Você está na página 1de 68

Cutting and pasting are two of the first skills

children learn, and the tools they use are scissors


and glue.

Similarly, cutting DNA and pasting DNA


fragments together typically are among the first
techniques learned in the molecular biology lab
and are fundamental to all recombinant DNA
work.

SUCH MANIPULATIONS OF DNA ARE


CONDUCTED BY A TOOLKIT OF
ENZYMES:

restriction endonucleases are used as


molecular scissors,
DNA ligase functions to bond pieces of DNA
together, and
a variety of additional enzymes that modify
DNA are used to facilitate the process.

DNA MODIFYING ENZYMES


Restriction enzymes and DNA ligases
represent the cutting and joining
functionsinDNA manipulation.
All other enzymes involved in genetic
engineering fall under the broad category of
enzymes known as DNA modifying enzymes.
These enzymes are involved in the
degradation, synthesis and alteration of the
nucleic acids.

2006
Craig C. Mello and
Andrew Fire's
received a noble

WHAT ARE PLASMIDS?


Circular DNA that is
used by bacteria to
store their genetic
information.
Modifying plasmids
to include extra
genes allows for the
production of new
proteins.

HOW CAN WE MODIFY PLASMIDS?


1)

Restriction Enzymes

2)

Restriction Enzyme attached to DNA before


cleavage

BamHI, HindIII, etc.


Where do they come
from?
How do they work?
Different restriction
enzymes do different
things.

DNA Ligase

ORIGINS OF RESTRICTION ENZYMES


1)

Bacteria produce restriction enzymes to


protect against invading viral DNA/RNA.

ORIGINS OF RESTRICTION ENZYMES


2)

The enzymes cut the invading DNA/RNA,


rendering it harmless.

BIOLOGICAL ROLE OF RE

Restriction Modification System -restriction


enzymes are paired with methylases.

Methylases are enzymes that add methyl


groups to specific nucleotides within the
recognition sequence. The methylation
prevents recognition by the restriction
enzyme.

Therefore, the restriction enzyme within a cell


doesnt destroy its own DNA. However the
restriction enzyme can destroy foreign DNA
which enters the cell such as bacteriophage.

RESTRICTION ENZYME IN ACTION


Scanning

GGACGCTAGCTGATGAATTCGCATCGGATCCGAATCCGCTCTTTCAA
CCTGCGATCGACTACTTAAGCGTAGCCTAGGCTTAGGCGAGAAAGTT
Recognition Sequence

GGACGCTAGCTGATGAATTCGCATCGGATCCGAATCCGCTCTTTCAA
CCTGCGATCGACTACTTAAGCGTAGCCTAGGCTTAGGCGAGAAAGTT

Cleavage

GGACGCTAGCTGATG
CCTGCGATCGACTACTTAA

AATTCGCATCGGATCCGAATCCGCTCTTTCAA
GCGTAGCCTAGGCTTAGGCGAGAAAGTT

RESTRICTION ENZYME IN ACTION

Sticky Ends

1)

DNA strand with EcoRI restriction site highlighted.

2)

EcoRI restriction enzyme added (outline of separation about to


occur).

3)

Restriction fragments separate, with sticky ends at each


edge.

ADDING DNA LIGASE

Sticky Ends

DNA ligase bonds sticky ends cut with the same restriction
enzyme.

Sticky ends cut with different restriction enzymes will not bond
together.

Why?

Application Exercise

Make Recombinant
DNA Using Restriction
Enzymes

DNA FROM TWO SOURCES


(RESTRICTION SITES
LABELED)

Circular DNA

Linear DNA

APPLICATION OF RESTRICTION
ENZYMES

ADDING DNA LIGASE

RECOMBINANT DNA PLASMID

Many possible
recombinant DNA
plasmids can be
produced, but this
was the desired
plasmid for the
experiment.

MANY OTHER RECOMBINANT


POSSIBILITIES

and many more!

PLASMID DNA INSERTION


DNA plasmids can be inserted into
bacteria using a variety of laboratory
processes.

TRANSGENIC COLONY ALLOWED TO


GROW

HOW DO WE GET THE DESIRED


PLASMID?
Recombinant
plasmids

Transformation of
bacterial cells
through
electroporation.

Bacteria are then moved to a


growth plate, and grown on
selective media to weed out
cells that have not picked up the
desired plasmid.

Restriction fragments will


ligate randomly,
producing many plasmid
forms.
Bacterial insertion would
be necessary, then
colony growth, and
further testing to isolate
bacteria with the desired
plasmid.

TYPES OF RESTRICTION
ENDONUCLEASES

Type I and Type II restriction enzymes


have both endonuclease and methylase
activity on the same polypeptide.
Type I enzymes cleave the DNA at a
location of at least 1000 bp away from the
recognition sequence.
Type III enzymes cleave DNA from 24 to
26 bp away from the recognition site.
Type II restriction enzymes are separate
from their methylases. These enzymes
cleave DNAs at specific sites within the
recognition sequence.

RESTRICTION
ENDONUCLEASES
Named for bacterial genus, species, strain, and
type

Example: EcoR1
Genus: Escherichia
Species: coli
Strain: R
Order discovered: 1

RESTRICTION ENDONUCLEASES
RECOGNIZE PALLINDROMIC
Palindrome-a word, verse, or sentence that reads
SEQUENCES
the same forwards or backwards.

Restriction enzymes cleave 2 DNA strands at


positions that are symmetrically staggered about the
center of the palindromic sequence.
Yields restriction fragments with complementary
single-stranded ends (1-4 nt in length called sticky
ends).
The sticky ends can associate by complementary
base pairing with other fragments generated by the
same restriction enzyme.

RESTRICTION
ENDONUCLEASES
Recognition sites have symmetry
(palindromic)
Able was I, ere, I saw Elba

5-GGATCC-3
Bam H1 site:
3-CCTAGG-5

RESTRICTION
ENDONUCLEASES
Enzymes recognize specific 4-8 bp sequences
Some enzymes cut in a staggered fashion - sticky
ends
EcoRI

5GAATTC3
3CTTAAG5

Some enzymes cut in a direct fashion blunt ends


PvuII

5CAGCTG3
3GTCGAC5

Page 103

DIVERSITY OF ENZYMES
EcoRI

Esherichia coli R

G/AATTC

BamHI Baccilu amyloliquefaciens H

G/GATCC

HindIII

Haemophilus influenzae Rd

A/AGCCT

PstI

Providencia stuartii

PmeI

Psuedomonas mendocina

CTGCA/G
GTTT/AAAC

RECOGNITION SEQUENCES
EcoRI G/AATTC
BamHI G/GATCC
HindIII A/AGCCT
PstI

CTGCA/G

PmeI

GTTT/AAAC

HincII
GTY/RAC
FunII

G/AATTC

Features
Palindromic
Length
4 cutters, 6 cutters etc
Site of cleavage
Sticky ends
3 overhang
5 overhang
blunt end
Compatibility
Multiple Recognition sequence
Isoschisomers
Type II vs Type III RE

RESTRICTION MAP

http://www.phschool.com/science/bi
ology_place/biocoach/red/intro.html
http://wps.prenhall.com/wps/media/
objects/1144/1171557/17_5.html

RESTRICTION
ENDONUCLEASES
Restriction enzyme animation

http://www.dnai.org/b/index.html

Nuclease
s

NUCLEASES ACTING ON DNA


Nuclease enzymes degrade nucleic acids by
breaking the phosphodiester bond that holds
the nucleotides together.
Restriction enzymes are good examples of
endonucleases, which cut within a DNA
strand.
A second group of nucleases, which degrade
DNA from the termini of the molecule, are
known as exonucleases.

Apart from restriction enzymes, there are four


useful nucleases that are often used in genetic
engineering.
These are

Bal

31 and
exonuclease III (exonucleases), and
deoxyribonuclease I (DNase I) and
S1-nuclease (endonucleases).

These enzymes differ in their precise mode of


action and provide the genetic engineer with a
variety of strategies for attacking DNA.
Their features are summarised in Fig. (next
slide)

MODE OF ACTION OF VARIOUS


NUCLEASES.
(a)

(b)

(c)

(d)

Nuclease Bal 31 is a complex enzyme. Its


primary activity is a fast-acting 3 exonuclease,
which is coupled with a slow-acting
endonuclease. When Bal 31 is present at a high
concentration these activities effectively
shorten DNA molecules from both termini.
Exonuclease III is a 3 exonuclease that
generates molecules with protruding 5 termini.
DNase I cuts either single-stranded or doublestranded DNA at essentially random sites.
Nuclease S1 is specific for single-stranded RNA
or DNA.

NUCLEASES AND ITS ACTION

NUCLEASES ACTING ON RNA


In addition to DNA-specific nucleases, there
are ribonucleases (RNases), which act on
RNA.
These may be required for many of the
stages in the preparation and analysis of
recombinants and are usually used to get rid
of unwanted RNA in the preparation.
However, as well as being useful,
ribonucleases can pose some unwanted
problems.
They are remarkably difficult to inactivate
and can be secreted in sweat.

Thus, contamination with RNases can be a


problem in preparing recombinant DNA.
In this case it is vital to avoid RNase
contamination by wearing gloves and
ensuring that all glass and plastic equipment
is treated to avoid ribonuclease
contamination.
Not all nucleases are helpful!
Ribonucleases can be a problem when
working with purified preparations of RNA,
and care must be taken to remove or
inactivate RNase activity.

Polymera
ses

POLYMERASES
Polymerase enzymes synthesise copies of
nucleic acid molecules and are used in many
genetic engineering procedures.
When describing a polymerase enzyme, the
terms DNA-dependent or RNA-dependent
may be used to indicate the type of nucleic
acid template that the enzyme uses.
Thus, a

DNA-dependent

DNA polymerase copies DNA

into DNA,
an RNA-dependent DNA polymerase copies RNA
into DNA, and
a DNA-dependent RNA polymerase transcribes
DNA into RNA.

These enzymes synthesise nucleic acids by


joining together nucleotides whose bases are
complementary to the template strand
bases.
The synthesis proceeds in a 53 direction,
as each subsequent nucleotide addition
requires a free 3-OH group for the formation
of the phosphodiester bond.
This requirement also means that a short
double-stranded region with an exposed 3OH (a primer) is necessary for synthesis to
begin.

Polymerases are the copying enzymes of the


cell; they are also essential parts of the
genetic engineers armoury.
These enzymes are template-dependent and
can be used to copy long stretches of DNA or
RNA.

The enzyme DNA polymerase I has, in addition


to its polymerase function, 53 and 35
exonuclease activities.
The enzyme catalyses a strand-replacement
reaction, where the 53 exonuclease function
degrades the non-template strand as the
polymerase synthesises the new copy.
A major use of this enzyme is in the nick
translation procedure for radiolabelling DNA.
The 53 exonuclease function of DNA
polymerase I can be removed by cleaving the
enzyme to produce what is known as the
Klenow fragment.

It exhibits 5'3' polymerase activity and 3'5'


exonuclease (proofreading) activity, but lacks
5'3' exonuclease activity of DNA polymerase I.

This

retains the polymerase and 35


exonuclease activities.
The Klenow fragment is used where a
single-stranded DNA molecule needs to be
copied; because the 53 exonuclease
function is missing, the enzyme cannot
degrade the non-template strand of
dsDNA during synthesis of the new DNA.
The 35 exonuclease activity is
supressed under the conditions normally
used for the reaction.

Major

uses for the Klenow fragment


include radiolabelling by primed
synthesis and DNA sequencing by the
dideoxy method in addition to the
copying of single-stranded DNAs
during the production of recombinants.
A modified form of DNA polymerase I
called the Klenow fragment is a useful
polymerase that is used widely in a
number of applications.

Applications
DNA blunting by fill-in 5'-overhangs
Random-primed DNA labeling
Labeling by fill-in 5'-overhangs of dsDNA
DNA sequencing by the Sanger method
Site-specific mutagenesis of DNA with
synthetic oligonucleotides
Second strand synthesis of cDNA

Reverse transcriptase (RTase) is an RNAdependent DNA polymerase, and therefore


produces a DNA strand from an RNA template.
It has no associated exonuclease activity.
The enzyme is used mainly for copying mRNA
molecules in the preparation of cDNA
(complementary or copy DNA) for cloning,
although it will also act on DNA templates.
Reverse transcriptase is a key enzyme in the
generation of cDNA; the enzyme is an RNAdependent DNA polymerase, which produces a
DNA copy of an mRNA molecule.

DNA
Ligase

DNA LIGASE JOINING DNA


MOLECULES
DNA ligase is an important cellular enzyme,
as its function is to repair broken
phosphodiester bonds that may occur at
random or as a consequence of DNA
replication or recombination.
In genetic engineering it is used to seal
discontinuities in the sugarphosphate chains
that arise when recombinant DNA is made by
joining DNA molecules from different sources.
It can therefore be thought of as molecular
glue, which is used to stick pieces of DNA
together.

This function is crucial to the success of


many experiments, and DNA ligase is
therefore a key enzyme in genetic
engineering.
The enzyme used most often in experiments
is T4 DNA ligase, which is purified from E. coli
cells infected with bacteriophage T4.
Although the enzyme is most efficient when
sealing gaps in fragments that are held
together by cohesive ends, it will also join
blunt-ended DNA molecules together under
appropriate conditions.

DNA LIGASE JOINS DNA FRAGMENTS


TOGETHER

Enzymes that cut with staggered cuts result in


complementary ends that can be ligated together.

HindIII - leaves 5 overhangs (sticky)

5AAGCTT3

5AAGCTT3

3TTCGAA5

3TTCGAA5

Sticky ends that are complementary (from digests


with the same or different enzymes) can be ligated
together.

Sticky ends that are not complementary cannot be


ligated together.

DNA Ligase can also join blunt ends


DNA FRAGMENTS WITH BLUNT ENDS GENERATED BY
DIFFERENT ENZYMES CAN BE LIGATED TOGETHER
(WITH LOWER EFFICIENCY), BUT USUALLY CANNOT
BE RE-CUT BY EITHER ORIGINAL RESTRICTION
ENZYME.
SmaI CCCGGG
DraIAAATTT

CCCGGG
AAATTT
CCCTTT
AAAGGG

Ligations that re-constitute a SmaI or DraI site (CCCGGG or AAATTT)


can be re-cut by SmaI or DraI.

Mixed ligation products (CCCTTT + AAAGGG) cannot be re-cut by SmaI


or DraI.

ANY COMPLEMENTARY ENDS CAN BE


LIGATED
BamHIGGATCC
CCTAGG

BglIIA
TCTAG

ResultGGATCT
CCTAGA

GATCT
A

No longer
palindromic, so not
cut by BamHI or BglII

The enzyme works best at 37 C, but is often


used at much lower temperatures (4--15C) to
prevent thermal denaturation of the short basepaired regions that hold the cohesive ends of DNA
molecules together.
The ability to cut, modify, and join DNA molecules
gives the genetic engineer the freedom to create
recombinant DNA molecules.
The technology involved is a test-tube
technology, with no requirement for a living
system.
However, once a recombinant DNA fragment has
been generated in vitro, it usually has to be
amplified so that enough material is available for
subsequent manipulation and analysis.

Amplification usually requires a biological


system, unless the polymerase chain
reaction (PCR) is used.
We must, therefore, examine the types of
living systems that can be used for the
propagation of recombinant DNA molecules.
DNA ligase is essentially molecular glue;
with restriction enzymes, it provides the tools
for cutting and joining DNA molecules.

CONCLUSION

These are the modifying enzymes represent


the cutting and joining functionsinDNA
manipulation and genetic engineering.

WHAT ARE SOME APPLICATIONS OF


RECOMBINANT DNA TECHNOLOGY?
Bacteria, Yeasts, and Plants
can all be modified to produce
important pharmaceuticals,
enriched foods, and industrial
products.

Group Assignment 1

Form a group of 5-6 members.

Find a product in any of the fields listed in the


previous slide and write a short summary to
include:
The

organism used
The recombinant DNA product
The products application
Is the product an improvement compared to
similar non-recombinant products (explain)?

QUIZ 1

Why dont bacteria destroy their


own DNA with their restriction
enzymes?

QUIZ 2

Give the main difference between DNA


polymerase (large fragment), and DNA
polymerase I.

Complete the following sequence: (BamH I)


5
3

3
G