Você está na página 1de 97

Biologia Molecular

Processos biolgicos difcil de definir o comeo funcionam de forma muito integrada. CLULAS: Unidade fundamental da vida Menor parte de um ser vivo capaz de desenvolver, de forma autnoma, as funes bsicas que caracterizam a vida: Reproduo e Crescimento. Organismos vivos unicelulares e pluricelulares clulas assumem diferentes formas e se especializam em vrias funes diferenciao celular

CLULAS local de muitas reaes qumicas e suas funes dependem das substncias qumicas que produzem. CLULAS ENTRE AS ESPCIES com muitas diferenas, mas tambm com muitas similaridades TODOS OS ORGANISMOS DESCENDEM DE UM ANCESTRAL COMUM! PROCARIONTES EUCARIONTES

CONSTITUIO QUMICA DAS CLULAS:

inorgnicos

orgnicos Carboidratos, lipdios protenas e c. Nuclicos

gua, sais min.

PROTENAS E C. NUCLICOS IMPORTANTES PARA A BIOL. MOLECULAR CIDOS NUCLICOS DNA E RNA controlam de forma integrada a sntese de protenas O cdigo do DNA molculas de DNA e protenas so lineares linear segundo a seqncia de nucleotdeos cada 3 letras = 1 aminocido SNTESE DE PROTENAS DNA RNAm Protena Quando ocorre um erro - MUTAO

1. HISTRICO O advento da Biologia Molecular 1940 - Bases da Biologia Molecular: estudo da estrutura e funo das molculas biolgicas. 1944 Avery, MacLeod e McCarty cido desoxirribonuclico (DNA) continha a informao gentica.

1952 Hershey e Chase - DNA tem a capacidade de controlar as clulas : experincia com bacterifagos. 1950 Chargaff distribuio dos nucleotdeos (identificados pelas bases nitrogenadas) possuia um padro: quantidade de timina era igual a de adenina e guanina igual a de citosina. 1953 utilizando os dados sobre a molcula de DNA obtidos atravs de cristalografia de raios X por Rosalind Franklin, James Watson e Francis Crick propuseram o modelo dupla hlice do DNA: duas cadeias de nucleotdeos enroladas em espiral e ligadas entre s pelas bases - como o material gentico se duplica e produo do RNA , sntese protica e controle da atividade celular).

1956 processos de autoduplicao do DNA 1960 decifrao do cdigo gentico dos aminocidos 1961 processo de transcrio do RNA. 1962 processo de traduo do RNA para sintetizar protenas.

Estrutura do DNA

Estrutura de Dupla Hlice (Watson e Crick 1953)

Capacidade de Replicao

A Molcula de DNA

Tipos de DNA

H pelo menos trs modelos de DNA :


Modelos A, B e Z O DNA B de longe o mais frequente, mas o DNA Z tamm encontrado na clula. Admite-se que o DNA Z "silencioso", isto , no pode ser transcrito. A transio B-Z seria, assim, um recurso para silenciar grandes blocos de genes. A forma Z

DNA: A, B e Z. Nesta figura est bem visvel a fenda maior entre a volta verde de cima e a vermelha de baixo e a menor, entre a vermelha de baixo e a verde da base, no modelo B. Tambm fica claro que os dois modelos A e B so hlices destrgiras, enquanto o Z levgiro. DNA Z no tem duas

CLASSES DE DNA O DNA das clulas eucariontes apresenta trs fraes caracterizadas pelo grau de repetio: DNA Singular ou de Cpia nica Constitui a maior parte do DNA no genoma. As sequncias que codificam protenas (isto , a poro codificadora dos genes) compreendem apenas uma pequena proporo do DNA de cpia nica. A maior parte do DNA de cpia nica encontra-se em extenses curtas, entremeadas

DNA Repetitivo Disperso


Consiste em sequncias relacionadas que se espalham por todo o genoma, em vez de ficarem localizadas. Os elementos repetidos dispersos mais exatamente estudados pertencem famlia Alu e famlia L1.

DNA Satlite
Envolve sequncias repetidas (em tandem) agrupadas em um ou em alguns locais, intercaladas com sequncias de cpia nica ao longo do cromossomo. As famlias de DNA satlite variam quanto localizao no genoma, comprimento total da srie em tandem, comprimento das unidades repetidas que constituem a

TRANSPOSONS Transposons - molculas que copiam e colam Transposons so pedaos de DNA que podem copiar e inserirem-se em regies no-homlogas de outros DNAs na mesma clula. Transposons = Transposio

DNA: Processos de replicao, Transcrio e Traduo

Controle da expresso gnica

Jacob e Monod criaram um modelo no qual o stio promotor, associado a um outro stio chamado operador, controlava a expresso de todos os genes imediatamente abaixo, isto , 3, do promotor. A este conjunto chamaram operon. Como os genes que estudavam eram os responsveis pela sntese das protenas que degradavam lactose, chamaram a este arranjo de genes operon lac.

Distribuio dos genes e mdulos de controle do operon lac. O gene i, para o repressor lac, expresso constitutivamente, est situado prximo ao conjunto dos genes induzveis lacZ, lacY e lacA, responsveis pela sntese das protenas b-galactosidase, permease e transacetilase. O promotor plac controlado pelo operador olac, onde se ligam duas

Que importncia tem o operon lac na gentica molecular? Muitos dos vetores de expresso, sejam eles fagos ou plasmdeos, empregados em engenharia gentica, tm o gene clonado sob o controle de um promotor/operador lac. Este sistema propicia o controle da expresso do gene clonado atravs da adio de um anlogo da lactose, o IPTG (isopropiltiogalactosdeo). Este produto muitas vezes mais efetivo

TECNOLOGIA DO DNA RECOMBINANTE partir do conhecimento da molcula de DNA, os cientistas agora querem administrar essa fbrica de protenas!! DNA molcula relativamente simples e muito regular; varia s nas 4 bases (com caract. qumicas muito semelhantes) e so macromolculas com as mesmas propriedades qumicas. pelo comportamento qumico impossvel separar uma molcula de DNA TECNOLOGIA DO DNA RECOMBINANTE O DNA extrado da clula com o gene de interesse cortado em fragmentos menores de modo controlado - cada fragmento ligado em uma outra molcula de DNA clula hospedeira clula com a molcula hbrida, passa a copi-la, duplicando-a em cada diviso celular com grande quantidade da molcula possvel localizar o gene. Isolar o gene multiplic-lo e obter grande quantidade da protena ENZIMAS DE RESTRIO (endonucleases)

2. Introduo Engenharia Gentica Utilizando as enzimas de restrio bacterianas, tornou-se possvel cortar dois DNAs diferentes e, pela ao de enzimas ligases, unir os segmentos resultantes e formar um DNA recombinante - Tecnologia do DNA Recombinante incio da Engenharia Gentica. Assim, os cientistas tm desenvolvido tcnicas que possibilitam transferir os genes de um tipo celular para outro (por exemplo, de plantas e animais para as bactrias).

Aplicaes comerciais: o futuro da engenharia gentica considerado muito amplo, sendo que j resolveu alguns dos maiores problemas de pesquisa. Por exemplo, genes que codificam a produo de compostos importantes, com produo reduzida em seu tecido normal, podem ser retirados de clulas animais ou vegetais e inseridos na clula bacteriana- esta sintetiza em quantidades ilimitadas os produtos codificados pelos genes. Muitos exemplos de sua aplicao so observados na medicina. Outra aplicao importante a transformao de plantas, animais e microrganismos para a obteno de Transgnicos (OGM).

3. Importncia dos Microrganismos e das Enzimas na Engenharia Gentica As clulas animais e vegetais usualmente no podem ser cultivadas para produo de compostos especficos estas perdem a habilidade de sntese quando so isoladas e cultivadas em laboratrio. Tambm , o cultivo de clulas de tecido em laboratrio dispendioso e requer meios complexos altamente enriquecidos. Uso de microrganismos medicina: altamente empregado, pois evita muitos dos problemas associados com a obteno de compostos importantes (insulina, interferom, hormnios, etc.). As bactrias que carregam os genes para os mais diversos compostos, podem ser cultivadas indefinidamente.

Por meio da introduo de genes estranhos em microrganismos, possvel desenvolver cepas que oferecem novas solues para problemas diversos, como poluio, escassez de alimento e energia , controle de doenas e at mesmo terapia gnica. ENZIMAS: fundamental para a tecnologia do DNA recombinante. Endonucleases de restrio: apresentam papel fundamental, clivando o DNA em seqncias especficas, gerando um conjunto de fragmentos menores. DNA ligase: os fragmentos separados para serem clonados podem ser unidos a um vetor de clonagem apropriado usando a DNA ligase. Assim, o vetor recombinante introduzido numa clula hospedeira que o clona, a medida que a clula realiza muitas geraes de divises celulares.

Vetores de Clonagem Plasmdios bacterifagos cosmdios - E. coli. Plasmdios : molculas de DNA circulares que se replicam separadamente do cromossomo hospedeiro. -Plasmdios bacterianos naturais 5.000 a 400.000 pares de bases. -Plasmdios introduzidos nas clulas por tcnicas de transformao

Utilizados para clonar segmentos de DNA at 15.000 pares de bases.

Construo de uma Bactria pela Engenharia Gentica Obteno do gene do organismo doador ou, em alguns casos, pode ser sintetizados em laboratrio pr nucleotdeos artificiais. DNA plasmidial (ou outro vetor de clonagem) isolado para servir como carreador de determinado gene. O DNA doador e o plasmidial so tratados com a mesma enzima, uma endonuclease de restrio, que cliva o DNA, formando fitas simples com terminais complementares (terminais coesivos). Esses so capazes de ligar-se a outros fragmentos de DNA que apresentam o mesmo terminal complementar das fitas simples.

O terminal coesivo de um fragmento de DNA doador liga-se com o terminal coesivo do DNA plamidial atravs da DNA ligase plasmdio com o fragmento do DNA doador. O plasmdio adicionado a uma suspenso de bactrias receptoras transformao. As bactrias geneticamente construdas so propagadas em grande quantidade e o produto (protena) codificado pelo gene transferido extrado da cultura e purificado. Ou outro caminho colocar esta bactria transformada com outro tecido e fazer a transferncia do gene.

Isolamento e amplificao de plasmdios

Bacterifago : clonagem de segmentos de DNA maiores. Bacterifago 48.502 pares de bases. Clonagem do DNA no Bacterifago baseado em duas carcatersticas-chave do genoma do genoma do : a) um tero do genoma no essencial e pode ser substitudo pelo DNA estranho b) o DNA ser empacotado em partculas do fago infecciosas, apenas se possurem entre 40.000 e 50.000 pares de bases de comprimento.

Utilizados para clonar fragmentos de DNA at 23.000 pares de bases.

Cosmdios : plasmdios recombinantes com caractersticas teis tanto dos plasmdios quanto do bacterifago . Cosmdios so molculas de DNA circulares pequenas (5.000 a 7.000 pares de bases), que contm: a) uma origem plasmidial de replicao; b) um ou mais marcadores de seleo; c) um certo nmero de stios nicos de restrio onde o DNA estranho pode ser inserido e; d) um stio cos (seqncia de DNA do bacterifago ).

Utilizados para clonar fragmentos de DNA at 45.000 pares de bases.

Vetores de clonagem
PORQUE CONSTRUIR UMA MOLCULA DE DNA RECOMBINANTE? ESTUDO DA ESTRUTURA DOS GENES DIAGNSTICO CLNICO TERAPIA GNICA MELHORAMENTO ANIMAL E VEGETAL OBTENO DE GRANDES QUANTIDADES DE PROTENAS RARAS. CONSTRUO DE BIBLIOTECAS DE GENES

Isolamento de um gene especfico


Como exemplo gene humano

C-DNA um auxlio na identificao de genes

Quanto maior o nmero de fragmentos ou clones produzidos, mais difcil ser encontrar o clone com o gene de interesse.

BANCOS GENMICOS DE ORGANISMOS COMPLEXOS (P. EX. HOMEM), DEVEM SER CONSTRUDOS COM FRAGMENTOS DE DNA NO MUITO PEQUENOS. BANCO CROMOSSMICO - Banco genmico para cada cromossomo. CROMOSSOMOS - so isolados por fluorescncia.

Hibridizao e seqenciamento de genes

Seqenciamentode DNA: Identificao da


Seqncia de Nucleotdeos que compem a molcula de DNA

Molcula de DNA
DNA- Polmero, cujas unidades so os nucleotdeos. Cada nucleotdeo consiste de um acar, uma base nitrogenada e um grupo fosfato

Informao Gentica

ATGGGCCTTTG CTTTGCCCCCAAA TGCCCCCAAAAGGGGG AAAGGGGGAAAAG

50 kb

ATGGGCCTTTGCCCCCAAAAGGGGGAAAAG AGGGGGAAAAGTTTGC CCTGGGGGATGGGCCTTTGC

Gaps

50 kb 1 a 2 kb
CCTGGGTTAGCTGCCTTTGC ATGCCCGGGTACGCCGGGGGAAAAG

1 a 2 kb

6. Problemas Envolvidos na Clonagem do Gene Endonucleases de restrio podem cortar e destruir os genes a serem clonados. Tambm mais que um gene pode estar envolvido na expresso de uma caracterstica. Insero incorreta do gene doador no plasmdio vetor resultando na falha da bactria em expressar o gene. A protena sintetizada pode estar dentro da clula como agregados grandes e insolveis ocorrem dificuldades no isolamento da protena. Pode ocorrer sntese em excesso do produto do gene s vezes pode ser letal para a bactria.

.Pode

ocorrer destruio do produto aps sua sntese.

.Pode ocorrer instabilidade plasmidial a cultura resultante pode conter muitas clulas sem o gene clonado. .Pode ocorrer dificuldades na extrao e purificao do produto do gene, devido presena de produtos naturais ou estruturas sintetizadas pelas clulas receptoras.

Bactrias Gram-negativas, como a E. coli, so usadas como clulas receptoras de genes mas essas bactrias no secretam protenas no meio de cultura, pois sua membrana externa retm as protenas dificultando a excreo das mesmas, necessitando de um rompimento das clulas. Bactrias Gram-positivas, como o Bacillus subtilis, no apresentam membrana externa e secretam as protenas podem ser teis como sintetizadoras do produto do gene. Mas, frqentemente estas bactrias elaboram enzimas proteolticas que destroem o produto. Leveduras no apresentam membrana externa e geralmente no sintetizam enzimas proteolticas, sendo muito teis na expresso de genes estranhos. Ex.: gene para celulase bacteriana foi clonado em leveduras clulas leveduriformes eucariticas secretam a enzima bacteriana no meio de cultura.