History of evolution

commons.wikimedia.org/wiki/Image:DNA_double_helix_vertikal.PNG

commons.wikimedia.org/wiki/Image:Charles_Darwin_1881.jpg

History of Evolution
1. 2. 3. 4. World without evolution Evolution of evolution Synthesis between Genetics and Evolution Evolution in the age of DNA

5.

Evolution in the age of genomes

World without Evolution (Discovery1: fixed species)

Creations & religions --Creationism

Egyptian mythology

Christian mythology

Chinese mythology

Aztec mythology
Babilonians Mathematical Equations

Hindu mythology

Why was Creationism questioned?

Annals of the Old Testament, Deduced from the First Origins of the World- Bishop James Ussher Creation began at nightfall before Sunday, Oct 23, 4004 B.C.E. Age of earth ~6000 years gives very little time for change Many geologists started suspecting that earth must be millions of years old

Geologists postulate an ancient earth

University of Edinburgh-Scotland became a center for geologyJames Hutton By the mid-19th century geologists had worked out the 1. major geological periods in the history of the Earth and assembled diagrams showing strata in their historical order. 2. Each layer contained a unique set of fossils, which helped biologists understand how the types and forms of life had changed over immense stretches of geological time

Discovery (2): Fossils and Strata

http://en.wikipedia.org/wiki/ ImageWilliam_Smith.g.jpg http://en.wikipedia.org/wiki/Image: Geological_map_of_Great_Britain.jpg http://en.wikipedia.org/wiki/Image:Smith_fossils2.jpg

William Smith, his geology map & some of his fossil specimens At about the same time, geologists like William Smith were mapping the rocks and fossils of Britain. He and others showed that different species existed in the past compared with today.

Smith and others were able to show that 1. 2. rocks were laid down in a certain order different fossils in different layers lived at different intervals of geological time.

3.

Here was clear evidence that different

species had existed in the past compared with today.

However, Smith did not go on to ask the question, Why? or to consider that this might be evidence for evolution.

Evolution of evolution: Discovery (3): Transmutation

Around 1800, scientists began to wonder whether species could change or transmute. Lamarck thought that if an animal acquired a characteristic during its lifetime, it could pass it onto its offspring.

commons.wikimedia.org/wiki/Image:Jean-baptiste_lamarck2.jpg

Hence giraffes got their long necks Jean Baptiste de Lamarck through generations of straining to reach high branches.
en.wikipedia.org/wiki/Image:Giraffe_standing.jpg

Evolution of evolution: Discovery (3): Transmutation

tienne Geoffroy Saint-Hilaire (17721844) National Museum of National History

Discovery (4): Darwins Voyage

From 1831-1836, a young naturalist called Charles Darwin toured the world in HMS Beagle. He was dazzled by the amazing diversity of life and started to wonder how it might have originated

Voyage of the Beagle

en.wikipedia.org/wiki/Image:Charles_Darwin_by_G._Richmond.jpg en.wikipedia.org/wiki/Image:HMS_Beagle_by_Conrad_Martens.jpg

Discovery (5): Survival of the Fittest

In his Origin of Species, published in 1859, Darwin proposed how one species might give rise to another. Where food was limited, competition meant that only the fittest would survive. This would lead to the natural selection of the best adapted individuals and eventually the evolution of a new species.
en.wikipedia.org/wiki/Image:Darwin%27s_finches.jpeg

Natural Selection explains adaption

Darwin in 1860

Discovery (6): Huxley v. Wilberforce

Darwins idea of Evolution by Natural Selection was met with huge controversy. A famous debate in 1860 pitted Bishop Wilberforce against Darwins bulldog, Thomas Henry Huxley.

Bishop Wilberforce v. T. H. Huxley

Evolutionists got the better of the debate, but few were convinced by Darwins idea of Natural Selection.
www.bbc.co.uk/religion/galleries/spiritualhistory/images/9.jpg

Who coined the term Evolution

Mendelian Genetics Discovery (7)

Attempts to link Genetics & Evolution

1. Matthias Schleiden (180481) and Theodor Schwann (181082): Cell Discovery of chromosomes August Weismann(18341914): Meiosis Translation of Mendels work: Mendels Principles of Heredity: A Defence (1902) by Bateson Garrod proved Mendels laws in humans. Morgans famous mutation experiments on Drosophila melanogaster 2. 3. 4.

5. 6.

Morgan

Discovery (8): Population Genetics

In the early 20th century, scientist started to make sense of how evolution worked.

Building on Mendels genetics, studies showed how characteristics in a population could be selected by environmental pressures. This Modern Synthesis, as Julian Huxley called it, brought Darwins Natural Selection back to the centre of evolutionary theory.

Julian Huxley Hardy, Weinberg, Haldane, Fischer and Wright and the Were pioneers of Population Genetics Modern Synthesis
en.wikipedia.org/wiki/Image:Hux-Oxon-72.jpg

Discovery of DNA

Central Dogma of Life

New theories on origin of life

DNA from fossils also provided substantial evidence

The Tree of Life

All living things share a common ancestor. We can draw a Tree of Life to show how every species is related.

en.wikipedia.org/wiki/Image:Phylogenetic_tree.svg

Genome sequencing Genome Year Organism Significance chronology size (bp)

1977 Bacteriophage fX174 Human mitochondria First genome ever! First organelle First freeliving organism First eukaryote 1981

Number of genes

5,386 11

16,500 37

Haemophilus 1995 influenzae Rd Saccharomyces cerevisiae

1,830,137 ~3,500

1996

12,086,000 ~6,000

http://www.ncbi.nlm.nih.gov/ICTVdb/Images/Ackerman/Phages/Microvir/238-27_1.jpg http://www.alsa.org/research/article.cfm?id=822 http://www.waterscan.co.yu/images/virusi-bakterije/Haemophilus%20influenzae.jpg http://www.biochem.wisc.edu/yeastclub/buddingyeast(color).jpg

Genome sequencing
Year Organism Caenorhabditis elegans
Human chromosome 22 Arabidopsis thaliana

Significance First multicellular organism

First human chromosome First plant genome

Genome size (bp)

Number of genes

1998

97,000,000 ~19,000

1999

49,000,000 673

2000

150,000,000 ~25,000

2001

Human

First human genome

3,000,000,000 ~30,000

http://www.sih.m.u-tokyo.ac.jp/chem1.gif http://lter.kbs.msu.edu/Biocollections/Herbarium/Images/ARBTH3H.jpg

So where are we heading?

Jo Handelsman
Synthetic Cell Metagenomics

Understood. So, What is Evolution?

Evidences of Evolution

Evidence (1): Biochemistry

The basic similarity of all living things suggests that they evolved from a single common ancestor. As we have already seen, all living things pass on information from generation to generation using the DNA molecule. All living things also use a molecule called ATP to carry energy around the DNA for Information organism. Transfer
en.wikipedia.org/wiki/Image:ATP-xtal-3D-sticks.png

ATP for Energy Transfer

Evidence (2): Similar Genes

HUMAN CHIMPANZEE GORILLA CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCATGACTGTTGAACGA CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA

Genetic code of chimps and gorillas is almost identical to humans If evolution is true then we might also expect that closely related organisms will be more similar to one another than more distantly related organisms. Comparison of the human genetic code with that of other organisms show that chimpanzees are nearly genetically identical (differ by less than 1.2%) whereas the mouse differs by 15%.

Evidence (3): Comparative Anatomy

Similar comparisons can be made based on anatomical evidence. The skeleton of humans and gorillas are very similar suggesting they shared a recent common ancestor, but very different from the more distantly related woodlouse

Human and Gorilla

en.wikipedia.org/wiki/Image:Primatenskelett-drawing.jpg

yet all have a common shared characteristic: bilateral symmetry Woodlouse

Evidence (4): Homology

The pentadactyl limb is ancestral to all vertebrates

but modified for different uses

en.wikipedia.org/wiki/Image:Evolution_pl.png

Evidence (5): Vestigial Structures

As evolution progresses, some structures get side-lined as they are not longer of use. These are known as vestigial structures. The coccyx is a much reduced version of an ancestral tail, which was formerly adapted to aid balance and climbing. The coccyx is a vestigial tail Another vestigial structure in humans is the appendix.
en.wikipedia.org/wiki/Image:Illu_vertebral_column.jpg

Evidence (7): Transitional fossils

Many fossils show a clear transition from one species, or group, to another. Archaeopteryx was found in Germany in 1861. It share many characteristics with both dinosaurs and birds.

Archaeopteryx
en.wikipedia.org/wiki/Image:Archaeopteryx_lithographica_paris.JPG

It provides good evidence that birds arose from dinosaur ancestors

Evidence (9): Antibiotic resistance

Staphylococcus We are all familiar with the way that certain bacteria can become resistant to antibiotics

This is an example of natural selection in action. The antibiotic acts as an environmental pressure. It weeds out those bacteria with low resistance and only those with high resistance survive to reproduce.
http://en.wikipedia.org/wiki/Image:Antibiotic_resistance.svg en.wikipedia.org/wiki/Image:Staphylococcus_aureus%2C_50%2C000x%2C_USDA%2C_ARS%2C_EMU.jpg