Você está na página 1de 53

CIDOS

NUCLEICOS
MACROMOLCULAS
ORGNCIAS
I. DEFINICIN:
Biomolculas orgnicas pentarias
formados por C,H,O,N,P.
Constituidas por
cientos o miles de
unidades
estructurales
llamadas nucletidos.
II. FUNCIONES
1. Almacenan
informacin
hereditaria para
la formacin de
rasgos biolgicos
de un organismo.
2. Transmiten caractersticas de
generacin en generacin.
3. Permite la evolucin biolgica y
diversificacin de las especies.
4. Permite la diferenciacin entre
tejidos.
III. COMPOSICIN O ESTRUCTURA
MOLECULAR
Formada por una o dos cadenas de
miles de nucletidos
NUCLETIDOS
Monmero de los
cidos nuclicos
compuestos por:
cido fosfrico
Pentosa
Base nitrogenada
Nucletido
CIDO FOSFRICO (H
3
PO
4
)
Responsable del
carcter cido de
los cidos nuclicos.
Posee tres grupos
OH.
Sirve para unir los
nucletidos entre s.
GLCIDO: PENTOSA
Azcar de 5 carbonos que puede ser:
Ribosa en el ARN
Desoxirribosa en el ADN
Constituye el esqueleto principal (central) de
los cidos nucleicos.
Desoxirribosa
Ribosa
BASES NITROGENADAS
Componentes cclicos de Nitrgeno y
Carbono en sus anillos.
Pueden ser purinas o pirimidinas
PURINAS
Posee 2 anillos cclicos.
Son la Adenina (A) y la Guanina (G)
9
9
PIRIMIDINAS
Posee un anillo cclico
Son la Timina (T) citosina (C) y Uracilo
(U).
1
Timina
Citosina
Uracilo
ADN
ARN
NUCLESIDOS
Es la unin de una base nitrogenada (purina
o pirimidina) con un azcar (pentosa).
Es decir, el nuclesido fosforilado es un
nucletido.
NUCLESIDO = Base nitrogenada + Pentosa
NUCLETIDO = NUCLESIDO + Ac. Fosfrico
Unin base Pentosa
Entre C
1
de la
pentosa y el N
9

de las purinas o el
N
1
de las
pirimidinas.
Forman
nuclesidos
NUCLESIDO
9
1
FORMACIN DE UN NUCLETIDO
(Unin nuclesido cido fosfrico)
El cido fosfrico se une con la pentosa en el
C5.
Clasificacin de los nucletidos:

* Segn el tipo de pentosa:
Ribonucletidos: Si poseen RIBOSA
Desoxirribonucletidos: Si poseen
DESOXIRRIBOSA.
* Segn el nmero de residuos fosfato:
Nuclesido monofosforilado: si posee un grupo
fosfato
Nuclesido difosforilado: si posee dos grupos
fosfato.
Nuclesido trifosforilado: si posee tres grupos
fosfato
Funcin de los Nucletidos:
Estructural: Forman en ARN y ADN
Mensajeros qumicos: Como el AMPc y
CMPC importantes mensajeros
intracelulares
Energtica: Presentan enlaces fosfato-
fosfato de alta energa
Coenzimas: Participan en reacciones
de oxidoreduccin, como el NAD, FAD,
NADP, etc

ENLACE FOSFODISTER
Resulta de la reaccin entre el OH de la pentosa de un
nucletido (C3) y el grupo OH de un fosfato de otro
nucletido (C5), liberndose una molcula de agua.
La unin de varias
cadenas de nucletidos
mediante enlace
fosfodister forman:
POLINUCLETIDOS.
Los polinucletidos se
sintetizan en direccin:
53.
IV. CLASIFICACIN DE LOS
CIDOS NUCLICOS
- ADN
- ARN
ADN
El mdico
alemn
Friedrich
Miescher
aisl por
primera vez
el ADN en
1869, de los
glbulos
blancos
En 1953, James Watson y Francis Crick
combinaron los datos qumicos y fsicos del
DNA, y propusieron un modelo estructural del
DNA: la doble hlice


1. CARACTERSTICAS:
- Constituido por:
- purinas A,G
- pirimidinas T,C
- Es una molcula
bicatenaria con un giro
a la derecha
(dextrgiro)
Dos cadenas de
polidesoxirribonucletidos
antiparalelas,
complementarias y
helicoidales.

Polidesoxi
rribonucletidos
porque poseen
desoxirribosa.


2. ESTRUCTURA
Antiparalelas porque ambas cadenas
viajan en direccin opuesta: una en
53 y otra en 35
Sus cadenas son complementarias. Las
parejas de bases que se unen se llaman
complementarias
adenina
timina
citosina
guanina
nucletidos
timina


Cumple la Ley de Chargaff:
Suma de purinas = suma de pirimidinas
A+G =T+C
Erwin Chargaff,1949
[A]=[T]
[G]=[C]
ATCGGTACCGTTACCGTTGACCTGGTTAAAGCCCGTGC
TAGCCATGGCAATGGCAACTGGACCAATTTCGGGCACG
Las bases nitrogenadas se unen a
travs de puentes de hidrgeno.
Sus cadenas son helicoidales
brindando una estructura de doble
hlice que asemeja a una escalera de
caracol
ADN
B
:
Ms abundante,
posee 10 pares
de bases por
vuelta.


3. CLASES DE ADN
ADN
A
:
Presenta 11
pares de
bases por
vuelta. Es
ms ancho.
ADN
Z
:
Presenta giro a la
izquierda y forma
de zigzag: Posee
12 pares de bases
por vuelta, pero es
menos ancho que
los dems.
Casi de manera
exclusiva en el
ncleo
(cromosomas)
mitocondrias y
cloroplastos.



4. LOCALIZACIN
ARN
Es el AN ms
abundante en la
clula. Una clula tpica
contiene 10 veces ms
RNA que DNA.
Segn las modernas
teoras sobre el origen
de la vida, el RNA fue
el primer biopolmero
que apareci en la
corteza terrestre.


1. CARACTERSTICAS:
Constituido por purinas (A,G) y pirimidinas
(U,C).
Es una molcula unicatenaria, formada por
una cadena de polirribonucletidos.


2. CLASES:


En procariotas existe 3 tipos:
ARN mensajero (ARNm)
ARN de transferencia (ARNt) y
ARN ribosmico (ARNr)
En eucariotas existen 4 tipos:
Los tres anteriores y adems
El ARN heterogneo nuclear (ARNhn)
ARN hn
Se elabora a partir de una cadena
molde de ADN en el ncleo.
Es el precursor del ARNm, ARNt y ARN
r.
ARNm
Sale del ncleo hacia los ribosomas con
la informacin para la sntesis de
protenas.
Est formado por CODONES
(secuencia de triples de nucletidos).
ARNt
reconoce los codones del ARNm
Transporta y adapta a los aminocidos
durante la sntesis proteica.
Tiene forma de trbol con cuatro sitios de
unin diferente: Uno para la enzima (ARN
aminoacil sintetasa), otro para la unin con
el codn del ARNm, otro para unirse con el
ribosoma y el ltimo para unirse con el
aminocido correspondiente segn el
cdigo gentico.
ARNr
Forma el 65% del
volumen del ribosoma.
Algunos poseen
actividad cataltica
(ribozimas).


3. LOCALIZACIN

En el ncleo (nucleolo)
En las mitocondrias y cloroplastos
En los ribosomas
En el citosol
CODONES: Estn formados por tripletes de
bases (3 bases), son de 3 clases:
Codones que inician la sntesis de una
cadena polipeptdica. Codn de iniciacin;
AUG.
Codones que sealan el trmino de una
cadena, la seal es dada por los codones sin
sentido: UAG, UAA, UGA.
Codones de identificacin de cada uno de los
20 aminocidos