Você está na página 1de 30

Sequenciamento usando o

Mtodo de Sanger
Luiz Claudio Santana da Silva
Maira Cicero Ferreira

Histrico
1975:
primeira
sequenciamento.

descrio

do

Esse procedimento foi feito usando DNA


polimerase, primer, dNTP e ddNTP
marcadas por 32P.

Sanger, Coulson, 1975.

dNTPs

Paulo Jos Pereira Lima Teixeira.


Tecnologias de sequenciamento de DNA.

ddNTPS

SANGER, NICKLEN, COULSON. 1997

ddNTPS
Atkinson
mostrou
a
atividade
inibitria
do
ddTTP
(23
dideoxitimidina trifosfato).
Aps a incorporao do ddTTP ocorre
a inibio da sntese da cadeia.

ATKINSON, DEUTSCHER, KORNBERG, RUSSELL, MOFFATT. 1969


SANGER, NICKLEN, COULSON. 1997

Metodologia
Desnaturao do DNA de dupla fita.

Primers: iniciam a reao feita pela


DNA polimerase, nesse momento
ser definido qual a cadeia que ser
usada como molde.
Sanger, Coulson, 1975.

Metodologia
Usam-se baixas concentraes de
ddNTPs e altas concentraes de
dNTPs.
Em cada reao, um ddNTP
incorporado aleatoriamente ao invs
do dNTP correspondente, provocando
a terminao da polimerizao.
Sanger, Coulson, 1975.

ddNTP marcada por

32

Feitas 4 reaes: uma para cada


base ddNTP marcada por 32P.
Formados diversos fragmentos com
tamanhos variados, de acordo com a
posio e o ddNTP incorporado.

Sanger, Coulson, 1975.

ddNTP marcada por


Feito
gel
poliacrilamida.

32

desnaturante

P
de

A autoradiografia feita aps a


corrida do gel.

Sanger, Coulson, 1975.

Leitura
Aps autoradiografia a ordem dos
nucleotdeos, pode ser visualizada.
Porm, esta ser complementar ao
molde.

Sanger, Coulson, 1975.

Paulo Jos Pereira Lima Teixeira.


Tecnologias de sequenciamento de DNA.

Sanger, Coulson, 1975.

Sequenciadores
automticos
Criado em 1986 pela Applied Biosystems.
O
princpio

o
mesmo
do
sequenciamento manual feito por Sanger.
ddNTPs so marcados por fluorescncia
caracterstica, permitindo a distino das
cadeias
truncada
pela
respectiva
fluorescncia.

Sequenciadores
automticos
Feita a eletroinjeo onde as
molculas de DNA(-) em suspenso
so introduzidas nos capilares.
Cada fragmento, recebe um feixe de
laser de argnio, que ser detectado
por um sistema ptico e uma cmara
de CCD.

Sequenciadores
automticos
A ordem em que os diferentes
fragmentos passam pelo detector de
fluorescncia indica a sequncia da
cadeia de DNA complementar
cadeia usada como molde.

Paulo Jos Pereira Lima Teixeira.


Tecnologias de sequenciamento de DNA.

Formato de sada AB1

Formato de sada- AB1

Formato de sada AB1

Formato de sada PHD

Formato de sada SEQ


NNNNNNNNNNNNNNNNNNNNNNTCTCTTATATANNATTCCCGCCTTCNNTAAAGT
ATGCAAATAATGTCTGGTTTTAAAGTAATGATTAACTGCATGCTCAGGATAATAGG
GTTTGATGCCTTTATCCATGGGAAAATATTTGGTAACCTTAGGATAAAATCTAGCT
GGCATAACCAATTTTAATCTTCGTAATTCATTTTTAGTAAGTGGGCCTACAAATTGT
TCACATTTAGAAATCAGGTCTTGATGCAAATGAATATTAGGAAAAGAAGNANTGN
ACCAGTTAGGATTAAAAGCAGGCACAGTAGAAGAGTAAAGCCCCGTAAAGTTTC
CCACCTTATGAGTCCAAGGAATACTAACATTGGNAAGCTGGAGATTGAGATCTGC
GGCGACGCGGTGATTGAGATCTTCGTCTGCGAGGNGAGNNAGTTCTTCTNCTA
GGGGACCTGCCTCGTCGNCTAACAACAGTAGTTTCCGGAAGTGTGNATAGGATA
GGGGCNTTTGGTGGTCTGTANGCAGGANGAGTGCGAATCNNCACTCNNAAGGA
CACCAAATACTCTAGNACTGTNCTCTTCCAAAAGTAAGGCAGGAAATGTGANNN
NACANCAGNNGTCTANNTTNNNNNNNNNNNNNNNNAACNTAGNNAACTACTAAA
NCCCTANCTNNNNCNNNNCANNNNNNNNNNCNCCCNAGNNNGCNANNNNCATN
NCCTNNNNCNNNANANNNNNNANNNTNNCTNNNNNCCNTNNNGNNNNNAANNN
NNNANNNNCAGNNNANNNNNNNNNNNNNNNNNAANNNNNNNNNNNNNNNTNN
NNNANNNNNNNNNNNNGGNNNANNCANNNNNN

Resumo do mtodo Sanger

Paulo Jos Pereira Lima Teixeira.


Tecnologias de sequenciamento de DNA.

Principal aspecto positivo


Leitura de fragmentos longos.

Principal aspecto negativo


Valor elevado por base sequenciada.

RESUMO DAS PLATAFORMAS

Paulo Jos Pereira Lima Teixeira.


Tecnologias de sequenciamento de DNA.

RESUMO DAS PLATAFORMAS

Bjrn Nystedt, 2011

RESUMO DAS PLATAFORMAS

Bjrn Nystedt, 2011


Glenn, 2011

OBRIGADO (A) !