Você está na página 1de 83

CAPTULO 1

FUNDAMENTOS DE BIOLOGIA
CELULAR E DO DESENVOLVIMENTO

Profa.Ivana BM Cruz, UFSM - 2011

Padro de Organizao dos


Seres Vivos
Auto-criao (autopoise)
Reproduo
Manuteno da constncia do ambiente
interno (homeostase) e do reparo

AUTO-CRIAO

REPRODUO

HOMEOSTASE

MACRO-MOLCULAS
FUNDAMENTAIS DOS SERES VIVOS
Alimentos

Carboidratos

Glicose

-Produo de energia: glicose


-Armazenamento de energia:
Glicose- Sangue
Glicognio Msculos
Fgado
Fonte carboidratos (glicose):
-Dieta
-Produzida pelo organismo

UNIDADE

MACRO-MOLCULAS
FUNDAMENTAIS DOS SERES VIVOS
Lipdios
Principais molculas
cidos graxos
-Triglicerdeos
-Colesterol

Molculas
mais heterogneas

Participam:
- Membrana Plasmtica
- A partir do colesterol so sintetizados
todos os hormnios esterides do corpo
como o estrognio, testosterona, vitamina D,
etc.

MACRO-MOLCULAS
FUNDAMENTAIS DOS SERES VIVOS
Protenas

Unidade fudamental:
Aminocidos

Cadeia de
aminocidos

Molcula fundamental na estrutura celular do ser vivo

Alimentos

MACRO-MOLCULAS
FUNDAMENTAIS DOS SERES VIVOS
20 AMINOCIDOS
AMINOCIDOS ESSENCIAIS: no sintetizamos

Protenas

arginina, fenilalanina, isoleucina, leucina,


lisina, metionina, serina, treonina, triptofano,
histidina e valina

AMINOCIDOS NO-ESSENCIAIS
alanina, asparagina, cistena, glicina,
glutamina, prolina, tirosina, cido asprtico,
cido glutmico

MACRO-MOLCULAS
FUNDAMENTAIS DOS SERES VIVOS
cidos Nuclecos: DNA & RNAs

ORGANIZAO DOS SERES


VIVOS MULTICELULARES

NVEIS DE ORGNIZAO
DOS SERES VIVOS

CLULAS E TECIDOS

Membrana Celular

Membrana Celular: funes


- Delimitao (isolamento fsico) da clula em relao ao ambiente
que a rodeia;
-Regulao das trocas qumicas ou fsicas entre o interior da clula
e o ambiente externos;
-Comunicao entre as clulas e o seu meio ambiente;
-Suporte estrutural para que as clulas formem os tecidos corporais
-Delimitao de ambientes especficos intracelulares que possuem
funes diferenciadas (organelas).

Membrana Celular

Fonte: Silverthorn, 2002

Membrana Celular

Membrana celular: estrutura

Membrana celular: protenas

Membrana celular: protenas

Membrana celular: protenas

Membrana celular: protenas

Membrana celular: protenas

Membrana celular: protenas

Membrana celular: protenas

Membrana celular: protenas

Movimento atravs da membrana

Membrana: comunicao clulaclula


-Existem dois tipos de sinais: qumicos ou eltricos
-Existem trs processos de comunicao:
(1) transferncia citoplasmtica de sinais
qumicos/eltricos via junes comunicantes
(2) comunicao local de substncias que
se difundem atravs do lquido extracelular
(3) comunicao a longa distncia: hormnios
Fonte: Silverthorn, 2002

Membrana: comunicao clulaclula

Membrana: comunicao clulaclula

Membrana: comunicao clulaclula

Membrana: comunicao clulaclula

Membrana: comunicao clulaclula

CITOSOL E ORGANELAS

CITOSOL E ORGANELAS
PRINCIPAIS FUNES DO CITOESQUELETO
Determina a forma das clulas
Estabiliza a posio das organelas dentro do
citoplasma
Auxilia no transporte de molculas para dentro
e para fora da clula
Auxilia na manuteno da clula em um local
do tecido
Permite o movimento de algumas clulas atravs
do corpo

CITOSOL E ORGANELAS

CITOSOL E ORGANELAS

CITOSOL E ORGANELAS

CITOSOL E ORGANELAS

CITOSOL E ORGANELAS

CITOSOL E ORGANELAS

MATRIZ EXTRACELULAR
Material sintetizado que e secretado pelas clulas
de um tecido

Serve como sustentao do tecido e


atua na manuteno da homeostase corporal
A quantidade de matriz extracelular
As molculas que compe a matriz extracelular
Altamente variveis e dependente
do tipo de tecido

CICLO CELULAR

SENESCNCIA CELULAR

n
LIMITE DE HAYFLICK
+ 50 DIVISES

CICLO CELULAR

MITOSE

G2

G1

n=50

ENVELHECIMENTO CELULAR
MITOSE

G2

G1

n ~ 50

Modificaes
Estruturais e
funcionais

-Cessa a proliferao
- Clula cresce

Revisando

Proteo aos genes


que esto nos cromossomos

Estrutura telomrica
Telmero possui uma
simples molcula de DNA
(TTAGGG)n
Resto do cromossomo
dupla fita

Cromossomo

ENCURTAMENTO TELOMRICO

Processos Fundamentais
da Diferenciao Celular

Diviso Celular
Mitose

Prfase
Metfase
Anfase
Telfase

Interaes Bioqumicas
Molculas bioqumicas modulam:
regulao diferencial dos genes:
Genes funcionam conforme:
- clulas e estgio do desenvolvimento

Ncleo

Como ocorre o
desenvolvimento
corporal e a
manuteno
da homeostase se
todas as clulas
contm o mesmo
DNA?

Clula

DOGMA GENE-PROTENA/RNA
Clula
DNA
5ATTCGTTAGAGACCATTGGAT3
3TAAGCAATCTCTGGTAAGCTA5
Ncleo
5ATTCGTTAGAGACCATTGGAT3
htRNA
Sliplicing
5ATTCGTTACCATTGGAT3
mRNA

Protenas

ESTRUTURA DO GENE EUCARITICO

ESTRUTURA DO GENE EUCARITICO


Inibio/
Estimulao

Regio
Promotora

Estradiol

Testosterona

Modulao da Expresso
do gene

REGULAO DA EXPRESSO GNICA


Inibio/
Estimulao

Regio
Promotora

Modulao da Expresso
do gene

Resveratrol

DIETA

BENEFCIO A SADE

Regulao Gnica
Muitos processos biolgicos ocorrem em todas
as clulas portanto a sntese de muitas protenas
igual
Algumas PROTENAS so abundantes em tipos
Especializados de clulas apesar dos seus
Genes estarem em TODAS AS CLULAS

Regulao Gnica
Estudos sugerem que uma clula eucaritica
Expressa aproximadamente 10-20 mil genes
dos 30 mil genes que possui.

Regulao Gnica
A expresso de um gene CONTROLADA
DNA
Controle transcricional

Rna heterogneo
Controle splicing
mRNA (processamento)
Controle traducional

Protena
Controle ps-sntese

Modificaes ps-sntese

Regulao Gnica
A expresso de um gene CONTROLADA
DNA
Controle transcricional

Rna heterogneo
Controle splicing
mRNA (processamento)
Controle traducional

Protena
Controle ps-sntese

Modificaes ps-sntese

Movimento Celular
-Para a formao dos tecidos e rgos
-Muitas clulas precisam se mover dentro do
embrio
-Este processo denomina-se:
-Movimento Celular ou Migrao Celular
-Movimento celular gerado por elementos
contrteis do citoesqueleto
-Principais protenas associadas ao
movimento celular: integrinas e fibronectinas

Integrinas

Direo da migrao

Filopdia
Contato focal

Parece que a migrao celular mediada por protenas que so agrupadas


Famlia Abelson de tirosina quinases- Abn Family.

Adeso Celular
Processo pelo qual as clulas ficam
aderidas em um determinado local do
corpo.
Mediado por molculas conhecidas como:
CAM= molculas clulas-adesivas
(Cell Adhesive Molecules)
Ex. Caderinas

Adeso Celular

Caderinas conectam uma clula na outra


Auxiliando na adeso a matriz extracelular

Morte Celular ProgramadaApotose


Sucidio de determinadas linhagens
celulares ao longo da embriognese,
ou de algumas clulas ao longo da vida

Morte Celular ProgramadaApotose


Exemplo: formao dos dedos

BIOLOGIA CELULAR E O
CNCER

ESCAPE DA SENESCNCIA REPLICATIVA


CELULAR: CNCER
Causado pelo crescimento descontrolado de clulas que tambm
tm a capacidade de invadir outros tecidos e formar tumores
secundrios (metstases)

O CNCER UMA DOENA GENTICA


CAUSADO POR ACMULO DE
MUTAES

Ocorrem mutaes no DNA


Ativam genes que estavam silenciados
Proto-oncogenes
Inativam genes que estavam ativos
Genes de supresso tumoral

Clula normal

1a Mutao

2a Mutao

3a Mutao
Clula
Maligna
(Cncer)

PRINCIPAIS ALTERAES MORFO-FUNCIONAIS


DA CLULA CANCEROSA

(1) DIVISO CELULAR

NEOPLASIA

Escape da senescncia
celular
MITOSE

G1

G2

Nmero
Indefinido de
Mitoses

IMORTALIZAO

PRINCIPAL CAUSA DA IMORTALIZAO

RE-ATIVAO DA ENZIMA TELOMERASE

OS TELMEROS DA CLULA VOLTAM


A SER PRODUZIDOS

CLULA SE REPLICA INDEFINIDAMENTE

Imortalizao

Linhagem celular
Imortal de
Henrietta Lacks
Mulher jovem com cncer cervical
(Adenocarcinoma)
Morreu em 1951
Clulas continuam a ser produzidas
e utilizadas por laboratrios no
mundo todo

CLULAS
HeLA

Utilizadas para estudos in vitro


sobre o cncer

(2) ALTERAES NAS INTERAES BIOQUMICAS

Citoesqueleto desorganizado: perda da forma celular


original
Menor quantidade de organelas
Menor tamanho celular
Ncleo fica proporcionalmente maior em relao
a clula
Perda da funo celular

(2) Exemplo: cncer de colo do tero

tero
Cervix
saudvel
Esfregao celular
(Exame Papanicolau)
Cervix
com
carcinoma

Clula saudvel

(3) MOVIMENTO E ADESO CELULAR

(3) MOVIMENTO E ADESO CELULAR


Consequncia principal: METSTASES

(3) MOVIMENTO E ADESO CELULAR

(4) APOPTOSE

Cncer resistncia a apoptose


clulas no desencadeiam a sua morte
Esta alterao est relacionada:
- com o inicio da carcinognese
- com resistncia de clulas cancerosas a
quimioterapia e a radioterapia
Mecanismos de resistncia:
- inibio de protenas pr-apoptticas
Ex. p53
- expresso de protenas pr-oncognicas
Ex. survivinas

CONSIDERAES FINAIS
O padro de auto-organizao dos seres vivos,
em especial dos organismos multicelulares,
Envolve padres cito-morfolgicos e fisiolgicos
Que garantem o seu desenvolvimento, processos
de regenerao/cicatrizao, controle homeosttico
e reproduo. Para tanto existem 05 processos
fundamentais

REFERNCIAS BIBLIOGRFICAS E DE FIGURAS


JUNQUEIRA LC & CARNEIRO J. Histologia Bsica. Guanabara-Koogan, Rio de Janeiro, 2004; 2008
KERR JB. Atlas de Histologia Funcional. Artes Mdicas, Porto Alegre, 2000.
GARTNER Color Atlas Histology. Williams & Wilkins, Baltimore, 1994.
KIERSZENBAUM AL. Histologia e biologia celular: uma introduo a patologia. Elsevier, Rio de
Janeiro. 2008.
COCHARD LR. Atlas de embriologia humana de Netter. Artmed, Porto Alegre, 2001.
DOYLE MJ. Embriologia humana, Atheneu, So Paulo, 2005.
MOORE K. Embriologia Clnica, Elsevier, Rio de Janeiro, 2008.
BREW MCC. Histologia geral para a odontologia, Guanabara-Koogan, Rio de Janeiro, 2003.
ATLAS DE HISTOLOGIA UFRGS - http://www.dominiopublico.gov.br/download/texto/ur000002.pdf
ATLAS DE HISTOLOGIA UERJ - http://www.micron.uerj.br/atlas/index.html
ATLAS DE HISTOLOGIA CLARETIANO http://www2.claretiano.edu.br/da/biologia/atlas_virtual/atlas_histologia.htm
ATLAS DE HISTOLOGIA UFPEL-http://minerva.ufpel.edu.br/~mgrheing/cd_histologia/index.htm
ATLAS DE EMBRIOLOGIA HUMANA (Ingls) -http://www.embryo.chronolab.com/fertilization.htm
MULTIDIMENSIONAL HUMAN EMBRYO (Ingls) - http://embryo.soad.umich.edu/index.html
ATLAS OF HUMAN BIOLOGY CRONOLAB (Ingls) -Http://www.embryo.chronolab.com/
fertilization.htm
ATLAS DE HISTOLOGIA E EMBRIOLOGIA VIRTUAL UFSM. http://w3.ufsm.br/labhisto/atlas.htm