Rekayasa genetika dan prinsip

rekayasa protein

Budiman Bela dan T. Mirawati Sudiro

Departemen Mikrobiologi FKUI
Genetic engineering deals with the ability of scientists to
manipulate DNA through the use of an expanding repertoir of
recombinant DNA techniques. These techniques allow DNA to be
cut, separated by size and even sequenced to determined the
actual composition and order of nucleotides.
Topics:
Tools and techniques of genetic engineering
Methods in Recombinant technology
Genome and protein analysis
Other techniques
 Goals of the DNA Technology:
1. Isolation of a particular gene, part of a
gene or region of a genome
2. Production of a desired RNA or protein
molecule in large quantities
3. Increased production efficiency for
commercially made enzymes and drugs
4. Modification of existing organisms so that
they express a particularly desirable trait
not previously encoded in the genome.
5. Correction of genetic defects in complex
organisms, including humans.
etc.
12/11/17 4
http://www.bio.miami.edu/dana/250/25003_10.html
Tools and techniques of genetic engineering
Struktur DNA
 Semiconservative replication of DNA

DNA denaturation:
Double strand-DNA separated into 2 single
strand DNA
In vitro : dsDNA heated 90-95oC will be
denatured.
Restriction endonuclease:
Enzim (endonuklease) yang dapat memotong untai DNA pada posisi
tertentu
Memotong ikatan fosfodiester pada diantara nukleotida pada kedua untai.
Tempat pemotongan tersebut (restriction site) : palindrom
Contoh :

DNA yang terpotong dapat berujung rata

blunt end atau berekor (sticky end,
cohesive end).
Potongan-potongan DNA ini disebut :
restriction fragment
Ligase:
Enzim yang menautkan 2 fragmen DNA dengan cohesive end yang
sesuai dengan menyambung ikatan gula fosfat yang terpotong oleh
endonuklease.
Contoh : Penggunaan restriction
endonuclease dan ligase untuk
menginsersikan fragmen DNA
pada vektor plasmid
 [GENETYX-WIN: Search Restriction Map]
Date : 2008.11.28
Filename : ns1 den2 jakarta.bio
Sequence Size : 1056
Sequence Position: 1 - 1056

670 680 690 700 710 720

aaaagctgccactggccaaagtcacacactctctggagtaatggagtgctagaaagtgag
/
AluI

730 740 750 760 770 780

atgataattccaaagaattttgcaggaccagtgtcacaacacaactacagaccaggttat

790 800 810 820 830 840

catacacaaacggcaggaccctggcatctaggtaagcttgagatggactttgatttctgc
/ /
HindIII

AluI

850 860 870 880 890 900

gaaggaaccacagtggtagtgactgaggactgtggaaatagaggaccctctttaagaaca

910 920 930 940 950 960

DNA polymerase III:
Adding bases to the new DNA chain ------ DNA replication
Unable to synthesizing a chain of nucleotides, but can only continue to add
nucleotides to an already existing chain (or start with a primer)
Can only add nucleotide in one direction (5 to 3)
Reverse transcriptase
Produce complementary DNA (cDNA) from an RNA template.
From retrovirus
Analisis DNA dengan elektroforesis jel
Elektroforesis dapat dilakukan pada jel agarosa atau
poliakrilamida
Grup fosfat pada DNA menyebabkan DNA bermuatan negatif,
arus listrik akan menggerakkan DNA ke kutub positif.
DNA akan bergerak dan terpisah berdasarkan ukurannya.
Fragmen berukuran besar akan bergerak lebih lambat.
MDV1DV3DV2DV4NN+
Hasil elektroforesis DNA Lambda yang dipotong dengan EcoRI
Hibridisasi asam nukleat dan pelacak (probe)
Dua untai asam nukleat dengan urutan basa yang saling
komplementer dapat melekat/ bergabung.
Dapat terjadi : DNA-DNA; DNA-RNA; RNA-RNA
Sifat ini digunakan untuk merancang oligonukleotida yang
dapat mengenali fragmen/sekuens DNA tertentu yang
ingin dicari ----- pelacak/ probe.
 Contoh

Sekuensdaerah3virusdenguetipe3:
..CAAAGGACUAGAGGUUAGAGGAGACCCCCCGCAAA
UAAAAACAGCAUAUUGACGCUGGGAGAGACCAGAGAUC
CUGCUGUCUCCUCAGCAUCAUUCCAGGCACAGAACGCCA
GAAAAUGGAAUGGUGCUGUUGAAUCAACAGGUUCU

..CUGUCUCCUCAGCAUCAUUCCAGGCACAGAAC

GCCAGAAAAUGGAAUGGUGCUGUUGAAUCAACAGGUUCU

TTACCACGACAACTTAGTTG
Agardapatdilihat,probedilabeldenganradioaktifatauenzim
TeknikmendeteksiasamnukleattertentudenganpelacakRNAatau
DNAdisebuthibridisasi

Southernblot:
SampelDNAdilarikanpadaelekroforesisjelagarosa----blotke
membran---hibridisasidenganpelacakberlabel----visualisasi

Northernblot:
SampelDNAdilarikanpadaelekroforesisjelagarosa----blotke
membran---hibridisasidenganpelacakberlabel----visualisasi
Southern blot
Reverse hybridization with non-radioactive label
DNA sequencing
- Untuk mengetahui urutan nukleotida pada DNA

Metoda Sanger:
Fragmen DNA ----- denaturasi ---- ssDNA sebagai cetakan -----
+ 4 dNTP + ddATP/ ddTTP/ ddCTP/ ddGTP
Dideoksinukleotida tidak memiliki molekul O pada 3karbon dari ribose
---- pemanjangan rantai DNA terhenti bila rantai mengikat ddNTP
------ terbentuk DNA dengan gradasi ukuran dari 1 maksimal -----
elektroforesis ---- baca.
Automated DNA sequencing
Polymerase chain reaction
A molecular copy machine for DNA
Primer : Oligonukleotida sintetis yang dirancang untuk mengenali
bagian DNA yang akan diamplifikasi, dan memungkinkan terjadinya
polimerasi/ pemanjangan untai DNA.
Diperlukan suhu tinggi untuk denaturasi DNA
Digunakan enzim DNA polimerase yang tahan pada suhu 95oC (misal
enzim taq polymerase dari Thermus aquaticus)
PCR

Terdiri atas 30-40 siklus 3 tahap dasar, yaitu:

Denaturasi :
90-95oC, terjadi pemisahan DNA rantai ganda, menjadi 2 untai
rantai tunggal

Annealing/ priming
50-65oC, perlekatan primer pada DNA target

Elongation
68-72oC, reaksi polimerasi, pemanjangan rantai DNA
Polymerase chain reaction
 Metoda untuk membuat DNA rekombinan
----- DNA cloning
Strategi :
1. Mengambil gen/ bagian gen yang diinginkan dari 1 organisme (donor)
- Memotong dengan restriction endonuclease
- dari RNA, menggunakan reverse transcriptase untuk
mendapatkan cDNA
- Amplifikasi dengan PCR
- Sintesis DNA

2. Insersi gen yang diinginkan ke vektor (plasmid, virus, cosmid)

3. Memasukkan vektor yang telah mengandung insert DNA ke sel
hospes yang sesuai (cloning host) - bakteri, jamur, sel mamalia
4. Seleksi sel berisi DNA yang diinginkan
5. Konfirmasi dengan analisis DNA / protein
Gene cloning
! E. coliisthemostwidelyusedcloninghostforamplification
ofrecombinantDNA
12/11/17 30
http://www.bmb.psu.edu/courses/micro106/biotech/biotechover.jpg
12/11/17 31
http://www.bmb.psu.edu/courses/micro106/biotech/biotech.htm
12/11/17 32
http://www.bio.miami.edu/dana/250/25003_10.html
 Early 1970's, Herbert Boyer, Stanley Cohen, Paul Berg
and co-workers Started Recombinant DNA
Technology:
insertion of foreign pieces of DNA in to host cells
and cloned those host cells to produce multiple
copies of the inserted DNA.
Currently, there are many sophisticated techniques
available for doing essentially the same thing: inserting
DNA from one species into another species, and
allowing that recipient species to replicate, producing
multiple copies of the new RECOMBINANT DNA.
An organism containing an artificially inserted, foreign
piece of DNA is said to be TRANSGENIC

12/11/17 33
http://www.bio.miami.edu/dana/250/25003_10.html
Sifat penting vektor untuk kloning gen, a.l.:
Punya ori (origin of replication)
Dapat menerima DNA insert, kecil, tidak mudah terdegradasi
Mempunyai restriction site yang dapat digunakan untuk insersi gen
yang akan diklon
Membawa gen marker, misal pembawa sifat resistensi antibiotika
---- untuk seleksi

Sifat penting vektor untuk kloning gen untuk ekspresi protein

Sama dengan di atas
Mempunya promoter dan
ribosome binding sequence
VECTOR YANG DIGUNAKAN UNTUK KLONING GEN
a.l.:
retroviruses
adenoviruses
adeno-associated viruses (AAV)
herpes simplex virus
rhinoviruses
Human Immunodeficiency Virus (HIV)
plasmids of various types (misal : plasmid pBR322 and pUC)
faga lambda
cosmid (hibrid plasmid dan faga lambda)
Introduksi klon gen ke sel hospes
Sel : Bakteri, sel mamalia, sel serangga, sel tanaman
Syarat : - Tumbuh cepat, mudah dibiak
- Non-patogen
- Genomnya sudah dipetakan
- Dapat menerima vektor plasmid atau faga
- Mempertahankan gen asing selama multiplikasinya
- Mengekspresi dan mensekresi protein klon dalam jumlah besar

Metoda : Transformasi, transfeksi, elektroporasi, biolistik, transduksi dll.

Sifat penting mikroba sebagai cloning host
Tumbuh cepat
Mudah dibiak
Non-patogen
Genomnya sudah dipetakan
Dapat menerima plasmid atau faga
Mempertahankan gen asing saat replikasinya
Mengekspresikan protein yang diinginkan dalam jumlah besar
 Transformation
(this term is used for introduction of DNA to bacterial or plant cells)

Transformation: DNA picked up

directly from the medium and
recombined into the genome

heteroduplex

! Competent cell:
bacterial cell
capable of picking
up DNA
Transfection :
the introduction of foreign material into eukaryotic cells. Transfection
typically involves opening transient pores or 'holes' in the cell
plasma membrane, to allow the uptake of material.
Genetic material (such as supercoiled plasmid DNA or siRNA
constructs), or even proteins such as antibodies, may be
transfected.
Transfection is frequently carried out by mixing a cationic lipid with
the material to produce liposomes, which fuse with the cell plasma
membrane and deposit their cargo inside.
The term transfection is most often used in reference to
mammalian cells.
The term transformation is more often used for the same process
in bacteria and, occasionally, plants.
Methods of transfection:
calcium phosphate precipitation, originally discovered by S.
Bacchetti and F. L. Graham in 1977.[1] HEPES-buffered saline
solution (HeBS) containing phosphate ions is combined with a
calcium chloride solution containing the DNA to be transfected.
When the two are combined, a fine precipitate of calcium
phosphate will form, binding the DNA to be transfected on its
surface. The suspension of the precipitate is then added to the
cells to be transfected (usually a cell culture grown in a
monolayer). By a process not entirely understood, the cells take up
some of the precipitate, and with it, the DNA.

electroporation
heat shock
Lipofectamine and Fugene.
gene gun, where the DNA is coupled to a nanoparticle of an
inert solid (commonly gold) which is then "shot" directly into
the target cell's nucleus BIOLISTICS
 ELECTROPORATION
if host cell has cell walls, enzymes are used to dissolve
the walls, leaving only a protoplast (cell without walls)
Foreign DNA is introduced via ELECTROPORATION--
protoplasts are exposed to a short electrical pulse which
opens transient membrane channels through which DNA
can pass
transformed cells can then be cultured in media that
allows re-formation of cell walls and normal growth into a
whole organism (plants, fungi, some protists).
Animal cells lack cell walls, and so are easily
transformed via electroporation.

12/11/17 42
http://www.bio.miami.edu/dana/250/25003_10.html
 BIOLISTICS
BIOLISTICS is the process of bombarding cells with
microscopic projectiles (usually made of an inert
substance such as tungsten or gold) and coated with
DNA
These are shot at high velocity from a particle gun into
cells or tissue
This technique is promising for use in live organisms
It was invented by A Guy.

12/11/17 43
http://www.bio.miami.edu/dana/250/25003_10.html
 TRANSDUCTION
Viruses with affinity for certain cell types can also be
used as vectors if they are "loaded" with desired foreign
DNA and allowed to infect target host cells

12/11/17 44
http://www.bio.miami.edu/dana/250/25003_10.html
 MICROINJECTION
One greatly desired goal is the introduction of genes into
all cells of an animal affected with a genetic disorder, in the
hopes of allowing the faulty cells to transform and
substitute functional genes for faulty ones.
Transgenic animal with an entirely genetically altered
animal can be obtained via MICROINJECTION.
To generate a transgenic animal, foreign DNA must
be inserted into a zygote or very early embryo.
DNA is injected directly into the nucleus of the cell with
an extremely tiny pipette.
Once DNA transfer is accomplished, it is sometimes (if
the researcher is lucky!) incorporated into the host cell
chromosome
The transformed zygote/embryo can then be implanted
into a surrogate mother for growth and development.
12/11/17 45
http://www.bio.miami.edu/dana/250/25003_10.html
Introduction of DNA into mammalian cells
Seleksi klon yang mengandun
insert DNA yang dikehendaki

- Sel bakteri : Ampicillin

- Sel mamalia : geneticin
Genomic library in phages
A DNA LIBRARY is a collection of cloned restriction fragments from a
single organism's genome. The goal is to have a library containing clones
of ALL the organism's genes. But like real libraries (particularly U.M.'s)--
not all DNA libraries are complete.
A GENOMIC LIBRARY is a DNA library containing an organism's
complete genome, in the form of small DNA fragments (oligonucleotides)
representing known genes.
The new field of BIOINFORMATICS involves the use of computers to
analyze and store genetic data, such as the DNA libraries of particular
species.
A cDNA LIBRARY is a DNA library made up of DNA clones
reconstructed (using reverse transcriptase) from some of the organism's
mRNA molecules.
Untuk konfirmasi klon
Pemotongan dengan endonuklease restriksi
Southern blot
PCR
Western blot
Western blot:
Protein di-elektroforesis pada gel poliakrilamida
Blot protein/ gel ke membran nitroselulosa
Adanya protein dikenali dengan antibodi spesifik
Antibodi sekunder berlabel radioaktif atau enzim
Visualisasi
Mutagenesis dengan oligonukleotida sintetik
Analisis ekpresi protein dengan DNA microarray

Contoh:
Untuk mengetahui perbedaan ekspresi gen pada
sel kanker dan sel normal.
Pada chip telah direkatkan sejumlah probe
oligonukleotida yang mengenali gen-gen yang
akan diteliti.
Isolasi mRNA
Dengan RT, dibuat cDNA, disertai label yang
berbeda untuk sel kanker (merah) dan sel normal
(hijau).
Campurkan cDNA, hibridisasikan pada chip
microarray yang telah disiapkan
Baca hasil
PROTEIN ENGINEERING

Budiman Bela
 OUTLINE
Introduction
Protein Engineering Goals
Preliminary Requirements
Rational Mutagenesis and Protein Design
 INTRODUCTION

Proteins are the workhorses of the cell.

There are 20 common amino acids that allow different
combinations and formation of proteins with various functions
and capabilities:
1. Specific binding of ligands
2. Catalysis of complex chemical reactions
3. Functionality in extreme environments
4. Transportation of valuable molecules
5. The exhibition of diverse structural and material
properties
 INTRODUCTION

The main thrusts in the field of protein engineering can be loosely

divided into two areas:
1. Investigation and verification of hypotheses during the study of
protein functions
2. Engineering of proteins for desired improvements
 PROTEIN ENGINEERING
GOALS
Traits that can be altered through protein
engineering:
Activity
Stability
! Expression
Other traits
!
 PROTEIN ENGINEERING
GOALS

PROTEIN ACTIVITY:
Improved catalysis with natural substrate
or cofactor
Improved catalysis with nonnatural
substrate or cofactor
! Increased catalysis in nonnatural solvent
! Improved ligand binding
! Decreased effects of inhibition
PROTEIN ENGINEERING
GOALS

PROTEIN STABILITY:
Increased thermostability
Increased activity in alternative pH
Increased acitivity in different ionic strength
Improved protein folding
Decreased susceptibility to proteolysis
Pharmacokinetics
PROTEIN ENGINEERING
GOALS

EXPRESSION:
Improved expression levels in nonnatural
host
Targeted expression to different cellular
location
Added tags to detect protein expression
Altered posttranslational modification
PROTEIN ENGINEERING
GOALS

OTHER TRAITS:
Added tags to facilitate purification
Altered tendency for polymerization
Added tags to visualize localization
Engineered allosteric binding sites
Altered isoelectric point
Decreased immunogenicity
 Addition of tag to facilitate purification:

! - Addition of GST tag for purification using

glutathione-sepharose collumn
! - Addition of histidine tag for purification using nickel
collumn
 PRELIMINARY
REQUIREMENTS
Before a protein engineering project can begin, a
certain amount of information is required about the
protein of interest:
1. Amino acid sequence of the protein
2. DNA sequence that encodes the amino acid
sequence (Amplification of DNA for sequencing
PCR) cloning in plasmid
3. Although not required, information about the the 3-
dimensional (3-D) structure of a protein can aid
the engineering of a protein
PRELIMINARY REQUIREMENTS
Protein to be engineered

Associated DNA Sequence

Site Directed Mutagenesis Combinatorial Mutagenesis

1. Make specific mutation 1. Make library of mutations

2. Assay effect of mutation on 2. Screen or select for improved
protein function proteins
3. Repeat as necessary 3. Determine specific mutations
4. Repeat as necessary

Newly engineered protein

 Mutagenesis of Proteins

Two main approaches for alteration of

proteins:
Rational mutagenesis
Combinatorial Methods
 Rational Mutagenesis
Top down approach:
A hypothesis is made about mutations at a
specific location (often guided by 3-D structural
information) the hypothesis is tested
through the mutation of specific smino acids
and assays of the subsequent mutant proteins
 Combinatorial mutagenesis

Bottom up approach:
A library of different mutant proteins is
produced a method is then developed to
screen or select members of the library that
have an improved trait, the mutations that
caused the improvement are determined later
 Rational Mutagenesis
1. Site Directed Mutagenesis
2. Other methods:
1. Use of restriction sites:
- insertions
- deletions
- significant rearrangements
2. Introduction of restriction site by site directed mutagenesis
(restriction sites
can be introduced without altering the associated protein
sequence) cut and paste of DNA sequences: fusion proteins,
swap domains of proteins, remove entire section of proteins
 Rational Mutagenesis

Example: Insulin
Human insulin is used for treatment of diabetes
Native insulin form dimers and hexamer : enable
stockpiling in the pacreas before it is needed for
release
Problem in the use of insulin in therapy :
purified insulin is injected subcutaneously only
active monomer form is desired
Formation of dimers and hexamers can slow down
absorption
 Rational Mutagenesis
Example: Insulin
Problem solution:
Site-directed mutagenesis to introduce repulsive
charges and steric hindrances at the dimer
interface reduce the tendency of human insulin
to self-assemble
Insulin monomers is produced based on the
above work, that have an increased rate of
absorption resulting in preferable postprandial
plasma concentration profile
Terima kasih