pela presença de ALELOS, que são formas diferentes do
mesmo gene, encontrados na mesma posição cromossômica.
• Tipos de variação genética:
a) descontínua: uma característica encontrada numa população
em 2 ou mais formas distintas e separadas (fenótipos). Estes
fenótipos em geral são codificados pelos alelos de um gene
(polimorfismo). Exemplo : albinismo
b) Contínua: mostra uma gama não interrompida de fenótipos na
população (curva de distribuição em forma de sino). Ocorre
com característica mensuráveis como altura, peso, podendo
sofrer a influência do ambiente e não só a genética.
Exercícios
1. O gene para a proteína humana albumina ocupa uma região cromossômica de 25.000
pares de nucleotídeos (25 quilobases, ou kb) desde o começo da seqüência codificante
da proteína até o final da seqüência codificante, mas o RNA mensageiro para esta
proteína tem só 2,1 kb de tamanho. O que você acha que explica esta enorme diferença?
2. Se um códon no mRNA é 5'-UUA-3', desenhe o anticódon do tRNA que se ligaria a este
códon (marque as pontas 5' e 3').
3. Considere o seguinte segmento de DNA: 5'GCTTCCCAA 3'
3'CGAAGGGTT 5'
Suponha que o filamento de cima é o molde usado pela RNA polimerase. Responda: Ele
seria transcrito da esquerda para a direita como desenhado, ou da direita para a
esquerda?
4. Nos humanos, um tipo de miopia (uma anomalia ocular) é dependente de um gene (M). O
gene normal é m. Supondo que os genes estão situados em cromossomos, desenhe
(colocando os genes em cromossomos homólogos) uma reprodução entre uma mulher
com miopia que é geneticamente Mm e um homem normal (mm). Mostre os tipos de
gametas que cada genitor pode produzir e resuma os resultados esperados desta
reprodução.
5. Em humanos, uma anomalia do intestino grosso chamada polipose intestinal é dependente
do gene A, e um distúrbio neurológico chamado doença de Huntington é determinado pelo
gene H. Os genes normais são a e h, respectivamente. Um homem que é Aa hh casou-se
com uma mulher que é aa Hh. Suponha que A e H estejam em cromossomos não-
homólogos. Represente a constituição cromossômica dos dois genitores e os gametas
que cada um produziria. Que gametas formariam um zigoto que tem um A e um H?
6. Seria esperada uma variabilidade genética maior entre organismos de reprodução
assexuada, organismos autofecundantes, ou organismos bissexuais? Explique.
Bibliografia
• A célula 2001...

ROBERTIS, E. M. F. De. & HIB, Jose. Bases da Biologia Celular e
Molecular. 3 ed. Rio de Janeiro: Ed. Guanabara Koogan S. A. 2001.

• JUNQUEIRA, & CARNEIRO. Biologia Celular e Molecular.

• Alberts et al Biologia Molecular da Célula

• Raven, P. Biologia Vegetal cap. 11