Molecular Biology & Genetics: Biochemistry JSS Medical College

Molecular Biology
&
Genetics
Dr.Prashant Vishwanath
Biochemistry
JSS Medical College
Learning Objectives
 Central dogma of molecular biology
 Structure of DNA
 Explain prokaryotic DNA Replication
 Differences between prokaryotic and
eukaryotic DNA replication
Biochemistry
JSS Medical College
The Central Dogma
 This order of events is called the central
dogma of molecular biology:
DNA RNA P R T E N
O I
Replication Transcription Translation
Biochemistry
JSS Medical College
Structure of DNA
 DNA is a polydeoxyribonucleotide
 3’ – 5’ Phosphodiester Linkages
 Double stranded molecule
 Two strands wind around each other to
form a double helix
 In eukaryotes it is found associated with
nucleoproteins
Biochemistry
JSS Medical College
Biochemistry
JSS Medical College
DNA Replication
 Semi Conservative
 Slightly different in
eukaryotes and
prokaryotes
 Initiation of Replication
commits the cell to
continue the process till
the entire genome has
been replicated
Biochemistry
JSS Medical College
Steps of DNA Replication
 Initiation
 Synthesis of RNA Primer
 Elongation of DNA strand
 Proof reading of synthesized strands
 Removal of RNA primers
Biochemistry
JSS Medical College
Separation of the two complementary DNA strands
 DNA replication begins at a single unique
nucleotide sequence – origin of replication
 In eukaryotes, replication begins at
multiple sites along the DNA helix
 These sites usually have a short sequence
composed exclusively of AT base pairs :
“Consensus Sequence”
Biochemistry
JSS Medical College
Formation of the Replication Fork
 Two strands unwind

and form a “V”
 Replication Fork
moves along the
DNA molecule as
synthesis occurs
 Replication is
bidirectional
Biochemistry
JSS Medical College
Biochemistry
JSS Medical College
Proteins Required for DNA Strand Separation
 DnaA Protein – 20 to 50 monomers of

dnaA protein bind to specific nucleotide
sequences at the origin of replication,
which is particularly rich in AT base
pairs
 Single stranded DNA binding (SSB)
proteins – These bind only to single
stranded DNA. They bind cooperatively
Biochemistry
JSS Medical College
 DNA Helicases – these enzymes bind
to single stranded DNA near replication
fork
 Unzip the double stranded DNA
 Requires energy provided by ATP
Biochemistry
JSS Medical College
 DNA helicase separates the two DNA strands by
breaking the hydrogen bonds between them
 This generates positive supercoiling ahead of
each replication fork
– DNA topoisomerases travels ahead of the helicase and
alleviates these supercoils
 There are two types of DNA topoisomerases
 Type I & II
Biochemistry
JSS Medical College
Solving the problem of Supercoils
Biochemistry
JSS Medical College
Type I DNA topoisomerase
 Reversibly cut one
strand of the double
helix
 Have nuclease and
ligase activities
 Do not require ATP
 Relax negative
supercoil in E coli, and
both positive and
negative supercoils in
eukaryotic cells
Biochemistry
JSS Medical College
Type II DNA topoisomerase
 Binds to DNA double helix
and make transient breaks
in both strands
 ATP requiring process
 Both positive and negative
supercoil can be relieved
 Anticancer agents,
etoposide, target human
topoisomerase II
 Ciprofloxacin targets
bacterial DNA gyrase
Biochemistry
JSS Medical College
Direction of DNA Replication
 DNA polymerases are able to read only
3’ – 5’ direction and synthesize new
strands in 5’ – 3’ direction
 Therefore the synthesis of chains must
occur in opposite directions.
 It is different in both the strands
 Leading Strand & Lagging Strand
Biochemistry
JSS Medical College
Figure 11.13 “Three Dimensional” view of Replication Fork
Direction of synthesis
of leading strand
Direction of synthesis
Of lagging strand
Biochemistry
Direction of fork movement
JSS Medical College
Lagging Strand
 The strand that is being copied away
from the replication fork is synthesized
discontinuously with small fragments of
DNA being copied
 These short stretches are called as
Okazaki fragments and are eventually
joined to become single continuous
strand
Biochemistry
JSS Medical College
RNA Primers
 Short double stranded
region consisting of RNA
base paired to DNA
template with free hydroxyl
group on the 3’ end of RNA
strand
 This hydroxyl group serves
as acceptor for the 1st
nucleotide by action of DNA
polymerase
Biochemistry
JSS Medical College
Primase
 A specific RNA polymerase that synthesizes the short
streches of RNA that are complementary and
antiparallel to the DNA template
 These short RNA sequences are constantly being

synthesized at the replication fork on the lagging
strand, but only one RNA sequence at the origin of
replication is required on the leading strand
Biochemistry
JSS Medical College
Biochemistry
JSS Medical College
Chain Elongation
 Prokaryotic and eukaryotic DNA
polymerases elongate a new DNA by
adding deoxyribonuleotides, one at a
time.
 The sequence of addition is dictated by
the base sequence of template strand
Biochemistry
JSS Medical College
DNA Polymerase III
 DNA Chain elongation is catalyzed by
DNA Polymerase III.
 All four deoxyribonucleotides must be
present for DNA elongation
 Pyrophosphate is released when each
nucleotide is added to growing chain
Biochemistry
JSS Medical College
Proofreading of Newly Synthesized DNA
 DNA Polymerase III has in addition a
proofreading activity
 3’ – 5’ exonuclease activity removes the
misplaced nucleotide
 5’ – 3’ polymerase then replaces it with
the correct nucleotide
Biochemistry
JSS Medical College
Biochemistry
JSS Medical College
Excision of RNA primer and their replacement by
DNA
 DNA polymerase III continues to synthesize
DNA on the lagging strand untill it is blocked
by proximity to an RNA primer
 The RNA is excised and the gap filled by
DNA polymerase I
 It has 5’-3’ exonuclease activity
Biochemistry
JSS Medical College
DNA Ligase
 The final phosphodiester linkage between the
5’ phosphate group on the DNA chain

synthesized by DNA polymerase III and the 3’
hydroxyl group on the chain made by DNA
polymerase I is catalysed by DNA ligase
 This required energy which is provided by the

cleavage of ATP to AMP + PPi
Biochemistry
JSS Medical College
Biochemistry
JSS Medical College
Protein Synthesis
 Protein synthesis is the process in which a cell

makes protein based on the message contained
within its DNA.
 However:
– DNA is only found in the nucleus
– Proteins are only made outside the nucleus – in
the cytoplasm.
Biochemistry
JSS Medical College
Protein Synthesis
 How do the many different messages within the

DNA molecule get to the many ribosomes outside
the nucleus?
 A molecular cousin of DNA – RNA – is used to
carry these messages.
Biochemistry
JSS Medical College
Ribonucleic Acids (RNA)
 The job of RNA (ribonucleic acid) is to carry
messages from the DNA (in the nucleus) to the
ribosomes (in the cytoplasm).
 There are three types of RNA:
1. mRNA – carries a message from the DNA to
the cytoplasm
2. tRNA – transports amino acids to the
mRNA to make a protein
3. rRNA – make up ribosomes, which make
protein.
Biochemistry
JSS Medical College
 RNA is almost exactly like DNA, except:
– Contains a ribose sugar, instead of a

deoxyribose sugar (hence the name…)
– Contains uracil instead of thymine.
– RNA is single-stranded, not double-stranded
Biochemistry
JSS Medical College
Biochemistry
JSS Medical College
Protein Synthesis
 Occurs in TWO steps:

1. Transcription – the genetic information from a
strand of DNA is copied into a strand of
mRNA
2. Translation – the mRNA, with the help of the
ribosome, forms a chain of amino acids
(eventually forming a protein) based on the
information contained on the mRNA.
Biochemistry
JSS Medical College
Step 1: Transcription
 Transcription involves three different stages
– Initiation
– Elongation
– Termination
Biochemistry
JSS Medical College
Initiation
 The binding of the enzyme RNA polymerase to

DNA is the prerequisite for the transcription to
start
 The specific region on the DNA where the enzyme
binds is known as promoter region
 The enzymes split apart base pairs and Unzips the
DNA
Biochemistry
JSS Medical College
Elongation
 RNA is synthesized from 5’ end to 3’ end
antiparallel to the DNA template
 RNA polymerase utilizes ribonucleotide
triphosphates (ATP, GTP, CTP and UTP) for the
formation of RNA.
 The sequence of nucleotide bases in the mRNA is
complementary to the template DNA strand
Biochemistry
JSS Medical College
Termination
 The process of transcription stops by termination

signals
 Two types of termination are identified
– Rho (ρ) dependent termination
– Rho (ρ) independent termination
Biochemistry
JSS Medical College
Step One: Transcription
 Try it! What RNA strand will be made

from the following DNA sequence?
TACGCATGACTAGCAAGTCTAACT
Biochemistry
JSS Medical College
Step One: Transcription
 Try it! What RNA strand will be made

from the following DNA sequence?
TACGCATGACTAGCAAGTCTAACT
AUGCGUACUGAUCGUUCAGAUUGA
Biochemistry
JSS Medical College
RNA Editing
 An mRNA molecule has to be “edited” in order to be
useful. There’s a lot of unnecessary information that
needs to be removed.
 An mRNA sequence that does NOT code for protein is
called an interon. A sequence that is useful in making
a protein is called an exon.
Biochemistry
JSS Medical College
RNA Editing
DNA
transcription
pre-RNA (in nucleus)
exon 1 interon exon 2 interon exon 3
RNA editing
interon
interon
RNA (in cytoplasm)

exon 1 exon 2 exon 3
Biochemistry
JSS Medical College
Step Two: Translation
 Now that our mRNA molecule has been made,

it’s time for its message to be made into a
protein sequence.
 How does the mRNA sequence translate into an

amino acid sequence?
Biochemistry
JSS Medical College
Step Two: Translation
 Problem:
– There are 20 different amino acids.
– There are 4 RNA bases.
A T C G
phe ile val pro ala his asn asp cys arg
leu met ser thr tyr gln lys glu trp gly
Biochemistry
JSS Medical College
Genetic code
 The three nucleotide base sequences in mRNA that act as
code words for amino acids in protein constitute the
genetic code
 The codons are composed of the four nucleotide bases
 These four bases produce 64 different combination
 Sixty one codons code for the 20 amino acids found in
protein
 The three codons UAA, UAG and UGA do not code for
amino acids
 They act as stop signals in protein synthesis
Biochemistry
JSS Medical College
The Genetic Code
Biochemistry
JSS Medical College
Protein synthesis
 The protein synthesis may be divided into the

following stages
– Requirement of the components
– Activation of amino acids
– Protein synthesis proper

– Post translational modifications
Biochemistry
JSS Medical College
Requirement of the components
 The protein synthesis may be considered as a

biochemical factory operating on the ribosomes and
requires many components
– Amino acids
– Ribosomes
– mRNA
– tRNA
– Energy sources – Both GTP and ATP
– Protein factors
Biochemistry
JSS Medical College
Activation of amino acids
 Amino acids are activated and attached to tRNAs
 A group of enzymes – namely aminoacyl tRNA
synthetases – are required for this process
 These enzymes are highly specific for the amino
acid and the corresponding tRNA
Biochemistry
JSS Medical College
Protein synthesis proper
 Protein synthesis occurs on the ribosomes
 The mRNA is read in 5’-3’ direction and the
polypeptide synthesis proceeds from N-terminal
end to C-terminal end
 Translation proper is divided into 3 stages
– Initiation
– Elongation
– Termination
Biochemistry
JSS Medical College
Initiation
 The initiation factors – IF1 and IF3 – first bind with
the free 30S subunit
 This is followed by the attachment of mRNA with
30S subunit
 Next, IF2 and methionine tRNA, in the presence of
GTP, bind with 30S ribosome
 The 50S ribosome associates with 30S to form 70S
initiation complex and the initiation factors are
released
Biochemistry
JSS Medical College
Initiation codon
 The codon AUG is responsible for the initiation of

protein synthesis
 It is found at the 5’ end close to Shine-Dalgarno
sequence
 The initiator tRNA with anticodon UAC
recognizes the initiation codon AUG and starts
protein synthesis
Biochemistry
JSS Medical College
Biochemistry
JSS Medical College
Elongation
 Ribosomes elongate the polypeptide chain by a
sequential addition of amino acids to the growing
carboxyl end
 During elongation, the ribosome moves from 5’ end to
3’ end of the mRNA
 Elongation factors – EF-Tu and EF-Ts – in association
with GTP, facilitate elongation
 At the beginning, the initiation tRNA occupies the ‘P’
site of the ribosomes
Biochemistry
JSS Medical College
Elongation
 The incoming next amino acid corresponding to codon on
mRNA is deposited at ‘A’ site of the ribosome
 The enzyme peptidyltransferase catalyses the formation
of peptide bond
 As the peptide bond formation occurs, the ribosome
moves to the next codon in the mRNA
 This process, called translocation, basically involves the
movement of growing peptide chain from A site to P site
of the ribisome
Biochemistry
JSS Medical College
Biochemistry
JSS Medical College
Elongation
 The translocation requires EF-G and GTP
 The elongation process is repeated again and

again, with addition of one amino acid each time,
till the signal of termination is reached
Biochemistry
JSS Medical College
Biochemistry
JSS Medical College
Termination
 One of the three codons UAA, UAG and UGA act as
stop signals and terminate the growing polypeptide
 These signal codons do not have specific tRNAs to
bind with them
 As the termination codon occupies the ribosomal A
site, the release factors – RF-1, RF-2 and RF-3 – bind
with the codon
 These factors cause the hydrolytic breakdown of the
peptidyl-tRNA and release the newly synthesized
protein
Biochemistry
JSS Medical College
Biochemistry
JSS Medical College
Biochemistry
JSS Medical College
Post-translational modifications
 The proteins synthesized in translation are, as such, not
functional
 Many changes take place in the polypeptides after the
protein synthesis is completed
 These modifications include trimming by proteolytic
degradation and covalent changes which are
collectively known as post-translational modifications
Biochemistry
JSS Medical College
Inhibitors of protein synthesis
 Translation is a complex process and is inhibited by
antibiotics
 Antibiotics are the substances produced by bacteria or
fungi which inhibit the growth of other organisms
 They interfere with the bacterial protein synthesis and are
harmless to higher organisms
 This is due to the fact that the process of translation
sufficiently differs between prokaryotes and eukaryotes
Biochemistry
JSS Medical College
Examples
 Chloramphenicol inhibits the peptidyl transferase

activity of bacterial ribosomes
 Tetracycline inhibits the binding of aminoacyl
tRNA to the ribosomal complex
 Erythromycin inhibits translocation by binding
with 50S subunit of bacterial ribosome
Biochemistry
JSS Medical College
 Streptomycin and aminoglycoside are bactericidal.
Bind to 30S subunit of bacterial ribosomes. Cause
misreading of mRNA and at high concentration
completely inhibit the initiation complex
formation
Biochemistry
JSS Medical College
Inhibitors of DNA Replication
Drug Action (Inhibition of)
Antibacterial agents
Ciprofloxacin Bacterial DNA gyrase
Nalidixic Acid Bacterial DNA gyrase
Novobiocin Bacterial DNA gyrase
Anticancer Drugs
Etoposide Human topoisomerase
Adriamycin Human topoisomerase
Doxorubicin Human topoisomerase
6-mercaptopurine Human DNA polymerase
5-fluro uracil Thymidylate synthase
THANK YOU
Biochemistry
JSS Medical College

Molecular Biology & Genetics: Biochemistry JSS Medical College

Enviado por

Dados do documento

Título original

Direitos autorais

Formatos disponíveis

Compartilhar este documento

Compartilhar ou incorporar documento

Opções de compartilhamento

Você considera este documento útil?

Este conteúdo é inapropriado?

Direitos autorais:

Formatos disponíveis

Molecular Biology & Genetics: Biochemistry JSS Medical College

Enviado por

Direitos autorais:

Formatos disponíveis

Molecular Biology

Replication Transcription Translation

 Two strands unwind

 DnaA Protein – 20 to 50 monomers of

 These short RNA sequences are constantly being

 The RNA is excised and the gap filled by

 It has 5’-3’ exonuclease activity

5’ phosphate group on the DNA chain

 This required energy which is provided by the

 Protein synthesis is the process in which a cell

 How do the many different messages within the

 RNA is almost exactly like DNA, except:

– Contains a ribose sugar, instead of a

– Contains uracil instead of thymine.

– RNA is single-stranded, not double-stranded

 Occurs in TWO steps:

 Transcription involves three different stages

 The binding of the enzyme RNA polymerase to

 The process of transcription stops by termination

– Rho (ρ) dependent termination

– Rho (ρ) independent termination

 Try it! What RNA strand will be made

 Try it! What RNA strand will be made

RNA (in cytoplasm)

 Now that our mRNA molecule has been made,

 How does the mRNA sequence translate into an

 The protein synthesis may be divided into the

– Activation of amino acids

– Protein synthesis proper

 The protein synthesis may be considered as a

 A group of enzymes – namely aminoacyl tRNA

synthetases – are required for this process

 These enzymes are highly specific for the amino

acid and the corresponding tRNA

 The codon AUG is responsible for the initiation of

 The translocation requires EF-G and GTP

 The elongation process is repeated again and

 Chloramphenicol inhibits the peptidyl transferase

Você também pode gostar