INSTITUTO NACIONAL DE PESQUISAS DA AMAZÔNICA – INPA

PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA,

CONSERVAÇÃO E BIOLOGIA EVOLUTIVA

Identificação molecular e integração de espécies

amazônicas à filogenia molecular de fungos da ordem
Phallales (Phallomycetidae, Basidiomycota)

Tiara Sousa Cabral

Manaus, Amazonas
Abril, 2016
 ii

Tiara Sousa Cabral

Identificação molecular e integração de espécies amazônicas à filogenia

molecular de fungos da ordem Phallales (Phallomycetidae, Basidiomycota)

Orientador: Dr. Charles R. Clement

Co-orientadores: Drs. Iuri Goulart Baseia e Kentaro Hosaka

Tese apresentada ao Instituto Nacional de

Pesquisas da Amazônia como parte dos
requisitos para obtenção do título de Doutor
em Genética, Conservação e Biologia
Evolutiva.

Manaus, Amazonas
Abril, 2016
 iii

Ficha catalográfica

C117 Cabral, Tiara Sousa

Identificação molecular e integração de espécies amazônicas à

filogenia molecular de fungos da ordem Phallales (Phallomycetidae,
Basidiomycota) / Tiara Sousa Cabral. --- Manaus: [s.n.], 2016.

131 f. : il. color.

Tese (Doutorado) --- INPA, Manaus, 2016.

Orientador : Charles Roland Clement.

Coorientadores: Iuri Goulart Baseia, Kentaro Hosaka.

Área de concentração: Genética, Conservação e Biologia

evolutiva.

1. Fungos gasteroides. 2. Phallales. 3. Filogenia molecular. I. Título.

CDD 589.2
SINOPSE

Com o estudo de espécimes da ordem Phallales coletados na Amazônia, estudados

através de ferramentas de filogenia molecular aliados às análises de taxonomia
morfológica, foi possível observar padrões de diversificação em níveis taxonômicos
de gênero e espécie. Esses padrões permitiram um melhor entendimento da
diversidade e evolução de fungos faloides, demonstrando a importância de se estudar
áreas pouco amostradas, como as florestas Neotropicais.

Palavras-chave: Fungos gasteroides, Phallales, filogenia molecular, delimitação de

espécies, Neotrópicos, taxonomia.
 iv

Agradecimentos
Agradeço ao Prof. Charles R. Clement por ter aceitado me orientar durante o
doutorado e por ter confiado na realização desse trabalho. Suas inúmeras sugestões e
incentivos foram extremamente valiosas e levaram à plena realização deste projeto. Aos
Profs. Iuri Goulart Baseia pela co-orientação e confiança no trabalho e Kentaro Hosaka por
me aceitar em seu laboratório durante o período de doutorado sanduíche e por ter me
mostrado as maravilhas do Japão. À Maria P. Martín, por estar sempre disposta a esclarecer
minhas inúmeras dúvidas e pela co-orientação não oficial. Também agradeço à Noemia Kazue
Ishikawa pelos preciosos ensinamentos, tanto acadêmicos quanto para a vida, e pelas
oportunidades proporcionadas. À Doriane P. Rodrigues por ceder o laboratório de Evolução
Aplicada para realizar os experimentos de genética molecular.
Aos companheiros de campo e laboratório, com quem pude dividir as frustrações e
alegrias que os experimentos nos proporcionam! Agradeço à Bianca Denise (UFRN), por
sempre estar disposta a ajudar nos estudos morfológicos. Agradeço aos meus amigos por
proporcionarem horas de divertimento e distração! Agradeço a Flocos que sempre parecia
saber quando eu já tinha passado tempo demais em frente ao computador, e me chamava para
passear!
Em especial agradeço a Emanuell Ribeiro, meu companheiro, que participou
ativamente nas diversas fases desse trabalho, que discutiu os resultados com a dedicação de
como se fossem seus resultados! Sobretudo pela paciência que sempre teve, e entendimento
das limitações que a vida que escolhemos nos impõe. E por não me deixar desistir.
Agradeço a minha família, minha mãe por acreditar em mim, meu pai por me
incentivar a seguir nesse caminho, e a meus irmãos que além de acreditarem, nunca
questionaram o caminho escolhido por mim. Sei que sempre estarão lá quando precisar.
Finalmente, agradeço ao Programa de Pós-Graduação em Genética, Conservação e
Biologia Evolutiva do INPA, e às agências de fomento (CNPq, CAPES e FAPEAM) por
terem concedido as bolsas de doutorado e doutorado sanduíche, e pelo financiamento da
pesquisa. Agradeço também a todos os moradores das comunidades por onde passamos
durante as coletas, que nos receberam com tanto carinho e atenção, e com quem aprendi um
pouco da vida na Amazônia!
 v

Resumo
O presente trabalho teve como objetivo principal integrar espécies amazônicas à filogenia
molecular da ordem Phallales com sequências diagnósticas padrões, e com este conjunto de
dados inferir sobre a classificação e evolução do grupo. Para isso, coletas foram realizadas ao
longo dos rios Amazonas, Solimões, Negro, Madeira e Tapajós. Os basidiomas coletados
foram herborizados, depositados no Herbário do INPA, e fragmentos foram retirados para
extração de DNA genômico. Foram obtidas sequências de ITS de todos os espécimes e,
dependendo do grupo em estudo, foram obtidas sequências de outras regiões gênicas.
Análises de Máxima Parcimônia e Bayesiana foram utilizadas para inferência filogenética
molecular dos grupos em estudo, além da construção de árvores de espécies. Esta tese
encontra-se dividida em quatro capítulos. No primeiro capítulo, uma espécie nova (Geastrum
inpaense) e novos registros de fungos gasteroides são descritos: seis espécies constituem
novos registros para Amazônia Central (Geastrum lloydianum, G. schweinitzii, Phallus
merulinus, Staheliomyces cinctus), uma para o Brasil (Phallus atrovolvatus) e uma para
América do Sul (Mutinus fleischeri). O segundo capítulo, dois novos registros de fungos
faloides são descritos para o Brasil (Lysurus arachnoideus) e América do Sul (Phallus
cinnbarinus), com descrições morfológicas detalhadas e fotos, além de sequências da região
ITS. No terceiro capítulo, a diversidade observada entre espécimes coletados do gênero
monotípico Xylophallus foi avaliada por meio de análises morfológicas aliadas a métodos de
delimitação de espécies utilizando sequências de cinco regiões gênicas. As análises
mostraram uma diversidade inesperada dentro do gênero ao revelar a presença de três
unidades evolutivas: uma corresponde a X. xylogenus; uma é uma espécie nova denominada
X. clavatus; e a terceira corresponde a uma espécie críptica – o primeiro registro em fungos
faloides. No quarto capítulo, foi avaliada a diversidade morfológica e molecular de Phallus
indusiatus sensu lato coletada na Amazônia brasileira. A árvore filogenética obtida com
sequências de ITS revelou quatro clados distintos que possuiam concordância com os dados
morfológicos. Um clado corresponde a P. indusiatus Vent., cujos espécimes apresentam
caracteres morfológicos iguais ou bem próximos à descrição original. Os outros três clados
possuem características distintas de P. indusiatus e quaisquer outras espécies com indúsio
branco, correspondendo portanto a três novas espécies: P. amazonicus possui também uma
variedade nova, P. amazonicus var. denigricans, diferenciada principalmente pela coloração
escura da volva; P. squamulosus é caracterizada pela volva com superfície escamosa e foi
encontrada na Mata Atlântica; P. purpurascens é a espécie mais distinta, sendo a maior entre
as espécies citadas, possui volva branca a lilás, reticulações do receptáculo estreitas e esporos
menores que as demais espécies. Até 2012, haviam apenas dois registros de Phallales para a
Amazônia brasileira. Atualmente podem ser contabilizadas 13 espécies de fungos faloides
para a Amazônia brasileira, sendo quatro dessas espécies novas para a ciência. Esses
resultados demonstram a importância de estudar a micobiota de florestas Neotropicais,
principalmente de grupos negligenciados como os fungos faloides. Demostra também a
importância da inclusão de dados moleculares no estudo de taxonomia e sistemática de
fungos, e como esses dados podem ser explorados. Testar diferentes regiões gênicas além de
ITS – o barcode proposto de fungos – e métodos alternativos de delimitação de espécies
também devem ser levados em consideração.
 vi

Abstract
The present study aimed to integrate Amazonian species to the molecular phylogeny of
the order Phallales using standard DNA sequences, and with this, to make inferences about
the classification and evolution of the group. Specimens were collected along the main rivers
of the Amazon basin: Negro, Madeira, Solimões, Amazonas and Tapajós. The specimens
were herborized, deposited at the INPA herbarium, and small fragments of basidioma were
excised for DNA extraction. ITS sequences were obtained from all specimens, and sequences
from additional DNA regions were obtained depending on the group of study. Maximum
Parsimony and Bayesian analyses were performed for molecular phylogenetic inferences, in
addition to construction of species trees. This thesis is divided in four chapters. In the first
chapter, one new species (Geastrum inpaense) and new records of gasteroid fungi are
described: six species are new records for Central Amazonia (Geastrum lloydianum, G.
schweinitzii, Phallus merulinus, Staheliomyces cinctus), one for Brazil (Phallus atrovolvatus)
and one for South America (Mutinus fleischeri). In the second chapter, two new records of
phalloid fungi are described for Brazil (Lysurus arachnoideus) and South America (Phallus
cinnbarinus), with detailed morphological descriptions and images, in addition to ITS
sequences. In the third chapter, the diversity observed in specimens of the monotypic genus
Xylophallus was evaluated using morphological analysis allied to methods of species
delimitation using five DNA regions. The analyses showed unexpected diversity in
Xylophallus, by revealing three evolutionary units: one corresponds to X. xylogenus; another
is a new species named X. clavatus; and the third corresponds to a cryptic species – the first
record for phalloid fungi. In chapter four, the morphological and molecular diversity found in
Amazonian specimens of Phallus indusiatus sensu lato was evaluated. The phylogenetic tree
obtained with ITS sequences revealed four distinct clades, which agreed with morphological
data. One clade corresponds to P. indusiatus Vent., The other three clades are
morphologically different from P. indusiatus and any other species with white indusium, thus
corresponding to three new species: P. amazonicus, which also has a new variety, P.
amazonicus var. denigricans differentiated by the darker volva; P. squamulosus is
characterized by the squamous surface of the volva and it was found in the Atlantic
Rainforest; P. purpurascens is the most distinct and the largest among these new species, it
has a pinkish volva, smaller reticulations on the receptaculum and smaller spores than the
other species. Until 2012, there were only two records of Phallales for Brazilian Amazonia.
Currently, 13 species are recorded, of which four species are new to science. These results
show the importance of studying mycobiota from Neotropical forests, especially neglected
groups such as phalloid fungi. It also demonstrates the importance of including molecular data
in the study of systematics and evolution of fungi, and how these data should be explored.
Testing different DNA regions other than ITS – the proposed barcode for fungi – and
alternative species delimitation methods should also be considered.
 vii

Sumário

Lista de Figuras .................................................................................................................................... viii

Introdução Geral...................................................................................................................................... 1
Objetivos ................................................................................................................................................. 5
Capítulo 01 .............................................................................................................................................. 6
Capítulo 02 ............................................................................................................................................ 22
Capítulo 03 ............................................................................................................................................ 29
Capítulo 04 ............................................................................................................................................ 65
Síntese ................................................................................................................................................. 100
Referências Bibliográficas .................................................................................................................. 103
Anexos................................................................................................................................................. 112
 viii

Lista de Figuras

Figura 1 Morfologia de Phallales. A. Phallus indusiatus; B. Itajahya galericulata; C. Clathrus

ruber; D. Protubera maracuja. g. gleba; ps. pseusdoestipe; v. volva; p. perídio; en.
Endoperídio; re. receptáculo; rz. rizomorfas. Adaptado de Miller e Miller
(1988)...........................................2

Capítulo 01
Figura 1. Phylogenetic tree of Geastrum used to position G. inpaense within the genus
constructed with Bayesian analysis, with posterior probabilities values on nodes. Herbarium
vouchers follow the taxa name. ..................................................................................................9
Figura 2. Geastrum inpaense macrostructures. Expanded basidiomata (a, b, c, d), scale bars
correspond to 20 mm; peristome (e, f), scale bars correspond to 5 mm; hairs of mycelial layer
indicated by arrows (g, h), scale bars correspond to 10 mm and 1 mm. Photographs by T.S.
Cabral........................................................................................................................................11
Figura 3. Geastrum inpaense microstructures. Endoperidium surface (a), spore ornamentation
(b), capillitial hyphae with (c) and without (d) amorphous substance………………………..12
Figura 4. Geastrum inpaense schematic drawing. Mycelial layer hyphae (a), bar = 10 µm;
fibrous layer hyphae (b), bar = 10 µm; fleshy layer hyphae (c), bar = 20 µm; spores (d), bar =
10 µm; basidia (e), bar = 10 µm. Illustration by D.S. Alfredo………………………………..13
Figura 5. Geastraceae species. Geastrum lloydianum (a), Geastrum saccatum (b), Geastrum
schweinitzii (c), Geastrum triplex (d). Photographs by T.S. Cabral………………………….14
Figura 6. Phallaceae species. Phallus merulinus (a), Phallus atrovolvatus (b), Phallus
indusiatus (c), Mutinus fleischeri (d), Staheliomyces cinctus (e). Scale bars correspond to 20
mm. Photographs (a), (b) and (d) by N.K.Ishikawa, photographs (c) and (e) by T.S.
Cabral…………………………………………………………………………………………15
Figura 7. Morganella fuliginea. Expanded basidiomata (a); exoperidium sphaerocyst chains
(b); spores in 5% KOH (c) and under SEM (d). Photograph by R.B. Neto..............................17

Capítulo 02
Figura 1. Lysurus arachnoideus (INPA 256537). A: Expanded basidioma. B:
Basidiospores............................................................................................................................25
Figura 2. Phallus cinnabarinus (INPA 255835). A: Expanded basidioma. B: Basidiospores.
C: Pseudoparenchymatous hyphae of pseudostipe with pinkish pigment droplets…………..26
 ix

Capítulo 03
Figura 1. Geographic distribution of specimens of Xylophallus reported in this study. Blue
dots are specimens of Xylophallus clavatus, red dots are specimens of Xylophallus xylogenus
and green dots are the X. xylogenus phylogenetic cryptic
species………………………………….35
Figura 2. Barplots showing the distribution of the absolute number of false positive (grey) and
false negative (black) identifications across a range of pre-set threshold values on the x axis.
(a) Ef-1α, (b) gpd, (c) rpb1, (d) rpb2, (e)
ITS………………………………………………...........41
Figura 3. Species tree based on five genes inferred by *BEAST. Values on nodes indicate
posterior probabilities. Scale represents the estimated site substitution rates, by units of branch
length………………………………………………………………………………………….42
Figura 4. Macromorphology of Xylophallus clavatus. (a, b) Fresh basidiomata; (c) dried
basidiomata with a longitudinal cut through the volva, showing the pseudostipe not attached
to it; (d) dried basidiomata showing a minutely perforated apex; (e, f) immature basidiomata
with protuberances on surface. Photos: Tiara S.
Cabral…………………………………….............45
Figura 5. Micromorphology of Xylophallus clavatus. (a) Basidiospores; (b) basidium at the
yellow arrow; (c) pseudoparenchymatous hyphae of pseudostipe; (d) filamentous hyphae from
volva…………………………………………………………………………………………..46
Figura 6. Xylophallus xylogenus. (a, b) Fresh mature basidiomata; (c) Immature basidiomata
fresh and (d) dried showing the smooth surface; (e) basidiospores; (f) pseudoparenchymatous
hyphae of pseudostipe; (g) clavate basidia; (h) a representative of the Xylophallus cryptic
species. Photos a-g: Tiara S. Cabral; h: Ricardo Braga Neto...................................................49

Capítulo 04
Figura 01. Currently known distributions of the new Phallus species described in this study.
Colored areas are the Brazilian Biomes (IBGE 2016): Amazonian Rainforest (dark green),
Cerrado (brown), Caatinga (beige), Atlantic Rainforest (light green), Pantanal (dark blue),
Pampa (light blue)…………………………………………………………………………….66

Figura 02. Phylogenetic tree obtained by Bayesian analysis. Colored clades correspond to
Brazilian species: in blue, P. amazonicus; in green, P. purpurascens; in red, P. squamulosus;
 x

in brown, P. indusiatus sensu stricto. Posterior probability values are on the nodes. The black
dots indicate specimens under Phallus indusiatus deposited in Genbank and downloaded for
this study….…………………………………………………………………………………..67

Figura 03. Phallus amazonicus. (a) fresh basidiome, holotype; (b) volva with small hyphae
projections on surface; (c) receptacle with a prominent pore and pale-yellow color (TSC 248);
(d) spores; (e) hyphae from volva; (f) rhizomorphs hyphae; (g) crystals in globose cells found
on volva……………………………………………………………………………………….71

Figura 04. Phallus amazonicus var. denigricans fresh basidiome. a. whole basidiome; b.
blackish and smooth volva in detail. Bars = 20 mm. (c) spores; (d) pseudoparenchymatous
hyphae of pseudostipe; (e) hyphae from rhizomorphs; (f) hyphae from
volva…………………………..................................................................................................73

Figura 05. Phallus purpurascens (a) fresh basidiome; (b) longitudinal section of an immature
basidiome, showing the purplish volva and rhizomorphs; (c) gregarious immature basidioma,
with purplish pigments on surface. Bars correspond to 20 mm. (d) spores; (e) rhizomorphs
hyphae; (f) pseudoparenchymatous hyphae from pseudostipe; (g) hyphae from volva; (h)
crystals in globose cells found on volva………………………………………………….….76

Figura 06. Phallus squamulosus DT 253 (a) fresh basidiome and (b) immature basidiome with
squamous surface. Bars correspond to 20 mm. (c) spores; (d) pseudoparenchymatous hyphae
from pseudostipe; (e) hyphae from volva; (f) hyphae from rhizomorphs and crystals deposits
on globose cells……………………………………………………………………………….79

Figura 07. Phallus indusiatus fresh basidiome. (a) TSC 148; (b) TSC 135, showing the volva
with pinkish pigments. Bars correspond to 20 mm..................................................................81
 1

Introdução Geral
Os fungos constituem um vasto Reino de organismos eucariotos heterotróficos com
morfologia e dimensões muito distintas, variando desde formas microscópicas até formas
macroscópicas. No passado os fungos foram tratados como pertencendo ao Reino das Plantas
devido à semelhanças compartilhadas, e só foram considerados um reino a parte quando
Whittaker (1959) propôs o estabelecimento do Reino Fungi. O filo Basidiomycota possui
mais de trinta mil espécies (Webster & Weber 2007), caracterizado principalmente por
possuírem estruturas chamadas basídios onde são produzidos os esporos.
A classe Agaricomycetes constitui 98% do subfilo Agaricomycotina (Basidiomycota), e é
composta pelos fungos que produzem corpos de frutificação, conhecidos popularmente por
cogumelos (Kirk et al. 2008). As espécies desta classe podem ser divididas em duas grandes
categorias: formas não gasteroides (agaricoides, boletoides, poliporoides, etc.) e gasteroides
(“puffballs, “birds nest fungi”, “stinkhorns”, etc.). A principal diferença entre esses grupos é
a forma de liberação dos esporos, que é por balistosporia (liberação ativa, com gasto de
energia) em não gasteoides, e estatismosporia (liberação passiva, dependente de agentes
externos) em gasteroides (Wilson et al. 2011)
Os fungos gasteroides evoluíram de maneira independente em diferentes linhagens dentro
dos basidiomicetos. Portanto, essa morfologia convergente não é considerada para
classificação, uma vez que a forma gasteroide é considerada uma homoplasia (Moncalvo et al.
2002; Wilson et al. 2011). Os gasteroides então encontram-se desmembrados em várias
ordens dentro de Basidiomycota. Na subclasse Phallomycetidae, porém, das quatro ordens
que a compõem, duas são compostas inteiramente por fungos gasteroides: Phallales e
Geastrales (Hosaka et al. 2006).
Os fungos faloides (ordem Phallales) são caracterizados principalmente por possuírem a
gleba – porção onde são formados os esporos – mucilaginosa com odor fétido que atrai
agentes dispersores, em sua maioria insetos. Possuem uma parede externa denominada
perídio, composta de duas a três camadas; inicialmente o perídio envolve completamente o
receptáculo e a gleba, e na maturidade pode se romper a partir do ápice, como ocorre na
maioria das espécies (Cunningham 1944). Podem apresentar o desenvolvimento hipógeo e/ou
epígeo (abaixo e acima da terra, respectivamente). As famílias Trappeaceae, Claustulaceae,
Protophallaceae e Gastroporiaceae são caracterizadas por não possuírem pseudoestipe, e em
algumas espécies o perídio permanece fechado mesmo após a maturação da gleba, o que
confere um corpo de frutificação oval a piriforme. O basidioma pode variar de um
 2

pseudoestipe oco com a gleba localizada no ápice formando o receptáculo, como em

Phallaceae e Lysuraceae, a uma estrutura em forma de gaiola (Clathraceae) formada por
braços que se intercruzam, onde localiza-se a gleba (Figura 01).

Figura 1 Morfologia de Phallales. A. Phallus indusiatus; B. Itajahya galericulata; C. Clathrus ruber; D.

Protubera maracuja. g. gleba; ps. pseusdoestipe; v. volva; p. perídio; en. Endoperídio; re. receptáculo; rz.
rizomorfas. Adaptado de Miller e Miller (1988).

Os faloides são cosmopolitas e efêmeros, com a maioria das espécies sapróbias. Suas
rizomorfas podem ser encontradas se estendendo às raízes enterradas e pedaços de madeira
em decomposição (Miller & Miller 1988), sendo comum também a frutificação em folhiço,
exercendo papel importante na ciclagem de matéria orgânica (Leite et al. 2007). O mau cheiro
exalado pela gleba tem como finalidade a atração de insetos que se alimentam dela,
caracterizando uma importante e diferente estratégia de dispersão de esporos para os fungos
(Tuno 1998; Oliveira & Morato 2000).
Este grupo tem sido estudado por décadas e estes estudos tem revelado uma grande
diversidade ao redor do mundo. Apesar da sua grande diversidade, ainda há lacunas no
conhecimento do grupo, tanto relacionado a taxonomia quanto a distribuição geográfica.
 3

Recentemente, Trierveiler-Pereira et al. (2014) propuseram uma nova filogenia para a ordem
Phallales, focando em gêneros sub-representados, incluindo espécies tropicais e sub-tropicais.
Porém, apesar de as relações entre as famílias estarem aparentemente bem estabelecidas, as
relações entre os gêneros dentro de cada família ou ainda a delimitação taxonômica entre os
taxa, ainda são conflitantes, o que resulta em um grande número de sinonímias para a ordem
Phallales. Isso em parte se deve à dificuldade em separar morfologicamente os taxons, devido
à escassez e plasticidade dos caracteres diagnósticos (Begerow et al. 2010). Aliado a isso, o
fato de possuírem frutificação efêmera e a difícil preservação do material também influenciam
nos estudos de taxonomia e sistemática das espécies nessa ordem.
Ao se integrar dados moleculares aos fenotípicos, muitos caracteres morfológicos
mostram-se homoplásicos ou filogeneticamente não informativos (Begerow et al. 2006;
Cabral et al. 2012; Marincowitz et al. 2015), e a evolução morfológica convergente parece ser
bem difundida entre fungos (Hibbett & Hawksworth 2007). Assim, dados de filogenia
molecular e delimitação por DNA barcode podem ser utilizados como uma importante
ferramenta para auxiliar estudos de sistemática e evolução desses fungos. De fato, vários
estudos moleculares tem revelado novas espécies e a existência de complexos de espécies e
espécies crípticas (Zhao et al. 2008; Cabral et al. 2012; Degreef et al. 2013; Li et al. 2014; Li
et al. 2005; Desjardin & Perry 2009). Apesar do número crescente de estudos filogenéticos
em fungos faloides (Hosaka et al. 2006; Degreef et al. 2013; Trierveiler-Pereira et al. 2014;
Trierveiler-Pereira & Meijer 2014; Li et al. 2014; Marincowitz et al. 2015; da Silva et al.
2015), a classificação infragenética de espécies já descritas ainda permanence inconsistente.
Os faloides possuem distribuição geográfica ampla, porém acredita-se que a maior
diversidade deste grupo seja encontrada em regiões tropicais e subtropicais (Hawksworth
2001). De fato, vários registros e novas espécies vêm surgindo nos últimos anos para África
tropical (Dring 1964; Calonge & Kreisel 2002; Desjardin & Perry 2009; Marincowitz et al.
2015), Ásia e Oceania tropicais (Kasuya 2007; Kasuya 2008; Hosaka 2010; Li et al. 2014;
Rebriev et al. 2014), América Central (Saénz & Nassar 1982; Calonge et al. 2005; Hemmes &
Desjardin 2009), e América do Sul (Baseia et al. 2003; Baseia & Calonge 2005; Gómez &
Gazis 2006; Ottoni et al. 2010; Cheype 2010; Cabral et al. 2012; Cortez et al. 2011; da Silva
et al. 2015). No entanto, no Brasil esses estudos estão restritos basicamente à Mata Atlântica,
de forma que dados sobre outras regiões que englobam ecossistemas diferentes são
inexistentes ou escassos.
A floresta Amazônica, que representa 62% da área total do território brasileiro, é
mundialmente reconhecida pela alta biodiversidade, e ainda assim a micobiota é pouco
 4

conhecida. Na Amazônia brasileira, até 2012 havia apenas dois registros de Phallales, as
espécies Phallus indusiatus e Mutinus caninus para o Estado de Rondônia (Trierveiler-Pereira
et al. 2009; Trierveiler-Pereira et al. 2011), além de 21 registros no Herbário INPA para a
família Phallaceae. A Amazônia vem sendo continuamente desmatada e a consequente
fragmentação do habitat é preocupante para a manutenção da biodiversidade, uma vez que
contribui para a perda de espécies endêmicas e não descritas, além das espécies descritas
(Fearnside 2005; Haddad et al. 2015). A fragmentação de habitat também é uma ameaça para
a micobiota (Dahlberg et al. 2010; Dahlberg & Mueller 2011), e por isso é importante obter
informações sobre a diversidade e distribuição de fungos em áreas ameaçadas, como áreas de
floresta Amazônica.
A falta de dados sobre a biodiversidade possui implicações significantes em vários
aspectos, como hipóteses filogenéticas, relações coevolutivas e interpretações de padrões
biogeográficos (Mueller & Schmit 2007). O desenvolvimento de estudos de fungos faloides
em áreas sub-amostradas e ameaçadas, como a floresta Amazônica, com uma abordagem
englobando dados morfológicos e de filogenia molecular, possibilitará um maior
entendimento da diversidade e evolução do grupo. Isso permitirá também estudos de revisões
taxonômicas, como também a delimitação confiável de espécies para apoiar posteriores
estudos de ecologia e conservação, assim como a avaliação da biodiversidade (Begerow et al.
2010).
Os quatro capítulos apresentados a seguir contribuem para o conhecimento da diversidade
de fungos faloides da Amazônia brasileira, e demonstram como o conhecimento dessa
diversidade altera o atual entendimento da sistemática e evolução da ordem Phallales em
níveis infragenéricos. Os resultados aqui apresentados consistem nos primeiros levantamentos
de fungos faloides para a Amazônia brasileira, aliando dados morfológicos e moleculares.
 5

Objetivos
O objetivo geral deste trabalho foi integrar espécies amazônicas à filogenia molecular
da ordem Phallales com sequências diagnósticas padrões e DNA barcodes.
Os objetivos de cada capítulo foram os seguintes:
• Capítulos 01 e 02 - Caracterizar morfo e molecularmente as espécies de fungos
gasteroides, principalmente da ordem Phallales, coletadas em períodos chuvosos
ao longo dos rios Amazonas-Solimões e Negro-Madeira;
• Capítulo 03 – Analisar a diversidade observada entre espécimes do gênero
monotípico Xylophallus por meio de análises morfológicas aliadas a métodos de
delimitação de espécies utilizando sequências de cinco regiões gênicas.
• Capítulo 04 - Avaliar a diversidade morfológica e molecular de Phallus
indusiatus sensu lato coletados no Brasil, principalmente na Amazônia brasileira.
 6

Capítulo 01
___________________________________________________________________________
Cabral, T.S.; da Silva, B.D.B.; Ishikawa, N.K.;
Alfredo, D.A.; Braga-Neto, R.; Clement, C.R.;
Baseia, I.G. 2014. A new species and new
records of gasteroid fungi (Basidiomycota)
from Central Amazonia, Brazil. Phytotaxa,
183(4), pp.239–253.
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
 22

Capítulo 02
___________________________________________________________________________
Cabral, T.S., Clement, C.R. & Baseia, I.G., 2015.
Amazonian phalloids: new records for Brazil
and South America. Mycotaxon, 130(2),
pp.315–320.
23
24
25
26
27
28
 29

Capítulo 03
________________________________________________________________
Multiple Loci and Morphology Reveal a New
Species and Hidden Diversity in the Genus
Xylophallus (Phallomycetidae, Basidiomycota).
Tiara S. Cabral, María P. Martín, Charles R.
Clement, Kentaro Hosaka, Iuri G. Baseia.
Manuscrito submetido para PLoS ONE
30
 31

2 Full title: Multiple Loci and Morphology Reveal a New Species and Hidden Diversity in

3 the Genus Xylophallus (Phallomycetidae, Basidiomycota)

4 Short title: Hidden Diversity in the Genus Xylophallus

5 Tiara S. Cabral1*, María P. Martín2, Charles R. Clement3, Kentaro Hosaka4, Iuri G. Baseia5

7 1. Post-graduate Program in Genetics, Conservation and Evolutionary Biology, Instituto

8 Nacional de Pesquisas da Amazônia (INPA), Manaus, Amazonas, Brazil.

9 2. Department of Mycology, Real Jardín Botánico-CSIC, Plaza de Murillo 2, Madrid, Spain.

10 3. Department of Technology and Innovation, INPA, Manaus, Amazonas, Brazil.

11 4. Department of Botany, National Museum of Nature and Science, Tsukuba, Ibaraki, Japan.

12 5. Departament of Botany and Zoology, Universidade Federal do Rio Grande do Norte, Natal,

13 Rio Grande do Norte, Brazil.

14 *Corresponding author
15 E-mail: ttiara@gmail.com
16

17 Abstract
18 The Amazon rainforest is the largest Neotropical Biome and plays essential roles in terrestrial

19 carbon storage and climate. Although it is a highly biodiverse biome, the diversity and

20 distribution of fungal species are still poorly known. The Amazon rainforest is being

21 deforested and habitat fragmentation is a serious threat for mycobiota. Information about

22 fungal species diversity and distribution in Amazonia is important, as they are important

23 ecosystem members. Xylophallus xylogenus is the smallest phalloid fungi described to date.

24 Xylophallus was considered monospecific and is geographically restricted to the Neotropics.

25 During field trips in Amazonia, morphological variations within Xylophallus were observed.

26 We evaluated six independent DNA regions and their power for discovering putative species
 32

27 in the genus. We also estimated the species trees for the genus and we tested competing

28 models of species delimitation using Bayes factors. The results reveal the presence of three

29 evolutionary units within the genus: one is X. xylogenus; another is a new species; and the

30 third appears to be a cryptic species – the first recorded in phalloid fungi. These findings

31 demonstrate the mycological richness of Neotropical forests.

32

33 1. Introduction
34 The Amazon rainforest is the largest Neotropical Biome and contains about 40% of

35 the world’s remaining tropical rainforests. The forest plays essential roles in terrestrial carbon

36 storage and climate, and is a highly diverse biome, hosting about 25% of world’s known

37 biodiversity (Malhi et al. 2008). Nonetheless, the diversity and distribution of numerous taxa

38 are still poorly known or unknown in Amazonia (Fearnside 2006). This is particularly true for

39 the megadiverse kingdom Fungi, which is species-rich in tropical forests, and plays a crucial

40 role in ecosystem functions (Hawksworth & Rossman 1997; Arnold & Lutzoni 2007;

41 Tedersoo et al. 2014).

42 The Amazon rainforest has been continuously deforested for economic reasons (Fearnside

43 2006). Habitat fragmentation caused by deforestation is of major concern for maintenance of

44 biodiversity, since it contributes to the loss of known, endemic and undescribed species

45 (Fearnside 2005; Haddad et al. 2015). Since habitat fragmentation is one of the main threats to

46 fungal diversity (Dahlberg et al. 2010; Dahlberg & Mueller 2011), it is important to have

47 information about fungal species diversity and distributions in endangered tropical systems,

48 such as the Amazon rainforest. Although fungi receives limited attention in conservation

49 biology, it provides services for other organisms including humans and can act as indicators

50 of disturbances in ecosystems (Heilmann-Clausen et al. 2015). Therefore, information about

 33

51 fungal species diversity and distribution is important for the development of conservation

52 strategies.

53 Species description is essential for biodiversity assessment and conservation studies

54 (Peterson & Navarro-Sigüenza 1999; Agapow et al. 2004; Frankham et al. 2012; Ortega-

55 Andrade et al. 2015). Traditionally, fungal species have been described using morphological

56 characters, but this can be difficult due to the lack and/or plasticity of characters used in

57 taxonomic classification (Begerow et al. 2010; Suwannasai et al. 2013). When integrating

58 molecular and morphological data for taxonomic studies, several morphological characters

59 seem to be homoplasic or phylogenetically uninformative (Begerow et al. 2006; Cabral et al.

60 2012; Zamora et al. 2014), which leads to frequent changes in classification. In this way,

61 different methods of fungal species recognition have been used according to the taxonomic

62 group under study.

63 The phalloid fungi is a very distinctive group of gasteroid fungi (Basidiomycota)

64 characterized mainly by the mucilaginous and fetid spore mass that attracts dispersal agents,

65 mostly insects. They have been studied for decades and these studies have revealed great

66 diversity all over the world (Li et al. 2002; Leite et al. 2007; Desjardin & Perry 2009; da Silva

67 et al. 2015; Marincowitz et al. 2015). Phalloid fungi are very ephemeral and a small number

68 of morphological characters are used to identify species, such as basidiomata (fruit body)

69 shape and color (Dring 1980). For this reason, infrageneric classification of phalloid species is

70 often inconsistent.

71 In this paper, we describe a new species and report the existence of a geographically

72 restricted cryptic species in the genus Xylophallus (Schltdl.) E. Fisch based on morphological

73 and molecular data. To date, this genus contained only one species, Xylophallus xylogenus

74 (Mont.) E. Fisch., the smallest phalloid yet described (up to 15 mm high). It is always found

75 on rotten wood and is currently restricted to northern South America (French Guiana, Brazil,
 34

76 Peru, Ecuador) and southern Central America (Costa Rica) (Trierveiler-Pereira & da Silveira

77 2012). Several attempts were made to properly classify this species: it was treated as section

78 Xylophallus in Phallus (Schlechtendal 1861), reallocated to Mutinus (Fischer 1898) and

79 finally a distinct genus Xylophallus (Schltdl.) E. Fisch. was erected (Fischer 1933). In the

80 most recent phylogeny of the order, based on DNA sequences of three independent genes,

81 Xylophallus is in fact an independent genus and it is closely related to the genus Mutinus

82 (Trierveiler-Pereira et al. 2014). Despite these efforts to classify it, there are still few

83 specimen records of this species (Baseia et al. 2003; Gómez & Gazis 2006; Cheype 2010;

84 Trierveiler-Pereira & da Silveira 2012), which prevents significant comparisons of collections

85 from different localities.

86 Field trips in Amazonia enabled us to collect numerous specimens of Xylophallus

87 xylogenus with great morphological differences. We found unexpected diversity in genus

88 Xylophallus when evaluating the power of species discovery of six independent DNA regions

89 and estimating their species trees, and combining these with morphological differences. The

90 discovery of such diversity in a rare genus restricted to Neotropical forests demonstrates the

91 importance of studying the mycobiota of under-sampled and threatened areas, and especially

92 the usage of molecular data allied with morphological analysis on the discovering of new

93 fungal taxa.

94

95 2. Material and Methods

96 a. Taxon sampling

97 Specimens of Xylophallus were collected in Brazilian Amazonia during the rainy

98 season from 2013 to 2015 along the main rivers of the Amazon basin: Negro and Madeira

99 Rivers (North and South axis) and Solimões and Amazonas Rivers (East and West axis).

100 Additional sampling was done along the lower Tapajós River, and in Cayenne (French
 35

101 Guiana) (Fig 1). The specimens were collected in ombrophilous dense forests, both in old-

102 growth and secondary upland forests. Collections were authorized by Sisbio 37506/2012,

103 38853/2013 and 43426/2014.

104

105 Fig 1. Geographic distribution of specimens of Xylophallus reported in this study. Blue

106 dots are specimens of Xylophallus sp. nov., red dots are specimens of Xylophallus xylogenus

107 and green dots are the X. xylogenus phylogenetic cryptic species.

108

109 We collected basidiomata randomly along pre-existing trails. An electric dryer was

110 used at 40°C during 48 hours to herborize material. After identification, the material was

111 deposited at the INPA herbarium.

 36

112 Recently, the synonymy of Phallus pygmaeus to Xylophallus xylogenus was proposed

113 (Cheype 2010). Because the type locality of Phallus pygmaeus is the Brazilian Atlantic

114 Forest, additional specimens were requested from the herbaria Padre Camille Torrand (URM)

115 and UFRN-Fungos, and included in analyses. A specimen from Costa Rica was kindly

116 provided by Dr. Clark Ovrebo, University of Central Oklahoma.

117 b. Morphological analyses

118 Specimens were studied at the Laboratory of Fungi Biology, Federal University of Rio

119 Grande do Norte, and at the Laboratory of Botany, National Research Institute for Amazonia.

120 Microscopes and stereoscopes were used to analyze microstructures, following traditional

121 methodology for phalloid fungi taxonomy (Baseia et al. 2006; Cortez et al. 2011; Kornerup &

122 Wanscher 1978). We made cuts from the different layers, including gleba, which were

123 mounted on separate slides with 5% KOH. The hyphae were separated until they became

124 homogenous, when they were observed under the microscope. We took 20 measurements

125 from each structure. Species identification as well as descriptions were made by observing the

126 micro and macrostructures, and were based on the specific literature for this group of fungi

127 (Calonge 2005; Kreisel 1996; Trierveiler-Pereira & da Silveira 2012). Mycological

128 nomenclature followed Kirk et al. (2008).

129
130
131

132 c. Phylogenetic analyses

133 i. DNA extraction, PCR and sequencing

134 DNA extraction was done from immature basidiomata for all specimens, following

135 Hosaka (2009). The DNA sequences were obtained for five independent regions: internal

136 transcribed spacer (ITS) from rDNA, translation elongation factor subunit 1α (EF-1α),
 37

137 glyceraldehyde 3-phosphate dehydrogenase (gpd), and genes encoding the two largest

138 subunits of RNA polymerase II (rpb1 and rpb2). First, we amplified and sequenced the four

139 protein genes for part of the specimens to check for the existence of variable regions. Then,

140 we developed specific primers for Xylophallus xylogenus, targeting the variable regions of the

141 protein genes (Table 01), using Primer3 (Rozen & Skaletsky 2000). For ITS, we used the

142 primer pairs ITS5 and ITS4 (White et al. 1990). We obtained the complete data set of all five

143 genes for most of the specimens. PCR reactions had a final volume of 10 µl, each containing

144 5 µl of EmeraldAmp® MAX PCR Master Mix (2X Premix) (Takara), 0.25 µl of each primer

145 (5 mM) and 1 µl of genomic DNA. The PCR cycling parameters for all genes were 1 cycle of

146 94°C for 3 min, 35 cycles of 94°C for 35 sec, 51°C for 30 sec and 72°C for 1 min, and a final

147 extension of 72°C for 10 min. The DNA fragments were visualized in 1 % agarose gels

148 stained with GelRed™ (Biotium) under UV light. The fragments were purified using Ilustra

149 ExoProStar (GE Healthcare) and sequenced using Big Dye Terminator Cycle Sequencing Kit

150 (Applied Biosystems) with the same primer pairs used for PCR for each gene, except for ITS

151 where the primer pair ITS1/ITS4 was used (White et al. 1990). Overall, the protein genes

152 were easily amplified and sequenced; on the other hand, 21 of 78 specimens presented double

153 peaks in ITS sequence electropherograms, even though it was easily amplified. For this

154 reason, we used a clone sequencing protocol aiming to better resolve the ITS sequences for

155 some specimens. After cloning, there were at least two different copies of ITS sequences for

156 some specimens and all ribotype copies were used for gene tree reconstruction and DNA

157 barcoding analyses, but not for species delimitation with Bayes factors.

158
159 Table 1. Specific primers designed for Xylophallus.

DNA region Primer names Sequences

EF-1α EF-Xy1F GCTTTTACCCTCGGTGTGAG

 38

EF-Xy2R CAAGGTCTTTCCCTTCACCA

GPD-Xy1F CCTCGACGTCAGTTACATGG

gpd GPD-Xy2R GCGAGTATACCCTGGTGGAA

RPB1-Xy1F TAGATGGATTCGCCACACAA

rpb1 RPB1-Xy2R CATCCACGGCGATACTAGGT

RPB2-Xy1F GAAACACACAAGGAATTCAACC

rpb2 RPB2-Xy2R AATCATGCTGGGATGGATCT

160
161
162 ii. DNA barcoding

163 Eletropherogram visualization, contig assembly, and alignments were made with

164 Geneious R6.1 (Biomatters Ltd.), creating five DNA sequence matrices (available at

165 TreeBase ID 18935). Five markers were analyzed for their potential for species discovery

166 (Schindel & Miller 2005) by investigating the existence of a barcoding gap (Meyer & Paulay

167 2005) in each gene database, testing several genetic distance threshold values. For this, a false

168 positive and false negative identification analysis across a range of possible genetic distance

169 thresholds calculated based on intra- and interspecific distance values, following Stefani et al.

170 (2014), was performed. For this analysis, we used the threshold optimization approach in R

171 package SPIDER (Brown et al. 2012). With this package, the genetic distance matrices using

172 p-distance for each gene were calculated. Based on these matrices, barplot graphs were

173 constructed for each gene showing the false positive (grey bars) and false negative (black

174 bars) rates of species identification according to a range from 0.1% to 2% (3% for ITS) of

175 genetic distance values. When there is no false identification, there is perfect sequence

176 assignment to species, and so there is a threshold value that can be considered as a barcode

177 gap (Brown et al. 2012).

178 iii. Gene trees, species trees and species delimitation

 39

179 To understand the evolutionary patterns in the genus, we constructed phylogenetic

180 trees for each gene separately and for the four protein genes concatenated. We used PAUP*

181 (Swofford 1998) for Maximum Parsimony analysis and MrBayes 3.1.2 to perform Bayesian

182 analysis (Huelsenbeck & Ronquist 2001). Substitution models were chosen in MrModelTest

183 2.3 (Nylander 2004). The outgroup was defined according to the most recent Phallales

184 phylogeny (Trierveiler-Pereira et al. 2014). In both analyses, the phylogenetic reconstruction

185 with protein genes resulted in trees with basically the same topology, where two

186 monophyletic clades could be observed, while ITS analysis showed no congruence with either

187 morphological data or protein genes phylogenetic trees (Fig S1 and S2). Interestingly, with

188 the ITS analysis, a monophyletic clade composed only of specimens from the Madeira River

189 basin was recovered. Because of this incongruence we estimated species trees using *BEAST

190 implemented in BEAST v.1.8.2 (Drummond & Rambaut 2007; Heled & Drummond 2010).

191 We also ran species delimitation analysis using Bayes factors, with the marginal likelihoods

192 calculation implemented in *BEAST (Grummer et al. 2014).

193 For *BEAST analyses, the model K80 was chosen for EF-1α and rpb1 partitions,

194 TrNef for gpd, K80+G for ITS and rpb2, all chosen with jModelTest (Darriba et al. 2012). We

195 selected the Yule speciation process with a strict clock model (fixed rate for EF-1α and the

196 rates for other partitions estimated relative to this gene) (Drummond et al. 2006), and

197 population size as piecewise linear and constant root. We used the default values for the rest

198 of the prior settings. The analysis was run for 50 million generations, sampling at every 5000.

199 For species delimitation through model testing using Bayes factor, we used the marginal

200 likelihood estimator through a stepping-stone process with chain length of 10 million

201 generations for 100 path steps. Two different analyses were run, one considering three species

202 (model M0: X. xylogenus, X. sp. nov. and a third phylogenetic species composed of specimens

203 from Madeira river basin), and another considering of two species (model M1: X. xylogenus
 40

204 and X. sp. nov.). Then the calculated Bayes factors (2lnBf) were used to evaluate which model

205 best explains the data, following Grummer et al. (2014) and Kass and Raftery (1995).

206 The convergence was calculated with TRACER v1.6 (Rambaut et al. 2014) and trees

207 were summarized with TREEANNOTATOR 1.7.0 (Rambaut & Drummond 2013). All

208 phylogenetic trees were visualized and edited with FigTree v1.4.2 (Rambaut 2012) and the

209 confidence values were calculated with posterior probabilities (PP).

210

211 Nomenclature

212 The electronic version of this article in Portable Document Format (PDF) in a work with

213 an ISSN or ISBN will represent a published work according to the International Code of

214 Nomenclature for algae, fungi, and plants, and hence the new names contained in the

215 electronic publication of a PLOS article are effectively published under that Code from the

216 electronic edition alone, so there is no longer any need to provide printed copies.

217 In addition, new names contained in this work have been submitted to MycoBank from

218 where they will be made available to the Global Names Index. The unique MycoBank number

219 can be resolved and the associated information viewed through any standard web browser by

220 appending the MycoBank number contained in this publication to the prefix

221 http://www.mycobank.org/MB/815135. The online version of this work is archived and

222 available from the following digital repositories: PubMed Central and LOCKSS.

223

224 3. Results
225 A total of 73 specimens were collected in Brazilian Amazonia and French Guyana,

226 and 4 more specimens from the Brazilian Atlantic rainforest and 1 from Costa Rica were

227 borrowed from herbaria. Collection localities and herbarium vouchers are described in Table
 41

228 S3. We discovered one new species belonging to the genus Xylophallus based on

229 morphological and molecular data, and one new cryptic species.

230 a. Barcoding analyses

231 A total of 76 specimens were used for phylogenetic analyses. We obtained 364 DNA

232 sequences in this study (72 EF-1α, 72 gpd, 76 ITS, 75 rpb1 and 69 rpb2), which were

233 deposited at Genbank – the accession numbers can be found in Table S3. The alignment

234 lengths for each gene were 303 bp for EF-1α, 791 bp for gpd, 533 bp for ITS, 525 bp for rpb1

235 and 706 bp for rpb2.

236 The barplot graphs (Fig 2) that resulted from threshold optimization analysis show both

237 the absolute number of false positive (in grey) and false negative (in black) species

238 identifications for all five genes, considering the existence of three distinct evolutionary units.

239 In other words, this analysis showed the absence of universal barcode gaps; therefore it was

240 not possible to clearly identify the species limits through standard genetic distance

241 differentiation methods.

242

243 Figure 2. Barplots showing the distribution of the absolute number of false positive

244 (grey) and false negative (black) identifications across a range of pre-set threshold

245 values on the x axis. (a) Ef-1α, (b) gpd, (c) rpb1, (d) rpb2, (e) ITS.
 42

246

247 b. Phylogenetic analyses

248 The species tree, estimated based on the five-genes dataset in *BEAST, clearly

249 supports (PP>0.95) a hypothesis of three distinct evolutionary units, herein considered

250 different species (Fig 3). One of the clades is composed of the specimens distributed along the

251 upper Solimões, Amazonas and Negro Rivers, Amanã Lake, and the lower Tapajós River,

252 here named Xylophallus clavatus (blue clade in Fig 3, Fig S1 and S2; blue distribution in Fig

253 1). Its sister clade is composed of specimens of Xylophallus xylogenus sensu lato (red clade in

254 Fig 3, Fig S1 and S2; red distribution in Fig 1), distributed along the middle and lower

255 Solimões River, lower Negro River, Cayenne and the Brazilian Atlantic rainforest. Specimens

256 distributed along the Madeira River compose the third and sister clade of X. xylogenus (green

257 clade in Fig 3, Fig S1 and S2; green distribution in Fig 1). When the Bayes factor 2lnBf > 10,

258 there is strong evidence of M0 over M1 (Kass & Raftery 1995). Hence, our data set is more

259 likely to be composed of three phylogenetic species than two (Table 2).

260

261 Table 2. Xylophallus species delimitation based on five gene sequences using model
262 selection with the Bayes factor approach.

Model Hypothesis log marginal 2lnBf

likelihood

M0 3 species (X. clavatus, X. xylogenus, cryptic -5131.63 49.96

species)

M1 2 species (X. clavatus, X. xylogenus) -5156.61

263

264
 43

265

266 Fig 3. Species tree based on five genes inferred by *BEAST. Values on nodes indicate

267 posterior probabilities. Scale represents the estimated site substitution rates, by units of branch

268 length.

269
270
271

272 c. Taxonomy

273 For the morphological analyzes we used the mature basidiomata of 47 Xylophallus

274 specimens. Remarkable morphological differences were found on the basidiomata and in

275 spore sizes of Xylophallus clavatus sp. nov. and Xylophallus xylogenus. On the other hand, no

276 clear morphological distinctions were observed between Xylophallus xylogenus and the

277 cryptic species. In this latter case, our assumption is exclusively based on the phylogenetic

278 tree topology and the geographic distribution of the phylogenetic cryptic species.

279

280 Xylophallus clavatus Cabral T.S., Baseia, I.G., Hosaka K., sp. nov. Fig. 4, 5.

281 Mycobank: MB815135

282 Etymology: in reference to basidiomata shape.

283 Holotype: BRAZIL, Pará, Belterra, National Forest of the Tapajós (W54.92998 S2.94187), 29

284 Mar 2014, T.S. Cabral & D.L. Komura (INPA 264901). DNA sequence data (GenBank
 44

285 accession numbers): ITS = KU871795, rpb1 = KU871689, rpb2 = KU871723, Ef-1α =

286 KU871513, gpd = KU871583.

287 Diagnosis: Xylophallus clavatus has an immature basidiome with protuberances on the

288 surface and rhizomorfs on the base. The mature basidiome has a clavate shape, up to 38 mm

289 high; receptacle is campanulate with an umbilicated depression on the apex, the pseudostipe

290 has reticulations that are deeper closer to the receptacle. Gleba is olive brown, with

291 basidiospores 4.5–4.9 µm high.

292 Description: Immature basidiome globose to subglobose, with protuberances on the surface,

293 up to 8 × 6 mm, light brown (N40A99M20) on base to brown to the apex (N90A99M99),

294 rhizomorphs on the base. Mature basidiome up to 38 × 7 mm in its thickest portion when

295 fresh, clavate shape. Receptacle campanulate, smooth, with an umbilicated depression or

296 minutely perforated at apex, adnate to pseudostipe, up to 6 × 7 mm. Pseudostipe up to 21 × 7

297 mm, cylindrical, hollow, not attached to the volva, reticulated surface with reticulations

298 deeper when closer to receptacle, white (N00A00M00), composed of ovoid to pyriform

299 pseudoparenchymatous hyphae 20–35 × 20–27 µm, hyaline in 5 % KOH (same hyphae of

300 receptacle). Volva light brown (N40A99M20) to brown (N90A99M99), with irregular

301 dehiscence, rhizomorfs at base forming a net spreading through substrate, interconnecting

302 basidiomes; external layer composed of filamentous hyphae 2.3–3.5 µm wide, hyaline in 5 %

303 KOH, sinuous, septate and with clamp connections; internal gelatinous layer composed of

304 pseudoparenchymatous hyphae 19–34 × 19–27 µm, hyaline in 5 % KOH. Rhizomorphs

305 composed of filamentous hyphae, 1.5–3.6 µm wide, thick walled, septate, hyaline in 5 %

306 KOH. Gleba olive brown (N99A50M10), gelatinous. Basidium clavate bearing 6–8 spores.

307 Basidiospores bacilar, smooth, 4.5–4.9 × 1.6–2.1 µm, greenish to hyaline in 5 % KOH.

308
 45

309 Habitat and distribution: found on rotten wood, in the state of Amazonas (municipalities of

310 São Gabriel da Cachoeira, São Paulo de Olivença, Maraã, Parintins and Barcelos) and Pará

311 (Belterra), Brazil; and Costa Rica (Fig 1).

312 Specimens examined: BRAZIL, Pará, Belterra, National Forest of Tapajós (W54.92998

313 S2.94187), 25 Mar 2014, INPA 264900; 26 Mar 2014, INPA 264931; 30 Mar 2014, INPA

314 264902, INPA 264903, INPA 264904, INPA 264905, INPA 264906, INPA 264932; 31 Mar

315 2014, INPA 264933; Amazonas, São Paulo de Olivença, Monte Santo Community

316 (W68.99939 S3.49752), 7 Feb 2014, T.S. Cabral & R. Braga-Neto, INPA 264893, INPA

317 264894; Maraã, Sustainable Development Reserve Amanã (W64.62007 S2.48734), 14 Feb

318 2014, T.S. Cabral & R. Braga-Neto, INPA 264896, INPA 264897, INPA 264898; São Gabriel

319 da Cachoeira, Itacoatiara-Mirim Community (W66.97344 S0.12872), 6 May 2014, T.S.

320 Cabral, INPA 264927; Parintins, Açaí Community, (W2.6475 S56.5484), 5 Feb 2015, T.S.

321 Cabral, INPA 271636, INPA 271637, INPA 271638, INPA 271639, INPA 271640, INPA

322 271641, INPA 271642, INPA 271643, INPA 271644, INPA 271645, INPA 271646, INPA

323 271647; 6 Feb 2015, INPA 271648, INPA 271649, INPA 271650, INPA 271651, INPA

324 271652; Barcelos, 11 Apr 2015, INPA 271654, INPA 271655.

325
 46

326
327 Fig 4. Macromorphology of Xylophallus clavatus. (a, b) Fresh basidiomata; (c) dried

328 basidiomata with a longitudinal cut through the volva, showing the pseudostipe not attached

329 to it; (d) dried basidiomata showing a minutely perforated apex; (e, f) immature basidiomata

330 with protuberances on surface. Photos: Tiara S. Cabral.

331
 47

332

333 Fig 5. Micromorphology of Xylophallus clavatus. (a) Basidiospores; (b) basidium at the

334 yellow arrow; (c) pseudoparenchymatous hyphae of pseudostipe; (d) filamentous hyphae from

335 volva.

336

337 Xylophallus xylogenus (Mont.) E. Fisch., in Engler & Prantl, Nat. Pflanzenfam., Edn 2

338 (Leipzig) 7a: 96 (1933), [MB#223720] Fig. 6a-g.

339 Basyonym: Phallus xylogenus Mont., Annales des Sciences Naturelles Botanique 3: 137, t.

340 6:7 (1855) [MB#223720]

341 Immature basidiome globose to subglobose, smooth and pruinose surface, up to 4 × 3 mm

342 broad, light brown (N40A99M20) on base to brown to the apex (N90A99M99), rhizomorphs

343 on the base. Mature basidiome up to 13 × 3 mm broad in its thickest portion when fresh.

344 Receptacle campanulate, smooth, with an umbilicated depression or minutely perforated at

345 apex, adnate to pseudostipe, 4.5 × 3 mm. Pseudostipe 4 × 2.5 mm, cylindrical, hollow, not
 48

346 attached to the volva, reticulated surface with deep reticulations all over pseudostipe, white

347 (N00A00M00), composed of ovoid to pyriform pseudoparenchymatous hyphae 17–40 × 17–

348 31 µm, hyaline in 5 % KOH (same hyphae of receptacle). Volva light brown (N40A99M20)

349 to brown (N90A99M99), with irregular dehiscence, rhizomorfs at base forming a net

350 spreading through substrate, interconnecting basidiomata; external layer composed of

351 filamentous hyphae 2.1–3.2 µm wide, hyaline in 5 % KOH, sinuous, septate and with clamp

352 connections; internal gelatinous layer composed of pseudoparenchymatous hyphae 15–26 ×

353 18–28 µm, hyaline in 5 % KOH. Rhizomorphs composed of filamentous hyphae, 1.5-3.6 µm

354 wide, thick walled, septate, hyaline in 5 % KOH. Gleba olive brown (N99A50M10),

355 gelatinous. Basidium clavate bearing 6–8 spores. Basidiospores bacilar, smooth, 3.9–4.4 ×

356 1.5–1.8 µm, greenish to hialine in 5 % KOH.

357

358 Habitat and distribution: found on rotten wood. Xylophallus xylogenus sensu lato is known

359 from French Guiana (Montagne 1855; Cheype 2010), French Antilles (Cheype 2010),

360 Suriname (Fischer 1933), Brazil (Baseia et al. 2003), Peru and Ecuador (Gómez & Gazis

361 2006). In this study we also found it in the state of Amazonas (municipalities of Tefé, Novo

362 Airão, Manaus, Autazes and Presidente Figueiredo), Brazil (Fig 1), and these are the first

363 records for Brazilian Amazonia.

364 Additional specimens examined: BRAZIL, Amazonas, Careiro, Purupuru community

365 (W59.712514 S3.394185), 7 Feb 2013, T.S. Cabral INPA 264875, INPA 264876, INPA

366 264877; Presidente Figueiredo (W59.987902 S2.046274), 20 Jun 2013, T.S. Cabral INPA

367 264889; Manaus, Botanical Garden (W59.947141 S3.008101), 7 Aug 2013, T.S. Cabral INPA

368 264890; Ducke Reserve (W59.966424 S2.964135), 14 Jan 2014, T.S. Cabral INPA 264892;

369 Novo Airão, São Sebastião Community (W60.47490 S2.82801), 12 Apr 2014, T.S. Cabral

370 INPA 264907, INPA 264908, INPA 264909, INPA 264910; 13 Apr 2014, T.S. Cabral INPA
 49

371 264911, INPA 264912, INPA 264935, INPA 264913, INPA 264914, INPA 264915; Centro

372 de Integração e Aperfeiçoamento em Polícia Ambiental – CIAPA (W60.38326 S2.70825), 15

373 Apr 2014, T.S. Cabral INPA 264916, INPA 264917, INPA 264918, INPA 264919, INPA

374 264920, INPA 264921; 16 Apr 2014, T.S. Cabral INPA 264922, INPA 264923, INPA

375 264924, INPA 264925; Tefé (W64.623400 S3.482733), 11 Mar 2015, T.S. Cabral INPA

376 271653; Pernambuco, Recife, Trierveiler-Pereira URM 80262, URM 44245, URM 44244;

377 Gurjaú, Estação Ecológica de Gurjaú (W35.569445 S8.597222), 28 Jun 2002, Baseia, I.G.;

378 Gibertoni, T.B.; UFRN-Fungos 458, as Phallus pygmaeus. FRANCE, French Guiana, Rémire-

379 Montjoly (W52.286944 N4.93925), 13 Mar 2013, T.S. Cabral INPA 264878.

380 Additional specimens examined from the cryptic species: BRAZIL, Amazonas, Humaitá, Road

381 to Ipixuna (W063,11626 S07,57440), 4 Apr 2013, T.S. Cabral & R. Braga-Neto INPA

382 264879; Barreira do Tambaqui Community (W062,88771 S07,85109), 5 Apr 2013, T.S.

383 Cabral & R. Braga-Neto INPA 264880; Acará Lake - Terra Preta Community (W062,42154

384 S06,37516), 8 Apr 2013, T.S. Cabral & R. Braga-Neto INPA 264881; Acará Lake – São

385 Francisco Community (W062,45149 S06,35173), 9 Apr 2013 T.S. Cabral & R. Braga-Neto

386 INPA 264882; Manicoré, Barro Alto Community (W061,48618 S05,97782), 11 Apr 2013,

387 T.S. Cabral & R. Braga-Neto INPA 264883; Jatuarana Lake - Castanhal do Galeno

388 (W061,43864 S05,73451), 12 Apr 2013, T.S. Cabral & R. Braga-Neto INPA 264884; Boca

389 do Rio Community (W061,32956 S05,87370), 13 Apr 2013, T.S. Cabral & R. Braga-Neto

390 INPA 264885, INPA 264886; Novo Aripuanã, São Félix Community, 16 Apr 2013, T.S.

391 Cabral & R. Braga-Neto INPA 264887, INPA 264888.

 50

392
393 Fig 6. Xylophallus xylogenus. (a, b) Fresh mature basidiomata; (c) Immature basidiomata

394 fresh and (d) dried showing the smooth surface; (e) basidiospores; (f) pseudoparenchymatous
 51

395 hyphae of pseudostipe; (g) clavate basidia; (h) a representative of the Xylophallus cryptic

396 species. Photos a-g: Tiara S. Cabral; h: Ricardo Braga Neto.

397

398 4. Discussion
399 This study aimed to investigate infrageneric diversity of Xylophallus through

400 morphological and molecular phylogenetic methods. The results reveal the presence of three

401 evolutionary units belonging to the genus. One is the known species X. xylogenus, and

402 another corresponds to a morphologically different and new species in the genus, named

403 Xylophallus clavatus. A third clade can also be distinguished by the ITS rDNA marker, with

404 geographic distribution restricted to the lower Madeira River basin, although specimens of

405 this clade are morphologically identical to X. xylogenus.

406 The morphological analysis revealed two different morphospecies, with one

407 corresponding to X. xylogenus. Although the nomenclatural history of X. xylogenus is quite

408 confusing (see Trierveiler-Pereira & da Silveira (2012) for details), this is a valid name,

409 following the International Code of Nomenclature for Algae, Fungi, and Plants. Since the

410 holotype is from Cayenne, French Guiana (Montagne 1855), and in our study the specimen

411 from this type locality clustered in the red clade (Fig 3, Fig S1 and S2), we believe that this

412 clade corresponds to Xylophallus xylogenus sensu lato. In fact, comparisons between

413 specimens of X. xylogenus obtained in this study and those published earlier (Cheype 2010;

414 Trierveiler-Pereira & da Silveira 2012; Baseia et al. 2003; Fischer 1898) confirm that they all

415 belong to the same species, with a congruence between morphological characters and

416 geographic distribution. Cheype (2010) proposed the synonymy of Phallus pygmaeus to

417 Xylophallus xylogenus, which was sustained by Trierveiler-Pereira & da Silveira (2012). In

418 our analysis we also included specimens from the Atlantic rainforest published as Phallus
 52

419 pygmaeus (Baseia et al. 2003), and they clustered in the X. xylogenus clade (Fig S1 and S2),

420 which confirms that both taxa belong to the same species.

421 The second morphospecies is new to science, named Xylophallus clavatus. It is

422 macroscopically characterized by its larger basidiomata size, the immature basidiomata

423 surface with protuberances, the clavate shape of the mature basidiomata and the pseudoestipe

424 formed by relatively shallow reticulations (Fig 4). On the other hand, X. xylogenus is smaller,

425 the immature basidiomata has a smooth surface, the mature basidiomata is fusiform, and the

426 pseudostipe is formed by deeper reticulations (Fig 6). Microscopically, they differ mainly by

427 basidiospore sizes: in X. clavatus the basidiospores are 4.5-4.9 µm in length, while in X.

428 xylogenus basidiospores are 3.9-4.4 µm (Figs 5 and 6). Sáenz et al. (1972) provided a very

429 detailed description of specimens from Costa Rica. In our analysis, the Costa Rican specimen

430 grouped in the new species clade. We found morphological similarities between the author’s

431 description and the specimens of X. clavatus analyzed here, such as mature and immature

432 basidiomata sizes, immature basidiomata surface with protuberances and basidiospore sizes.

433 In fact, the authors claim that their results are somewhat different from those previously

434 published, which now can be explained since previous papers were dealing with X. xylogenus

435 sensu lato.

436 We could detect no noticeable differences in morphological characters and ecology

437 between X. xylogenus and the third clade (green on Fig 3), which corresponds to a cryptic

438 species. So far, the only noticeable difference between these two species is their distributions.

439 X. xylogenus can be found both in the Atlantic and Amazon forests, while the cryptic species

440 seems to be restricted to the lower Madeira River basin in the Amazon forest domain.

441 Bickford et al. (2007) consider kingdom Fungi as a group with high probabilities of harboring

442 cryptic species. Indeed, several examples of cryptic speciation in Fungi can be found in the

443 literature with many of them in Basidiomycota (Ramirez-Lopez et al. 2015; Sheedy et al.
 53

444 2013; Harder et al. 2013; Stefani et al. 2014; Geml et al. 2006), but the present one is the first

445 example of a cryptic species in phalloid fungi recorded to date. The discovery of cryptic

446 diversity in fungi has significance in species and habitat conservation, and this specific case

447 shows the importance of studying little-studied taxa and under-sampled areas. In addition to

448 the already known X. xylogenus, a new species and a cryptic one were found, all endemic to

449 Neotropical forests, more specifically to old-growth dense forests. The destruction of habitats

450 caused by deforestation could lead to the loss of the Neotropical fungal species yet to be

451 discovered, especially those with very specific habitats. Therefore, more efforts should be

452 spent to study the mycobiota of Neotropical forests so that conservation programs can take

453 into account the existence of this so far hidden fungal diversity.

454 DNA barcode methodology is an elucidative tool for taxonomists. There are two different

455 goals when using DNA barcodes: species identification, when the goal is to assign a name to

456 an unknown specimen using DNA data from correctly identified species; and species

457 discovery, when the goal is to sort collections into species-like units (Schindel & Miller 2005;

458 Collins & Cruickshank 2013). One of our aims in this study was to investigate the resolution

459 power of the barcoding methodology in our dataset, which could be used to avoid

460 misidentification of specimens collected in the future. The threshold optimization approach

461 showed only false negative and positive identifications for all genes used herein, which means

462 that these genes did not present a clear barcoding gap (Brown et al. 2012). Several reasons

463 can be suggested for the lack of a barcoding gap, such as incorrect taxonomy, hybridization,

464 radiation and incomplete lineage sorting (Pino-Bodas et al. 2013). Considering the recent

465 speciation in Xylophallus, as evidenced by the short branch lengths, the lack of a barcoding

466 gap can be explained by incomplete lineage sorting of the gene sequences analyzed, which

467 can also explain the inconsistency between gene trees and species trees (van Velzen et al.

468 2012). Schoch et al. (2012) tested 6 DNA regions and showed that the nuclear ribosomal
 54

469 internal transcribed spacer (ITS) was the most suitable region for species delimitation in

470 Fungi, but the authors acknowledge that supplementary barcodes can be developed for

471 specific cases. In fact, there are several studies demonstrating that ITS by itself might fail to

472 delimitate species in some fungi (Pino-Bodas et al. 2013; Bellanger et al. 2015; Li et al. 2013;

473 Lücking et al. 2014; Lindner & Banik 2011), just as it fails to define boundaries between the

474 Xylophallus species based on genetic distance. The lack of a barcoding gap for each gene

475 makes it impossible to define a threshold for delimiting species in Xylophallus; therefore an

476 alternative methodology that is not based on genetic distances was used.

477 Using independently evolving markers in a species tree approach with selection of the best

478 model of species delimitation using Bayes factors seems to be useful in understanding the

479 evolutionary history in Xylophallus. This method of coalescent-based species delimitation

480 was recently proposed and estimates marginal likelihoods for each competing model, from

481 which Bayes factors are calculated and compared (Grummer et al. 2014). Although this

482 method can test only a limited number of hypotheses (Yang & Rannala 2014), it still has great

483 advantages, like the ability to compare models with different numbers of species or different

484 assignments of individuals to species. In our dataset, the species delimitation model of three

485 species was selected over the model of two species, partially agreeing with morphological

486 data and fully with geographical data. In the same way, Bryson et al. (2014) were able to

487 delimit species in a group of snakes using model selection with Bayes factors, where two

488 groups were recognized as new species in concordance with morphological data. This

489 methodology is elucidative using either DNA sequences or genome-wide SNP data (Leaché et

490 al. 2014), indicating that it can be a promising method for species delimitation based on

491 multiple loci data.

492 The species tree inferred indicates that the previous taxonomy of Xylophallus does not

493 reflect its evolutionary history. This genus is actually composed of at least three species,
 55

494 where X. xylogenus is a sister species of a cryptic species, and X. clavatus is a sister clade of

495 these two. The cryptic species shares the same morphological characters with X. xylogenus,

496 probably because of its recent speciation. On the other hand, the speciation between X.

497 xylogenus and X. clavatus is older, so morphological differences accumulated over time.

498 Although it seems to be a true species, we have decided to not provide a description of the

499 cryptic species using the available data, until more specimens can be added for future

500 analysis.

501 The speciation event that gave rise to X. clavatus and X. xylogenus is older than the split

502 between the latter and the cryptic species. Since it is not possible to reliably date the

503 phylogenetic trees, it is hard to infer the most probable geological scenario in which this

504 speciation may have occurred. Still, the lower Madeira River basin might have played an

505 important role in the speciation between Xylophallus cryptic species and X. xylogenus, since

506 the cryptic species is so far restricted to that area. The distribution of Xylophallus cryptic

507 species is on both sides of Madeira River and no other large river seems to be a barrier for

508 other Xylophallus species’ distributions. Given the statimospory nature of Xylophallus spore

509 liberation, its dependence on insects for dispersal and the lack of barriers due to major rivers,

510 we do not yet have a hypothesis to explain the divergence of the cryptic species from X.

511 xylogenus sensu lato.

512

513 5. Conclusions
514 The species tree allied with methods of species delimitation and morphological data

515 analyses provide strong evidence for the existence of more than one species in the genus

516 Xylophallus. Besides the already known X. xylogenus, this genus harbors a new species

517 named X. clavatus, and a third cryptic species with a very restricted geographic distribution.

518 We provide enough morphological characters to differentiate the newly described species, but
 56

519 we have decided to not formally describe the cryptic species until more collections from un-

520 sampled areas are available. All four genes show the same phylogenetic history with the

521 presence of two species, but the ITS region shows the existence of a third species. This

522 difference certainly reflects the lower mutation rates of the protein coding genes. Due to the

523 recent diversification, it was not possible to delimit species in the genus based only on genetic

524 distances of the five DNA regions used in this paper, so a method of species delimitation

525 model selection was used. This shows the importance of testing different DNA regions along

526 with the ITS region, the proposed barcode for fungi, and to test alternative methods of species

527 delimitation. This study demonstrates the importance of studying fungal diversity of

528 Neotropical forests.

529

530 Acknowledgments
531 We thank Dr. Doriane Picanço Rodrigues for coordination of the Laboratory of Applied

532 Evolution at Federal University of Amazonas, where part of the molecular data were obtained.

533 We thank Dr. Rupert Collins for his insights on species delimitation methods, and Ricardo

534 Braga Neto and Dirce Leimi Komura for collecting support. We are extremely grateful for all

535 residents of the communities visited along the rivers of the Amazon basin, who supported us

536 on field trips.

537

538 References
539 Agapow, P.M. et al., 2004. The Impact of Species Concept on Biodiversity Studies. The
540 Quarterly Review of Biology, 79(2), pp.161–179.
541 Anon, IBGE – Instituto Brasileiro de Geografia e Estatística. Available at:
542 http://www.ibge.gov.br [Accessed April 5, 2016].
543 Arnold, A.E. & Lutzoni, F., 2007. Diversity and Host Range of Foliar Fungal Endophytes: are
544 tropical leaves biodiversity hotspots? Ecology, 88(3), pp.541–549.
545 Baseia, I.G. & Calonge, F.D., 2005. Aseroë floriformis, a new phalloid with a sunflower-
 57

546 shaped receptacle. Mycotaxon, 92, pp.169–172.

547 Baseia, I.G., Gibertoni, T.B. & Maia, L.C., 2003. Phallus pygmaeus, a new minute species
548 from a Brazilian Tropical Rainforest. Mycotaxon, 85, pp.77–79.
549 Baseia, I.G., Maia, L.C. & Calonge, 2006. Notes on Phallales in the Neotropics. Boletin de la
550 Sociedad Micologica de Madrid, 30, pp.87–93.
551 Begerow, D. et al., 2010. Current state and perspectives of fungal DNA barcoding and rapid
552 identification procedures. Applied microbiology and biotechnology, 87(1), pp.99–108.
553 Begerow, D., Stoll, M. & Bauer, R., 2006. A phylogenetic hypothesis of Ustilaginomycotina
554 based on multiple gene analyses and morphological data. Mycologia, 98(6), pp.906–916.
555 Bellanger, J.-M. et al., 2015. Plunging hands into the mushroom jar: a phylogenetic
556 framework for Lyophyllaceae (Agaricales, Basidiomycota),
557 Bickford, D. et al., 2007. Cryptic species as a window on diversity and conservation. Trends
558 in Ecology & Evolution, 22(3), pp.148–155.
559 Brown, S.D.J. et al., 2012. Spider: an R package for the analysis of species identity and
560 evolution, with particular reference to DNA barcoding. Molecular ecology resources,
561 12(3), pp.562–5.
562 Bryson, R.W. et al., 2014. Multilocus species delimitation in the Crotalus triseriatus species
563 group (Serpentes: Viperidae: Crotalinae), with the description of two new species.
564 Zootaxa, 3826(3), pp.475–496.
565 Cabral, T.S. et al., 2012. Abrachium, a new genus in the Clathraceae, and Itajahya reassessed.
566 Mycotaxon, 119, pp.419–429.
567 Calonge, F.D., 2005. A tentative key to identify the species of Phallus. Boletin de la Sociedad
568 Micologica de Madrid, 29, pp.9–18.
569 Calonge, F.D. & Kreisel, H., 2002. Phallus minusculus sp. nova from Tropical Africa. Feddes
570 Repertorium, 113, pp.600–602.
571 Calonge, F.D., Kreisel, H. & Mata, M., 2005. Phallus atrovolvatus, a new species from Costa
572 Rica. Boletin de la Sociedad Micologica de Madrid, 29, pp.5–8.
573 Calonge, F.D., Mata, M. & Carranza, J., 2005. Contribución al catálogo de los
574 Gasteromycetes (Basidiomycotina, Fungi) de Costa Rica. Anales del Jardín Botánico de
575 Madrid, 62(1), pp.23–45.
576 Cheype, J., 2010. Phallaceae et Clathrus récoltés en Guyane Française. Bulletin Mycologique
577 et Botanique Dauphiné-Savoie, 66, pp.51–66.
578 Coker, W.C. & Couch, J.N., 1928. The Gasteromycetes of the Eastern United States and
579 Canada,
580 Collins, R. a. & Cruickshank, R.H., 2013. The seven deadly sins of DNA barcoding.
581 Molecular Ecology Resources, 13(6), pp.969–975.
582 Cortez, V.G., Baseia, I.G. & da Silveira, R.M.B., 2011. Two noteworthy Phallus from
583 southern Brazil. Mycoscience, 52, pp.436–438.
584 Courtecuisse, R., 2008. Current trends and perspectives for the global conservation of fungi.
585 In D. Moore et al., eds. Fungal conservation: issues and solutions. New York:
586 Cambridge University Press, pp. 7–18.
587 Cunningham, G.H., 1944. The Gasteromycetes of Australia and New Zealand, Dunedin:
588 McIndoe.
 58

589 Dahlberg, A., Genney, D.R. & Heilmann-Clausen, J., 2010. Developing a comprehensive
590 strategy for fungal conservation in Europe: current status and future needs. Fungal
591 Ecology, 3(2), pp.50–64.
592 Dahlberg, A. & Mueller, G.M., 2011. Applying IUCN red-listing criteria for assessing and
593 reporting on the conservation status of fungal species. Fungal Ecology, 4(2), pp.147–
594 162.
595 Darriba, D. et al., 2012. jModelTest 2: more models, new heuristics and parallel computing.
596 Nature Methods, 9(8), p.772.
597 Das, K., Singhi, S.K. & Calonge, F.D., 2007. Gasteromycetes of western Ghats, india: I. a
598 new form of Phallus Indusiatus. Boletin de la Sociedad Micologica de Madrid, 31,
599 pp.135–138.
600 Davis, C.C. et al., 2014. Long-term morphological stasis maintained by a plant-pollinator
601 mutualism. Proceedings of the National Academy of Sciences of the United States of
602 America, 111(16), pp.5914–9.
603 Degreef, J. et al., 2013. Two Rare Phallales Recorded from São Tomé Two rare Phallales
604 recorded from São Tomé. Cryptogamie Mycologie, 34(1), pp.3–13.
605 Demoulin, V. & Dring, D.M., 1975. Gasteromycetes of Kivu (Zaire), Rwanda and Burundi.
606 Bulletin du Jardin botanique national de Belgique, 45(3), pp.339–372.
607 Dennis, R.W.G., 1960. Fungi venezuelani: III. Kew Bulletin, 14(3), pp.418–458.
608 Dennis, R.W.G., 1953. Some West Indian Gasteromycetes. Kew Bulletin, 8(3), pp.307–328.
609 Desjardin, D.E. & Perry, B.A., 2009. A new species of Phallus from Sao Tome, Africa.
610 Mycologia, 101(4), pp.545–547.
611 Dissing, H. & Lange, M., 1962. Gasteromycetes of Congo. Bulletin du Jardin Botanique de
612 l’État a Bruxelles, 32(4), pp.325–416.
613 Dring, D.M., 1980. Contributions towards a Rational Arrangement of the Clathraceae. Kew
614 Bulletin, 35, pp.1–96.
615 Dring, D.M., 1964. Gasteromycetes of West Tropical Africa. Mycological Papers, 15(98),
616 pp.1–60.
617 Dring, D.M. & Rose, A.C., 1977. Additions to West African Phalloid Fungi. Kew Bulletin,
618 31(3), pp.741–751.
619 Drummond, A.J. et al., 2006. Relaxed phylogenetics and dating with confidence. PLoS
620 Biology, 4(5), pp.699–710.
621 Drummond, A.J. & Rambaut, A., 2007. BEAST: Bayesian evolutionary analysis by sampling
622 trees. BMC evolutionary biology, 7, p.214.
623 Fearnside, P.M., 2005. Deforestation in Brazilian Amazonia: History, rates, and
624 consequences. Conservation Biology, 19(3), pp.680–688.
625 Fearnside, P.M., 2006. Desmatamento na Amazônia: dinâmica, impactos e controle. Acta
626 Amazonica, 36(3), pp.395–400.
627 Fischer, E., 1898. Phallineae. In A. Engler & K. Prantl, eds. Die natürlichen Pflanzenfamilien
628 nebst ihren Gattungen und wichtigeren Arten insbesondere der Nutzpflanzen. pp. 276–
629 296.
630 Fischer, V.E., 1933. Phallineae. In A. Engler & K. Prantl, eds. Die natürlichen
631 Pflanzenfamilien nebst ihren Gattungen und wichtigeren Arten insbesondere der
 59

632 Nutzpflanzen.
633 Frankham, R. et al., 2012. Implications of different species concepts for conserving
634 biodiversity. Biological Conservation, 153, pp.25–31.
635 Geml, J. et al., 2006. Beringian origins and cryptic speciation events in the fly agaric
636 (Amanita muscaria). Molecular ecology, 15(1), pp.225–39.
637 Geml, J. et al., 2008. Evidence for strong inter- and intracontinental phylogeographic structure
638 in Amanita muscaria, a wind-dispersed ectomycorrhizal basidiomycete. Molecular
639 phylogenetics and evolution, 48(2), pp.694–701.
640 Gómez, L.D. & Gazis, R., 2006. Dos Gasteromycetes (Basidiomycotina, Fungi) del Perú.
641 Brenesia, 65, p.71.
642 Grummer, J. a., Bryson, R.W. & Reeder, T.W., 2014. Species delimitation using bayes
643 factors: Simulations and application to the Sceloporus scalaris species group (Squamata:
644 Phrynosomatidae). Systematic Biology, 63(2), pp.119–133.
645 Guzmán, G., Montoya, L. & Bandala, V.M., 1990. Las especies y formas de Dictyophora
646 (Fungi, Basidiomycetes, Phallales) en México y observaciones sobre su distribución en
647 América latina. Acta Botánica Mexicana, 9, pp.1–11.
648 Haddad, N.M. et al., 2015. Habitat fragmentation and its lasting impact on Earth’s
649 ecosystems. Science Advances, 1(2), pp.e1500052–e1500052.
650 Halling, R.E., Osmundson, T.W. & Neves, M.-A., 2008. Pacific boletes: implications for
651 biogeographic relationships. Mycological research, 112(Pt 4), pp.437–47.
652 Harder, C.B. et al., 2013. A three-gene phylogeny of the Mycena pura complex reveals 11
653 phylogenetic species and shows ITS to be unreliable for species identification. Fungal
654 biology, 117(11-12), pp.764–75.
655 Hawksworth, D.L., 2001. The magnitude of fungal diversity: the 1.5 million species estimate
656 revisited*. Mycological Research, 105(12), pp.1422–1432.
657 Hawksworth, D.L. & Rossman, A.Y., 1997. Where Are All the Undescribed Fungi?
658 Phytopathology, 87(9), pp.887–891.
659 Heilmann-Clausen, J. et al., 2015. A fungal perspective on conservation biology.
660 Conservation Biology, 29(1), pp.61–68.
661 Heled, J. & Drummond, A.J., 2010. Bayesian Inference of Species Trees from Multilocus
662 Data. Molecular Biology and Evolution, 27(3), pp.570–580.
663 Hemmes, D.E. & Desjardin, D.E., 2009. Stinkhorns of the Hawaiian Islands. Fungi, 2(3),
664 pp.8–10.
665 Hibbett, D.S. & Hawksworth, D.L., 2007. After the gold rush, or before the flood?
666 Evolutionary morphology of mushroom-forming fungi (Agaricomycetes) in the early
667 21st century 5. Mycological Research, 111, pp.1001–1018.
668 Hosaka, K. et al., 2006. Molecular phylogenetics of the gomphoid-phalloid fungi with an
669 establishment of the new subclass Phallomycetidae and two new orders. Mycologia,
670 98(6), pp.949–59.
671 Hosaka, K., 2009. Phylogeography of the Genus Pisolithus Revisited with some Additional
672 Taxa from New Caledonia and Japan. Bulletin of the National Museum of Nature and …,
673 35(3), pp.151–167.
674 Hosaka, K., 2010. Preliminary List of Phallales (Phallomycetidae , Basidiomycota) in
675 Taiwan. Memoirs of the National Science Museum, 46, pp.57–64.
 60

676 Hosaka, K., Castellano, M. a & Spatafora, J.W., 2008. Biogeography of Hysterangiales
677 (Phallomycetidae, Basidiomycota). Mycological research, 112(Pt 4), pp.448–62.
678 Huelsenbeck, J.P. & Ronquist, F., 2001. MRBAYES : Bayesian inference of phylogenetic
679 trees. Bioinformatics Applications Note, 17(8), pp.754–755.
680 Iofisidou, P. & Agerer, R., 2002. Die Rhizomorphen von Fastrosporium simplex und einige
681 Gedanken zur systematischen Stellung der Gastrosporiaceae (Hymenomycetes,
682 Basidiomycota). Feddes Repertorium, 113(1-2), pp.11–23.
683 Jargeat, P. et al., 2010. Phylogenetic species delimitation in ectomycorrhizal fungi and
684 implications for barcoding: the case of the Tricholoma scalpturatum complex
685 (Basidiomycota). Molecular ecology, 19(23), pp.5216–30.
686 Kass, R.E. & Raftery, A.E., 1995. Bayes Factors. Journal of the American Statistical
687 Association, 90(430), pp.773–795.
688 Kasuya, T., 2008. Phallus luteus comb. nov., a new taxonomic treatment of a tropical phalloid
689 fungus. Mycotaxon, 106, pp.7–13.
690 Kasuya, T. et al., 2012. Phylogenetic placement of Geastrum melanocephalum and polyphyly
691 of Geastrum triplex. Mycoscience.
692 Kasuya, T., 2007. Validation of Aseroë coccinea (Phallales, Phallaceae). Mycoscience, 48,
693 pp.309–311.
694 Kibby, G. & McNeil, D., 2012. Phallus duplicatus new to Britain. Field Mycology, 13(3),
695 pp.86–89.
696 Kirk, P.M. et al., 2008. Dictionary of the Fungi 10th ed., Wallingford: CAB International.
697 Kornerup, A. & Wanscher, J.H., 1978. Methuen Handbook of Colours 3rd ed., London: Eyre
698 Methuen.
699 Kreisel, H., 1996. A preliminary survey of the genus Phallus sensu lato. Czech Mycology,
700 48(4), pp.273–281.
701 Kreisel, H. & Hausknecht, A., 2009. The gasteral Basidiomycetes of Mascarenes and
702 Seychelles 3. Some recent records. Österr. Z. Pilzk., 18, pp.149–159.
703 Leaché, A.D. et al., 2014. Species Delimitation using Genome-Wide SNP Data. Systematic
704 Biology, 63(4), pp.534–542.
705 Lee, C.E. & Frost, B.W., 2002. Morphological stasis in the Eurytemora affinis species
706 complex (Copepoda: Temoridae). Hydrobiologia, 480, pp.111–128.
707 Leite, A.G. et al., 2007. Espécies raras de Phallales (Agaricomycetidae, Basidiomycetes) no
708 Nordeste do Brasil. Acta Botanica Brasilica, 21(1), pp.119–124.
709 Li, H. et al., 2014. New species of Phallus from a subtropical forest in Xishuangbanna, China.
710 Phytotaxa, 163(2), pp.91–103.
711 Li, T.H. et al., 2005. A new species of Phalfus from China and P. formosanus, new the
712 mainland. Mycotaxon, 91, pp.309–314.
713 Li, T.H., Song, B. & Liu, B., 2002. Three taxa of Phallaceae in HMAS , China. Fungal
714 Diversity, 11, pp.123–127.
715 Li, Y., Jiao, L. & Yao, Y.J., 2013. Non-concerted ITS evolution in fungi, as revealed from the
716 important medicinal fungus Ophiocordyceps sinensis. Molecular Phylogenetics and
717 Evolution, 68(2), pp.373–379.
718 Lindner, D.L. & Banik, M.T., 2011. Intragenomic variation in the ITS rDNA region obscures
 61

719 phylogenetic relationships and inflates estimates of operational taxonomic units in genus
720 Laetiporus. Mycologia, 103(4), pp.731–740.
721 Liu, B., 1984. The Gasteromycetes of China 76th ed., J. Cramer.
722 Lloyd, C.G., 1909. Synopsis of the known phalloids. Bulletin of the Lloyd Library, 13, pp.1–
723 96.
724 Lücking, R. et al., 2014. Multiple ITS haplotypes in the genome of the lichenized
725 basidiomycete cora inversa (Hygrophoraceae): Fact or artifact? Journal of Molecular
726 Evolution, 78(2), pp.148–162.
727 Malhi, Y. et al., 2008. Climate change, deforestation, and the fate of the Amazon. Science
728 (New York, N.Y.), 319(5860), pp.169–72.
729 Marincowitz, S. et al., 2015. Phylogenetic placement of Itajahya: An unusual Jacaranda
730 fungal associate. IMA Fungus, 6(2), pp.257–262.
731 Martín, M.P. & Tabarés, M., 1994. Notas sobre Gasteromycetes II: Phallus duplicatus Bosc.
732 Revista Catalana de Micologia, pp.87–98.
733 Meyer, C.P. & Paulay, G., 2005. DNA barcoding: Error rates based on comprehensive
734 sampling. PLoS Biology, 3(12), pp.1–10.
735 Miller, O.K. & Miller, H.H., 1988. Gasteromycetes: morphological and developmental
736 features, with keys to the orders, families, and genera., Eureka, CA: Mad River Press.
737 Moncalvo, J. et al., 2002. One hundred and seventeen clades of euagarics. Molecular
738 Phylogenetics and Evolution, 23, pp.357–400.
739 Montagne, C., 1855. Cryptogamia Guayanensis. Annales des Sciences Naturelles, Botanique
740 Serie 4, 3, pp.91–144.
741 Mueller, G.M. et al., 2001. Assesing biogeographic relationchips between North American
742 and Chinese macrofungi. J. Biogeo., 28, pp.271–281.
743 Mueller, G.M. & Schmit, J.P., 2007. Fungal biodiversity: what do we know? What can we
744 predict? Biodiversity & Conservation, 16, pp.1–5.
745 Nylander, J.A.A., 2004. MrModeltest v2. Program distributed by the author.
746 Oliveira, M.L. & Morato, E.F., 2000. Stingless bees (Hymenoptera, Meliponini) feeding on
747 stinkhorn spores (Fungi, Phallales): robbery or dispersal? Revista Brasileira de Zoologia,
748 17(3), pp.881–884.
749 Ortega-Andrade, H.M. et al., 2015. Insights from Integrative Systematics Reveal Cryptic
750 Diversity in Pristimantis Frogs (Anura: Craugastoridae) from the Upper Amazon Basin.
751 PLoS ONE, 10(11), p.e0143392.
752 Ottoni, B.S.. et al., 2010. Phallus roseus, first record from the neotropics. mycota, 112, pp.5–
753 8.
754 Peterson, A.T. & Navarro-Sigüenza, A.G., 1999. Alternate species concepts as bases for
755 determining priority conservation areas. Conservation Biology, 13(2), pp.427–431.
756 Pino-Bodas, R. et al., 2013. Species delimitation in Cladonia (Ascomycota): A challenge to
757 the DNA barcoding philosophy. Molecular Ecology Resources, 13(6), pp.1058–1068.
758 Rambaut, A., 2012. FigTree. Tree figure drawing tool.
759 Rambaut, A. et al., 2014. Tracer.
760 Rambaut, A. & Drummond, A.J., 2013. TreeAnnotator.
 62

761 Ramirez-Lopez, I. et al., 2015. Thelephora versatilis and Thelephora pseudoversatilis: two
762 new cryptic species with polymorphic basidiomes inhabiting tropical deciduous and sub-
763 perennial forests of the Mexican Pacific coast. Mycologia, 107(2), pp.346–358.
764 Rebriev, Y.A., Pham, T.H.G. & Alexandrova, A. V., 2014. Phallus coronatus sp. nov. from
765 Vietnam. Mycotaxon, 127, pp.93–96.
766 Rozen, S. & Skaletsky, H.J., 2000. Primer3 on the WWW for general users and for biologist
767 programmers. In S. Krawetz & S. Misener, eds. Bioinformatics Methods and Protocols:
768 Methods in Molecular Biology. Totowa, New Jersey: Humana Press, pp. 365–386.
769 Saénz, J.A. & Nassar, M., 1982. Hongos de Costa Rica: Familias Phallaceae y Clathraceae.
770 Revista de Biología Tropical, 30(1), pp.41–52.
771 Saenz, J.A., Nassar, M. & Morales, M.., 1972. Contribution to the study of xylophallus
772 xylogenus. Mycol, 64, pp.510–520.
773 Schindel, D.E. & Miller, S.E., 2005. DNA barcoding a useful tool for taxonomists. Nature,
774 435(7038), p.17.
775 Schlechtendal, D., 1861. Eine neue Phalloidee, nebst Bemerkungen über die ganze Familie
776 derselben. Linnaea, 31, pp.101–194.
777 Schoch, C.L. et al., 2012. Nuclear ribosomal internal transcribed spacer (ITS) region as a
778 universal DNA barcode marker for Fungi. Proceedings of the National Academy of
779 Sciences, 109(16), pp.6241–6246.
780 Sheedy, E.M. et al., 2013. Multigene sequence data reveal morphologically cryptic
781 phylogenetic species within the genus Laccaria in southern Australia. Mycologia, 105(3),
782 pp.547–63.
783 da Silva, B.D.B. et al., 2015. Mutinus albotruncatus (Phallales, Agaricomycetes), a new
784 phalloid from the Brazilian semiarid, and a key to the world species. Phytotaxa, 236(3),
785 pp.237–248.
786 Smith, K.N., 2005. A Field Guide to the Fungi of Australia, Sidney, Australia: UNSW Press.
787 Stefani, F.O.P., Jones, R.H. & May, T.W., 2014. Concordance of seven gene genealogies
788 compared to phenotypic data reveals multiple cryptic species in Australian dermocyboid
789 Cortinarius (Agaricales). Molecular Phylogenetics and Evolution, 71(1), pp.249–260.
790 Suwannasai, N. et al., 2013. Fungi in Thailand: A Case Study of the Efficacy of an ITS
791 Barcode for Automatically Identifying Species within the Annulohypoxylon and
792 Hypoxylon Genera. PLoS ONE, 8(2).
793 Swofford, D.L., 1998. PAUP*. Phylogenetic Analysis Using Parsimony (*and Other
794 Methods). Version 4.0 b., Sunderland, Massachusetts: Sinauer Associates.
795 Tedersoo, L. et al., 2014. Global diversity and geography of soil fungi. Science, 346(6213),
796 pp.1–10.
797 Trierveiler-Pereira, L., Gomes-Silva, A.C. & Baseia, I.G., 2009. Notes on gasteroid fungi in
798 the Brazilian Amazon rainforest. Mycotaxon, 110, pp.73–80.
799 Trierveiler-Pereira, L., Gomes-silva, A.C. & Baseia, I.G., 2011. Observations on gasteroid
800 Agaricomycetes from the Brazilian Amazon rainforest. Mycotaxon, 118, pp.273–282.
801 Trierveiler-Pereira, L. & Meijer, A., 2014. Updates on< i> Protubera</i>(Protophallaceae,
802 Phallales) and additional notes on< i> P. maracuja</i>. Mycoscience.
803 Trierveiler-Pereira, L., Silveira, R. & Hosaka, K., 2014. Multigene phylogeny of the Phallales
804 (Phallomycetidae, Agaricomycetes) focusing on some previously unrepresented genera.
 63

805 Mycologia, 106(5), pp.904–911.

806 Trierveiler-Pereira, L. & da Silveira, R.M.B., 2012. Notes on Xylophallus xylogenus
807 (Phallaceae, Agaricomycetes) based on Brazilian specimens. Mycotaxon, 120, pp.309–
808 316.
809 Tuno, N., 1998. Spore dispersal of Dictyophora fungi (Phallaceae) by fies. Ecological
810 Research, 13, pp.7–15.
811 van Velzen, R. et al., 2012. DNA barcoding of recently diverged species: Relative
812 performance of matching methods. PLoS ONE, 7(1).
813 Ventenat, E.P., 1798. Dissertation sur le genre Phallus. Mémoires de l’institut National des
814 Sciences et Arts, 1, pp.503–523.
815 Webster, J. & Weber, R., 2007. Webster J, Weber RWS (2007) Introduction to fungi, 3rd edn.
816 Cambridge University Press, New York 3rd ed., New York: Cambridge University Press.
817 White, T.J. et al., 1990. Amplification and direct sequencing of fungal ribosomal RNA genes
818 for phylogenetics. In M. A. Innis, D. H. Sninsky, & T. J. White, eds. PCR protocols: A
819 Guide to Methods and Applications.
820 Whittaker, R., 1959. On the broad classification of organisms. Quarterly Review of Biology,
821 34, pp.210–226.
822 Wilson, A.W., Binder, M. & Hibbett, D.S., 2011. Effects of gasteroid fruiting body
823 morphology on diversification rates in three independent clades of fungi estimated using
824 binary state speciation and extinction analysis. Evolution; international journal of
825 organic evolution, 65(5), pp.1305–22.
826 Yang, Z. & Rannala, B., 2014. Unguided species delimitation using DNA sequence data from
827 multiple loci. , pp.1–27.
828 Zamora, J.C. et al., 2014. Systematics of the genus Geastrum (Fungi: Basidiomycota)
829 revisited. Taxon, 63(3), pp.477–497.
830 Zamora, J.C., Calonge, F.D. & Mart??n, M.P., 2013. New sources of taxonomic information
831 for earthstars (Geastrum, Geastraceae, Basidiomycota): Phenoloxidases and rhizomorph
832 crystals. Phytotaxa, 132(1), pp.1–20.
833 Zang, M., Zheng, D. & Hu, Z., 1988. A new species of the genus Dictyophora from China.
834 Mycotaxon, 33, pp.145–148.
835 Zhao, R.-L. et al., 2008. A new species of bird’s nest fungi: characterisation of Cyathus
836 subglobisporus sp. nov. based on morphological and molecular data. Persoonia, 21,
837 pp.71–6.
838

839 Supporting Information

840 Figure S1. Phylogenetic trees obtained by Bayesian analysis. (A) EF-1α, (B) gpd, (C) ITS,

841 (D) rpb1, (E) rpb2, (F) concatenated protein genes tree. Only PP>0.9 is shown on nodes.

842 Trees A, E and F were rooted using sequences available on Genbank; B, C and D were

843 midpoint rooted.

 64

844 Figure S2. Phylogenetic trees obtained with Parsimony analysis. (A) EF-1α, (B) gpd, (C)

845 ITS, (D) rpb1, (E) rpb2, (F) concatenated protein genes tree. Only PP>80 is shown on nodes.

846 Trees A, E and F were rooted using sequences available on Genbank; B, C and D were

847 midpoint rooted.

848 Table S3. Specimens used in this study. Their localities, herbarium vouchers and Genbank

849 accession numbers.

850
 65

Capítulo 04
________________________________________________________________
Phallus indusiatus sensu lato from Brazilian
rainforests
Tiara S. Cabral, Bianca D. B. da Silva, María P.
Martín, Charles R. Clement, Kentaro Hosaka, Iuri G.
Baseia.
Manuscrito em preparação
 66

1 Title: Phallus indusiatus sensu lato from Brazilian rainforests

2 Cabral TS, Silva BDB, Martin MP, Cortez VG, Clement CR, Hosaka K, Baseia IG
3
4 ABSTRACT
5 Studies have demonstrated that cosmopolitan species actually consist of divergent
6 clades that present high levels of morphological stasis through their evolutionary histories.
7 Phallus indusiatus s.l. has been described as a circumtropical species, although this
8 distribution may actually reflect the lack of taxonomic resolution due to the small number of
9 morphological diagnostic characters, which leads to the identification of new records as
10 populations of P. indusiatus. Here, we examine the P. indusiatus-like species diversity in
11 Brazilian Amazonia. We show a clear congruence between detailed morphological data and
12 ITS based phylogenetic analysis, and describe three new species within the indusiate clade.
13 These results highlight the importance of more detailed investigation with the inclusion of
14 non-traditional molecular information in Neotropical fungi.
15
16 KEYWORDS: Phallus indusiatus, Neotropic, phalloid fungi, Amazonia, Phallales, ITS.
17
18 INTRODUCTION
19 Recently, the worldwide-distribution of fungi species hypothesis has been questioned
20 by modern molecular analyses. Studies have demonstrated that cosmopolitan species actually
21 consist of divergent clades that present high levels of morphological stasis through their
22 evolutionary histories (Bickford et al. 2007; Geml et al. 2008; Davis et al. 2014; Mueller et al.
23 2001). Phallus indusiatus s.l. has been described as a circum-tropical species, with records for
24 South and Central America (Cheype 2010; Leite et al. 2007; Dennis 1960; Saénz & Nassar
25 1982), Mexico (Guzmán et al. 1990), Africa (Dring 1964; Dring & Rose 1977; Dissing &
26 Lange 1962; Demoulin & Dring 1975), Asia (Hosaka 2010; Liu 1984; Dennis 1953) and
27 Australia (Smith 2005). For some groups of fungi, spore dispersal mechanisms may support
28 the idea of transoceanic dispersal connecting geographically isolated populations (Hosaka et
29 al. 2008; Halling et al. 2008). However, the current distribution of P. indusiatus may actually
30 reflect the lack of taxonomic resolution due to the small number of morphological diagnostic
31 characters, which leads to the identification of new records as populations of P. indusiatus.
32 As in phalloid fungi in general, few morphological characters are available to delimit
33 species in Phallus. In addition, most of the widely used diagnostic characters show high
34 plasticity, another factor that may lead to miss-identifications and mask the real diversity
 67

35 within the genus (Kreisel 1996; Calonge 2005). As a reflex of these taxonomic uncertainties,
36 a great number of synonyms are reported for several species of this clade. Phallus indusiatus
37 is an emblematic example, where at least nineteen synonyms and several distinct forms have
38 being described for this species (Liu 1984; Kreisel 1996; Calonge 2005; Cheype 2010; Lloyd
39 1909; Guzmán et al. 1990; Das et al. 2007).
40 Due to lack of resolution when using morphological characters to identify Phallus
41 species, we believe that several specimens that have been identified as P. indusiatus might
42 actually consist of independently evolving entities. In fact, some new species with minimal,
43 yet noticeable morphological differences from P. indusiatus, have been proposed. For
44 instance, P. serrata, recently described for China, differs by the meshes of the indusium with
45 serrate edges (Li et al. 2014); P. echinovolvatus has a whitish volva with mycelioid
46 projections on the surface (Zang et al. 1988); and P. flavidus, described for the Seychelles, has
47 yellowish pigments on the receptacle and indusium (Kreisel & Hausknecht 2009). At least
48 three species resembling P. indusiatus were described for Brazil, P. moelleri, P. callichrous
49 and Dictyophora phalloidea; however, they are considered synonyms by some authors (Lloyd
50 1909; Calonge 2005; Kreisel & Hausknecht 2009). Some of these species hypotheses were
51 made in concordance with molecular data, which reinforce the importance of this kind of
52 analysis to solve these taxonomic uncertainties.
53 Phallus indusiatus was described by Étienne Pierre Ventenat in 1798, based on a
54 specimen from Suriname. In 1809, Desvaux created a new genus, Dictyophora, mainly
55 characterized by the presence of an indusium, a skirt-like structure that expands from the
56 receptacle toward the ground. Ventenat’s species was transferred to Dictyophora, and named
57 D. indusiata. Kreisel (1996) considered that the importance of an indusium for the taxonomy
58 of the genus was overestimated, hence he downgraded Dictyophora as a section of Phallus.
59 More recently, with the introduction of molecular data to the systematics and taxonomy of
60 fungi, studies have shown that the indusium is a recurrent character, which independently
61 emerged several times during the evolution of the group (Hosaka et al. 2006; Cabral et al.
62 2012; Marincowitz et al. 2015). Today, Phallus indusiatus is the valid name for Ventenat’s
63 species. P. indusiatus seems to be widespread in Brazil, with records from four of the six
64 Brazilian biomes (Magnago et al. 2013), but information concerning its diversity and
65 distribution is still insufficient.
66 In this study, we examined the P. indusiatus-like species diversity in Brazilian
67 Amazonia. We show a clear congruence between detailed morphological data and ITS based
68 phylogenetic analysis, and describe three new species within the indusiate clade. These results
 68

69 highlight the importance of more detailed investigation with the inclusion of non-traditional
70 molecular information in Neotropical fungi.
71
72 MATERIAL & METHODS
73 Morphological data — A total of 26 specimens of Phallus sp. with white indusium were
74 collected during the rainy seasons of 2013 to 2015 in various areas of the Amazon Rainforest
75 domain. We included in the analyses four additional specimens with the name “Phallus
76 indusiatus” borrowed from the Herbarium of the Instituto de Botânica (São Paulo) and the
77 Universidade Federal de Rio Grande do Norte-Fungos, which were collected in various areas
78 of the Atlantic Rainforest domain. A specimen identified as P. indusiatus f. rosea collected in
79 southern Brazil was also included to determine its phylogenetic placement and if it should be
80 considered as a separate species, as Kasuya et al. (2008) observed with P. luteus. Other
81 Phallus species were included in molecular analysis to increase taxon coverage (Table 1).
82 Species were morphologically described based on fresh and dried material. Macroscopic
83 characters were described based on field notes and photographs, while microscopic data were
84 obtained by mounting slides with fragments from different layers and structures of dried
85 basidioma in 5% KOH. We followed the specific literature for species identification (Lloyd
86 1909; Calonge 2005; Kreisel & Hausknecht 2009; Kreisel 1996).
87 DNA extraction, amplification and sequencing — DNA extraction followed Hosaka (2009).
88 The internal transcribed spacer (ITS) region was amplified using ITS4/ITS5 primers, and
89 DNA fragments were visualized in 1 % agarose gel stained with GelRed™ (Biotium) under
90 UV light. The fragments were purified using Ilustra ExoProStar (GE Healthcare), and then
91 sequenced using Big Dye Terminator Cycle Sequencing Kit (Applied Biosystems), with
92 ITS1/ITS4 primers (White et al. 1990). After sequencing, some electropherograms presented
93 double peaks; in order to resolve these, the PCR fragments were cloned. All ribotypes were
94 included in the phylogenetic analysis.
95 Molecular phylogenetic analyses — We submitted each sequence to a BLAST search to
96 identify the closest relatives and to check for possible contamination. The closest sequences
97 resulting from the BLAST search and sequences with genus names of Phallus or Dictyophora
98 were retrieved from Genbank and added to the dataset. All sequences were aligned and
99 manually edited with Geneious R6.1 (Biomatters Ltd.). The final aligned matrix contained
100 538 characters and was used to infer phylogenetic trees. Species of the genus Mutinus were
101 chosen as outgroups, based on previous phylogenies (Trierveiler-Pereira et al. 2014).
102 Maximum Parsimony (MP) analysis was performed under heuristic searches with the TBR
 69

103 branch-swapping algorithm; the initial tree was obtained by stepwise addition of random
104 additional sequences repeated 100 times and 1000 replicates as bootstrap (bs) settings. For
105 Bayesian analysis (BA), the substitution model of evolution was chosen with MrModelTest
106 (Nylander 2004). Two parallel runs were executed with four incrementally-heated
107 simultaneous MCMC simulations over 3 million generations, with trees sampled every 1000
108 generations. The consensus tree was reconstructed with the remaining trees after the burn-in
109 stage, which was defined based on the average standard deviation of split frequency values.
110 The confidence values were estimated with posterior probabilities (pp). Trees were visualized
111 and edited in FigTree version 1.4.2. All data are available in TreeBASE under ID XXXX.
112
113 RESULTS

114 A total of 30 recently collected specimens of Phallus sp. with white indusium were
115 studied, 26 of which were collected in Brazilian Amazonia, while four other specimens were
116 collected from the Brazilian Atlantic Rainforest (SP and UFRN-Fungos herbaria) (Fig. 01).
117 The collection localities, herbarium vouchers and Genbank accession numbers can be found
118 in Table 01.
119 Phylogenetic analyses - The DNA extraction, and ITS amplification and sequencing were
120 performed for all specimens, but only 25 specimens yielded good clean sequences. Both
121 Maximum Parsimony and Bayesian analyses resulted in trees with similar topology (Fig. 02).
122 For Maximum Parsimony analysis, of the 538 characters, 299 were informative and resulted
123 in a most parsimonious tree with 1392 steps (CI = 0.518, RI = 0.881, RC = 0.457). The
124 Brazilian specimens of Phallus with white indusium grouped in a monophyletic clade (PP=1,
125 BT=96). This clade could be divided into five clades with strong support values (PP>0.95,
126 BT>92), which correspond to the morphospecies identified and described here. These five
127 clades are closely related to P. cinnabarinus, also found in Amazonia. Based on both
128 morphological and molecular analyses, we described three new species and one new variety.
129 Sequences under the name P. indusiatus (and Dictyophora indusiata) retrieved from
130 Genbank, all from Asia (China and Japan), as well as those collected by us in this study, form
131 a paraphyletic clade with intercontinental disjunct distributions. We believe that the Brazilian
132 clade actually corresponds to the P. indusiatus sensu stricto (brown in Fig. 02), based on
133 morphological similarities and the geographical proximity to the type locality (Suriname) of
134 the Amazonian specimens collected that nested in the clade.
135
 70

136
137 Fig. 01. Currently known distributions of the new Phallus species described in this study.
138 Colored areas are the Brazilian Biomes (Anon n.d.)(Anon n.d.)(Anon n.d.)(IBGE 2016):
139 Amazonian Rainforest (dark green), Cerrado (brown), Caatinga (beige), Atlantic Rainforest
140 (light green), Pantanal (dark blue), Pampa (light blue).
 71

141
 72

142 Fig. 02. Phylogenetic tree obtained by Bayesian analysis. Colored clades correspond to
143 Brazilian species: in blue, P. amazonicus; in green, P. purpurascens; in red, P. squamulosus;
144 in brown, P. indusiatus sensu stricto. Posterior probability values are on the nodes. The black
145 dots indicate specimens under Phallus indusiatus deposited in Genbank and downloaded for
146 this study.
147
148 TAXONOMY
149 Phallus amazonicus T.S.Cabral, B.D.B.Silva & Baseia, sp. nov. Fig. 03
150 Mycobank XXX
151 Diagnosis: Basidiome with completely epigeous development. Receptacle campanulated, but
152 slightly constricted at the base, pale yellow, reticulated, with a prominent apical pore.
153 Indusium extending to 2/3 of pseudostipe, poorly developed, white. Volva with small
154 projections on surface, white, epigeous, hyphae with clamp connections. Gleba olive-brown,
155 mucilaginous.
156 Typification: BRAZIL. Amazonas: Barcelos, Bacabal Community (S0.49004 W62.93089), 7
157 April 2015, Cabral TS (holotype INPAXXXX TSC266). Isotype UFRN-FungosXXX.
158 Genbank accessions: XXX.
159 Immature basidiomes not observed. Fresh expanded basidiome 120 mm high.
160 Receptacle 25 × 25 mm, campanulate but slightly constricted at the base, with a prominent
161 apical pore, deeply reticulated surface, reticulations up to 3.9 x 2.4 mm, whitish to pale
162 yellow (N00A20M00) when gleba is absent. Pseudostipe 81 × 22 mm, cylindrical, spongy,
163 white (N00A00M00), composed of globose to elongate-ovoid pseudoparenchymatous hyphae,
164 20.5–60.8 × 17.5–51.2.5 µm, hyaline. Indusium extending to 2/3 of pseudostipe, white
165 (N00A00M00), 57 mm in length, poorly developed, with polygonal to irregular meshes up to 12
166 × 4 mm, attached to the apex of the pseudostipe. Volva white (N00A00M0), with small hyphae
167 projections on surface, epigeous, formed by filamentous hyphae, septate, branched, hyaline,
168 clamp connections present, 2.5–3.5 μm diameter. Rhizomorphs composed of at least two
169 types of hyphae: filamentous, thin walled hyphae, with clamp connections, and thicker hyphae
170 (2.5-4.5 µm) that seem to communicate with each other by pores on the inflated tips. Crystals
171 in globose cells were found distributed among the hyphae of volva and rhizomorphs,
172 measuring 8.2–11.5 × 6.8–10.6 μm. Gleba olive brown (N99A50M10), mucilaginous.
173 Basidiospores elongated, smooth, 3.4–4 × 1.9 – 2.4 µm, hyaline in KOH 5%.
 73

174 Habitat and Distribution: on soil, in a fragment of upland old-growth forest. So far restricted
175 to Amazon rainforest, found in the municipalities of Barcelos and Parintins (State of
176 Amazonas, Brazil) and Belterra (State of Pará, Brazil).
177 Etymology: in reference to the Amazonian biome, to which the species is currently restricted.
178 Other specimens examined: BRAZIL. Amazonas: Novo Airão, São Sebastião Community, 13
179 April 2014, Cabral TS (INPA264935); Parintins, Açaí Community (S2.62665 W56.54041), 5
180 March 2015, Cabral TS (TSC248, TSC250); 6 March 2015 (TSC251, TSC253, TSC255,
181 TSC258); Barcelos, Bacabal Community (S0.49004 W62.93089), 7 April 2015, Cabral TS
182 (TSC264, TSC265); Pará: Belterra, Floresta Nacional do Tapajós, Jamaraqua Community
183 (S2.812667 W55.033083), 31 April 2014, Cabral TS (INPA264933, INPA264934,
184 INPA264928).
185 Commentary: This species is characterized by the shape and color of receptacle, the
186 conspicuous pore, the volva with protruding hyphae on the surface and the poorly developed
187 indusium. P. duplicatus Bosc. is similar to P. amazonicus by having a strongly developed
188 pore and pale yellow receptacle, and by basidiome and spore sizes (Lloyd 1909; Kreisel &
189 Hausknecht 2009); however, the indusium and volva can be white to pinkish, and the
190 indusium threads are thicker than in P. amazonicus (Kreisel & Hausknecht 2009; Martín &
191 Tabarés 1994; Coker & Couch 1928; Kibby & McNeil 2012). P. flavidus Kreisel & Hauskn.
192 can be comparable to P. amazonicus by the pale orange and conical receptacle, and the
193 indusium size; yet, P. flavidus has smaller spores (up to 3.6 x 1.8 µm), the surface of the volva
194 is light grey with an orange flush, and the indusium is cream to yellow (Kreisel & Hausknecht
195 2009). P. impudicus var. obliteratus (Malençon) Kreisel has a reticulate white receptacle and
196 a rudimentary white indusium; P. amazonicus has a poorly-developed indusium, but it is very
197 different from P. impudicus var. obliteratus, where the indusium is hidden under the
198 receptacle (Kreisel & Hausknecht 2009; Calonge 2005). P. callichrous (Möller) Lloyd is a
199 species described for Brazil, with white indusium and differs from P. amazonicus by having
200 an orange to pink receptacle and reddish-violet rhizomorphs; currently, it is considered a
201 synonym of P. indusiatus (Calonge 2005). P. echinovolvatus (M. Zang, D.R. Zheng & Z.X.
202 Hu) Kreisel is another white-indusiate species, characterized mainly by the volva covered
203 with echinulate hyphae projections; in P. amazonicus hyphae projections on the volva surface
204 can also be found, but they are smaller than in P. echinovolvatus (Zang et al. 1988). Finally,
205 in P. indusiatus the receptacle is campanulated, the immature basidiome is hypogeous, so that
206 the volva is buried under the ground when the basidiome is fully developed, the indusium is
207 completely developed reaching the ground, and the volva and rhizomorphs have pinkish
 74

208 pigments (Ventenat 1798). On the other hand, in P. amazonicus the campanulated receptacle
209 is constricted at the base, the basidiome has a completely epigeous development, the indusium
210 is poorly-developed and reaches only 2/3 of the basidiome, the rhizomorphs and volva are
211 white, and the latter has small hyphae projections on the surface. P. amazonicus is so far
212 restricted to Brazilian Amazonia, and it was found in sympatry with P. indusiatus specimens
213 collected in the region of the Tapajós River. In both the Bayesian and Maximum Parsimony
214 phylogenetic trees, specimens of P. amazonicus grouped in a monophyletic clade with high
215 support values (pp=1, bs=95), in concordance with morphological data. Hence, based on
216 morphological and phylogenetic analyses, and geographic distribution, we believe that P.
217 amazonicus is in fact a new species.
 75

218
219 Fig. 03. Phallus amazonicus. (a) fresh basidiome, holotype; (b) volva with small hyphae
220 projections on surface; (c) receptacle with a prominent pore and pale-yellow color (TSC 248);
221 (d) spores; (e) hyphae from volva; (f) rhizomorphs hyphae; (g) crystals in globose cells found
222 on volva.
 76

223 Phallus amazonicus var. denigricans T.S.Cabral, B.D.B.Silva & Baseia, var. nov. Fig. 04.
224 Mycobank: XXX
225 Diagnosis: Basidiome with completely epigeous development. Receptacle campanulated but
226 slightly constricted at the base, pale yellow, reticulated, with a prominent apical pore.
227 Indusium extending to 2/3 of pseudostipe, poorly developed, white. Blackish volva with
228 smooth surface, epigeous, hyphae with clamp connections. Gleba olive-brown, mucilaginous.
229 Typification: BRAZIL. Amazonas: Maraã, Reserva de Desenvolvimento Sustentável do
230 Amanã, Ubim Community (S02.50500 W064.66039), 15 Feb 2014, Cabral TS (holotype
231 INPAXXXX TSC115). Isotype UFRN-FungosXXX. Genbank accessions: XXX.
232 Immature basidiomes not observed. Fresh expanded basidiome 98 mm high. Receptacle
233 26 × 19 mm, campanulate but slightly constricted at the base, with a prominent apical pore,
234 deeply reticulated surface. Pseudostipe 54 × 10 mm, cylindrical, spongy, white (N00A00M00),
235 composed of globose to elongate-ovoid pseudoparenchymatous hyphae, 18.5–65.5 × 19–52.5
236 µm, hyaline. Indusium extending to 2/3 of pseudostipe, white (N00A00M00), 53 mm in length,
237 polygonal to irregular meshes up to 13 × 8 mm, attached to the apex of the pseudostipe. Volva
238 brownish (N60A60M50), with smooth surface, epigeous, formed by filamentous hyphae,
239 septate, branched, hyaline, clamp connections present, 1.8–5 μm diameter, with inflated ends
240 up to 15.5 μm diameter. Rhizomorphs composed of at least two types of hyphae: filamentous,
241 thin-walled hyphae, with clamp connections, and thicker hyphae (7-16 µm) that seem to
242 communicate with each other by pores on the inflated tips. Gleba olive brown (N99A50M10),
243 mucilaginous. Basidiospores elongated, smooth, 3.6–4.6 × 2.2-2.5 µm, hyaline in KOH 5%.
244 Habitat and Distribution: on soil, in a fragment of upland old-growth forest. Found in
245 municipalities of São Gabriel da Cachoeira and Maraã (State of Amazonas, Brazil)
246 Etymology: in reference to the blackish volva.
247 Other specimens examined: BRAZIL. Amazonas: São Gabriel da Cachoeira, Itacoatiara
248 Mirim Community, (S0.304167 W66.8403), 1 April 2013, Komura DL (INPAXXXX
249 DLK1119).
250 Commentary: The main differences between this variety and P. amazonicus sensu stricto are
251 the blackish volva with smooth surface, the larger spores (up to 4.6 x 2.5 µm), and no crystals
252 were found on the volva or rhizomorphs. The two specimens with white indusium and
253 blackish volva from our collection grouped within the P. amazonicus clade with high support
254 values (pp=1, bs=98). For this reason and because there are few differences between the two
255 groups, we decided to describe it as P. amazonicus var. denigricans. A similar case can be
256 found between P. merulinus (Berk.) Cooke and P. atrovolvatus Kreisel & Calonge. These two
 77

257 species are very similar, differing by the volva color, that is black in P. atrovolvatus and white
258 in P. merulinus (Francisco Diego Calonge et al. 2005). So far, there are no studies with DNA
259 data that allows determining the species boundaries between P. atrovolvatus and P.
260 merulinus.

261
262 Fig. 04. Phallus amazonicus var. denigricans fresh basidiome. a. whole basidiome; b.
263 blackish and smooth volva in detail. Bars = 20 mm. (c) spores; (d) pseudoparenchymatous
264 hyphae of pseudostipe; (e) hyphae from rhizomorphs; (f) hyphae from volva.
265
266 Phallus purpurascens T.S.Cabral, B.D.B.Silva & Baseia, sp. nov. Fig. 05
267 Mycobank: XXX
268 Diagnosis: Basidiome with partially epigeous development. Receptacle conic, thimble-like,
269 flat at the apex, white, strongly reticulated, with an apical pore. Indusium extending to 2/3 of
270 pseudostipe, white. Volva white, becoming purplish when exposed, with a smooth surface,
 78

271 semi-hypogeous, hyphae with clamp connections; purplish rhizomorphs at the base. Gleba
272 olive-brown, mucilaginous.
273 Typification: BRAZIL. Amazonas: Manaus (S3.0615 W60.0111), 27 Feb 2014, Cabral TS
274 (holotype INPAXXXX TSC234). Genbank accessions: XXX. Mato Grosso: Sinop, Parque
275 Florestal de Sinop (S11.8359 W55.5008), 7 Nov 2013, Cabral TS (paratype SINOP27).
276 Immature basidiomes whitish (N60A60M50) with purplish pigments (A10M10C10), globose
277 to subglobose, 56 x 43 mm, growing gregariously. Fresh expanded basidiome up to 200 mm
278 high. Receptacle 45 × 29 mm, thimble like, flat at the apex, with an apical pore, strongly
279 reticulated surface, shallow reticulations up to 3.2 x 1.7 mm, white (N00A00M00). Pseudostipe
280 122 × 21 mm, cylindrical, spongy, white (N00A00M00), composed of globose to elongate-ovoid
281 pseudoparenchymatous hyphae, 37–65.5 × 22.5–48 µm hyaline. Indusium extending up to 2/3
282 of the pseudostipe, white (N00A00M00), 100 mm in length, polygonal meshes up to 10 × 5 mm,
283 attached to the apex of the pseudostipe. Volva white (N00A00M00) becoming purplish
284 (A10M10C10) when exposed, with a smooth surface, semi-hypogeous, formed by filamentous
285 hyphae, septate, branched, hyaline, clamp connections present, 3.1–6.6 μm diameter, with
286 crystal deposits in globose cells widely distributed among the hyphae, 17.5–38 × 20.5–35.7
287 μm. Rhizomorphs composed of at least two types of hyphae: filamentous, thin-walled hyphae,
288 with clamp connections, and thicker hyphae (3-6.5 µm) that seem to communicate with each
289 other by pores on the inflated tips. Gleba olive-brown (N99A50M10), mucilaginous.
290 Basidiospores cylindrical, smooth, 4.4–5 × 2.5-3.4 µm, hyaline in KOH 5%.
291 Habitat and Distribution: on soil, in a fragment of upland secondary forest. It was found in
292 municipalities of Manaus (State of Amazonas, Brazil) and Sinop (State of Mato Grosso,
293 Brazil).
294 Etymology: in reference to the volva becoming purple.
295 Other specimens examined: BRAZIL. Mato Grosso: Sinop, Parque Florestal de Sinop
296 (S11.8359 W55.5008), 7 Nov 2013, Cabral TS (SINOP27, SINOP28, SINOP30).
297 Commentary: This species is the most distinct among our collections. It is characterized by its
298 large basidiome (up to 200 mm), the indusium reaching 2/3 of the basidiome, the purplish
299 volva and rhizomorphs, and the thimble-like and strongly reticulated receptacle. P.
300 rubrovolvatus (M. Zang, D.G. Ji & X.X. Liu) Kreisel is one of the largest white-indusiate
301 species (up to 330 mm); it differs from P. purpurascens by the deep red volva, the fragile
302 indusium, by larger reticulations on the receptacle and smaller spores (3.7-4 x 2-2.5 µm) (Liu
303 1984; Calonge 2005). P. callichrous has reddish-violet rhizomorphs (Kreisel & Hausknecht
304 2009), which differ from the purplish volva and rhizomorphs of P. purpurascens;
 79

305 unfortunately, there is little information available for this Brazilian species (Calonge 2005). P.
306 multicolor (Berk. & Broome) Cooke is similar to P. purpurascens in the purplish volva and
307 rhizomorphs, but it differs by the cream to orange indusium and the light yellow pseudostipe
308 (Lloyd 1909; Calonge 2005; Kreisel & Hausknecht 2009). P. indusiatus differs from P.
309 purpurascens by the smaller basidiome, the hypogeous development of the immature
310 basidioma, and smaller spores (4.1 × 2.2 µm), the well-developed indusium reaching the
311 ground, and the campanulate receptacle with wider reticulations (Ventenat 1798). The
312 phylogenetic analyses show specimens of P. purpurascens grouping in a monophyletic clade
313 with high support values (pp=0.96, bs=98), as a sister clade of the newly proposed P.
314 amazonicus. Although they are closely related, they are morphologically distinct: P.
315 purpurascens has larger basidiome and spores, an inconspicuous pore, the thimble-like
316 receptacle and purplish volva and rhizomorphs. P. purpurascens was found in a fragment of
317 secondary forest, in an extremely threatened area of the Amazonian forest domain in the State
318 of Mato Grosso, Brazil. This State was the second most deforested in Brazil in 2015
319 (PRODES – INPE), meaning that species in this area may be suffering the consequences of
320 habitat fragmentation, which is one of the main causes of decline in fungi species
321 (Courtecuisse 2008). Thus, this new species record shows the urgency of cataloging fungal
322 biodiversity of threatened areas, such as Neotropical forests.
 80

323
 81

324 Fig 05. Phallus purpurascens (a) fresh basidiome; (b) longitudinal section of an immature
325 basidiome, showing the purplish volva and rhizomorphs; (c) gregarious immature basidioma,
326 with purplish pigments on surface. Bars correspond to 20 mm. (d) spores; (e) rhizomorphs
327 hyphae; (f) pseudoparenchymatous hyphae from pseudostipe; (g) hyphae from volva; (h)
328 crystals in globose cells found on volva.
329
330 Phallus squamulosus T.S.Cabral, B.D.B.Silva & Baseia, sp. nov. Fig. 06.
331 Mycobank XXX
332 Diagnosis: Basidiome with completely epigeous development. Receptacle campanulate to
333 thimble like, with a wide apical pore, and strongly reticulated surface. Indusium extending to
334 2/3 of pseudostipe, white. Volva whitish to pale yellow, with squamous surface, epigeous.
335 Gleba olive-brown, mucilaginous.
336 Typification: BRAZIL. Rio Grande do Norte: Baía Formosa, Reserva Particular do
337 Patrimônio Natural Mata Estrela (W35.000365 S6.383307), 27 Feb 2014, Silva BDB
338 (holotype DT 253 UFRN-FungosXXXX). Genbank accessions: XXX.
339 Immature basidiomes whitish (N60A60M50), ovoid, with squamous surface, 39 × 34 mm.
340 Fresh expanded basidiome up to 95 mm high. Receptacle 20 × 28 mm, campanulate to
341 thimble like, with a wide apical pore, and a strongly but shallow reticulated surface,
342 reticulations 1.6-2 x 0.8-1.2 mm. Pseudostipe 60 × 12 mm, cylindrical, spongy, white
343 (N00A00M00), composed of globose to elongate-ovoid pseudoparenchymatous hyphae, 18–71
344 × 10.5–35 µm, hyaline. Indusium extending to 2/3 of pseudostipe, white (N00A00M00), 44 mm
345 in length, polygonal to rounded meshes up to 6 × 3 mm, attached to the apex of the
346 pseudostipe. Volva whitish (N00A00M00) to pale yellow (N00C00A30), with squamous surface,
347 epigeous, formed by filamentous hyphae, septate, branched, hyaline, clamp connections
348 present, 2.5–4.5 μm diameter; base with whitish (N00A00M00) rhizomorphs composed of
349 filamentous, thin-walled hyphae, with clamp connections, with crystal deposits in globose
350 cells distributed among the hyphae, 15–17.9 × 14–17 μm. Gleba olive-brown (N99A50M10),
351 mucilaginous. Basidiospores elongated, smooth, 3.5–4.4 × 1.8-2.2 µm, hyaline in KOH 5%.
352 Habitat and Distribution: found in sandy soil, in an area of the Atlantic Rainforest domain.
353 Etymology: in reference to the volva covered with small scales.
354 Commentary: Only one specimen of this species has been found to date in the northern
355 Atlantic Rainforest domain, but it is quite distinct from other species in Brazil. This species is
356 well characterized by the immature basidiome and volva with a squamous surface, the white
357 receptacle with shallow reticulations and a wide pore. We could not find white-indusiate
 82

358 species records with squamous exoperidium in the available literature. However, P.
359 duplicatus, described in Martin and Tabarés (1994), presents an immature basidiome with fine
360 scales on the exoperidium, but this character is not found in other described P. duplicatus
361 (Kibby & McNeil 2012; Liu 1984; Kreisel & Hausknecht 2009; Lloyd 1909). Nevertheless,
362 the material described by Martin and Tabarés (1994) differs from P. squamulosus mainly by
363 having a conic-campanulate receptacle with crenulate disc on the apex. P. amazonicus
364 presents small hyphae projections on immature exoperidium surfaces, but these projections
365 are arranged differently in P. squamulosus, where they appear as scales. P. indusiatus is
366 different from P. squamulosus by the campanulate receptacle with a smaller pore and deeper
367 reticulations, the indusium reaches the ground, the immature basidiome is hypogeous, with
368 smooth surface and pinkish pigments.
 83

369
370 Fig. 06. Phallus squamulosus DT 253 (a) fresh basidiome and (b) immature basidiome with
371 squamous surface. Bars correspond to 20 mm. (c) spores; (d) pseudoparenchymatous hyphae
 84

372 from pseudostipe; (e) hyphae from volva; (f) hyphae from rhizomorphs and crystals deposits
373 on globose cells.
374
375 Phallus indusiatus Vent., Mém. Inst. Natl. Sci., Sci. Math. 1: 520, 1798. Fig. 07.
376 Immature basidiomes not observed. Fresh expanded basidiome 120 mm high. Receptacle
377 25 × 25 mm, campanulate, with an apical pore, reticulated surface. Pseudostipe 67 × 12 mm,
378 cylindrical, spongy, white (N00A00M00), composed of globose to elongate-ovoid
379 pseudoparenchymatous hyphae, X–X × X–X µm, hyaline. Indusium in full development
380 extending to the ground, white (N00A00M00), 74 mm in length, polygonal to rounded meshes
381 up to 7 × 4 mm, attached to the apex of the pseudostipe, composed of pseudoparenchymatous
382 hyphae, X–X × X–X µm. Volva white (N00A00M0), with pinkish pigments (N00M10C00),
383 hypogeous, outer layer papery, composed of filamentous hyphae, X–X µm, yellowish,
384 septate, with clamp connections; inner layer gelatinous, composed of thin hyphae (X–X µm
385 wide), hyaline; base with rhizomorphs composed of filamentous, thin-walled hyphae, with
386 clamp connections. Gleba olive-brown (N99A50M10), mucilaginous. Basidiospores elongated,
387 smooth, 3.6–4.1 × 1.5 – 2.2 µm, hyaline in KOH 5%.
388 Habitat and Distribution: found on sandy soil, in old-growth dense forest. It has a
389 circumtropical distribution, with records for South and Central America, Mexico, Africa, Asia
390 and Australia.
391 Specimens examined: BRAZIL. Pará: Belterra, Floresta Nacional do Tapajós, Jamaraqua
392 Community (S2.812667 W55.033083), 25 March 2014, Cabral TS (INPA264929,
393 INPA264930, INPA264931); São Paulo, Parque Estadual das Fontes do Ipiranga (S23.54
394 W46.63), Jan. 2011, Oliveira, J.J.S. (SP416389); Mar 2011, Ventura, P.O. (SP416393);
395 Capelari, M. (SP416087).
396 Commentary: According to Ventenat’s original description, P. indusiatus is characterized by
397 the hypogeous volva, the campanulate and reticulated receptacle, and by the indusium
398 reaching the ground. The indusium is white, but it can become reddish as it matures. Ventenat
399 does not give information on color of volva and rhizomorphs, but some authors state that the
400 volva can be light pinkish and rhizomorphs can be pinkish to violet (Kreisel & Hausknecht
401 2009; Calonge 2005). Our collection presents the same characteristics of the original
402 description and those in the key for indusiate species presented by Kreisel & Hausknecht
403 (2009); in addition, some of the specimens are from State of Pará, which is geographically
404 close and with the same forest domain as the type locality (Suriname). For these reasons, we
405 believe that the specimens that are nested in the same monophyletic clade in phylogenetic tree
 85

406 (Fig. 02), all collected in the Brazilian Amazonian and Atlantic rainforests, correspond to P.
407 indusiatus sensu stricto. We also included a specimen with pink indusium, identified as P.
408 indusiatus f. rosea (Cesati) Kobayasi, which groups in the P. indusiatus clade. Three colored
409 indusiate forms of P. indusiatus are known, with the pink, white and yellow indusium. The
410 yellow indusiate form P. indusiatus f. lutea was erected to species by Kasuya (2008). In our
411 analysis, the pinkish and white indusiate forms are nested in the same clade. This indicates
412 that the species can present either a white or pinkish indusiate forms.

413
414 Fig. 07. Phallus indusiatus fresh basidiome. (a) TSC 148; (b) TSC 135, showing the volva
415 with pinkish pigments. Bars correspond to 20mm.
416

417 DISCUSSION

418 Molecular and morphological analyses and geographical distributions support the
419 hypothesis of three different species and a variety of Phallus indusiatus-like species with
420 partially overlapping distributions in Brazil. Our results suggest that a great number of species
421 might be hidden within the circumtropical P. indusiatus, since the samples we obtained from
422 Genbank are not monophyletic, but clearly polyphyletic with different relationships with other
423 Phallus species. In a similar way, several studies have unveiled fungal diversity hidden under
424 cryptic speciation and species complexes, especially after the integration of molecular and
425 phenotypic data (Geml et al. 2006; Jargeat et al. 2010; Kasuya et al. 2012). For instance,
426 Geml et al. (2008) reveled that at least eight phylogenetic species are found in the worldwide
427 distribution of Amanita muscaria (L.) Lam, with strong intercontinental genetic disjunctions
428 and intracontinental phylogeographic structure.
 86

429 Phallus indusiatus is a paraphyletic clade in our phylogenetic tree (Fig 02). The
430 specimens identified as P. indusiatus (as Dictyphora indusiatus in the figure) do not share a
431 common ancestor; therefore the P. indusiatus-like clade is here considered an artificial group.
432 We suggest that species within this group are in fact divergent entities that maintained the
433 general ancestral phenotype due to high levels of morphological stasis throughout their
434 evolutionary history. This would explain the high frequency of taxonomic uncertainties,
435 which generates a great number of species synonyms for this group.
436 The maintenance of a conserved morphology due to slow rates of phenotypic variation
437 has been widely discussed in evolution (Davis et al. 2014). Two main mechanisms have been
438 proposed to explain the small levels of morphological change through time: genetic and
439 developmental constraints may restrict the appearance of phenotypic variation; or strong
440 stabilizing selection for a phenotype (Geml et al. 2008; Davis et al. 2014; Lee & Frost 2002).
441 Phallus indusiatus sensu lato has a circumtropical distribution; in our hypothesis, this putative
442 species with intercontinental disjunct distributions (as evidenced in phylogenetic tree – Fig
443 02) might occupy similar niches in different continents. Therefore, they are likely to be under
444 similar environmental conditions and selective pressures. A similar pattern was found by
445 Mueller (2001) between two disjunct and paraphyletic populations of Suillus spraguei (Berk.
446 & M.A. Curtis) Kuntze, that presented no noticeable morphological differences, probably as a
447 result of stabilizing selection.
448 When studying phalloid species it is noticeable that macro-characters are more variable
449 than micro-characters. For instance, spores are often cylindrical to bacilloid and smooth
450 throughout the order (except for Gastrosporiaceae), probably as an adaptation for dispersal,
451 since they are dispersed through the gut and do not adhere on the body of insects (Oliveira &
452 Morato 2000; Tuno 1998). The presence of rounded crystals in globose cells among hyphae
453 of volva and rhizomorphs was reported for Phallales species (Iofisidou & Agerer 2002), but it
454 is not a commonly used character in species descriptions. We believe these crystals are
455 formed by calcium oxalate, as found in other Phallomycetidae species, such as Geastrum and
456 Gastrosporium simplex (Zamora et al. 2013; Iofisidou & Agerer 2002), but further studies
457 about function and composition in Phallus are needed. These rounded crystals are present in
458 all species described here, except for P. amazonicus var. denigricans. However, we found
459 these structures only on the volva of P. purpurascens, on rhizomorphs of P. squamulosus, and
460 on both volva and rhizomorphs in P. amazonicus. Further studies are needed in order to
461 evaluate the taxonomic value of the presence of crystals in phalloid fungi. For instance, the
 87

462 presence, shape and the arrangement of oxalate crystals were found to be important characters
463 to delimit species in Geastrum (Zamora et al. 2013).
464 On the other hand, macro-characters, such as the shape, surface and color of the main
465 structures (receptacle, pseudostipe, indusium, volva and rhizomorphs), are important
466 characters for infrageneric classification (Kreisel 1996). In this study, the phylogenetic clades
467 of P. indusiatus-like species were differentiated based on these features, confirming their
468 importance as diagnostic characters. Given that these diagnosable characters are lost once
469 phalloid specimens are dehydrated, it is extremely important that the newly described species
470 and new records should be well illustrated with colored pictures of fresh material. In addition,
471 we believe that molecular data seems to be indispensable for delimiting and describing
472 species in Phallus.
473
474 ACKNOWLEDGMENTS
475 We thank CNPq (473422/2012-3), FAPEAM (3137/2012), PPBio and the INCT-
476 CENBAM project for financial support. We thank Dr. Doriane Picanço Rodrigues for
477 coordination of the Laboratory of Applied Evolution at Federal University of Amazonas,
478 where part of the molecular data was obtained. We thank Ricardo Braga Neto, Dr. Dirce
479 Leimi Komura and Leonardo Kumagai for collecting support, and the curators of SP and
480 UFRN-Fungos Herbaria for specimen loan.
481
482 REFERENCES
483 Agapow, P.M. et al., 2004. The Impact of Species Concept on Biodiversity Studies. The
484 Quarterly Review of Biology, 79(2), pp.161–179.
485 Anon, IBGE – Instituto Brasileiro de Geografia e Estatística. Available at:
486 http://www.ibge.gov.br [Accessed April 5, 2016].
487 Arnold, A.E. & Lutzoni, F., 2007. Diversity and Host Range of Foliar Fungal Endophytes: are
488 tropical leaves biodiversity hotspots? Ecology, 88(3), pp.541–549.
489 Baseia, I.G. & Calonge, F.D., 2005. Aseroë floriformis, a new phalloid with a sunflower-
490 shaped receptacle. Mycotaxon, 92, pp.169–172.
491 Baseia, I.G., Gibertoni, T.B. & Maia, L.C., 2003. Phallus pygmaeus, a new minute species
492 from a Brazilian Tropical Rainforest. Mycotaxon, 85, pp.77–79.
493 Baseia, I.G., Maia, L.C. & Calonge, 2006. Notes on Phallales in the Neotropics. Boletin de la
494 Sociedad Micologica de Madrid, 30, pp.87–93.
495 Begerow, D. et al., 2010. Current state and perspectives of fungal DNA barcoding and rapid
 88

496 identification procedures. Applied microbiology and biotechnology, 87(1), pp.99–108.

497 Begerow, D., Stoll, M. & Bauer, R., 2006. A phylogenetic hypothesis of Ustilaginomycotina
498 based on multiple gene analyses and morphological data. Mycologia, 98(6), pp.906–916.
499 Bellanger, J.-M. et al., 2015. Plunging hands into the mushroom jar: a phylogenetic
500 framework for Lyophyllaceae (Agaricales, Basidiomycota),
501 Bickford, D. et al., 2007. Cryptic species as a window on diversity and conservation. Trends
502 in Ecology & Evolution, 22(3), pp.148–155.
503 Brown, S.D.J. et al., 2012. Spider: an R package for the analysis of species identity and
504 evolution, with particular reference to DNA barcoding. Molecular ecology resources,
505 12(3), pp.562–5.
506 Bryson, R.W. et al., 2014. Multilocus species delimitation in the Crotalus triseriatus species
507 group (Serpentes: Viperidae: Crotalinae), with the description of two new species.
508 Zootaxa, 3826(3), pp.475–496.
509 Cabral, T.S. et al., 2012. Abrachium, a new genus in the Clathraceae, and Itajahya reassessed.
510 Mycotaxon, 119, pp.419–429.
511 Calonge, F.D., 2005. A tentative key to identify the species of Phallus. Boletin de la Sociedad
512 Micologica de Madrid, 29, pp.9–18.
513 Calonge, F.D. & Kreisel, H., 2002. Phallus minusculus sp. nova from Tropical Africa. Feddes
514 Repertorium, 113, pp.600–602.
515 Calonge, F.D., Kreisel, H. & Mata, M., 2005. Phallus atrovolvatus, a new species from Costa
516 Rica. Boletin de la Sociedad Micologica de Madrid, 29, pp.5–8.
517 Calonge, F.D., Mata, M. & Carranza, J., 2005. Contribución al catálogo de los
518 Gasteromycetes (Basidiomycotina, Fungi) de Costa Rica. Anales del Jardín Botánico de
519 Madrid, 62(1), pp.23–45.
520 Cheype, J., 2010. Phallaceae et Clathrus récoltés en Guyane Française. Bulletin Mycologique
521 et Botanique Dauphiné-Savoie, 66, pp.51–66.
522 Coker, W.C. & Couch, J.N., 1928. The Gasteromycetes of the Eastern United States and
523 Canada,
524 Collins, R. a. & Cruickshank, R.H., 2013. The seven deadly sins of DNA barcoding.
525 Molecular Ecology Resources, 13(6), pp.969–975.
526 Cortez, V.G., Baseia, I.G. & da Silveira, R.M.B., 2011. Two noteworthy Phallus from
527 southern Brazil. Mycoscience, 52, pp.436–438.
528 Courtecuisse, R., 2008. Current trends and perspectives for the global conservation of fungi.
529 In D. Moore et al., eds. Fungal conservation: issues and solutions. New York:
 89

530 Cambridge University Press, pp. 7–18.

531 Cunningham, G.H., 1944. The Gasteromycetes of Australia and New Zealand, Dunedin:
532 McIndoe.
533 Dahlberg, A., Genney, D.R. & Heilmann-Clausen, J., 2010. Developing a comprehensive
534 strategy for fungal conservation in Europe: current status and future needs. Fungal
535 Ecology, 3(2), pp.50–64.
536 Dahlberg, A. & Mueller, G.M., 2011. Applying IUCN red-listing criteria for assessing and
537 reporting on the conservation status of fungal species. Fungal Ecology, 4(2), pp.147–
538 162.
539 Darriba, D. et al., 2012. jModelTest 2: more models, new heuristics and parallel computing.
540 Nature Methods, 9(8), p.772.
541 Das, K., Singhi, S.K. & Calonge, F.D., 2007. Gasteromycetes of western Ghats, india: I. a
542 new form of Phallus Indusiatus. Boletin de la Sociedad Micologica de Madrid, 31,
543 pp.135–138.
544 Davis, C.C. et al., 2014. Long-term morphological stasis maintained by a plant-pollinator
545 mutualism. Proceedings of the National Academy of Sciences of the United States of
546 America, 111(16), pp.5914–9.
547 Degreef, J. et al., 2013. Two Rare Phallales Recorded from São Tomé Two rare Phallales
548 recorded from São Tomé. Cryptogamie Mycologie, 34(1), pp.3–13.
549 Demoulin, V. & Dring, D.M., 1975. Gasteromycetes of Kivu (Zaire), Rwanda and Burundi.
550 Bulletin du Jardin botanique national de Belgique, 45(3), pp.339–372.
551 Dennis, R.W.G., 1960. Fungi venezuelani: III. Kew Bulletin, 14(3), pp.418–458.
552 Dennis, R.W.G., 1953. Some West Indian Gasteromycetes. Kew Bulletin, 8(3), pp.307–328.
553 Desjardin, D.E. & Perry, B.A., 2009. A new species of Phallus from Sao Tome, Africa.
554 Mycologia, 101(4), pp.545–547.
555 Dissing, H. & Lange, M., 1962. Gasteromycetes of Congo. Bulletin du Jardin Botanique de
556 l’État a Bruxelles, 32(4), pp.325–416.
557 Dring, D.M., 1980. Contributions towards a Rational Arrangement of the Clathraceae. Kew
558 Bulletin, 35, pp.1–96.
559 Dring, D.M., 1964. Gasteromycetes of West Tropical Africa. Mycological Papers, 15(98),
560 pp.1–60.
561 Dring, D.M. & Rose, A.C., 1977. Additions to West African Phalloid Fungi. Kew Bulletin,
562 31(3), pp.741–751.
563 Drummond, A.J. et al., 2006. Relaxed phylogenetics and dating with confidence. PLoS
 90

564 Biology, 4(5), pp.699–710.

565 Drummond, A.J. & Rambaut, A., 2007. BEAST: Bayesian evolutionary analysis by sampling
566 trees. BMC evolutionary biology, 7, p.214.
567 Fearnside, P.M., 2005. Deforestation in Brazilian Amazonia: History, rates, and
568 consequences. Conservation Biology, 19(3), pp.680–688.
569 Fearnside, P.M., 2006. Desmatamento na Amazônia: dinâmica, impactos e controle. Acta
570 Amazonica, 36(3), pp.395–400.
571 Fischer, E., 1898. Phallineae. In A. Engler & K. Prantl, eds. Die natürlichen Pflanzenfamilien
572 nebst ihren Gattungen und wichtigeren Arten insbesondere der Nutzpflanzen. pp. 276–
573 296.
574 Fischer, V.E., 1933. Phallineae. In A. Engler & K. Prantl, eds. Die natürlichen
575 Pflanzenfamilien nebst ihren Gattungen und wichtigeren Arten insbesondere der
576 Nutzpflanzen.
577 Frankham, R. et al., 2012. Implications of different species concepts for conserving
578 biodiversity. Biological Conservation, 153, pp.25–31.
579 Geml, J. et al., 2006. Beringian origins and cryptic speciation events in the fly agaric
580 (Amanita muscaria). Molecular ecology, 15(1), pp.225–39.
581 Geml, J. et al., 2008. Evidence for strong inter- and intracontinental phylogeographic structure
582 in Amanita muscaria, a wind-dispersed ectomycorrhizal basidiomycete. Molecular
583 phylogenetics and evolution, 48(2), pp.694–701.
584 Gómez, L.D. & Gazis, R., 2006. Dos Gasteromycetes (Basidiomycotina, Fungi) del Perú.
585 Brenesia, 65, p.71.
586 Grummer, J. a., Bryson, R.W. & Reeder, T.W., 2014. Species delimitation using bayes
587 factors: Simulations and application to the Sceloporus scalaris species group (Squamata:
588 Phrynosomatidae). Systematic Biology, 63(2), pp.119–133.
589 Guzmán, G., Montoya, L. & Bandala, V.M., 1990. Las especies y formas de Dictyophora
590 (Fungi, Basidiomycetes, Phallales) en México y observaciones sobre su distribución en
591 América latina. Acta Botánica Mexicana, 9, pp.1–11.
592 Haddad, N.M. et al., 2015. Habitat fragmentation and its lasting impact on Earth’s
593 ecosystems. Science Advances, 1(2), pp.e1500052–e1500052.
594 Halling, R.E., Osmundson, T.W. & Neves, M.-A., 2008. Pacific boletes: implications for
595 biogeographic relationships. Mycological research, 112(Pt 4), pp.437–47.
596 Harder, C.B. et al., 2013. A three-gene phylogeny of the Mycena pura complex reveals 11
597 phylogenetic species and shows ITS to be unreliable for species identification. Fungal
 91

598 biology, 117(11-12), pp.764–75.

599 Hawksworth, D.L., 2001. The magnitude of fungal diversity: the 1.5 million species estimate
600 revisited*. Mycological Research, 105(12), pp.1422–1432.
601 Hawksworth, D.L. & Rossman, A.Y., 1997. Where Are All the Undescribed Fungi?
602 Phytopathology, 87(9), pp.887–891.
603 Heilmann-Clausen, J. et al., 2015. A fungal perspective on conservation biology.
604 Conservation Biology, 29(1), pp.61–68.
605 Heled, J. & Drummond, A.J., 2010. Bayesian Inference of Species Trees from Multilocus
606 Data. Molecular Biology and Evolution, 27(3), pp.570–580.
607 Hemmes, D.E. & Desjardin, D.E., 2009. Stinkhorns of the Hawaiian Islands. Fungi, 2(3),
608 pp.8–10.
609 Hibbett, D.S. & Hawksworth, D.L., 2007. After the gold rush, or before the flood?
610 Evolutionary morphology of mushroom-forming fungi (Agaricomycetes) in the early
611 21st century 5. Mycological Research, 111, pp.1001–1018.
612 Hosaka, K. et al., 2006. Molecular phylogenetics of the gomphoid-phalloid fungi with an
613 establishment of the new subclass Phallomycetidae and two new orders. Mycologia,
614 98(6), pp.949–59.
615 Hosaka, K., 2009. Phylogeography of the Genus Pisolithus Revisited with some Additional
616 Taxa from New Caledonia and Japan. Bulletin of the National Museum of Nature and …,
617 35(3), pp.151–167.
618 Hosaka, K., 2010. Preliminary List of Phallales (Phallomycetidae , Basidiomycota) in
619 Taiwan. Memoirs of the National Science Museum, 46, pp.57–64.
620 Hosaka, K., Castellano, M. a & Spatafora, J.W., 2008. Biogeography of Hysterangiales
621 (Phallomycetidae, Basidiomycota). Mycological research, 112(Pt 4), pp.448–62.
622 Huelsenbeck, J.P. & Ronquist, F., 2001. MRBAYES : Bayesian inference of phylogenetic
623 trees. Bioinformatics Applications Note, 17(8), pp.754–755.
624 Iofisidou, P. & Agerer, R., 2002. Die Rhizomorphen von Fastrosporium simplex und einige
625 Gedanken zur systematischen Stellung der Gastrosporiaceae (Hymenomycetes,
626 Basidiomycota). Feddes Repertorium, 113(1-2), pp.11–23.
627 Jargeat, P. et al., 2010. Phylogenetic species delimitation in ectomycorrhizal fungi and
628 implications for barcoding: the case of the Tricholoma scalpturatum complex
629 (Basidiomycota). Molecular ecology, 19(23), pp.5216–30.
630 Kass, R.E. & Raftery, A.E., 1995. Bayes Factors. Journal of the American Statistical
631 Association, 90(430), pp.773–795.
 92

632 Kasuya, T., 2008. Phallus luteus comb. nov., a new taxonomic treatment of a tropical phalloid
633 fungus. Mycotaxon, 106, pp.7–13.
634 Kasuya, T. et al., 2012. Phylogenetic placement of Geastrum melanocephalum and polyphyly
635 of Geastrum triplex. Mycoscience.
636 Kasuya, T., 2007. Validation of Aseroë coccinea (Phallales, Phallaceae). Mycoscience, 48,
637 pp.309–311.
638 Kibby, G. & McNeil, D., 2012. Phallus duplicatus new to Britain. Field Mycology, 13(3),
639 pp.86–89.
640 Kirk, P.M. et al., 2008. Dictionary of the Fungi 10th ed., Wallingford: CAB International.
641 Kornerup, A. & Wanscher, J.H., 1978. Methuen Handbook of Colours 3rd ed., London: Eyre
642 Methuen.
643 Kreisel, H., 1996. A preliminary survey of the genus Phallus sensu lato. Czech Mycology,
644 48(4), pp.273–281.
645 Kreisel, H. & Hausknecht, A., 2009. The gasteral Basidiomycetes of Mascarenes and
646 Seychelles 3. Some recent records. Österr. Z. Pilzk., 18, pp.149–159.
647 Leaché, A.D. et al., 2014. Species Delimitation using Genome-Wide SNP Data. Systematic
648 Biology, 63(4), pp.534–542.
649 Lee, C.E. & Frost, B.W., 2002. Morphological stasis in the Eurytemora affinis species
650 complex (Copepoda: Temoridae). Hydrobiologia, 480, pp.111–128.
651 Leite, A.G. et al., 2007. Espécies raras de Phallales (Agaricomycetidae, Basidiomycetes) no
652 Nordeste do Brasil. Acta Botanica Brasilica, 21(1), pp.119–124.
653 Li, H. et al., 2014. New species of Phallus from a subtropical forest in Xishuangbanna, China.
654 Phytotaxa, 163(2), pp.91–103.
655 Li, T.H. et al., 2005. A new species of Phalfus from China and P. formosanus, new the
656 mainland. Mycotaxon, 91, pp.309–314.
657 Li, T.H., Song, B. & Liu, B., 2002. Three taxa of Phallaceae in HMAS , China. Fungal
658 Diversity, 11, pp.123–127.
659 Li, Y., Jiao, L. & Yao, Y.J., 2013. Non-concerted ITS evolution in fungi, as revealed from the
660 important medicinal fungus Ophiocordyceps sinensis. Molecular Phylogenetics and
661 Evolution, 68(2), pp.373–379.
662 Lindner, D.L. & Banik, M.T., 2011. Intragenomic variation in the ITS rDNA region obscures
663 phylogenetic relationships and inflates estimates of operational taxonomic units in genus
664 Laetiporus. Mycologia, 103(4), pp.731–740.
665 Liu, B., 1984. The Gasteromycetes of China 76th ed., J. Cramer.
 93

666 Lloyd, C.G., 1909. Synopsis of the known phalloids. Bulletin of the Lloyd Library, 13, pp.1–
667 96.
668 Lücking, R. et al., 2014. Multiple ITS haplotypes in the genome of the lichenized
669 basidiomycete cora inversa (Hygrophoraceae): Fact or artifact? Journal of Molecular
670 Evolution, 78(2), pp.148–162.
671 Malhi, Y. et al., 2008. Climate change, deforestation, and the fate of the Amazon. Science
672 (New York, N.Y.), 319(5860), pp.169–72.
673 Marincowitz, S. et al., 2015. Phylogenetic placement of Itajahya: An unusual Jacaranda
674 fungal associate. IMA Fungus, 6(2), pp.257–262.
675 Martín, M.P. & Tabarés, M., 1994. Notas sobre Gasteromycetes II: Phallus duplicatus Bosc.
676 Revista Catalana de Micologia, pp.87–98.
677 Meyer, C.P. & Paulay, G., 2005. DNA barcoding: Error rates based on comprehensive
678 sampling. PLoS Biology, 3(12), pp.1–10.
679 Miller, O.K. & Miller, H.H., 1988. Gasteromycetes: morphological and developmental
680 features, with keys to the orders, families, and genera., Eureka, CA: Mad River Press.
681 Moncalvo, J. et al., 2002. One hundred and seventeen clades of euagarics. Molecular
682 Phylogenetics and Evolution, 23, pp.357–400.
683 Montagne, C., 1855. Cryptogamia Guayanensis. Annales des Sciences Naturelles, Botanique
684 Serie 4, 3, pp.91–144.
685 Mueller, G.M. et al., 2001. Assesing biogeographic relationchips between North American
686 and Chinese macrofungi. J. Biogeo., 28, pp.271–281.
687 Mueller, G.M. & Schmit, J.P., 2007. Fungal biodiversity: what do we know? What can we
688 predict? Biodiversity & Conservation, 16, pp.1–5.
689 Nylander, J.A.A., 2004. MrModeltest v2. Program distributed by the author.
690 Oliveira, M.L. & Morato, E.F., 2000. Stingless bees (Hymenoptera, Meliponini) feeding on
691 stinkhorn spores (Fungi, Phallales): robbery or dispersal? Revista Brasileira de Zoologia,
692 17(3), pp.881–884.
693 Ortega-Andrade, H.M. et al., 2015. Insights from Integrative Systematics Reveal Cryptic
694 Diversity in Pristimantis Frogs (Anura: Craugastoridae) from the Upper Amazon Basin.
695 PLoS ONE, 10(11), p.e0143392.
696 Ottoni, B.S.. et al., 2010. Phallus roseus, first record from the neotropics. mycota, 112, pp.5–
697 8.
698 Peterson, A.T. & Navarro-Sigüenza, A.G., 1999. Alternate species concepts as bases for
699 determining priority conservation areas. Conservation Biology, 13(2), pp.427–431.
 94

700 Pino-Bodas, R. et al., 2013. Species delimitation in Cladonia (Ascomycota): A challenge to

701 the DNA barcoding philosophy. Molecular Ecology Resources, 13(6), pp.1058–1068.
702 Rambaut, A., 2012. FigTree. Tree figure drawing tool.
703 Rambaut, A. et al., 2014. Tracer.
704 Rambaut, A. & Drummond, A.J., 2013. TreeAnnotator.
705 Ramirez-Lopez, I. et al., 2015. Thelephora versatilis and Thelephora pseudoversatilis: two
706 new cryptic species with polymorphic basidiomes inhabiting tropical deciduous and sub-
707 perennial forests of the Mexican Pacific coast. Mycologia, 107(2), pp.346–358.
708 Rebriev, Y.A., Pham, T.H.G. & Alexandrova, A. V., 2014. Phallus coronatus sp. nov. from
709 Vietnam. Mycotaxon, 127, pp.93–96.
710 Rozen, S. & Skaletsky, H.J., 2000. Primer3 on the WWW for general users and for biologist
711 programmers. In S. Krawetz & S. Misener, eds. Bioinformatics Methods and Protocols:
712 Methods in Molecular Biology. Totowa, New Jersey: Humana Press, pp. 365–386.
713 Saénz, J.A. & Nassar, M., 1982. Hongos de Costa Rica: Familias Phallaceae y Clathraceae.
714 Revista de Biología Tropical, 30(1), pp.41–52.
715 Saenz, J.A., Nassar, M. & Morales, M.., 1972. Contribution to the study of xylophallus
716 xylogenus. Mycol, 64, pp.510–520.
717 Schindel, D.E. & Miller, S.E., 2005. DNA barcoding a useful tool for taxonomists. Nature,
718 435(7038), p.17.
719 Schlechtendal, D., 1861. Eine neue Phalloidee, nebst Bemerkungen über die ganze Familie
720 derselben. Linnaea, 31, pp.101–194.
721 Schoch, C.L. et al., 2012. Nuclear ribosomal internal transcribed spacer (ITS) region as a
722 universal DNA barcode marker for Fungi. Proceedings of the National Academy of
723 Sciences, 109(16), pp.6241–6246.
724 Sheedy, E.M. et al., 2013. Multigene sequence data reveal morphologically cryptic
725 phylogenetic species within the genus Laccaria in southern Australia. Mycologia, 105(3),
726 pp.547–63.
727 da Silva, B.D.B. et al., 2015. Mutinus albotruncatus (Phallales, Agaricomycetes), a new
728 phalloid from the Brazilian semiarid, and a key to the world species. Phytotaxa, 236(3),
729 pp.237–248.
730 Smith, K.N., 2005. A Field Guide to the Fungi of Australia, Sidney, Australia: UNSW Press.
731 Stefani, F.O.P., Jones, R.H. & May, T.W., 2014. Concordance of seven gene genealogies
732 compared to phenotypic data reveals multiple cryptic species in Australian dermocyboid
733 Cortinarius (Agaricales). Molecular Phylogenetics and Evolution, 71(1), pp.249–260.
 95

734 Suwannasai, N. et al., 2013. Fungi in Thailand: A Case Study of the Efficacy of an ITS
735 Barcode for Automatically Identifying Species within the Annulohypoxylon and
736 Hypoxylon Genera. PLoS ONE, 8(2).
737 Swofford, D.L., 1998. PAUP*. Phylogenetic Analysis Using Parsimony (*and Other
738 Methods). Version 4.0 b., Sunderland, Massachusetts: Sinauer Associates.
739 Tedersoo, L. et al., 2014. Global diversity and geography of soil fungi. Science, 346(6213),
740 pp.1–10.
741 Trierveiler-Pereira, L., Gomes-Silva, A.C. & Baseia, I.G., 2009. Notes on gasteroid fungi in
742 the Brazilian Amazon rainforest. Mycotaxon, 110, pp.73–80.
743 Trierveiler-Pereira, L., Gomes-silva, A.C. & Baseia, I.G., 2011. Observations on gasteroid
744 Agaricomycetes from the Brazilian Amazon rainforest. Mycotaxon, 118, pp.273–282.
745 Trierveiler-Pereira, L. & Meijer, A., 2014. Updates on< i> Protubera</i>(Protophallaceae,
746 Phallales) and additional notes on< i> P. maracuja</i>. Mycoscience.
747 Trierveiler-Pereira, L., Silveira, R. & Hosaka, K., 2014. Multigene phylogeny of the Phallales
748 (Phallomycetidae, Agaricomycetes) focusing on some previously unrepresented genera.
749 Mycologia, 106(5), pp.904–911.
750 Trierveiler-Pereira, L. & da Silveira, R.M.B., 2012. Notes on Xylophallus xylogenus
751 (Phallaceae, Agaricomycetes) based on Brazilian specimens. Mycotaxon, 120, pp.309–
752 316.
753 Tuno, N., 1998. Spore dispersal of Dictyophora fungi (Phallaceae) by fies. Ecological
754 Research, 13, pp.7–15.
755 van Velzen, R. et al., 2012. DNA barcoding of recently diverged species: Relative
756 performance of matching methods. PLoS ONE, 7(1).
757 Ventenat, E.P., 1798. Dissertation sur le genre Phallus. Mémoires de l’institut National des
758 Sciences et Arts, 1, pp.503–523.
759 Webster, J. & Weber, R., 2007. Webster J, Weber RWS (2007) Introduction to fungi, 3rd edn.
760 Cambridge University Press, New York 3rd ed., New York: Cambridge University Press.
761 White, T.J. et al., 1990. Amplification and direct sequencing of fungal ribosomal RNA genes
762 for phylogenetics. In M. A. Innis, D. H. Sninsky, & T. J. White, eds. PCR protocols: A
763 Guide to Methods and Applications.
764 Whittaker, R., 1959. On the broad classification of organisms. Quarterly Review of Biology,
765 34, pp.210–226.
766 Wilson, A.W., Binder, M. & Hibbett, D.S., 2011. Effects of gasteroid fruiting body
767 morphology on diversification rates in three independent clades of fungi estimated using
 96

768 binary state speciation and extinction analysis. Evolution; international journal of
769 organic evolution, 65(5), pp.1305–22.
770 Yang, Z. & Rannala, B., 2014. Unguided species delimitation using DNA sequence data from
771 multiple loci. , pp.1–27.
772 Zamora, J.C. et al., 2014. Systematics of the genus Geastrum (Fungi: Basidiomycota)
773 revisited. Taxon, 63(3), pp.477–497.
774 Zamora, J.C., Calonge, F.D. & Mart??n, M.P., 2013. New sources of taxonomic information
775 for earthstars (Geastrum, Geastraceae, Basidiomycota): Phenoloxidases and rhizomorph
776 crystals. Phytotaxa, 132(1), pp.1–20.
777 Zang, M., Zheng, D. & Hu, Z., 1988. A new species of the genus Dictyophora from China.
778 Mycotaxon, 33, pp.145–148.
779 Zhao, R.-L. et al., 2008. A new species of bird’s nest fungi: characterisation of Cyathus
780 subglobisporus sp. nov. based on morphological and molecular data. Persoonia, 21,
781 pp.71–6.
782
783
784
785 TABLE 01. The collection localities, herbarium vouchers and Genbank accession numbers of
786 specimens collected in this study.
Species Locality Herbarium voucher Genbank accession
number

P. amazonicus Brazil, Pará, Belterra INPA264928

TSC121

Brazil, Amazonas, Novo Airão INPA264935

TSC202

Brazil, Amazonas, Parintins TSC248

Brazil, Amazonas, Parintins TSC250

Brazil, Amazonas, Parintins TSC253

Brazil, Amazonas, Parintins TSC255

Brazil, Amazonas, Barcelos TSC264

 97

Brazil, Amazonas, Barcelos TSC265

Brazil, Amazonas, Barcelos TSC266

Brazil, Pará, Belterra INPA264933

TSC188

Brazil, Pará, Belterra TSC192

P. amazonicus var. Brazil, Amazonas, Maraã TSC115

denigricans

Brazil, Amazonas, São Gabriel da DLK1119

Cachoeira

P. purpurascens Brazil, Amazonas, Manaus TSC234

Brazil, Mato Grosso, Sinop SINOP26

Brazil, Mato Grosso, Sinop SINOP27

Brazil, Mato Grosso, Sinop SINOP28

Brazil, Mato Grosso, Sinop SINOP30

P. squamulosus Brazil, Rio Grande do Norte, Baía DT 253

Formosa

P. indusiatus Brazil, Pará, Belterra TSC135

Brazil, Pará, Belterra TSC136

Brazil, Pará, Belterra TSC148

Brazil, São Paulo, São Paulo SP416387

Brazil, São Paulo, São Paulo SP416389

Brazil, São Paulo, São Paulo SP416393

P. indusiatus f. rosea Brazil, Paraná, Palotina

Dictyophora KHCAM10143
 98

Dictyophora Thailand KH_TH09_097

Dictyophora Thailand KHTH09070

Dictyophora KHCAM10033

Dictyophora indusiata Japan KHJPN08052

Phallus Japan KHJPN09553

Phallus Japan KHJPN10304

Phallus NR_119579

Phallus Japan KHJPN121965

Phallus Japan, Ibaraki, Tsukuba KHTBG130925

Phallus Japan, Ibaraki, Tsukuba KHTBG121403

Phallus Japan KHJPN11468

Phallus Japan KHJPN13940

Phallus coronatus Vietnam LE 295238

Phallus echinatus 204 Vietnam VN-12-221

Phallus flavocostatus Russia, Altai Kray RE2004

Phallus hadriani Russia, Rostov region, Volgodonsk RE180

Phallus impudicus Japan, Ibaraki, Tsukuba KHTBG121224

Phallus impudicus Japan, Ibaraki, Tsukuba KHTBG11880

Phallus impudicus Japan, Ibaraki, Tsukuba KHTBG121423

Phallus impudicus KHTW08001

Mutinus sp. Japan, Ibaraki, Tsukuba KHTBG11449

Mutinus sp. New Caledonia KHNC11143

Mutinus sp. Japan KHJPN11372

787
 99

788
789
790

791

792
 100

Síntese
Em uma abordagem envolvendo delimitação de espécies e filogenia molecular baseada em
DNA, aliados a dados morfológicos e de distribuição geográfica, os capítulos aqui
apresentados revelaram uma fração da diversidade de fungos faloides encontrados
principalmente em ambientes de floresta Amazônica, em sua maioria em áreas de floresta
primária.
No primeiro capítulo uma espécie nova (Geastrum inpaense) e novos registros de fungos
gasteroides são descritos: seis espécies constituem novos registros para Amazônia Central
(Geastrum lloydianum, G. schweinitzii, Phallus merulinus, Staheliomyces cinctus), uma para
Brazil (Phallus atrovolvatus) e uma para América do Sul (Mutinus fleischeri). O segundo
capítulo descreve dois novos registros de fungos faloides para o Brasil (Lysurus
arachnoideus) e América do Sul (Phallus cinnbarinus), disponibilizando descrições
morfológicas detalhadas e fotos, além de sequências da região ITS.
No terceiro capítulo foi estudada a diversidade dentro do gênero Xylophallus. A
reconstrução filogenética utilizando genes de proteínas mostraram a presença de duas
unidades evolutivas, o que foi compatível com os dados morfológicos que mostravam a
existência de duas morfoespécies. Por outro lado, o barcode de fungos (ITS) revelou a
presença de um terceiro clado, com espécimes com distribuição restrita à bacia do rio
Madeira. Já o método de delimitação de espécies por distância genética mostrou-se falho para
os cinco genes testados, e por isso outro método foi aplicado, o teste de modelos por fator de
Bayes. A árvore de espécies foi construída a partir das árvores de genes para dois cenários:
um considerando duas espécies e outro considerando três espécies. Esses modelos foram
comparados utilizando fatores de Bayes, e o modelo com 3 espécies apresentou maior
probabilidade de ser o correto. Esses resultados revelaram que o gênero Xylophallus é
composto por no mínimo três espécies, sendo uma espécie nova (X. clavatus) e uma
conhecida (X. xylogenus). A terceira espécie forma um clado irmão desta última, mas por não
terem sido encontradas diferenças morfológicas entre as duas, acredita-se tratar de uma
espécie críptica. Xylophallus xylogenus e a espécie críptica apresentam diferenças na
distribuição geográfica. Enquanto X. xylogenus parece estar bem distribuído pelo norte da
América do Sul, a espécie críptica parece estar restrita à bacia do baixo rio Madeira.
Entretanto, não foi possível estabelecer uma hipótese biogeográfica para explicar os eventos
de especiação dentro do gênero.
 101

No quarto capítulo foi avaliada a diversidade morfológica e molecular de Phallus

indusiatus sensu lato coletadas na Amazônia brasileira. A árvore filogenética obtida com
sequências de ITS revelou quatro clados distintos que possuiam concordância com os dados
morfológicos. Um clado corresponde a Phallus indusiatus Vent., onde os espécimes
apresentam caracteres morfológicos iguais ou bem próximos a descrição original. Os outros
três clados possuem características distintas de P. indusiatus e quaisquer outras espécies com
indúsio branco, correspondendo, portanto, a três novas espécies. Uma dessas novas espécies,
P. amazonicus, possui também uma variedade nova, P. amazonicus var. denigricans
diferenciada principalmente pela coloração escura da volva. Este clado é formado por
espécimes exclusivamente amazônicas, até o momento restrito à floresta madura. Um terceiro
clado corresponde a P. squamulosus, que é caracterizada pela volva com superfície escamosa.
Este clado é formado por um único espécime da Mata Atlântica, especificamente de floresta
semidecidual com solo arenoso. É uma área onde a micobiota vem sido frequentemente
estudada e que vem revelando novas espécies de fungos gasteroides. O quarto clado, P.
purpurascens, é a espécie mais distinta, sendo a maior entre as espécies citadas, possui volva
branca a lilás, reticulações do receptáculo estreitas e esporos menores que as demais espécies.
Os espécimes desse clado foram coletados em Manaus (AM) e Sinop (MT), ambos em áreas
de floresta Amazônica. Dado o número de espécies novas encontras entre espécies
semelhantes a Phallus indusiatus, acredita-se que P. indusiatus deve ser composto por várias
unidade evolutivas diferentes. Por isso, mais estudos precisam ser realizados, envolvendo
tanto coletas em áreas sub-amostradas quanto a inclusão de espécimes depositados em
herbários sob o nome de P. indusiatus. Assim será possível esclarecer a sistemática e
evolução deste grupo, assim como padrões de dispersão biogeográfica poderão ser observados
em nível mundial.
O presente trabalho consiste em uma contribuição no entendimento da diversidade e
evolução de fungos da ordem Phallales. Ao todo, 13 espécies de fungos faloides foram
descritas para a Amazônia, sendo 4 destas novas para a ciência. Este número reflete a falta de
estudos deste grupo para áreas de florestas Neotropicais, especialmente para a Amazônia,
como também reflete as estimativas de Tedersoo et al. (2014) sobre a diversidade global de
fungos, que é maior em florestas tropicais. A continuidade de estudos com próposito de
acessar a diversidade de fungos em ambientes pouco explorados é de extrema importância,
principalmente em áreas que sofrem intensa pressão antrópica. As espécies do gênero
Xylophallus são endêmicas de florestas Neotropicais, e a espécie críptica do gênero
aparentemente possui distribuição geográfica ainda mais restrita. O mesmo ocorre com
 102

Staheliomyces cinctus, um fungo faloide que também está restrito a florestas Neotropicais.
Duas espécies novas de Phallus também parecem ser restritas a Amazônia até o momento.
Essas espécies podem estar susceptíveis aos efeitos da fragmentação de habitat, que é uma
ameaça constante na Amazônia.
O presente trabalho também evidencia a importância da inclusão de dados moleculares no
estudo de taxonomia e sistemática de fungos. Apesar das diferenças encontradas entre as
espécies aqui descritas, uma delimitação clara só pôde ser atingida ao se utilizar dados de
filogenia molecular. Um exemplo é a presença de uma espécie críptica em Xylophallus, que
difere apenas na sua distribuição geográfica, e portanto só pôde ser detectada analisando
regiões gênicas. Também, foi possível delimitar a espécie Phallus indusiatus, que, por ter sido
descrita em 1798, ainda deixava dúvidas quanto a identidade da espécie. Da mesma forma,
outras 3 espécies e uma variedade de Phallus com indúsio branco também foram detectadas, e
que poderiam ser morfologicamente confundidas com P. indusiatus. Entretanto, é importante
levar em consideração o uso de métodos alternativos de delimitação de espécies, e testar
diferentes regiões gênicas além de ITS.
 103

Referências Bibliográficas
Agapow, P.M. et al., 2004. The Impact of Species Concept on Biodiversity Studies. The
Quarterly Review of Biology, 79(2), pp.161–179.
Anon, IBGE – Instituto Brasileiro de Geografia e Estatística. Available at:
http://www.ibge.gov.br [Accessed April 5, 2016].
Arnold, A.E. & Lutzoni, F., 2007. Diversity and Host Range of Foliar Fungal Endophytes: are
tropical leaves biodiversity hotspots? Ecology, 88(3), pp.541–549.
Baseia, I.G. & Calonge, F.D., 2005. Aseroë floriformis, a new phalloid with a sunflower-
shaped receptacle. Mycotaxon, 92, pp.169–172.
Baseia, I.G., Gibertoni, T.B. & Maia, L.C., 2003. Phallus pygmaeus, a new minute species
from a Brazilian Tropical Rainforest. Mycotaxon, 85, pp.77–79.
Baseia, I.G., Maia, L.C. & Calonge, 2006. Notes on Phallales in the Neotropics. Boletin de la
Sociedad Micologica de Madrid, 30, pp.87–93.
Begerow, D. et al., 2010. Current state and perspectives of fungal DNA barcoding and rapid
identification procedures. Applied microbiology and biotechnology, 87(1), pp.99–108.
Begerow, D., Stoll, M. & Bauer, R., 2006. A phylogenetic hypothesis of Ustilaginomycotina
based on multiple gene analyses and morphological data. Mycologia, 98(6), pp.906–916.
Bellanger, J.-M. et al., 2015. Plunging hands into the mushroom jar: a phylogenetic
framework for Lyophyllaceae (Agaricales, Basidiomycota),
Bickford, D. et al., 2007. Cryptic species as a window on diversity and conservation. Trends
in Ecology & Evolution, 22(3), pp.148–155.
Brown, S.D.J. et al., 2012. Spider: an R package for the analysis of species identity and
evolution, with particular reference to DNA barcoding. Molecular ecology resources,
12(3), pp.562–5.
Bryson, R.W. et al., 2014. Multilocus species delimitation in the Crotalus triseriatus species
group (Serpentes: Viperidae: Crotalinae), with the description of two new species.
Zootaxa, 3826(3), pp.475–496.
Cabral, T.S. et al., 2012. Abrachium, a new genus in the Clathraceae, and Itajahya reassessed.
Mycotaxon, 119, pp.419–429.
Calonge, F.D., 2005. A tentative key to identify the species of Phallus. Boletin de la Sociedad
Micologica de Madrid, 29, pp.9–18.
Calonge, F.D. & Kreisel, H., 2002. Phallus minusculus sp. nova from Tropical Africa. Feddes
Repertorium, 113, pp.600–602.
Calonge, F.D., Kreisel, H. & Mata, M., 2005. Phallus atrovolvatus, a new species from Costa
 104

Rica. Boletin de la Sociedad Micologica de Madrid, 29, pp.5–8.

Calonge, F.D., Mata, M. & Carranza, J., 2005. Contribución al catálogo de los
Gasteromycetes (Basidiomycotina, Fungi) de Costa Rica. Anales del Jardín Botánico de
Madrid, 62(1), pp.23–45.
Cheype, J., 2010. Phallaceae et Clathrus récoltés en Guyane Française. Bulletin Mycologique
et Botanique Dauphiné-Savoie, 66, pp.51–66.
Coker, W.C. & Couch, J.N., 1928. The Gasteromycetes of the Eastern United States and
Canada,
Collins, R. a. & Cruickshank, R.H., 2013. The seven deadly sins of DNA barcoding.
Molecular Ecology Resources, 13(6), pp.969–975.
Cortez, V.G., Baseia, I.G. & da Silveira, R.M.B., 2011. Two noteworthy Phallus from
southern Brazil. Mycoscience, 52, pp.436–438.
Courtecuisse, R., 2008. Current trends and perspectives for the global conservation of fungi.
In D. Moore et al., eds. Fungal conservation: issues and solutions. New York:
Cambridge University Press, pp. 7–18.
Cunningham, G.H., 1944. The Gasteromycetes of Australia and New Zealand, Dunedin:
McIndoe.
Dahlberg, A., Genney, D.R. & Heilmann-Clausen, J., 2010. Developing a comprehensive
strategy for fungal conservation in Europe: current status and future needs. Fungal
Ecology, 3(2), pp.50–64.
Dahlberg, A. & Mueller, G.M., 2011. Applying IUCN red-listing criteria for assessing and
reporting on the conservation status of fungal species. Fungal Ecology, 4(2), pp.147–
162.
Darriba, D. et al., 2012. jModelTest 2: more models, new heuristics and parallel computing.
Nature Methods, 9(8), p.772.
Das, K., Singhi, S.K. & Calonge, F.D., 2007. Gasteromycetes of western Ghats, india: I. a
new form of Phallus Indusiatus. Boletin de la Sociedad Micologica de Madrid, 31,
pp.135–138.
Davis, C.C. et al., 2014. Long-term morphological stasis maintained by a plant-pollinator
mutualism. Proceedings of the National Academy of Sciences of the United States of
America, 111(16), pp.5914–9.
Degreef, J. et al., 2013. Two Rare Phallales Recorded from São Tomé Two rare Phallales
recorded from São Tomé. Cryptogamie Mycologie, 34(1), pp.3–13.
Demoulin, V. & Dring, D.M., 1975. Gasteromycetes of Kivu (Zaire), Rwanda and Burundi.
 105

Bulletin du Jardin botanique national de Belgique, 45(3), pp.339–372.

Dennis, R.W.G., 1960. Fungi venezuelani: III. Kew Bulletin, 14(3), pp.418–458.
Dennis, R.W.G., 1953. Some West Indian Gasteromycetes. Kew Bulletin, 8(3), pp.307–328.
Desjardin, D.E. & Perry, B.A., 2009. A new species of Phallus from Sao Tome, Africa.
Mycologia, 101(4), pp.545–547.
Dissing, H. & Lange, M., 1962. Gasteromycetes of Congo. Bulletin du Jardin Botanique de
l’État a Bruxelles, 32(4), pp.325–416.
Dring, D.M., 1980. Contributions towards a Rational Arrangement of the Clathraceae. Kew
Bulletin, 35, pp.1–96.
Dring, D.M., 1964. Gasteromycetes of West Tropical Africa. Mycological Papers, 15(98),
pp.1–60.
Dring, D.M. & Rose, A.C., 1977. Additions to West African Phalloid Fungi. Kew Bulletin,
31(3), pp.741–751.
Drummond, A.J. et al., 2006. Relaxed phylogenetics and dating with confidence. PLoS
Biology, 4(5), pp.699–710.
Drummond, A.J. & Rambaut, A., 2007. BEAST: Bayesian evolutionary analysis by sampling
trees. BMC evolutionary biology, 7, p.214.
Fearnside, P.M., 2005. Deforestation in Brazilian Amazonia: History, rates, and
consequences. Conservation Biology, 19(3), pp.680–688.
Fearnside, P.M., 2006. Desmatamento na Amazônia: dinâmica, impactos e controle. Acta
Amazonica, 36(3), pp.395–400.
Fischer, E., 1898. Phallineae. In A. Engler & K. Prantl, eds. Die natürlichen Pflanzenfamilien
nebst ihren Gattungen und wichtigeren Arten insbesondere der Nutzpflanzen. pp. 276–
296.
Fischer, V.E., 1933. Phallineae. In A. Engler & K. Prantl, eds. Die natürlichen
Pflanzenfamilien nebst ihren Gattungen und wichtigeren Arten insbesondere der
Nutzpflanzen.
Frankham, R. et al., 2012. Implications of different species concepts for conserving
biodiversity. Biological Conservation, 153, pp.25–31.
Geml, J. et al., 2006. Beringian origins and cryptic speciation events in the fly agaric
(Amanita muscaria). Molecular ecology, 15(1), pp.225–39.
Geml, J. et al., 2008. Evidence for strong inter- and intracontinental phylogeographic structure
in Amanita muscaria, a wind-dispersed ectomycorrhizal basidiomycete. Molecular
phylogenetics and evolution, 48(2), pp.694–701.
 106

Gómez, L.D. & Gazis, R., 2006. Dos Gasteromycetes (Basidiomycotina, Fungi) del Perú.
Brenesia, 65, p.71.
Grummer, J. a., Bryson, R.W. & Reeder, T.W., 2014. Species delimitation using bayes
factors: Simulations and application to the Sceloporus scalaris species group (Squamata:
Phrynosomatidae). Systematic Biology, 63(2), pp.119–133.
Guzmán, G., Montoya, L. & Bandala, V.M., 1990. Las especies y formas de Dictyophora
(Fungi, Basidiomycetes, Phallales) en México y observaciones sobre su distribución en
América latina. Acta Botánica Mexicana, 9, pp.1–11.
Haddad, N.M. et al., 2015. Habitat fragmentation and its lasting impact on Earth’s
ecosystems. Science Advances, 1(2), pp.e1500052–e1500052.
Halling, R.E., Osmundson, T.W. & Neves, M.-A., 2008. Pacific boletes: implications for
biogeographic relationships. Mycological research, 112(Pt 4), pp.437–47.
Harder, C.B. et al., 2013. A three-gene phylogeny of the Mycena pura complex reveals 11
phylogenetic species and shows ITS to be unreliable for species identification. Fungal
biology, 117(11-12), pp.764–75.
Hawksworth, D.L., 2001. The magnitude of fungal diversity: the 1.5 million species estimate
revisited*. Mycological Research, 105(12), pp.1422–1432.
Hawksworth, D.L. & Rossman, A.Y., 1997. Where Are All the Undescribed Fungi?
Phytopathology, 87(9), pp.887–891.
Heilmann-Clausen, J. et al., 2015. A fungal perspective on conservation biology.
Conservation Biology, 29(1), pp.61–68.
Heled, J. & Drummond, A.J., 2010. Bayesian Inference of Species Trees from Multilocus
Data. Molecular Biology and Evolution, 27(3), pp.570–580.
Hemmes, D.E. & Desjardin, D.E., 2009. Stinkhorns of the Hawaiian Islands. Fungi, 2(3),
pp.8–10.
Hibbett, D.S. & Hawksworth, D.L., 2007. After the gold rush, or before the flood?
Evolutionary morphology of mushroom-forming fungi (Agaricomycetes) in the early
21st century 5. Mycological Research, 111, pp.1001–1018.
Hosaka, K. et al., 2006. Molecular phylogenetics of the gomphoid-phalloid fungi with an
establishment of the new subclass Phallomycetidae and two new orders. Mycologia,
98(6), pp.949–59.
Hosaka, K., 2009. Phylogeography of the Genus Pisolithus Revisited with some Additional
Taxa from New Caledonia and Japan. Bulletin of the National Museum of Nature and …,
35(3), pp.151–167.
 107

Hosaka, K., 2010. Preliminary List of Phallales (Phallomycetidae , Basidiomycota) in

Taiwan. Memoirs of the National Science Museum, 46, pp.57–64.
Hosaka, K., Castellano, M. a & Spatafora, J.W., 2008. Biogeography of Hysterangiales
(Phallomycetidae, Basidiomycota). Mycological research, 112(Pt 4), pp.448–62.
Huelsenbeck, J.P. & Ronquist, F., 2001. MRBAYES : Bayesian inference of phylogenetic
trees. Bioinformatics Applications Note, 17(8), pp.754–755.
Iofisidou, P. & Agerer, R., 2002. Die Rhizomorphen von Fastrosporium simplex und einige
Gedanken zur systematischen Stellung der Gastrosporiaceae (Hymenomycetes,
Basidiomycota). Feddes Repertorium, 113(1-2), pp.11–23.
Jargeat, P. et al., 2010. Phylogenetic species delimitation in ectomycorrhizal fungi and
implications for barcoding: the case of the Tricholoma scalpturatum complex
(Basidiomycota). Molecular ecology, 19(23), pp.5216–30.
Kass, R.E. & Raftery, A.E., 1995. Bayes Factors. Journal of the American Statistical
Association, 90(430), pp.773–795.
Kasuya, T., 2008. Phallus luteus comb. nov., a new taxonomic treatment of a tropical phalloid
fungus. Mycotaxon, 106, pp.7–13.
Kasuya, T. et al., 2012. Phylogenetic placement of Geastrum melanocephalum and polyphyly
of Geastrum triplex. Mycoscience.
Kasuya, T., 2007. Validation of Aseroë coccinea (Phallales, Phallaceae). Mycoscience, 48,
pp.309–311.
Kibby, G. & McNeil, D., 2012. Phallus duplicatus new to Britain. Field Mycology, 13(3),
pp.86–89.
Kirk, P.M. et al., 2008. Dictionary of the Fungi 10th ed., Wallingford: CAB International.
Kornerup, A. & Wanscher, J.H., 1978. Methuen Handbook of Colours 3rd ed., London: Eyre
Methuen.
Kreisel, H., 1996. A preliminary survey of the genus Phallus sensu lato. Czech Mycology,
48(4), pp.273–281.
Kreisel, H. & Hausknecht, A., 2009. The gasteral Basidiomycetes of Mascarenes and
Seychelles 3. Some recent records. Österr. Z. Pilzk., 18, pp.149–159.
Leaché, A.D. et al., 2014. Species Delimitation using Genome-Wide SNP Data. Systematic
Biology, 63(4), pp.534–542.
Lee, C.E. & Frost, B.W., 2002. Morphological stasis in the Eurytemora affinis species
complex (Copepoda: Temoridae). Hydrobiologia, 480, pp.111–128.
Leite, A.G. et al., 2007. Espécies raras de Phallales (Agaricomycetidae, Basidiomycetes) no
 108

Nordeste do Brasil. Acta Botanica Brasilica, 21(1), pp.119–124.

Li, H. et al., 2014. New species of Phallus from a subtropical forest in Xishuangbanna, China.
Phytotaxa, 163(2), pp.91–103.
Li, T.H. et al., 2005. A new species of Phalfus from China and P. formosanus, new the
mainland. Mycotaxon, 91, pp.309–314.
Li, T.H., Song, B. & Liu, B., 2002. Three taxa of Phallaceae in HMAS , China. Fungal
Diversity, 11, pp.123–127.
Li, Y., Jiao, L. & Yao, Y.J., 2013. Non-concerted ITS evolution in fungi, as revealed from the
important medicinal fungus Ophiocordyceps sinensis. Molecular Phylogenetics and
Evolution, 68(2), pp.373–379.
Lindner, D.L. & Banik, M.T., 2011. Intragenomic variation in the ITS rDNA region obscures
phylogenetic relationships and inflates estimates of operational taxonomic units in genus
Laetiporus. Mycologia, 103(4), pp.731–740.
Liu, B., 1984. The Gasteromycetes of China 76th ed., J. Cramer.
Lloyd, C.G., 1909. Synopsis of the known phalloids. Bulletin of the Lloyd Library, 13, pp.1–
96.
Lücking, R. et al., 2014. Multiple ITS haplotypes in the genome of the lichenized
basidiomycete cora inversa (Hygrophoraceae): Fact or artifact? Journal of Molecular
Evolution, 78(2), pp.148–162.
Malhi, Y. et al., 2008. Climate change, deforestation, and the fate of the Amazon. Science
(New York, N.Y.), 319(5860), pp.169–72.
Marincowitz, S. et al., 2015. Phylogenetic placement of Itajahya: An unusual Jacaranda
fungal associate. IMA Fungus, 6(2), pp.257–262.
Martín, M.P. & Tabarés, M., 1994. Notas sobre Gasteromycetes II: Phallus duplicatus Bosc.
Revista Catalana de Micologia, pp.87–98.
Meyer, C.P. & Paulay, G., 2005. DNA barcoding: Error rates based on comprehensive
sampling. PLoS Biology, 3(12), pp.1–10.
Miller, O.K. & Miller, H.H., 1988. Gasteromycetes: morphological and developmental
features, with keys to the orders, families, and genera., Eureka, CA: Mad River Press.
Moncalvo, J. et al., 2002. One hundred and seventeen clades of euagarics. Molecular
Phylogenetics and Evolution, 23, pp.357–400.
Montagne, C., 1855. Cryptogamia Guayanensis. Annales des Sciences Naturelles, Botanique
Serie 4, 3, pp.91–144.
Mueller, G.M. et al., 2001. Assesing biogeographic relationchips between North American
 109

and Chinese macrofungi. J. Biogeo., 28, pp.271–281.

Mueller, G.M. & Schmit, J.P., 2007. Fungal biodiversity: what do we know? What can we
predict? Biodiversity & Conservation, 16, pp.1–5.
Nylander, J.A.A., 2004. MrModeltest v2. Program distributed by the author.
Oliveira, M.L. & Morato, E.F., 2000. Stingless bees (Hymenoptera, Meliponini) feeding on
stinkhorn spores (Fungi, Phallales): robbery or dispersal? Revista Brasileira de Zoologia,
17(3), pp.881–884.
Ortega-Andrade, H.M. et al., 2015. Insights from Integrative Systematics Reveal Cryptic
Diversity in Pristimantis Frogs (Anura: Craugastoridae) from the Upper Amazon Basin.
PLoS ONE, 10(11), p.e0143392.
Ottoni, B.S.. et al., 2010. Phallus roseus, first record from the neotropics. mycota, 112, pp.5–
8.
Peterson, A.T. & Navarro-Sigüenza, A.G., 1999. Alternate species concepts as bases for
determining priority conservation areas. Conservation Biology, 13(2), pp.427–431.
Pino-Bodas, R. et al., 2013. Species delimitation in Cladonia (Ascomycota): A challenge to
the DNA barcoding philosophy. Molecular Ecology Resources, 13(6), pp.1058–1068.
Rambaut, A., 2012. FigTree. Tree figure drawing tool.
Rambaut, A. et al., 2014. Tracer.
Rambaut, A. & Drummond, A.J., 2013. TreeAnnotator.
Ramirez-Lopez, I. et al., 2015. Thelephora versatilis and Thelephora pseudoversatilis: two
new cryptic species with polymorphic basidiomes inhabiting tropical deciduous and sub-
perennial forests of the Mexican Pacific coast. Mycologia, 107(2), pp.346–358.
Rebriev, Y.A., Pham, T.H.G. & Alexandrova, A. V., 2014. Phallus coronatus sp. nov. from
Vietnam. Mycotaxon, 127, pp.93–96.
Rozen, S. & Skaletsky, H.J., 2000. Primer3 on the WWW for general users and for biologist
programmers. In S. Krawetz & S. Misener, eds. Bioinformatics Methods and Protocols:
Methods in Molecular Biology. Totowa, New Jersey: Humana Press, pp. 365–386.
Saénz, J.A. & Nassar, M., 1982. Hongos de Costa Rica: Familias Phallaceae y Clathraceae.
Revista de Biología Tropical, 30(1), pp.41–52.
Saenz, J.A., Nassar, M. & Morales, M.., 1972. Contribution to the study of xylophallus
xylogenus. Mycol, 64, pp.510–520.
Schindel, D.E. & Miller, S.E., 2005. DNA barcoding a useful tool for taxonomists. Nature,
435(7038), p.17.
Schlechtendal, D., 1861. Eine neue Phalloidee, nebst Bemerkungen über die ganze Familie
 110

derselben. Linnaea, 31, pp.101–194.

Schoch, C.L. et al., 2012. Nuclear ribosomal internal transcribed spacer (ITS) region as a
universal DNA barcode marker for Fungi. Proceedings of the National Academy of
Sciences, 109(16), pp.6241–6246.
Sheedy, E.M. et al., 2013. Multigene sequence data reveal morphologically cryptic
phylogenetic species within the genus Laccaria in southern Australia. Mycologia, 105(3),
pp.547–63.
da Silva, B.D.B. et al., 2015. Mutinus albotruncatus (Phallales, Agaricomycetes), a new
phalloid from the Brazilian semiarid, and a key to the world species. Phytotaxa, 236(3),
pp.237–248.
Smith, K.N., 2005. A Field Guide to the Fungi of Australia, Sidney, Australia: UNSW Press.
Stefani, F.O.P., Jones, R.H. & May, T.W., 2014. Concordance of seven gene genealogies
compared to phenotypic data reveals multiple cryptic species in Australian dermocyboid
Cortinarius (Agaricales). Molecular Phylogenetics and Evolution, 71(1), pp.249–260.
Suwannasai, N. et al., 2013. Fungi in Thailand: A Case Study of the Efficacy of an ITS
Barcode for Automatically Identifying Species within the Annulohypoxylon and
Hypoxylon Genera. PLoS ONE, 8(2).
Swofford, D.L., 1998. PAUP*. Phylogenetic Analysis Using Parsimony (*and Other
Methods). Version 4.0 b., Sunderland, Massachusetts: Sinauer Associates.
Tedersoo, L. et al., 2014. Global diversity and geography of soil fungi. Science, 346(6213),
pp.1–10.
Trierveiler-Pereira, L., Gomes-Silva, A.C. & Baseia, I.G., 2009. Notes on gasteroid fungi in
the Brazilian Amazon rainforest. Mycotaxon, 110, pp.73–80.
Trierveiler-Pereira, L., Gomes-silva, A.C. & Baseia, I.G., 2011. Observations on gasteroid
Agaricomycetes from the Brazilian Amazon rainforest. Mycotaxon, 118, pp.273–282.
Trierveiler-Pereira, L. & Meijer, A., 2014. Updates on< i> Protubera</i>(Protophallaceae,
Phallales) and additional notes on< i> P. maracuja</i>. Mycoscience.
Trierveiler-Pereira, L., Silveira, R. & Hosaka, K., 2014. Multigene phylogeny of the Phallales
(Phallomycetidae, Agaricomycetes) focusing on some previously unrepresented genera.
Mycologia, 106(5), pp.904–911.
Trierveiler-Pereira, L. & da Silveira, R.M.B., 2012. Notes on Xylophallus xylogenus
(Phallaceae, Agaricomycetes) based on Brazilian specimens. Mycotaxon, 120, pp.309–
316.
Tuno, N., 1998. Spore dispersal of Dictyophora fungi (Phallaceae) by fies. Ecological
 111

Research, 13, pp.7–15.

van Velzen, R. et al., 2012. DNA barcoding of recently diverged species: Relative
performance of matching methods. PLoS ONE, 7(1).
Ventenat, E.P., 1798. Dissertation sur le genre Phallus. Mémoires de l’institut National des
Sciences et Arts, 1, pp.503–523.
Webster, J. & Weber, R., 2007. Webster J, Weber RWS (2007) Introduction to fungi, 3rd edn.
Cambridge University Press, New York 3rd ed., New York: Cambridge University Press.
White, T.J. et al., 1990. Amplification and direct sequencing of fungal ribosomal RNA genes
for phylogenetics. In M. A. Innis, D. H. Sninsky, & T. J. White, eds. PCR protocols: A
Guide to Methods and Applications.
Whittaker, R., 1959. On the broad classification of organisms. Quarterly Review of Biology,
34, pp.210–226.
Wilson, A.W., Binder, M. & Hibbett, D.S., 2011. Effects of gasteroid fruiting body
morphology on diversification rates in three independent clades of fungi estimated using
binary state speciation and extinction analysis. Evolution; international journal of
organic evolution, 65(5), pp.1305–22.
Yang, Z. & Rannala, B., 2014. Unguided species delimitation using DNA sequence data from
multiple loci. , pp.1–27.
Zamora, J.C. et al., 2014. Systematics of the genus Geastrum (Fungi: Basidiomycota)
revisited. Taxon, 63(3), pp.477–497.
Zamora, J.C., Calonge, F.D. & Mart??n, M.P., 2013. New sources of taxonomic information
for earthstars (Geastrum, Geastraceae, Basidiomycota): Phenoloxidases and rhizomorph
crystals. Phytotaxa, 132(1), pp.1–20.
Zang, M., Zheng, D. & Hu, Z., 1988. A new species of the genus Dictyophora from China.
Mycotaxon, 33, pp.145–148.
Zhao, R.-L. et al., 2008. A new species of bird’s nest fungi: characterisation of Cyathus
subglobisporus sp. nov. based on morphological and molecular data. Persoonia, 21,
pp.71–6.
 112

Anexos
Capítulo 03: Supporting Information
Figure S1. Phylogenetic trees obtained by Bayesian analysis. (A) EF-1α, (B) gpd, (C) ITS,

(D) rpb1, (E) rpb2, (F) concatenated protein genes tree. Only PP>0.9 is shown on nodes.

Trees A, E and F were rooted using sequences available on Genbank; B, C and D were

midpoint rooted.
113
114
115
116
117
 118

Figure S2. Phylogenetic trees obtained with Parsimony analysis. (A) EF-1α, (B) gpd, (C)

ITS, (D) rpb1, (E) rpb2, (F) concatenated protein genes tree. Only PP>80 is shown on nodes.

Trees A, E and F were rooted using sequences available on Genbank; B, C and D were

midpoint rooted.
119
120
121
122
123
 124

Table S3. Specimens used in this study. Their localities, herbarium vouchers and Genbank

accession numbers.

Species Locality Herbari Genbank Accession numbers

um
Ef-1α gpd ITS rpb1 rpb2
voucher

Xylophallus Puru Puru, Autazes, INPA26 KU87 - KU87 KU87 KU87

xylogenusa Amazonas, BR 4875 1557 1816 1650 1759

Puru Puru, Autazes, INPA26 KU87 - KU87 - KU87

Amazonas, BR 4876 1527 1819 1756

Puru Puru, Autazes, INPA26 KU87 KU87 KU87 KU87 KU87

Amazonas, BR 4877 1548 1638 1817 1667 1747

Cayenne, French Guiana, INPA26 KU87 KU87 KU87 KU87 KU87

FR 4878 1551 1600 1818 1675 1782

Presidente Figueiredo, INPA26 KU87 KU87 KU87 KU87 KU87

Amazonas, BR 4889 1560 1636 1824 1679 1762

Manaus, Amazonas, BR INPA26 KU87 KU87 KU87 KU87 KU87

4890 1533 1614 1825 1643 1768

Manaus, Amazonas, BR INPA26 KU87 KU87 KU87 KU87 KU87

4892 1530 1621 1826 1677 1783

Novo Airão, Amazonas, INPA26 KU87 KU87 KU87 KU87 KU87

BR 4907 1547 1611 1827 1653 1764

Novo Airão, Amazonas, INPA26 KU87 KU87 - KU87 KU87

BR 4908 1556 1620 1640 1775

Novo Airão, Amazonas, INPA26 KU87 KU87 KU87 KU87 KU87

 125

BR 4909 1563 1623 1828 1672 1751

Novo Airão, Amazonas, INPA26 KU87 KU87 KU87 KU87 -

BR 4910 1545 1629 1829 1648

Novo Airão, Amazonas, INPA26 KU87 KU87 KU87 KU87 KU87

BR 4911 1532 1632 1830 1654 1753

Novo Airão, Amazonas, INPA26 KU87 KU87 - KU87 KU87

BR 4912 1542 1605 1668 1774

Novo Airão, Amazonas, INPA26 KU87 KU87 KU87 KU87 KU87

BR 4913 1553 1607 1831 1658 1773

Novo Airão, Amazonas, INPA26 KU87 KU87 KU87 KU87 KU87

BR 4914 1555 1635 1832 1664 1746

Novo Airão, Amazonas, INPA26 KU87 KU87 KU87 KU87 KU87

BR 4915 1558 1608 1833 1659 1780

Novo Airão, Amazonas, INPA26 KU87 KU87 KU87 KU87 KU87

BR 4916 1564 1613 1834 1642 1757

Novo Airão, Amazonas, INPA26 KU87 KU87 KU87 KU87 KU87

BR 4917 1538 1603 1835 1647 1779

Novo Airão, Amazonas, INPA26 KU87 KU87 KU87 KU87 KU87

BR 4918 1554 1602 1836 1641 1778

Novo Airão, Amazonas, INPA26 KU87 KU87 KU87 KU87 KU87

BR 4919 1537 1609 1844 1644 1781
 126

Novo Airão, Amazonas, INPA26 KU87 KU87 KU87 KU87 -

BR 4920 1549 1630 1837 1655

Novo Airão, Amazonas, INPA26 KU87 KU87 KU87 KU87 KU87

BR 4921 1535 1601 1838 1646 1748

Novo Airão, Amazonas, INPA26 KU87 KU87 KU87 KU87 KU87

BR 4922 1539 1610 1843 1645 1776

Novo Airão, Amazonas, INPA26 KU87 KU87 KU87 KU87 KU87

BR 4923 1536 1615 1839 1656 1770

Novo Airão, Amazonas, INPA26 KU87 KU87 KU87

KU871840* KU87
BR 4924 1552 1612 1657
KU871841* 1754

Novo Airão, Amazonas, INPA26 KU87 KU87 KU87 KU87 KU87

BR 4925 1567 1606 1842* 1660 1743

Novo Airão, Amazonas, INPA26 KU87 KU87 - KU87 KU87

BR 4926 1531 1604 1673 1752

Tefé, Amazonas, BR INPA27 - - - KU87 -

1653 1662

Recife, Pernambuco, BR URM KU87 KU87 KU87 KU87 KU87

80262 1550 1626 1820 1680 1745

Gurjaú, Pernambuco, BR UFRN- KU87 KU87 KU87 KU87 KU87

Fungos 1541 1627 1822 1674 1766
458

Recife, Pernambuco, BR URM KU87 KU87 KU87 KU87 KU87

44245 1534 1625 1821 1676 1765
 127

Recife, Pernambuco, BR URM KU87 KU87 KU87 KU87 -

44244 1529 1631 1823 1678

Xylophallus Humaitá, Amazonas, BR INPA26 KU87 KU87 KU87 KU87 KU87

cryptic speciesb 4879 1565 1633 1845 1670 1755

Humaitá, Amazonas, BR INPA26 KU87 KU87 - KU87 KU87

4880 1566 1628 1661 1749

Humaitá, Amazonas, BR INPA26 KU87 KU87 KU87 KU87 KU87

4881 1562 1624 1846 1671 1750

Humaitá, Amazonas, BR INPA26 KU87 KU87 KU87

KU871847* KU87
4882 1540 1619 1649
KU871848* 1772
KU871849*

Manicoré, Amazonas, BR INPA26 KU87 KU87 KU87 KU87 KU87

4883 1528 1637 1850 1652 1769

Manicoré, Amazonas, BR INPA26 KU87 KU87 KU87 KU87 KU87

4884 1561 1622 1851 1665 1767

Manicoré, Amazonas, BR INPA26 KU87 KU87 KU87

KU871852* KU87
4885 1543 1617 1663
KU871853* 1744

Manicoré, Amazonas, BR INPA26 KU87 KU87 KU87 KU87 KU87

4886 1544 1618 1854 1666 1771

Novo Aripuanã, INPA26 KU87 KU87 KU87

KU871855* KU87
Amazonas, BR 4887 1546 1616 1651
KU871856* 1763
KU871857*
KU871858*
Novo Aripuanã, INPA26 KU87 KU87 KU87 KU87 KU87
 128

Amazonas, BR 4888 1559 1634 1859 1669 1777

Xylophallus São Paulo de Olivença, INPA26 KU87 KU87 KU87 KU87 KU87
clavatusc Amazonas, BR 4893 1499 1593 1784* 1710 1722

KU87
1785*

São Paulo de Olivença, INPA26 KU87 KU87 KU87 KU87 KU87

Amazonas, BR 4894 1496 1574 1786* 1714 1727

KU87
1787*

Lago Amanã, Maraã, INPA26 KU87 KU87 KU87 KU87 KU87

Amazonas, BR 4895 1498 1639 1788 1706 1717

Lago Amanã, Maraã, INPA26 KU87 KU87 KU87 KU87 KU87

Amazonas, BR 4896 1525 1589 1789 1709 1720

Lago Amanã, Maraã, INPA26 KU87 KU87 KU87

KU871790* KU87
Amazonas, BR 4897 1523 1599 1682
KU871791* 1731

Lago Amanã, Maraã, INPA26 KU87 KU87 KU87

KU871792* -
Amazonas, BR 4898 1500 1592 1708
KU871793*

Belterra, Pará, BR INPA26 KU87 KU87 KU87 KU87 KU87

4900 1526 1581 1794 1685 1734

Belterra, Pará, BR INPA26 KU87 KU87 KU87 KU87 KU87

4901- 1513 1583 1795 1689 1723
holotype

Belterra, Pará, BR INPA26 KU87 KU87 KU87 KU87 KU87

4902 1517 1598 1796 1692 1730

Belterra, Pará, BR INPA26 KU87 KU87 KU87 KU87 KU87

 129

4903 1510 1579 1797 1681 1724

Belterra, Pará, BR INPA26 KU87 KU87 KU87 KU87 KU87

4904 1520 1594 1798 1691 1729

Belterra, Pará, BR INPA26 KU87 KU87 KU87 KU87 KU87

4905 1521 1576 1799 1684 1738

Belterra, Pará, BR INPA26 KU87 KU87 - KU87 KU87

4906 1522 1597 1683 1721

São Gabriel da Cachoeira, INPA26 KU87 KU87 KU87 KU87 KU87

Amazonas, BR 4927 1497 1596 1800 1707 1716

Parintins, Amazonas, BR INPA KU87 KU87 KU87 KU87 -

271636 1511 1571 1801 1701

Parintins, Amazonas, BR INPA KU87 KU87 KU87 KU87 KU87

271637 1501 1595 1802 1704 1735

Parintins, Amazonas, BR INPA KU87 KU87 - KU87 KU87

271638 1507 1590 1688 1740

Parintins, Amazonas, BR INPA KU87 KU87 KU87 KU87 KU87

271639 1506 1585 1803 1711 1719

Parintins, Amazonas, BR INPA KU87 KU87 KU87 KU87 KU87

271640 1504 1582 1804 1712 1718

Parintins, Amazonas, BR INPA KU87 KU87 KU87 KU87 KU87

271641 1505 1577 1805 1693 1728
 130

Parintins, Amazonas, BR INPA KU87 KU87 - KU87 KU87

271642 1509 1570 1703 1726

Parintins, Amazonas, BR INPA KU87 KU87 - KU87 KU87

271643 1518 1584 1699 1732

Parintins, Amazonas, BR INPA - KU87 KU87 KU87 KU87

271644 1587 1806 1713 1739

Parintins, Amazonas, BR INPA - - KU87 KU87 -

271645 1807 1705

Parintins, Amazonas, BR INPA KU87 KU87 KU87 KU87 -

271646 1519 1572 1808 1687

Parintins, Amazonas, BR INPA KU87 KU87 KU87 KU87 KU87

271647 1503 1591 1809 1700 1725

Parintins, Amazonas, BR INPA KU87 KU87 KU87 KU87 KU87

271648 1502 1578 1810 1695 1741

Parintins, Amazonas, BR INPA KU87 KU87 - KU87 KU87

271649 1524 1580 1696 1733

Parintins, Amazonas, BR INPA - KU87 - KU87 -

271650 1573 1694

Parintins, Amazonas, BR INPA KU87 KU87 KU87 KU87 KU87

271651 1516 1569 1811 1686 1737

Parintins, Amazonas, BR INPA KU87 KU87 KU87 KU87 -

271652 1508 1588 1812 1702
 131

Barcelos, Amazonas, BR INPA KU87 KU87 KU87 KU87 KU87

271654 1512 1586 1813 1698 1736

Barcelos, Amazonas, BR INPA KU87 KU87 KU87 KU87 KU87

271655 1515 1575 1814 1697 1742

Heredia, Costa Rica USJ KU87 KU87 KU87 KU87 KU87

28095 1514 1568 1815 1690 1715