Você está na página 1de 63

Traduo

Modificando o alfabeto
molecular
Prof. Dr. Francisco Prosdocimi

Traduo em eukarya e
prokarya

Eventos ps-transcricionai

Processo de sntese de
protenas
RNAm contm o cdigo do gene
RNAt o adaptor que liga o mundo do
cido nuclico ao mundo das protenas
RNAr faz parte do ribossomo e
contm a enzima que catalisa a
ligao entre aminocidos adjacentes

tRNA o adaptador de
Crick
~60-90bp

Transcrio e
processament
o do RNAt
transcrito de um gene
presente no DNA
... E ento processado
Contm o cdigo do
adaptador

O cdigo gentico
Traduo in vitro de
sequncias de polinucleotdeos
conhecidos
Diferenas nas cadeias
laterais dos
aminocidos
Ribozimas X Enzimas

O cdigo gentico
redundante
Gamow: 20 aminocidos devem ser
codificados por, pelo menos 3 bases

UUA

CCU

AUU

AAA

CGG

Leu

Pro

Ile

Lis

Arg

CUG

CCG

AUA

AAG

CGA

Cdon: cada grupo


de trs nucleotdeos
consecutivos

Open reading frame


determinao da janela de leitura (ORF)

Cdigo no-sobreposto

As seis fases de leitura


possveis
5'3' Frame 1
gaggtctggtttgcaactggggtctctgggaggaggggttaagggtggttgtcagtggcc
E V W F A T G V S G R R G - G W L S V A
5'3' Frame 2
gaggtctggtttgcaactggggtctctgggaggaggggttaagggtggttgtcagtggcc
R S G L Q L G S L G G G V K G G C Q W
5'3' Frame 3
gaggtctggtttgcaactggggtctctgggaggaggggttaagggtggttgtcagtggcc
G L V C N W G L W E E G L R V V V S G
3'5' Frame 1
ggccactgacaaccacccttaacccctcctcccagagaccccagttgcaaaccagacctc
G H - Q P P L T P P P R D P S C K P D L
3'5' Frame 2
ggccactgacaaccacccttaacccctcctcccagagaccccagttgcaaaccagacctc
A T D N H P - P L L P E T P V A N Q T
3'5' Frame 3
ggccactgacaaccacccttaacccctcctcccagagaccccagttgcaaaccagacctc
P L T T T L N P S S Q R P Q L Q T R P

Pareamento cdonanticdon
Pareamento de bases Watson-Crick
nas duas primeiras bases do cdon
3-5 to 5-3
paralelo)

(pareamento anti-

Bases oscilantes
(wooble)
A base 3 do cdon
oscilante
O contato qumico
no perfeito (3D)

Inosina, derivado
de Adenina

tRNA contm bases


modificadas
Processamento do
tRNA

Como o aminocido correto


ligado ao tRNA?
Como o tRNA
correto ligado
ao aminocido?
Como o cdigo
gentico funciona
molecularmente

tRNA-aminoacil
sintetases
Ligam o tRNA e o
aminocido
Reconhecem o
anticdon e
carregam o
aminocido
correto

Aminocidos ativados

Ativao do triptofano

Quantas tRNA-aminoacil
transferases?
Uma por
aminocido?
Ou uma por
cdon?
Uma nica
amino acil
tRNA sintetase
liga um
aminocido a
todos os seus
tRNAs

Classes de tRNA aminoacil


transferases

Controle da
traduo I
Afinidade da enzima
pelo tRNA disposto no
cdigo
tRNA errado liga-se
lentamente e desliga-se
rapidamente

A adio do
aminocido ao tRNA
incorreto muito lenta

Controle da traduo II
O aminocido
deve se encaixar
no stio sinttico
da tRNAaminoacil
-sintetase
... e no ao
stio de edio
Mecanismo de
peneira dupla

(des)Controle da
traduo III
No acontece
verificao do
aminocido
na traduo
O controle,
portanto,
feito apenas
no momento
da
aminoacila
o do tRNA

O congelamento do cdigo
gentico
Conservado em
praticamente
todos os organismos vivos
Maquinaria altamente complexa e
eficiente
Surgiu uma nica vez e todos os
organismos vivos hoje so
descendentes do organismo onde o
cdigo surgiu adaptao!

Ribossomos

Estrutura 2D e 3D do RNAr

Ribossomos de E. coli

Ribossomos eucariticos
O peso do ribossomo
se deve mais ao
componente de RNA
do que ao
componente protico

Ribosomal components

Reciclagem ribossomal

Stios ribossomais
utilizados na traduo

Quatro stios:
um para mRNA e
trs (stio A, P e
E)
para tRNA

Prokarya X Eukarya
RNA policistrnico
Operon

RNA monocistrnico
interao entre protenas
que se ligam a cauda
poliA e protenas do
Complexo de Iniciao

Iniciao da traduo
Procariotos: Shine-delgarno
Binding Site)

Consenso de Kosak

(Ribosome

GCCRCCAUGG

hiptese do scanning pelo ribossomo


necessidade do 5 CAP

Start codon
Normalmente codifica metionina

Iniciao da
Traduo
Fatores de iniciao
da traduo
IF-1 e IF-3
tRNA carregado
formil-metionina

Seleo do tRNA
correto
Somente se pareia
o anti-cdon
que...
Liga-se tambm ao
rRNA

Complexo de
iniciao da
traduo

mRNA liga
subunidade menor do
ribossomo
tRNA contendo
metionina (formilada)
liga-se ao complexo
Fatores de iniciao da
traduo ajudam
Subunidade maior
reune-se ao complexo

Stios peptidil e
aminoacil

N-terminal
H H
H
-OOC C N - COH
-OOC C - NH2
R
R

Ribossomo
UAC

AA
A

AUG UUU
GUU

CUU

GAC

CCC

UGA

GGC
3

RNA
mensageiro

-O
OC H
-C H
-N
R -CO
-O
O
C- H
C- ..
N
R H

Formao da
ligao peptdica

U A CA A A

AUG
GUU

UUU

CUU

GAC

CCC

UGA

GGC

H
-CO
N

H
C R
C
H N
O

C
R
OC
O
-

Translocao
Requer GTP

H..
-OOC C - NH2
R

G
C
A
A
U
A
AAA
AUG
GUU

UUU

CUU

GAC

CCC

UGA

GGC

N
C R

H C
O

C
- R

-O

H
..
-OOC C - NH2
R

AAAGAA

AUG UUU
GUU

CUU

GAC

CCC

UGA

GGC

AUG
AG

AAAGAA
UUU

CUU

GAC

CCC

- -

H
O H H
H H
-OOC C N C C N C- C N -COH
R H
R
O R

UGA

GGC

Stios peptidil e
aminoacil
O ribossomo possui 3
stios onde cabem
molculas de tRNA
O alongamento da
traduo
Protenas so geradas
do N ao C terminal

Ordem de ligao de
aminocidos

Ligao peptdica

Alongamento da
traduo

Alongamento ainda...
O
alongamento
continua at o
aparecimento
de um cdon
de parada
(stop codon)
UAA
UAG
UGA

Terminao da
Traduo
Fator de
terminao
liga-se ao stop
codon
UAA, UGA,
UAG

Protena
liberada
Complexo
desfeito

Releasing factor

Traduo em procariotos
http://www.biostudio.com/demo_freeman_protein_synthesis.htm
http://highered.mcgraw-hill.com/sites/0072437316/student_view0/chapter15/animations
.html
#

Traduo em eucariotos
http://207.207.4.198/pub/flash/26/transmenu_s.swf

Tempo de execuo do
processo

Possveis
erros no
processo
Erro na traduo
Protena
incorretamente
produzida
Dano metablico

Frameshift
Alterao da fase
de leitura (frame)
tRNAs especficos
passam pelo stopcodon
4 bases lidas como 3

Ultrapassa um
cdon de
terminao
Produo de
protenas fundidas

Chaperonas I

Complexo protico que


auxilia na montagem da
estrutura 3D de uma
protena

Chaperonas II

Modificaes pstraducionais
Formao de ligaes
dissulfeto/dobramento
Clivagem da cadeia
Regula
Fosforilao
Glicosilao
o da
Metilao/Acetilao
funo
Adio de ncoras lipdicas

protica

Protena
Pronta!
E agora?
Destinos
possveis...

Endereamento de
protenas I - Co-

traducional (vias
de secreo):
ER
Golgi
Membrana
plasmtica
Meio
extracelular

II- postraducional:

ncleo
mitocndria
cloroplasto
Lisossomos/pe
roxissomos

Sinais de endereamento na Protena:


1- Seqncia sinal (16-30 aminocidos no N-terminal)
2- Sinal de endereamento nuclear ( 4-8 aminocidos com carga positiva, ex.: PKKKRLV
3- Sinal de reteno no RE (KDEL)

Protenas organelares
Produzidas com
sinal de exportao
Sinal clivado
quando a protena
alcana seu destino
celular

Protenas
transmembrana
Domnios
hidrofbicos so
capazes de
invadir as regies
lipdicas (tambm
hidrofbicas) da
membrana
plasmtica

Inibidores de sntese
protica
Antibiticos inibem a
sntese de protenas
bacteriana
Tetraciclina
Liga no RNA 16S (sub 30S)
Inibe a ligao do aminoacyl tRNA no stio A

Cloranfenicol
Liga na subunidade 50S

Concluses
Traduo o processo de produo de protenas
A regulao ocorre principalmente na transcrio
Modificaes ps-traducionais so importantes para regular a
funo protica

Diferentes tipos de RNAs e protenas atuam no processo


A tRNA aminoacil sintetase a protina responsvel
pelo cdigo gentico
A ltima molcula a se juntar ao complexo de iniciao
a subunidade maior do ribossomo
As protenas normalmente comeam com o aminocido
metionina
A traduo continua at que haja um stop codon
As protenas precisam ter uma conformao 3D correta
pra funcionar (chaperonas ajudam na montagem)
Muitas protenas contm sinais de sinalizao celular