Você está na página 1de 58

Biologia Molecular

DNA
Alexandre S. Osório
A natureza química dos genes

Histórico
 Miescher (1871) – Análise química com células de pus,
rins, fígado, testículos, leveduras e hemácias de aves
(detecção de C, H, N, O e P) = NUCLEÍNA.

 Altmann (1889) – Purificação de nucleína (caráter ácido)


= Ácidos Nucléicos.

 Kossel (1877) – Detecção de guanina, adenina e timina.


(1893) – Identificação de timina, citosina e
pentose.
A natureza química dos genes

Histórico
 Levine e Jacobs (1909) – Descoberta dos nucleotídeos e
caracterização do DNA e RNA.
A natureza química dos genes
Histórico
Watson e Crick (1953) – Modelo Helicoidal do DNA.
Identificação do DNA como
material genético
Transformação bacteriana - Griffith (1928)
RNA
Transcrição &
Processamento

RNA: eficiente &


eficaz
Dogma Central da Biologia
Molecular
TRANSCRIÇÃO

• Processo pelo qual uma molécula de RNA é


sintetizada a partir da informação contida na
seqüência de nucleotídeos de uma molécula de DNA
fita dupla.

• A transcrição representa a diversidade e a


complexidade da expressão dos genes contidos em
um determinado genoma.

• Enquanto a síntese de DNA deve ser precisa e


uniforme, a transcrição reflete o estado fisiológico da
célula e, portanto, é extremamente variável para
atender às suas necessidades.
TRANSCRIÇÃO

Características Gerais:

•Complementaridade
•Antiparalelismo ( T = U)
•Síntese 5' → 3‘
•RNA Polimerase (RNAP):
• Funções
reconhecem e ligam-se
desnaturam DNA
mantém estável a dupla fita aberta
mantém estável DNA:RNA
terminam síntese
restauram DNA
TRANSCRIÇÃO

• Apenas uma das fitas do DNA é utilizada como


molde, portanto, a molécula de RNA sintetizada é
complementar à fita de DNA que lhe deu origem e
idêntica à outra fita de DNA, sendo as timinas
substituídas por uracilas

• Em 1960, Hurwitz, Stevens e Weiss descobriram,


independentemente, uma enzima capaz de sintetizar
RNA na presença de DNA fita dupla e dos
nucleotídeos A, U, C, G.

• Esta enzima foi denominada RNA polimerase.


RNA POLIMERASE

• Reconhece e liga-se a seqüências específicas de


DNA;
• Desnatura o DNA expondo a seqüência de
nucleotídeos a ser copiada;
• Mantém as fitas de DNA separadas na região de
síntese;
• Renatura o DNA na região imediatamente
posterior à da síntese;
• Sozinha, ou com o auxílio de proteínas
específicas, termina a síntese do RNA.
RNA POLIMERASE

Em eucariotos existem vários subtipos de RNA


polimerases envolvidas na síntese de RNAs
específicos:

. RNA polimerase I – localizada no nucléolo e


responsável pela síntese do RNA ribossômico
. RNA polimerase II – localizada no nucleoplasma
e responsável pela síntese do RNA mensageiro
. RNA polimerase III – também localizada no
nucleoplasma e responsável pela síntese do RNA
transportador
TRANSCRIÇÃO

1.INÍCIO
Reconhecimento de seqüências específicas no DNA

2. ALONGAMENTO
Incorporação dos ribonucleotídeos

3. TERMINAÇÃO
Seqüências no DNA são reconhecidas e a síntese é
interrompida
INÍCIO DA TRANSCRIÇÃO

• O DNA apresenta seqüências específicas,


denominadas PROMOTORES, que sinalizam
exatamente onde a síntese do RNA deve ser
iniciada.

• Os promotores são, primeiramente,


reconhecidos por fatores de transcrição que,
ligados ao DNA, interagem com outros fatores,
formando um complexo ao qual a RNA
polimerase se associa.
O PROCESSAMENTO DO RNA

• Os diferentes RNAs sintetizados no processo


de transcrição são chamados de transcritos
primários;

• Na maioria das vezes, esses transcritos não


representam a molécula madura, ou seja, aquela
cuja seqüência e estrutura correspondem à
forma final do RNA funcional;

• Esses transcritos necessitam sofrer


modificações que fazem parte do
processamento do RNA.
PROCESSAMENTO DO mRNA

O transcrito primário da molécula de mRNA é


também conhecido como pré-mRNA

Este RNA precursor é sintetizado no núcleo e


sofre várias alterações transformado-se no
que se chama mRNA maduro ou processado.
O RNA maduro é, então, transportado ao
citoplasma onde será traduzido
RNAm liga-se as Ribonucleoproteínas
nucleares pequenas (snRNPs)

Splicing mediado por


spliciossomo:
Utiliza ATP

•FUNÇÃO:

 ajuda a clivar no sítio


de splicing
remove intron
une os éxons
anteriores e posteriores
PROCESSAMENTO DO mRNA

Splicing:

•FUNÇÃO:

 ajuda a clivar no sítio


de splicing
remove intron
impede afastamento
dos éxons
une os éxons
PROCESSAMENTO DO mRNA
Estrutura do mRNA
PROCESSAMENTO DO mRNA

• Um transcrito primário pode ser processado de


diferentes maneiras sendo que o que é intron
para um mRNA pode ser exon para outro mRNA
que provém do mesmo RNA precursor

• Esta diferença de processamento pode ser


devida à diferença no processo de “splicing” do
pré-mRNA
MOLÉCULAS DE RNA

• RNA mensageiro – carrega a informação copiada


do DNA sob a forma de inúmeros “triplets” cada um
especificando um aminoácido

• RNA transportador – decifra o código representado


pelo mRNA

• RNA ribossômico – associa-se com uma série de


proteínas para formar os ribossomos
TRADUÇÃO

• Processo que se baseia na seqüência do mRNA


para determinar e unir os aminoácidos
formando, assim, a proteína.

• Cada aminoácido é codificado na seqüência de


DNA como um códon contendo uma seqüência
de três nucleotídeos.

• Moléculas de RNA transportador transferem a


informação contida no genoma à uma seqüência
de aminoácidos nas proteínas.
RNA TRANSPORTADOR

• Liga-se quimicamente à um aminoácido


específico, através da enzima aminoacil –tRNA
sintetase, sendo chamado, desta forma, de
aminoacil-tRNA;

• Pareia com a seqüência do codon do mRNA


adicionando o aminoácido que carrega à uma
cadeia de peptídeos crescente.
RNA TRANSPORTADOR
RIBOSSOMOS

A eficiência da tradução se deve, principalmente, à


ligação da molécula de mRNA e dos aminoacil-
tRNAs ao maior complexo RNA-proteína da célula
– o ribossomo – que direciona o crescimento da
cadeia polipeptídica

Durante a síntese protéica, o ribossomo se move


ao longo da cadeia de mRNA interagindo com
vários fatores protéicos e o tRNA
CÓDIGO GENÉTICO

A relação entre a seqüência de bases no DNA e a


seqüência correspondente de aminoácidos, na proteína, é
chamada de código genético
O código genético encontra-se na forma de triplets – os
códons
TRADUÇÃO

• O codon AUG, que codifica o aminoácido


metionina, age como o codon de iniciação na
maioria das moléculas de mRNA.

• O tRNAMet reconhece codons AUG internos, não


carregando nunca uma metionina formilada.

• Quando AUG está colocado no início este é lido


como uma formil-metionina; quando está dentro
da região codificadora, é lido como metionina.
TRADUÇÃO

Durante a síntese de proteínas, os ribossomos


deslocam-se ao longo do mRNA, possibilitando
um pareamento entre esse e os tRNAs que
carregam os diferentes aminoácidos que irão
compor as proteínas
TRADUÇÃO

A terminação da síntese de proteínas ocorre


pelo aparecimento de códons de terminação
na molécula de mRNA

O reconhecimento desses códons é realizado


por proteínas e não por moléculas de tRNA,
diferentemente do que ocorre nos outros
códons
Dogma Central da biologia Molecular
Núcleo
RNA polimerase

Gene
Transcrição
hnRNA
Processamento
mRNA
Tradução
Citoplasma

proteína
Transcrição:

RNA polimerase
Gene ativo
5’ CG TA C 3’
A 3’
ACGTA A
TGCAT AC
GU A T
TG G
3’ C A T 5’
5’
A

AC GU

Molécula de RNA nascente


Tradução:
aa livre
Gly
Ribossomo Phe His
Glu
Proteína Asp
Met
Ala Cys
tRNA
5’ 3’
AUGGCAUGCGACGAAUUCGGACACAUA

Molécula de mRNA
codon

Direção do avanço do ribossomo


Gly
Phe His
Glu
Asp
Met
Ala Cys

5’ 3’
AUGGCAUGCGACGAAUUCGGACACAUA
Gly
Phe His
Glu
Met
Ala
Cys Asp

5’ 3’
AUGGCAUGCGACGAAUUCGGACACAUA
His
Gly
Met Phe
Ala
Cys
Asp Glu

5’ 3’
AUGGCAUGCGACGAAUUCGGACACAUA
Ile
Met His
Ala Gly
Cys
Asp
Glu
Phe

5’ 3’
AUGGCAUGCGACGAAUUCGGACACAUA
Lys
Met
Ala Ile
Cys His
Asp
Glu
Phe
Gly

5’ 3’
AUGGCAUGCGACGAAUUCGGACACAUA
Met
Ala Lys
Cys
Asp Ile
Glu
Phe
Gly
His

5’ 3’
AUGGCAUGCGACGAAUUCGGACACAUA
Met
Ala
Cys Lys
Asp
Glu
Phe
Gly
His
Ile

5’ 3’
AUGGCAUGCGACGAAUUCGGACACAUA
Met
Ala
Cys
Asp Leu
Glu
Phe
Gly
His
Ile
Lys

5’ 3’
GCAUGCGACGAAUUCGGACACAUAAAA
Met
Ala
Cys
Asp Met
Glu
Phe
Gly
His
Ile
Lys Leu

5’ 3’
UGCGACGAAUUCGGACACAUAAAAUUA
Met
Ala
Cys
Asp
Glu Asn
Phe
Gly
His
Ile
Lys
Leu Met

5’ 3’
GACGAAUUCGGACACAUAAAAUUAAUG
Met Ala
Cys
Asp
Glu
Phe Pro
Gly
His
Ile
Lys
Leu
Met Asn

5’ 3’
GAAUUCGGACACAUAAAAUUAAUGAAC
Met Ala Cys
Asp
Glu
Phe
Gly Gln
His
Ile
Lys
Leu
Met
Asn Pro

5’ 3’
UUCGGACACAUAAAAUUAAUGAACCCA
Met Ala Cys Asp
Glu
Phe
Gly
His
Ile
Lys
Leu
Met
Asn
Pro Gln

5’ 3’
GGACACAUAAAAUUAAUGAACCCACAA
Met Ala Cys Asp Glu
Phe
Gly
His
Ile
Lys
Leu
Met
Asn
Pro
Gln

5’ STOP 3’

CACAUAAAAUUAAUGAACCCACAAUAA
Ala Cys Asp Glu Phe
Met Gly
His
Ile
Lys
Leu
Met
Asn
Pro
Gln

5’ STOP 3’
AUAAAAUUAAUGAACCCACAAUAAAAA
Ala Cys Asp Glu Phe
Met Gly
His
Ile
Lys
Leu
Met
Asn
Pro
Gln

5’ STOP 3’
AUAAAAUUAAUGAACCCACAAUAATAC
Ala Cys Asp Glu Phe
Met Gly
His
Ile
Gln Lys
Pro Leu
Asn Met

5’ 3’
AUAAAAUUAAUGAACCCACAAUAATAC
VARIAÇÃO GENÉTICA
Ala Cys Asp Glu Phe
=POLIMORFISMO Met
Gly
His
Ile
Gln Lys
Pro Leu
Asn Met

5’ 3’
AUAAAAUUAAUGAACCCACAAUAATAC

Ala Cys Asp Glu Phe


Met
Gly
His
Ile Muda a
Gln Lys forma e
Pro Leu função
Asn CYS

5’ 3’
A U A A A A U U A A U G A A C AA A C A A U A A T A C
REPRESENTAÇÃO LINEAR A MOLÉCULA DO DNA

5’ATTCGGCGCTATGCATGCTATGCG3’

aa1 aa2 aa3 aa4 aa5 aa6 aa7 aa8

PROTEÍNA - Queratina- cabelo


- Albumina- sangue
- Hemoglobina-sangue
- Estrutura do cabelo
- Proteína da cor do cabelo
(Melanina)
VARIAÇÕES GENÉTICAS Acontecem no nosso DNA

Células germinativas Células somáticas

Passa para os filhos Não passa para


os filhos

Ex. cor dos olhos Ex. câncer


Lembrar...RNApolimerase
• É essencial na transcrição... (1ª etapa da
expressão gênica)
• Sem a RNA polimerase não há vida!!!
• Sem RNA polimerase não há enzimas!!!!
• A inibição da RNA polimerase leva à morte do
organismo...
Correlação Clínica
• Antibióticos e Toxinas que têm como alvo a
RNA Polimerase:
– Toxina do cogumelo Amanita phalloides ou
“chapéu da morte”, altamente tóxico.
– A toxina mais letal, - amanitina, inibe a
subunidade maior da RNA polimerase II, inibindo
assim a síntese de mRNA.
• Gastrointerites, insuficiência hepática (RNA essenciais
são degradados e não são substituídos).
– Ação do antibiótico Rifampicina, para TB