Você está na página 1de 227

Aula DNA

Forense
Arthur Estivalet Svidzinski
Odontologia. 1. Percia odonto-legal, peritos, documentos mdicos, laudos
periciais, modelos e interpretao, tica odontolgica. 2. Percia odontolgica nos
foros civil, penal, trabalhista e administrativo. 3. Documentao odontolgica. 4.
Marcas de mordidas: metodologias de coleta e estudo comparativo. 5. Crimes de
leses corporais: art. 129 do CPB e as percias odontolgicas das leses do
aparelho estomatogmtico. 6. Os arcos dentrios na identificao. 7. Estimativa
do sexo, idade e estatura por meio do estudo dos dentes. 8. Biotipologia. 9.
Tcnicas de identificao utilizando o DNA. 10. Tcnicas de biologia molecular:
tcnica de PCR, PCR em tempo real, eletroforese, sequenciamento de DNA. 11.
Traumatologia forense: energias de ordem mecnica, energias de ordem fsica,
energias de ordem qumica, energias de ordem fsico-qumica. 12. Estimativa de
sexo, estatura, idade, fentipo, cor da pele, por meio do estudo do crnio. 13.
Noes de tanatologia. 14. Sexologia forense: estupro e atentado violento ao
pudor.
9. Tcnicas de identificao utilizando o DNA. 10. Tcnicas
de biologia molecular: tcnica de PCR, PCR em tempo real,
eletroforese, sequenciamento de DNA.
1.3. Biologia Molecular: transcrio, traduo,
replicao, mutao, recombinao e reparo do DNA,
expresso gnica. 1.4. Tcnicas de Biologia Molecular:
tcnica de PCR, PCR em tempo real, eletroforese,
sequenciamento de DNA; de
usando
tcnicaso DNA. 1.5. Gentica e genticaidentificao
de populaes:
teorema de Hardy-Weinberg, estrutura de populaes,
anlise filogentica, padres de herana gentica,
seleo natural, mutao, deriva, fluxo gnico.
Mendel - 1864
Watson e Crick - 1953
Bases
Nitrogenadas
Bases Nitrogenadas
Gentica Conceitos bsicos

Gene Sequncia de DNA que codifica


uma protena

Somente aproximadamente 1,5%


do genoma humano codificador
Gentica Conceitos bsicos
E os outros 98,5%?
O DNA no codificante composto principalmente
de sequncias altamente repetitivas e aos poucos
as suas funes vo sendo descobertas

Por exmplo, as sequencias Alu e L1 representam


28% do genoma humano
Gentica Conceitos bsicos
Tamanho do genoma de diferentes organismos
Organismo Tamanho em pb

Virus Fago 5,2 mil

Escherichia coli 4,7 milhes

Homo sapiens 3,2 bilhes

Amoeba proteus 670 bilhes


Gentica Conceitos bsicos
Nmero de cromossomos de diferentes organismos
Organismo Nmero de cromossomos

Drosfila 8

Minhoca 32

Homem 46

Borboleta 380
Gentica Conceitos bsicos

No incio do projeto genoma acreditava-se


que o genoma humano codificava algo em
torno de 100 a 120 mil genes.

Hoje sabe-se que esse nmero no passa


de 20 a 30 mil genes
Gentica Conceitos bsicos
Cromossomos homlogos:
Cromossomos que
formam um par em
espcies diplides.

Um homlogo de
origem materna e outro
paterna
Gentica Conceitos bsicos

Alelo Uma das verses de um


mesmo gene

Exemplo: Sistema ABO


Alelos: IA, IB e i
Gentica Conceitos bsicos

Gentipo: Conjunto de informaes


genticas de um indivduo

Fentipo: Conjunto de manifestaes


fsicas relacionadas a essas
informaes
Gentica Conceitos bsicos

Homozigose: Quando o indivduo


apresenta os alelos iguais: AA, ii, XX

Heterozigose: Quando o indivduo


apresenta dois alelos diferentes: Aa, IAi, XY
Gentica Conceitos bsicos
Gentica Conceitos bsicos
Exemplo
Gentipo Fentipo

Sangue tipo A
IAIA

IAi Sangue tipo A

Sangue tipo AB
IAIB

ii Sangue tipo O
Gentica Conceitos bsicos

Cruzamentos: Avaliao dos possveis


gentipos dos descendentes a partir do
gentipo dos seus genitores.
Gentica Conceitos bsicos
A respeito da natureza qumica e da funcionalidade do DNA, julgue os itens
subseqentes:

-O contedo informacional do DNA reside na seqncia em que suas


unidades monomricas esto ordenadas.

-Espcimes de DNA isolados de diferentes tecidos da mesma pessoa


possuem a mesma composio de bases.

-Durante a desnaturao do DNA so quebradas as ligaes covalentes


presentes em sua estrutura.

-Nas molculas de DNA dos eucariotos, a ocorrncia das bases G + C


aproximadamente igual de T + A.
Reao de PCR

Polimerase Chain Reaction

Mtodo de amplificao de DNA


invitro
Ciclo Celular
Reao de PCR

Utilizada em situaes em preciso


trabalhar que quantidades
com muito pequenas
de
DNA sequncias especficas de
Amplifica
DNA

Processo realizado em vrios ciclos


Reao de PCR

DNA a ser amplificado

P rimers Forward e Reverse

dNTPs Nucleotdeos

DNA Polimerase
Reao de PCR

Primers: Iniciadores
da duplicao de DNA
Reao de PCR
Polimerase:

Duplica uma
fita simples de DNA

Necessita de
uma sequncia
iniciadora
Reao de PCR

Taq Polimerase: Enzima polimerase


do micro-organismo Thermus aquaticus

Temperatura de duplicao de 70 a 72C

Adiciona uma adenina ao final da


duplicao da sequncia de DNA
Reao de PCR
Reao de PCR

1 Fase: Aquecimento a mais de 90C para


a separao da dupla fita

Separa tanto a Fita de DNA original


quanto os produtos de amplificao
Reao de PCR
Reao de PCR

2 Fase: Anelamento dos primers

Hibridizao

Temperatura varia entre 40 a 70C


conforme o par de primers

Determina a especificidade da ligao


Reao de PCR
Reao de PCR

3 Fase: Extenso dos primers


Duplicao do DNA

Temperatura tima em torno de 72C


Reao de PCR
Reao de PCR
Reao de PCR
Reao de PCR

Ao final da reao, a quantidade de


DNA amplificado em relao ao DNA inicial
igual a 2n, sendo que n= nmero de ciclos da
PCR

Exemplo: PCR de 29 ciclos:


229= 536.870.912 cpias para cada fita original
Reao de PCR
Reao de PCR
Efeito Plateau: desvio da quantidade terica

Perda da atividade da Polimerase

Acmulo de inibidores

Limitao dos componentes

Competio entre produtos

Pareamento Produto x Molde,

Competio com anelamento do primer


Reao de PCR
Em uma investigao de estupro seguido de morte, na tentativa de identificao do
criminoso por meio da tcnica de reao em cadeia da polimerase (PCR), os
investigadores coletaram material junto ao corpo da vtima. A respeito desse assunto,
julgue os itens seguintes:

-Sangue, cabelo e smen encontrados no local do crime constituem material com


potencial para fornecimento de DNA para a realizao da tcnica de PCR.

-A tcnica de PCR possibilita a clonagem de seqncias especficas de DNA, de


forma rpida, numerosa e sem a necessidade de uma clula viva.

-Por ser bastante simples, a tcnica de PCR dispensa o uso de luvas descartveis,
reagentes e solues de alta qualidade ou micropipetas de uso exclusivo.

-Independentemente da tcnica de PCR, a presena de espermatozides do


criminoso em esfregao vaginal da vtima de estupro possibilita a identificao inequvoca
deste.

-Alm da molcula de DNA, o RNA tambm pode ser usado como molde original
Gentica
Forense

Ramo dagentica humana voltada para


questes legais
Gentica
Forense

Identificao Humana atravs do DNA

Estabelecimento de vnculo gentico


Gentica

Forense
Quem a vtima?

Quem o pai dessa


criana?
quem pertence a mancha de
A

deixada em um local de crime?


sangue

Quem deixou os espermatozides no corpo


da vtima?
Gentica
Forense
Aplicaes de DNA para fins forenses

Justia Cvil: Testes de paternidade

Justia Criminal: Identificao humana,


crimes sexuais, crimes contra a vida, crimes
contro o patrimnio, desastres de massa.
Perito Criminal - Polcia Federal
2004
Para a realizao do exame de paternidade,
a
percia, geralmente, realizada no campo
mdico- legal por meio da pesquisa do DNA.
Porm, pode ocorrer que, sendo esta impossvel
por alguma razo, o juiz determine a realizao de
percia de caracteres dos arcos dentrios, o que
transmisso
somente ser gentica
possvel sedominante
existirem no camp
caracteres
bucodentrio, como
teratolgicos ou a sndrome
doenas de de Gorlin o que
hereditria autossmica ,
dominante, penetrncia e co alta
expressividade varivel. m
Gentica
Forense
Identificao Humana
Necessidade do ser humano desde
antiguidade

Caracteres morfolgicos

Tatuagens

Fotografias

Impresses digitais
Gentica
Histrico
Forense
1986 - Alec Jeffreys: Descobriu que o DNA
apresentava regies altamente repetitivas.

Essas repeties variavam de indivduo


para indivduo

DNA fingerprint
Gentica
Forense
Gentica
Forense
Polimorfismo
Acmulo de mutaes durante diversas geraes

Gerou sequncias hipervariveis no DNA humano


no codificante

Utilizadas para a diferenciao de indivduos


Impresses digitais e outras pistas coletadas em cenas de crimes esto cedendo
espao para as anlises de DNA nas investigaes policiais. O DNA extrado de fios de
cabelo, de pequenas amostras de sangue ou da saliva permite descobrir a identidade de
criminosos.
Cincia Hoje, n. 169, mar./2001 (com adaptaes).
Tendo o texto acima como referncia inicial e considerando as tcnicas para
identificao com base em cidos nuclicos e os conceitos moleculares e genticos a
elas relacionados, julgue os itens a seguir:
-Apesar de a identificao com a utilizao de DNA ser um mtodo bastante
especfico, algumas caractersticas genticas, como o polimorfismo, so obstculos a
esse mtodo.

-A existncia de quantidades restritas de amostra para identificao com base no


DNA no inviabiliza o processo, pois tcnicas como a de PCR amplificam a quantidade
de cidos nuclicos presentes.
Gentica
Forense
DNA fingerprint

Perfil de DNA obtido atravs da tcnica de RFLP


(restriction fragment length polymorphism)

Utilizava enzimas de restrio para clivar a


sequncia de DNA, produzindo um padro de
fragmentos diferente em cada indivduo
Gentica
Forense
Gentica
Forense
Gentica
Forense
Gentica
Forense
Gentica
Forense
Gentica
Forense
Gentica
Em 1983Forense
e 1986 duas mulheres foram
estupradas e mortas em Narborough, Inglaterra

Um homem confessou a autoria dos


crimes, mas o seu perfil no batia com o
sangue e o smen encontrados

Exames de DNA em massa foram


realizados com todos os homens do vilarejo
(5.000 pessoas) mas o autor no foi
Gentica
Forense
Aproximadamente 1 ano depois uma mulher
ouviu em um bar um homem comentando que
havia doado sangue no lugar do seu amigo
Colin Pitchfork.

O perfil deste homem era idntico


encontrado
ao nos locais de crime.

Foi o primeiro caso de condenao


baseado em um exame de DNA
Gentica
Forense
Gentica
Forense
Desvantagens

Tcnica muito demorada e trabalhosa

Necessita de grande quantidade de DNA

Dificuldade em se estabelecer
vnculos genticos

Anlise de misturas invivel


Gentica
Forense
STRs
Short Tandem Repeat Marcadores de DNA
utilizados na gentica forense atualmente
Gentica
Forense
Gentica
Forense
STRs
So pequenas de DNA (2 a 8
bases) que se repetem inmeras
sequncias A
vezes.
quantidade de repeties da sequncia
varia de um indivduo para o outro
Gentica
Forense
Exemplo: Marcador X

A lelo 1:
AGCTAATCGATCGATCGATCGATCGATCGATCGGTGCA

Alelo 2:
AGCTAATCGATCGATCGATCGATCGATCGATCGATCGGT
GCA
Gentica
Forense
Marcador X
Alelo 1: 7 repeties
Alelo 2: 8 repeties

Marcador X

7 8
Gentica
Forense
Pai Me

7 9 10 11

Criana

9 10
Gentica
ForenseSTRs
Possuem um grande poder de diferenciao
entre indivduos e apresentam um tempo de
anlise relativamente rpido
Possibilitam a anlise de mais de um marcador
ao mesmo tempo - Multiplex
Gentica
Forense
Reao de PCR Multiplex
uma reao de PCR em que so
amplificados diversos fragmentos do DNA de
interesse ao invs de apenas um
Gentica
Alelo Forense
Me Criana Suposto Pai
TH01 7 8 8 8 8 10
TPOX 12 12 10 12 10 12
D5S818 12 12 11 12 9 11
D7S820 13 14 13 13 12 13
D18S51 20 21 20 20 20 21
CSF1PO 6 8 6 7 7 7
FGA 21 25 23 25 22 23
vWA 17 17 17 18 18 18
Amelog. X X X X X Y
Gentica
Forense
SequnciasSTRsde 4 5 repeties so
e
degradao
amplificadasde DNA e amplificao
facilmente e sofrem diferencial
com
menos
Fazem parte de uma classe de
marcadores geneicos chamados de
microssatlites
Gentica
Forense
Gentica
Forense
Gentica
Forense
Gentica
Forense
Gentica
Forense
Gentica
Forense
Amelogenina: Gene que protenas
codifica presentes no esmalte do
dente.
No cromossomo X um ntron desse gene
apresenta uma deleo de 6 bp, o que no
acontece no cromossomo Y.
A anlise de DNA teve sua primeira aplicao no contexto criminal em 1986 e, desde
ento, tem experimentado um enorme desenvolvimento, caracterizando-se como uma
especialidade das cincias forenses. A esse respeito, julgue os itens a seguir.

-De forma geral, as regies codificantes do genoma humano so altamente polimrficas.

-As repeties curtas em tandem (STR) fazem parte de uma classe de marcadores que
rene caractersticas altamente desejveis na identificao humana.

-Quando comparados aos marcadores genticos, alguns marcadores proticos


polimrficos tm expresso tecido-especfica e, conseqentemente, aplicao limitada a
algumas categorias de material biolgico.

-Os marcadores de DNA, quando comparados aos marcadores convencionais,


possibilitam a identificao de vestgios em elevado estado de putrefao ou submetidos a
altas temperaturas.
Rotina de DNA forense

Processos, reagentes e equipamentos


na rotina de um laboratrio de DNA
forense
Rotina de DNA forense

Tudo comea fora do laboratrio

Coleta das amostras


Rotina de DNA forense

A coleta das amostras importantssima


para a qualidade do resultado final
Rotina de DNA forense
Origens diversas:

Local de crime

V timas

S uspeitos

Roupas e objetos

P artes em um processo
Rotina de DNA forense
Materiais biolgicos mais utilizados
coletados em pessoas vivas:

Sangue

Swab mucosa oral

Pelos
O modelo do DNA, proposto em 1953, por Watson e Crick, com base na seqncia
linear de nucleotdeos, rendeu a seus autores o Prmio Nobel em 1962. graas ao
DNA que cada pessoa caracterizada como um indivduo singular. Com base nos
estudos sobre o DNA, julgue os itens que se seguem:

-Somente a partir da dcada de 80 do sculo XX, o DNA passou a ser usado


legalmente para justificar uma condenao.

-As principais tcnicas laboratoriais usadas para comparar e avaliar fragmentos de


material de DNA so as anlises de polimorfismo de comprimento dos fragmentos de
restrio (RFLP) e a reao em cadeia da polimerase (PCR).

-Freqentemente, os tecidos moles da cavidade bucal so boas fontes de DNA.


Entretanto, a saliva no pode ser usada como fonte para estudo do DNA, por ser
destituda de clulas, ao contrrio dos tecidos bucais.
Rotina de DNA forense
Materiais biolgicos mais utilizados
coletados em cadveres:

Sangue

Swab mucosa bexiga

Msculo e Cartilagem

Ossos e dentes
Rotina de DNA forense
Materiais biolgicos coletados de
suportes:

Roupas

Projtil

Armas

Cigarro

Veculo
Rotina de DNA forense

Coleta e conservao:
Os vestgios em locais
crime devem ser
encontrados de
corretamente transportados e armazenados
preservados, coletados,
antes de serem examinados em laboratrio
Rotina de DNA forense

Cadeia de custdia:
um usado manter
documentar
processo a histria
para cronolgica e
de
vestgio, desde a sua coleta em um local um
de crime at o resultado final dos exames
Rotina de DNA forense
Caso O. J. Simpson
Rotina de DNA forense
Caso O. J. Simpson
Rotina de DNA forense
Caso O. J. Simpson
Rotina de DNA forense
Em uma cidade dos Estados Unidos da Amrica (EUA), a polcia local encontrou
uma cena de crime farta em evidncias: muito sangue, peas de vesturio,
pegadas e uma trilha de sangue que revelava o caminho seguido pelo criminoso.
Seguindo essas pistas, os policiais chegaram casa do ex-marido de Nicole, o
astro de cinema e dolo do futebol norte-americano O. J. Simpson, obtendo ali
mais evidncias: manchas de sangue em seu carro, nas suas meias e no cho
do jardim. Exames de DNA comprovaram que esse sangue era das vtimas.
Assim, a promotoria acreditava ter nas mos um caso fechado, que no poderia
ser contestado, mas foi surpreendida pela estratgia dos advogados de O. J.
Simpson: o questionamento das provas. As cmeras de televiso flagraram o
principal perito da polcia coletando amostras sem luvas, policiais manipulando
evidncias sem trocar as luvas e muitas pessoas circulando na cena do crime,
que no tinha sido bem isolada.
Cincia Hoje, vol. 29, n. 169 (com
adaptaes).

Considerando a situao descrita no texto acima, que relata dados


referentes a um caso de homicdio ocorrido nos EUA em 1994, julgue os itens a
seguir.
- As metodologias de RFLP e PCR, que so
fundamentadas no mesmo princpio e requerem a
amostra,
mesma diferindo apenas
quantidade de quanto s utilizadas
enzimas poderiam ter sido aplicadas situao ,
descrita.
- Na situao descrita, a tipagem sangunea seria
suficiente para a precisa identificao das vtimas a partir de
manchas de sangue, no sendo necessrio o uso de exames
de DNA.
- Na considerada material mido coletado
perito para anlise ,de padres de
situao DNA deveria ser
pelo
em
armazenado plstico hermeticament fechados, pois
sacos
microrganismos s capazes ede contaminar a no
amostra sobrevivem em tais condies.
Rotina de DNA forense
Cuidados na coleta de material biolgico:

Usar luvas e mscaras

Evitar conversar sobre as amostras

Coletar quantidade suficiente para


os exames evitando ao mximo
contaminao
Rotina de DNA forense
Cuidados na do
preservao biolgico: material

Secar os suportes utilizados para a coleta

Manter as amostras em baixa


temperatura (congeladas)
Rotina de DNA forense

Testes de natureza das amostras

Sangue: Imunolgicos, sorolgicos,


luminol

Esperma: PSA, fosfatase alcalina

Globulina humana
Rotina de DNA forense
Extrao

Tem o objetivo de retirar o material celular


do suporte, lisar as clulas e eliminar todo
o contedo celular deixando apenas o DNA
Rotina de DNA forense

Extrao

Protocolos diferentes para cada tipo de


amostra
Rotina de DNA forense
Sangue

Amostra padro
para coletas de
referncias

E xtrao
simplificada
Rotina de DNA forense
Papel FTA
Rotina de DNA forense
Swab de mucosa oral

A lternativa menos invasiva ao sangue

M u i t o utilizada para coleta em crianas

Coleta necessita ser bem feita para se


obter boa quantidade de clulas

Coleta menos especializada


Rotina de DNA
forense
Swab de mucosa oral
Rotina de DNA
forense
Swab de mucosa oral
Rotina de DNA
forense
Pelos

P raticamente no se usa a coleta de pelos


e fios de cabelo para amostras de referncia,
devido a dificuldade de se trabalhar com esse
tipo de amostra
Rotina de DNA
forense
Pelos
Rotina de DNA forense
Amostras Forenses

Diversos protocolos diferentes de


extrao
mais
usada,

E x t r apor
oser barata e extrair
orgnica grande quantidade
Fenol-Clorofrmio

Desvantagem: Mais trabalhosa, muitas


etapas, reagentes perigosos e o produto final
no to limpo
Rotina de DNA forense
Rotina de DNA forense
Rotina de DNA forense
Rotina de DNA forense
Rotina de DNA forense
Amostras Forenses

1 Etapa: Amostra incubada com um tampo


de
lavagem e lise celular

2 Etapa: Extrao com Fenol-clorofrmio

3 Etapa: Precipitao com lcool


Rotina de DNA forense
Rotina de DNA forense
Extrao diferencial

Utilizada em casos de crimes sexuais

Objetivo realizar uma lise diferencial


das clulas epiteliais femininas e dos
espermatozides

Utiliza dois detergentes de


membrana diferentes
Rotina de DNA forense
Extrao diferencial
Rotina de DNA forense
Extrao com Chelex

Resina que tem afinidade por DNA

E x t r a o mais rpida e com menos


etapas do que a orgnica

P roduto final em menor quantidade e


mais sujo do que orgnica.
Rotina de DNA forense
Extrao com kit comerciais

Kits de extrao prontos, otimizados para


um grupo ou amostras especficas

Extrao mais rpida e produto mais


limpo, porm mais cara e menor
quantidade.
Rotina de DNA forense
Extrao com kit comerciais
Rotina de DNA forense
Quantificao

Importante para avaliar a quantidade de


DNA presente em uma amostra

Tcnicas modernas tambm


passam informao sobre a presena de
inibidores de PCR
Rotina de DNA
forense
Quantificao
Quantificao atravs de PCR-RT
PCR em tempo real

Modificao da tcnica de PCR a


que torna
quantitativa

Utilizada para deteco de alelos em DNA


genmicos, diagnstico de doenas,
de organismos
identificao identificao
transgnicos, patgenos em de
alimentos
PCR em tempo real
PCR em tempo real
qPCR
qPCR
Rotina de DNA
forense
Quantificao
Amostra Protocolo Ct Qtd (ng)
C-9856 Humano 29,58 3,324
Masculino 28,49 3,129
IPC 27,31

PCR em tempo real permite quantificar
DNA
o presente em uma amostra

Permite tambm distinguir a fonte de


emDNA
humana e masculina

Padro interno permite avaliar a presena ou


no de inibidores

Possibilita ajuste da concentrao ideal


DNA
de
Rotina de DNA
forense
Amplificao
Amplificao
Amplificao
Amplificao

Primers Forward e (sense -


: Reverse anti-
sense

Se o for
produto primers so marcados
submetido com
eletroforese
fluorforo
capilar, os um

A amplificao ocorre sempre no sentido 5`-


3`
Rotina de DNA forense
Amplificao
Amplificao
Amplificao
Parmetros dos ciclos
1. Temperatura e Tempo de desnaturao

Falta de desnaturao do molde uma


causa comum de falha na PCR

Tipicamente 94C por 30 s

Tempo de desnaturao muito longo reduz


a meia vida da enzima
Parmetros dos ciclos
2. Temperatura e Tempo de anelamento

Temperatura de anelamento = 5oC abaixo


do Tm real dos primers

Tempo de anelamento = 15 a 30 s

Tempo de extenso: funo tamanho


do AMPLICON
1 minuto suficiente 1,2 kb
Longo, reduz a meia vida da enzima
Efeito Plateau: desvio da quantidade terica
Eficincia terica x Eficincia Real
Principais fatores contribuintes

Perda da atividade da Polimerase

Acmulo de inibidores

Limitao dos componentes

Competio entre produtos

Pareamento Produto x Molde,

Competio com anelamento do primer


Rotina de DNA
forense
Amplificao
Componente Volume
H2O 5,5 L
Reaction Mix 12,5 L
Primer Set 10,5 L
Taq Gold 0,5 L
Volume total 22,0 L
DNA (0,5 a 1,25 ng) 5,0 L
Rotina de DNA
forense
Amplificao
Rotina de DNA
forense
Eletroforese
Rotina de DNA forense
Eletroforese
Eletroforese

Para separao de fragmentos de DNA


so utilizados dois tipos de gel: Agarose e
Poliacrilamida

Agarose utilizado para fragmentos maiores


e poliacrilamida pra amplicons menores
(como os de STR)
Eletroforese
A
eletroforese em gel trabalha com
tantoDNA
na forma fita simples quanto fita dupla

Para conseguir que o DNA fique estvel


na forma de fita simples so utilizados
agentes desnaturantes como por exemplo
Uria e Formamida
Eletroforese Capilar

Separao dos amplicons de DNA em


capilar
um ao invs do gel

Possui diversas vantagens como maior


poder de resoluo, corrida mais rpida,
potencial para automao, utiliza pequenas
quantidades de amostra, visualizao do
resultado imediata
Rotina de DNA forense
Eletroforese
Rotina de DNA forense
Resumo
Quantificao

Recebimento Armazenamento Extrao

Genotipagem Eletroforese Amplificao


Sequenciamento

Tcnicas utilizadas para descobrir a sequencia


das bases de um fragmento de DNA no
conhecido
Sequenciamento
Sequenciamento de Nova Gerao

Novas metodologias que permitiram aumentar


vezes a muitas capacidade de sequenciamento,
possibilidade para novos estudos
abrindo que eram ainviveis com as
tecnologias mais antigas
Marcadores dos Cromossomos X e Y
Cromossomo Y
Cromossomo Y

Linhagem Patrilnea

90% da populao brasileira possui Y


de origem europia

E s t u do da origem populacional
Cromossomo Y
Cromossomo Y
Cromossomo Y

Muito til em crimes sexuais

Reconstituies de paternidade com


filhos homens ou com parentes homens

Marcadores de linhagem, no
indivduos especficos
Cromossomo Y
Cromossomo Y
Cromossomo Y
Cromossomo Y

O resultado do matching do Y no
identifica indivduo, mas sim uma linhagem!

Resultado forte nos casos de excluso


e fraco nas incluses.
Cromossomo X
Cromossomo X
Principal uso: Casos de paternidade
deficientes, com apenas um genitor
(principalmente suposto pai ausente)

Complementar em casos de
identificao humana e mutao de
autossmicos
DNA Mitocondrial
DNA Mitocondrial
DNA Mitocondrial

Cromossomo mitocondrial 16,569


bp, centenas de cpias por clula

til para amostras com alto grau


de degradao e em baixssima
quantidade
DNA Mitocondrial
Cromossomo caracterstico
da linhagem materna,
passado da me para os
filhos
Membros de uma mesma
famlia possuem o mesmo
hapltipo, a no ser que
tenham ocorrido mutaes
DNA Mitocondrial
DNA Mitocondrial

Desvantagens

Baixo poder de
discriminao Estudo caro
e trabalhoso
Sobre a utilizao de DNA mitocondrial como fonte de material para anlises de DNA correto
afirmar que:

(A) freqentemente utilizado em casos de determinao de paternidade, pois est presente em


grande quantidade no espermatozide;

(B)sua utilizao no indicada para materiais resultantes de incndios ou exploses, pois s h


uma cpia de DNA mitocondrial.

(C) indicado nos casos em que a quantidade de material celular reduzida, como nos resduos
fecais e material calcinado, pois as clulas possuem grande nmero de cpias do DNA mitocondrial em
relao ao nuclear;

(D)no permite a realizao de estudos evolutivos em materiais muito degradados, como as


mmias, pois menos resistente que o nuclear.

(E)a anlise do DNA mitocondrial humano no recomendada s aplicaes forenses, pois possui
muitas regies desconhecidas e to grande quanto o DNA nuclear.
DNA Mitocondrial
SNPs
SNPs
SNPs
SNPs
SNPs
MUITO OBRIGADO
E BOA SORTE!

arthursvidzinski@hotmail.com