Você está na página 1de 46

O amadurecimento da Biologia

Molecular como disciplina


científica
Prof. Dr. Alexandro Cagliari

FATOS E ESPECULAÇÕES INICIAIS SOBRE OS MOLDES DE RNA


DO LIVRO : A PASSION FOR DNA; GENES, GENOMES AND SOCIETY
O papel do DNA
• Salvador Luria (1912-91)
• Vírus podem ter DNA
ou RNA
• Avery, MacLeod, McCarty
– 1944: DNA como princípio
transformante
– Crítica: DNA poderia estar contaminado com proteínas
• Hershey e Chase
– Prova final e conclusiva para aceitar o DNA como a molécula da
hereditariedade
– Watson leu o artigo em 1951 para uma platéia indiferente na
sociedade de microbiologia...
Hershey and Chase
Jean Brachet (1909 – 1998)
• Cientista belga trabalhando
em Bruxelas
• 1933
– DNA está no núcleo, RNA no citoplasma
• 1951
– Enfatiza a correlação entre o conteúdo de
RNA de uma célula e a síntese de proteínas
• ~1952
– Corta a alga em duas metades e percebe que a
metade sem núcleo continua produzindo
proteínas
• DNA não tem participação na síntese de proteínas
O nascimento da dupla hélice
• Haviam fortes evidências de que o DNA carregava o material
genético
• 1952: primeiro encontro de Watson e Crick
– “Desde o dia de nosso primeiro encontro,
Crick e eu pensamos que seria altamente
provável que a informação genética do DNA
fosse codificada pela seqüência de quatro
bases”
– DNA tinha estrutura helicoidal
– A dupla hélice explicava tudo!

– O que eles viram com clareza?


• A possibilidade de um código digital para
a herança

– Resolução do problema por


construção de modelos teóricos!
Levene X Watson-Crick
1953

A dupla hélice
• Alto poder explicativo e preditivo:
– Como seria codificado um gene
– Como ocorreria a duplicação do DNA
– Estrutura química precisa
da molécula
– Proporções de bases
• Novas perguntas...
– Pra quê servia o RNA?
– Como acontecia a síntese
de proteínas
A estrutura do RNA
Como a estrutura do DNA 1953: Watson muda-se para
clarificou tantas coisas, talvez Pasadena
seja hora de estudarmos a Trabalha com Alex Rich na
estrutura do RNA... estrutura do RNA
Mas...

• Só às vezes parecia ter


estrutura helicoidal...
• Sem equivalência
– [A] != [U]
[G] != [C]
• Motivo: fita simples
Finalmente, Gamow
• Físico russo (1904 –1968)
• Distâncias observadas
– Entre aminoácidos: 3,6 Å
– Entre bases: 3,4 Å
• Logo, as proteínas devem ir
se encaixando no DNA como
um tipo de lego para se formarem
(modelo mecanicista) D
C
T
V
M
Gamow brinca de lego
O código de Gamow
• 20 aminoácidos
– 2 bases, 42 = 16 combinações
– Logo, pelo menos 3 bases
– 43 = 64; logo o código é redundante (degenerado)

• Watson
– Sabia que o DNA não era o molde para a síntese
de proteínas
– Mas... Pensava que o RNA poderia ser dupla-
fita...
• Sanger (1949, 1952)
– Produz a primeira estrutura primária
de uma proteína
– Sequência de aminoácidos incompatível
com o código de Gamow
O RNA Tie Club
• Com 20 membros, um para
cada aminoácido, jamais teve
uma única reunião formal
• Esforço conjunto para desvendar
o código genético (como o DNA codificava
proteínas)
• Várias das cartas para o clube foram
enviadas pelos membros, cartas estas que
viravam publicações
• Dentre elas, a mais importante foi...
Crick e a hipótese do
Adaptador
• Depois de passar meses discutindo com
Brenner e Gamow sobre os códigos, Crick
começou a questionar sua premissa básica
– Seria difícil acomodar quimicamente todas as
cadeias laterais dos aminoácidos no código do
DNA
– Ainda mais se considerássemos que o código
era degenerado (mesma cadeias laterais para
diferentes códons)

• Deve haver um adaptador,


polinucleotídeos que pareiem
com RNAs moldes
Os intermediários acilados
• Mahlon Hoagland e Paul Zamecnik
– RNAs solúveis de alta-energia ligavam aos
aminoácidos acilados
• 1957
• Watson sabia que
tais moléculas
poderiam ser os
adaptadores de Crick
Estrutura e função dos
ácidos nucléicos
(DNA e RNA)
Ácidos nucléicos – DNA e RNA:

Estrutura Química
Estrutura química simples e não varia nos diversos organismos.
Consistem de seqüências de nucleotídeos (polímeros).

DNA RNA
Ácido desoxirribonucléico Ácido ribonucléico

ribose

O
Adenina Adenina
Guanina
purinas Guanina
Citosina Citosina
Timina
pirimidinas Uracila
adenina timina/uracil
guanina citosina

Os nucleotídeos são denominados de acordo com a


base que possuem!!!
Os nucleotídeos estão ligados
entre si da seguinte forma:

 O carbono 3 da pentose se liga


ao carbono 5 da pentose
adjacente, entremeadas pelo
fosfato, formando cadeia de
nucleotídeos;

 Os nucleotídeos terminais da
cadeia tem grupos livres na
posição 5’ e 3’;

 Por convenção se faz a “leitur


a” da cadeia de DNA na direção
5’ → 3’.
Pontes
fosfodiéster
Como ocorrem as ligações químicas na
estruturação do DNA?

 Nucleotídeos ligados entre si (numa mesma fita) por


pontes fosfodiéster!!!

 Uma fita de DNA fica aderida à outra através do


pareamento das bases através das pontes de hidrogênio!!!
Pareamento de bases na molécula do DNA e RNA

no RNA
Pareamento de bases na cadeia de DNA
Ácidos nucléicos:

estrutura molecular
A estrutura molecular do DNA - 1953

Francis Crick James Watson Maurice Wilkins Rosalind Franklin


1916 - 2004 1928 - 1916 - 2004 1920 - 1958

"for their discoveries concerning the molecular structure


of nucleic acids and its significance for information
transfer in living material“

Nobel Prize in Physiology or Medicine - 1962


A descoberta da estrutura do
DNA, em 1953, é um dos grandes
eventos da história da
humanidade!
Modelo Watson e Crick (1953) - estrutura do DNA:

 Modelo “escada de cordas”: DNA é uma dupla hélice em que as duas fitas se
enrolam em torno do eixo da hélice, ficando as moléculas de fosfato e açúcar
para fora (corrimão) e as bases para dentro (degraus), pareadas e mantendo a
estrutura da molécula. Uma fita tem direção 5’ → 3’ e a outra 3’ → 5’.
 Duas cadeias polinucleotídicas antiparalelas (correm em direção
opostas considerando a localização dos carbonos 5’ e 3’ no açúcar).

5’

3’

Estabilização da dupla hélice:


interação entre bases
pontes de hidrogênio
DNA RNA

Desoxirribos Ribose
e Uracil
Timina

dupla hélice uma cadeia de nucleotídeos

Contém informação Utiliza a informação


que codifica uma codificada pelo DNA
proteína
Vantagens de estrutura molecular do DNA:

 Armazenamento e codificação de imensa quantidade de

informação;

 Mecanismo para sua replicação: cada cadeia serve como molde para
síntese de nova cadeia complementar;

 Mecanismo de defesa contra perda de informação genética


causada por dano no DNA utilizando fita complementar.
CICLO CELULAR
A duplicação do DNA é semiconservativa!

Cada molécula recém formada


tem uma cadeia da molécula
original e outra recém
sintetizada.
Com objetivo de aumentar nosso compreensão da replicação semiconservativa, vamos
considerar alguns aspectos relevantes...

Onde de inicia a replicação de DNA ao longo do cromossomo?

Há somente uma origem de replicação, ou a síntese de DNA inicia em mais


de um ponto?

O ponto de origem ocorre em local aleatório, ou em uma região específica no


cromossomo?

Uma vez iniciada, a replicação prossegue em uma só direção, ou em ambas as


direções a partir da origem?
Conceito de gene

 Beaddle e Tatum (1941) – um gene = uma proteína

Realidade é muito mais complexa...

Um fator genético (região do DNA)


que ajuda a determinar uma
característica!
Estrutura do gene
GCCGCGGCATCCGCACCATCTTCCTCGAGG
T
GGAAGAGAACAATCAGCCGGCGCGACGGCT
C
Estrutura do gene
TATGAAAGGGCCGGATTCGGCGTGATCGGC
C
GCCGCGAACGCTACTACAAGCAGCCCGGCG
G
GGAACATTTGAACGCGCTTCTGATGCGGCG
C
GACTTGTTATAACATCGGCGCGATGGCAGA
A
CAGCGCCCTGCTCTGCCATCCAAGGCCCAA
G
GATTGGCCAAGGACCTGCCAAGGACCCATG
A
CGACGGTGAAAATCACGCCTGCGCAGAAGA
A
TACCGGCATCGAGGCGCGCTGCGCTGCGAC
C
GGCATGCGCATGACCGAACAGCGTCGTGTG
A
TCGCACGCGTGCTGGCGGAGGCCATGGATC
A
CCCCGACGTCGAGGAGCTCTACCGCCGCTG
C
GTGGCGGTCGACGACAAGATCTCGATCTCG
A
CCGTCTATCGCACCGTCAAGCTGTTCGAGG
Procariotos
Eucariotos
Os genes estão organizados em cromossomos. O material
genético de cada cromossomo consiste de um filamento
muito longo de DNA, contendo muitos genes em ordem
linear, embora nem sempre contínua.
DNA: Livro da vida, escrito com 4 letras: ATCG

Você também pode gostar