Você está na página 1de 213

UNIVERSIDADE FEDERAL DE SANTA CATARINA

PROGRAMA DE PS-GRADUAO EM ENGENHARIA


AMBIENTAL

Jamile Wagner

DESENVOLVIMENTO DE GRNULOS AERBIOS E


TRATAMENTO DE ESGOTO DOMSTICO EM UM REATOR
EM BATELADAS SEQUENCIAIS (RBS) SOB DIFERENTES
CONDIES OPERACIONAIS

Florianpolis
2011

Jamile Wagner

DESENVOLVIMENTO DE GRNULOS AERBIOS E


TRATAMENTO DE ESGOTO DOMSTICO EM UM REATOR
EM BATELADAS SEQUENCIAIS (RBS) SOB DIFERENTES
CONDIES OPERACIONAIS

Dissertao submetida ao Programa de


Ps-Graduao
em
Engenharia
Ambiental da Universidade Federal de
Santa Catarina para a obteno do
Grau de Mestre em Engenharia
Ambiental.
Orientadora: Prof. Dr. Rejane Helena
Ribeiro da Costa

Florianpolis
2011

Catalogao na fonte pela Biblioteca Universitria


da
Universidade Federal de Santa Catarina

Jamile Wagner

DESENVOLVIMENTO DE GRNULOS AERBIOS E


TRATAMENTO DE ESGOTO DOMSTICO EM UM REATOR
EM BATELADAS SEQUENCIAIS (RBS) SOB DIFERENTES
CONDIES OPERACIONAIS

Esta Dissertao foi julgada adequada para obteno do Ttulo de


Mestre em Engenharia Ambiental, e aprovada em sua forma final pelo
Programa de Ps-Graduao em Engenharia Ambiental da Universidade
Federal de Santa Catarina.
Florianpolis, 16 de maro de 2011.

Banca Examinadora:

Aos meus pais, Alvaro e Tania Regina


Wagner.

AGRADECIMENTOS

Agradeo a todos que, direta ou indiretamente, ajudaram na


execuo deste trabalho, em especial:
minha orientadora Rejane Ribeiro da Costa, pela amizade,
pacincia, motivao, disponibilidade e, principalmente, por acreditar no
meu trabalho.
Aos meus pais, irmos e sobrinhos, pelo amor, incentivo e apoio
incondicional em todos os momentos decisivos em minha vida.
Ao meu namorado Murilo, por todo amor, carinho, pacincia e
companheirismo dedicados, e tambm por sempre ter me acompanhado
nas visitas ao reator nos finais de semana e feriados.
Aos bolsistas de iniciao cientfica: Jorge, Guilherme, Letcia e,
principalmente, Renata, por terem se dedicado e contribudo
enormemente para esta pesquisa, e pela amizade conquistada durante o
trabalho.
Aos amigos do mestrado: Viviane, Pauline, Wanderli, Tiago e
Juliana pela amizade e companheirismo ao longo destes dois anos.
Helosa, pela ajuda com a microscopia e por ter realizado as
anlises FISH.
Aos amigos do LABEFLU: Cludia, Rodrigo, Jorge, Maria
Ceclia, Anigeli, Amanda e Thales, por todo o auxlio e apoio.
Aos funcionrios do LIMA: Arlete, Eliani e Vitor, pela
assistncia no laboratrio.
Ao Edevaldo e ao Seu Hlio pelos servios prestados nas
instalaes experimentais.
s minhas grandes amigas: Luana, Yasmine, Beth, Elisa,
Nssara, Laura, Lauren e tambm ao grupo das Legais, por sempre
estarem presentes na minha vida, mesmo quando fisicamente distantes.
Isabel, my dear english teacher, pela imensurvel ajuda com os
artigos em ingls.
Eleonora, minha grande amiga e professora de francs, pelas
conversas e conselhos, e tambm por sempre me reanimar diante das
dificuldades.
Aos colegas, professores e funcionrios do PPGEA.
Ao CNPq pelo financiamento do projeto e pela bolsa concedida
durante a pesquisa.
Aos professores Flvio Rubens Lapolli, Paulo Belli Filho e
Mrcia Dezotti por aceitarem participar da banca.

Un homme seul ne peut rien, il lui


faut l'appui de ses semblables pour
arriver l o il doit aller.

Victor-Lvy Beaulieu

RESUMO
Entre as recentes tecnologias desenvolvidas para o tratamento biolgico de
efluentes destacam-se os reatores com biomassa na forma de grnulos
aerbios. Entretanto, a maioria dos pesquisadores tem focado seus estudos
na formao desses grnulos em reatores alimentados com esgoto sinttico
de elevada carga orgnica. Assim, para poder aplicar na prtica essa
tecnologia, preciso realizar estudos da utilizao dos grnulos aerbios no
tratamento de esgoto domstico, o qual usualmente caracterizado como
sendo de baixa carga orgnica. Neste contexto, a presente pesquisa teve
como objetivo estudar o desenvolvimento de grnulos aerbios no
tratamento de esgoto domstico em um reator em bateladas seqenciais
(RBS) sob diferentes condies operacionais. Para isso, o estudo foi
dividido em trs estratgias operacionais. A Estratgia Operacional I
avaliou o desempenho do reator utilizando ciclos operacionais de 3 e 4
horas de durao. A Estratgia Operacional II avaliou o comportamento do
reator quando submetido a diferentes cargas orgnicas. E por ltimo, a
Estratgia Operacional III avaliou o efeito da diminuio do tempo de
sedimentao nas caractersticas dos grnulos e no desempenho do reator.
Em relao Estratgia I, o aumento da durao do ciclo no foi um
parmetro decisivo no processo de granulao aerbia, mas influenciou na
qualidade do efluente tratado, principalmente no processo de nitrificao,
cuja eficincia aumentou de 23 para 69%. Referente Estratgia II,
observou-se que os grnulos aerbios podem ser mantidos no reator mesmo
com o aumento da carga orgnica aplicada, desde que haja condies de
cisalhamento adequadas. Alm disso, o reator mostrou-se bastante adequado
para o tratamento de afluentes com cargas orgnicas mais elevadas,
apresentando remoo de DQO s de 92%, NH4+-N de 96% e PO4-P de 91%.
Na Estratgia III observou-se que a diminuio gradual do tempo de
sedimentao foi uma maneira efetiva de melhorar as caractersticas dos
grnulos, mas provocou uma piora temporria na qualidade do efluente
tratado. Aps o restabelecimento do reator, as eficincias de remoo foram
de 93% para DQOs, 96% para NH4+-N e 60% para PO4-P. De maneira geral,
o reator mostrou-se capaz de remover carbono, nitrognio e fsforo
simultaneamente em uma nica unidade operacional compacta, provando
ser uma tecnologia bastante promissora para o tratamento de esgoto
domstico.

Palavras-chave: Grnulos Aerbios, Reator em Bateladas Seqenciais,


Tratamento de Esgoto Domstico.

ABSTRACT
Of the recent technologies developed for biological wastewater treatment,
the reactors based on biomass in the form of aerobic granules are drawing
the most attention. However, most researchers have focused their studies on
granule formation in reactors fed with high-strength synthetic wastewaters.
In order to apply aerobic granulation technology, more information is
needed about its utilization in the treatment of domestic wastewater, which
is usually characterized as a low-strength influent. Given these
considerations, the aim of this research was to study the aerobic granules
development in the treatment of domestic wastewater in a sequencing batch
reactor operated under different conditions. Towards this end, three
operational strategies were established. Operational Strategy I surveyed the
reactors performance during 3 and 4 hour cycles. Operational Strategy II
evaluated the organic loads effect on the reactors behavior. Lastly,
Operational Strategy III examined the effect of the decrease in
sedimentation time on the granules characteristics and the reactors
performance. In Strategy I, although the increase in cycle duration was not a
decisive aerobic granulation parameter, it did influence the effluents
quality, particularly the nitrification process, which went from an efficiency
of 23% to 69%. For Strategy II, observations indicated that aerobic granules
can be kept inside the reactor even with an increase in the organic load, so
long as the appropriate shear force conditions are maintained. Moreover, the
reactor was effective in the treatment of higher organic load influent,
presenting a removal efficiency of 92% for CODS, 96% for NH4+-N, and
91% for PO4-P. In Strategy III, while the gradual reduction of the
sedimentation time improved the granules characteristics, it also
temporarily worsened the effluents quality. After the reactors recovery, the
removal efficiencies were 93% for CODS, 96% for NH4+-N, and 60% for
PO4-P. In a generalized manner, the reactor simultaneously removed
carbon, nitrogen, and phosphorus in a single compact operational unit,
proving to be a very promising technology for domestic wastewater
treatment.

Keywords: Aerobic Granules,


Sequencing Batch Reactor.

Domestic

Wastewater

Treatment,

LISTA DE FIGURAS
Figura 1. Representao esquemtica do metabolismo bacteriano heterotrfico
em um ambiente aerbio. .................................................................................. 31
Figura 2. Transformao do nitrognio nos processos biolgicos de tratamento.
.......................................................................................................................... 33
Figura 3. Concentrao de OD e substrato em um agregado microbiano. ........ 45
Figura 4. Fases de operao de um RBS. .......................................................... 50
Figura 5. Representao esquemtica do RBS (VB = volume da zona de carga;
VF = volume da zona de transio; e VL = volume da zona de lodo). ............... 52
Figura 6. Combinao de processos nos grnulos aerbios. ............................. 55
Figura 7. Seleo da biomassa com boa sedimentabilidade em um RBS de
grnulos aerbios. ............................................................................................. 61
Figura 8. Sistema Experimental: (1) poo de visita da CASAN; (2) tanque de
armazenamento; (3) tanque intermedirio com misturador; (4) bomba de
alimentao do reator; (5) reator em bateladas seqenciais com grnulos
aerbios (RBSG); (6) rotmetro; (7) compressor de ar; (8) bomba para retirada
do efluente; (9) painel de comandos eltricos. .................................................. 63
Figura 9. Foto do reator piloto. ......................................................................... 64
Figura 10. Variao da concentrao de oxignio dissolvido com o tempo,
durante a execuo do mtodo respiromtrico. ................................................. 75
Figura 11. Esquema do sistema experimental utilizado nos ensaios de
respirometria. .................................................................................................... 75
Figura 12. Representao do procedimento respiromtrico utilizado para obter a
repartio da biomassa ativa: (1) respirao endgena; (2) nitrificao; (3)
respirao exgena. ........................................................................................... 79
Figura 13. Evoluo da formao dos grnulos no reator: (A) inculo; (B) 14
dias; (C) 28 dias; (D) 56 dias; (E) 70 dias; (F) 99 dias; (G) 114 dias; (H) 121
dias; e (I) 150 dias. Barra = 0,1 mm.................................................................. 86
Figura 14. Evoluo da concentrao de SST e SSV no reator, de SST no
efluente e da proporo de SSV/SST no reator ao longo da Estratgia I. ......... 90
Figura 15. Evoluo do IVL em diferentes tempos de sedimentao (5, 10, 15 e
30 minutos) e da relao IVL30/IVL10 ao longo da Estratgia I. ....................... 91
Figura 16. Comportamento da concentrao de DQO T afluente e efluente e a
respectiva eficincia de remoo aps 130 dias de operao. ........................... 97
Figura 17. Comportamento da concentrao de DQO s afluente e efluente e a
respectiva eficincia de remoo ao longo da Estratgia I. ............................... 97
Figura 18. Comportamento da concentrao de COD afluente e efluente e a
respectiva eficincia de remoo ao longo da Estratgia I. ............................... 98
Figura 19. Comportamento da concentrao de NH4+-N afluente e efluente e a
respectiva eficincia de remoo ao longo da Estratgia I. ............................... 98
Figura 20. Comportamento da concentrao de NO 2--N e NO3--N no efluente
tratado, e a respectiva eficincia de desnitrificao e de remoo de nitrognio
total ao longo da Estratgia I. ..........................................................................102

Figura 21. Comportamento da concentrao de PO 4-P afluente e efluente e a


respectiva eficincia de remoo ao longo da Estratgia I............................... 105
Figura 22. Comportamento da taxa de consumo de oxignio especfica aps 95
dias de operao. ............................................................................................. 106
Figura 23. Comportamento da DQOs e da NH4+-N ao longo de um ciclo padro
de 3 horas monitorado aos 79 dias de operao da Estratgia I. ...................... 108
Figura 24. Comportamento do nitrito e do nitrato ao longo de um ciclo padro
de 3 horas monitorado aos 79 dias de operao da Estratgia I. ...................... 108
Figura 25. Comportamento do oxignio dissolvido, pH e temperatura ao longo
de um ciclo padro de 3 horas monitorado aos 79 dias de operao da Estratgia
I........................................................................................................................ 109
Figura 26. Comportamento do fosfato ao longo de um ciclo padro de 3 horas
monitorado aos 79 dias de operao da Estratgia I. ....................................... 109
Figura 27. Comportamento da DQOs, da NH4+-N e da TCO ao longo de um ciclo
padro de 4 horas monitorado aos 135 dias de operao da Estratgia I. ........ 111
Figura 28. Comportamento do nitrito e do nitrato ao longo de um ciclo padro
de 4 horas monitorado aos 135 dias de operao da Estratgia I. .................... 111
Figura 29. Comportamento do oxignio dissolvido, pH e temperatura ao longo
de um ciclo padro de 4 horas monitorado aos 135 dias de operao da
Estratgia I. ...................................................................................................... 112
Figura 30. Comportamento do potencial redox ao longo de um ciclo padro de 4
horas monitorado aos 135 dias de operao da Estratgia I............................. 113
Figura 31. Comportamento do fosfato ao longo de um ciclo padro de 4 horas
monitorado aos 135 dias de operao da Estratgia I. ..................................... 114
Figura 32. Morfologia dos grnulos no final de Estratgia I (A) e ao longo da
Estratgia II: (B) 5 dias; (C) 42 dias; (D) 55 dias; (E) 61 dias e (F) 68 dias.
Barra = 0,1 mm................................................................................................ 117
Figura 33. Distribuio do tamanho das partculas do lodo presente no reator aos
33 dias de operao da Estratgia II. ............................................................... 120
Figura 34. Distribuio do tamanho das partculas do lodo presente no reator aos
70 dias de operao da Estratgia II. ............................................................... 120
Figura 35. Comportamento da concentrao de polissacardeos extracelulares ao
longo da Estratgia II. ...................................................................................... 121
Figura 36. Evoluo da concentrao de SST e SSV no reator, de SST no
efluente e da proporo de SSV/SST no reator ao longo da Estratgia II........ 122
Figura 37. Evoluo do IVL em diferentes tempos de sedimentao (5, 10, 15 e
30 minutos) e da relao IVL30/IVL10 ao longo da Estratgia II. ..................... 124
Figura 38. Comportamento da concentrao de DQO T afluente e efluente e a
respectiva eficincia de remoo ao longo da Estratgia II. ............................ 129
Figura 39. Comportamento da concentrao de NTK afluente e efluente e a
respectiva eficincia de remoo ao longo da Estratgia II. ............................ 129
Figura 40. Comportamento da concentrao de DQOs afluente e efluente e a
respectiva eficincia de remoo ao longo da Estratgia II. ............................ 130
Figura 41. Comportamento da concentrao de COD afluente e efluente e a
respectiva eficincia de remoo ao longo da Estratgia II. ............................ 130

Figura 42. Comportamento da concentrao de NH4+-N afluente e efluente e a


respectiva eficincia de remoo ao longo da Estratgia II. ............................131
Figura 43. Comportamento da concentrao de NO2--N e NO3--N no efluente
tratado, e a respectiva eficincia de desnitrificao e de remoo de nitrognio
total ao longo da Estratgia II. .........................................................................133
Figura 44. Comportamento da concentrao de PO4-P afluente e efluente e a
respectiva eficincia de remoo ao longo da Estratgia II. ............................136
Figura 45. Comportamento da taxa de consumo de oxignio especfica ao longo
da Estratgia II. ................................................................................................138
Figura 46. Comportamento da DQOs, da NH4+-N e da TCO ao longo de um ciclo
padro monitorado aos 54 dias de operao da Estratgia II. ..........................140
Figura 47. Comportamento do nitrito e do nitrato ao longo de um ciclo padro
monitorado aos 54 dias de operao da Estratgia II. ......................................140
Figura 48. Comportamento do oxignio dissolvido, pH e temperatura ao longo
de um ciclo padro monitorado aos 54 dias de operao da Estratgia II. .......141
Figura 49. Comportamento do potencial redox ao longo de um ciclo padro
monitorado aos 54 dias de operao da Estratgia II. ......................................142
Figura 50. Comportamento do fosfato ao longo de um ciclo padro monitorado
aos 54 dias de operao da Estratgia II. .........................................................142
Figura 51. Clulas hibridizadas pela sonda NSO (DAPI em azul e hibridizao
em vermelho) visualizadas em microscpio epifluorescente (Aumento 1000x).
.........................................................................................................................144
Figura 52. Clulas hibridizadas pela sonda NIT (DAPI em azul e hibridizao
em vermelho) visualizadas em microscpio epifluorescente (Aumento 1000x).
.........................................................................................................................144
Figura 53. Morfologia dos grnulos ao longo da Estratgia III: Ts = 12 min: (A)
6 dias e (B) 26 dias (Barra = 0,1 mm); Ts = 9 min: (C) 35 dias (Barra = 0,1
mm); Ts = 7 min: (D) 53 dias (Barra = 1,4 mm)..............................................146
Figura 54. Zoom dos grnulos apresentados na Figura 53D. .........................147
Figura 55. Distribuio do tamanho das partculas do lodo presente no reator aos
4 dias de operao da Estratgia III (Ts = 12 min). .........................................148
Figura 56. Distribuio do tamanho das partculas do lodo presente no reator aos
35 dias de operao da Estratgia III (Ts = 9 min). .........................................148
Figura 57. Distribuio do tamanho das partculas do lodo presente no reator aos
45 dias de operao da Estratgia III (Ts = 7 min). .........................................148
Figura 58. Comportamento da concentrao de polissacardeos extracelulares ao
longo da Estratgia III......................................................................................150
Figura 59. Evoluo da concentrao de SST e SSV no reator, de SST no
efluente e da proporo de SSV/SST no reator ao longo da Estratgia III.......152
Figura 60. Evoluo do IVL em diferentes tempos de sedimentao (5, 10, 15 e
30 minutos) e da relao IVL30/IVL10 ao longo da Estratgia III. ....................152
Figura 61. Sedimentao do lodo ao longo da fase de sedimentao aos 26 dias
de operao (Ts = 12 min). ..............................................................................154
Figura 62. Sedimentao do lodo ao longo da fase de sedimentao aos 53 dias
de operao (Ts = 7 min). ................................................................................154

Figura 63. Comportamento da concentrao de DQO T afluente e efluente e a


respectiva eficincia de remoo ao longo da Estratgia III. ........................... 158
Figura 64. Comportamento da concentrao de NTK afluente e efluente e a
respectiva eficincia de remoo ao longo da Estratgia III. ........................... 158
Figura 65. Comportamento da concentrao de DQO S afluente e efluente e a
respectiva eficincia de remoo ao longo da Estratgia III. ........................... 159
Figura 66. Comportamento da concentrao de COD afluente e efluente e a
respectiva eficincia de remoo ao longo da Estratgia III. ........................... 159
Figura 67. Comportamento da concentrao de NH4+-N afluente e efluente e a
respectiva eficincia de remoo ao longo da Estratgia III. ........................... 160
Figura 68. Comportamento da concentrao de NO 2--N e NO3--N no efluente
tratado, e a respectiva eficincia de desnitrificao e de remoo de nitrognio
total ao longo da Estratgia III......................................................................... 161
Figura 69. Comportamento da concentrao de PO 4-P afluente e efluente e a
respectiva eficincia de remoo ao longo da Estratgia III. ........................... 164
Figura 70. Comportamento da taxa de consumo de oxignio especfica ao longo
da Estratgia III. .............................................................................................. 165
Figura 71. Comportamento da DQOs, da NH4+-N e da TCO ao longo de um ciclo
padro monitorado aos 40 dias de operao da Estratgia III. ......................... 168
Figura 72. Comportamento do nitrito e do nitrato ao longo de um ciclo padro
monitorado aos 40 dias de operao da Estratgia III...................................... 168
Figura 73. Comportamento do oxignio dissolvido, pH e temperatura ao longo
de um ciclo padro monitorado aos 40 dias de operao da Estratgia III. ..... 169
Figura 74. Comportamento do potencial redox ao longo de um ciclo padro
monitorado aos 40 dias de operao da Estratgia III...................................... 170
Figura 75. Comportamento do fosfato ao longo de um ciclo padro monitorado
aos 40 dias de operao da Estratgia III. ........................................................ 171
Figura 76. Clulas hibridizadas pela sonda EUB (DAPI em azul e hibridizao
em verde) visualizadas em microscpio confocal (Aumento 630x). ............... 173
Figura 77. Clulas hibridizadas pela sonda NSO (DAPI em azul e hibridizao
em verde) visualizadas em microscpio confocal (Aumento 630x). ............... 173
Figura 78. Clulas hibridizadas pela sonda NIT (DAPI em azul e hibridizao
em verde) visualizadas em microscpio confocal (Aumento 630x). ............... 173

LISTA DE TABELAS
Tabela 1. Cintica de reduo dos nitratos de alguns substratos orgnicos. ..... 42
Tabela 2. Resumo das condies operacionais do reator durante a Estratgia I.66
Tabela 3. Resumo das condies operacionais do reator durante a Estratgia II.
.......................................................................................................................... 67
Tabela 4. Durao das fases dos ciclos operacionais durante a Estratgia
Operacional III. ................................................................................................. 68
Tabela 5. Sntese das Estratgias Operacionais. ............................................... 68
Tabela 6. Cargas aplicadas nas Estratgias Operacionais. ................................ 69
Tabela 7. Mtodos e freqncia das anlises fsico-qumicas. .......................... 71
Tabela 8. Descrio das sondas utilizadas na deteco dos microrganismos
presentes nos grnulos pela tcnica de FISH. ................................................... 73
Tabela 9. Categorias quantitativas da biomassa hibridizada. ............................ 73
Tabela 10. Condies experimentais para a determinao da TCO. ................. 79
Tabela 11: Caractersticas do esgoto domstico e cargas aplicadas durante a
Estratgia Operacional I. ................................................................................... 85
Tabela 12. Comparao entre estudos sobre a formao de grnulos aerbios
utilizando esgoto domstico e sinttico............................................................. 88
Tabela 13. Comparao entre as principais caractersticas dos grnulos obtidos
em estudos utilizando esgoto domstico. .......................................................... 93
Tabela 14. Resultados obtidos para OD, pH e temperatura nas fases aeradas ao
longo da Estratgia I. ........................................................................................ 94
Tabela 15. Desempenho do reator em relao remoo de matria carboncea
e nitrogenada para os ciclos de 3 e 4 horas. ...................................................... 96
Tabela 16. Comparao entre o desempenho de diferentes RBSG obtidos nos
estudos utilizando esgoto domstico. ...............................................................100
Tabela 17. Concentraes de nitrito e nitrato durante a Estratgia I. ...............101
Tabela 18. Percentuais de nitrificao, desnitrificao e remoo de nitrognio
total durante a Estratgia I. ..............................................................................103
Tabela 19. Concentraes de fosfato e eficincia de remoo durante a
Estratgia I. ......................................................................................................104
Tabela 20. Resultados da anlise FISH dos grnulos aos 150 dias de operao
da Estratgia I. .................................................................................................115
Tabela 21: Caractersticas do esgoto domstico e cargas aplicadas durante a
Estratgia Operacional II. ................................................................................116
Tabela 22. Resultados obtidos para OD, pH e temperatura nas fases aeradas ao
longo da Estratgia II. ......................................................................................126
Tabela 23. Desempenho do reator em relao matria carboncea e
nitrogenada durante a Estratgia II. .................................................................128
Tabela 24. Concentraes de nitrito e nitrato durante a Estratgia II...............133
Tabela 25. Percentuais de nitrificao, desnitrificao e remoo de nitrognio
total durante a Estratgia II. .............................................................................134

Tabela 26. Concentraes de fosfato e eficincia de remoo durante a


Estratgia II. .................................................................................................... 136
Tabela 27. Resultados da anlise FISH dos grnulos aos 70 dias de operao da
Estratgia II. .................................................................................................... 143
Tabela 28: Caractersticas do esgoto domstico e cargas aplicadas durante a
Estratgia Operacional III. ............................................................................... 145
Tabela 29. Resultados obtidos para OD, pH e temperatura nas fases aeradas ao
longo da Estratgia III. .................................................................................... 155
Tabela 30. Desempenho do reator em relao matria carboncea e
nitrogenada durante a Estratgia III. ................................................................ 157
Tabela 31. Concentraes de nitrito e nitrato durante a Estratgia III. ............ 161
Tabela 32. Percentuais de nitrificao, desnitrificao e remoo de nitrognio
total durante a Estratgia III. ........................................................................... 162
Tabela 33. Concentraes de fosfato e eficincia de remoo durante a
Estratgia III. ................................................................................................... 163
Tabela 34. Resultados da anlise FISH dos grnulos aos 53 dias de operao da
Estratgia III. ................................................................................................... 172
Tabela 35. Concentrao de biomassa ativa autotrfica e hetetotrofica no
primeiro e no ltimo dia de operao da Estratgia III. ................................... 174
Tabela 36. Sntese das condies operacionais aplicadas e dos principais
resultados obtidos durante cada Estratgia Operacional. ................................ 176

LISTA DE ABREVIATURAS E SIGLAS


A/D Relao Altura/Dimetro
A/M Relao Alimento/Microrganismo
ANA Agncia Nacional de guas
ATU Allylthiourea
BOA Bactrias Oxidadoras de Amnia
BON Bactrias Oxidadoras de Nitrito
CaCO3 Carbonato de Clcio
CASAN Companhia Catarinense de guas e Saneamento
CLP Controlador Lgico Programvel
C/N Relao Carbono/Nitrognio
COD Carbono Orgnico Dissolvido
CONAMA Conselho Nacional do Meio Ambiente
DQOt Demanda Qumica de Oxignio Total
DQOs Demanda Qumica de Oxignio Solvel
ETE Estao de Tratamento de Esgoto
FISH Hibridizao Fluorescente In Situ
H+ on Hidrognio
HNO2 cido Nitroso
IVL ndice Volumtrico do Lodo
IVL30/IVL10 Relao ndice Volumtrico do Lodo aps 30 minutos de
sedimentao e ndice Volumtrico do Lodo aps 10 minutos de
sedimentao
LABEFLU Laboratrio de Efluentes Lquidos e Gasosos
LBBMM Laboratrio de Bioqumica e Biologia Molecular de
Microrganismos
LCT Laboratrio de Caracterizao Tecnolgica
LIMA Laboratrio Integrado do Meio Ambiente
n Nmero de dados
NDS Nitrificao e Desnitrificao Simultneas
NH3 Amnia no ionizada
NH4+-N Nitrognio Amoniacal
N2 Nitrognio Gasoso
N2O xido Nitroso
NO xido Ntrico
NO2- Nitrito
NO2--N Nitrito expresso como nitrognio
NO3- Nitrato
NO3--N Nitrato expresso como nitrognio

NOX-N Compostos nitrogenados oxidados (nitrito e nitrato)


NTK Nitrognio Total Kjeldahl
NT Nitrognio Total
O2 Oxignio Gasoso
OD Oxignio Dissolvido
ORP Potencial Redox
pH Potencial Hidrogeninico
PHB Polihidroxibutirato
PO4-P Fosfato expresso como fsforo
PRODES Programa Despoluio de Bacias Hidrogrficas
PSE Polissacardeos Extracelulares
PTV Percentual de Troca Volumtrica
RBS Reator em Bateladas Seqenciais
RBSG Reator em Bateladas Seqenciais de Grnulos Aerbios
SSF Slidos Suspensos Fixos
SST Slidos Suspensos Totais
SSV Slidos Suspensos Volteis
SSV/SST Proporo Slidos Suspensos Volteis e Slidos Suspensos
Totais
T Temperatura
TCO Taxa de Consumo de Oxignio
TCO A Taxa de Consumo de Oxignio Autotrfica
TCOE Taxa de Consumo de Oxignio Especfica
TCOend Taxa de Consumo de Oxignio Endgena
TCO H Taxa de Consumo de Oxignio Heterotrfica
TRH Tempo de Reteno Hidrulica
TSE Tempo de Sedimentao
UFSC Universidade Federal de Santa Catarina
USEPA United States Environment Protection Agency
VLS Volume de Lodo Sedimentado
XA Concentrao de Biomassa Ativa Autotrfica
XH Concentrao de Biomassa Ativa Heterotrfica

SUMRIO

1 INTRODUO.................................................................................. 25
1.1 JUSTIFICATIVA .......................................................................... 25
1.2 OBJETIVOS ................................................................................. 28
1.2.1 Objetivo Geral ........................................................................ 28
1.2.2 Objetivos Especficos .............................................................. 28
2 FUNDAMENTAO TERICA ..................................................... 29
2.1 CONVERSO BIOLGICA DA MATRIA ORGNICA
CARBONCEA ................................................................................. 29
2.2 CONVERSO BIOLGICA DO NITROGNIO .......................... 32
2.2.1 Nitrificao ............................................................................. 33
2.2.2 Desnitrificao ....................................................................... 38
2.2.3 Nitrificao e Desnitrificao Simultneas (NDS) ................... 43
2.3 REATORES EM BATELADAS SEQENCIAIS (RBS) ............... 49
2.4 GRNULOS AERBIOS ............................................................. 53
2.4.1 Caractersticas Gerais ............................................................ 54
2.4.2 Formao dos Grnulos Aerbios ........................................... 56
2.4.3 Fatores que Afetam a Granulao Aerbia .............................. 56
2.4.4 Aplicaes dos Grnulos Aerbios .......................................... 61
3 MATERIAIS E MTODOS .............................................................. 63
3.1 SISTEMA EXPERIMENTAL........................................................ 63
3.2 INOCULAO DO REATOR ...................................................... 65
3.3 OPERAO DO REATOR ........................................................... 66
3.4 MONITORAMENTO DO REATOR.............................................. 70
3.4.1 Anlises Fsico-Qumicas ........................................................ 70
3.4.2 Anlises Morfolgicas e Microbiolgicas ................................ 72
3.4.3 Granulometria por Difrao a Laser ....................................... 73
3.4.4 Respirometria ......................................................................... 74
3.5 CLCULOS REALIZADOS ......................................................... 79
3.5.1 Vazo Diria de Esgoto (Qd) ................................................... 79
3.5.2 Carga Volumtrica Aplicada (CV) ........................................... 80
3.5.3 Tempo de Reteno Hidrulica (TRH) ..................................... 80
3.5.4 Velocidade Superficial Ascensional do Ar ................................ 81
3.5.5 Eficincia (E) .......................................................................... 81
3.5.6 Eficincia de Desnitrificao (EDN) ......................................... 81
3.5.7 Eficincia de Remoo do Nitrognio Total (E NT) .................... 82
3.5.8 Concentrao de Biomassa Ativa ............................................ 82

4 RESULTADOS E DISCUSSO ......................................................... 85


4.1 ESTRATGIA OPERACIONAL I ................................................. 85
4.1.1 Formao dos Grnulos Aerbios ............................................ 85
4.1.2 Desempenho do Reator ............................................................ 93
4.1.3 Hibridizao Fluorescente in situ (FISH) ............................... 114
4.2 ESTRATGIA OPERACIONAL II.............................................. 116
4.2.1 Caractersticas dos Grnulos Aerbios .................................. 117
4.2.2 Desempenho do Reator .......................................................... 125
4.2.3 Hibridizao Fluorescente in situ (FISH) ............................... 143
4.3 ESTRATGIA OPERACIONAL III ............................................ 145
4.3.1 Caractersticas dos Grnulos Aerbios .................................. 145
4.3.2 Desempenho do Reator .......................................................... 155
4.3.3 Hibridizao Fluorescente in situ (FISH) ............................... 171
4.3.4 Biomassa Ativa Autotrfica e Heterotrfica ............................ 174
4.4 SNTESE DAS ESTRATGIAS OPERACIONAIS ..................... 176
5 CONCLUSES E RECOMENDAES......................................... 181
REFERNCIAS .................................................................................. 185

25

1 INTRODUO

A gua um recurso natural finito indispensvel vida e s


diversas atividades desenvolvidas pelo ser humano. Entretanto, tem-se
verificado uma crescente degradao dos recursos hdricos,
principalmente nas regies metropolitanas, devido intensa
industrializao associada ao crescimento demogrfico desordenado.
De acordo com o Programa Despoluio de Bacias Hidrogrficas
(PRODES) da Agncia Nacional de guas (ANA) (2001), os esgotos
domsticos representam uma das principais fontes poluidoras dos
recursos hdricos, uma vez que no Brasil menos de 20% do esgoto
urbano recebe algum tipo de tratamento, sendo o restante lanado in
natura nos corpos dgua, colocando em risco a sade do ecossistema e
da populao local.
Os esgotos domsticos carreiam dejetos de origem humana,
podendo conter microrganismos patognicos, os quais so associados a
doenas de veiculao hdrica. Alm disso, a matria orgnica presente
nas guas residurias, quando introduzida nos mananciais, provoca o
consumo do oxignio dissolvido na gua, gerando impactos negativos
sobre a vida aqutica (MOTA, 2006).
Desta forma, o controle da poluio dos recursos hdricos assume
importncia vital, a fim de satisfazer a demanda quantitativa e
qualitativa de gua. Este controle pode ser realizado atravs de medidas
preventivas como, por exemplo, coleta, transporte, tratamento e
disposio adequada dos esgotos domsticos, contribuindo assim para a
proteo ambiental.
Tendo em vista a fragilidade dos ecossistemas aquticos e da
necessidade de assegurar os usos mltiplos da gua, os padres de
lanamento de efluentes esto cada vez mais rigorosos, exigindo uma
demanda de tecnologias de tratamento capazes de remover os principais
poluentes presentes nas guas residurias de forma eficiente e
econmica.

1.1 JUSTIFICATIVA

Atualmente, um dos principais problemas relacionados ao


lanamento de esgotos sem tratamento prvio so os altos nveis de
contaminao das guas, especialmente por nutrientes como o

26

nitrognio e fsforo, os quais se apresentam sob diferentes formas no


meio aqutico.
O lanamento excessivo desses nutrientes cria condies
favorveis ao crescimento exacerbado de plantas aquticas. Este
fenmeno, denominado de eutrofizao, provoca efeitos indesejveis
nos corpos hdricos, como problemas de odor, sabor, turbidez e,
principalmente, a reduo de oxignio dissolvido, o que ocasiona
considerveis impactos negativos nos organismos aquticos.
Alm disso, o lanamento e a acumulao dos compostos
nitrogenados (em forma de amnia livre, nitritos e nitratos) em guas
superficiais podem causar efeitos txicos vida aqutica, e constituem
perigos potenciais sade humana, por estarem relacionados a doenas
como a metahemoglobinemia (sndrome do beb azul) e cncer
(USEPA, 1993).
A legislao ambiental contempla, alm da necessidade de
reduo da poluio orgnica, a reduo de nitrognio e fsforo para o
lanamento de efluentes sanitrios e/ou industriais em cursos dgua. De
acordo com a Resoluo n 357/05 do CONAMA, a qual estabelece as
condies e padres de lanamento de efluentes, o valor mximo
permitido de nitrognio amoniacal de 20 mgNL-1 (BRASIL, 2005).
No entanto, este padro foi suspenso temporariamente pela Resoluo n
397/08 do CONAMA (BRASIL, 2008). J a legislao ambiental de
Santa Catarina, atravs da Lei n 14.675/09, estabelece que os efluentes
somente podem ser lanados direta ou indiretamente em trechos de
lagoas, lagunas e esturios, quando a concentrao de fsforo total for
inferior a 4 mgL-1 ou quando a eficincia de remoo de fsforo for no
mnimo de 75%, desde que no altere as caractersticas dos corpos de
gua (SANTA CATARINA, 2009).
Segundo Mota & Von Sperling (2009), os sistemas convencionais
de tratamento de esgoto so projetados visando, principalmente,
remoo de matria orgnica, dificultando assim o atendimento s
exigncias da legislao ambiental, uma vez que os efluentes desses
sistemas apresentam concentraes de nitrognio e fsforo prximas s
do esgoto bruto.
De forma a minimizar os impactos ambientais relacionados ao
lanamento indevido de esgotos domsticos e atender s legislaes
vigentes, a busca de alternativas adequadas e eficientes para o
tratamento de esgotos assume extrema importncia.
Neste contexto, o Laboratrio de Efluentes Lquidos e Gasosos
(LABEFLU) da Universidade Federal de Santa Catarina, coordenado
pelos professores Rejane Helena Ribeiro da Costa e Paulo Belli Filho,

27

vem desenvolvendo desde 1997, pesquisas sobre o tratamento biolgico


de esgotos domsticos e industriais utilizando sistemas de biomassa fixa,
como os reatores de leito fluidizado (WOLFF, 1997; BARTHEL, 1998;
SALES, 1999; ALVES, 2000; HEIN DE CAMPOS, 2001; MARTINS,
2003) e os reatores de leito fluidizado em bateladas seqenciais
(BARBOSA, 2004; BORTOLOTTO NETO, 2004; HEIN DE
CAMPOS, 2006); sistemas de biomassa suspensa, como os reatores em
bateladas seqenciais (COSTA, 2005; THANS, 2008); e sistemas
hbridos (biomassa suspensa + biomassa fixa), de fluxo contnuo ou em
bateladas seqenciais (WOLFF, 2005; SOUTO, 2007; LAMEGO
NETO, 2008). Atualmente, vem sendo realizadas pesquisas utilizando
sistemas de biomassa granular em reatores em bateladas seqenciais
(JUNGLES, em andamento).
Entre as recentes tecnologias desenvolvidas para o tratamento
biolgico de esgotos, os reatores baseados na biomassa em forma de
grnulos aerbios tm despertado bastante interesse (DI IACONI et al.,
2007). Esses reatores granulares surgiram nos ltimos anos com a
finalidade de desenvolver sistemas mais eficientes que os tratamentos
convencionais por lodos ativados, no que diz respeito eliminao
biolgica de matria orgnica e nitrognio (DE KREUK & BRUIN,
2004).
Entretanto, apesar da granulao aerbia ter sido extensivamente
investigada nos ltimos anos, a maioria dos pesquisadores tem focado
seus estudos nos processos de converso e formao dos grnulos
aerbios em sistemas bem controlados de escala laboratorial,
alimentados com esgoto sinttico de mdia e elevada carga orgnica
(DE KREUK & VAN LOOSDRECHT, 2006), o qual elaborado a
partir de compostos orgnicos e inorgnicos solveis de fcil
assimilao pelos microrganismos. Alm disso, a complexidade e
variedade da qualidade e da quantidade dos esgotos domsticos tornam a
formao, as caractersticas e o desempenho de tratamento dos grnulos
aerbios mais complexos do que comparado aos sistemas que usam
esgoto sinttico (JI et al., 2009).
Assim, para poder aplicar na prtica a tecnologia dos grnulos
aerbios, preciso realizar estudos sobre a potencial utilizao desta
tecnologia no tratamento de esgoto domstico, o qual usualmente
caracterizado como sendo de baixa carga orgnica. De Kreuk & Van
Loosdrecht (2006) observaram que possvel formar grnulos aerbios
em um reator em bateladas seqenciais (RBS) utilizando um afluente
complexo como o esgoto domstico. Esses autores observaram que os
grnulos formados nessas condies so mais heterogneos do que os

28

grnulos obtidos em estudos que utilizaram esgoto sinttico. Ni et al.


(2009) tambm obtiverem grnulos aerbios com uma alta capacidade
de remoo de carbono e amnia, em um reator piloto em bateladas
seqenciais usando esgoto municipal de baixa carga orgnica.
Desta forma, o presente trabalho teve por finalidade aprofundar
os conhecimentos relativos ao tratamento de esgotos domsticos por
grnulos aerbios, a fim de complementar a linha de pesquisa realizada
no LABEFLU e tambm contribuir com informaes relevantes para a
sociedade e a comunidade cientfica, tendo em vista que o
desenvolvimento cientfico e tecnolgico, e a difuso dos
conhecimentos gerados na rea de saneamento bsico so objetivos da
Poltica Federal de Saneamento Bsico (BRASIL, 2007).

1.2 OBJETIVOS
1.2.1 Objetivo Geral
Este trabalho teve como objetivo geral estudar o desenvolvimento
de grnulos aerbios no tratamento de esgoto domstico em um reator
em bateladas seqenciais sob diferentes condies operacionais.

1.2.2 Objetivos Especficos


Avaliar o desempenho do reator em relao remoo de
carbono e nitrognio utilizando ciclos operacionais com
diferentes tempos de durao;
Avaliar o comportamento do reator quando submetido a
diferentes cargas orgnicas;
Avaliar o efeito da diminuio do tempo de
sedimentao nas caractersticas dos grnulos e no
desempenho do reator.

29

2 FUNDAMENTAO TERICA
2.1 CONVERSO
CARBONCEA

BIOLGICA DA MATRIA

ORGNICA

O material orgnico presente nos esgotos domsticos


normalmente composto por carbono, hidrognio, oxignio e, em alguns
casos, nitrognio. A matria orgnica presente nos esgotos constituda
principalmente por protenas (40 a 60%), carboidratos (25 a 50%), e
leos e graxas (8 a 12%). Alm disso, o esgoto pode conter pequenas
quantidades de um largo nmero de diferentes molculas orgnicas
sintticas, com estruturas variando entre simples e extremamente
complexas (METCALF & EDDY, 2003).
Segundo SantAnna Jr. (2010), os poluentes orgnicos so
primeiramente adsorvidos nas superfcies dos aglomerados microbianos
(flocos, biofilmes ou grnulos) existentes no sistema de tratamento.
Dependendo das caractersticas da molcula poluente, ela poder sofrer
hidrlise ou outras transformaes catalisadas por enzimas excretadas
pelos microrganismos e que se localizam na matriz constituinte dos
aglomerados microbianos. Portanto, somente quando essas molculas
orgnicas j sofreram as transformaes pertinentes, que elas podem
ser absorvidas pelas clulas microbianas, sendo ento metabolizadas.
Essas substncias assimiladas pelas clulas bacterianas sofrem ento o
processo de biodegradao, tambm conhecido como oxidao da
matria orgnica.
A oxidao da matria orgnica responsvel pelo principal
problema de poluio das guas, que o consumo de oxignio
dissolvido pelos microrganismos nos seus processos metablicos de
utilizao e estabilizao da matria orgnica. Este consumo devido
respirao dos microorganismos decompositores, representados em sua
maioria por bactrias heterotrficas aerbias e facultativas, as quais, na
presena de oxignio, convertem a matria orgnica a compostos
simples e estveis, como gua e gs carbnico. Com isso, elas tendem a
crescer e a se reproduzir, gerando mais bactrias, enquanto houver
disponibilidade de alimento e oxignio no meio (VON SPERLING,
2005).
De maneira geral, a matria orgnica dos esgotos se apresenta em
duas formas: em suspenso, que tende a sedimentar formando o lodo de
fundo; e dissolvida, a qual permanece na massa lquida. De acordo com

30

Fernandes & Souza (2001), o processo de oxidao da matria orgnica


passa por duas etapas: a oxidao direta da matria orgnica
biodegradvel (respirao exgena) e conseqente aumento da biomassa
bacteriana, seguida da oxidao do material microbiano celular pelos
prprios microrganismos (respirao endgena).
Na etapa de respirao exgena, representada pela Equao 1,
predominam processos de catabolismo (oxidao) e anabolismo
(sntese). Segundo Van Haandel & Marais (1999), no catabolismo, parte
da matria orgnica presente na gua residuria oxidada a produtos
estveis num processo que acompanhado pela liberao de energia. Os
microrganismos desempenham este importante papel no tratamento de
esgotos, pois necessitam desta energia liberada para exercer suas
atividades metablicas (PIVELI & KATO, 2006). Assim, o anabolismo
ocorre simultaneamente ao catabolismo, sendo um processo de
assimilao ou sntese de nova massa celular a partir do material
orgnico. Desta forma, observa-se que o material orgnico serve como
fonte energtica no catabolismo e como fonte material no anabolismo
(VAN HAANDEL & MARAIS, 1999).
matria

orgnica

O2

bactrias

CO

H 2O

material

celular

Energia

Equao 1

Os processos de catabolismo e anabolismo resultam em


fenmenos mensurveis, uma vez que a oxidao da matria orgnica
causa o consumo de oxignio dissolvido na gua e a sntese microbiana
pode ser detectada atravs da determinao dos slidos em suspenso
(VAN HAANDEL & MARAIS, 1999).
A segunda etapa da oxidao da matria orgnica, a respirao
endgena, acontece quando o substrato disponvel para a biodegradao
encontra-se em sua maior parte removido e, devido a esta baixa
disponibilidade de substrato no meio, os microrganismos passam a
consumir o prprio protoplasma microbiano a fim de obter energia para
suas reaes celulares (FERNANDES & SOUZA, 2001). Isto resulta
numa auto-oxidao da matria celular e na diminuio do nmero de
organismos. Esta fase pode ser representada pela Equao 2.
material

celular

O2

bactrias

CO

H 2O

Energia

Equao 2

31

Em uma estao de tratamento de esgoto (ETE), h a coexistncia


das duas reaes (Equao 1 e Equao 2), sendo que a segunda nunca
completa, uma vez que para isso seria necessrio ter uma idade de lodo
muito elevada, o que conduziria a um significativo aumento das
unidades da ETE (DEGRMONT, 2005).
Existem ainda compostos, chamados de resduos no
biodegradveis ou recalcitrantes, para os quais os microrganismos so
incapazes de produzir enzimas que possam romper suas ligaes
qumicas, permanecendo, assim, inalterados (PIVELI & KATO, 2006).
Na Figura 1 apresentado um esquema simplificado do
metabolismo dos microrganismos heterotrficos em um ambiente
aerbio, em que os compostos orgnicos biodegradveis so
transformados em produtos finais mais estveis ou mineralizados.

Figura 1. Representao esquemtica do metabolismo bacteriano


heterotrfico em um ambiente aerbio.
Fonte: Adaptado de Van Haandel & Marais (1999).

De acordo com Jordo & Pessa (2005), para que haja a efetiva
converso da matria orgnica necessrio haver: uma populao de
microrganismos ativos; contato adequado entre os microrganismos e os
esgotos a serem degradados; disponibilidade de oxignio;

32

disponibilidade de nutrientes; e condies ambientais favorveis


(temperatura, pH, etc.).
De acordo com SantAnna Jr. (2010), a oxidao do material
orgnico pode ocorrer em uma ampla faixa de temperatura (10 a 40 C),
sendo que a velocidade do processo cresce de 10 at 35 C, e abaixo de
5 C h uma considervel queda nas velocidades de crescimento e de
metabolizao do substrato.
A oxidao da matria orgnica carboncea pode ocorrer em pH
na faixa de 6 a 9, sendo o pH timo prximo ao neutro. Em relao ao
oxignio dissolvido (OD), concentraes acima de 0,5 mgL-1
apresentam pouco efeito na taxa de degradao (METCALF & EDDY,
2003). No entanto, o ideal adotar o valor OD de mnimo igual a
2,0 mgL-1, para poder, com segurana, acomodar variaes inerentes ao
processo (temperatura, carga orgnica, entre outros) (SANTANNA JR.,
2010).
Alm disso, as bactrias heterotrficas responsveis pela
remoo da matria orgnica podem tolerar elevadas concentraes de
substncias txicas em comparao com as bactrias responsveis pela
oxidao da amnia ou pela produo de metano (METCALF & EDDY,
2003).

2.2 CONVERSO BIOLGICA DO NITROGNIO

Nas guas residurias, o material nitrogenado composto


principalmente de nitrognio amoniacal (gasoso, NH3; e salino NH4+) e
nitrognio orgnico (uria, aminocidos e outras substncias orgnicas
com o grupo amino). Ocasionalmente, ocorrem ainda traos das formas
oxidadas do nitrognio, como o nitrito (NO2-) e, principalmente, o
nitrato (NO3-) (VAN HAANDEL et al., 2009).
A remoo biolgica do nitrognio nos sistemas de tratamento de
esgoto domstico feita por dois mecanismos principais (Figura 2): 1)
sntese da biomassa (assimilao do nitrognio) e descarte do lodo; e 2)
nitrificao e desnitrificao biolgica. No tratamento de esgoto
domstico, o nitrognio pode ser removido de 15 a 30% pelo primeiro
mecanismo. Entretanto, somente com a etapa de desnitrificao
possvel alcanar um elevado nvel de remoo de nitrognio e uma
baixa concentrao de nitrognio inorgnico no efluente (USEPA,
2010).

33
Nitrognio
Orgnico

Nitrognio
Amoniacal

Nitrificao

O2

Nitrognio
Orgnico

Nitrognio
Orgnico

(clulas bacterianas)

(crescimento lquido)

Assimilao
Lise e auto-oxidao

Nitrito
O2

Nitrato

Desnitrificao

Nitrognio
Gasoso

Carbono Orgnico

Figura 2. Transformao do nitrognio nos processos biolgicos de


tratamento.
Fonte: Adaptado de Metcalf & Eddy (2003).

Neste trabalho sero abordados apenas os processos de


nitrificao e desnitrificao, os quais podem ocorrer de forma
seqencial ou simultnea.

2.2.1 Nitrificao

2.2.1.1 Princpios da Nitrificao

A nitrificao pode ser definida como sendo a oxidao biolgica


da amnia, tendo o oxignio como receptor de eltrons e o nitrato como
produto final. Esta oxidao ocorre em duas etapas seqenciais: na
primeira etapa, a amnia oxidada a nitrito, e na segunda, o nitrito
oxidado a nitrato.
Segundo Von Sperling (1996), os microrganismos envolvidos
neste
processo
so
autotrficos
quimiossintetizantes
(ou
quimioauttrofos). Esses microrganismos utilizam o gs carbnico como
principal fonte de carbono, e obtm energia atravs da oxidao de um
substrato orgnico, como a amnia, a formas mineralizadas.

34

A reao de transformao da amnia em nitrito, nitritao,


catalisada pelas bactrias oxidadoras de amnia (BOA), como as do
gnero Nitrosomonas, e pode ser expressa pela Equao 3:
NH

1, 5 O 2

Nitrosomon

as

NO

2H

H 2O

Equao 3

A reao de oxidao de nitrito a nitrato, nitratao, ocorre pela


atuao das bactrias oxidadoras de nitrito (BON), com as do gnero
Nitrobacter, e pode ser expressa pela Equao 4:
NO

0 ,5 O 2

Nitrobacte

NO

energia

Equao 4

A reao global da nitrificao a soma das Equaes 3 e 4:


NH

2 O2

NO

2H

H 2O

Equao 5

A partir da Equao 5, pode-se perceber que a nitrificao produz


acidez (H+), alm de consumir uma elevada quantidade de oxignio: 2
mols de oxignio por mol de amnia, o que corresponde a 4,57 gO2/gN
oxidado (METCALF & EDDY, 2003; BERNET & SPRANDIO,
2009). Segundo Van Haandel et al. (2009), a produo de 1 mol de H+
(acidez mineral) equivale ao consumo de 1 mol de alcalinidade (ou
50gCaCO3) portanto, durante o processo de nitrificao, tem-se um
consumo de alcalinidade igual a 100 gCaCO 3 por mol de N, o que
corresponde a 7,14 gCaCO3/gN oxidado.
Nas ultimas dcadas, com uso de metodologia gentica para
classificar os microrganismos, foi identificado que as Nitrosomonas e as
Nitrobacter, apesar de serem as mais comumente conhecidas como as
responsveis pelo processo de nitrificao, nem sempre predominam nas
ETEs. Alm dessas bactrias, outros gneros como Nitrosococcus,
Nitrosospira, Nitrosolobus e Nitrosorobrio, so tambm capazes de
oxidar a amnia a nitrito, e a oxidao do nitrito pode tambm ser
realizada por outros gneros como Nitrococcus, Nitrospira, Nitrospina,
e Nitroeystis (RITTMANN & MCCARTY, 2001; METCALF & EDDY,
2003).
Embora a nitrificao seja realizada por bactrias autotrficas, h
registros na literatura da ocorrncia desse processo tambm por ao de

35

bactrias heterotrficas que utilizam o carbono orgnico e oxidam a


amnia a nitrato, como por exemplo, Arthrobacter (VERSTRAETE &
ALEXANDER, 1972), Thiosphaera pantotropha (WEHRFRITZ et al.,
1993; GUPTA, 1997) e Alcaligenes faecalis (JOO et al., 2005).

2.2.1.2 Fatores Ambientais que Afetam a Nitrificao

Diversos fatores ambientais exercem influncia na taxa de


crescimento dos organismos nitrificantes. Dentre os fatores mais
significativos pode-se citar: tempo de reteno de slidos, temperatura,
concentrao de oxignio, pH, alcalinidade, concentrao de substratos
e presena de substncias txicas ou inibidoras. Entretanto, segundo
Bernet & Sprandio (2009), comparado com os microrganismos
heterotrficos, o crescimento das bactrias nitrificantes lento e
escasso, mesmo nas condies timas. Desta forma, nos sistemas
biolgicos de remoo de nitrognio, a nitrificao vai ser o processo de
controle, uma vez que os microrganismos nitrificantes representam
aproximadamente 2% da massa microbiana, tm exigncias estritas de
crescimento
e
so
sensveis
s
condies
ambientais
(JEYANAYAGAM, 2005).
a) Tempo de reteno de slidos (idade do lodo)
Como exposto anteriormente, as bactrias nitrificantes
apresentam uma velocidade de crescimento mais lenta do que as que
bactrias heterotrficas. Desta forma, os organismos nitrificantes
requerem um maior tempo no reator biolgico para que possam oxidar o
nitrognio amoniacal. Em conseqncia disto, o tempo de reteno de
slidos deve ser levado em considerao no dimensionamento dos
projetos para assegurar a ocorrncia da nitrificao (METCALF &
EDDY, 2003; JEYANAYAGAM, 2005). De acordo com Rittmann &
McCarty (2001), a idade do lodo deve ser igual ou maior do que 15 dias.
b) Temperatura
A maioria das bactrias nitrificantes so mesoflicas, com
temperatura tima de crescimento entre 28 e 36 C. Em vista disso, a
velocidade de crescimento das bactrias nitrificantes diminui com a
diminuio da temperatura, mas o processo de nitrificao possvel
mesmo em temperaturas em torno de 5 C. A influncia da temperatura

36

na velocidade de crescimento pode ser expressa pela equao de van't


Hoff-Arrhenius (Equao 6) (BERNET & SPRANDIO, 2009).
T

20

20

Equao 6

Onde : velocidade especfica de crescimento (d-1), 20: valor de


a 20 C (d-1), : coeficiente de temperatura (adimensional), e T:
temperatura (C).
A relao entre temperatura e velocidade de crescimento mximo
diferente entre as bactrias oxidadoras de nitrito e de amnia
(BERNET & SPRANDIO, 2009). A temperatura tima para
Nitrosomonas igual a 35 C, e para Nitrobacter na faixa de 38 C
(GRUNDITZ & DALHAMMAR, 2001). Segundo Bline (2001),
temperaturas inferiores ou superiores a temperatura tima so menos
desfavorveis ao desenvolvimento das Nitrosomonas do que das
Nitrobacter, e podem tambm conduzir acumulao de nitritos.
c) pH e Alcalinidade
A taxa de nitrificao diminui significativamente se o pH
reduzido abaixo da zona neutra (pH < 6,8), sendo que para um timo
desempenho do sistema o ideal manter o pH na faixa de 7,4 a 8,0
(METCALF & EDDY, 2003; USEPA, 2010). No entanto, segundo Ros
(1993), a nitrificao pode ocorrer em pH na faixa de 5 a 9. J de acordo
com Surampalli et al. (1997), valores de pH abaixo de 7,0 e acima de
9,8 podem reduzir a velocidade de nitrificao em cerca de 50%. Desta
forma, para garantir velocidades de nitrificao razoveis, valores de pH
entre 7,0 e 7,2 so normalmente adotados nos projetos e operaes das
ETEs (METCALF & EDDY, 2003; USEPA, 2010).
Como visto anteriormente na Equao 5, no processo de
nitrificao ocorre a liberao de H+, o que, conseqentemente, provoca
o consumo da alcalinidade do meio e a reduo do pH (VON
SPERLING, 1996). Assim, em alguns casos, para se assegurar um pH
estvel, pode ser necessria a adio de alcalinidade, na forma de cal,
carbonato de sdio, bicarbonato de sdio e hidrxido de magnsio
(METCALF & EDDY, 2003).
Alm disso, o pH tambm tem um efeito indireto no processo de
nitrificao, uma vez que afeta o equilbrio qumico entre a amnia
salina e gasosa (NH4+/NH3 - Equao 7), e o nitrito e o cido nitroso
(NO2-/HNO2 - Equao 8) (BERNET & SPRANDIO, 2009).

37
NH

OH

NH

H 2O

Equao 7
NO

HNO

Equao 8

d) Oxignio dissolvido (OD)


A presena de oxignio dissolvido um requisito indispensvel
para a ocorrncia da nitrificao. Segundo USEPA (1993), a velocidade
de crescimento das Nitrossomonas no est limitada em nveis de OD
acima de 1,0 mgL-1, mas na prtica, requerido um OD maior do que
2,0 mgL-1. A velocidade de nitrificao em concentraes de OD igual
a 0,5 mgL-1 apenas 60% da que ocorre com concentrao igual a
2,0 mgL-1 (USEPA, 2009). Alm disso, de acordo com Jeyanayagam
(2005), a nitrificao pode ser inibida quando se tem, por um perodo
prolongado, concentraes de OD abaixo de 2 mgL -1. Segundo Metcalf
& Eddy (2003), baixas concentraes de OD tem um efeito inibidor
maior nas Nitrobacter do que nas Nitrosomonas, o que pode levar a um
aumento da concentrao de nitrito no efluente. Portanto, em projetos de
sistemas de lodo ativado recomendado que o nvel mnimo de OD seja
estimado em 2,0 mgL-1 no reator biolgico para prever picos de carga
de amnia no meio lquido (FERREIRA, 2000).
Por outro lado, em sistemas de tratamento onde as bactrias
nitrificantes esto localizadas em agregados ou biofilmes, preciso
considerar a ocorrncia de diferentes gradientes de concentrao de OD
no interior desses aglomerados. Portanto, nesses sistemas, a
concentrao de oxignio requerido no meio vai ser maior (FIGUEROA
& SILVERSTEIN, 1992; BERNET & SPRANDIO, 2009).
e) Concentrao de substratos e produtos da reao
Altas concentraes de matria orgnica proporcionam condies
favorveis ao desenvolvimento de microrganismos heterotrficos, mas
podem diminuir a velocidade do processo de nitrificao, em funo da
competio pelo oxignio dissolvido que ocorre entre os organismos
autotrficos e heterotrficos (FIGUEROA & SILVERSTEIN, 1992).
A nitrificao tambm pode ser afetada pela presena de certas
formas de nitrognio, como a amnia no ionizada (NH 3) e o cido
nitroso no ionizado (HNO2). Segundo USEPA (2010), a presena de
NH3 tem um efeito inibidor maior nas BON do que nas BOA, enquanto
que a presena de HNO2 tem um efeito inibidor maior nas BOA. Como

38

exposto anteriormente nas Equao 7 e 8, a concentrao de NH3 e


HNO2 depende do pH e, conseqentemente, da temperatura.
f) Substncias txicas ou inibidoras
Os organismos nitrificantes so sensveis a diversos compostos
orgnicos e inorgnicos em concentraes bem inferiores quelas que
afetam os organismos aerbios heterotrficos (DEGRMONT, 2005).
Em muitos casos, esses compostos no causam a morte das bactrias
nitrificantes, mas inibem significativamente a sua taxa de crescimento
(USEPA, 2010), principalmente das Nitrosomonas, que so as mais
sensveis (VON SPERLING, 2002).
A utilizao de inibidores da nitrificao tem sido bastante
empregada em alguns experimentos a fim de determinar a atividade e a
taxa de crescimento das bactrias nitrificantes (SURMACZ-GORSKA
et al.,1996; GINESTET et al., 1998; NING et al., 2000; OCHOA et al.,
2002; WOLFF et al., 2003; POLLARD, 2006; WOLFF et al., 2006;
PAUL et al., 2007). O inibidor mais amplamente usado a Allylthiourea
(ATU), que um inibidor seletivo do grupo das Nitrosomonas
(SURMACZ-GORSKA et al.,1996).

2.2.2 Desnitrificao
2.2.2.1 Princpios da Desnitrificao
A desnitrificao a reduo biolgica do nitrato ou nitrito e
pode ser um processo assimilatrio e/ou dissimilatrio. A desnitrificao
assimilatria envolve a reduo de nitrato/nitrito para nitrognio
amoniacal, o qual pode ser usado na sntese de biomassa quando no
tiver NH4+-N disponvel de outra maneira. A maioria das referncias de
desnitrificao biolgica refere-se ao processo dissimilatrio, no qual o
nitrato/nitrito o aceptor final de eltrons para a oxidao de diversos
substratos orgnicos e inorgnicos (USEPA, 2010). Neste trabalho, ser
abordado apenas o processo de desnitrificao dissimilatria.
Assim, de uma maneira geral, a desnitrificao pode ser definida
como um processo onde as formas oxidadas de nitrognio nitrato e
nitrito so reduzidas a nitrognio gasoso em condies anxicas, ou
seja, ausncia de oxignio e presena de nitratos. Desta forma,
necessrio que a desnitrificao seja precedida da nitrificao.

39

A reduo do nitrato (NO3-) envolve a formao de uma srie de


produtos intermedirios, como nitrito (NO2-), xido ntrico (NO), xido
nitroso (N2O) e nitrognio gasoso (N2), com decrescente grau de
oxidao (Equao 9). Segundo Cuervo-Lpez et al. (2009), cada uma
dessas etapas catalisada por uma enzima redutase especfica, a qual
sintetizada quando as condies ambientais se tornam anxicas. As
enzimas envolvidas no processo de desnitrificao so: nitrato redutase,
nitrito redutase, xido ntrico redutase e xido nitroso redutase.
NO

NO

NO

N 2O

N2

Equao 9

Atualmente, a emisso de N2O bastante preocupante, devido ao


fato de o mesmo ser um dos mais significativos gases de efeito estufa,
com um potencial de aquecimento global aproximadamente 300 vezes
maior do que o do dixido de carbono (USEPA, 2010).
Os microrganismos desnitrificantes requerem ainda a
disponibilidade de uma fonte de carbono orgnico (doador de eltrons),
que pode ser adicionado externamente, como o metanol, ou que pode
estar presente no prprio esgoto (JORDO & PESSA, 2005). No
ltimo caso, de acordo com USEPA (2009), o carbono orgnico pode
estar na forma de produtos orgnicos solveis degradveis provenientes
do afluente, de material orgnico solvel produzido pela hidrlise do
material particulado presente no afluente, e de matria orgnica liberada
durante o decaimento endgeno da biomassa.
Segundo Derozier et al. (2001), a reao global de desnitrificao
pode ser representada pela Equao 10:
matria

orgnica

NO

bactrias

N2

H 2O

CO

novas bactrias

Equao 10

Representando a matria orgnica do esgoto como sendo


C10H19O3N, a desnitrificao pode ser representada pela Equao
11(METCALF & EDDY, 2003):
C 10 H 19 O 3 N

10 NO

bactrias
3

5N 2

3 H 2O

10 CO

NH

10 OH

Equao 11

40

A partir da Equao 11, pode-se perceber que 1 mol de


alcalinidade (OH-) produzida por mol de NO3- reduzido, o que
corresponde a 3,57 gCaCO3/gN reduzido (USEPA, 2010). Como visto
anteriormente, na nitrificao so consumidos 7,14 gCaCO3/gN
oxidado. Portanto, a incorporao da desnitrificao no sistema de
tratamento pode gerar uma economia de 50% no consumo da
alcalinidade (VON SPERLING, 2002).
A desnitrificao pode ser realizada por bactrias heterotrficas
que oxidam os substratos orgnicos, por bactrias nitrificantes
heterotrficas, e tambm por bactrias autotrficas (USEPA, 2010).
Entretanto, o processo de desnitrificao ocorre principalmente pela
atuao de bactrias heterotrficas facultativas, que na falta de oxignio
livre (O2), modificam o seu sistema enzimtico e utilizam o oxignio
presente no nitrato ou no nitrito como aceptor final de eltrons. De
acordo com Derozier et al. (2001), cerca de 50% das espcies presentes
em uma estao de tratamento so suscetveis de efetuar essa respirao
a partir dos nitratos.
As bactrias desnitrificantes mais comuns e mais largamente
distribudas so as da espcie Pseudomonas, as quais podem usar
hidrognio, metanol, carboidratos, cidos orgnicos, alcois, benzoatos,
e outros compostos aromticos para a desnitrificao. Outras bactrias
heterotrficas responsveis pelo processo de desnitrificao incluem os
seguintes gneros: Achromobacter, Acinetobacter, Agrobacterium,
Alcaligenes,
Arthrobacter,
Bacillus,
Chromobacterium,
Corynebacterium, Flavobacterium, Hypomicrobium, Moraxella,
Nesseria,
Paracoccus,
Propionibacteria,
Rhizobium,
Rhodopseudmonas, Spirillum e Vibrio (METCALF & EDDY, 2003).

2.2.2.2 Fatores que Afetam a Desnitrificao

Comparadas com as bactrias nitrificantes, as bactrias


desnitrificantes so muito menos sensveis s condies ambientais.
Desta forma, quando a nitrificao se desenvolve, a desnitrificao
tambm possvel (VAN HAANDEL et al., 2009). No entanto, os
seguintes fatores ambientais influem na velocidade de desnitrificao:
oxignio dissolvido, temperatura, pH, substrato orgnico, relao
carbono e nitrognio, e presena de substncias txicas ou inibidoras.
De acordo com USEPA (2009), a fonte de carbono empregada o fator
ambiental mais importante para o processo de desnitrificao.

41

a) Oxignio dissolvido (OD)


O nvel de OD considerado um parmetro fundamental para o
xito do processo, visto que a desnitrificao deve ser conduzida em
condies anxicas (SANTANNA JR., 2010). Contudo, de acordo com
Cuervo-Lpez et al. (2009), a atividade desnitrificante inibida de
maneira reversvel em condies aerbias.
Concentraes de OD acima de 0,2 e 0,5 mgL -1 reduzem
consideravelmente a taxa de desnitrificao (VAN HAANDEL &
MARAIS, 1999). Para Jordo & Pessa (2005), a concentrao de OD
mxima admitida de 0,1 mgL-1. No entanto, segundo Ferreira (2000),
na prtica usual e aceitvel se trabalhar com concentraes de OD em
torno de 0,5 mgL-1, com mximo de 1,0 mgL-1, onde ento comea a
inibio mais intensa da desnitrificao.
Na realidade, difcil estabelecer uma concentrao de OD limite
alm da qual a desnitrificao inibida, pois esses valores dependem do
tamanho dos agregados microbianos e, portanto, da transferncia de OD
para as bactrias, alm de depender da natureza e da concentrao de
carbono orgnico (DEGRMONT, 2005).
b) Temperatura
A taxa de consumo de nitrato e a velocidade de crescimento dos
microrganismos desnitrificantes so afetadas pela temperatura. De
acordo com Lalucat et al. (2006), o processo de desnitrificao pode
ocorrer em temperaturas na faixa de 5 a 35 C. No entanto, segundo
Jeyanayagam (2005), elevadas temperaturas provocam o aumento da
atividade microbiana, conduzindo a maiores taxas de desnitrificao,
sendo que para uma dada concentrao de substrato, uma mudana de
temperatura de 20 C para 10 C pode provocar uma diminuio de
aproximadamente 75% da velocidade de desnitrificao. Assim,
Cuervo-Lpez et al. (2009) recomendam que a temperatura seja mantida
entre 20 e 35 C a fim de se obter uma constante e aceitvel velocidade
de desnitrificao. Segundo esses autores, os efeitos de baixas e altas
temperaturas esto principalmente relacionados com as mudanas fsicoqumicas nas estruturas das membranas celulares.
c) pH
A dependncia do pH na desnitrificao muito menos acentuada
que na nitrificao (VAN HAANDEL et al., 2009). A velocidade de
desnitrificao mxima para a faixa de pH entre 7,0 e 7,5, sendo que
para pH menor do que 6,0 e maior do que 8,5 h uma grande diminuio
da atividade de desnitrificao (VAN HAANDEL & MARAIS, 1999).

42

Segundo Degrmont (2005), o pH timo para a desnitrificao se situa


entre 7,0 e 8,2, enquanto que para Surampalli et al. (1997) e Jordo &
Pessa (2005), o pH timo est na faixa de 6,5 a 8,0.
d) Substrato orgnico
Como exposto anteriormente, a presena de carbono
biodegradvel muito importante para a ocorrncia da desnitrificao,
sendo muitas vezes necessria a adio de uma fonte externa de
carbono. Contudo, a velocidade de desnitrificao pode ser afetada pela
natureza do substrato orgnico utilizado como doador de eltrons.
Velocidades significativamente mais elevadas so possveis
utilizando-se metanol e produtos finais da fermentao, tais como os
cidos graxos volteis presentes no esgoto afluente. No entanto, a
utilizao do carbono orgnico liberado pela respirao endgena
associada a baixas velocidades de desnitrificao (JEYANAYAGAM,
2005). Na Tabela 1 esto apresentadas as cinticas de reduo dos
nitratos de alguns substratos orgnicos.
Tabela 1. Cintica de reduo dos nitratos de alguns substratos
orgnicos.

Substrato orgnico
Etanol
Acetato
Propionato
Metanol
Butirato
Esgoto domstico
Respirao endgena

Cintica de reduo (1)


(mg NO3--N reduzido/g de matria voltilh)

5,1
4,9
5,1
2,5
5,1
3,3
1,5

(1)

Temperatura a 20 C.
Fonte: Degrmont, 2005.

e) Relao carbono/nitrognio (C/N)


A relao C/N considerada um importante parmetro para o
processo de desnitrificao. De acordo com Jeyanayagam (2005), a
relao DBO/NTK mnima no afluente necessria para assegurar o
desenvolvimento da desnitrificao de aproximadamente 3/1. O valor
mais adequado da relao C/N deve ser determinado caso a caso, pois o
desempenho do processo depende da conjugao de diversos fatores,

43

como por exemplo, as condies operacionais e a biodegradabilidade do


substrato (JEYANAYAGAM, 2005; SANTANNA JR., 2010).
f) Substncias txicas ou inibidoras
No h muita informao sobre a influncia de substncias
txicas para o processo de desnitrificao, alm da inibio j
mencionada de OD e pH (VAN HAANDEL et al., 2009). Segundo
SantAnna Jr. (2010), baixos valores de pH e OD inibem a enzima xido
nitroso redutase, fazendo com que esse gs de efeito estufa seja o
produto final do processo de desnitrificao.
As bactrias desnitrificantes encontram-se presentes em uma
maior diversidade de espcies, o que reduz o impacto de algum agente
inibidor especfico. Em geral, as bactrias nitrificantes so mais
sensveis presena de materiais txicos do que as bactrias
desnitrificantes (VON SPERLING, 2002; VAN HAANDEL et al.,
2009).

2.2.3 Nitrificao e Desnitrificao Simultneas (NDS)

2.2.3.1 Princpios da NDS


As estaes convencionais de tratamento de esgotos so baseadas
no princpio que a nitrificao um processo aerbio, enquanto a
desnitrificao restrita a condies anxicas. Isto implica na separao
espacial da nitrificao e da desnitrificao, ou na separao temporal,
alternando fases aeradas e no aeradas na mesma unidade (PATUREAU
et al., 1997). Desta forma, os sistemas convencionais apresentam muitas
etapas para a remoo do nitrognio, exigindo uma complicada
seqncia de operaes e, conseqentemente, uma grande rea de
instalao (MORITA et al., 2008), o que, por sua vez, gera maiores
custos de implantao.
Diversos estudos mostraram que a nitrificao e a desnitrificao
podem ocorrer simultaneamente em um mesmo reator (PATUREAU et
al., 1997; POCHANA & KELLER, 1999; GUO et al., 2005; RUAN et
al., 2006; CHIU et al., 2007; JU et al., 2007; BAEK & PAGILLA,
2008; HE et al., 2009; RAHIMI et al., 2011). Este processo conhecido
como nitrificao e desnitrificao simultneas (NDS) (do ingls
simultaneous nitrification denitrification SND).

44

A NDS tem sido aplicada em vrios tipos de processos biolgicos


de tratamento, como biorreatores membrana (WANG et al., 2005a;
BAEK & PAGILLA, 2008; HE et al., 2009), reatores de grnulos
aerbios (MOSQUERA-CORRAL et al., 2005a; RUAN et al., 2006),
reatores em bateladas seqenciais (CHIU et al., 2007; THANS et al.,
2009), reatores de leito fluidizado (SEN & DENTEL, 1998), reatores de
biofilme (GUO et al., 2005; RAHIMI et al., 2011), e reatores hbridos
em bateladas seqenciais (WANG et al., 2008; WALTERS et al., 2009).
Ju et al. (2007), resumiram em trs os mecanismos responsveis
pelas reaes de NDS: presena de micro zonas anxicas/aerbias no
interior dos flocos, biofilmes ou grnulos, devido limitao da difuso
de oxignio; presena de macro zonas anxicas/aerbias no interior do
reator biolgico; ou ainda, presena de microrganismos capazes de
nitrificar e desnitrificar, simultaneamente, sob condies aerbias.
Em relao ao primeiro mecanismo, como exposto anteriormente,
a concentrao de OD no lquido no representa a real concentrao de
OD no interior dos agregados microbianos (flocos, grnulos ou
biofilmes) devido limitao da difuso de oxignio. De acordo com Ju
et al. (2007), medida que o oxignio presente no meio lquido se
difunde no floco este consumido pelos organismos, criando um
gradiente de concentrao de OD. Segundo USEPA (2010), isso ocorre
quando a concentrao de OD no lquido suficientemente baixa,
fazendo com que o OD difundido seja removido antes de penetrar toda a
profundidade do floco.
Assim, como conseqncia, existem dentro dos agregados zonas
com alta concentrao de OD, onde os organismos nitrificantes esto
ativos, e zonas com baixa concentrao de OD, onde esto
preferencialmente ativos os organismos desnitrificantes (MUNCH et al.,
1994). Essa distribuio desigual de OD dentro da biomassa permite a
proliferao simultnea das bactrias nitrificantes e desnitrificantes
(CHIU et al., 2007). Desta forma, o nitrato produzido na zona aerbia
pelo processo de nitrificao difunde-se, junto com os substratos, para a
zona anxica interna, de modo que a desnitrificao ocorre na parte mais
interna do floco (LIU et al., 2010a). Na Figura 3 apresenta-se o perfil da
concentrao de OD e do substrato em um agregado microbiano.
No segundo mecanismo, ocorre estratificao de OD no interior
do reator, com a existncia de zonas aerbias e anxicas devido s
condies de mistura e a distncia do ponto de aerao (METCALF &
EDDY, 2003). Portanto, tm-se pontos de OD mnimo, onde a
desnitrificao pode ocorrer, e mximo (perto dos aeradores), onde
ocorre a nitrificao (VAN HAANDEL et al., 2009).

45

Meio lquido

Camada de difuso

Zona aerbia

Concentrao
Zona anxica

Entretanto, segundo Van Haandel et al. (2009), como a demanda


de oxignio varivel e geralmente se aplica uma aerao esttica, a
concentrao de OD variar com o tempo e as zonas anxicas tero
volume varivel. Desta forma, a desnitrificao vai ser irregular: quando
a carga baixa, a demanda de oxignio ser pequena, a concentrao de
OD alta e a desnitrificao limitada; por outro lado, em momentos de
maior carga, a desnitrificao se desenvolver mais, mas poder haver
nitrificao incompleta devido falta de OD.

DBO
NH4+-N
O2

NO2NO3-

Figura 3. Concentrao de OD e substrato em um agregado


microbiano.
Fonte: He et al. (2009).

Referente ao terceiro mecanismo de NDS, diversos autores


demonstraram a habilidade de algumas bactrias em desnitrificar sob
circunstncias inteiramente aerbias, como a Thiosphaera pantotropha
(ROBERTSON et al., 1988), Comamonas sp. (PATUREAU et al.,
1997), Microvirgula aerodenitrificans (PATUREAU et al., 1998),
Citrobacter diversus (HUANG & TSENG, 2001), Pseudomonas
aeruginosa (CHEN et al., 2003), Alcaligenes faecalis (JOO et al., 2005)
Pseudomonas putida (KIM et al., 2008b), Providencia rettgeri
(TAYLOR et al., 2009), entre outras. Esses microrganismos utilizam o
oxignio e o nitrato simultaneamente como aceptores de eltrons (co-

46

respirao), a fim de alcanar uma elevada velocidade de crescimento


biolgico (HUANG & TSENG, 2001). Robertson et al. (1988) mostrou
que a co-respirao um importante mecanismo na desnitrificao
aerbia.
Alguns desses microrganismos podem efetuar a desnitrificao
aerbia em concentraes de OD prximas a 7 mgL -1 (PATUREAU et
al., 1997). De acordo com Robertson et al. (1989), os microrganismos
capazes de desnitrificar sob altas concentraes de OD, como a
Thiosphaera pantotropha e a Alcaligenes faecalis, podem tambm
efetuar a nitrificao heterotrfica, como exposto no item 2.2.1.1. Isto
implica na completa converso da poluio amoniacal em nitrognio
gasoso por um nico microrganismo (PATUREAU et al., 1997).
Nesse caso, as reaes do metabolismo heterotrfico de NDS so
diferentes daquelas dos nitrificantes autotrficos e dos desnitrificantes
heterotrficos: a amnia convertida a hidroxilamina (NH 2OH) sob
condies aerbias, a qual por sua vez oxidada a nitrito, e, finalmente,
o nitrito diretamente transformado em N2 (CHIU et al., 2007).
De uma maneira geral, o processo de NDS apresenta as seguintes
vantagens:
No necessita de unidades de desnitrificao separadas ou de
fases alternadas de reaes anxicas/aerbias nos reatores,
simplificando a operao do sistema de tratamento (POCHANA
& KELLER, 1999);
Requer menos gastos com produtos qumicos para ajustar o pH
do sistema, uma vez que a alcalinidade consumida durante a
nitrificao parcialmente recuperada pela desnitrificao
(HUANG & TSENG, 2001);
Utiliza de 22 a 40% menos fonte de carbono e reduz a produo
de lodo em 30% (TURK & MAVINIC, 1987);
Consome menos energia devido menor necessidade de
aerao (COLLIVIGNARELLI & BERTANZA, 1999).

2.2.3.2 Fatores que afetam a NDS

Diversos fatores influenciam a ocorrncia do processo NDS,


como a estrutura, tamanho, densidade e concentrao dos agregados,
concentrao de OD, relao alimento/microrganismo (A/M), pH, entre
outros (WANG et al., 2005a; HE et al. 2009).

47

a) Oxignio dissolvido (OD)


O nvel de OD considerado o principal parmetro para o
estabelecimento da NDS. Segundo USEPA (2010), a concentrao de
OD na qual a NDS possvel, depende da concentrao da biomassa, da
taxa de consumo de oxignio (TCO), da temperatura, da carga de
substrato e do tamanho do floco.
Baek & Pagilla (2008), operando um biorreator membrana,
obtiveram uma NDS mais efetiva quando a concentrao de OD foi
igual a 0,6 mgL-1, sendo que em concentraes de OD maiores do que
0,6 mgL-1 ocorreu a acumulao de nitrito, a qual pode ter sido causada
pela inibio temporria da etapa de nitratao. Thans et al. (2009),
operando um reator em bateladas seqenciais em escala real, verificaram
que a eficincia de NDS diminuiu de 50 para 19% quando a
concentrao de OD foi maior do que 0,6 mgL-1.
Wang et al. (2005a), tambm operando um biorreator
membrana, observaram que a NDS foi mais eficiente quando o OD foi
mantido em 1 mgL-1, e a nitrificao foi inibida com OD igual a
0,5
mgL-1 devido ao suprimento inadequado de oxignio para a completa
nitrificao. Desta forma, de acordo com Zhao et al. (1999), o OD deve
estar disponvel para as nitrificantes, mas, ao mesmo tempo, no deve
exceder um determinado nvel, a fim de no inibir as desnitrificantes.
Alm disso, concentraes de OD muito elevadas so
inadequadas para o processo de NDS, uma vez que nessas condies o
OD ir penetrar nos bioflocos, dificultando a formao da zona anxica
e afetando a desnitrificao (WANG et al., 2005a; HE et al., 2009).
Segundo Zhao et al. (1999), a difuso completa do oxignio presente no
meio lquido para o interior do floco ocorre em concentrao de OD
entre 0,6 e 2,5 mgL-1, dependendo do tamanho do floco.
Entretanto, alguns microrganismos desnitrificantes aerbios como
Citrobacter diversus podem tolerar concentraes de OD maiores do
que 5 mgL-1 (HUANG & TSENG, 2001). O microrganismo
desnitrificante aerbio mais estudado, a bactria Thiosphaera
pantotropha, apresenta, em concentraes de OD prximas a
5,6 mgL-1, uma velocidade de desnitrificao equivalente a 50% da
calculada em condies anxicas (ROBERTSON et al., 1988).
b) Tamanho dos agregados
O tamanho e a densidade dos flocos afetam a difuso de OD. Nos
flocos grandes h uma maior distncia de difuso, dificultando a
penetrao de OD, e facilitando a formao da zona anxica. Alm
disso, quanto mais denso o floco, maior a quantidade de microrganismos

48

contidos na sua unidade de volume e maior o consumo de oxignio


(WANG et al., 2005a; HE et al., 2009).
Segundo Van Loosdrecht & Jetten (1998), flocos com tamanhos
em torno de 0,15 mm so suficientes para permitir uma substancial
desnitrificao nos processos de tratamento convencionais.
Pochana & Keller (1999) observaram que uma diminuio do
tamanho do floco de 80 para 40 m resultou em uma reduo da NDS
de 52 para 21%. Neste caso, a velocidade de nitrificao permaneceu
constante, sugerindo que a queda na NDS foi devida diminuio do
tamanho da zona anxica interna.
c) Temperatura e pH
O efeito da temperatura e do pH na NDS no tem sido muito
contemplado por estudos especficos. de se supor que a condio mais
conveniente para a simultaneidade dos processos deve ser alcanada via
as mais apropriadas condies de conduo dos processos individuais
(SANTANNA JR., 2010).
De acordo com Wang et al. (2005a) e He et al. (2009), o pH ideal
para a NDS em torno de 7,5. Contudo, Sen & Dentel (1998)
consideram que o pH no essencial para a ocorrncia da NDS, embora
provavelmente melhore a eficincia do processo. Em relao
temperatura, segundo SantAnna Jr. (2010), os estudos de NDS tm sido
realizados, em geral, na faixa de 15 a 30 C. Liu et al. (2010a),
observaram que h um aumento da ocorrncia de NDS em temperaturas
elevadas (acima de 12 C).
d) Relao A/M
O fornecimento de substncia orgnica como fonte de carbono
um importante fator para a ocorrncia da NDS, uma vez que as bactrias
heterotrficas presentes na zona aerbia e as bactrias desnitrificantes
presentes na zona anxica competem pelo substrato. Assim, a parte
externa do floco ocupada pelas bactrias heterotrficas e,
conseqentemente, ser mais fcil para elas obterem alimento do meio
lquido do que as bactrias desnitrificantes presentes na zona anxica
interna. Durante o processo de difuso do substrato orgnico do meio
lquido para o interior dos flocos e, posteriormente, para a zona anxica,
uma grande quantidade do substrato orgnico utilizada pelas bactrias
heterotrficas, sendo que o substrato remanescente pode no atender a
quantidade requerida para o processo de desnitrificao. Desta forma, o
fornecimento de substrato orgnico deve ser adequado para manter uma
alta relao A/M. Do contrrio, uma baixa relao A/M pode levar a um

49

elevado consumo do substrato, afetando a desnitrificao (WANG et al.,


2005a; HE et al., 2009).

2.3 REATORES EM BATELADAS SEQENCIAIS (RBS)

A verso original do sistema de lodos ativados funcionava em


batelada. No entanto, devido necessidade de reduo de mo-de-obra
para operao e das limitaes tcnicas na poca para estabelecer a
automao do ciclo dos reatores em bateladas seqenciais (RBS), estes
logo foram substitudos pelo processo contnuo (SANTOS et al., 2006a).
Com os avanos tecnolgicos e as melhorias nos equipamentos
utilizados, especialmente dos dispositivos de aerao e dos sistemas de
controle computacional, os RBS se tornaram uma alternativa vivel em
relao aos sistemas convencionais de lodo ativado (AL-REKABI et al.,
2007).
Os RBS vm ganhando difuso para o tratamento de esgotos
domsticos e industriais, particularmente em reas que apresentam
vazes baixas ou variveis, como campings, canteiros de obras, escolas
rurais e hotis (AL-REKABI et al., 2007; USEPA, 2009). No caso de
esgotos domsticos, a remoo de nutrientes (nitrognio e fsforo) pode
ser alcanada em altos nveis explorando-se a versatilidade do sistema,
que pode operar em condies anxicas ou xicas, caso necessrio
(SANTANNA JR., 2010).
Esses reatores operam em fluxo intermitente e consistem
basicamente em um nico tanque, o qual serve como reator biolgico e
tambm como decantador. Segundo Von Sperling (2002), utilizando
tanque nico, os processos e operaes associados ao tratamento de
esgotos passam a ser simplesmente seqncias no tempo, no
necessitando de unidades separadas, como ocorre nos processos de fluxo
contnuo. Assim, todas as etapas do tratamento ocorrem em um ou mais
reatores de mistura completa, atravs do estabelecimento de ciclos de
operao que apresentam duraes definidas.
A operao do RBS envolve basicamente as seguintes fases
(Figura 4): enchimento, reao, sedimentao, retirada e repouso.
Na fase de enchimento ocorre a adio do esgoto bruto no reator,
que pode ser realizada com os aeradores e/ou agitadores ligados ou
desligados, dependendo do objetivo do tratamento (SINGH &
SRIVASTAVA, 2010). Antes de comear essa fase, j est no reator a
biomassa que permaneceu do ciclo anterior (repouso), a qual ir

50

interagir com o novo afluente durante o enchimento. Segundo Al-Rekabi


et al. (2007), a determinao do volume de enchimento baseada em
diversos fatores, tais como a carga que se deseja aplicar, o tempo de
deteno e as caractersticas de sedimentao dos organismos.

1 - Enchimento

5 - Repouso

4 - Retirada

2 - Reao

3 - Sedimentao

Figura 4. Fases de operao de um RBS.

Algumas estratgias de enchimento tm sido reportadas na


literatura. De acordo com NEIWPCC (2005), a agitao e a aerao
podem variar durante o enchimento a fim de criar trs diferentes
cenrios: enchimento esttico, ou seja, sem aerao ou agitao;
enchimento agitado, sem aerao, mas com os agitadores mecnicos
ligados; e enchimento aerado, com os aeradores e agitadores ligados.
Guo et al., (2007 reporta que o enchimento do tipo escalonado
(step-feed), com mltiplas fases aerbias e anxicas, proporciona uma
maior remoo de nitrognio (>98%) quando comparado ao processo
com um nico enchimento. Costa et al. (2008), estudando o tratamento
de esgoto domstico em um Reator Hbrido em Bateladas Seqenciais
(RHBS) operado com trs enchimentos escalonados, obtiveram um
efluente de boa qualidade, com eficincia de remoo de NH4+-N de at
99%.
Com o reator cheio, inicia-se a etapa de reao, que tem por
objetivo efetuar a remoo do substrato iniciada durante o enchimento.

51

De acordo com Wilderer et al. (1997), esta etapa realizada em mistura


completa e pode apresentar uma alternncia de condies aerbias,
anxicas e anaerbias, dependendo do objetivo do tratamento. O
ligamento/desligamento cclico dos aeradores fornece condies para a
nitrificao, desnitrificao e remoo de fsforo (SINGH &
SRIVASTAVA, 2010). Alm disso, a maior parte da matria orgnica
carboncea removida nessa fase (NEIWPCC, 2005). A durao da fase
de reao pode ser de 50% ou mais do tempo total do ciclo (ALREKABI et al., 2007; SINGH & SRIVASTAVA, 2010).
Na sedimentao os aeradores e agitadores so desligados e
ocorre a separao slido/lquido, ou seja, a sedimentao do lodo e a
decantao do efluente tratado. Ferreira (2000) considera esta fase
semelhante ao que acontece nos clarificadores de tratamentos biolgicos
convencionais, sendo mais eficiente do que nos decantadores contnuos,
uma vez que no h a interferncia da entrada e/ou sada dos lquidos.
De acordo com NEIWPCC (2005), a sedimentao a parte mais crtica
do ciclo, pois os slidos que no sedimentam rapidamente podem sair do
reator, degradando a qualidade do efluente.
Na etapa de retirada realiza-se o descarte do sobrenadante
(efluente tratado) do reator. Segundo Singh & Srivastava (2010), o
mecanismo de retirada deve ser projetado e operado de maneira a
prevenir que algum material flotado saia com o efluente tratado.
Depois desta fase, a biomassa permanece no reator em repouso
at o comeo do prximo ciclo. Segundo Jordo & Pessa (2005), a fase
de repouso usada para ajustar o tempo entre o fim de um ciclo e o
incio de outro, e a remoo do lodo excedente pode ser realizada
durante essa fase. Quando necessrio essa fase tambm pode ser usada
para aumentar a durao de uma ou mais fases (ARTAN & ORHON,
2005).
O tempo de durao de cada fase tem considervel influncia no
desempenho do reator, sendo considerada a varivel mais importante de
dimensionamento (KATSOGIANNIS et al., 2002). Metcalf & Eddy
(2003) sugerem que a porcentagem do tempo de cada perodo, em
relao durao total do ciclo, seja de: enchimento = 25%, reao =
35%, sedimentao = 20%, retirada = 15%, e repouso = 5%.
A ocorrncia sucessiva de todas estas fases compe o que se
denomina de um ciclo, sendo que ao longo de um dia o sistema pode
operar com um ou mais ciclos. Os RBS geralmente operam com dois at
quatro ciclos por dia (JORDO & PESSA, 2005).
Segundo Santos et al. (2006b), a operao segundo um ciclo
seqencial implica na diviso do reator em duas zonas sobrepostas: zona

52

de carga e zona de lodo (Figura 5). A zona de carga refere-se parte


superior do volume til do tanque, sendo alternadamente enchida e
esvaziada, o que determina a intermitncia do fluxo de esgoto. A parte
inferior consiste na zona de lodo, na qual acumulado o lodo do reator
aps a sedimentao. Por medida de segurana e visando evitar, durante
a fase de retirada, o arraste do lodo sedimentado, necessrio existir
uma zona de transio entre a zona de carga e de lodo, composta por
uma camada de lquido clarificado.

Figura 5. Representao esquemtica do RBS (VB = volume da zona de


carga; VF = volume da zona de transio; e VL = volume da zona de
lodo).
Fonte: Adaptado de Santos et al. (2006b).

Para que o sistema tenha boa eficincia, necessrio que haja


suprimento satisfatrio de oxignio e que a massa de microrganismos no
interior do reator seja suficiente para metabolizar a matria orgnica
presente no esgoto. necessrio tambm que seja efetuada corretamente
a remoo do excesso de lodo, a fim de que no haja fuga de biomassa
no efluente tratado (SANTOS et al., 2006b).
Alm disso, para otimizar o desempenho do sistema, dois ou mais
reatores so usados em uma seqncia pr-determinada de operaes, de
modo que um reator esteja enchendo enquanto o outro est na fase de
reao, sedimentao ou retirada (USEPA, 1992; MAHVI, 2008).

53

Os reatores em bateladas seqenciais apresentam as seguintes


vantagens:
So bastante flexveis, uma vez que possvel ajustar o
tempo dos ciclos atravs da mudana da durao das
fases no painel de controle, o que torna esse tipo de
tratamento bastante adequado para o equacionamento de
problemas provenientes de grandes variaes de carga
(WILDERER et al., 2001);
Podem ser facilmente adaptados a fim de atender as
mudanas de regulao dos parmetros de lanamento de
efluentes (USEPA, 1999);
A massa biolgica permanece no reator durante todo o
ciclo, eliminando a necessidade de decantadores
separados e de elevatrias de recirculao do lodo (VON
SPERLING, 2002);
Facilidade de mudana entre condies de altas e baixas
relaes A/M (alimento/microrganismo) durante a fase
de reao (GOMES & SOUZA, 1998);
Possibilidade de impor ao reator diferentes condies de
oxignio dissolvido (aerobiose, anaerobiose e anoxia), a
fim de alcanar a remoo biolgica de nutrientes,
incluindo a nitrificao, desnitrificao e remoo de
fsforo (AL-REKABI et al., 2007).
Entretanto, esses sistemas apresentam tambm algumas
desvantagens:
Descarte do efluente tratado de forma pontual, a cada
trmino do ciclo, podendo gerar choque de carga para o
corpo receptor, caso haja problemas no tratamento
(COSTA, 2005);
Possibilidade de obstruo dos dispositivos de aerao
durante o funcionamento dos ciclos (SINGH &
SRIVASTAVA, 2010);
Problemas na sedimentao do lodo podem resultar na
presena de slidos no efluente tratado, diminuindo a
eficincia do processo (USEPA, 1992).
Elevado nvel de sofisticao e manuteno, comparado
com os sistemas convencionais, associados com a
necessidade de controles, interruptores e vlvulas
automatizadas (USEPA, 1999).
2.4 GRNULOS AERBIOS

54

2.4.1 Caractersticas Gerais

As tecnologias desenvolvidas no tratamento de efluentes baseadas


na formao de biomassa granular incluem processos de granulao
aerbia e anaerbia.
A formao dos grnulos anaerbios j foi extensivamente
estudada por diversos autores (LETTINGA et al., 1980; SPONZA,
2001; LIU et al., 2003b; HULSHOFF POL et al., 2004; YE et al., 2004;
SHE et al., 2006; WENJIE et al., 2008). Atualmente, existem no mundo
todo, diversas estaes de tratamento de esgoto que aplicam a tecnologia
de granulao anaerbia, sendo o mais conhecido os reatores anaerbios
de fluxo ascendente e manta de lodo (do ingls Upflow Anaerobic
Sludge Blanket UASB).
Recentemente, a formao da biomassa na forma de grnulos
aerbios tem sido estudada em diversos pases (BEUN et al., 1999;
TAY et al., 2001a; BEUN et al., 2002; LIN et al., 2003; MOSQUERACORRAL et al., 2005; DE KREUK & VAN LOOSDRECHT, 2006; DI
IACONI et al., 2007; HUBNER, 2008; MCSWAIN & IRVINE, 2008;
NI et al., 2009; THANH et al., 2009; VAZQUEZ-PADIN et al., 2009).
Mishima & Nakaruma (1991) foram os primeiros a relatar a
formao de grnulos em um reator aerbio de fluxo ascendente
contnuo. Desde ento, a maioria das pesquisas sobre granulao aerbia
tem sido focada em reatores em bateladas seqenciais operados em
sucessivos ciclos que incluem as seguintes fases: enchimento, aerao,
sedimentao e descarte.
Segundo De Kreuk et al. (2005b), os grnulos aerbios podem ser
definidos como sendo agregados de origem microbiana, que coagulam
sob efeito de condies hidrodinmicas de estresse elevadas e que
sedimentam significativamente mais rpido que os flocos de lodos
ativados. Ainda em comparao com os flocos, os grnulos possuem
uma estrutura fsica forte, regular e densa, elevada reteno de
biomassa, excelente capacidade de sedimentao, elevada atividade,
capacidade de tratar esgotos de alta concentrao e suportar cargas de
choque (LIN et al., 2003; LIU AND TAY, 2004).
Ademais, uma vez que os grnulos aerbios apresentam uma
estrutura compacta, com tamanho variando geralmente entre 0,5 e 2
mm, a resistncia transferncia de massa, especialmente de oxignio,
maior do que no floco de lodo ativado convencional (LIU & TAY,
2006). Portanto, a limitao da difuso do oxignio dentro do grnulo,

55

permite a existncia simultnea de zonas aerbias, anxicas e


anaerbias, o que, por sua vez, cria condies ambientais favorveis
para o crescimento de bactrias aerbias e facultativas, possibilitando a
remoo de carbono, nitrognio e fsforo ao mesmo tempo (LI et al.,
2005; WANG et al., 2009). A combinao desses processos pode ser
visualizada na Figura 6.
Segundo De Kreuk (2006), o mecanismo de remoo de
nutrientes atravs de grnulos semelhante ao utilizado nos sistemas
convencionais de lodos ativados, sendo que a principal diferena reside
no fato de no ser necessria a utilizao de diversos tanques, mas sim, a
criao de diferentes zonas do interior do grnulo.

Figura 6. Combinao de processos nos grnulos aerbios.


Fonte: Adaptado de Figueroa et al., 2009.

Aps o enchimento, a concentrao de carbono orgnico (por


exemplo, acetato) no meio lquido elevada. Esse substrato
completamente difundido para o interior dos grnulos, sendo
parcialmente convertido e armazenado na forma de polmeros, como os
polihidroxibutiratos (PHB). A formao de PHB um dos principais
mecanismos para a produo de grnulos densos, uniformes e estveis.
Em relao ao OD, o mesmo tem uma profundidade de penetrao
muito menor do que o carbono orgnico, em funo do rpido consumo
de OD pelos organismos autotrficos e heterotrficos localizados na
camada externa do grnulo. O nitrito e o nitrato, produzidos pela
nitrificao, vo difundir em direo ao centro dos grnulos. Nesta zona,
o PHB est disponvel para ser usado como fonte de carbono para o
processo de desnitrificao. Desta forma, a remoo de nitrognio
ocorre no interior dos grnulos atravs do processo de NDS. Com a

56

diminuio da concentrao de substrato, a penetrao de OD no


grnulo vai ser maior, uma vez que a sua concentrao no meio lquido
vai ser mais elevada (DE KREUK & DE BRUIN, 2004; FIGUEROA et
al., 2009).

2.4.2 Formao dos Grnulos Aerbios

A granulao aerbia considerada como sendo um agrupamento


das clulas por meio de um processo de auto-imobilizao, formando
assim uma associao estvel e multicelular (LIU et al., 2005a). A
formao dos grnulos um processo que envolve interaes entre as
clulas, as quais incluem fenmenos biolgicos, fsicos e qumicos (LIU
& TAY, 2004). De acordo com Tay et al. (2001a), este processo se
inicia pela formao de agregados densos a partir do lodo utilizado
como inculo, passando, posteriormente, para a forma de lodo granular
e finalmente para grnulos maduros e compactos.
Chen et al. (2006) dividiram o processo de formao dos grnulos
em basicamente trs etapas nomeadamente aclimatao, multiplicao e
maturao, de acordo com a taxa de crescimento especfico dos
grnulos. J Liu & Tay (2002) descreveram o processo de biogranulao
aerbia em 4 etapas. Na Etapa 1 ocorre o movimento fsico responsvel
pelo contato entre as bactrias. Esse movimento proporcionado pelas
foras hidrodinmica, de difuso e gravitacional, pelo movimento
Browniano e pela mobilidade das prprias clulas. Na Etapa 2 verificase a estabilizao do contato multicelular resultante das foras de
atrao iniciais. Nesta etapa, os organismos filamentosos auxiliam a
formao de uma estrutura tridimensional, a qual vai fornecer um
ambiente estvel para o crescimento aderido das bactrias. Na Etapa 3
observa-se o crescimento e a maturao do aglomerado de clulas,
formados a partir da produo de polmeros extracelulares, das
alteraes metablicas e da criao de ambientes que induzam
alteraes genticas, as quais, por sua vez, facilitam as interaes
celulares e promovem o desenvolvimento de grnulos com uma
estrutura organizada. Na Etapa 4 atinge-se o estado estacionrio da
estrutura tridimensional do agregado microbiano, que foi moldada a
partir das foras hidrodinmicas.
2.4.3 Fatores que Afetam a Granulao Aerbia

57

As bactrias no se agregam naturalmente devido s foras


eletrostticas de repulso e s interaes de hidratao que existem entre
elas (LIU & TAY, 2004). Desta forma, para que os microrganimos se
agreguem, diversas condies precisam ser satisfeitas. Os principais
parmetros reportados na literatura que afetam a formao e as
propriedades dos grnulos aerbios so: composio do substrato, carga
orgnica, alternncia de concentrao de substrato, durao do ciclo,
foras de cisalhamento hidrodinmico, tempo de sedimentao, tempo
de reteno hidrulica e configurao do reator.
a) Composio do substrato
O processo de formao de grnulos aerbios pode ocorrer a
partir de uma grande variedade de substratos, incluindo glicose, acetato,
etanol, fenol, fcula, amido, molases, sucrose e outros meios sintticos,
e tambm com esgotos de origem domstica e industrial (FIGUEROA et
al., 2009). Segundo Liu et al. (2010b), a granulao aerbia
independene do tipo de substrato, o que permite uma ampla aplicao
dessa tecnologia para o tratamento de vrios tipos de afluentes.
Para Tay et al. (2001a), as caractersticas do substrato no afetam
diretamente a formao dos grnulos, mas tm um profundo impacto na
estrutura fsica e na diversidade das espcies presentes nos mesmos.
Como exemplo, pode-se citar os estudos de Tay et al. (2001a) e Wang et
al. (2004), os quais observaram que os grnulos cultivados com glicose
apresentaram uma superfcie filamentosa, enquanto que os grnulos
cultivados com acetato apresentaram uma estrutura compacta e
dimetros mais elevados.
b) Carga orgnica
A carga orgnica um importante parmetro operacional que
pode afetar o processo de granulao atravs da seleo e
enriquecimento de diferentes espcies de bactrias e influenciar no
tamanho, na sedimentao e na atividade microbiana dos grnulos (TAY
et al., 2004b; TAY & YAN, 1996).
Os grnulos aerbios podem ser formados em uma ampla faixa de
carga (entre 2,5 a 15 kgDQOm-3d-1) (LIU et al., 2005a). Entretanto,
Tay et al. (2004b) demonstraram que difcil formar grnulos quando a
carga orgnica menor do que 2,0 kgDQOm-3d-1. Segundo Moy et al.
(2002) e De Kreuk (2006), a utilizao de cargas relativamente elevadas
facilita o processo de granulao.

58

No caso dos RBS, a carga orgnica depende tanto da


concentrao de substrato afluente, como da carga hidrulica, sendo esta
ltima governada pelo percentual de troca volumtrica (volume de
enchimento/volume do reator) e pela durao do ciclo. Assim, se um
esgoto de baixa concentrao usado como substrato e uma carga
hidrulica usual empregada, a carga orgnica resultante no ser
suficientemente elevada para o processo de granulao. Por outro lado,
um aumento da carga orgnica devido ao aumento da carga hidrulica
ir compensar a baixa concentrao do substrato, favorecendo o
processo de granulao. Desta forma, para manter uma carga orgnica
adequada para a formao dos grnulos quando o sistema for alimentado
com afluente de baixa concentrao, como no caso do esgoto domstico,
necessrio ter uma carga hidrulica elevada. Isso pode ser alcanado
aplicando-se elevados percentuais de troca volumtrica (entre 50 e 75%)
e ciclos de curta durao (em torno de 3 horas) (NI et al., 2009).
Contudo, Moy et al. (2002), Tay et al. (2004a,b), Liu et al.
(2007c), Adav et al. (2010) e Jungles et al. (2011) reportaram que
cargas muito elevadas (acima de 8 kgDQOm-3d-1) causaram a
desintegrao dos grnulos. De acordo com Tay et al. (2004b), o
tamanho dos grnulos geralmente aumenta com o aumento da carga
aplicada, o que pode levar a uma diminuio na densidade e a um
aumento da porosidade dos grnulos, provocando a instabilidade do
sistema. Para Zheng et al. (2006), a possibidade dos grnulos em
demonstrar instabilidade aumenta com o aumento da carga orgnica.
c) Alternncia de concentrao de substrato
A forma pela qual a alimentao estabelecida no reator uma
condio muito importante para alcanar a granulao aerbia. Assim, a
alimentao deve ser realizada em um tempo curto, a fim de permitir a
existncia de duas fases durante o perodo de aerao: fase de
degradao e fase de inanio. A fase de degradao ocorre no incio
do perodo de aerao, devido mxima concentrao de substrato que
se estabelece no reator aps a alimentao. O substrato ento
consumido at um valor mnimo, atingindo a fase de inanio, onde o
mesmo no se encontra mais disponvel no meio (FIGUEROA et al.,
2009; TAY et al., 2001a; HUBNER, 2008). Deste modo, os
microrganismos so sujeitos a perodos de alternncia de concentrao
de substrato. Segundo Tay et al. (2001a), sob condies de baixa
concentrao de substrato, as bactrias se tornam mais hidrofbicas, o
que facilita a agregao e adeso microbiana.

59

d) Durao do ciclo
A durao do ciclo representa a freqncia com que os slidos
so lavados do reator atravs da fase de retirada do efluente tratado, e
est relacionada com o tempo de reteno hidrulica (TRH) (WANG &
LIU, 2008). Segundo Liu & Tay (2007), menores valores de TRH
favorecem o processo de granulao.
Wang et al. (2005b), estudando o efeito da durao do ciclo nas
caractersticas dos grnulos aerbios, constataram que ciclos de 3 horas
de durao conduzem a um processo de granulao mais rpido,
enquanto que em ciclos de 12 horas a formao dos grnulos mais
lenta. De acordo com esses autores, em ciclos de 3 horas os
microrganismos esto freqentemente sujeitos fase de degradao, na
qual as bactrias sintetizam novas clulas em uma alta velocidade de
crescimento. Nesse caso, h um rpido aumento da biomassa, resultando
em grnulos com maiores dimetros. Por outro lado, em ciclos de 12
horas, os microrganismos passam por longos perodos de inanio, nos
quais a velocidade de crescimento especfico lenta, o que, por sua vez,
resulta em grnulos com dimetros pequenos.
e) Foras de cisalhamento hidrodinmico
A hidrodinmica um fator crucial nos sistemas de grnulos
aerbios, uma vez que favorece a transferncia de massa e as
propriedades fsicas da biomassa. Desta forma, a estrutura dos grnulos
fortemente influenciada pela fora de cisalhamento hidrodinmico
presente no reator (FIGUEROA et al., 2009). Segundo McSwain &
Irvine (2008), essa fora de cisalhamento geralmente descrita em
termos de velocidade superficial ascensional, isto , a taxa de aerao
aplicada sobre a rea superficial do reator. Elevadas foras de
cisalhamento favorecem a formao de grnulos mais fortes, compactos,
densos e arredondados (TAY et al., 2004a), alm de fornecer ao sistema
oxignio suficiente para conter o crescimento filamentoso (ADAV et al.,
2008). De acordo com Tay et al. (2001b) e Liu & Liu (2008), isso
acontece pelo fato de que a fora de cisalhamento hidrodinmico
favorece a produo de substncias polimricas extracelulares, as quais,
segundo Figueroa et al., (2009), so mediadores da coeso e adeso das
clulas, tendo um importante papel na manuteno da integridade
estrutural das mesmas. Outra funo importante das foras de
cisalhamento prover um balano entre o desprendimento e o
crescimento da biomassa, a fim de manter a estabilidades dos grnulos
(LIU & TAY, 2006).

60

f) Tempo de sedimentao
O tempo de sedimentao um importante parmetro
operacional, pois desempenha um papel fundamental na seleo da
comunidade microbiolgica (LIU & TAY, 2004). Essa seleo tem sido
identificada como o principal mecanismo que favorece a formao e o
acmulo de grnulos no reator (HUBNER, 2008).
De acordo com Qin & Liu (2008), os grnulos aerbios podem
ser cultivados com sucesso e se tornarem dominantes somente se o
reator for operado com curtos tempos de sedimentao. Esta uma
estratgia eficiente para limitar a presena de organismos formadores de
flocos, uma vez que os grnulos, por serem mais densos, requerem um
menor tempo de sedimentao do que os flocos (FIGUEROA et al.,
2009; BEUN et al., 1999). Assim, ocorrer uma seleo entre a
biomassa que apresenta boa sedimentabilidade (grnulos) e a biomassa
que sedimenta mal (filamentos e flocos) (BEUN et al., 2002). Um
esquema dessa seleo est apresentado na Figura 7. As partculas que
sedimentam rpido ficaro retidas no reator, e as que no sedimentam
suficientemente rpido sero lavadas do reator saindo com o efluente
(FIGUEROA et al., 2009; LIU & TAY, 2004). Essas partculas com boa
sedimentabilidade retidas no RBS vo assegurar uma granulao rpida
e eficiente (NI et al., 2009).
A maioria dos estudos adota tempos de sedimentao na faixa de 2
a 20 minutos (QIN & LIU, 2008). Contudo, Qin et al. (2004b) consideram
que os grnulos aerbios s podem se formar quando o tempo de
sedimentao for menor ou igual a 15 minutos. Segundo Ni et al. (2009),
empregando-se tempos de sedimentao longos, os flocos que
sedimentam mal no podem ser removidos eficazmente, podendo, por
sua vez, competir com as biopartculas formadoras de grnulos por
nutrientes para o crescimento. Como resultado, a granulao aerbia no
pode ser alcanada em um RBS operado com longos tempos de
sedimentao.
A combinao de um curto tempo de sedimentao e de uma
curta durao de ciclo gera uma forte presso de seleo hidrulica,
facilitando o processo de formao dos grnulos aerbios (LIU et al.,
2007b). Ademais, o tempo de sedimentao o parmetro mais
importante para manter a estabilidade do lodo granular (LIU et al.,
2010b).

61

Figura 7. Seleo da biomassa com boa sedimentabilidade em um RBS


de grnulos aerbios.
Fonte: Beun et al., 2002

g) Configurao do reator
Na maioria dos estudos relatados, a formao dos grnulos
ocorreu em RBS do tipo coluna de fluxo de ar ascendente. Segundo Liu
& Tay (2004), nesse tipo de reator, a ascenso do ar ou do lquido na
coluna cria um fluxo circular relativamente homogneo e vrtices
localizados ao longo do eixo do reator. Desta forma, os agregados esto
sujeitos a um constante atrito hidrulico, forando-os a se adaptarem a
forma granular, que apresenta mnima energia livre de superfcie. Esses
autores afirmam ainda que para assegurar essa trajetria de fluxo e
promover um eficaz atrito hidrulico, devem-se utilizar reatores que
apresentam uma alta razo entre a altura e o dimetro (A/D). Segundo
Beun et al. (1999), a utilizao de reatores com uma alta razo A/D gera
uma reduo da rea superficial ocupada e favorece a seleo dos
grnulos pela diferena na velocidade de sedimentao, como exposto
anteriormente.

2.4.4 Aplicaes dos Grnulos Aerbios

Existem poucos relatos na literatura sobre a aplicao da


tecnologia dos grnulos aerbios em escala real ou piloto, sendo que a
instabilidade dos grnulos considerada como um dos maiores
problemas que impedem a sua aplicao na prtica (LEE et al., 2010).
A maioria dos estudos tem sido realizada em escala laboratorial
utilizando esgoto sinttico de mdia e elevada carga orgnica.
Recentemente, os reatores granulares vm sendo aplicados no

62

tratamento de esgotos de origem industrial, como os provenientes de


cervejaria (SCHWARZENBECK et al., 2004; WANG et al., 2007),
laticnios (ARROJO et al., 2004; SCHWARZENBECK et al., 2005;
WICHERN et al., 2008), abatedouro de carne (CASSIDY & BLIA,
2005), indstria de papel (HAILEI et al., 2006), vincola (LPEZPALAU et al., 2009), indstria txtil (MUDA et al., 2010), indstria
farmacutica (INIZAN et al., 2005), afluentes salinos da indstria de
pesca (FIGUEROA et al., 2008), entre outros.
No Brasil, Pujol (2008) e Hubner (2008) aplicaram os grnulos
aerbios para o tratamento de guas residurias da suinocultura. Pujol
(2008) avaliou a eficincia de um RBS de grnulos no tratamento de
efluente de biodigestor anaerbio alimentado com dejetos de sunos,
enquanto Hubner (2008) avaliou um sistema composto por decantador,
reator aerbio de biogrnulos e lagoa de aguap para o tratamento de
esgoto bruto da suinocultura.
O emprego desta tecnologia no tratamento de esgotos de origem
domstica tem sido pouco relatado na literatura. De Kreuk & Van
Loosdrecht (2006), Ni et al. (2009) e Liu et al. (2010b) estudaram o
processo de formao dos grnulos em RBS alimentados com esgoto
domstico. As pesquisas de Ni et al. (2009) e Liu et al. (2010b) foram
conduzidas em reatores de escala piloto.
Por outro lado, Liu et al. (2007a), Ji et al. (2009), Wang et al.
(2009) e Jungles et al. (2010) avaliaram, em escala laboratorial, o
tratamento de esgoto domstico em reatores inoculados com grnulos
pr-cultivados com esgoto sinttico. Entretanto, na prtica, a utilizao
de grnulos aerbios como inculo em sistemas de larga escala se torna
invivel, devido ao grande volume do reator (LIU et al., 2010b).
Na Holanda, desde 1999, a empresa de consultoria DHV e a
Universidade Tecnolgica de Delft estabeleceram uma parceria na
investigao sobre os sistemas de tratamento de guas residurias
baseados em RBS de grnulos aerbios (DOUTOR, 2008). Em 2005,
essa tecnologia foi patenteada com o nome de Nereda. Atualmente,
existem duas aplicaes em escala real da tecnologia Nereda no
tratamento de esgoto domstico, sendo uma em Portugal (Freilas) e
outra na frica do Sul (Gansbaai) (GADEMAN et al., 2010). Alm
disso, est previsto, para o primeiro trimestre de 2011, a construo da
segunda estao de tratamento da frica do Sul (Wemmershoek) a
utilizar a tecnologia Nereda (DHV, 2011). Na Holanda, a aplicao
dessa tecnologia tem sido realizada apenas em escala piloto, mas,
segundo Erasmus (2010), trs projetos em escala real esto em processo
de negociao.

63

3 MATERIAIS E MTODOS

3.1 SISTEMA EXPERIMENTAL

O sistema experimental foi instalado no Laboratrio de Efluentes


Lquidos e Gasosos (LABEFLU) do Departamento de Engenharia
Sanitria e Ambiental, estando situado no campus da Universidade
Federal de Santa Catarina (UFSC). Um esquema do sistema
experimental pode ser visualizado na Figura 8.

3
9

6
7

Figura 8. Sistema Experimental: (1) poo de visita da CASAN; (2)


tanque de armazenamento; (3) tanque intermedirio com misturador;
(4) bomba de alimentao do reator; (5) reator em bateladas
seqenciais com grnulos aerbios (RBSG); (6) rotmetro; (7)
compressor de ar; (8) bomba para retirada do efluente; (9) painel de
comandos eltricos.

O afluente utilizado no sistema era proveniente da rede coletora


de esgotos do bairro Pantanal, na cidade de Florianpolis/SC, sendo de
origem essencialmente domstica. A captao do esgoto era feita por
meio de uma bomba submersa instalada no poo de visita da Companhia
Catarinense de guas e Saneamento (CASAN), sendo ento bombeado
para um tanque de armazenamento com capacidade para 5000 litros. O

64

esgoto era mantido por no mximo 3 dias nesse tanque de


armazenamento.
Devido rede coletora receber todo tipo de efluente urbano, a
bomba submersa (marca Schneider, BSC-94 - CV Mono 60 Hz)
funcionava dentro de um tubo de PVC, o qual possua furos de 0,01m,
com a finalidade de filtrar e evitar a entrada de materiais slidos
grosseiros.
Do tanque de armazenamento, o esgoto seguia, por gravidade,
para um tanque intermedirio de capacidade de 1000 litros, com
misturador mecnico (motor eltrico do tipo vertical 1750 rpm 60 Hz),
de onde era ento bombeado (bomba modelo BPF Sibrape) para o
interior do reator nos perodos de enchimento de cada ciclo operacional.
Aps o tratamento, a mesma bomba descartava o efluente na rede
coletora da CASAN, em um ponto jusante da captao.
O Reator em Bateladas Sequenciais de Grnulos Aerbios
(RBSG) foi construdo em coluna cilndrica de acrlico transparente
(Figura 9), apresentando as seguintes dimenses: 2,0 m de altura e 0,09
m de dimetro interno. A altura til utilizada para o tratamento foi de
1,73 m, correspondendo a um volume mximo igual a 11 L.

Figura 9. Foto do reator piloto.

O reator apresentava uma elevada razo entre a altura e o


dimetro (A/D em torno de 20), a fim de favorecer a seleo dos
grnulos pela diferena na velocidade de sedimentao, como
recomendado por Beun et al. (1999). Este valor se encontra dentro da

65

faixa usualmente reportada na literatura, que segundo Kong et at. (2009)


entre 20 e 30.
A aerao era feita por meio de um compressor (marca Air Pump
Modelo EL 100, capacidade de 100 Lmin-1) que enviava o ar
comprimido para o interior do reator atravs de um difusor circular do
tipo membrana, instalado na parte inferior do reator. A escolha desse
sistema de aerao foi devido ao fato de que esses difusores permitem a
obteno de bolhas finas e apresentam uma elevada eficincia de
transferncia de oxignio, proporcionando um maior contato superficial
das bolhas de ar com o meio lquido (Jordo & Pessa, 2005). A linha
de ar comprimido era composta ainda por filtros, vlvulas reguladoras
de presso e rotmetro para medio da vazo.
O funcionamento destes equipamentos foi automatizado por meio
de um controlador lgico programvel (CLP) (marca SIEMENS)
localizado em um painel de comandos eltricos. Por meio da CLP, foi
possvel controlar a durao de cada fase (enchimento, aerao,
sedimentao e retirada) do ciclo operacional do reator, o acionamento e
desligamento das bombas de entrada/sada de esgoto e do compressor de
ar. Para o controle de nvel de esgoto dentro do reator foram instaladas
duas sondas, uma de nvel mnimo e outra de nvel mximo. No painel
de controle foram instalados botes que sinalizavam a fase do ciclo
durante o funcionamento do reator e tambm possibilitavam o controle
manual do sistema.

3.2 INOCULAO DO REATOR

O reator foi inoculado no dia 18 de maio de 2009 com lodo


ativado proveniente de um reator em bateladas seqenciais que trata
esgotos de origem domstica, localizado em Florianpolis/SC. O
inculo apresentava uma concentrao de slidos suspensos totais (SST)
de 4,5 g.L-1 e um ndice volumtrico de lodo (IVL30) de 187 mL.g-1.
Foram adicionados 3,5 L deste lodo no reator, e, em seguida,
completou-se com 7,5 L de esgoto bruto, totalizando os 11 L de volume
til do reator. Aps 12 horas de aerao, foi feita a sedimentao do
lodo e a retirada do esgoto, e iniciou-se a operao do reator.

66

3.3 OPERAO DO REATOR

O RBSG foi operado em regime de ciclos, com fases de


enchimento esttico (sem aerao ou agitao), reao aerbia,
sedimentao e retirada. O reator foi operado durante 294 dias, sendo o
seu estudo dividido em trs estratgias operacionais, como detalhado a
seguir.
a) Estratgia Operacional I:
O objetivo da Estratgia Operacional I foi estudar a formao dos
grnulos aerbios utilizando esgoto domstico, bem como avaliar o
desempenho do RBSG utilizando ciclos operacionais com diferentes
tempos de durao (3 e 4 horas).
Esta estratgia iniciou-se no dia 19 de maio de 2009 e foi
finalizada no dia 05 de novembro de 2009, totalizando 171 dias de
operao. Neste perodo, foram realizadas 37 coletas de esgoto bruto e
tratado, e foram monitorados 8 ciclos.
O reator foi inicialmente operado em sucessivos ciclos de 3 horas,
compreendendo 0,5 min. de enchimento, 164 min. de aerao, 15 min. de
sedimentao e 0,5 min. de retirada do efluente. A fim de melhorar o
desempenho do RBSG, aps 88 dias de operao, a durao do ciclo foi
aumentada para 4 horas, compreendendo 0,5 min. de enchimento, 224
min. de aerao, 15 min. de sedimentao e 0,5 min. de retirada do
efluente. Um resumo dessas condies est apresentado na Tabela 2.
Tabela 2. Resumo das condies operacionais do reator durante a
Estratgia I.
Parmetros

Ciclo 3 horas

Ciclo 4 horas

Tempo de operao (dias)


Durao da fase (min)
Enchimento
Aerao
Sedimentao
Retirada

88

83

0,5
164
15
0,5

0,5
224
15
0,5

A escolha de se iniciar a operao do reator com ciclos de 3 horas e


tempo de sedimentao de 15 minutos foi baseada no estudo de Ni et al.
(2009). Esses autores conseguiram formar grnulos aerbios em um RBS
utilizando esgoto domstico de baixa concentrao. Alm disso, a

67

utilizao de ciclos de curta durao uma maneira eficaz de aumentar a


carga orgnica aplicada ao sistema, quando se utiliza esgoto de baixa
concentrao, como o esgoto domstico.
b) Estratgia Operacional II:
O objetivo da Estratgia Operacional II foi avaliar o efeito da
carga orgnica no desempenho do RBSG e nas caractersticas
morfolgicas dos grnulos. Para isso foi adicionado, no tanque
intermedirio, acetato de sdio ao esgoto bruto, a fim de dobrar a carga de
carbono aplicado ao sistema. A escolha da utilizao de acetato de sdio
como fonte externa de carbono foi baseada nos resultados obtidos por Tay
et al. (2001a). Esses autores observaram que os grnulos cultivados com
glicose apresentaram uma superfcie filamentosa, enquanto que os
grnulos cultivados com acetato apresentaram uma estrutura compacta e
dimetros mais elevados.
Esta estratgia iniciou-se no dia 06 de novembro de 2009 e foi
finalizada no dia 14 de janeiro de 2010, totalizando 70 dias de operao.
Neste perodo, foram realizadas 17 coletas de esgoto bruto e de esgoto
tratado, e foram monitorados 4 ciclos.
O reator continuou operando em sucessivos ciclos de 4 horas,
compreendendo 0,5 min. de enchimento, 224 min. de aerao, 15 min.
de sedimentao e 0,5 min. de retirada do efluente, em virtude dos bons
resultados alcanados com essa condio durante a Estratgia
Operacional I. Um resumo das condies operacionais do reator durante
a Estratgia II est apresentado na Tabela 3.
Tabela 3. Resumo das condies operacionais do reator durante a
Estratgia II.
Parmetros
Tempo de operao (dias)
Durao da fase (min)
Enchimento
Aerao
Sedimentao
Retirada

Estratgia II
70
0,5
224
15
0,5

c) Estratgia Operacional III:


O objetivo da Estratgia Operacional III foi avaliar o efeito da
diminuio do tempo de sedimentao nas caractersticas dos grnulos e
no desempenho do RBSG. Desta forma, ao longo desta estratgia o tempo

68

de sedimentao foi reduzido gradualmente de 12 para 9 minutos e,


posteriormente para 7 minutos.
Esta estratgia iniciou-se no dia 15 de janeiro de 2010 e foi
finalizada no dia 08 de maro de 2010, totalizando 53 dias de operao.
Neste perodo, foram realizadas 13 coletas de esgoto bruto e de esgoto
tratado, e foram monitorados 2 ciclos.
A carga orgnica aplicada a esta estratgia foi a mesma utilizada
durante a Estratgia Operacional II, devido aos bons resultados
alcanados. O reator foi operando em sucessivos ciclos de 4 horas,
sendo que a configurao desses ciclos foi mudada ao longo da
estratgia. Desta forma, a operao do reator foi dividida em trs etapas,
em funo do tempo de sedimentao adotado. A durao das fases dos
ciclos durante a Estratgia III apresentada na Tabela 4.
Tabela 4. Durao das fases dos ciclos operacionais durante a
Estratgia Operacional III.
Parmetros

Ts = 12 min

Ts = 9 min

Ts = 7 min

26

18

0,5
227
12
0,5

0,5
230
9
0,5

0,5
232
7
0,5

Tempo de operao (dias)


Durao da fase (min)
Enchimento
Aerao
Sedimentao
Retirada

Uma sntese das condies operacionais estabelecidas e das


cargas aplicadas em cada Estratgia Operacional apresentada na
Tabela 5 e na Tabela 6, respectivamente.
Tabela 5. Sntese das Estratgias Operacionais.
Condies Aplicadas
Tempo de operao
(dias)
Tempo de ciclo
(horas)
Tempo de
sedimentao (min)
Adio de carga
orgnica

Estratgia I

Estratgia II

Estratgia III

171

70

53

3e4

15

15

12-9-7

No

Sim

Sim

69

Tabela 6. Cargas aplicadas nas Estratgias Operacionais.


Cargas Aplicadas
Carga orgnica
(kg DQOsm-3d-1)
Carga nitrogenada
(kg NH4+-Nm-3d-1)
Carga de fsforo
(kg PO4-Pm-3d-1)

Estratgia I
3 horas
4 horas
(n=16)
(n=20)

Estratgia
II
(n=16)

Estratgia
III
(n=13)

1,400,43

1,000,23

2,000,26

2,010,22

0,290,04

0,200,01

0,180,02

0,180,02

0,030,01

0,020,01

0,020,00

0,020,01

Ainda em relao operao do reator, a cada dois dias as


paredes do reator eram limpas a fim de impedir a formao de biofilme.
Com o aparecimento dos grnulos, a freqncia de limpeza foi
diminuindo gradativamente. Esse procedimento foi adotado tendo em
vista que os microrganismos presentes no biofilme podem entrar em
competio com os grnulos. Quando o crescimento do biofilme
limitado atravs da limpeza das paredes do reator, o crescimento dos
microrganismos na forma de grnulos se torna mais vantajoso
(MORGENROTH et al., 1997).
O volume de enchimento foi de 4,4 L, ou seja, a cada ciclo o
percentual de troca volumtrica (Venchimento/Vreator) foi de 40%, resultando
em 35,1 e 26,4 L de esgoto tratados diariamente, quando o reator foi
operado em sucessivos ciclos de durao de 3 e 4 horas, respectivamente.
O reator foi operado em temperatura ambiente e sem controle de
pH. A vazo de ar aplicada ao reator foi sempre maior do que 243 Lh-1, o
que corresponde a uma velocidade superficial ascensional de ar de
1,1 cms-1. Este valor foi adotado com base nos estudos de McSwain &
Irvine (2008), que concluram que os grnulos aerbios no so estveis
quando so aplicadas velocidades superficiais ascensionais de ar menores
do que 1,0 cms-1, em sistemas onde a fora de cisalhamento controlada
somente pela taxa de aerao.

70

3.4 MONITORAMENTO DO REATOR

3.4.1 Anlises Fsico-Qumicas

A fim de monitorar o desempenho do reator, foram coletadas,


duas vezes por semana, amostras do afluente bruto (entrada do reator),
mistura (aps 5 minutos do incio da aerao) e efluente tratado (sada
do reator). A cada trs semanas, era realizado o monitoramento de um
ciclo completo, onde alm das amostras acima mencionadas, foram
efetuadas coletas ao longo de todo o ciclo, com o objetivo de verificar a
variao da concentrao do substrato. Essas coletas seguiram a seguinte
freqncia: nos primeiros 30 minutos de ciclo, tendo em vista que o
substrato rapidamente consumido, as amostras eram coletadas a cada
10 minutos; no restante do ciclo, onde o consumo de substrato menos
acentuado, as amostras eram coletadas a cada 30 minutos.
As amostras coletadas eram armazenadas em frascos coletores
apropriados e em seguida encaminhadas ao Laboratrio Integrado do
Meio Ambiente (LIMA) do Departamento de Engenharia Sanitria e
Ambiental da UFSC, para a realizao das anlises fsico-qumicas.
Estas anlises foram feitas seguindo as metodologias recomendadas pelo
Standard Methods (APHA, 2005). Os mtodos e freqncia das anlises
esto listados na Tabela 7.
As variveis nitrognio total kjeldahl e polissacardeos
extracelulares foram determinadas apenas a partir da Estratgia
Operacional II em virtude de problemas operacionais nos equipamentos.
O ndice volumtrico do lodo (IVL) foi determinado seguindo a
metodologia proposta por Schwarzenbeck et al. (2004), denominada de
IVL dinmico. Esses autores consideram que o mtodo tradicional de
determinao de IVL no apropriado para descrever a
sedimentabilidade dos grnulos aerbios, uma vez que os mesmos
sedimentam mais rpido que a biomassa floculada. Deste modo, no
mtodo dinmico, o IVL determinado em diferentes tempos de
sedimentao, e no apenas aps 30 minutos, como no mtodo
tradicional.
Neste estudo, escolheu-se determinar o volume do lodo aps 5,
10, 15 e 30 minutos de sedimentao em uma proveta graduada de 1 L.
O IVL foi calculado usando a Equao 12.

71

Tabela 7. Mtodos e freqncia das anlises fsico-qumicas.


Amostras
Licor misto
Afluente, mistura, efluente
e ao longo do ciclo
Afluente, mistura, efluente
e ao longo do ciclo

Anlises

Mtodos

Freqncia

Oxignio dissolvido (OD), temperatura


(T), pH, potencial Redox (ORP)
Nitrito (NO2--N), Nitrato (NO3--N) e
Fosfato (PO4-P)

Sonda multi-parmetro
(YSI 6820)
Cromatografia lquida de troca inica
(DIONEX DX 120). SM* 4110C
Mtodo colorimtrico de Nessler.
17.20 Vogel (2002)
Digesto e destilao VELP.
SM 4500 - Norg B
Mtodo colorimtrico em refluxo
fechado. SM 5220D
Mtodo colorimtrico em refluxo
fechado. SM 5220D
Mtodo do carbono orgnico no
purgvel (TOC-5000 marca
SHIMADZU). SM 5310B

duas vezes
por semana
duas vezes
por semana
duas vezes
por semana
uma vez por
semana
duas vezes
por semana
duas vezes
por semana

Nitrognio Amoniacal (NH4+-N)

Afluente e efluente

Nitrognio Total Kjeldahl (NTK)

Afluente, mistura, efluente


e ao longo do ciclo

Demanda Qumica de Oxignio Solvel


(DQOS)
Demanda Qumica de Oxignio Total
(DQOT)

Afluente e efluente
Afluente, mistura, efluente
e ao longo do ciclo

Carbono Orgnico Dissolvido (COD)

Lodo

Polissacardeos Extracelulares (PSE)

Mtodo de Dubois et al. (1956)

uma vez por


semana

Licor misto e efluente

Slidos Suspensos Totais (SST),


Slidos Suspensos Volteis (SSV) e
Slidos Suspensos Fixos (SSF)

Mtodo gravimtrico em membrana de


fibra de vidro (0,47m). SM 2540

uma vez por


semana

Licor misto

ndice Volumtrico do Lodo (IVL)

Mtodo modificado de
Schwarzenbeck et al. (2004)

uma vez por


semana

*SM = Standard Methods

duas vezes
por semana

72
IVL

VLS
X

1000
SST

Equao 12
Onde:
IVL: ndice volumtrico do lodo (mLg-1);
X: tempo de sedimentao (min);
VLS: volume de lodo sedimentado (mLL-1);
SST: concentrao de slidos suspensos totais na amostra
(mgL-1).

3.4.2 Anlises Morfolgicas e Microbiolgicas


O acompanhamento da formao e da morfologia dos grnulos foi
realizado semanalmente, atravs da utilizao de microscpio tico
(marca Olympus BX-40) e de estereomicroscpio (lupa marca
Tecnival). O dimetro dos grnulos foi medido com o auxlio de uma
lente ocular com escala micromtrica. Fotos foram tiradas utilizando
mquina fotogrfica digital (Sony Cybershot DSC P93).
A identificao dos microrganismos presentes nos grnulos foi
feita por anlise microbiolgica FISH (hibridizao fluorescente in situ).
Foram coletadas trs amostras de grnulos (uma de cada estratgia
operacional), as quais foram encaminhadas ao Laboratrio de
Bioqumica e Biologia Molecular de Microorganismos (LBBMM), no
departamento de Bioqumica da UFSC, onde foram realizadas as
anlises.
A tcnica de FISH foi realizada seguindo a metodologia descrita
por Amann (1995). Resumidamente, a metodologia empregada pode ser
dividida em sete etapas:
1) Coleta, fixao das amostras com paraformaldedo 4% e
conservao das amostras em congelador (-20 C);
2) Imobilizao e desidratao das clulas sobre a lmina;
3) Hibridizao das clulas com oligonucleotdeos
fluorescentes (sondas - Tabela 8);
4) Lavagem das lminas para otimizao da estringncia;
5) Colorao das clulas com DAPI;
6) Adio de anti fading (CitiFluor) sobre a amostra recm
preparada (para evitar a perda da fluorescncia) e cobertura
da lmina com lamnula;

73

7) Observao em microscpio epifluorescente e/ou confocal.


Tabela 8. Descrio das sondas utilizadas na deteco dos
microrganismos presentes nos grnulos pela tcnica de FISH.
Sonda

Especificidade

EUB mix
(I+II+III) 1

Todas
Eubactrias

NEU1
Eury
4991
DSV
4071

Nitrosomonas sp.
Grupos
Methanomicrobiales

Sequncia

Referncia

GCTGCCTCCCGTAGGAGT
CAGCCACCCGTAGGTGT
CTGCCACCCGTAGGTGT
CCCCTCTGCTGCACTCTA

Polprasert &
Sawaittayothin
(2006)
-

CGGTCTTGCCCGGCCCT

Desuifovibionaceae

CCGAAGGCCTTCTTCCCT

ARC 915

Todas Archae

GTGCTCCCCCGCCAATTCCT

NIT 3

Nitrobacter sp.

CCTGTGCTCCATGCTCCG

Todas BOA beta

CGATCCCCTGCTTTTCTCC

NSO 190

Stahl et al.
(1991)
Wagner et
al. (1996)
Mobarry et al.
(1996)

Para a obteno de uma estimativa da abundncia de clulas


hibridizadas nas amostras, foi utilizado um sistema subjetivo de
anlises, enquadrando a biomassa hibridizada em cinco categorias,
conforme apresentado na Tabela 9.
Tabela 9. Categorias quantitativas da biomassa hibridizada.

Categoria

Descrio

Nenhuma
Raras
Poucas
Algumas
Muitas

0% DAPI
At 5% DAPI
5-30% DAPI
30-60% DAPI
60-100% DAPI

3.4.3 Granulometria por Difrao a Laser

O tamanho dos grnulos foi tambm determinado por meio de


anlise granulomtrica por difrao a laser (Mastersizer 2000, Malvern
Instrument SA). Esta tcnica baseia-se na capacidade das partculas em

74

difratar luz. Qualquer partcula iluminada por um feixe laser difrata luz
em todas as direes com uma distribuio de intensidade que depende
da dimenso da partcula. Desta forma, a granulometria por difrao a
laser uma tcnica de medida indireta, utilizada para obter a
distribuio granulomtrica das partculas em suspenso.
Ao longo da operao do reator, foram coletadas nove amostras
de grnulos e encaminhadas para o Laboratrio de Caracterizao
Tecnolgica (LCT) do departamento de Engenharia de Minas e de
Petrleo da Escola Politcnica da Universidade de So Paulo, onde
foram realizadas as anlises granulomtricas. Contudo, essas anlises s
puderam ser realizadas a partir da Estratgia Operacional II, devido
dificuldade de encontrar um aparelho com limite de deteco necessrio.

3.4.4 Respirometria

O mtodo respiromtrico consiste basicamente em utilizar uma


sonda para determinar a concentrao de oxignio dissolvido. Desta
forma, em um dado instante do processo aerbio (t0) a aerao
interrompida, de forma a anular a transferncia de oxignio. Com isso, a
concentrao de OD (C0) tende a diminuir, em virtude do consumo de
oxignio pelos microrganismos, at atingir um certo valor (C01), onde se
retoma a aerao (SCHMIDELL, 2001). Dessa forma, determina-se a
taxa de consumo de oxignio (TCO) mediante a observao da variao
da concentrao de OD em funo do tempo, cujo diagrama
normalmente se aproxima de uma reta, conforme ilustrado na Figura 10.
Para a realizao dos ensaios de respirometria foram utilizados os
seguintes materiais:
Bomba de aqurio com pedra difusora para a aerao;
Erlenmeyer modificado com trs entradas: uma em cima
para a sonda de oxignio, e duas laterais, sendo uma para
aerao e a outra para o peagmetro. As entradas laterais
tambm servem para dosar solues e/ou retirar
amostras, e permitem que as bolhas de ar escapem
durante o perodo de aerao.
Agitador magntico com controle de temperatura;
Sonda multi-parmetro YSI 556;
Peagmetro.

75

Um esquema do sistema experimental utilizado nos ensaio de


respirometria pode ser visualizado na Figura 11.

Figura 10. Variao da concentrao de oxignio dissolvido com o


tempo, durante a execuo do mtodo respiromtrico.
Fonte: Schmidell, 2001.

Figura 11. Esquema do sistema experimental utilizado nos ensaios de


respirometria.
Fonte: Batista et al., 2005.

76

3.4.4.1 Ensaio de Determinao da Taxa de Consumo de Oxignio


(TCO)

O objetivo deste ensaio foi caracterizar a atividade da biomassa


presente no reator, a partir da determinao da taxa de consumo de
oxignio (TCO) e da taxa especfica de consumo de oxignio (TCOE).
Estes ensaios foram realizados semanalmente em amostras de lodo
coletadas diretamente do reator, seguindo a metodologia descrita por
Schmidell (2001).
Resumidamente, o procedimento do ensaio seguiu as seguintes
etapas:
1) Aps a coleta, a amostra foi colocada na unidade
respiromtrica (erlenmeyer) e por meio da bomba de
aqurio e do agitador magntico, submeteu-se a mesma
aerao e agitao constantes;
2) A concentrao de OD foi determinada a cada 5 segundos
utilizando-se a sonda multi-parmetro YSI 556;
3) A aerao foi mantida at o alcance da saturao, ou seja,
at o momento em que no foi percebida uma variao
significativa na concentrao de OD;
4) A aerao foi ento desligada, mantendo-se apenas uma
leve agitao, com o propsito de impedir a sedimentao
da biomassa;
5) Aps a concentrao de OD cair em torno de 2 mgL-1,
devido ao consumo de oxignio pelas bactrias, a aerao
foi retomada;
6) Traou-se um grfico com os valores de OD (mgL -1) em
funo do tempo (h), a fim de obter a TCO atravs da
inclinao da reta de melhor ajuste (regresso linear).
7) A TCOE foi obtida a partir da Equao 13 (SCHMIDELL,
2001).
TCO

TCO
E

Equao 13

Onde:
TCOE:
taxa
(mgO 2gcel-1h-1);

de

consumo

de

oxignio

especfica

77

X: concentrao celular (gcelL-1);


TCO: taxa de consumo de oxignio (mgO2L-1h-1).
3.4.4.2 Ensaio de Determinao da Biomassa Ativa

Para a determinao da biomassa ativa autotrfica e heterotrfica,


a medio da TCO considerou as variaes na taxa de respirao do
lodo em conseqncia do tipo de substrato adicionado. Este ensaio foi
realizado em duas amostras de lodo coletadas durante a Estratgia
Operacional III, e seguiu a metodologia descrita por Ochoa et al. (2002),
Wolff et al. (2006) e Paul et al. (2007). Assim, a TCO foi medida em
trs condies diferentes para obter:
1. Respirao Endgena (TCOend): representa o oxignio
necessrio para a respirao do lodo, ou seja, a energia
requerida para manter as funes das clulas;
2. Consumo de oxignio durante a nitrificao (TCOA), sem
fonte de carbono, aps a adio de cloreto de amnio
(NH4Cl substrato para as bactrias autotrficas); e
3. Respirao Exgena (TCOH) com adio de fonte de
carbono, aps a inibio da nitrificao com soluo de
Allylthiourea (ATU) - que um inibidor seletivo do grupo
das Nitrosomonas. A fonte de carbono utilizada nos testes
respiromtricos foi o acetato de sdio (substrato para as
bactrias heterotrficas).
Resumidamente, o procedimento do ensaio seguiu as seguintes
etapas:
1) Aps a coleta, a amostra foi inicialmente aerada durante 24
horas por meio de um aerador (bomba de aqurio e pedra
difusora), sendo que durante este perodo no foi
adicionado qualquer substrato exgeno. O objetivo desta
etapa foi garantir que toda a matria orgnica e os
nutrientes presentes na amostra fossem consumidos,
atingindo-se ento a fase de respirao endgena;
2) Completadas as 24 horas, a amostra foi ento colocada na
unidade respiromtrica e por meio da bomba de aqurio e
do agitador magntico, submeteu-se a mesma aerao e
agitao constantes;

78

3) A concentrao de OD foi determinada a cada 5 segundos


utilizando-se a sonda multi-parmetro YSI 556;
4) A aerao foi mantida at o alcance da saturao, ou seja,
at o momento em que no foi percebida uma variao
significativa na concentrao de OD
5) A aerao foi ento desligada, mantendo-se apenas uma
leve agitao, com o propsito de impedir a sedimentao
da biomassa;
6) Aps a concentrao de OD cair em torno de 2 mgL -1,
devido respirao endgena das bactrias, a aerao foi
retomada. Essa etapa foi repetida trs vezes, e fez-se uma
mdia dos valores obtidos TCO1;
7) Aps a concentrao de OD atingir novamente a saturao,
adicionou-se o pulso de NH4Cl (50 mgNL-1);
8) A aerao foi ento desligada, mantendo-se apenas uma
leve agitao;
9) Aps a concentrao de OD cair em torno de 2 mgL -1,
devido ao consumo de OD para a nitrificao e para a
respirao endgena, a aerao foi retomada. Essa etapa foi
repetida trs vezes, e fez-se uma mdia dos valores obtidos
TCO2;
10) Aps a concentrao de OD atingir novamente a saturao,
adicionaram-se os pulsos de ATU (30 mgATUL-1) e de
acetato de sdio (100 mgDQOL-1);
11) A aerao foi ento desligada, mantendo-se apenas uma
leve agitao;
12) Aps a concentrao de OD cair em torno de 2 mgL-1,
devido ao consumo de OD para a respirao exgena e
endgena, a aerao foi retomada. Essa etapa foi repetida
trs vezes, e fez-se uma mdia dos valores obtidos TCO3;
13) Traou-se um grfico com os valores de OD (mgL-1) em
funo do tempo (h), a fim de obter a TCO atravs da
inclinao da reta de melhor ajuste (regresso linear).
importante salientar que, segundo Vanrolleghem et al. (1999),
o uso da ATU causa um impacto destrutivo na biomassa nitrificante, o
que conseqentemente impede que a amostra seja utilizada em um
prximo experimento
Um resumo das condies experimentais para a determinao da
TCO est apresentado na Tabela 10. A representao do procedimento

79

respiromtrico utilizado para obter a repartio da biomassa ativa est


apresentado na Figura 12.
Tabela 10. Condies experimentais para a determinao da TCO.
Condio

TCO

Endgena
TCOend = TCO1
TCO1
Autotrfica TCOA = TCO1 TCO2
TCO2
Heterotrfica
TCOH = TCO3
TCO3
Fonte: Adaptado de Ochoa et al., 2002.

Concentrao de OD (mgL-1)

Interrupo
da aerao

Adio
substrato
autotrficas

(1)

Amnia

Carbono

ATU

no

no

no

sim

no

no

sim

sim

sim

Adio
Adio substrato
ATU heterotrficas

(2)

(3)

Retomada
da aerao

Tempo (horas)

Figura 12. Representao do procedimento respiromtrico utilizado


para obter a repartio da biomassa ativa: (1) respirao endgena; (2)
nitrificao; (3) respirao exgena.

3.5 CLCULOS REALIZADOS

3.5.1 Vazo Diria de Esgoto (Qd)

Qd

nc Ve

Equao 14

80

Onde:
Qd: vazo diria de esgoto (m3dia-1)
nc: nmero de ciclos realizados por dia;
Ve:volume de enchimento por ciclo (m3).
3.5.2 Carga Volumtrica Aplicada (CV)

S A Qd

CV

V u 1000

Equao 15

Onde:
CV: carga volumtrica aplicada por dia (kgDQOm-dia-1 ou
kgNH4-Nm-dia -1);
SA: concentrao de DQO ou NH4-N no afluente (gm-3);
Qd: vazo diria de esgoto (mdia-1);
Vu: volume til do reator (m).
3.5.3 Tempo de Reteno Hidrulica (TRH)

TRH

Vu
Qd

Equao 16

Onde:
TRH: tempo de reteno hidrulica (dias);
Qd: vazo diria de esgoto (mdia-1);
Vu: volume til do reator (m).

81

3.5.4 Velocidade Superficial Ascensional do Ar

Qa

va

100

Ab

Equao 17

Onde:
va: velocidade superficial do ar (cms-1);
Qa: vazo de ar (m3s-1);
Ab: rea da base do reator (m2).
3.5.5 Eficincia (E)

A eficincia de remoo, para as variveis DQO, COD, NTK,


NH4-N (nitrificao) e PO4-P, foi calulada pela Equao 18.
SA

SE

100

SA

Equao 18

Onde:
E: eficincia de remoo (%);
SA: concentrao do afluente (mgL-1);
SE: concentrao do efluente (mgL-1).
3.5.6 Eficincia de Desnitrificao (EDN)
A eficincia do processo de desnitrificao foi calculada pela
Equao 19.
NH
E DN

N
NH

NH

A
4

NO

NH

100

Equao 19

82

Onde:
EDN: eficincia de desnitrificaao (%);
(NH4-N)A: concentrao de amnia no afluente (mgL-1);
(NH4-N)E: concentrao remanescente de amnia no efluente
(mgL-1);
(NOX-N)E: concentrao de nitrito e nitrato no efluente (mgL-1).
3.5.7 Eficincia de Remoo do Nitrognio Total (ENT)
A eficincia de remoo do nitrognio total foi calculada pela
Equao 20.
NT

E NT

NT

NT

100

Equao 20

Onde:
ENT: eficincia de remoo de nitrognio total em %;
NTA: soma da concentrao todas as formas de nitrognio
presentes no afluente (mgL-1);
NTE: soma da concentrao todas as formas de nitrognio
presentes no efluente (mgL-1).

3.5.8 Concentrao de Biomassa Ativa

A biomassa ativa heterotrfica (XH) e a biomassa ativa


autotrfica (XA) foram calculadas de acordo com o ASM1 Activated
Sludge Model n.1 (HENZE et al., 1987), atravs das Equao 21
Equao 22:
X

YH

1
H
H max

YH

( TCO ) H

max

Equao 21

83
X

1
A
A max

YA
4 , 57

YA

( TCO ) A max

Equao 22
Onde:
XH: concentrao de biomassa heterotrfica (mgDQOL-1);
XA: concentrao de biomassa autotrfica (mgDQOL-1);
Hmax: taxa de crescimento heterotrfico mximo (d-1);
Amax: taxa de crescimento autotrfico mximo (d-1);
YH: coeficiente de converso heterotrfica (gDQO/gDQOoxidado);
YA: coeficiente de converso autotrfica (gDQO/gNoxidado);
(TCO)Hmax: taxa de consumo de oxignio mxima da biomassa
heterotrfica (mgO2L-1.h-1);
(TCO)Amax: taxa de consumo de oxignio mxima da biomassa
autotrfica (mgO2L-1.h-1).
Os parmetros estequiomtricos (YA e Y H) e cinticos (Amax e
Hmax) utilizados para o clculo foram obtidos na literatura (HENZE et
al., 1987), sendo:
YH = 0,67 gDQO/gDQOoxidado;
YA = 0,24 gDQO/gNoxidado;
H = 6 d-1 a 20 C (fator de correo da temperatura = 1,103);
A = 0,75 d-1 a 20 C (fator de correo da temperatura = 1,072).

84

85

4 RESULTADOS E DISCUSSO

4.1 ESTRATGIA OPERACIONAL I

O objetivo da Estratgia Operacional I foi estudar a formao dos


grnulos aerbios utilizando esgoto domstico, bem como avaliar o
desempenho do RBSG utilizando ciclos operacionais com diferentes
tempos de durao (3 e 4 horas).
As caractersticas do esgoto domstico e as cargas aplicadas
durante esta estratgia esto apresentadas na Tabela 11. O esgoto
domstico utilizado pode ser classificado, segundo Metcalf & Eddy
(2003), como sendo de mdia concentrao, em termos de DQO, e de alta
concentrao, em termos de NH4+-N e de PO4-P.
Tabela 11: Caractersticas do esgoto domstico e cargas aplicadas
durante a Estratgia Operacional I.

Variveis
-1

DQOs (mgL )
NH4+-N (mgL-1)
PO4-P (mgL-1)
Carga orgnica (kg DQOsm-3d-1)
Carga nitrogenada (kg NH4+-Nm-3d-1)
Carga de fsforo (kg PO 4-Pm-3d-1)

Ciclo 3 horas

Ciclo 4 horas

(n=16)

(n=20)

430 140
91 12
9,8 1,2
1,40 0,43
0,29 0,04
0,03 0,01

412 95
83 5
9,7 1,2
1,00 0,23
0,20 0,01
0,02 0,01

4.1.1 Formao dos Grnulos Aerbios

4.1.1.1 Morfologia dos Grnulos Aerbios


A evoluo da formao dos grnulos ao longo da Estratgia I
pode ser visualizada na Figura 13 (Figura 13A a 13E ciclo de 3 horas;
Figura 13F a 13I - ciclo de 4 horas). O lodo utilizado como inculo
(Figura 13A) era formado majoritariamente por flocos, os quais
apresentavam uma estrutura morfolgica bastante irregular. Aps 14 dias
de operao (Figura 13B) observou-se o incio da aglutinao dos

86

microrganismos para a formao dos grnulos. Assim, os primeiros


grnulos comearam a aparecer com 28 dias (Figura 13C), no entanto, os
mesmos apresentavam uma superfcie bastante filamentosa. A partir de 56
dias (Figura 13D e 13E) os grnulos se tornaram mais densos,
apresentando uma estrutura mais regular e esfrica. Entretanto, neste
perodo, a presena de flocos no reator ainda era dominante. Com o passar
do tempo, o nmero de grnulos, bem como o dimetro dos mesmos, foi
aumentando gradativamente (Figura 13F, 13G e 13H). Com 150 dias de
operao (Figura 13I), a biomassa do reator era formada principalmente
por grnulos maduros e compactos, com dimetros variando entre 0,3 e
1,3 mm e dimetro mdio de 0,5 mm. Neste perodo, foi possvel observar
a presena de apenas alguns flocos. Esses resultados esto de acordo com
De Kreuk et al. (2005b), que recomendam que o tamanho mnimo dos
grnulos seja em torno de 0,2 mm, a fim de poder separ-los corretamente
dos flocos durante a fase de sedimentao.

Figura 13. Evoluo da formao dos grnulos no reator: (A) inculo;


(B) 14 dias; (C) 28 dias; (D) 56 dias; (E) 70 dias; (F) 99 dias; (G) 114
dias; (H) 121 dias; e (I) 150 dias. Barra = 0,1 mm.

A partir da Figura 13, pode-se perceber que a formao dos


grnulos um processo gradual que segue trs estgios consecutivos:

87

aclimatao do lodo, agregao do lodo e maturao dos grnulos


(WANG et al., 2005b).
De Kreuk & Van Loosdrecht (2006), estudando a formao de
grnulos aerbios com esgoto domstico em um RBS, observaram a
presena de grnulos somente 20 dias aps mudarem o tempo de ciclo de
3 para 2 horas (36 dias de operao do reator). Essa diminuio do tempo
de ciclo foi realizada a fim de aumentar a carga orgnica aplicada, e,
conseqentemente, favorecer o processo de granulao. Os autores
obtiveram grnulos com dimetro mdio de 1,1 mm, entretanto, os
mesmos apresentavam uma estrutura filamentosa e alongada.
Ni et al. (2009), estudando o processo de granulao em um RBS
utilizado no tratamento de esgoto de baixa concentrao (DQOs entre 35 e
120 mgL-1 e NH4+-N entre 10 e 40 mgL-1), observaram pequenos
grnulos apenas aps 80 dias de operao. Os autores verificaram ainda
que, com 300 dias de operao, aproximadamente 85% da biomassa do
reator era formada por grnulos com dimetros variando entre 0,2 e 0,8
mm.
Liu et al. (2010b), estudando a granulao aerbia em um RBS
alimentado com esgoto misto (composto por 40% de esgoto domstico e
60% de esgoto industrial), reportaram um tempo maior ainda para
transformar o lodo ativado em grnulo aerbio. Esses autores observaram
que os grnulos foram dominantes no reator apenas aps 400 dias de
operao (dimetro mdio dos grnulos igual a 0,35 mm), embora a
presena de partculas esfricas tenha sido notada aps 3 meses.
Morgenroth et al. (1997), estudando a granulao aerbia em um
RBS alimentado com esgoto sinttico, observaram os primeiros grnulos
com 40 dias de operao, sendo que os mesmos foram dominantes aps
70 dias (dimetro mdio dos grnulos igual a 2,35 mm e dimetro
mximo de 7 mm).
Dangcong et al. (1999) e Beun et al. (2002), tambm estudando a
granulao aerbia em um RBS alimentado com esgoto sinttico,
verificaram que em um ms o processo de granulao estava completo. O
dimetro dos grnulos obtidos por Dangcong et al. (1999) variaram entre
0,3 e 0,5 mm, enquanto que Beun et al. (2002) obtiveram grnulos com
dimetro mdio de 2,5 mm.
Jungles et al. (2011), estudando a granulao aerbia com esgoto
sinttico em um RBS em escala piloto, observaram pequenos grnulos
com 6 dias de operao. Os autores verificaram um aumento gradual do
tamanho dos grnulos, os quais atingiram um dimetro mdio de 3,5 mm
aps 63 dias de operao.

88

Na Tabela 12 esto resumidos os principais resultados do presente


estudo e dos estudos apresentados acima a respeito da granulao aerbia
utilizando esgoto domstico e sinttico.
Tabela 12. Comparao entre estudos sobre a formao de grnulos
aerbios utilizando esgoto domstico e sinttico.

Referncia

Este estudo
De Kreuk &
Van
Loosdrecht
(2006)
Ni et al.
(2009)
Liu et al.
(2010b)
Morgenroth
et al. (1997)
Dangcong et
al. (1999)
Beun et al.
(2002)
Jungles et al.
(2011)

Afluente

DQOs(1)
(mg L-1)

NH4+-N(1)
(mg L-1)

Tempo de
granulao
(dias)

Dimetro
dos
grnulos
(mm)

Esgoto
domstico

191-602

73-112

~150

0,3-1,3

Esgoto
domstico

280(2)

57(2)

36

1,1(2)

35-120

10-40

300

0,2-0,8

250-1800

39-93

400

0,35(2)

400(2)

22(2)

70

2,35(2)

800(2)

250(2)

30

0,3-0,5

2,5(3)

39

30

2,5(2)

2,419,70(3)

0,140,51(4)

63

3,5

Esgoto
domstico
Esgoto
domstico e
industrial
Esgoto
sinttico
Esgoto
sinttico
Esgoto
sinttico
Esgoto
sinttico

(1)

Concentrao afluente. (2) Valores mdios. (3) Carga orgnica em


kg DQOsm-3d-1. (4) Carga nitrogenada em kg NH4+-Nm-3d-1.

Os resultados apresentados na Tabela 12 indicam que o processo


de formao dos grnulos aerbios em um RBS utilizando esgoto
domstico requer mais tempo do que comparado aos sistemas que
utilizam esgoto sinttico. De acordo com Liu et al. (2010b), os grnulos
aerbios cultivados com efluente sinttico usualmente levam de 2 a 4
semanas para se formarem e de 1 a 2 meses para alcanar o estado
estacionrio em reatores de escala laboratorial. Esses autores sugerem que
isto pode ser explicado pelo fato de que os efluentes reais apresentam uma
elevada flutuao dos componentes, principalmente de DQO, o que leva a

89

uma condio ambiental instvel e resulta em um processo de granulao


mais lento do que comparado com os efluentes sintticos.

4.1.1.2 Comportamento dos Slidos e do IVL

Na Figura 14 est apresentada a variao da concentrao de SST e


SSV no reator e SST no efluente (sada do reator), bem como a proporo
SSV/SST no reator ao longo da Estratgia I. Aps a inoculao, a
concentrao inicial de SST no reator era de 1,6 gL-1 (dado no
apresentado na Figura 14). Em funo do baixo tempo de sedimentao,
o lodo com pior sedimentabilidade foi lavado do reator, saindo com o
efluente, e somente as partculas com boa sedimentabilidade ficaram
retidas no reator. Como resultado, a perda da biomassa causou uma
severa diminuio na concentrao de SST no reator, alcanando
0,2 gL-1 aos 7 dias de operao. Devido formao dos grnulos
(Figura 13), a concentrao de SST foi aumentando gradualmente,
estabilizando-se em torno de 1,5 gL-1 aps 100 dias de operao. J a
qualidade do efluente, em termos de SST, variou entre 30 e 160 mgL-1,
estabilizando-se em torno de 85 mgL-1 tambm aps 100 dias de
operao.
Entretanto, concentraes de biomassa mais elevadas eram
esperadas no reator, tendo em vista a estrutura compacta e densa dos
grnulos. Por outro lado, Liu & Tay (2007) consideram que a presena de
grnulos no garante uma elevada concentrao de biomassa no reator.
De acordo com De Kreuk et al. (2005b), a concentrao de SST
nos reatores granulares pode variar entre 0,88 a 16,2 gL-1, sendo o valor
mdio usualmente obtido pelos pesquisadores igual a 6,8 gL-1.
Apesar de terem obtido grnulos com dimetros semelhantes ao do
presente estudo, Ni et al. (2009) observaram concentraes de SST no
reator bem mais elevadas (valores entre 8,0 e 10,0 gL-1) e menores
concentraes de SST no efluente (em torno de 15 mgL-1) aps a
formao dos grnulos. Esses melhores resultados podem ter ocorrido em
virtude de os autores terem empregado tempos de sedimentao mais
elevados (entre 15 e 30 min). Liu et al. (2010b) tambm obtiveram
elevadas concentraes de biomassa aps o processo de granulao
(valores acima de 10,0 gL-1).
Resultados similares aos do presente estudo foram obtidos por
Liu et al. (2007a). Os autores reportaram uma concentrao mdia de
biomassa igual a 1,3 gL-1 aps 70 dias de operao de um RBS

90

(previamente inoculado com grnulos aerbios) utilizado para o


tratamento de esgoto domstico de baixa concentrao (DQO entre 100 e
280 mgL-1 e NH4+-N entre 12 e 88 mgL-1).
4 horas
100
80
60

1
40
20

SSV/SST (%)

SST e SSV (g.L-1)

3horas
2

Tempo (dias)
SSTreator

SSVreator

SSTefluente

SSV/SST

Figura 14. Evoluo da concentrao de SST e SSV no reator, de SST


no efluente e da proporo de SSV/SST no reator ao longo da
Estratgia I.

Em relao presena de slidos no efluente, segundo Arrojo et


al. (2004), a mesma pode variar dependendo da quantidade de biomassa
que lavada do reator e do teor de slidos presentes no afluente. Beun
et al. (2000) reportaram concentraes de SST no efluente prximas ao
do presente estudo (em torno de 75 mgL-1) em um RBS de grnulos
aerbios alimentado com afluente sinttico livre de slidos suspensos.
Ainda em relao Figura 14, pode-se perceber que a
concentrao de SSV no reator ao longo da Estratgia I seguiu a mesma
tendncia da curva de SST, estabilizando-se em torno de 1 gL-1 aps
100 dias de operao. J a proporo SSV/SST, que no incio da
operao era em torno de 60%, aumentou acentuadamente,
estabilizando-se em torno de 92% aps 42 dias de operao.
Ni et al. (2009) reportaram que a proporo SSV/SST aumentou
continuamente de 50% no inculo para 70-80% nos grnulos. Liu et al.
(2010b) obtiveram, durante todo o perodo de operao, valores de
SSV/SST acima de 90%. Resultados similares tambm foram obtidos
por Zheng et al. (2005). Esses autores, estudando a formao dos
grnulos em um RBS do tipo airlift alimentado com esgoto sinttico

91

enriquecido com sucrose, relataram uma proporo SSV/SST entre 92 e


94% aps 10 dias de operao.
De acordo com Wang et al. (2005b), a proporo SSV/SST pode
dar uma exata representao da biomassa presente nos grnulos. Esses
autores consideram que valores elevados de SSV/SST indicam que as
bactrias encontram-se em fase de crescimento e reproduo, o que
causa um rpido aumento da biomassa nos grnulos. Por outro lado,
baixos valores de SSV/SST indicam que as bactrias esto degradando o
material celular para obteno de energia, e como resultado, a biomassa
nos grnulos aumenta lentamente.
A evoluo do IVL em diferentes tempos de sedimentao (5, 10,
15 e 30 minutos) e a relao IVL30/IVL10 ao longo da Estratgia I esto
apresentadas na Figura 15.

3horas

4 horas

100

200

80

150

60

100

40

50

20

IVL30/IVL10 (%)

IVL (mL.g-1)

250

Tempo (dias)
IVL 5

IVL 10

IVL 15

IVL 30

IVL30/IVL10

Figura 15. Evoluo do IVL em diferentes tempos de sedimentao (5,


10, 15 e 30 minutos) e da relao IVL30/IVL10 ao longo da Estratgia I.

O lodo utilizado como inculo apresentava um IVL30 igual a


187 mLg-1. Com 7 dias de operao (Figura 15), esse valor caiu para
130 mLg-1, comprovando a observao de que a biomassa com pior
sedimentabilidade foi lavada do reator (Figura 14). Ao longo da
evoluo da formao dos grnulos (Figura 13), o IVL30 diminuiu
gradualmente, estabilizando-se em torno de 53 mLg-1, aps 100 dias de
operao. De acordo com Von Sperling (2002) quanto maior o valor do
IVL30, pior a sedimentabilidade do lodo. Portanto, pode-se concluir que
os grnulos maduros obtidos nessa pesquisa apresentaram uma melhor
sedimentabilidade quando comparada a do inculo.

92

Alm disso, a sedimentabilidade do lodo em funo do IVL 30


pode ser classificada, segundo Von Sperling (2002), como sendo de boa
sedimentabilidade (IVL30 entre 50-100 mLg-1), em relao aos
grnulos, e de mdia sedimentabilidade (IVL30 entre 100-200 mLg-1),
em relao ao inculo.
Analisando as Figuras 14 e 15, pode-se notar ainda que a
concentrao de biomassa no reator foi inversamente proporcional a
sedimentabilidade da mesma, ou seja, quanto maior a concentrao de
biomassa, maior a eficincia da sedimentao e menor o valor de IVL.
Essa mesma constatao foi observada por Schwarzenbeck et al. (2005).
A partir da Figura 15, percebe-se que houve diferenas entre os
valores de IVL5, IVL10, IVL15 e IVL30 durante todo o perodo de
operao do reator. No entanto, com a formao dos grnulos, essa
diferena diminuiu, e a relao IVL 30/IVL10 ficou prxima de 90% aps
140 dias de operao.
De acordo com De Kreuk et al. (2005b) a relao entre o IVL30 e
o IVL10 considerada com sendo um excelente indicador sobre a
formao dos grnulos, devido excelente sedimentabilidade dos
mesmos. Liu & Tay (2007) consideram que o processo de granulao
est completo quando a diferena entre IVL10 e o IVL30 est prxima de
10%, ou seja, IVL30/IVL10 em torno de 90%. Desta forma, pode-se
concluir que a partir dos 140 dias de operao, o processo de granulao
no reator estava completo, o que corrobora com a visualizao
microscpica apresentada na Figura 13I.
Ni et al. (2009) tambm observaram essa tendncia entre os valores
de IVL10 e IVL30. Os autores reportaram que o IVL10 diminuiu
gradualmente de 100 para 35 mLg-1, enquanto que o IVL30 diminuiu
gradualmente de 65 para 35 mLg-1.
J Liu et al. (2007a) verificaram uma diferena muito pequena
entre o IVL10 e o IVL30 durante o tempo de operao (valores abaixo de
70 mLg-1). Este resultado est relacionado com o fato de os autores
terem inoculado o reator com grnulos aerbios previamente formados
com esgoto sinttico, visto que a diminuio da relao IVL30/IVL10
ocorre ao longo do processo de formao dos grnulos.
Apesar de terem obtido grnulos com superfcie bastante
filamentosa, De Kreuk & Van Loosdrecht (2006) relataram baixos valores
de IVL10 (em torno de 38 mLg-1). Liu et al. (2010b) reportaram IVL30 e
IVL30/IVL5 em torno de 30 mLg-1 e acima de 90%, respectivamente, aps
a formao dos grnulos.
Na Tabela 13 esto resumidas as principais caractersticas dos
grnulos obtidos no presente estudo aps 140 dias de operao (processo

93

de granulao completo) e nos estudos apresentados acima utilizando


esgoto domstico.
Tabela 13. Comparao entre as principais caractersticas dos grnulos
obtidos em estudos utilizando esgoto domstico.
Referncia

Afluente

SST
(g L-1)

SSV/SST
(%)

IVL30
(mL g-1)

IVL30/IVL10
(%)

Este
estudo(1)
De Kreuk
& Van
Loosdrecht
(2006)
Ni et al.
(2009)

Esgoto
domstico

1,5

92

53

88

Esgoto
domstico

38(2)

Esgoto
8-10
70-80
35
100
domstico
Esgoto
Liu et al.
domstico
>10
>90
30
>90(3)
(2010b)
e industrial
(1)
Aps 140 dias de operao (processo de granulao completo). (2) IVL10.
(3)
IVL30/IVL5.

4.1.2 Desempenho do Reator

4.1.2.1 Monitoramento do Oxignio Dissolvido, pH e Temperatura

Os valores das concentraes de oxignio dissolvido (OD), pH e


temperatura nas fases aeradas ao longo da Estratgia I esto
apresentados na Tabela 14.
Em relao concentrao de OD, valores mdios de 8,3 e
7,5 mgL-1 foram obtidos durantes as fases aeradas dos ciclos de 3 e 4
horas, respectivamente. A menor concentrao mdia de OD durante os
ciclos de 4 horas pode estar relacionada com a maior concentrao de
SST no reator observada nesse perodo (Figura 14). Desta forma, houve
um maior consumo de OD por parte dos microrganismos no processo de
metabolizao do substrato.

94

Os valores de OD observados esto todos dentro do recomendado


para a oxidao da matria orgnica carboncea, de acordo com Metcalf
& Eddy (2003), e tambm para a ocorrncia do processo de nitrificao,
conforme Ferreira (2000). Por outro lado, os valores de OD encontramse todos acima do admitido para a ocorrncia da desnitrificao, de
acordo com Jordo & Pessa (2005). Entretanto, a concentrao de OD
foi medida no meio lquido, no representando a real concentrao de
OD dentro dos grnulos. Desta forma, a ocorrncia da desnitrificao
possvel mesmo sob condies de OD elevadas, como exposto no item
2.2.3.
Tabela 14. Resultados obtidos para OD, pH e temperatura nas fases
aeradas ao longo da Estratgia I.
Fase Aerada
Varivel

OD (mgL-1)

pH

T (C)

Anlise
Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados
Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados
Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados

3 horas

4 horas

8,3
1,3
9,9
4,7
29
8,0
0,2
8,8
7,6
42
18
3
23
11
42

7,5
1,8
10,3
2,6
70
8,3
0,2
8,8
7,8
70
21
2
28
16
70

De maneira geral, nota-se que os valores de OD na fase aerada


foram bastante elevados, o que por sua vez pode ter gerado um elevado
consumo de energia pelo sistema. No entanto, esses valores de OD
foram resultantes da elevada vazo de ar aplicada a fim de se obter uma
velocidade superficial ascensional de ar sempre maior do que 1,0 cms-1,
gerando assim o cisalhamento adequado para a formao dos grnulos,
conforme recomendado por McSwain & Irvine (2008). Segundo
Mosquera-Corral et al. (2005) e Liu & Liu (2006), os grnulos

95

desenvolvidos sob baixas concentraes de OD no so estveis, alm


de que nessas condies pode ocorrer, eventualmente, o encorajamento
do crescimento filamentoso.
Pode-se notar ainda que houve uma pequena variao de pH
durante as duas condies, com valores mdios de 8,0 e 8,3 para os
ciclos de 3 e 4 horas, respectivamente. Esses valores esto dentro do
recomendado para a oxidao da matria orgnica carboncea, de
acordo com Metcalf & Eddy (2003). No entanto, o pH mdio para os
ciclos de 4 horas est um pouco fora da faixa ideal para a ocorrncia de
nitrificao, que segundo USEPA (2010) de 7,4 a 8,0.
As temperaturas mdias para os ciclos de 3 e 4 horas foram,
respectivamente, de 18 e 21C, estando dento da faixa recomendada
para a oxidao do material orgnico, conforme SantAnna Jr. (2010).
Entretanto, esses valores se encontram fora da faixa de temperatura
tima de crescimento das bactrias nitrificantes, que, segundo Bernet &
Sprandio (2009), entre 28 e 36C.

4.1.2.2 Comportamento da Matria Carboncea e Nitrogenada

Os resultados obtidos com o RBSG em relao matria


carboncea e nitrogenada para os ciclos de 3 e 4 horas, respectivamente,
esto apresentados na Tabela 15. As principais variveis sero
exploradas mais detalhadamente nas Figuras 16 a 19.
Em relao varivel DQOT (Figura 16), a mesma foi
determinada apenas aps o incio da estabilizao dos grnulos no reator
(aps 130 dias de operao), tendo em vista que antes deste perodo os
flocos que sedimentavam mal eram constantemente lavados do reator.
No entanto, a partir da Figura 16 e da Tabela 15, percebe-se que mesmo
com fomao dos grnulos a DQOT do efluente era bastante elevada
(mdia 257 mgL-1). Segundo Schwarzenbeck et al. (2005), os RBSG
devem ser operados de tal maneira que a biomassa que sedimenta mal
(flocos) seja lavada a cada ciclo. Como resultado, uma frao
significativa de slidos suspensos pode ser encontrada no efluente,
resultando em valores elevados de DQOT.
Nas Figuras 17, 18 e 19 esto apresentadas, respectivamente, as
concentraes afluentes e efluentes de DQOs, COD e NH4+-N, e as
respectivas eficincias de remoo ao longo da Estratgia I.

96

Tabela 15. Desempenho do reator em relao remoo de matria carboncea e nitrogenada para os ciclos de 3 e 4
horas.
Ciclo 3 horas
Varivel

DQOT
(mgL-1)

DQOS
(mgL-1)

COD
(mgL-1)

NH4+-N
(mgL-1)

Anlise
Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados
Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados
Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados
Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados

Amostras
Afluente
Efluente
430
140
602
191
16
149
78
344
86
14
91
12
112
76
16

147
71
292
61
16
39
14
63
21
14
74
12
101
56
16

Ciclo 4 horas
Eficincia
(%)
64
18
90
27
68
15
92
43
18
8
26
7
-

Amostras
Afluente
Efluente
589
109
728
391
11
412
95
551
212
20
134
56
313
70
20
83
5
95
73
21

257
42
328
201
11
72
14
104
45
20
23
7
42
13
20
26
16
58
3
21

Eficincia
(%)
54
14
69
39
82
5
89
70
82
7
92
67
69
19
97
26
-

800

100
80

600

60
400
40
200

20

Tempo (dias)
Afluente

Efluente

Eficincia de Remoo (%)

Concentrao DQOT (mgL-1)

97

Eficincia de Remoo

1000

3 horas

4 horas

100

800

80

600

60

400

40

200

20

Tempo (dias)

Eficincia de Remoo (%)

Concentrao DQOS (mgL-1)

Figura 16. Comportamento da concentrao de DQO T afluente e


efluente e a respectiva eficincia de remoo aps 130 dias de operao.

Afluente
Efluente
Eficincia de Remoo
Figura 17. Comportamento da concentrao de DQO s afluente e
efluente e a respectiva eficincia de remoo ao longo da Estratgia I.

500

3 horas

4 horas

100

400

80

300

60

200

40

100

20

Tempo (dias)

Eficincia de Remoo(%)

Concentrao COD (mg.L-1)

98

120

3 horas

4 horas

100

100
80

80
60
60
40
40
20

20
0

Tempo (dias)

Eficincia de Remoo (%)

Concentrao de NH4+-N (mg.L-1)

Afluente
Efluente
Eficincia de Remoo
Figura 18. Comportamento da concentrao de COD afluente e
efluente e a respectiva eficincia de remoo ao longo da Estratgia I.

Afluente
Efluente
Eficincia de Remoo
Figura 19. Comportamento da concentrao de NH4+-N afluente e
efluente e a respectiva eficincia de remoo ao longo da Estratgia I.

Durante os primeiros 50 dias de operao o processo no estava


estvel, em virtude da necessidade de aclimatao do lodo inoculado s
novas condies operacionais e tambm devido baixa concentrao de
SST durante esse periodo, conforme apresentado na Figura 14.

99

Aps o perodo inicial de aclimatao, o desempenho do reator


aumentou continuamente, atingindo uma eficincia de remoo mdia
de DQOs de 78 9%, COD de 78 13% e NH 4+-N de 23 4%, para o
ciclo de 3 horas. Esse aumento na eficincia de remoo tambm est
relacionado com o aparecimento dos grnulos no reator (Figura 13D).
Em relao concentrao de DQO s, COD e NH4+-N no efluente, neste
mesmo perodo, obteve-se valores mdios de 85, 29 e 68 mgL-1,
respectivamente.
Aps 88 dias de operao, aumentou-se a durao do ciclo para 4
horas. Nas Figuras 17, 18 e 19 visualiza-se que operando o reator com
ciclos de 4 horas, a eficincia mdia de remoo de DQOs, COD e
NH4+-N aumentou para 82 5%, 82 7% e 69 19%, respectivamente.
Desta forma, a concentrao mdia de DQO s do efluente diminuiu para
72 mgL-1, a de COD para 23 mgL-1, e a de NH4+-N para 26 mgL-1,
mostrando que o aumento da durao do ciclo teve um maior impacto no
processo de nitrificao do que na remoo da matria carboncea.
De Kreuk & Van Loosdrecht (2006), operando um RBSG com
ciclos de 2 horas, no obtiveram um sistema estvel durante todo o
tempo de operao (70 dias). Os autores verificaram que o processo de
nitrificao foi limitado (em torno de 11% de eficincia) e que a
eficincia mdia de remoo de DQO s foi de apenas 49%. Em relao
concentrao de DQOs e NH4+-N do efluente, os autores obtiveram
valores mdios de 170 mgL-1 e 51 mgL-1, respectivamente.
Entretanto, Ni et al. (2009), trabalhando com ciclos de 3 horas de
durao, alcanaram elevadas eficincias de remoo aps 3 meses de
operao (DQO entre 85-95% e NH4+-N entre 90-99%). A elevada
eficincia do processo de nitrificao pode estar relacionada com o fato
de que os autores empregaram, durante o primeiro ms de operao,
ciclos de 4 horas, o que deve ter favorecido o crescimento dos
organismos nitrificantes.
Liu et al. (2010b), trabalhando com ciclos de 4 horas de durao,
tambm no obtiveram um sistema estvel durante os 50 primeiros dias
de operao. Aps esse perodo, a eficincia de remoo de DQO e
NH4+-N manteve-se em torno de 80 e 98%, respectivamente.
Na Tabela 16 esto apresentados os resultados do desempenho do
reator do presente estudo e de RBSG utilizados no tratamento de esgoto
domstico em ciclos operacionais com diferentes tempos de durao.
Esses resultados indicam que a remoo de NH 4+-N fortemente
afetada pela durao do ciclo. Esta constatao est de acordo com os
resultados encontrados por Tay et al. (2002), os quais investigaram a
formao de grnulos nitrificantes em ciclos com diferentes duraes e

100

reportaram que com ciclos de 3 horas o lodo foi completamente


lavado do reator, impedindo a formao de grnulos nitrificantes.
Tabela 16. Comparao entre o desempenho de diferentes RBSG
obtidos nos estudos utilizando esgoto domstico.
Afluente

Durao
ciclo (h)

Eficincia
DQO (%)

Eficincia
NH4+-N (%)

Este estudo

Esgoto
domstico

3
4

78(1)(2)
82(1)

23(1)(2)
69(1)

De Kreuk &
Van Loosdrecht
(2006)

Esgoto
domstico

49(2)

11(2)

85-95

90-99

80(2)

98(2)

Referncia

Ni et al. (2009)
Liu et al.
(2010b)
(1)
(2)

Esgoto
domstico
Esgoto
domstico
e industrial

Valores obtidos aps o perodo de aclimatao (a partir de 50 dias de operao).


Valores mdios.

De acordo com Wang & Liu (2008), a durao do ciclo


representa a freqncia com que os slidos so lavados do reator
atravs da fase de retirada do efluente tratado, e est relacionada com o
tempo de reteno hidrulica (TRH). Desta forma, com o aumento do
ciclo de 3 para 4 horas, o TRH do reator aumentou de 7,5 para 10 horas,
respectivamente, diminuindo a freqncia com que os slidos eram
lavados do reator e possibilitando o desenvolvimento de bactrias
nitrificantes no interior dos grnulos.
Alm disso, segundo Von Sperling (2002), a velocidade de
crescimento dos microrganismos nitrificantes, principalmente
Nitrosomonas, bem lenta, e bastante inferior dos microrganismos
responsveis pela estabilizao da matria carboncea. Assim, em um
sistema de tratamento biolgico em que se objetiva a nitrificao, o
tempo de residncia celular deve ser tal que propicie o desenvolvimento
das bactrias nitrificantes, antes que elas sejam lavadas do sistema.
De maneira geral, ciclos de curta durao podem impedir o
crescimento de flocos, dado que o material suspenso freqentemente
lavado do sistema. Por outro lado, se a durao do ciclo muito curta,
a perda de biomassa no pode ser compensada pelo crescimento
bacteriano. Desta forma, o ciclo deve ser suficientemente curto para que

101

o lodo que sedimenta mal seja freqentemente lavado do reator, e


ainda suficientemente longo para que haja o crescimento e o acmulo
microbiano (LIU & TAY, 2004).
As concentraes de nitrito e nitrato obtidas na Estratgia I esto
apresentadas na Tabela 17. Na Figura 20 tem-se o comportamento da
concentrao de NO2--N e NO3--N no efluente tratado e a respectiva
eficincia de desnitrificao e de remoo de nitrognio total.
Tabela 17. Concentraes de nitrito e nitrato durante a Estratgia I.

Durao
ciclo

Varivel

NO2--N
(mgL-1)
3 horas
NO3--N
(mgL-1)

NO2--N
(mgL-1)
4 horas
NO3--N
(mgL-1)

Anlise
Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados
Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados
Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados
Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados

Amostras
Afluente Efluente
0,1
0,2
0,4
0,0
16
0,2
0,2
0,7
0,0
16
0,3
0,7
2,9
0,0
20
0,3
0,7
2,4
0,0
20

3,6
1,8
8,6
0,7
16
4,4
1,3
7,2
2,1
16
9,7
5,8
22,8
1,1
20
9,3
3,7
14,4
1,2
20

Durante o tempo em que o reator foi operado em ciclos de 3


horas, a formao de NO2--N e NO3--N foi baixa (valores mdios de 3,6
mgL-1 e 4,4 mgL-1, respectivamente), tendo em vista a baixa eficincia
do processo de nitrificao durante este perodo (Figura 19). Alm disso,
parte do NO3--N formado foi convertido a nitrognio gasoso pelo
processo de desnitrificao, com eficincia mdia de 48 12%. A

102

25

3 horas

4 horas

100

20

80

15

60

10

40

20

Nitrito Efluente

Eficincia (%)

Concentrao NOx-N (mg.L-1)

ocorrncia da nitrificao e desnitrificao simultneas (NDS), mesmo


sob concentraes de OD elevadas (Tabela 14), pode ter sido devida
presena de microrganismos desnitrificantes aerbios, como os
apresentados no item 2.2.3.1, uma vez que os grnulos ainda estavam
em processo de formao (Figura 13), o que diminui a probabilidade de
existncia de micro zonas anxicas no interior dos mesmos durante este
perodo.

Tempo (dias)
Nitrato Efluente

Eficincia Desnitrificao

Eficincia Remoo Nt
-

Figura 20. Comportamento da concentrao de NO2 -N e NO3--N no


efluente tratado, e a respectiva eficincia de desnitrificao e de
remoo de nitrognio total ao longo da Estratgia I.

Alm disso, pode-se notar ainda que operando o reator com ciclos
de 4 horas, houve um aumento na concentrao de NO 2--N e NO3--N no
efluente (valores mdios de 9,7 mgL-1 e 9,3 mgL-1, respectivamente),
devido ao aumento da eficincia do processo de nitrificao observado
durante este perodo (Figura 19). A presena de nitrito no efluente
tratado indica que o processo de nitrificao no ocorreu at seu ltimo
estgio de oxidao (nitratao). Alm disso, a eficincia mdia de
desnitrificao aumentou para 64 14%, sendo que as maiores
eficincias (em torno de 80%) foram obtidas aps 140 dias de operao,
o que corresponde ao perodo em que o processo de granulao no reator
estava completo (Figura 13I e Figura 15). Nesse perodo, a concentrao
de nitrito no efluente foi menor (em torno de 4,5 mgL-1), indicando uma
melhora na etapa de nitratao. Portanto, a formao de grnulos

103

maduros e densos pode ter contribudo para a existncia de micro zonas


anxicas e, conseqentemente, para a maior eficincia do processo de
NDS.
De maneira geral, pode-se concluir que a desnitrificao no foi
afetada pela durao do ciclo visto que os microrganismos
responsveis por esse processo so heterotrficos e apresentam uma
elevada velocidade de crescimento mas sim pela existncia de
grnulos maduros e compactos no reator.
Atividades desnitrificantes sob condies aerbias tm sido
reportadas na literatura sobre grnulos aerbios (BEUN et al., 2001;
MOSQUERA-CORRAL et al., 2005; WAN & SPERANDIO, 2009).
Entretanto, Liu et al. (2010b) no observaram a ocorrncia do processo
de NDS mesmo depois que dimetro mdio dos grnulos alcanou
800 m. J Ni et al. (2009) verificaram que apenas uma pequena parte
do nitrato formado foi usada para a desnitrificao.
Na Tabela 18 esto apresentados os percertuais de nitrificao,
desnitrificao e remoo de nitrognio total durante a Estratgia I.
Tabela 18. Percentuais de nitrificao, desnitrificao e remoo de
nitrognio total durante a Estratgia I.
Durao
do Ciclo

3 horas

4 horas

Anlise

Nitrificao
(%)

Desnitrificao
(%)

Nitrognio
Total (%)

Mdia
Desvio Padro
Mximo
Mnimo
Nmero dados
Mdia
Desvio Padro
Mximo
Mnimo
Nmero dados

18
8
26
7
16
69
19
97
26
21

48
12
61
27
16
64
14
83
32
20

10
5
17
2
16
46
19
80
9
20

Pode-se concluir que a remoo de nitrognio total (NH 4+-N e


NOx-N) foi fortemente afetada pela durao do ciclo, sendo que a
nitrificao foi a etapa limitante. Contudo, mesmo com o aumento do
ciclo, a remoo de nitrognio total foi baixa (mdia de 46%). De
acordo com De Kreuk & Bruin (2004), grnulos aerbios cultivados em
concentraes de OD prximas a saturao apresentam elevada

104

capacidade de remoo de DQO e NH 4+-N, mas, por outro lado, a


capacidade de remoo de nitrognio total insuficiente. Alm disso,
possvel observar ainda que os maiores valores de eficincia de remoo
(em torno de 66%) foram obtidos aps 140 dias de operao, devido
melhor eficincia do processo de NDS durante esse perodo.

4.1.2.3 Comportamento do Fosfato

As concentraes de fosfato e as respectivas eficincias de


remoo obtidas durante a Estratgia I esto apresentadas na Tabela 19.
O comportamento da concentrao de PO 4-P afluente e efluente e a
respectiva eficincia de remoo ao longo da Estratgia I esto
apresentados na Figura 21.
Tabela 19. Concentraes de fosfato e eficincia de remoo durante a
Estratgia I.

Durao
do Ciclo

3 horas

4 horas

Anlise
Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados
Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados

PO4-P (mgL-1)
Afluente Efluente
9,8
1,2
11,4
7,9
16
9,7
1,2
11,7
8,2
21

8,2
1,2
10,8
6,3
16
6,9
1,4
9,4
4,4
21

Eficincia
(%)
17
8
29
3
30
10
51
11
-

Pode-se perceber que houve uma grande oscilao na remoo de


fosfato ao longo da Estratgia I. Para o ciclo de 3 horas, a eficincia
mdia de remoo foi de 17 8% e a concentrao mdia de PO 4-P no
efluente foi de 8,2 mgL-1. J para o ciclo de 4 horas, a eficincia mdia
de remoo aumentou para 30 10% e a concentrao mdia de PO 4-P
no efluente diminuiu para 6,9 mgL-1.
Entretanto, 100% dos valores de PO4-P no efluente e de eficincia
de remoo esto acima do exigido pela legislao ambiental de Santa

105

3 horas

12

4 horas

100
80

60
6
40
3

20

Tempo (dias)
Afluente

Efluente

Eficincia de Remoo (%)

Concentrao PO4-P (mg.L-1)

Catarina, a qual estabelece um valor mximo de 4 mgL-1 para fsforo


total e tratamento com eficincia mnima de 75% para lanamento de
efluentes em corpos lnticos (SANTA CATARINA, 2009).

Eficincia de Remoo

Figura 21. Comportamento da concentrao de PO 4-P afluente e


efluente e a respectiva eficincia de remoo ao longo da Estratgia I.

O desempenho do RBSG na remoo de PO4-P foi mais acentuado


aps 150 dias de operao, o que corresponde ao perodo em que o
processo de granulao no reator estava completo (Figura 13I e Figura
15). Desta forma, pode-se concluir que a formao de grnulos maduros
e densos pode ter contribudo para a existncia de micro zonas
anaerbias e, conseqentemente, para a maior eficincia na remoo de
PO4-P.
Zhu et al. (2005) tambm observaram uma melhora na remoo de
fsforo com a evoluo do processo de granulao. Os autores obtiveram
eficincias mdias de 60% quando a biomassa era composta
principalmente por flocos, aumentando gradualmente para 67-87% com o
aumento da frao de grnulos, e atingindo 99% aps a completa
formao dos grnulos no reator.
A remoo de fsforo tem sido reportada na literatura sobre
grnulos aerbios (CASSIDY & BELIA, 2005; DE KREUK et al.,
2005a; LI et al., 2005; ZHU et al., 2005; YILMAZ et al., 2007;
KISHIDA et al., 2009; WANG et al., 2009; WU et al., 2010). No
entanto, esses autores empregaram uma alternncia de fases

106

anaerbias/aerbias dentro do reator para a remoo biolgica de


fsforo.

4.1.2.4 Taxa de Consumo de Oxignio Especfica (TCOE)

TCOE (mgO2.gSSV-1.h-1)

A atividade das bactrias, em termos de taxa de consumo de


oxignio especfica (TCOE), ao longo da Estratgia I, apresentada na
Figura 22. A TCOE foi determinada logo aps a fase de enchimento,
tendo em vista mxima disponibilidade de substrato e,
conseqentemente, mxima atividade dos microrganismos nesse
perodo. Entretanto, essa varivel s pde ser medida aps 95 de
operao (ciclos de 4 horas) em virtude de problemas operacionais na
sonda multiparmetros.

200

150

100

50

Tempo (dias)
Figura 22. Comportamento da taxa de consumo de oxignio especfica
aps 95 dias de operao.

A partir dessa figura, verificam-se trs fases distintas no


comportamento da TCOE: at os 140 dias de operao a TCOE estava
estvel em torno de 60 mgO 2gSSV-1h-1; aps esse perodo, houve um
aumento acentuado da TCOE de 62 para 163 mgO2gSSV-1h-1; por
ltimo, a TCOE estabilizou-se em torno de 154 mgO2gSSV-1h-1 aps

107

150 dias de operao, o que corresponde ao perodo em que o processo


de granulao no reator estava completo (Figura 13I e Figura 15). Esses
resultados indicam que os grnulos maduros apresentam uma maior
atividade, corroborando com as observaes realizadas nas Figuras 17 a
21.
De acordo com Liu & Tay (2004), uma ampla faixa de TCO E tem
sido reportada na literatura sobre grnulos aerbios. Sun et al. (2006)
obtiveram valores de TCOE entre 59 a 382 mgO2gSSV-1h-1 em 4
reatores alimentados com diferentes substratos sintticos (acetato,
glicose, peptona e fcula). Segundo esses autores, em comparao com
os flocos de lodo ativado, os grnulos aerbios apresentam uma maior
atividade, em termos de TCOE.
4.1.2.5 Monitoramento de Ciclos
Ciclo de 3 horas:
Na Figura 23 apresentado o comportamento da concentrao de
DQOs e de NH4+-N ao longo de um ciclo padro de 3 horas, monitorado
aos 79 dias de operao do reator. Observa-se uma queda gradual na
concentrao de DQOs e NH4+-N durante as 2 horas iniciais do ciclo. No
restante do tempo, a concentrao de substrato permanece praticamente
constante, chegando ao final do ciclo com DQO s de 78 mgL-1 e NH4+-N
de 62 mgL-1. As eficincias de remoo de DQOs e de NH4+-N para este
ciclo foram, respectivamente, de 68% e 21%.
Na Figura 24 apresentado o comportamento da concentrao de
NO2--N e NO3--N ao longo do ciclo monitorado. Mesmo com a baixa
eficincia de nitrificao, o consumo de NH4+-N (Figura 23) acarretou
na formao de NO2--N e NO3--N no reator (Figura 24). Alm disso,
parte do NO3--N produzido foi convertido a N2, resultando em uma
eficincia de desnitrificao de 54%. As concentraes de NO2--N e
NO3--N no efluente tratado foram iguais a 3,3 mgL-1 e 4,3 mgL-1,
respectivamente. A remoo de nitrognio total para este ciclo foi de
apenas 11%.

108
100
80

300

60
200
40
100

20

NH4+-N (mg.L-1)

DQOS (mg.L-1)

400

0
0

Tempo (horas)
DQOs

NH4-N

Figura 23. Comportamento da DQOs e da NH4+-N ao longo de um ciclo


padro de 3 horas monitorado aos 79 dias de operao da Estratgia I.

NOX-N (mg.L-1)

12

0
0

Tempo (horas)
NO2-N

NO3-N

Figura 24. Comportamento do nitrito e do nitrato ao longo de um ciclo


padro de 3 horas monitorado aos 79 dias de operao da Estratgia I.

Na Figura 25 apresenta-se o comportamento do OD, pH e


temperatura ao longo do ciclo monitorado. A temperatura no reator
manteve-se constante em torno de 20 C durante todo o ciclo. O OD
variou de 7,6 mgL-1, no incio do ciclo, a 9,2 mgL-1, no final da fase de
aerao. Com o desligamento da aerao durante a fase de sedimentao
(15 ltimos minutos do ciclo), a concentrao de OD diminui
continuamente, atingindo 5,8 mgL-1 no final do ciclo. O pH sofreu um

109

aumento (de 7,7 a 8,4) durante os primeiros 60 minutos, mantendo-se


estvel em torno de 8,3 no restante do ciclo.
10

15

10
6
5

Temperatura ( C)

OD (mg.L-1) e pH

20

0
0

Tempo (horas)
pH

OD

Figura 25. Comportamento do oxignio dissolvido, pH e temperatura


ao longo de um ciclo padro de 3 horas monitorado aos 79 dias de
operao da Estratgia I.

Na Figura 26 tem-se o comportamento do fosfato ao longo do


ciclo monitorado. Verificou-se uma pequena remoo de PO4-P (19%)
durante o ciclo, sendo que a concentrao de PO4-P no efluente tratado
foi igual a 7,2 mgL-1.
10

PO4-P(mg.L-1)

0
0

Tempo (horas)
Figura 26. Comportamento do fosfato ao longo de um ciclo padro de 3
horas monitorado aos 79 dias de operao da Estratgia I.

110

Ciclo de 4 horas:
Na Figura 27 apresentado o comportamento da concentrao de
DQOs e de NH4+-N, bem como da taxa de consumo de oxignio (TCO)
da biomassa ao longo de um ciclo padro de 4 horas, monitorado aos
135 dias de operao do reator. Observa-se uma elevada queda na
concentrao de DQOs e NH4+-N no incio do ciclo, mostrando que o
substrato principalmente absorvido e/ou removido nos primeiros 30
minutos. No restante do tempo, a concentrao de substrato permaneceu
praticamente constante, chegando ao final do ciclo com DQO s de
78 mgL-1 e NH4+-N de 38 mgL-1. Essa concentrao de DQOs no
efluente tratado pode ser atribuda a frao de substrato lentamente
biodegradvel usualmente presente no esgoto domstico. As eficincias
de remoo de DQOs e de NH4+-N para este ciclo foram,
respectivamente, de 79% e 56%.
Como exposto anteriormente no item 2.4, a fase aerada de um
RBSG consiste de uma fase de degradao, na qual o substrato
consumido at um valor mnimo, seguida de uma fase de inanio, na
qual o substrato no est mais disponvel (ADAV et al., 2008). Essas
duas fases podem ser facilmente identificadas no ciclo apresentado na
Figura 27, sendo possvel observar a fase de degradao durante os 30
primeiros minutos e a fase de inanio durante o restante do ciclo. No
entanto, essas fases no podem ser identificadas no ciclo apresentado na
Figura 23. Apesar do efeito da fase de inanio no processo de
granulao no estar ainda completamente claro, Liu & Tay (2004)
sugerem que a mesma tem um papel importante no processo de
agregao microbiana, conduzindo a grnulos mais fortes e densos.
A atividade das bactrias, em termos de TCO, foi bastante
elevada no incio do ciclo devido maior disponibilidade de substrato,
atingindo um valor mximo de 60 mgO2L-1h-1 (Figura 27). A
diminuio da concentrao de substrato provocou uma elevada queda
na TCO nos primeiros 30 minutos. No restante do ciclo, a TCO caiu
menos acentuadamente, chegando ao final do ciclo com um valor de
12 mgO2L-1h-1, o que pode indicar o trmino do processo de oxidao.
Neste ciclo, a concentrao celular no reator, em termos de
slidos suspensos volteis (SSV), foi de 1,16 gL-1. Com isso, pde-se
determinar a TCOespecfica mxima, dividindo a TCO mxima (incio do
ciclo) pela concentrao celular, onde se obteve um valor igual a
52 mgO 2gSSV-1h-1. Este valor encontra-se prximo a faixa de
47-58 mgO2gSSV-1h-1 obtida por Thanh et al. (2009) em um RBSG
alimentado com esgoto sinttico sob diferentes cargas orgnicas.

111

100
80

300

60
200
40
100

20

NH4+-N (mg.L-1)
TCO (mg O2.L-1.h-1)

DQOS (mg.L-1)

400

0
0

Tempo (horas)
NH4-N
TCO
DQOs
+
Figura 27. Comportamento da DQOs, da NH4 -N e da TCO ao longo de
um ciclo padro de 4 horas monitorado aos 135 dias de operao da
Estratgia I.

Na Figura 28 apresentado o comportamento da concentrao de


NO2--N e NO3--N ao longo do ciclo monitorado.

NOX-N (mg.L-1)

12

0
0

Tempo (horas)
NO2-N

NO3-N

Figura 28. Comportamento do nitrito e do nitrato ao longo de um ciclo


padro de 4 horas monitorado aos 135 dias de operao da Estratgia I.

112

Com a oxidao da NH4+-N (Figura 27), houve a formao de


e NO3--N no reator (Figura 28), devido ao processo de
nitrificao. Alm disso, parte do NO3--N produzido foi convertido a N2,
resultando em uma eficincia de desnitrificao de 68%. As
concentraes de NO2--N e NO3--N no efluente tratado foram iguais a
5,2 mgL-1 e 11,4 mgL-1, respectivamente. A remoo de nitrognio
total para este ciclo foi de 38%.
Na Figura 29 apresenta-se o comportamento do OD, pH e
temperatura ao longo do ciclo monitorado. A temperatura manteve-se
constante em torno de 18 C durante todo o ciclo. O OD na aerao
variou de 6,7 mgL-1, durante a fase de degradao, a 10 mgL-1, durante
a fase de inanio. Durante a sedimentao, a concentrao de OD
diminui continuamente, atingindo 7,7 mgL-1 no final do ciclo. O pH
sofreu um leve aumento durante os 30 primeiros minutos, mantendo-se
estvel em torno de 8,5 no restante do ciclo.
Como exposto anteriormente, a nitrificao produz acidez,
reduzindo o pH, enquanto que a desnitrificao produz alcalinidade,
provocando, consequentemente, o aumento do pH. Desta forma, a
estabilidade do pH observada durante o ciclo comprova a ocorrncia
simultnea do processo de nitrificao e desnitrificao no ciclo
monitorado.
NO2--N

20

15
10
10

8
5

Temperatura ( C)

OD (mg.L-1) e pH

12

0
0

Tempo (horas)
OD

pH

Figura 29. Comportamento do oxignio dissolvido, pH e temperatura


ao longo de um ciclo padro de 4 horas monitorado aos 135 dias de
operao da Estratgia I.

113

O comportamento do potencial redox (ORP) ao longo do ciclo


monitorado est apresentado na Figura 30. Como as outras variveis, o
ORP aumentou acentuadamente de -216 mV para -50 mV, durante os 30
primeiros minutos. Aps esse perodo, o ORP aumentou
gradativamente, estabilizando-se em torno de -14 mV aps 3 horas de
ciclo. Andreottola et al. (2001) e Bortolotto et al. (2004) tambm
observaram um aumento no ORP com o incio do processo de
nitrificao.
0

ORP (mV)

-50
-100

-150
-200
-250

Tempo (horas)
Figura 30. Comportamento do potencial redox ao longo de um ciclo
padro de 4 horas monitorado aos 135 dias de operao da Estratgia I.

O comportamento do fosfato ao longo do ciclo monitorado pode


ser observado na Figura 31. Apesar da inexistncia de uma fase
anaerbia na operao do RBSG, houve uma remoo de 24% de PO4-P
durante o ciclo monitorado, a qual provavelmente deve ter ocorrido
dentro da micro zona anaerbia existente nos grnulos. A concentrao
de PO4-P no efluente tratado foi igual a 6,3 mgL-1.
No geral, verificou-se que, para todas as variveis monitoradas, o
desempenho do reator no ciclo de 4 horas foi superior ao do ciclo de 3
horas.

114

10

PO4-P(mg.L-1)

0
0

Tempo (horas)
Figura 31. Comportamento do fosfato ao longo de um ciclo padro de 4
horas monitorado aos 135 dias de operao da Estratgia I.

4.1.3 Hibridizao Fluorescente in situ (FISH)

Os resultados obtidos com a anlise FISH de amostra de grnulos


coletada aos 150 dias de operao da Estratgia I esto apresentados na
Tabela 20. A amostra foi caracterizada como sendo heterognea e com
muito material extracelular. De acordo com Tay et al. (2001c), a
presena de material extracelular auxilia no processo de granulao
aerbia.
Verificou-se que aproximadamente 75% das bactrias estavam
ativas, sendo a maioria composta por organismos nitrificantes, com 20%
de bactrias oxidadoras de amnia, do tipo Nitrosomanas spp e
Nitrosococcus mobilis, e 40% de bactrias oxidadoras de nitrito, do tipo
Nitrobacter spp. Alm destas bactrias, foram identificadas as
betaproteobactrias (10%), as quais tambm oxidam a amnia. Desta
forma, pode-se concluir que as condies operacionais do reator durante
a Estratgia I ciclo 4 horas foram adequados, visto que possibilitou o
crescimento destes microrganismos essenciais ao processo de
nitrificao.
Ademais, foram identificadas bactrias metanognicas do tipo
Methanosarina, Methanosaeta e Methanomicrobiales, confirmando a
presena de zonas anaerbias no interior dos grnulos.

115

Tabela 20. Resultados da anlise FISH dos grnulos aos 150 dias de
operao da Estratgia I.

Sondas
EUB
(todas as eubactrias)
NEU
(a maioria das Nitrosomonas +
Nitrosococcus mobilis)
NSO
(Betaproteobacterias oxidadoras de amnia)
NIT
(Nitrobacter spp)
DSV
(Bactrias Sulfato RedutorasDesulfovibionaceae)
Eury
(grupos Methanosarina, Methanosaeta,
Methanomicrobiales)

Porcentagem (em
relao ao DAPI)
<75% DAPI
Muitas
Pequenas colnias
>20% DAPI
Poucas
>10% DAPI
Poucas
40% DAPI
Algumas
10% DAPI
Poucas
>10% DAPI
Poucas

116

4.2 ESTRATGIA OPERACIONAL II


A Estratgia Operacional II teve como objetivo avaliar o efeito da
carga orgnica no desempenho do RBSG e nas caractersticas
morfolgicas dos grnulos. Desta forma, durante esta estratgia, foi
adicionado acetato de sdio ao esgoto bruto a fim de aumentar a carga
orgnica aplicada ao reator.
As caractersticas do esgoto domstico durante esta estratgia esto
apresentadas na Tabela 21. O esgoto utilizado pode ser classificado, de
acordo com Metcalf & Eddy (2003), como sendo de alta concentrao, em
termos de DQO, NH4+-N e PO4-P.
Para uma melhor avaliao do efeito da carga no RBSG, os
resultados da Estratgia II foram comparados com os resultados obtidos
durante a Estratgia I, no perodo em que o reator foi operado em ciclos
de 4 horas, tendo em vista as mesmas condies operacionais do ciclo
(durao das fases). Desta forma, a partir das Tabela 11 e Tabela 21,
verifica-se que a carga orgnica, em termos de DQOs, durante a Estratgia
II foi o dobro da aplicada durante a Estratgia I (1,00 kg DQOsm-3d-1).
Tabela 21: Caractersticas do esgoto domstico e cargas aplicadas
durante a Estratgia Operacional II.

Parmetros
DQOs (mgL-1)
NH4+-N (mgL-1)
PO4-P (mgL-1)
Carga orgnica (kg DQOsm-3d-1)
Carga nitrogenada (kg NH4+-Nm-3d-1)
Carga de fsforo (kg PO 4-Pm-3d-1)

Estratgia II
(n=16)
849 107
76 9
9,1 1,2
2,00 0,26
0,18 0,02
0,02 0,00

117

4.2.1 Caractersticas dos Grnulos Aerbios

4.2.1.1 Morfologia dos Grnulos

Na Figura 32 apresenta-se a morfologia dos grnulos no final de


Estratgia I (Figura 32A) e em diferentes dias da Estratgia II (Figuras
32B a 32F).

Figura 32. Morfologia dos grnulos no final de Estratgia I (A) e ao


longo da Estratgia II: (B) 5 dias; (C) 42 dias; (D) 55 dias; (E) 61 dias e
(F) 68 dias. Barra = 0,1 mm

Com o aumento da carga orgnica na Estratgia II, observou-se


que aps 5 dias de adio de acetato de sdio houve a desintegrao dos

118

grnulos maduros (Figura 32A) e o aparecimento de flocos com


superfcie bastante filamentosa (Figura 32B).
De acordo com Moy et al. (2002), os RBSG podem ser
submetidos a diferentes cargas orgnicas sem que haja o
comprometimento da integridade dos grnulos aerbios. Entretanto, para
isso necessrio que alguns parmetros sejam ajustados como, por
exemplo, a velocidade superficial ascensional de ar. Chen et al. (2008)
demonstraram que a combinao da fora de cisalhamento hidrodinmico
(em termos de velocidade superficial ascensional de ar) e da carga
orgnica influencia o processo de granulao, as caractersticas dos
grnulos e o desempenho do reator.
Tendo em vista essas constataes, aumentou-se a vazo de ar
aplicada ao sistema de 243 Lh-1 para 275 Lh-1 o que corresponde a
uma velocidade superficial ascensional de 1,1 cms-1 e 1,2 cms-1,
respectivamente a fim de aumentar as foras de cisalhamento e
favorecer a formao de grnulos mais fortes, compactos, densos e
arredondados (TAY et al., 2004a).
Desta forma, aos 42 dias de operao (Figura 32C) verificou-se
um aumento no dimetro dos grnulos, sendo que os flocos, apesar de
serem ainda dominantes no reator, passaram a apresentar uma estrutura
no filamentosa. A partir dos 55 dias (Figuras 32D e 32E), a biomassa
do reator era formada predominantemente por grnulos, e com 68 dias
(Figura 32F), constatou-se novamente a presena de grnulos maduros e
compactos, com dimetros variando entre 0,2 e 0,7 mm e dimetro
mdio de 0,3 mm.
Comparando esses resultados com os obtidos durante a Estratgia
I (Figura 13), pode-se perceber que o dimetro dos grnulos foi um
pouco menor na estratgia com maior carga orgnica. Entretanto, Moy
et al. (2002), Tay et al. (2004c), Yang et al. (2004), Chen et al. (2008) e
Thanh et al. (2009), estudando as caractersticas dos grnulos aerbios
sob diferentes cargas orgnicas, reportaram que o tamanho dos grnulos
aumenta com o aumento da carga orgnica aplicada. De acordo com
Yang et al. (2004), isso ocorre pelo fato de que uma alta carga de
substrato resulta em uma alta taxa de crescimento microbiano, o que,
conseqentemente, resulta em grnulos de maiores dimenses.
Por outro lado, Yang et al. (2004), Tay et al. (2004a) e Chen et
al. (2008) constataram que o tamanho dos grnulos inversamente
relacionado s foras de cisalhamento. Segundo Yang et al. (2004),
elevadas foras de cisalhamento provocam uma maior coliso entre
partculas e uma maior frico partcula/lquido. Deste modo, ocorre um
maior desprendimento e os grnulos desenvolvidos nessas condies so

119

menores. Nesse caso, o crescimento observado da comunidade


microbiana vai ser resultante da interao entre a velocidade de
crescimento e as foras de desprendimento. Diante disso, pode-se
deduzir que, apesar do aumento da carga orgnica, o maior cisalhamento
ocasionado pelo aumento da vazo de ar acarretou em grnulos de
menores dimenses durante a Estratgia II.

4.2.1.2 Granulometria dos Grnulos

A distribuio do tamanho das partculas do lodo aos 33 e 70 dias


de operao da Estratgia II esto apresentadas, respectivamente, nas
Figuras 33 e 34. Aos 33 dias de operao (Figura 33), a distribuio do
tamanho das partculas variou entre 10 e 600 m, sendo que a
percentagem de volume de lodo com tamanho inferior a 200 m foi de
66% neste perodo. J aos 70 dias de operao (Figura 34), a
distribuio do tamanho das partculas foi um pouco maior, variando
entre 20 e 700 m, e a percentagem de volume de lodo com tamanho
inferior a 200 m diminuiu para 40%.
De acordo com Liu et al. (2010b), quando a percentagem de
volume de lodo com tamanho inferior a 200 m for menor do que 50%,
pode-se considerar que os grnulos so dominantes no reator. Desta
forma, pode-se concluir que aos 33 dias de operao os flocos eram
dominantes no reator em virtude da desintegrao dos grnulos no incio
da Estratgia II. Aos 70 dias de operao, os grnulos passaram a ser
dominantes, visto que a percentagem de volume de lodo com tamanho
inferior a 200 m foi menor do que 50%. Essas constataes
corroboram as observaes microscpicas (Figuras 32C e 32F).
Considerando que as partculas com tamanho superior a 200 m
so grnulos, pode-se perceber que no fim da Estratgia II a percentagem
de grnulos foi baixa (60%) em comparao com a percentagem obtida
pelos autores citados acima. Isso pode ter sido devido ao percentual de
troca volumtrica (PTV) do reator, que no presente estudo foi de 40% e
nos estudos de Liu et al. (2008) e Liu et al. (2010b) foi de 50%. Wang et
al. (2006) investigaram o efeito do PTV na formao de grnulos
aerbios alimentados com acetato. Para isso, os autores operaram quatro
RBS com diferentes PTV (20, 40, 60 e 80%) e observaram um aumento
na frao de grnulos com o aumento do PTV, sendo que com PTV igual
a 40% a frao de grnulos no reator era em torno de 50%.

120

Contudo, mesmo tendo em vista essas constataes, no foi


possvel aumentar o PTV do reator, visto que para isso seria necessrio
parar o sistema e realizar algumas modificaes estruturais no reator.

Figura 33. Distribuio do tamanho das partculas do lodo presente no


reator aos 33 dias de operao da Estratgia II.

Figura 34. Distribuio do tamanho das partculas do lodo presente no


reator aos 70 dias de operao da Estratgia II.

4.2.1.3 Polissacardeos Extracelulares (PSE)

O comportamento da concentrao de polissacardeos


extracelulares (PSE) ao longo da Estratgia II est apresentado na Figura
35. No primeiro dia da Estratgia II, a concentrao de PSE era de
100 mggSSV-1, diminuindo, em seguida, para 39 mggSSV -1 devido
desintegrao dos grnulos. Tay et al. (2001c), Dulekgurgen et al.
(2008) e Adav et al. (2010) tambm observaram uma diminuio da
produo de polissacardeos com a desintegrao dos grnulos. De
acordo com Tay et al. (2001c), os PSE tm um importante papel na
formao e/ou manuteno dos grnulos aerbios.

121

Concentrao PSE (mggSSV-1)

Com o aumento da velocidade superficial ascensional do ar e,


conseqentemente, com o restabelecimento dos grnulos, a
concentrao de PSE aumentou acentuadamente, estabilizando-se em
torno de 132 mggSSV-1, aps 40 dias de operao. Ni et al. (2009) e Li
et al. (2010) reportaram concentraes de PSE nos grnulos aerbios em
torno de 62 mggSSV-1 e entre 24 e 48 mggSSV-1, respectivamente.
Segundo Tay et al. (2001c), o aparecimento dos grnulos
aerbios est diretamente relacionado com um aumento significativo da
concentrao de polissacardeos. Alm disso, Tay et al. (2001c), Liu &
Tay (2002) e Yang et al. (2004) relataram que elevadas foras de
cisalhamento podem estimular a produo de PSE, auxiliando na
formao de grnulos densos e compactos. De acordo com Dulekgurgen
et al. (2008), o aumento na produo de PSE pode ser interpretado como
sendo uma estratgia metablica da biomassa face s condies de
cisalhamento elevadas.
Tendo em vista essas constataes, pode-se concluir que a
formao e a estabilidade dos grnulos aerbios dependem da produo
de PSE e das foras de cisalhamento proporcionadas pela aerao.

200

150

100

50

Tempo (dias)

Figura 35. Comportamento da concentrao de polissacardeos


extracelulares ao longo da Estratgia II.

122

4.2.1.4 Comportamento dos Slidos e do IVL

100

80

60

40

20

SSV/SST (%)

SST e SSV (g.L-1)

Na Figura 36 est apresentada a variao da concentrao de SST


e SSV no reator e SST no efluente, bem como a proporo SSV/SST no
reator ao longo da Estratgia II.
Como discutido anteriormente, no final da Estratgia I (Figura 14)
a concentrao de SST no reator era de 1,5 gL -1 e no efluente era de
85 mgL-1. Entretanto, no incio da Estratgia II houve uma reduo na
concentrao de slidos no reator (SSTreator = 980 mgL-1) e um aumento
na concentrao de slidos no efluente (SSTefluente = 293 mgL-1), em
virtude da desintegrao dos grnulos (Figura 32B). De acordo com
Thanh et al. (2009), isto ocorre porque com a desintegrao dos
grnulos so gerados flocos e partculas que so eliminados do reator,
saindo com o efluente tratado, resultando assim em uma significativa
reduo da concentrao de biomassa no reator nos dias seguintes a
desintegrao.

Tempo (dias)
SSTreator

SSVreator

SSTefluente

SSV/SST

Figura 36. Evoluo da concentrao de SST e SSV no reator, de SST


no efluente e da proporo de SSV/SST no reator ao longo da
Estratgia II.

Aps esse perodo, com o aumento da vazo de ar, houve


novamente a formao dos grnulos aerbios (Figura 32C), e,
conseqentemente, a concentrao de SST no reator aumentou

123

gradualmente, estabilizando-se em torno de 3,7 gL-1. Por outro lado,


houve uma diminuio da concentrao de SST no efluente, a qual se
estabilizou em torno de 70 mgL-1. A concentrao de SST no reator
mais elevada durante a Estratgia II do que na estratgia anterior se
deve adio de carga orgnica, a qual acarretou em um maior
crescimento da biomassa por causa da maior disponibilidade de
substrato.
Liu et al. (2003a) e Kim et al. (2008a), estudando o efeito da
carga orgnica nas caractersticas dos grnulos aerbios, tambm
observaram um aumento na concentrao de biomassa no reator com o
aumento da carga orgnica aplicada. Liu et al. (2003a) verificaram que a
concentrao de biomassa do reator aumentou de 8,4 para 9,5 gL-1 com
o aumento da concentrao de DQO de 500 para 1000 mgL-1,
respectivamente. Kim et al. (2008a) observaram que a concentrao de
biomassa foi em torno de 6,4, 7,7 e 9,5 gL-1 durante o perodo em que o
RBSG foi operado com cargas de 1,8, 2,5 e 2,8 kg DQOsm-3d-1,
respectivamente.
Em relao aos slidos presentes no efluente, verificou-se que,
aps a estabilizao, a concentrao de SST no efluente foi menor na
estratgia de maior carga. Por outro lado, Chen et al. (2008) e Thanh et
al. (2009) verificaram que houve um incremento na concentrao de
slidos no efluente com o aumento da carga orgnica aplicada. Apesar
disso, houve uma grande variao na concentrao de SST no efluente
durante a Estratgia II (entre 51 e 293 mgL-1) o que torna a descarga de
efluentes do RBSG diretamente nas guas receptoras desaconselhvel.
De acordo com Schwarzenbeck et al. (2005), durante o perodo de
arranque do reator e por razes de segurana, no caso da desintegrao
dos grnulos, um sistema de reteno da biomassa deve ser adicionado
em uma etapa subseqente ao reator granular. Esses autores consideram
que um processo de separao slido/lquido suficiente, desde que a
eficincia de remoo biolgica do reator seja elevada.
A partir da Figura 36, observa-se ainda que a concentrao de SSV
no reator ao longo da Estratgia II seguiu a mesma tendncia da curva
de SST, estabilizando-se em torno de 3,5 gL-1 aps 30 dias de operao.
Em relao proporo SSV/SST, durante o final da Estratgia I essa
varivel estava estabilizada em torno de 92% (Figura 14). Com a
desintegrao dos grnulos a proporo SSV/SST caiu para 83% no
incio da Estratgia II (Figura 36), estabilizando-se novamente em 92%
aps 30 dias de operao.
Por outro lado, Tay et al. (2004c), estudando o efeito da carga
orgnica nas caractersticas dos grnulos aerbios, reportaram um

124

aumento da proporo SSV/SST (64, 74, 85 e 93%) com o aumento da


carga orgnica (1, 2, 4 e 8 kg DQOm-3d-1, respectivamente).
Na Figura 37 est apresentada a evoluo do IVL em diferentes
tempos de sedimentao (5, 10, 15 e 30 minutos) e da relao
IVL30/IVL10 ao longo da Estratgia II.
O valor mdio de IVL30 no final da Estratgia I era de 53 mLg-1
(Figura 15). No entanto, no incio da Estratgia II o valor de IVL30
aumentou para 94 mLg-1 (Figura 37), devido desintegrao dos
grnulos e o aparecimento de flocos filamentosos (Figura 32B). De
acordo com Liu & Liu (2006), uma vez que o crescimento filamentoso
domina o reator, a sedimentabilidade dos grnulos piora e,
consequentemente, parte da biomassa lavada do reator.

100
80

100

60
40

50

20

IVL30/IVL10 (%)

IVL (mL.g-1)

150

Tempo (dias)
IVL5

IVL10

IVL15

IVL30

IVL30/IVL10

Figura 37. Evoluo do IVL em diferentes tempos de sedimentao (5,


10, 15 e 30 minutos) e da relao IVL30/IVL10 ao longo da Estratgia II.

Ao longo do restabelecimento da biomassa granular o IVL30


diminuiu gradualmente e, aps 50 dias de operao, estabilizou-se em
torno de 42 mLg-1, o que caracteriza o lodo como sendo de tima
sedimentabilidade, segundo a classificao de Von Sperling (2002).
Tendo em vista os resultados de IVL30 obtidos na Estratgia I e II,
pode-se concluir que a sedimentabilidade dos grnulos aumenta com o
aumento da carga orgnica aplicada. Esse resultado est de acordo com
o observado por Moy et al. (2002) e Thanh et al. (2009). Segundo Moy
et al. (2002), um aumento na carga orgnica acarreta a formao de

125

grnulos mais densos e compactos, com melhor sedimentabilidade, o


que, por sua vez, contribui para menores valores de IVL. Alm disso,
Chen et al. (2008) observou que o IVL dos grnulos diminui com o
aumento da velocidade superficial ascensional de ar aplicada, indicando
que uma maior fora de cisalhamento benfica para o desenvolvimento
de grnulos densos, alm de melhorar a sedimentabilidade do lodo.
A partir da Figura 37, pode-se perceber que houve diferenas
entre os valores de IVL5, IVL10, IVL15 e IVL30 durante a Estratgia II,
principalmente aps a desintegrao dos grnulos. Entretanto, com o
aparecimento dos grnulos, essa diferena diminuiu, e a relao
IVL30/IVL10 ficou prxima de 90% aps 50 dias de operao.
Como exposto anteriormente, o processo de granulao
considerado completo quando a relao IVL30/IVL10 em torno de 90%
(LIU & TAY, 2007). Desta forma, pode-se concluir que a partir dos 50
dias de operao da Estratgia II, o processo de granulao no reator
estava completo novamente, o que corrobora com a visualizao
microscpica apresentada na Figura 32D.
Os resultados apresentados nas Figuras 32, 36 e 37 indicam que,
mesmo aps o distrbio causado no sistema pelo aumento da carga
orgnica, os grnulos aerbios so capazes de se recuperar rapidamente.
Esta constatao tambm foi observada por Thanh et al. (2009) em seu
estudo de caracterizao dos grnulos aerbios sob diferentes cargas
orgnicas.

4.2.2 Desempenho do Reator

4.2.2.1 Monitoramento do Oxignio Dissolvido, pH e Temperatura

Os valores das concentraes de oxignio dissolvido (OD), pH e


temperatura nas fases aeradas ao longo da Estratgia II esto
apresentados na Tabela 22.
Como visto anteriormente na Tabela 14, a concentrao de OD
durante as fases aeradas da Estratgia I (ciclos de 4 horas) variou de 2,6
a 10,3 mgL-1, com mdia de 7,5 mgL-1. J na Estratgia II (Tabela 22), a
concentrao de OD durante as fases aeradas variou de 0,9 a 9,1 mgL-1,
com mdia de 6,1 mgL-1. Mesmo com o aumento da vazo de ar
aplicada, os valores de OD durante a Estratgia II foram menores do que
na estratgia anterior, em virtude do aumento na carga orgnica. Desta

126

forma, a maior disponibilidade de substrato ocasionou em um maior


consumo de OD.
Os valores de OD observados esto todos dentro do recomendado
para a oxidao da matria orgnica carboncea, de acordo com Metcalf
& Eddy (2003). Por outro lado, segundo Jeyanayagam (2005), a
nitrificao pode ser inibida quando se tem, por um perodo prolongado,
concentraes de OD abaixo de 2 mgL-1. Entretanto, valores de OD
inferiores a 2 mgL-1 foram observados apenas nos primeiros 15 minutos
de ciclo, onde a concentrao de substrato era mais elevada, no
afetando assim o processo de nitrificao.
Tabela 22. Resultados obtidos para OD, pH e temperatura nas fases
aeradas ao longo da Estratgia II.

Varivel

OD (mgL-1)

pH

T (C)

Anlise
Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados
Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados
Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados

Fase Aerada
6,1
2,7
9,1
0,9
76
8,5
0,3
9,2
8,0
76
27
2
31
22
76

Em relao ao pH, o mesmo variou de 7,8 a 8,8, com mdia de


8,3 durante as fases aeradas da Estratgia I (ciclos 4 horas) (Tabela 14),
e de 8,0 a 9,2, com mdia de 8,5 durante as fases aeradas da Estratgia II
(Tabela 22). Os maiores valores de pH durante a Estratgia II podem ter
sido devido adio de carga orgnica. De acordo com Zhou et al.
(2010), durante a oxidao do acetato ocorre o consumo do on
hidrognio, resultando em um aumento do pH no meio lquido.
Os valores de pH durante a Estratgia II esto dentro da faixa
recomendada para a oxidao da matria orgnica carboncea, de acordo

127

com Metcalf & Eddy (2003). No entanto, o pH mdio est um pouco


acima da faixa ideal para a ocorrncia de nitrificao, segundo USEPA
(2010).
A temperatura mdia durante a Estratgia II foi de 27 C, sendo
este valor maior do que o encontrado na estratgia anterior (temperatura
mdia de 21C). Isso se deve ao fato de que a Estratgia II ocorreu
durante o final da primavera e o incio do vero, onde geralmente so
registradas temperaturas mais elevadas.

4.2.2.2 Comportamento da Matria Carboncea e Nitrogenada

Os resultados obtidos com o RBSG em relao matria


carboncea e nitrogenada durante a Estratgia II esto apresentados na
Tabela 23.
Na Figura 38 tem-se o comportamento da concentrao de DQO T
afluente e efluente e a respectiva eficincia de remoo ao longo da
Estratgia II. As maiores concentraes de DQO T no efluente (em torno
de 350 mgL-1), e conseqentemente, as menores eficincias de remoo
(em torno de 68%) foram obtidas durante os primeiros dias da Estratgia
II. Com a formao dos grnulos, a eficincia de remoo de DQO T foi
aumentando gradualmente, estabilizando-se em torno de 90% aps 40
dias de operao. Nesse perodo, a concentrao mdia de DQO T no
efluente foi de 128 mgL-1.
Comparando esses resultados com os obtidos durante a Estratgia
I (Figura 16) onde os valores mdios de eficincia de remoo e de
concentrao no efluente foram, respectivamente, de 54% e 257 mgL-1
pode-se concluir que o desempenho do reator, em termos de DQO T, foi
melhor na estratgia de maior carga.
O comportamento da concentrao de NTK afluente e efluente e
a respectiva eficincia de remoo ao longo da Estratgia II esto
apresentados na Figura 39. O NTK se comportou de maneira bastante
similar a DQOT (Figura 38), onde as maiores concentraes de NTK no
efluente (em torno de 21 mgL-1), e conseqentemente, as menores
eficincias de remoo (em torno de 77%) foram obtidas nos primeiros
dias da Estratgia II, por causa da desintegrao dos grnulos. Com o
restabelecimento dos grnulos no reator, a eficincia mdia de remoo
de NTK aumentou para 94% aps 40 dias de operao. Nesse perodo, a
concentrao mdia de NTK no efluente foi de 5 mgL-1.

128

Desta forma, pode-se concluir que o aumento na concentrao de


SST no efluente (Figura 36), ocasionado pela desintegrao dos grnulos
e o aparecimento de flocos filamentosos, afetou o desempenho do reator,
em termos de remoo de DQOT e NTK.
Tabela 23. Desempenho do reator em relao matria carboncea e
nitrogenada durante a Estratgia II.

Varivel

DQOT
(mgL-1)

DQOS
(mgL-1)

COD
(mgL-1)

NTK

NH4+-N
(mgL-1)

Anlise
Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados
Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados
Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados
Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados
Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados

Amostras
Afluente Efluente
1083
174
1495
848
16
849
107
995
708
16
332
120
581
205
16
83
9
92
64
10
76
9
89
56
16

177
94
380
62
16
66
18
95
29
16
26
8
48
17
16
11
8
25
3
10
3
3
12
1
16

Eficincia
(%)
84
8
94
65
92
2
94
87
92
2
95
87
86
9
97
70
96
4
99
83
-

1600

100
80

1200

60

800
40

400

20

Tempo (dias)

Eficincia de Remoo (%)

Concentrao DQOT (mgL-1)

129

100

100

80

80

60

60

40

40

20

20

Tempo (dias)
Afluente

Efluente

Eficincia de Remoo (%)

Concentrao NTK (mgL-1)

Afluente
Efluente
Eficincia de Remoo
Figura 38. Comportamento da concentrao de DQO T afluente e
efluente e a respectiva eficincia de remoo ao longo da Estratgia II.

Eficincia de Remoo

Figura 39. Comportamento da concentrao de NTK afluente e efluente


e a respectiva eficincia de remoo ao longo da Estratgia II.

Nas Figuras 40, 41 e 42 esto apresentadas, respectivamente, as


concentraes afluentes e efluentes de DQOS, COD e NH4+-N, e as
respectivas eficincias de remoo ao longo da Estratgia II.

1000

100

800

80

600

60

400

40

200

20

Tempo (dias)

Eficincia de Remoo (%)

Concentrao DQOS (mgL-1)

130

600

100
80

400
60
40
200
20

Tempo (dias)

Eficincia de Remoo (%)

Concentrao COD (mgL-1)

Afluente
Efluente
Eficincia de Remoo
Figura 40. Comportamento da concentrao de DQO s afluente e
efluente e a respectiva eficincia de remoo ao longo da Estratgia II.

Afluente
Efluente
Eficincia de Remoo
Figura 41. Comportamento da concentrao de COD afluente e
efluente e a respectiva eficincia de remoo ao longo da Estratgia II.

100

100

80

80

60

60

40

40

20

20

Tempo (dias)

Eficincia de Remoo (%)

Concentrao NH4+-N (mgL-1)

131

Afluente
Efluente
Eficincia de Remoo
Figura 42. Comportamento da concentrao de NH4+-N afluente e
efluente e a respectiva eficincia de remoo ao longo da Estratgia II.
De uma maneira geral, nota-se que a eficincia de remoo dessas
variveis no foi afetada pela desintegrao dos grnulos, permanecendo
constante durante toda a Estratgia II. A eficincia mdia de remoo de
DQOS, COD e NH4+-N foi de 92 2%, 92 2% e 96 4%,
respectivamente. Em relao concentrao mdia de DQOs, COD e
NH4+-N no efluente obteve-se valores mdios de 66 mgL-1, 26 mgL-1 e
3 mgL-1, respectivamente (Tabela 23).
Comparando esses resultados com os obtidos durante a Estratgia
I (ciclo 4 horas) (Figura 16) onde a eficincia mdia de remoo de
DQOs, COD e NH4+-N foi, respectivamente, de 82 5%, 82 7% e 69
19%, e a concentrao mdia de DQOs, COD e NH4+-N no efluente
foi, respectivamente, de 72 mgL-1, 23 mgL-1, e 27 mgL-1 , pode-se
concluir que o desempenho do reator foi melhor na estratgia de maior
carga.
As maiores eficincias obtidas durante a Estratgia II podem estar
relacionadas com a maior concentrao de SST dentro do reator (Figura
36) durante este perodo. Segundo Liu & Liu (2008), uma alta
concentrao de biomassa favorece o desempenho e a estabilidade dos
reatores biolgicos.
Entretanto, apesar de terem relatado o aumento da concentrao
de biomassa com o aumento da carga orgnica, Kim et al. (2008) no

132

observaram uma mudana significativa no desempenho do RBSG, em


termos de remoo de DQO, sob diferentes cargas. Os autores
observaram que a eficincia de remoo de DQO foi igual a 96, 95 e
98%, quando o reator foi operado com cargas de 1,8, 2,5 e
2,8 kg DQOm-3d-1, respectivamente.
Tay et al. (2004b) avaliaram o efeito da carga orgnica na
formao dos grnulos e no desempenho do reator. Para isso, os autores
operaram quatro RBS (R1, R2, R3 e R4), sendo que a carga aplicada em
cada um deles foi de 1, 2, 4 e 8 kg DQOsm-3d-1, respectivamente. Os
autores constataram que no foi possvel formar grnulos aerbios sob
cargas orgnicas relativamente baixas (R1 e R2) mesmas cargas
aplicadas, respectivamente, na Estratgia I e II do presente estudo. A
aplicao de carga intermediria (R3) possibilitou a formao de
grnulos maduros e estveis, enquanto que com carga elevada (R4), os
grnulos formados foram instveis e se desintegraram duas semanas
aps o aparecimento. A concentrao mdia de DQOs no efluente foi de
25, 55, 10 e 200 mgL-1, o que equivale a eficincias mdias de remoo
de 90, 89, 99, e 90%, respectivamente, nos reatores R1, R2, R3 e R4.
Esses resultados
mostram que
os
grnulos
contribuem
significativamente para o melhor desempenho de remoo de DQO do
reator.
Li et al. (2008a) investigaram a evoluo da comunidade
bacteriana durante o processo de granulao aerbia. O estudo foi
conduzido em trs RBS alimentados com esgoto sinttico a base de
glicose, sendo que cada reator foi operado com carga orgnica de 1,5,
3,0 e 4,5 kg DQOm-3d-1, respectivamente. Os grnulos aerbios foram
cultivados com sucesso nos trs reatores e a remoo da matria
orgnica aumentou gradualmente durante o processo de granulao.
Concentraes de DQO no efluente abaixo de 100 mgL-1 foram
mantidas nos trs RBS, apesar das diferentes concentraes de DQO no
afluente.
As concentraes de nitrito e nitrato obtidas na Estratgia II esto
apresentadas na Tabela 24. Na Figura 43 tem-se o comportamento da
concentrao de NO2--N e NO3--N no efluente tratado e a respectiva
eficincia de desnitrificao e de remoo de nitrognio total. A
desintegrao dos grnulos afetou principalmente a desnitrificao, visto
que ocorreu um acmulo de nitrato durante os primeiros dias da
Estratgia II. Nesse perodo, a concentrao de NO2--N e NO3--N no
efluente foi em torno de 3 e 13 mgL-1, respectivamente, e a eficincia de
desnitrificao e de remoo de nitrognio total foi em torno de 76 e

133

63%, respectivamente. Vijayalayan (2008) tambm observou um


acmulo de nitrato no reator com a desintegrao dos grnulos aerbios.
Tabela 24. Concentraes de nitrito e nitrato durante a Estratgia II.

NO2--N
(mgL-1)

Concentrao NOx-N (mg.L-1)

NO3--N
(mgL-1)

Anlise

Amostras
Afluente Efluente

Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados
Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados

0,0
0,0
0,0
0,0
16
0,1
0,2
0,5
0,0
16

1,8
1,9
6,7
0,0
16
7,7
7,1
23
0,0
16

25

100

20

80

15

60

10

40

20

Nitrito Efluente

Eficincia (%)

Varivel

Tempo (dias)
Nitrato Efluente

Eficincia Desnitrificao

Eficincia Remoo Nt
-

Figura 43. Comportamento da concentrao de NO2 -N e NO3--N no


efluente tratado, e a respectiva eficincia de desnitrificao e de
remoo de nitrognio total ao longo da Estratgia II.

134

Aps 48 dias de operao, a concentrao mdia de NO 2--N e


no efluente diminuiu para 0,3 e 0,1 mgL-1, respectivamente, e a
eficincia mdia de desnitrificao e de remoo de nitrognio total
aumentou para 100 e 93%, respectivamente. Esse aumento na eficincia
de desnitrificao est relacionado com o restabelecimento dos grnulos
e, conseqentemente, com a existncia de micro zonas anxicas no
interior dos mesmos.
Os percentuais de nitrificao, desnitrificao e remoo de
nitrognio total (NH4+-N, NOx-N e Norgnico) durante toda a Estratgia II
esto apresentados na Tabela 25.
Ruan et al. (2006), estudando o processo de NDS em um RBSG,
avaliaram a remoo de nitrognio sob diferentes concentraes de
DQO afluente. Os autores verificaram que a eficincia de remoo de
nitrognio diminuiu de 99 para 62% quando a DQO afluente aumentou
de 400 para 700 mgL-1. Entretanto, no presente estudo, a remoo da
matria nitrogenada durante a estratgia de maior carga orgnica foi
consideravelmente superior a obtida na Estratgia I, mesmo com a
desintegrao dos grnulos.
NO3--N

Tabela 25. Percentuais de nitrificao, desnitrificao e remoo de


nitrognio total durante a Estratgia II.

Anlise

Nitrificao
(%)

Desnitrificao
(%)

Nitrognio
Total (%)

Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados

96
4
99
83
16

86
12
100
68
16

75
17
96
56
10

Apesar do dimetro mdio dos grnulos ter sido menor, a


eficincia de desnitrificao foi maior do que na estratgia anterior
(48 12%), provavelmente em virtude da maior disponibilidade de
substrato orgnico, visto que a presena de carbono biodegradvel,
como o acetato, muito importante para a ocorrncia da desnitrificao.
Esses resultados esto de acordo com o estudo realizado por Pochana &
Keller (1999). Esses autores observaram que a presena de uma fonte de
carbono facilmente biodegradvel foi benfica para o processo de NDS.
Alm disso, Chiu et al. (2007) mostraram como a relao carbono
e nitrognio (C/N) influencia o processo de NDS em um RBS inoculado

135

com lodo proveniente da uma lagoa aerbia utilizada no tratamento de


dejetos sunos. Os autores operaram o reator com diferentes relaes
C/N (6,3, 11,1 e 19,7) e observaram que uma baixa relao C/N (6,3)
resultou em um rpido dficit de carbono, dificultando o
estabelecimento eficiente do processo de NDS. Nessas condies, a
desnitrificao foi inibida pela ausncia de carbono lentamente
degradvel e a nitrificiao pelas bactrias autotrficas foi o principal
processo de remoo de nitrognio. Operando o reator com relaes C/N
de 11,1 e 19,7, as concentraes de NH4+-N, NO2--N, and NO3--N no
efluente foram todas abaixo do limite de deteco do mtodo analtico
empregado. Os autores concluram que um controle apropriado da
concentrao de carbono pode estimular o processo de NDS.
Wang et al. (2009) estudaram o efeito da relao C/N no processo
de remoo de nitrognio em um RBSG. Os autores verificaram que o
aumento da relao C/N de 2,0 para 3,0 promoveu um aumento nas
eficincias de nitrificao de 90 para 98%, de remoo de nitrognio
total de 46 para 60% e NDS de 51 para 61%.
Com as concentraes mdias de DQOS e NH4+-N (Tabela 11 e
Tabela 21), foi possvel determinar a relao C/N durante as duas
estratgias. Na Estratgia I (ciclo 4 horas) essa relao foi igual a 5,0,
aumentando para 11,2 na Estratgia II. Portanto, pode-se concluir que o
aumento da carga orgnica e, conseqentemente, da relao C/N
afetaram positivamente o processo de NDS no reator, o que est de
acordo com o reportando por Chiu et al. (2007) e Wang et al. (2009).
Alm disso, importante salientar que a volatilizao da amnia
pode ter ocorrido nas situaes em que o pH foi prximo de 9. Desta
forma, no se pode garantir que a reduo da concentrao de amnia
foi totalmente devido ao processo de nitrificao, visto que parte dessa
remoo pode ter sido devido volatilizao. Entretanto, de acordo com
USEPA (2000) e Metcalf & Eddy (2003) a volatilizao da amnia
mais acentuada em pH entre 10,8 e 11,5.

4.2.2.3 Comportamento do Fosfato

As concentraes de fosfato e as respectivas eficincias de


remoo obtidas durante a Estratgia II esto apresentadas na Tabela 26.
O comportamento da concentrao de PO 4-P afluente e efluente e a
respectiva eficincia de remoo esto apresentados na Figura 44. As
maiores concentraes de PO4-P no efluente (em torno de 5,1 mgL-1), e

136

conseqentemente, as menores eficincias de remoo (em torno de


41%) foram obtidas durante os primeiros dias da Estratgia II. Com a
formao dos grnulos, a eficincia de remoo de PO 4-P aumentou
acentuadamente, estabilizando-se em torno de 91% aps 40 dias de
operao. Nesse perodo, a concentrao mdia de PO 4-P no efluente foi
de 0,9 mgL-1, atendendo o padro de lanamento da legislao ambiental
de Santa Catarina (SANTA CATARINA, 2009). Esses resultados
comprovam a importncia da existncia de micro zonas anaerbias no
interior dos grnulos para a eficiente remoo de PO 4-P.
Tabela 26. Concentraes de fosfato e eficincia de remoo durante a
Estratgia II.

Anlise

9,1
1,2
11,1
7,4
17

2,9
2,6
7,0
0,3
17

12

Eficincia
(%)
67
29
97
11
-

100
80

60
6
40
3

20

Tempo (dias)
Afluente

Efluente

Eficincia de Remoo (%)

Concentrao PO4-P (mg.L-1)

Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados

PO4-P (mgL-1)
Afluente Efluente

Eficincia de Remoo

Figura 44. Comportamento da concentrao de PO 4-P afluente e


efluente e a respectiva eficincia de remoo ao longo da Estratgia II.

137

Assim como as demais variveis apresentadas no item 4.2.2.2, o


desempenho do reator, em termos de remoo de fosfato, foi mais
acentuado do que na Estratgia I, onde a eficincia mdia de remoo foi
de 30% e a concentrao mdia de PO4-P no efluente foi de 6,9 mgL-1.
Esse resultado pode ter ocorrido em virtude da maior
disponibilidade de substrato orgnico durante a Estratgia II, dado que,
de acordo com SantAnna Jr. (2010), a disponibilidade de uma fonte de
carbono facilmente degradavel essencial para a remoo do fsforo.
Lamego Neto (2008) estudando o efeito da carga orgnica no
desempenho de um reator hbrido em bateladas seqenciais, tambm
observou um aumento na remoo de fosfato com o aumento de carga.
O autor reportou que com o aumento da carga de 0,39 para
1,35 kg DQOTm-3dia -1, a eficincia mdia de remoo de PO 4-P
aumentou de 44 para 60%.
Outro fator que pode ter contribudo para esse resultado foi o
aumento da eficincia do processo de NDS. Segundo SantAnna Jr.
(2010), a presena de nitrato pode ser prejudical ao processo de remoo
de fsforo, em virtude da competio pelo substrato orgnico com os
microrganismos desnitrificantes.
Costa (2005) estudando um RBS convencional observou a
interferncia da presena de nitratos no processo de remoo do fsforo.
Thans (2008), estudando um reator RBS em escala real para o tratamento
de esgoto domstico, obteve timos resultados de remoo de fsforo,
com eficincias variando entre 80 e 100%, e efluente final com
concentraes mdias de 1,2 mgL-1, quando o processo NDS foi
eficiente.

4.2.2.4 Taxa de Consumo de Oxignio Especfica (TCOE)


A atividade das bactrias, em termos de taxa de consumo de
oxignio especfica (TCOE), ao longo da Estratgia II, apresentada na
Figura 45. A TCOE foi determinada logo aps a fase de enchimento,
tendo em vista mxima disponibilidade de substrato e,
conseqentemente, mxima atividade dos microrganismos nesse
perodo.
A partir dessa figura, nota-se que com a desintegrao dos
grnulos, a TCOE caiu acentuadamente de 154 mgO2gSSV-1h-1
(Estratgia I Figura 22) para 33 mgO2gSSV-1h-1 no incio da

138

TCOE (mgO2.gSSV-1.h-1)

Estratgia II. Com o restabelecimento dos grnulos, a TCO E estabilizouse em torno de 86 mgO 2gSSV-1h-1, aps 40 dias de operao.

100

80
60
40
20

Tempo (dias)
Figura 45. Comportamento da taxa de consumo de oxignio especfica
ao longo da Estratgia II.

Desta forma, pode-se concluir que a TCOE diminuiu com o


aumento da carga orgnica e da velocidade supercial ascencional do ar.
Entretanto, Tay et al. (2001b), estudando o efeito da fora de
cisalhamento na formao, estrutura e metabolismo dos grnulos
aerbios, verificaram um aumento da TCOE com o aumento da
velocidade superficial ascensional do ar. Segundo os autores, um
aumento do cisalhamento pode estimular de maneira significativa as
atividades respiratrias dos microrganismos.
Por outro lado Tay et al. (2004b) no observaram uma relao
direta entre a carga orgnica aplicada e a TCOE. Os autores reportaram
valores de TCOE de 50, 63, 29 e 90 mgO2gSSV-1h-1, para cargas de 1,
2, 4 e 8 kg DQOsm-3d-1, respectivamente. Na realidade, grnulos
maduros e estveis s foram observados com carga igual a
4 kg DQOsm-3d-1, o que corresponde ao menor valor de TCOE
reportado (29 mgO2gSSV-1h-1).

139

4.2.2.5 Monitoramento de Ciclos


Na Figura 46 apresentado o comportamento da concentrao de
DQOs e de NH4+-N, bem como da taxa de consumo de oxignio (TCO)
da biomassa ao longo de um ciclo padro da Estratgia II, monitorado
aos 54 dias de operao do reator. Observa-se uma elevada queda na
concentrao de DQOs e NH4+-N no incio do ciclo, mostrando que o
substrato principalmente absorvido e/ou removido nos primeiros 30
minutos. No restante do tempo, a concentrao de substrato permaneceu
praticamente constante, chegando ao final do ciclo com DQO s de
57 mgL-1 e NH4+-N de 1 mgL-1. As eficincias de remoo de DQOs e
de NH4+-N para este ciclo foram, respectivamente, de 93% e 99%.
possvel identificar a fase de degradao durante os 30 primeiros
minutos e a fase de inanio durante o restante do ciclo. A fase de
inanio corresponde a aproximadamente 86% do perodo total de
aerao. Resultados similares foram obtidos por Liu & Tay (2006), que
observaram que a fase de inanio de cada ciclo foi em torno de 80% do
perodo de aerao.
A atividade das bactrias em termos de TCO, conforme
apresentado na Figura 46, foi bastante elevada no incio do ciclo, devido
maior disponibilidade de substrato, atingindo um valor mximo de
227 mgO2L-1h-1. A diminuio da concentrao de substrato provocou
uma elevada queda na TCO nos primeiros 90 minutos. No restante do
ciclo, a TCO caiu menos acentuadamente, chegando ao final do ciclo
com um valor de 21 mgO2L-1h-1, indicando o trmino do processo de
oxidao. Neste ciclo, a concentrao celular no reator, em termos de
slidos suspensos volteis (SSV), foi de 3,3 gL-1. Desta forma, a
TCOespecfica mxima foi igual a 69 mgO2gSSV-1h-1. Este valor
encontra-se acima da faixa de 47-58 mgO 2gSSV-1h-1 reportada por
Thanh et al. (2009) em um RBSG alimentado com esgoto sinttico sob
diferentes cargas orgnicas.
Na Figura 47 apresentado o comportamento da concentrao de
NO2--N e NO3--N ao longo do ciclo monitorado. Mesmo com o consumo
da NH4+-N, no houve acmulo de NO2--N e NO3--N ao longo deste
ciclo, devido ao processo de NDS. A eficincia de desnitrificao e de
remoo de nitrognio total para este ciclo foi de 99,7 e 96%,
respectivamente.

140
240
200

800

160
600
120
400
80
200

40

NH4+-N (mg.L-1)
TCO (mg O2.L-1.h-1)

DQOS (mg.L-1)

1000

0
0

Tempo (horas)
NH4-N
TCO
DQOs
Figura 46. Comportamento da DQOs, da NH4+-N e da TCO ao longo de
um ciclo padro monitorado aos 54 dias de operao da Estratgia II.

NOX-N (mg.L-1)

0,8
0,6
0,4
0,2

0
0

Tempo (horas)
NO2-N

NO3-N

Figura 47. Comportamento do nitrito e do nitrato ao longo de um ciclo


padro monitorado aos 54 dias de operao da Estratgia II.

Na Figura 48 apresenta-se o comportamento do OD, pH e


temperatura ao longo do ciclo monitorado. A temperatura manteve-se
constante em torno de 28 C durante todo o ciclo. Nos 30 primeiros
minutos de ciclo, correspondente a fase degradao, o OD aumentou
acentuadamente de 2,5 para 6,8 mgL-1 devido diminuio da
concentrao de substrato e, em virtude do consumo do on hidrognio

141

10

30

25

20

15

Temperatura ( C)

OD (mgL-1) e pH

durante a oxidao do acetato, o pH aumentou de 8,5 para 8,7. Li et al.


(2010), estudando um reator de grnulos aerbios, tambm associou o
aumento no pH no incio do ciclo utilizao do acetato.
No perodo entre 30 min e 2 horas, observa-se um aumento
gradual da concentrao de OD de 6,8 para 8,0 mgL-1. Esse perodo
corresponde ao consumo de OD para a oxidao da matria lentamente
biodegradvel. Em relao ao pH, o mesmo diminuiu gradualmente de
8,7 para 8,3, e, em seguida, voltou a subir para 8,6, formando o
caracterstico vale da amnia, descrito por Andreottola et al. (2001).
Segundo Carucci et al. (1999), esse comportamento de queda e aumento
do pH, durante a fase aerbia, ocorre quando todo o processo de
nitrificao completado. Durante a sedimentao, a concentrao de
OD diminui continuamente, atingindo 4,0 mgL-1 no final do ciclo.

10
0

Tempo (horas)
OD

pH

Figura 48. Comportamento do oxignio dissolvido, pH e temperatura


ao longo de um ciclo padro monitorado aos 54 dias de operao da
Estratgia II.

O comportamento do potencial redox (ORP) ao longo do ciclo


monitorado est apresentado na Figura 49. Assim como o OD e o pH, o
ORP aumentou acentuadamente de -140 mV para 4 mV, durante os 30
primeiros minutos. Em seguida, observa-se que o ORP aumentou
gradativamente, estabilizando-se em torno de 10 mV aps 60 minutos de
ciclo, indicando que o processo de oxidao do substrato estava
completo.

142
0

ORP (mV)

20

-20

-60

-100

-140

Tempo (horas)
Figura 49. Comportamento do potencial redox ao longo de um ciclo
padro monitorado aos 54 dias de operao da Estratgia II.

O comportamento do fosfato ao longo do ciclo monitorado pode


ser observado na Figura 50. O PO4-P foi principalmente removido nos
primeiros 90 minutos do ciclo, sendo que a sua concentrao no efluente
tratado foi igual a 1,1 mgL-1 e a eficincia de remoo foi de 85%,
atendendo o padro de lanamento da legislao ambiental de Santa
Catarina (SANTA CATARINA, 2009).

10

PO4-P(mg.L-1)

0
0

Tempo (horas)
Figura 50. Comportamento do fosfato ao longo de um ciclo padro
monitorado aos 54 dias de operao da Estratgia II.

143

4.2.3 Hibridizao Fluorescente in situ (FISH)

Os resultados obtidos com a anlise FISH de amostra de grnulos


coletada aos 70 dias de operao da Estratgia II esto apresentados na
Tabela 27. A amostra foi caracterizada como sendo homognea,
presena de poucos filamentos e muito material extracelular, e clulas
em arranjos coloniais.
Verificou-se que aproximadamente 70% das bactrias estavam
ativas, sendo a maioria composta por organismos nitrificantes, com 35%
de bactrias oxidadoras de amnia (BOA) (Figura 51) do tipo beta, e
30% de bactrias oxidadoras de nitrito (BON) (Figura 52), do tipo
Nitrobacter spp. Ao contrrio do que ocorreu na anlise FISH da
estratgia anterior (Tabela 20), na Estratgia II a populao de BON foi
menor do que a populao de BOA, e no foram detectadas bactrias
metanognicas e sulfato redutoras. Deste modo, pode-se concluir que
houve uma menor diversidade de espcies na estratgia de maior carga.
Tabela 27. Resultados da anlise FISH dos grnulos aos 70 dias de
operao da Estratgia II.

Sondas
EUB
(todas as eubactrias)
NSO
(Betaproteobacterias oxidadoras de amnia)
NIT
(Nitrobacter spp)
DSV
(Bactrias Sulfato RedutorasDesulfovibionaceae)
ARC
(todas Archae)
Eury
(grupos Methanosarina, Methanosaeta,
Methanomicrobiales)

Porcentagem (em
relao ao DAPI)
70% DAPI
Muitas
35% DAPI
Algumas
30% DAPI
Algumas
0% DAPI
No detectado
0% DAPI
No detectado
0% DAPI
No detectado

144

Figura 51. Clulas hibridizadas pela sonda NSO (DAPI em azul e


hibridizao em vermelho) visualizadas em microscpio epifluorescente
(Aumento 1000x).

Figura 52. Clulas hibridizadas pela sonda NIT (DAPI em azul e


hibridizao em vermelho) visualizadas em microscpio epifluorescente
(Aumento 1000x).

Li et al. (2008a), estudando evoluo da comunidade bacteriana


durante o processo de granulao aerbia sob diferentes cargas
orgnicas, tambm verificaram que o reator operado com maior carga
(4,5 kg DQOm-3d-1) teve uma menor diversidade de espcies, enquanto
que o reator operado com menor carga (1,5 kg DQOsm-3d-1) teve uma
elevada diversidade de espcies. Alm disso, os autores observaram que
sob diferentes cargas orgnicas, os grnulos formados apresentavam
diferentes espcies dominantes. Assim, pode-se concluir que a carga
orgnica afeta a seleo e a dominncia das comunidades
microbiolgicas em RBSG.

145

4.3 ESTRATGIA OPERACIONAL III


A Estratgia Operacional III teve como objetivo avaliar o efeito da
diminuio do tempo de sedimentao nas caractersticas dos grnulos e
no desempenho do RBSG. Desta forma, ao longo desta estratgia o
tempo de sedimentao foi reduzido gradualmente de 12 para 9 minutos
e, posteriormente para 7 minutos.
As caractersticas do esgoto domstico durante a Estratgia III
esto apresentadas na Tabela 28. O esgoto utilizado pode ser classificado,
de acordo com Metcalf & Eddy (2003), como sendo de alta concentrao,
em termos de DQO, NH4+-N e PO4-P.
Tabela 28: Caractersticas do esgoto domstico e cargas aplicadas
durante a Estratgia Operacional III.

Parmetros
DQOs (mgL-1)
NH4+-N (mgL-1)
PO4-P (mgL-1)
Carga orgnica (kg DQOsm-3d-1)
Carga nitrogenada (kg NH4+-Nm-3d-1)
Carga de fsforo (kg PO 4-Pm-3d-1)

Estratgia III
(n=13)
840 90
74 10
8,8 2,2
2,01 0,22
0,18 0,02
0,02 0,01

Para uma melhor avaliao do efeito da diminuio do tempo de


sedimentao no RBSG, os resultados da Estratgia III foram comparados
com os resultados obtidos durante a Estratgia II, tendo em vista as
mesmas condies de durao de ciclo, carga orgnica aplicada e vazo
de ar.

4.3.1 Caractersticas dos Grnulos Aerbios


4.3.1.1 Morfologia dos Grnulos

Na Figura 53 apresenta-se a morfologia dos grnulos em


diferentes dias da Estratgia III. Com a reduo do tempo de

146

sedimentao, observou-se um aumento gradativo no tamanho dos


grnulos. No final da estratgia, os grnulos apresentavam uma estrutura
bastante densa e compacta, com dimetros variando principalmente
entre 0,2 e 1,4 mm, com mdia de 0,4 mm. Entretanto, nesse perodo
foram observados grnulos de at 8 mm (Figura 53D) o que
impossibilitou a visualizao dos mesmos por meio de microscopia
tica. Desta forma, a observao morfolgica desses grnulos foi
realizada utilizando-se um estereomicroscpio. Um zoom dos grnulos
apresentados na Figura 53D pode ser observado na Figura 54.

Figura 53. Morfologia dos grnulos ao longo da Estratgia III: Ts = 12


min: (A) 6 dias e (B) 26 dias (Barra = 0,1 mm); Ts = 9 min: (C) 35 dias
(Barra = 0,1 mm); Ts = 7 min: (D) 53 dias (Barra = 1,4 mm).

O tamanho dos grnulos na Estratgia III foi maior do que na


Estratgia II (Figura 32), indicando que a diminuio do tempo de
sedimentao promove um aumento no tamanho dos grnulos. Esse
resultado est de acordo com as observaes realizadas por Kim et al.
(2004), McSwain et al. (2004), Qin et al. (2004ab) e Adav et al. (2009).

147

Esses autores, estudando o efeito do tempo de sedimentao no processo


de granulao aerbia em RBS, tambm observaram um aumento
gradual do tamanho dos grnulos com a diminuio do tempo de
sedimentao. Adav et al. (2009), reportaram que, aps um ms de
operao, o tamanho mdio dos grnulos aerbios foi de 1,1, 1,8 e
2,2 mm para tempos de sedimentao de 10, 7 e 5 minutos,
respectivamente.
Isso pode ser explicado pelo fato de que um curto tempo de
sedimentao seleciona, preferencialmente, o crescimento de
biopartculas de melhor sedimentabilidade, alm de garantir a retirada de
bioflocos que sedimentam mal, os quais, por sua vez, podem competir
com as partculas formadoras de grnulos por nutrientes para o
crescimento (LIU et al., 2005a; LIU & WANG, 2008).

Figura 54. Zoom dos grnulos apresentados na Figura 53D.

4.3.1.2 Granulometria dos Grnulos

A distribuio do tamanho das partculas do lodo aos 4, 35 e 45


dias de operao da Estratgia III esto apresentadas, respectivamente,
nas Figuras 55, 56 e 57.

148

Figura 55. Distribuio do tamanho das partculas do lodo presente no


reator aos 4 dias de operao da Estratgia III (Ts = 12 min).

Figura 56. Distribuio do tamanho das partculas do lodo presente no


reator aos 35 dias de operao da Estratgia III (Ts = 9 min).

Figura 57. Distribuio do tamanho das partculas do lodo presente no


reator aos 45 dias de operao da Estratgia III (Ts = 7 min).

Aos 4 dias de operao (Ts = 12min - Figura 33), a distribuio


do tamanho das partculas variou entre 10 e 1000 m, sendo que a
percentagem de volume de lodo com tamanho inferior a 200 m foi de

149

48%. J aos 35 dias de operao (Ts = 9 min - Figura 56), a distribuio


do tamanho das partculas foi um pouco maior, variando entre 10 e 1100
m, e a percentagem de volume de lodo com tamanho inferior a 200 m
diminuiu para 39%. Aos 45 dias de operao (Ts = 7 min - Figura 57), a
distribuio do tamanho das partculas variou entre 20 e 1000m, e a
percentagem de volume de lodo com tamanho inferior a 200 m atingiu
25%.
Como exposto anteriormente, Liu et al. (2010b) consideram que
os grnulos so dominantes no reator quando a percentagem de volume
de lodo com tamanho inferior a 200 m for menor do que 50%. Desta
forma, pode-se concluir que os grnulos foram dominantes durante toda
a Estratgia III. No entanto, a percentagem de grnulos no reator
aumentou de 52 para 75% com a diminuio do tempo de sedimentao
de 12 para 7 minutos.
Esses resultados esto de acordo com as constataes reportadas
por McSwain et al. (2004), Qin et al. (2004a) e Adav et al. (2009), os
quais tambm observaram um aumento da frao de grnulos aerbios
com a diminuio do tempo de sedimentao.
Aps a estabilizao do sistema, McSwain et al. (2004)
observaram a coexistncia de flocos com grnulos no RBSG com Ts =
10 min, enquanto que no RBSG com Ts = 2 min houve um acmulo de
grnulos de maiores dimetros, tendo apenas pequenos grnulos e flocos
como estrutura secundria.
Qin et al. (2004a) obtiveram, no estado estacionrio, fraes de
grnulos de 10, 15, 35 e 100%, operando com tempos de sedimentao
de 20, 15, 10 e 5 minutos, respectivamente. Adav et al. (2009),
reportaram que, aps um ms de operao do RBSG, a frao de
grnulos foi de 22, 39 e 81% para tempos de sedimentao de 10, 7 e 5
minutos, respectivamente.

4.3.1.3 Polissacardeos Extracelulares (PSE)

O comportamento da concentrao de polissacardeos


extracelulares (PSE) ao longo da Estratgia III est apresentado na
Figura 58. No final da Estratgia II, a concentrao de PSE era de
132 mggSSV-1 (Figura 35). Com a diminuio do tempo de
sedimentao, esse valor diminui 72 mggSSV -1 aos 14 dias de operao
da Estratgia III, conforme pode ser observado na Figura 58. Aps esse
perodo, a concentrao de PSE aumentou acentuadamente com a

150

Concentrao PSE (mggSSV-1)

diminuio no tempo de sedimentao, alcanando valores em torno de


200 mggSSV-1 com 46 dias de operao. Esses valores so bastante
elevados se comparados com a faixa de 10-20 mggSS-1 obtida por Li et
al. (2008b) em reator de grnulos aerbios.

Ts = 12min

Ts = 9min

Ts = 7min

250
200
150
100
50

Tempo (dias)

Figura 58. Comportamento da concentrao de polissacardeos


extracelulares ao longo da Estratgia III.

McSwain et al. (2004) e Qin et al. (2004b) tambm verificaram


um aumento na produo de PSE com a diminuio do tempo de
sedimentao em RBSG.
Qin et al. (2004b) observaram que a concentrao de PSE foi de
60 e 166 mggSSV-1 para tempos de sedimentao de 20 e 5 minutos,
respectivamente. Os autores consideram que o aumento da produo de
polissacardeos uma resposta metablica da comunidade microbiana
face s mudanas nas condies ambientais. Desta forma, os
microrganismos expostos a uma maior presso de seleo hidrulica, em
termos de tempo de sedimentao, utilizam uma maior quantidade da
energia produzida no catabolismo para a sntese de PSE do que para o
crescimento.

151

4.3.1.4 Comportamento dos Slidos e do IVL

Na Figura 59 est apresentada a variao da concentrao de SST e


SSV no reator e SST no efluente, bem como a proporo SSV/SST no
reator ao longo da Estratgia III.
No final da Estratgia II, a concentrao de SST no reator e no
efluente era em torno de 3,7 gL-1 e 70 mgL-1, respectivamente (Figura
36). Entretanto, no incio da Estratgia III houve uma reduo na
concentrao de slidos no reator (SSTreator = 2,9 gL-1) e um aumento na
concentrao de slidos no efluente (SSTefluente = 222 mgL-1), as quais
podem ser atribudas reduo do tempo de sedimentao de 15 para 12
minutos. Segundo Tay et al. (2005), com a reduo do tempo de
sedimentao, a biomassa que sedimenta mais lentamente lavada do
reator saindo com o efluente, o que resulta em uma diminuio
temporria da concentrao de slidos no reator. No entanto, de acordo
com esses autores, um menor tempo de sedimentao exerce um papel
de seleo, encorajando a reteno de biomassa com melhor
sedimentabilidade. Conseqentemente, a recuperao da concentrao
de SST no reator foi observada aps 14 dias de operao, a qual se
estabilizou em torno de 3,8 gL-1. Nesse perodo, a concentrao de SST
no efluente estabilizou-se em torno de 78 mgL-1.
Essa mesma tendncia foi verificada quando o tempo de
sedimentao foi reduzido de 12 para 9 minutos e, posteriormente, de 9
para 7 minutos, sendo que nos ltimos dias de operao a concentrao
de SST no reator e no efluente foi em torno de 4,2 gL-1 e 64 mgL-1,
respectivamente.
Resultados similares foram obtidos por Cassidy & Belia (2005),
os quais observaram uma diminuio da concentrao de SST no reator,
e um aumento da concentrao de slidos no efluente com a diminuio
do tempo de sedimentao em um RBSG. Os autores reportaram ainda
que houve uma rpida recuperao da concentrao de slidos no reator
e no efluente, alguns ciclos aps o distrbio causado pela reduo do
tempo de sedimentao, indicando que ocorreu uma seleo efetiva da
biomassa de melhor sedimentabilidade.
A partir da Figura 59, observa-se ainda que a concentrao de SSV
no reator ao longo da Estratgia III seguiu a mesma tendncia da curva
de SST, estabilizando-se em torno de 3,7 gL-1 aps 50 dias de operao.
Em relao proporo SSV/SST, logo aps cada diminuio do tempo
de sedimentao, essa proporo caiu para 83%, estabilizando-se
novamente em 92% com a estabilizao da biomassa no reator.

152
Ts = 9min

Ts = 7min
100

SSV/SST (%)

SST e SSV (g.L-1)

Ts = 12min

80
3

60

40

20

Tempo (dias)
SSTreator

SSVreator

SSTefluente

SSV/SST

Figura 59. Evoluo da concentrao de SST e SSV no reator, de SST


no efluente e da proporo de SSV/SST no reator ao longo da
Estratgia III.

Na Figura 60 est apresentada a evoluo do IVL em diferentes


tempos de sedimentao (5, 10, 15 e 30 minutos) e da relao
IVL30/IVL10 ao longo da Estratgia III.
Ts = 9min

Ts = 7min
100

100

80

75

60

50

40

25

20

IVL30/IVL10 (%)

IVL (mL.g-1)

Ts = 12min
125

Tempo (dias)
IVL5

IVL10

IVL15

IVL30

IVL30/IVL10

Figura 60. Evoluo do IVL em diferentes tempos de sedimentao (5,


10, 15 e 30 minutos) e da relao IVL30/IVL10 ao longo da Estratgia
III.

153

O valor mdio de IVL30 no final da Estratgia II era de 42 mLg-1


(Figura 37). No entanto, no incio da Estratgia III o valor de IVL30
aumentou para 80 mLg-1, em virtude da diminuio do tempo de
sedimentao de 15 para 12 minutos. Com a recuperao da biomassa
aps 20 dias de operao, o IVL30 estabilizou-se em torno de 50 mLg-1.
Essa mesma tendncia foi verificada quando o tempo de sedimentao
foi reduzido de 12 para 9 minutos e, posteriormente, de 9 para 7
minutos, sendo que nos ltimos dias de operao o IVL 30 foi em torno
de 39 mLg-1, o que caracteriza o lodo como sendo de tima
sedimentabilidade, segundo a classificao de Von Sperling (2002).
A partir da Figura 60, pode-se perceber que houve uma maior
diferena entre os valores de IVL5, IVL10, IVL15 e IVL30 logo aps cada
diminuio do tempo de sedimentao. Entretanto, essa diferena
diminuiu com a estabilizao dos slidos do reator. De maneira geral, a
relao IVL30/IVL10 foi em mdia 90% durante toda a Estratgia III,
indicando que o processo de granulao estava estvel.
Analisando as Figuras 59 e 60, pode-se notar ainda que a
concentrao de biomassa no reator foi inversamente proporcional a
sedimentabilidade da mesma, ou seja, quanto maior a concentrao de
biomassa, menor o valor de IVL e vice versa. Essa mesma constatao
foi observada por Schwarzenbeck et al. (2005).
Nas Figuras 61 e 62 tem-se a sedimentao do lodo dentro do
reator ao longo da fase de sedimentao aos 26 e 53 dias de operao,
respectivamente.
Tendo em vista os resultados das Estratgias II e III, pode-se
concluir que a diminuio do tempo de sedimentao conduziu a um
aumento na concentrao de SST no reator e a uma melhora na
sedimentabilidade da biomassa, conforme observado nas Figuras 61 e
62. Alm disso, esses resultados podem ser relacionados com o maior
tamanho (Figura 53D) e a maior frao de grnulos (Figura 57)
alcanados no final da Estratgia III. Estas constataes esto de acordo
com as observaes relatadas por Qin & Liu (2008).
Resultados similares aos do presente estudo foram obtidos por
Kim et al. (2004), McSwain et al. (2004), Qin et al. (2004b) e Adav et
al. (2009). Esses autores tambm reportaram um aumento na
concentrao de SST no reator e uma diminuio do valor de IVL com a
diminuio do tempo de sedimentao em reatores de grnulos aerbios.
De acordo com Qin & Liu (2008), isso ocorre pois espera-se que a
estrutura dos grnulos aerbios seja mais compacta em tempos de
sedimentao mais curtos.

154

Figura 61. Sedimentao do lodo ao longo da fase de sedimentao aos


26 dias de operao (Ts = 12 min).

Figura 62. Sedimentao do lodo ao longo da fase de sedimentao aos


53 dias de operao (Ts = 7 min).

155

McSwain et al. (2004) observaram que os grnulos desenvolvidos


no reator com Ts = 10 min, apresentaram concentrao mdia de SST no
reator e valor de IVL30 de 3 gL-1 e 115 mLg-1, respectivamente,
enquanto que os grnulos formados no reator com Ts = 2 min,
apresentaram concentrao mdia de SST no reator e valor de IVL30 de
8,8 gL-1 e 47 mLg-1, respectivamente. Adav et al. (2009) observaram
valores mdios de IVL30 de 104, 57 e 43 mLg-1 para tempos de
sedimentao de 10, 7 e 5 minutos, respectivamente.
4.3.2 Desempenho do Reator
4.3.2.1 Monitoramento do Oxignio Dissolvido, pH e Temperatura

Os valores das concentraes de oxignio dissolvido (OD), pH e


temperatura nas fases aeradas ao longo da Estratgia III esto
apresentados na Tabela 29.
Tabela 29. Resultados obtidos para OD, pH e temperatura nas fases
aeradas ao longo da Estratgia III.

Varivel

OD (mgL-1)

pH

T (C)

Anlise
Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados
Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados
Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados

Fase Aerada
6,2
2,6
8,6
0,9
48
8,6
0,3
9,2
8,0
48
27
2
31
22
48

156

Analisando a Tabela 22 (Estratgia II) e a Tabela 29, nota-se que


os resultados obtidos para as trs variveis foram praticamente iguais
durante as duas estratgias, em virtude das mesmas condies de carga
orgnica e vazo de ar aplicadas, e de ambas terem ocorrido na mesma
estao do ano, com caractersticas similares de esgoto afluente e da
temperatura ambiente.
Desta forma, como na estratgia anterior, os valores de OD, pH e
temperatura durante a Estratgia III encontraram-se dentro da faixa
recomendado para a oxidao da matria carboncea e nitrogenada,
conforme SantAnna Jr. (2010). Os maiores valores de pH (>8,5) e os
menores valores de OD (<2,0 mgL-1) foram medidos no incio da fase
aerada, devido maior concentrao de acetato de sdio no meio
lquido.

4.3.2.2 Comportamento da Matria Carboncea e Nitrogenada

Os resultados obtidos com o RBSG em relao matria


carboncea e nitrogenada durante a Estratgia III esto apresentados na
Tabela 30.
Nas Figuras 63 e 64 esto apresentados, respectivamente, o
comportamento das concentraes afluentes e efluentes de DQOT e
NTK, e as respectivas eficincias de remoo ao longo da Estratgia III.
Aps o restabelecimento dos grnulos na Estratgia II, a
concentrao mdia de DQOT e NTK no efluente foi, respectivamente,
de 128 mgL-1 e 5 mgL-1, e a eficincia mdia de remoo foi de 90%
para DQOT e 94% para NTK (Figura 38 e Figura 39). Entretanto, no
incio da Estratgia III houve um aumento da concentrao DQOT e
NTK no efluente (204 e 11 mgL-1, respectivamente) e uma reduo na
eficincia de remoo dessas variveis (81 e 85%, respectivamente)
(Figura 63 e Figura 64), as quais podem ser atribudas ao aumento da
presena de slidos no efluente devido reduo do tempo de
sedimentao de 15 para 12 minutos, conforme observado na Figura 59.
Com a estabilizao da concentrao de SST no efluente aps 14 dias de
operao, observou-se novamente uma melhora na remoo de DQOT e
NTK.
Essa mesma tendncia foi verificada quando o tempo de
sedimentao foi reduzido de 12 para 9 minutos e, posteriormente, de 9
para 7 minutos, sendo que nos ltimos dias de operao a concentrao
de DQOT e NTK no efluente foi em torno de 75 mgL-1 e 3 mgL-1,

157

respectivamente, e a eficincia mdia de remoo foi de 93% para


DQOT e 96% para NTK.
Tendo em vista os resultados das Estratgias II e III, pode-se
concluir que a diminuio do tempo de sedimentao conduziu a um
aumento na eficincia de remoo de DQO T e NTK em virtude da
melhor sedimentabilidade do lodo verificada com Ts = 7 min.

Tabela 30. Desempenho do reator em relao matria carboncea e


nitrogenada durante a Estratgia III.

Varivel

DQOT
(mgL-1)

DQOS
(mgL-1)

COD
(mgL-1)

NTK

NH4+-N
(mgL-1)

Anlise
Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados
Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados
Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados
Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados
Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados

Amostras
Afluente Efluente
1178
207
1573
920
13
839
90
963
685
13
401
112
583
223
13
82
10
92
70
10
74
10
89
60
13

128
52
227
62
13
58
12
81
41
13
25
4
30
19
13
9
4
14
3
10
3
2
8
1
13

Eficincia
(%)
89
5
96
77
93
2
96
89
93
2
96
91
89
5
96
81
96
3
99
87
-

158

Ts = 9min

Ts = 7min
100

80

1200

60
800
40

400

20

Tempo (dias)
Afluente

Efluente

Eficincia de Remoo (%)

Concentrao DQOT (mg.L-1)

Ts = 12min
1600

Eficincia de Remoo

Figura 63. Comportamento da concentrao de DQO T afluente e


efluente e a respectiva eficincia de remoo ao longo da Estratgia III.
Ts = 9min

Ts = 7min
100

80

80

60

60

40

40

20

20

Tempo (dias)
Afluente

Efluente

Eficincia de Remoo (%)

Concentrao NTK (mg.L-1)

Ts = 12min
100

Eficincia de Remoo

Figura 64. Comportamento da concentrao de NTK afluente e efluente


e a respectiva eficincia de remoo ao longo da Estratgia III.

Nas Figuras 65, 66 e 67 esto apresentadas, respectivamente, as


concentraes afluentes e efluentes de DQOS, COD e NH4+-N, e as
respectivas eficincias de remoo ao longo da Estratgia III.

159
Ts = 9min

Ts = 7min
100

800

80

600

60

400

40

200

20

Tempo (dias)
Afluente

Efluente

Eficincia de Remoo (%)

Concentrao DQOS (mg.L-1)

Ts = 12min
1000

Eficincia de Remoo

Figura 65. Comportamento da concentrao de DQO S afluente e


efluente e a respectiva eficincia de remoo ao longo da Estratgia III.
Ts = 9min

Ts = 7min
100

500

80

400
60
300
40
200
20

100

Tempo (dias)
Afluente

Efluente

Eficincia de Remoo (%)

Concentrao COD (mg.L-1)

Ts = 12min
600

Eficincia de Remoo

Figura 66. Comportamento da concentrao de COD afluente e


efluente e a respectiva eficincia de remoo ao longo da Estratgia III.

Ts = 12min

Ts = 9min

Ts = 7min

100

100

80

80

60

60

40

40

20

20

Tempo (dias)
Afluente

Efluente

Eficincia de Remoo (%)

Concentrao NH4+-N (mg.L-1)

160

Eficincia de Remoo

Figura 67. Comportamento da concentrao de NH4+-N afluente e


efluente e a respectiva eficincia de remoo ao longo da Estratgia III.

De maneira geral, a diminuio do tempo de sedimentao no


afetou o desempenho do reator, em termos de DQO S, COD e NH4+-N,
uma vez que a eficincia de remoo dessas variveis permaneceu
praticamente constante ao longo da Estratgia III. A eficincia mdia de
remoo de DQOS, COD e NH4+-N foi de 93 2%, 93 2% e 96 3%,
respectivamente. Em relao concentrao mdia de DQO s, COD e
NH4+-N no efluente obteve-se valores mdios de 58, 25 e 2 mgL-1,
respectivamente (Tabela 30). Esses resultados esto de acordo com as
observaes realizadas por McSwain et al. (2004) e Adav et al. (2009),
os quais tambm no verificaram uma mudana no desempenho do
RBSG, em termos de remoo de DQO, com a diminuio do tempo de
sedimentao.
As concentraes de nitrito e nitrato obtidas na Estratgia III
esto apresentadas na Tabela 31. Na Figura 43 tem-se o comportamento
da concentrao de NO2--N e NO3--N no efluente tratado e a respectiva
eficincia de desnitrificao e de remoo de nitrognio total. possvel
perceber a ocorrncia de acmulo de nitrito, principalmente entre 14 e
40 dias de operao, indicando que o processo de nitrificao no
ocorreu completamente at seu ltimo estgio de oxidao (nitratao).
A baixa atuao das bactrias oxidadoras de nitrito (BON) pode ter
ocorrido devido a dois fatores.

161

Tabela 31. Concentraes de nitrito e nitrato durante a Estratgia III.

NO2--N
(mgL-1)

Concentrao NOx-N (mg.L-1)

NO3--N
(mgL-1)

25

Anlise

Amostras
Afluente Efluente

Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados
Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados

Ts = 12min

Ts = 9min

0,0
0,1
0,4
0,0
13
0,1
0,1
0,2
0,0
13

6,2
3,9
13
0,7
13
0,4
0,2
1,0
0,0
13

Ts = 7min

100

20

80

15

60

10

40

20

Nitrito Efluente

Eficincia (%)

Varivel

Tempo (dias)
Nitrato Efluente

Eficincia Desnitrificao

Eficincia Remoo Nt
-

Figura 68. Comportamento da concentrao de NO2 -N e NO3--N no


efluente tratado, e a respectiva eficincia de desnitrificao e de
remoo de nitrognio total ao longo da Estratgia III.

O primeiro deles corresponde possvel inibio das BON pela


presena de amnia na forma no ionizada (NH 3). De acordo com
Metcalf & Eddy (2003), em valores de pH prximos a 9, cerca de 30%
da amnia pode estar sob a forma de NH3. Segundo USEPA (2010), a
presena de NH3 tem um efeito inibidor maior nas BON do que nas

162

BOA. Bae et al. (2002) reportaram que a inibio das Nitrobacter sp.
ocorreu com concentraes de NH3 acima de 4,0 mgL-1 (pH entre 8-9),
gerando um acmulo de nitrito no reator. No entanto, durante a
Estratgia II, valores de pH prximos a 9 tambm foram registrados,
mas a acumulao de nitrito no foi verificada. Desta forma, pouco
provvel que tenha ocorrido inibio das BON durante a Estratgia III
por causa da amnia no ionizada.
O segundo fator que pode ter influenciado a acumulao de
nitrito, que com a diminuio do tempo de sedimentao parte das
BON foi lavada do reator. Desta forma, ocorreu o acmulo de nitrito,
uma vez que, segundo Von Sperling (2002), a velocidade de
crescimento dos organismos nitrificantes, principalmente Nitrosomonas,
bem lenta. Liu et al. (2008) e Shi et al. (2010) verificaram que o tempo
de sedimentao para a granulao nitrificante no precisa ser to curto
quanto para a granulao heterotrfica. De outra maneira, necessrio
um longo tempo de operao para compensar a biomassa que foi lavada
devido ao curto tempo de sedimentao, visto que os organismos
nitrificantes apresentam uma baixa velocidade de crescimento. Liu et al.
(2008) recomendam um tempo de sedimentao de 10 minutos para a
formao e manuteno de grnulos com atividades nitrificantes.
Portanto, com a estabilizao do sistema a partir dos 40 dias de
operao, a atuao das BON aumentou novamente, e a concentrao de
NO2--N no efluente diminuiu para 1,4 mgL-1.
Os percentuais de nitrificao, desnitrificao e remoo de
nitrognio total (NH4+-N, NOx-N e Norgnico) durante a Estratgia III
esto apresentados na Tabela 32.
Tabela 32. Percentuais de nitrificao, desnitrificao e remoo de
nitrognio total durante a Estratgia III.

Anlise

Nitrificao
(%)

Desnitrificao
(%)

Nitrognio
Total (%)

Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados

96
3
99
87
13

91
5
99
81
13

89
5
96
81
10

As eficincias mdias de desnitrificao e remoo de nitrognio


total foram menores do que na Estratgia II, a qual, aps o

163

restabelecimento dos grnulos, apresentou eficincia mdia de


desnitrificao e de remoo de nitrognio total de 100 e 93%,
respectivamente. A menor remoo da matria nitrogenada durante a
Estratgia III foi devido ao acmulo de nitrato no RBSG. Com a
melhora na atuao das BON aps 40 dias de operao, as eficincias de
desnitrificao e de remoo de nitrognio total aumentaram para 97 e
92%, respectivamente.
Kim et al. (2004) tambm no observaram uma mudana na
eficincia de nitrificao com a diminuio do tempo de sedimentao
em um reator de grnulos, visto que a mesma permaneceu sempre acima
de 97%. Por outro lado, os autores reportaram um aumento na eficincia
de desnitrificao e de remoo de DQO de 78 para 97% e de 78 para
98%, respectivamente. O aumento na eficincia de desnitrificao foi
relacionado com o aumento no tamanho dos grnulos de 0,1-0,5 mm
para 1,0-2,0 mm com a diminuio no tempo de sedimentao.

4.3.2.3 Comportamento do Fosfato

As concentraes de fosfato e as respectivas eficincias de


remoo obtidas durante a Estratgia III esto apresentadas na Tabela
33. O comportamento da concentrao de PO 4-P afluente e efluente e a
respectiva eficincia de remoo esto apresentados na Figura 69.
Tabela 33. Concentraes de fosfato e eficincia de remoo durante a
Estratgia III.

Anlise
Mdia
Desvio Padro
Mximo
Mnimo
Nmero de dados

PO4-P (mgL-1)
Afluente Efluente
9,1
1,9
12,5
5,1
13

4,0
1,8
6,1
1,1
13

Eficincia
(%)
57
15
82
34
-

Aps o restabelecimento dos grnulos na Estratgia II a eficincia


de remoo de PO4-P foi em torno de 91% e a concentrao mdia de
PO4-P no efluente foi de 0,9 mgL-1. Com a diminuio do tempo de

164

sedimentao, a eficincia de remoo diminuiu acentuadamente,


alcanando 34% aos 20 dias de operao.
Desta forma, pode-se considerar que, como no caso das BON, parte
das bactrias responsveis pela remoo do fsforo pode ter sido lavada
do reator com a diminuio do tempo de sedimentao. Aps 40 dias de
operao, a eficincia de remoo aumentou, estabilizando-se em torno de
60%. Neste perodo, a concentrao de PO4-P no efluente foi em mdia
3,2 mgL-1.
Ts = 9min

Ts = 7min
100

12

80

60

40

20

Tempo (dias)
Afluente

Efluente

Eficincia de Remoo (%)

Concentrao PO4-P (mg.L-1)

Ts = 12min
15

Eficincia de Remoo

Figura 69. Comportamento da concentrao de PO 4-P afluente e


efluente e a respectiva eficincia de remoo ao longo da Estratgia III.

Entretanto, uma maior capacidade de remoo de PO4-P era


esperada, tendo em vista o maior tamanho dos grnulos no final da
Estratgia III. Como exposto anteriormente, quanto maior o tamanho
dos grnulos, maior a limitao de difuso de oxignio e,
consequentemente, maior tamanho da zona anaerbia no interior dos
mesmos. possvel que se o reator tivesse sido operado por mais tempo,
nas mesmas condies finais e sem uma nova mudana no Ts, poderia
ocorrer uma melhora na atuao das bactrias responsveis pela remoo
do fsforo, levando a um aumento da eficincia do processo.
Zhu et al. (2005) tambm observaram uma queda na remoo de
fsforo de 100 para 60%, em virtude da remoo de aproximadamente
18% de lodo granular do reator. Os autores reportaram que aps mais ou
menos 50 dias, a capacidade de remoo de fsforo do RBSG voltou a
aumentar, alcanando 97% de eficincia.

165

Segundo Cassidy & Belia (2005), do ponto de vista operacional, a


perda excessiva de biomassa pode prejudicar a capacidade de remoo
de DQO, nitrognio e fsforo do sistema. Nesse caso, a recuperao da
capacidade de tratamento se torna difcil, especialmente para espcies
com baixa velocidade de crescimento, como as nitrificantes e os
microrganismos acumuladores de fsforo. Ao longo do tempo de
operao de um RBSG, esses autores reduziram gradualmente o tempo
de sedimentao de 60 para 2 minutos e observaram que esta estratgia
foi efetiva, visto que a remoo de DQO, nitrognio e fsforo foi acima
de 95% durante todo o perodo.

4.3.2.4 Taxa de Consumo de Oxignio Especfica (TCOE)


A atividade das bactrias, em termos de taxa de consumo de
oxignio especfica (TCOE), ao longo da Estratgia III, apresentada na
Figura 70. ATCOE foi determinada logo aps a fase de enchimento,
tendo em vista mxima atividade dos microrganismos nesse perodo.

TCOE (mgO2.gSSV-1.h-1)

Ts = 12min

Ts = 9min

Ts = 7min

120

100
80
60
40
20
0

Tempo (dias)
Figura 70. Comportamento da taxa de consumo de oxignio especfica
ao longo da Estratgia III.

166

Com a diminuio do tempo de sedimentao de 15 para 12


minutos, a TCOE diminuiu de 86 mgO2gSSV-1h-1 (Estratgia II - Figura
45) para 46 mgO2gSSV-1h-1 no incio da Estratgia III. Com o
restabelecimento da biomassa no reator (Figura 59), a TCOE estabilizouse em torno de 78 mgO2gSSV-1h-1, aps 14 dias de operao. Essa
mesma tendncia foi verificada quando o tempo de sedimentao foi
reduzido de 12 para 9 minutos e, posteriormente, de 9 para 7 minutos,
sendo que nos ltimos dias de operao a TCOE estabilizou-se em torno
de 94 mgO 2gSSV-1h-1.
Tendo em vista os resultados das Estratgias II e III, pode-se
concluir que de uma maneira geral, a TCOE aumentou com a diminuio
do tempo de sedimentao. Esse resultado est de acordo com Qin et al.
(2004), os quais tambm constataram um aumento da TCO E com a
diminuio do tempo de sedimentao em RBSG. Segundo esses
autores, a atividade respiratria dos microrganismos tende a ser
estimulada em tempos de sedimentao mais curtos. Desta forma, as
bactrias regulam o seu metabolismo energtico em resposta a mudana
de presso de seleo hidrulica, em termos de tempo de sedimentao,
exercida sobre elas. Entretanto McSwain et al. (2004), no verificaram
uma mudana na atividade dos grnulos, em termos de TCOE, com a
diminuio do tempo de sedimentao.
Por outro lado, Liu & Tay (2007) reportaram que a taxa de
remoo de DQO e a TCOE diminuram com o aumento da densidade e
do tamanho dos grnulos, devido maior limitao de transferncia de
massa dentro dos mesmos. Segundo Liu et al. (2005b), a limitao de
difuso mais acentuada em grnulos com dimetro mdio maior do
que 0,7 mm. No presente estudo, mesmo com o aumento do tamanho
dos grnulos com a diminuio do tempo de sedimentao, no se
verificou um reduo na TCOE, uma vez que o dimetro mdio dos
grnulos foi de apenas 0,4 mm no final da Estratgia III.

4.3.2.5 Monitoramento de Ciclos


Na Figura 71 apresentado o comportamento da concentrao de
DQOs e de NH4+-N, bem como da taxa de consumo de oxignio (TCO)
da biomassa ao longo de um ciclo padro da Estratgia III (Ts = 7 min),
monitorado aos 40 dias de operao do reator. Observa-se uma elevada
queda na concentrao de DQOs e NH4+-N no incio do ciclo, mostrando
que o substrato principalmente absorvido e/ou removido nos primeiros

167

30 minutos. No restante do tempo, a remoo do substrato foi menos


acentuada, chegando ao final do ciclo com DQO s de 55 mgL-1 e
NH4+-N de 1 mgL-1. Essa concentrao de DQOs no efluente tratato
pode ser atribuda matria recalcitrante de difcil degradao. As
eficincias de remoo de DQOs e de NH4+-N para este ciclo foram,
respectivamente, de 93% e 99%. Como observado na estratgia anterior,
possvel identificar a fase de degradao durante os 30 primeiros
minutos e a fase de inanio durante o restante do ciclo. De acordo com
Liu & Tay (2007), geralmente quando se tem uma alta concentrao de
biomassa granular dentro do reator, uma concentrao de DQO afluente
em torno de 1000 mgL-1 pode ser consumida em menos de 30 minutos
pelos grnulos.
A atividade das bactrias em termos de TCO, conforme
apresentado na Figura 71, foi bastante elevada no incio do ciclo, devido
maior disponibilidade de substrato, atingindo um valor mximo de
169 mgO2L-1h-1. A diminuio da concentrao de substrato provocou
uma elevada queda na TCO nos primeiros 90 minutos. No restante do
ciclo, a TCO caiu menos acentuadamente, chegando ao final do ciclo
com um valor de 7 mgO2L-1h-1, indicando o trmino do processo de
oxidao. Neste ciclo, a concentrao celular no reator, em termos de
slidos suspensos volteis (SSV), foi de 2,7 gL-1. Desta forma, a
TCOespecfica mxima foi igual a 63 mgO 2gSSV-1h-1. Este valor
encontra-se prximo aos valores mdios de TCOE de 56 e
69 mgO2gSSV-1h-1 reportados por Tay et al. (2001a) para grnulos
cultivados com acetato e glicose, respectivamente.
Na Figura 72 apresentado o comportamento da concentrao de
NO2--N e NO3--N ao longo do ciclo monitorado. A produo de NO2--N
foi mais acentuada nos primeiros 30 minutos de ciclo, em virtude do
maior consumo de NH4+-N nesse perodo. Com o trmino da etapa de
nitritao aos 90 minutos de ciclo, ocorreu uma queda na concentrao
de NO2--N, indicando que nesse perodo ocorreu apenas a segunda etapa
do processo de nitrificao (nitratao). O acmulo de NO3--N ao longo
de todo o ciclo foi praticamente insignificante, evidenciando a boa
atuao das bactrias desnitrificantes. A concentrao de NO2--N e
NO3--N no efluente foi de 5 e 0,5 mgL-1, respectivamente, e a eficincia
de desnitrificao e de remoo de nitrognio total para este ciclo foi de
94 e 79%, respectivamente.

1000

200

800

160

600

120

400

80

200

40

NH4+-N (mg.L-1)
TCO (mg O2.L-1.h-1)

DQOS (mg.L-1)

168

0
0

Tempo (horas)
NH4-N
TCO
DQOs
+
Figura 71. Comportamento da DQOs, da NH4 -N e da TCO ao longo de
um ciclo padro monitorado aos 40 dias de operao da Estratgia III.

20

NOX-N (mg.L-1)

16
12
8
4

0
0

Tempo (horas)
NO2-N

NO3-N

Figura 72. Comportamento do nitrito e do nitrato ao longo de um ciclo


padro monitorado aos 40 dias de operao da Estratgia III.

Na Figura 73 apresenta-se o comportamento do OD, pH e


temperatura ao longo do ciclo monitorado. A temperatura manteve-se
constante em torno de 27 C durante todo o ciclo. Aps os 15 primeiros
minutos de ciclo, onde o consumo do substrato foi mais intenso, o OD
aumentou acentuadamente de 2,3 para 7,3 mgL-1 devido diminuio
da concentrao de substrato. Alm disso, em virtude do consumo do

169

on hidrognio durante a oxidao do acetato, o pH aumentou de 8,3


para 9,0.
Com a oxidao da matria lentamente biodegradvel no perodo
entre 15 e 90 min, observa-se um aumento gradual da concentrao de
OD de 7,3 para 8,3 mgL-1, o qual se manteve estvel em torno deste
ultimo valor at o final da fase de aerao. Em relao ao pH, o mesmo
diminuiu gradualmente de 9,0 para 8,5, e, em seguida, voltou a subir
para 8,8, formando o caracterstico vale da amnia. Como exposto
anteriormente, de acordo com Carucci et al. (1999), esse comportamento
de queda e aumento do pH, durante a fase aerbia, ocorre quando todo o
processo de nitrificao completado, o que corrobora com os
resultados apresentados nas Figuras 71 e 72. Ma et al. (2009), estudando
o processo de NDS em um RBS, tambm observaram a formao do
vale da amnia com o trmino do processo de nitrificao.
Durante a sedimentao, a concentrao de OD diminui
continuamente, atingindo 6,9 mgL-1 no final do ciclo. Comparando esse
resultado com o obtido no ciclo monitorado na Estratgia II (Figura 48)
onde a concentrao de OD no final do ciclo foi de 4 mgL-1 pode-se
perceber que a concentrao de OD no final do presente ciclo foi maior
em virtude do menor tempo da fase de sedimentao (7 minutos).
30

10

25

8
20
6
15

Temperatura ( C)

OD (mgL-1) e pH

12

10
0

Tempo (horas)
OD

pH

Figura 73. Comportamento do oxignio dissolvido, pH e temperatura


ao longo de um ciclo padro monitorado aos 40 dias de operao da
Estratgia III.

170

O comportamento do potencial redox (ORP) ao longo do ciclo


monitorado est apresentado na Figura 74. Como as variveis OD e pH,
o ORP aumentou acentuadamente de -134 mV para 9 mV, durante os 15
primeiros minutos. Em seguida, observa-se que um aumento gradativo
do ORP, o qual se estabilizou em torno de 22 mV aps 60 minutos de
ciclo, indicando que o processo de oxidao do substrato estava
completo. Ma et al. (2009) tambm reportou um aumento do valor de
ORP de -250 a 50 mV com o trmino do processo de nitrificao.
0

ORP (mV)

-50

-100

-150

Tempo (horas)
Figura 74. Comportamento do potencial redox ao longo de um ciclo
padro monitorado aos 40 dias de operao da Estratgia III.

O comportamento do fosfato ao longo do ciclo monitorado pode


ser observado na Figura 75. O PO4-P foi principalmente removido nos
primeiros 90 minutos do ciclo, sendo que a sua concentrao no efluente
tratado foi igual a 5,4 mgL-1 e a eficincia de remoo foi de 56%, no
atendendo o padro de lanamento da legislao ambiental de Santa
Catarina (SANTA CATARINA, 2009).
De maneira geral, as variveis do ciclo monitorado na
Estratgia III seguiram o mesmo comportamento do ciclo apresentado
na Estratgia II (Figuras 46 a 50).

171

15

PO4-P(mg.L-1)

12

0
0

Tempo (horas)
Figura 75. Comportamento do fosfato ao longo de um ciclo padro
monitorado aos 40 dias de operao da Estratgia III.

4.3.3 Hibridizao Fluorescente in situ (FISH)

Os resultados obtidos com a anlise FISH de amostra de grnulos


coletada aos 53 dias de operao da Estratgia III esto apresentados na
Tabela 34. A amostra foi caracterizada como sendo heterognea, com a
presena de muito material extracelular, e clulas em arranjos coloniais
e isoladas.
Verificou-se que mais de 90% das eubactrias estavam ativas
(Figura 76), sendo a maioria composta por organismos nitrificantes, com
60% de bactrias oxidadoras de amnia (BOA) (Figura 77) do tipo beta,
e 70% de bactrias oxidadoras de nitrito (BON) (Figura 78), do tipo
Nitrobacter spp.
Em comparao com os resultados da Estratgia I (NSO > 10% e
NIT 40%) e Estratgia II (NSO 35% e NIT 30%), pode-se
verificar que com a diminuio do tempo de sedimentao e,
conseqentemente, com o aumento da frao de grnulos no reator,
houve um aumento da populao das bactrias nitrificantes. De acordo
com Shi et al. (2010), difcil obter e manter concentraes suficientes
de bactrias nitrificantes nas estaes de tratamento de esgoto, devido
baixa velocidade de crescimento desses organismos. Assim, os autores
consideram que a imobilizao dos organismos nitrificantes em grnulos

172

aerbios uma maneira eficiente de reter essas bactrias no sistema, o


que corrobora com os resultados obtidos no presente estudo.
Tabela 34. Resultados da anlise FISH dos grnulos aos 53 dias de
operao da Estratgia III.

Sondas
EUB
(todas as eubactrias)
NSO
(Betaproteobacterias oxidadoras de amnia)
NIT
(Nitrobacter spp)
DSV
(Bactrias Sulfato RedutorasDesulfovibionaceae)
ARC
(todas Archae)
Eury
(grupos Methanosarina, Methanosaeta,
Methanomicrobiales)

Porcentagem (em
relao ao DAPI)
>90% DAPI
Muitas
60% DAPI
Muitas
70% DAPI
Muitas
0% DAPI
Nenhuma
15% DAPI
Poucas
<5% DAPI
Raras

Alm das eubactrias, foram identificadas ainda arqueobactrias.


Dentre elas, observou-se a presena de aproximadamente 5% de
bactrias metanognicas pertecentes ao grupo da Methanosarina,
Methanosaeta e Methanomicrobiales, confimando a presena de zonas
anaerbias no interior dos grnulos.
Kim & Seo (2006) observaram por meio de anlise FISH que as
BON (Nitrobacter e Nitrospira) desapareceram gradualmente aps 100
dias de operao, em virtude da inibio do crescimento desses
organismos pela presena de amnia no ionizada.
Assim, a partir dos resultados obtidos na anlise FISH do
presente estudo, pode-se concluir que no houve inibio das BON por
causa da possvel presena de NH3, uma vez que as mesmas no
desapareceram do reator. Isso leva a crer que o leve acmulo de nitrito
observado (Figura 68) foi mesmo devido a uma parte da biomassa ter
sido lavada do reator com a diminuio do tempo de sedimentao.
Desta forma, aos 53 dias de operao, as BON j haviam se recuperado,
apresentando uma populao maior do que de BOA.

173

Figura 76. Clulas hibridizadas pela sonda EUB (DAPI em azul e


hibridizao em verde) visualizadas em microscpio confocal (Aumento
630x).

Figura 77. Clulas hibridizadas pela sonda NSO (DAPI em azul e


hibridizao em verde) visualizadas em microscpio confocal (Aumento
630x).

Figura 78. Clulas hibridizadas pela sonda NIT (DAPI em azul e


hibridizao em verde) visualizadas em microscpio confocal (Aumento
630x).

174

4.3.4 Biomassa Ativa Autotrfica e Heterotrfica

As concentraes de biomassa ativa autotrfica (X A) e


heterotrfica (XH) foram determinadas por meio de ensaios de
respirometria. Esses ensaios foram realizados em duas amostras de lodo
coletadas no primeiro e no ltimo dia de operao da Estratgia III, a
fim de verificar possveis mudanas na biomassa ativa com a diminuio
do tempo de sedimentao. Aps obter as velocidades de consumo de
oxignio, foi possvel calcular a concentrao de XH e X A presente nas
amostras, utilizando-se as Equaes 21 e 22, respectivamente. Os
valores obtidos esto apresentados na Tabela 35.
Tabela 35. Concentrao de biomassa ativa autotrfica e hetetotrofica
no primeiro e no ltimo dia de operao da Estratgia III.

Tempo de Operao (dias)


Biomassa Ativa
XH (mgDQOL-1)
XA (mgDQOL-1)

53

381,7
6,2

982,7
29,3

A concentrao de X A e XH aumentou ao longo da Estratgia III,


em virtude da diminuio do tempo de sedimentao e,
conseqentemente, do aumento da frao e do tamanho dos grnulos no
reator. No entanto, esse aumento foi proporcional, uma vez que no
primeiro dia de operao XH e XA representavam, respectivamente,
98,4% e 1,2% da biomassa ativa total do sistema (XH+XA), enquanto
que no ltimo dia de operao, essa representao foi bastante similar,
com 97,1% de XH e 2,9% de XA.
O aumento na XA corrobora com as observaes realizadas na
anlise FISH (Tabela 34), a qual indicou um aumento da populao de
bactrias nitrificantes em relao ao final da Estratgia II (incio
Estratgia III), conforme apresentado na Tabela 27.
Esses resultados mostram ainda que, nos dois ensaios realizados,
a biomassa ativa do lodo era formada majoritariamente por organismos
heterotrficos. Resultados similares foram obtidos por Plattes et al.
(2007), os quais utilizaram a respirometria para caracterizar a biomassa
ativa autotrfica e heterotrfica de um reator biolgico com leito mvel,
em escala piloto. Os autores obtiveram uma concentrao de XA de

175

49 mgDQOL-1 e X H de 2230 mgDQOL-1, sendo que 98% da biomassa


do sistema era formada por bactrias heterotrficas.
Ochoa et al. (2002), avaliando a evoluo da biomassa em
reatores hbridos, reportaram concentraes de biomassa ativa bastante
superiores aos do presente estudo. Os autores obtiveram valores de X H
entre 1750-3000 mgDQOL-1 e XA entre 150-245 mgDQOL-1, aps
adio de pulsos de 250 mgDQOL-1 e 20 mgNL-1, respectivamente.
Wolff et al. (2006) quantificaram a biomassa ativa em dois
reatores hbridos preenchidos com materiais suporte diferentes (P4 e
P5). Os autores reportaram que o reator com suporte P4 apresentou uma
frao mdia de 30% de organismos autotrficos e 70% heterotrficos,
enquanto que o reator com suporte P5 a frao autotrfica foi em mdia
19% e a heterotrfica 81%.
Xavier et al. (2007) e Ni et al. (2008) tambm reportaram
baixos percentuais de XA em grnulos aerbios. Xavier et al. (2007)
estabeleceram um modelo para descrever as dinmicas das populaes e
a composio microbiana dos grnulos em RBS. Os resultados
mostraram que a frao de organismos autotrficos correspodia a apenas
1% da biomassa total. Ni et al. (2008) desenvolveram um modelo
matemtico para descrever o crescimento autotrfico e heterotrfico em
um RBSG de escala laboratorial. Os autores reportaram que a biomassa
total (ativa + inerte) do sistema era composta por 65,7% de material
inerte, 32,5% de XH e 1,8% de X A. Baixos valores de XA ocorrem
devido baixa taxa de crescimento e ao baixo coeficiente de converso
dos organismos autotrficos. Alm disso, os autores demostraram que a
concentrao de DQO e NH4+-N do afluente governa a composio da
biomassa autotrfica e heterotrfica em RBS de grnulos aerbios.
Vzquez-Padn et al. (2010) simularam a concentrao de
biomassa ativa autotrfica e heterotrfica de um RBSG em trs
diferentes condies operacionais, em termos de relao DQO/N. Os
autores observaram que quando a relao DQO/N aplicada foi de 5,5, a
biomassa autotrfica representou 5% da biomassa ativa total, sendo que
a concentrao de XA e XH foi de 137,6 e 2381,4 mgDQOL-1,
respectivamente. Com a diminuio da relao DQO/N para 1,25, houve
um aumento do percentual da biomassa autotrfica para 30%, sendo
que, para esta condio, a concentrao de XA e XH foi de 171,6 e
324 mgDQOL-1, respectivamente. Na ltima condio, onde a a relao
DQO/N aplicada foi de 0, a concentrao biomassa autotrfica
representou 100% da biomassa ativa total, apresentando uma
concentrao de 3096 mgDQOL-1, o que indica um meio puramente
autotrfico.

176

4.4 SNTESE DAS ESTRATGIAS OPERACIONAIS

Na Tabela 36 est apresentada uma sntese das condies


operacionais aplicadas e dos principais resultados obtidos durante cada
Estratgia Operacional.
Tabela 36. Sntese das condies operacionais aplicadas e dos principais
resultados obtidos durante cada Estratgia Operacional.
Variveis
Durao (dias)
Tempo de ciclo (horas)
Tempo de sedimentao
(min)
Adio de carga orgnica
Vazo de ar aplicada (Lh-1)
Tamanho dos grnulos
(mm)
Frao de grnulos (%)
PSE (mggSSV-1)
SSTreator (gL-1)
SSTefluente (mgL-1)
IVL30 (mLg-1)
IVL30/IVL10 (%)
OD (mgL-1)
pH
T (C)
DQOT afluente (mgL-1)
DQOT efluente (mgL-1)
Eficincia de remoo
DQOT (%)
DQOS afluente (mgL-1)
DQOS efluente (mgL-1)
Eficincia remoo DQOS
(%)
NH4+-N afluente (mgL-1)
NH4+-N efluente (mgL-1)
Eficincia de remoo
NH4+-N (%)
NTK afluente (mgL-1)
NTK efluente (mgL-1)

Estratgia I
3 horas 4 horas

Estratgia
II

Estratgia
III

70
4

53
4

15

15

12-9-7

No
242

Sim
275

Sim
275

0,3-1,3(4)

0,2-0,7(6)

0,2-8,0(9)

- (2)
- (2)
1,5(3)
85(3)
53(3)
90(4)

75(8)
200(8)
4,2(9)
64(9)
39(9)
90(1)
6,2(1)
8,6(1)
27(1)
1178(1)
75(8)

88
3

83
4

8,3(1)
8,0(1)
18(1)
- (2)
- (2)

7,5(1)
8,3(1)
21(1)
589(4)
275(4)

60(7)
132(5)
3,7(5)
70(5)
42(6)
90(6)
6,1(1)
8,5(1)
27(1)
1083(1)
128(5)

- (2)

54(4)

90(5)

93(8)

430(1)
147(1)

412(1)
72(1)

849(1)
66(1)

839(1)
58(1)

64(1)

82(1)

92(1)

93(1)

91(1)
74(1)

83(1)
26(1)

76(1)
3(1)

74(1)
3(1)

18(1)

69(1)

96(1)

96(1)

- (2)
- (2)

- (2)
- (2)

83(1)
5(5)

82(1)
3(8)

177
Eficincia de remoo NTK
- (2)
- (2)
94(5)
96(8)
(%)
NO2--N efluente (mgL-1)
3,6(1)
4,5(4)
0,3(6)
1,4(8)
-1
(1)
(1)
(6)
NO3 -N efluente (mgL )
4,4
9,3
0,1
0,4(1)
Eficincia desnitrificao
48(1)
80(4)
100(6)
91(8)
(%)
Eficincia remoo NT (%)
10(1)
66(4)
93(6)
89(8)
PO4-P afluente (mgL-1)
9,8(1)
9,7(1)
9,1(1)
9,1(1)
PO4-P efluente (mgL-1)
8,2(1)
6,9(1)
0,9(5)
3,2(8)
Eficincia de remoo
17(1)
30(1)
91(5)
60(8)
PO4-P (%)
TCOE (mgO2gSSV-1h-1)
- (2)
154(4)
86(5)
94(8)
(1)
(2)
Valores mdios durante toda a Estratgia. Varivel no determinada. (3)
Aps 100 dias de operao da Estratgia I. (4) Aps 140 dias de operao da
Estratgia I. (5) Aps 40 dias de operao da Estratgia II. (6) Aps 50 dias de
operao da Estratgia II. (7) Aps 70 dias de operao da Estratgia II. (8) Aps
45 dias de operao da Estratgia III. (9) Aps 50 dias de operao da Estratgia
III.

Grnulos Aerbios
A vazo de ar aplicada e o tempo de sedimentao foram os
principais parmetros que influenciaram as caractersticas dos grnulos
(em termos de tamanho, frao e sedimentabilidade) e a produo de
polissacardeos extracelulares (PSE). O aumento da vazo de ar
acarretou em grnulos de menores dimenses durante a Estratgia II, em
virtude da maior coliso entre partculas e da maior frico
partcula/lquido (YANG et al., 2004). Elevadas foras de cisalhamento
estimularam a produo de PSE e melhoram a sedimentabilidade dos
grnulos, em termos de IVL30. A diminuio do tempo de sedimentao
selecionou o crescimento de biopartculas de melhor sedimentabilidade,
promovendo assim um aumento no tamanho e na frao dos grnulos.
Observou-se um aumento na produo de PSE com a diminuio do
tempo de sedimentao na Estratgia III, ume vez que os
microrganismos expostos a uma maior presso de seleo hidrulica, em
termos de tempo de sedimentao, utilizam uma maior quantidade da
energia produzida no catabolismo para a sntese de PSE do que para o
crescimento (QIN et al., 2004b).
SST reator
A concentrao de biomassa no reator foi influenciada
principalmente pela carga orgnica e pelo tempo de sedimentao. A
carga orgnica acarretou em um maior crescimento da biomassa devido

178

maior disponibilidade de substrato. J a diminuio do tempo de


sedimentao conduziu a um aumento na concentrao de SST no reator
devido maior frao e tamanho dos grnulos obtidos na Estratgia III.
SST efluente
Mesmo com a estabilizao dos grnulos no reator, uma
concentrao significativa de slidos foi encontrada no efluente tratado.
Segundo Thanh et al. (2009), a quantidade de slidos no efluente
depende da carga orgnica aplicada, tempo de retirada do efluente
tratado, tempo de sedimentao, concentrao de slidos no afluente,
configurao do reator, tipo de esgoto, entre outros. Alm disso, de
acordo com Arrojo et al. (2004), a presena de SST no efluente
resultado de pelo menos trs causas: presena de SST no prprio
afluente, desprendimento de pequenos pedaos dos grnulos e formao
de pequenos agregados durante o ciclo, devido ao crescimento da
biomassa. Desta forma, pode-se perceber que a maneira que o reator
operado pode reduzir a concentrao de slidos no efluente.
OD, pH e T
A concentrao de OD foi afetada pela concentrao de SST no
reator e pela adio de carga. Uma maior disponibilidade de substrato,
em virtude do aumento da carga orgnica, e uma maior concentrao de
SST no reator ocasionaram um maior consumo de OD por parte dos
microrganismos no processo de metabolizao do substrato. O pH foi
influenciado pela adio de carga orgnica, tendo em vista que durante a
oxidao do acetato ocorre o consumo do on hidrognio, resultando em
um aumento do pH no meio lquido. J a temperatura variou conforme a
estao do ano em que foi realizada cada estratgia, tendo em vista as
caractersticas do esgoto afluente e da temperatura ambiente.
Remoo de carbono e nitrognio
De maneira geral, a durao do ciclo e o aumento da carga
orgnica aplicada influenciaram o desempenho do reator, em termos de
nitrificao e remoo de carbono.
Por outro lado, na Estratgia I o processo de desnitrificao no
foi influenciado pela durao do ciclo, mas sim pela existncia de
grnulos maduros e compactos no reator.
Na Estratgia II foram registradas as menores concentraes de
NO2--N e NO3--N no efluente tratado e, conseqentemente, as maiores
eficincias de desnitrificao e de remoo de nitrognio total. O
aumento da eficincia de desnitrificao est relacionado com a maior

179

disponibilidade de substrato orgnico, visto que a presena de carbono


biodegradvel imprescindvel para a ocorrncia da desnitrificao.
Quanto Estratgia III, com a diminuio do tempo de
sedimentao, parte das BON foi lavada do reator. Por se tratarem de
organismos de lento crescimento, foi necessrio mais de 40 dias para
compensar a biomassa que foi perdida devido ao curto tempo de
sedimentao. Como resultado, foram verificadas nesta estratgia
maiores concentrao de NO2--N e NO3--N no efluente, e menores
eficincias de desnitrificao e remoo de nitrognio total, em
comparao com a Estratgia II.
Remoo de fsforo
Como o processo de desnitrificao, a remoo de fosfato durante
a Estratgia I no foi influenciada pela durao do ciclo, mas sim pela
existncia de micro zonas anaerbias dentro dos grnulos. Entretanto, o
desempenho do reator, em termos de remoo de fosfato, foi mais
acentuado na Estratgia II, tendo em vista que a disponibilidade de uma
fonte de carbono facilmente degradvel essencial para a ocorrncia
deste processo (SANTANNA JR., 2010).
Com a diminuio do tempo de sedimentao na Estratgia III, a
eficincia de remoo de PO4-P diminuiu acentuadamente. Como no caso
das BON, parte das bactrias responsveis pela remoo do fsforo foi
lavada do reator com a diminuio do tempo de sedimentao, afetando
assim o desempenho do RBSG.
TCOE
A TCOE diminuiu com o aumento da carga orgnica e da
velocidade superficial ascensional do ar. Alm disso, a TCOE aumentou
com a diminuio do tempo de sedimentao, indicando que a atividade
respiratria dos microrganismos tende a ser estimulada em tempos de
sedimentao mais curtos.

180

181

5 CONCLUSES E RECOMENDAES

Com base nos resultados obtidos no RBSG, para as condies


operacionais aplicadas, conclui-se que:
Em relao Estratgia Operacional I:
Os grnulos aerbios podem ser cultivados em um reator em
bateladas seqenciais utilizando um afluente complexo e de mdia
concentrao (em termos de DQOS) como o esgoto domstico. No
entanto, o processo de formao desses grnulos demandou mais tempo
do que nos estudos onde os mesmos foram cultivados com esgoto
sinttico de elevada concentrao de DQO (> 800 mgL-1). Apesar disso,
os grnulos obtidos durante a Estratgia I mostraram-se heterogneos e
com tima sedimentabilidade, em termos de IVL30.
Referente ao desempenho do reator, o mesmo apresentou elevada
remoo de DQOs e NH4+-N, principalmente quando operado em
sucessivos ciclos de 4 horas. O aumento da durao do ciclo no afetou
as caractersticas dos grnulos, mas influenciou fortemente a capacidade
de remoo de nitrognio, visto que nessas condies houve uma
diminuio da freqncia com que os slidos foram lavados do reator,
possibilitando assim o acmulo e o crescimento dos organismos
nitrificantes. Mesmo com concentraes de OD prximas a saturao, o
reator removeu fsforo e apresentou atividades desnitrificantes, devido
existncia de zonas anxicas e anaerbias dentro dos grnulos.
Portanto, pode-se concluir que a durao do ciclo no foi um
parmetro decisivo no processo de granulao aerbia, mas influenciou
na qualidade do efluente tratado.
Em relao Estratgia Operacional II:
A adio de carga orgnica nesta estratgia provocou a
desintegrao dos grnulos maduros e o aparecimento de flocos
filamentosos, o que por sua vez ocasionou em uma diminuio na
concentrao de slidos no reator e uma piora na sedimentabilidade da
biomassa. Aps algumas semanas, o reator voltou a apresentar grnulos,
devido ao maior cisalhamento proporcionado pelo aumento da vazo de
ar.

182

A desintegrao dos grnulos no afetou o desempenho do


RBSG, em termos de remoo de DQO s e NH4+-N, mas, por outro lado,
comprometeu o processo de desnitrificao e a remoo de DQO T, NTK
e fsforo. Com o restabelecimento dos grnulos no reator, a eficincia
de remoo dessas variveis voltou a subir, sendo que o processo de
desnitrificao e remoo de fsforo atingiram eficincias em torno de
100% e 91%, respectivamente.
Desta forma, conclui-se que os grnulos aerbios podem ser
mantidos no reator mesmo com o aumento da carga orgnica aplicada,
desde que haja condies de cisalhamento adequadas. Ademais, o RBSG
uma tecnologia bastante adequada para o tratamento de afluentes com
cargas orgnicas mais elevadas.
Em relao Estratgia Operacional III:
A reduo do tempo de sedimentao ao longo desta estratgia
selecionou o crescimento de biopartculas de melhor sedimentabilidade,
promovendo assim um aumento gradativo no tamanho dos grnulos e,
conseqentemente, na concentrao de slidos totais no reator. O tempo
de sedimentao mostrou-se como um importante parmetro operacional
para a predominncia dos grnulos no reator.
Quanto ao desempenho do RBSG, a diminuio do tempo de
sedimentao conduziu a um aumento na eficincia de remoo de
DQOT e NTK em virtude da melhor sedimentabilidade do lodo, mas no
afetou a remoo de DQOS e NH4+-N, uma vez que a eficincia de
remoo dessas variveis permaneceu praticamente constante ao longo
desta estratgia. Por outro lado, observou-se a ocorrncia de acmulo de
nitrito e a diminuio da remoo do fsforo devido parte da biomassa
ter sido lavada do reator, com a diminuio do tempo de
sedimentao. No final desta estratgia, o sistema voltou a apresentar
uma boa atuao das bactrias oxidadoras de nitrito (BON), mas seria
necessrio ainda mais tempo de operao para atingir uma eficincia de
remoo de fsforo similar a da Estratgia II.
A determinao da biomassa ativa mostrou um aumento na
concentrao de bactrias autotrficas e heterotrficas com a diminuio
do tempo de sedimentao e, conseqentemente, com o aumento da
frao e do tamanho dos grnulos no reator.
Desta forma, pode-se concluir que a diminuio gradual do tempo
de sedimentao uma maneira efetiva de melhorar as caractersticas

183

dos grnulos no reator, mas pode ocasionar, temporariamente, uma piora


na qualidade do efluente tratado.
A partir das concluses das trs estratgias operacionais, pode-se
perceber que, de maneira geral, o RBSG mostrou-se capaz de remover
carbono, nitrognio e fsforo simultaneamente em uma nica unidade
operacional compacta. Portanto, evidente o RBSG uma tecnologia
bastante promissora para o tratamento de esgoto domstico, devendo,
portanto, ser mais investigada.
Tendo em vista as constataes efetuadas na presente pesquisa,
sugerem-se algumas recomendaes para trabalhos futuros:
Estudar o processo de formao de grnulos aerbios com
esgoto domstico em um RBSG de maior escala;
Operar o RBSG com um percentual de troca volumtrica maior
(60 ou 70%), a fim de aumentar a carga aplicada e a frao de
grnulos no reator;
Durante o perodo de partida do reator, diminuir gradualmente o
tempo de sedimentao de 30 para 10 minutos, com o intuito de
aumentar a frao de grnulos no reator sem que haja uma
perda muito severa de biomassa;
Aumentar o tempo de enchimento para 10-15 minutos, com o
intuito de ter uma fase inicial anaerbia, que possibilite uma
maior remoo de nitrognio e fsforo, principalmente quando
o reator for operado com baixa/mdia carga orgnica;
Determinar possvel produo de xido nitroso (N 2O) durante o
processo de desnitrificao tendo em vista o seu grande
potencial para o aquecimento global;
Utilizar mais sondas nas anlises FISH, com o intuito de
detectar uma maior quantidade de microrganismos presentes
nos grnulos, como por exemplo, as bactrias removedoras de
fsforo;
Determinar a concentrao de protenas nos grnulos, visto que
a mesma tem sido reportada na literatura como sendo um
composto que tem um papel importante na formao e
estabilidade dos mesmos;
Determinar a composio da biomassa ativa autotrfica, em
termos de bactrias oxidadoras de amnia e bactrias
oxidadoras de nitrito, por meio de ensaios de respirometria e
utilizando inibidores seletivos.

184

185

REFERNCIAS

ADAV, S.S., LEE, D.J., SHOW, K.Y., TAY, J.H. Aerobic granular
sludge: recent advances. Biotechnology Advances, 26 (5): 411-423,
2008.
ADAV, S.S., LEE, D.J., LAI, J.Y. Aerobic granulation in sequencing
batch reactors at different settling times. Bioresource Technology,
100 (21): 5359-5361, 2009.
ADAV, S.S., LEE, D.J., LAI, J.Y. Potential cause of aerobic granular
sludge breakdown at high organic loading rates. Applied Microbiology
and Biotechnology, 85:1601-1610, 2010.
AL-REKABI, W.S., QIANG, H., QIANG, W.W. Review on sequencing
batch reactors. Pakistan Journal of Nutrition, 6 (1): 11-19, 2007.
ALVES, K.C.G. Tratamento de efluentes txteis usando reator de
leito fluidizado trifsico aerbio com pr ou ps ozonizao.
Dissertao (Mestrado em Engenharia Ambiental) - Universidade
Federal de Santa Catarina, Florianpolis - SC, 2000.
AMANN, R. In situ identification of microorganism by whole cell
hybridization with rRNA-targeted nucleic acid probes. In:
AKKERMAN, A.D.L., VAN ELSAS, J.D., DE BRUJIN, F.J. (eds).
Molecular microbial ecology manual. 1995, p. 1-15.
APHA, AWWA, WEF. Standard methods for the examination of
water and wastewater. 21ed., Washington, 2005.
ARROJO, B., MOSQUERA-CORRAL, A., GARRIDO, J.M.,
MNDEZ, R. Aerobic granulation with industrial wastewater in
sequencing batch reactors. Water Research, 38: 3389-3399, 2004.
ARTAN, N., ORHON, D. Mechanism and design of sequencing batch
reactors for nutrient removal. Scientific and Technical Report No. 19,
London: IWA Publishing, 2005. 100 p.

186

BAE, W., BAEK, S., CHUNG, J., LEE, Y. Optimal operational factors
for nitrite accumulation in batch reactors. Biodegradation, 12 (5): 359366, 2002.
BAEK, S.H., PAGILLA, K.R. Simultaneous nitrification and
denitrification of municipal wastewater in aerobic membrane
bioreactors. Water Environment Research, 80 (2): 109-117, 2008.
BARBOSA, S.R. Tratamento de efluentes em reator de leito
fluidizado seqencial em batelada. Dissertao (Mestrado em
Engenharia Ambiental) - Universidade Federal de Santa Catarina,
Florianpolis - SC, 2004.
BARTHEL, L. Estudo de biofilme desenvolvido em reator de leito
fluidizado trifsico aerbico no tratamento de efluentes txteis.
Dissertao (Mestrado em Engenharia Ambiental) - Universidade
Federal de Santa Catarina, Florianpolis - SC, 1998.
BATISTA, J.A., SANTOS, F.N., BARROS JR., L.M., SCHMIDELL,
W., MACEDO, G.R. Uso da respirometria na avaliao da toxicidade do
fenol em um lodo domstico. In: Congresso Brasileiro de Engenharia
Qumica em Iniciao Cientfica, 6, 2005, Campinas, So Paulo.
Anais... 2005.
BELINE, F. Le traitement biologique arobie du lisier de porc - Les
transformations de l'azote et les missions gazeuses polluantes. Coll.
tudes du Cemagref. Srie quipements pour leau et lenvironnement.
n 26, 2001. 134 p.
BERNET, N., SPRANDIO, M. Principles of nitrifying processes. In:
CERVANTES (editor), F.J. Environmental Technologies to Treat
Nitrogen Pollution: Principles and Engineering. London: IWA
Publishing, 2009, 23-39.
BEUN, J.J., HENDRIKS, A., VAN LOOSDRECHT, M.C.M.,
MORGENROTH, E., WILDERER, P.A., HEIJNEN, J.J. Aerobic
granulation in a sequencing batch reactor. Water Research, 33 (10):
2283-2290, 1999.

187

BEUN, J.J., HEIJNEN, J.J., VAN LOOSDRECHT, M.C. N-removal in


a granular sludge sequencing batch airlift reactor. Biotechnology &
Bioengineering, 75 (1):82-92, 2001.
BEUN, J.J., VAN LOOSDRECHT, M.C.M., HEIJNEN, J.J. Aerobic
granulation. Water Science & Technology, 41 (4-5): 41-48, 2000.
BEUN, J.J., VAN LOOSDRECHT, M.C.M., HEIJNEN, J.J. Aerobic
granulation in a sequencing batch airlift reactor. Water Research, 36:
702-712, 2002.
BORTOLLOTTO NETO, A.F. Estratgias para a nitrificao em
reator de leito fluidizado seqencial em batelada. Dissertao
(Mestrado em Engenharia Ambiental) - Universidade Federal de Santa
Catarina, Florianpolis - SC, 2004.
BORTOLLOTTO NETO, A.F., CAMPOS, R.H., THANS, F.C.,
COSTA, R.H.R. Nitrificao e remoo carboncea em RLFSB no
tratamento de esgoto urbano ao longo de uma batelada. In: Congresso
Interamericano de Engenharia Sanitria e Ambiental, 29, 2004, San
Juan, Porto Rico. Anais... 2004.
BRASIL. Resoluo CONAMA n 357/05, de 17 de maro de 2005.
Dispe sobre a classificao dos corpos de gua e diretrizes ambientais
para o seu enquadramento, bem como estabelece as condies e padres
de lanamento de efluentes, e d outras providncias. Oficial da Unio,
18 de maro de 2005, p. 58-63.
BRASIL. Lei n 11.445, de 5 de janeiro de 2007. Estabelece diretrizes
nacionais para o saneamento bsico; altera as leis n 6.766, de 19 de
dezembro de 1979, n 8.036, de 11 de maio de 1990, n 8.666, de 21 de
junho de 1993, n 8.987, de 13 de fevereiro de 1995; revoga a lei n
6.528, de 11 de maio de 1978 e d outras providncias. Dirio Oficial da
Unio, 8 de janeiro de 2007, p. 3-7.
BRASIL. Resoluo CONAMA n 397/08. Altera o inciso II do
pargrafo 4 e a Tabela X do pargrafo 5, ambos do art. 34 da
Resoluo do Conselho Nacional do Meio Ambiente, CONAMA n
357, de 2005. Dirio Oficial da Unio, 7 de abril de 2008, p. 68-69.

188

CARUCCI, A., CHIAVOLA, A., MAJONE, M., ROLLE, E. Treatment


of tannery wastewater in a sequencing batch reactor. Water Science &
Technology, 40 (1): 253-259, 1999.
CASSIDY, D.P., BELIA, E. Nitrogen and phosphorus removal from an
abattoir wastewater in a SBR with aerobic granular sludge. Water
Research, 39: 4817-4823, 2005.
CHEN, F., XIA, Q., JU, L.K. Aerobic denitrification of Pseudomonas
aeruginosa monitored by online NAD(P)H fluorescence. Applied and
Environmental Microbiology, 69 (11): 6715-6722, 2003.
CHEN, Y., JIANG, D., LI, J., LI, J, SUN, F., WANG, L., WANG, S.,
ZHANG, D., ZHANG, Q. Morphological and structural characteristics
of aerobic granulation, Journal of Chemical Technology and
Biotechnology, 81 (5): 823-830, 2006.
CHEN, Y., JIANG, W., LIANG, D.T., TAY, J.H. Aerobic granulation
under the combined hydraulic and loading selection pressures.
Bioresource Technology, 99: 7444-7449, 2008.
CHIUA, Y.C., LEE, L.L., CHANG, C.N., CHAO, A.C. Control of
carbon and ammonium ratio for simultaneous nitrification and
denitrification in a sequencing batch bioreactor. International
Biodeterioration & Biodegradation, 59: 1-7, 2007.
COLLIVIGNARELLI, C., BERTANZA, G. Simultaneous nitrification
denitrification processes in activated sludge plants: performance and
applicability. Water Science & Technology, 40 (4-5): 187-194, 1999.
COSTA, R.H.R., SOUTO, V.S., PRELHAZ, A.T.S., LAMEGO NETO,
L.G., WOLFF, D.B. Utilization of a hybrid sequencing batch reactor
(HSBR) as a decentralized system of domestic wastewater treatment.
Water Science & Technology, 57 (12): 1951-1956, 2008.
COSTA, T.B. Desempenho de reator em batelada seqencial (RBS)
com enchimento escalonado no tratamento de esgoto sanitrio
domstico. Dissertao (Mestrado em Engenharia Ambiental) Universidade Federal de Santa Catarina, Florianpolis - SC, 2005.

189

CUERVO-LPEZ, F., HERNANDEZ, S.M., TEXIER, A.C., GOMEZ,


J. Principles of denitrifying processes. In: CERVANTES (editor), F.J.
Environmental Technologies to Treat Nitrogen Pollution: Principles
and Engineering. London: IWA Publishing, 2009, 41-65.
DANGCONG, P., BERNET, N., DELGENES, J.P., MOLETTA, R.
Aerobic granular sludge a case report. Water Research, 33 (3): 890893, 1999.
DEGRMONT. Mmento technique de leau. 10.ed. 2005. 785 p.
DE KREUK, M.K. Aerobic granular sludge scaling up a new
technology. Ph.D. thesis, Delft University of Technology, Delft, The
Netherland, 2006.
DE KREUK, M.K., BRUIN, L.M.M. Aerobic granule reactor
technology. Water and Wastewater Practioner Series, STOWA Report.
London: IWA Publishing, 2004.
DE KREUK, M.K., HEIJNEN, J.J., VAN LOOSDRECHT, M.C.M.
Simultaneous COD, nitrogen, and phosphate removal by aerobic
granular sludge. Biotechnology & Bioengineering, 90 (6): 761-769,
2005a.
DE KREUK, M.K., MCSWAIN, B.S., BATHE, S., TAY, S.T.L.,
SCHWARZENBECK, N., WILDERER, P.A. Discussion outcomes. In:
Aerobic granular sludge. Water and Environmental Management
Series. London: IWA Publishing, 2005b, 155-169.
DE KREUK, M.K., VAN LOOSDRECHT, M.C.M. Formation of
aerobic granules with domestic sewage. Journal of Environmental
Engineering, 132(6): 694-697, 2006.
DERONZIER, G., SCHETRITE, S., RACAULT, Y., CANLER, J.P.,
LIENARD, A., HEDUIT, A., DUCHENE, P. Traitement de l'azote
dans les stations d'puration biologique des petites collectivits.
Ministre de l'Agriculture et de la pche Document technique,
FNDAE n 25. Paris: Cemagref, 2001. 79p.

190

DVH. Segundo Projecto Nereda na frica do Sul. Disponvel em:


http://www.dhv.pt/noticias/DHV-Mundo/detalhes/81/Segundo-ProjectoNereda-na-Africa-do-Sul. Acessado no dia 8 de fevereiro de 2011.
DI IACONI, C., RAMADORI, R., LOPEZ, A., PASSINO, R. Aerobic
granular sludge systems: the new generation of wastewater treatment
technologies. Ind. Eng. Chem. Res., 46: 6661-6665, 2007.
DOUTOR, J.R.C. Tecnologia NeredaTM aplicada ETAR de Frielas.
Dissertao (Mestrado em Engenharia do Ambiente) - Faculdade de
Cincias e Tecnologia da Universidade Nova de Lisboa, Lisboa Portugal, 2008.
DUBOIS, M., GILLES, K.A., HAMILTON, J.K., REBERS, P.A.,
SMITH, F. Colorimetric method for determination of sugars and related
substances. Annalical Chemestry, 28: 350-356, 1956.
DULEKGURGEN, E., ARTAN, N., ORHON, D., WILDERER, P.A.
How does shear affect aggregation in granular sludge sequencing batch
reactors? Relations between shear, hydrophobicity, and extracellular
polymeric substances. Water Science & Technology, 58 (2): 267-276,
2008.
ERASMUS, H. Clear as a nymph. Water Sewage & Effluent, 30 (2):
43-51, 2010
FERNANDES, F., SOUZA, S.G. Estabilizao de lodo de esgoto. In:
ANDREOLI, C.V (coord.). Resduos slidos do saneamento:
processamento, reciclagem e disposio final. Rio de Janeiro: RiMa,
ABES, 2001. p. 29-55.
FERREIRA, E.D.S., SOARES, S.R.A., BERNARDES, R.S. Uso da
respirometria para a caracterizao de esgotos domsticos: aplicao,
limites e apresentao de mtodo simplificado. In: Congresso
Interamericano de Engenharia Sanitria e Ambiental, 28, 2002, Cancun,
Mxico. Anais... ABES: Rio de Janeiro, 2002. CD-ROM.
FERREIRA, E.S. Cintica qumica e fundamentos dos processos de
nitrificao e desnitrificao biolgica. In: Congresso Interamericano de
Engenharia Sanitria e Ambiental, 27, 2000, Porto Alegre, RS. Anais...
ABES: Rio de Janeiro, 2000. CD-ROM.

191

FIGUEROA, L.A., SILVERSTEIN, J. The effect of particulate organic


matter on biofilm nitrification. Water Environment Research, 64 (5):
728-733, 1992.
FIGUEROA, M., MOSQUERA-CORRAL, A., CAMPOS, J.L.,
MENDEZ, R. Treatment of saline wastewater in SBR aerobic granular
reactors. Water Science & Technology, 58 (2): 479-485, 2008.
FIGUEROA, M., VAL DEL RIO, A., MORALES, N., CAMPOS, J.L.,
MOSQUERA-CORRAL, A., MENDEZ, R. Nitrogen removal in aerobic
granular systems. In: CERVANTES (editor), F.J. Environmental
Technologies to Treat Nitrogen Pollution: Principles and
Engineering. London: IWA Publishing, 2009, 373-401.
GADEMAN, G.E., GAYDON, P.N., DE BRUIN, B. Granular aerobic
activated sludge. In: Water Institute of Southern Africa (WISA)
Biennial Conference & Exhibition, Durban, 2010.
GINESTET, P., AUDIC, J.M., URBAIN, V., BLOCK, J.C. Estimation
of nitrifying bacterial activities by measuring oxygen uptake in the
presence of the metabolic inhibitor allylthiourea and azide. Applied and
Environmental Microbiology, 64 (6): 2266-2268, 1998.
GOMES, P.C.R., SOUZA, M.A.A. Remoo de nutrientes em reatores
seqenciais de batelada (RSB). In: Simpsio Luso-Brasileiro de
Engenharia Sanitria e Ambiental (SILUBESA), 8, 1998, Joo Pessoa,
PB. Anais... ABES: Rio de Janeiro, 1998. CD-ROM.
GRUNDITZ, C., DALHAMMAR, G. Development of nitrification
inhibition assays using pure cultures of nitrosomonas and nitrobacter.
Water Research, 3 (2): 433-440, 2001.
GUO, H., ZHOU, J., SU, J. ZHANG, Z. Integration of nitrification and
denitrification in airlift bioreactor. Biochemical Engineering Journal,
23: 57-62, 2005.
GUO, J., YANG, Q., PENG, Y., YANG, A., WANG, S. Biological
nitrogen removal with real-time control using step-feed SBR
technology. Enzyme and Microbial Technology, 40:1564-1569, 2007.

192

GUPTA, A.B. Thiosphaera pantotropha: a sulphur bacterium capable of


simultaneous heterotrophic nitrification and aerobic denitrification.
Enzyme and Microbial Technology, 21 (8): 589-595, 1997.
HAILEI, W., GUANGLI, Y., GUOSHENG, L., FENG, P. A new way to
cultivate aerobic granules in the process of papermaking wastewater
treatment. Biochemical Engineering Journal, 28: 99-103, 2006.
HE, S.B., XUE, G., WANG, B.Z. Factors affection simultaneous
nitrification and de-nitrification (SND) and its kinetics model in
membrana bioreactor. Journal of Hazardous Materials, 168: 704-710,
2009.
HEIN DE CAMPOS, R. Utilizao de reator de leito fluidizado
trifsico aerbio em sistema de tratamento combinado de guas
residurias. Dissertao (Mestrado em Engenharia Ambiental) Universidade Federal de Santa Catarina, Florianpolis - SC, 2001.
HEIN DE CAMPOS, R. Estudo da remoo de carbono e nitrognio
de efluentes urbanos em um reator de leito fluidizado operado em
bateladas seqenciais. Tese (Doutorado em Engenharia Ambiental) Universidade Federal de Santa Catarina, Florianpolis - SC, 2006.
HENZE, M., GRADY, C.L., GUJER, W., MARAIS, G.V.R.,
MATSUO, T. Activated sludge Model No 1. Scientific and Technical,
Report No. 1, London: IWA Publishing, 1987.
HUANG, H.K., TSENG, S.K. Nitrate reduction by Citrobacter diversus
under aerobic environment. Applied Microbiology and Biotechnology,
55: 90-94, 2001.
HUBNER, A.P. Reator aerbico de biogrnulos e lagoa de aguap
como biotecnologia para o tratamento de guas residuais da
suinocultura. Tese (Doutorado em Cincias do Solo) - Universidade
Federal de Santa Maria, Santa Maria - RS, 2008.
HULSHOFF POL, L.W., DE CASTRO LOPES, S.I., LETTINGA, G.,
LENS, P.N.L. Anaerobic sludge granulation. Water Research, 38 (6):
1376-1389, 2004.

193

INIZAN, M., FREJAL, A., CIGANA, J., MEINHOLD, J. Aerobic


granulation in a sequencing batch reactor (SBR) for industrial
wastewater treatment. Water Science & Technology, 52 (10-11): 335343, 2005.
JEYANAYAGAM, S. True Confessions of the Biological Nutrient
Removal Process. Florida Water Resources Journal: January 2005.
JI, M., WEI, Y., LU, S., WANG, F., CHENG, L. Characteristics and
stability of aerobic granules treating domestic sewage. In: 3rd
International Conference on Bioinformatics and Biomedical
Engineering (ICBBE), 1-5, 2009.
JOO, H.S., HIRAI, M., SHODA, M. Characteristics of ammonium
removal by heterotrophic nitrification-aerobic denitrificationby
Alcaligenes faecalis No. 4. Journal of Bioscience and Bioengineering,
100 (2): 184-191, 2005.
JORDO, E.P., PESSA, C.A. Tratamento de esgotos domsticos.
4.ed. Rio de Janeiro: ABES, 2005. 932 p.
JU, L.K., HUANG, L., TRIVEDI, H. Simultaneous nitrification,
denitrification, and phosphorus removal in single-tank low-dissolvedoxygen systems under cyclic aeration. Water Environment Research,
79 (8): 912-920, 2007.
JUNGLES, M.K. Tratamento de esgoto sanitrio em reator operado
em bateladas seqenciais com grnulos aerbios: remoo de
nutriente (N, P), desenvolvimento e caracterizao dos grnulos.
Tese (Doutorado em Engenharia Ambiental) - Universidade Federal de
Santa Catarina, Florianpolis - SC, em andamento.
JUNGLES, M.K., COSTA, R.H.R., CAMPOS, J.L., MOSQUERACORRAL, A., VAL, A. Tratamento de esgoto sanitrio em reator
operado em bateladas seqenciais com grnulos aerbios (RBSG). In:
Congresso Interamericano de Engenharia Sanitria e Ambiental, 32,
2010, Punta Cana, Republica Dominicana. Anais... 2010.
JUNGLES, M.K., FIGUEROA, M., MORALES, N., VAL DEL RO,
A., COSTA, R.H.R., CAMPOS, J.L., MOSQUERA-CORRAL, A.,
MNDEZ, R. Start up of a pilot scale aerobic granular reactor for

194

organic matter and nitrogen removal. Journal of Chemical Technology


& Biotechnology (aprovado para publicao), 2011.
KATSOGIANNIS, A.N., KORNAROS, M., LYBERATOS, G.
Enhanced nitrogen removal in SBRs by passing nitrate generation
accomplished by multiple aerobic/anoxic phase pairs. Water Science &
Technology, 47 (11): 53-59, 2002.
KIM, D.J., SEO, D. Selective enrichment and granulation of ammonia
oxidizers in a sequencing batch airlift reactor. Process Biochemistry,
41: 1055-1062, 2006.
KIM, I.S., KIM, S.M., JANG, A. Characterization of aerobic granules
by microbial density at different COD loading rates. Bioresource
Technology, 99: 1825, 2008a.
KIM, M., JEONG, S.Y., YOON, S.J., CHO, S.J., KIM, Y.H., KIM,
M.J., RYU, E.Y., LEE, S.J. Aerobic Denitrification of Pseudomonas
putida AD-21 at Different C/N Ratios. Journal of Bioscience and
Bioengineering, 106 (5): 498-502, 2008b.
KIM, S.M., KIM, S.H., CHOI, H.C., KIM, I.S. Enhanced aerobic floclike granulation and nitrogen removal in a sequencing batch reactor by
selection of settling velocity. Water Science & Technology, 50: 15762, 2004.
KISHIDA, N., TSUNEDA, S., KIM, J.H., SUDO, R. Simultaneous
nitrogen and phosphorus removal from high-strength industrial
wastewater using aerobic granular sludge. Environmental
Engineering, 135 (3): 153-158, 2009.
KONG, Y., LIU, Y.Q., TAY, J.H., WONG, F.S., ZHU, J. Aerobic
granulation in sequencing batch reactors with different reactor
height/diameter ratios. Enzyme and Microbial Technology, 45: 379383, 2009.
LALUCAT, J., BENNASAR, A., BOSCH, R., GARCIA-VALDS, E.,
PALLERONI, N.J. Biology of Pseudomonas stutzeri. Microbiology
and Molecular Biology Reviews, 70 (2): 510-547, 2006.

195

LAMEGO NETO, L.G. Tratamento de esgoto urbano em reator


hbrido operado em bateladas seqenciais (RHBS) submetido a
variaes de cargas. Dissertao (Mestrado em Engenharia Ambiental)
- Universidade Federal de Santa Catarina, Florianpolis - SC, 2008.
LEE, D.J., CHEN, Y.Y., SHOW, K.Y., WHITELEY, C.G., TAY, J.H.
Advances in aerobic granule formation and granule stability in the
course of storage and reactor operation. Biotechnology Advances, 28:
919-934, 2010.
LI, A.J., YANG, S.F., LI, X.Y. Microbial population dynamics during
aerobic sludge granulation at different organic loading rates. Water
Research, 42: 3552-3560, 2008a.
LI, X.M., YANG, G.J., ZENG, G.M., LIAO, D.X., HU, M.F., WU,
Y.M. Simultaneous phosphorus and nitrogen removal by aerobic
granular sludge in single SBR system. In: Aerobic Granular Sludge.
Water and Environmental Management Series. London: IWA
Publishing, 2005, 71-78.
LI, Z., ZHANG, T., LI, N., WANG, X. Granulation of filamentous
microorganisms in a sequencing batch reactor with saline wastewater.
Journal of Environmental Sciences, 22 (1): 62-67, 2010.
LI, Z.H., KUBA, T., KUSUDA, T., WANG, X.C. A comparative study
on aerobic granular sludge and effluent suspended solids in a sequencing
batch reactor. Environmental Engineering Science, 25 (4): 577-584,
2008b.
LIN, Y.M., LIU, Y.Q., TAY, J.H. Development and characteristics of
phosphorus-accumulating microbial granules in sequencing batch
reactors. Applied Microbiology and Biotechnology, 62: 430-435,
2003.
LIU, Q.S., LIU, Y. Aerobic granulation at different carbon sources and
concentrations. In: LIU, Y (editor). Wastewater purification: aerobic
granulation in sequencing batch reactors. Boca Raton: CRC Press,
2008, 1-23.

196

LIU, Q.S., LIU, Y. Aerobic granulation at different shear forces. In:


LIU, Y (editor). Wastewater purification: aerobic granulation in
sequencing batch reactors. Boca Raton: CRC Press, 2008, 25-36.
LIU, Q.S., TAY, J.H., LIU, Y. Substrate concentrarion-independent
aerobic granulation in sequential aerobic sludge blanket reator.
Environmental Technology, 24: 1235-1242, 2003a.
LIU, Y., LIU, Q.S. Causes and control of filamentous growth in aerobic
granular sludge sequencing batch reactors. Biotechnology Advances,
24: 115-127, 2006.
LIU, Y., SHI, H., XIA, L., SHI, H., SHEN, T., WANGA, Z., WANG,
G., WANG, Y. Study of operational conditions of simultaneous
nitrification and denitrification in a Carrousel oxidation ditch for
domestic wastewater treatment. Bioresource Technology, 101: 901906, 2010a.
LIU, Y., TAY, J.H. The essential role of hydrodynamic shear force in
the formation of biofilm and granular sludge. Water Research 36:16531665, 2002.
LIU, Y., WANG, Z.W. Selection pressure theory for aerobic granulation
in sequencing batch reactors. In: LIU, Y (editor). Wastewater
purification: aerobic granulation in sequencing batch reactors. Boca
Raton: CRC Press, 2008, 285-110.
LIU, Y., WANG, Z.W., QIN, L., LIU, Y.Q., TAY, J.H. Selection
pressure-driven aerobic granulation in a sequencing batch reactor.
Applied Microbiology and Biotechnology, 67: 26-32, 2005a.
LIU, Y.Q., LIU, Y., TAY, J.H. Relationship between size and mass
transfer resistance in aerobic granules. Letters in Applied
Microbiology, 40: 312-315, 2005b.
LIU, Y.Q., MOY, B., KONG, Y., TAY, J.H. Formation, physical
characteristics and microbial community structure of aerobic granules in
a pilot-scale sequencing batch reactor for real wastewater treatment.
Enzyme and Microbial Technology, 46 (6): 520-525, 2010b.

197

LIU, Y.Q, MOY, B.Y.P., TAY J.H. COD removal and nitrification of
low-strength domestic wastewater in aerobic granular sludge sequencing
batch reactors. Enzyme and Microbial Technology, 42: 23-28, 2007a.
LIU, Y.Q., TAY, J.H. State of the art of biogranulation technology for
wastewater treatment. Biotechnology Advances, 22: 533-563, 2004.
LIU, Y.Q., TAY, J.H. Variable aeration in sequencing batch reactor
with aerobic granular sludge. Journal of Biotechnology, 124: 338-346,
2006.
LIU, Y.Q, TAY, J.H. Influence of cycle time on kinetic behaviors of
steady-state aerobic granules in sequencing batch reactors. Enzyme and
Microbial Technology, 41: 516-522, 2007b.
LIU, Y.Q., WU, W.W., TAY, J.H., WANG, J.L. Starvation is not a
prerequisite for the formation of aerobic granules. Applied
Microbiology and Biotechnology, 76: 211-216, 2007c.
LIU, Y.Q., WU, W.W., TAY, J.H., WANG, J.L. Formation and longterm stability of nitrifying granules in a sequencing batch reactor.
Bioresource Technology, 99: 3919-3922, 2008.
LIU, Y.Q, XU, H.L., YANG, S.F., TAY, J.H. The mechanisms and
models for anaerobic granulation in upflow anaerobic sludge blanket
reactor. Water Research, 37: 611-673, 2003b.
LETTINGA, G., VAN VELSEN, A.F.M., HOBME, S.W., DE ZEEUW,
W., KLAPWIJK, A. Use of the upflow sludge blanket (USB) reactor
concept for biological waste water treatment especially for anaerobic
treatment. Biotechnology Bioengineering, 22: 699-734, 1980.
LPEZ-PALAU, S., DOSTA, J., MATA-LVAREZ, J. Start-up of an
aerobic granular sequencing batch reactor for the treatment of winery
wastewater. Water Science & Technology, 60 (4): 1049-1054, 2009.
MA, T., ZHAO, C., PENG, Y. LIU, X., ZHOU, L. Applying real-time
control for realization and stabilization of shortcut nitrificationdenitrification in domestic water treatment. Water Science &
Technology, 59 (4): 787-796, 2009.

198

MAHVI, A.H. Sequencing bacth reactor: a promising technology in


wastewater treatment. Iran. J. Environ. Health. Sci. Eng., 5 (2): 79-90,
2008.
MARSILI-LIBELLI, S., TABANI, F. Accuracy analysis of a
respirometer for activated sludge dynamic modelling. Water Research,
36: 1181-1192, 2002.
MARTINS, C.L. Comportamento de reator de leito fluidizado
trifsico aerbico utilizando diferentes materiais suporte.
Dissertao (Mestrado em Engenharia Ambiental) - Universidade
Federal de Santa Catarina, Florianpolis - SC, 2003.
MCSWAIN, B.S., IRVINE, R.L. Dissolved oxygen as a key parameter
to aerobic granule formation. Water Science & Technology, 58 (4):
781-787, 2008.
MCSWAIN, B.S., IRVINE, R.L., WILDERER, P.A. The influence of
settling time on the formation of aerobic granules. Water Science &
Technology, 50: 195-202, 2004.
METCALF & EDDY. Wastewater engineering: treatment and reuse.
4.ed. New York: McGraw-Hill, 2003. 1819 p.
MISHIMA, K., NAKAMURA, M. Self-immobilization of aerobic
activated sludge - a pilot study of the aerobic upow sludge blanket
process inmunicipal sewage treatment. Water Science & Technology,
23: 981990, 1991.
MOBARRY, B.K., WAGNER, M., URBAIN, V., RITTMANN, B.E.,
STAHL, D.A. Phylogenetic probes for analyzing abundance and spatial
organization of nitrifying bacteria. Applied and Environmental
Microbiology, 62 (6): 2156-2162, 1996.
MORGENROTH, E., SHERDEN, T., VAN LOOSDRECHT, M.C.M.,
HEIJNEN, J.J., WILDERER, P.A. Aerobic granular sludge in a
sequencing batch reactor. Water Research, 31: 3191-3194, 1997.
MORITA, M., UEMOTO, H., WATANABE, A. Nitrogen-removal
bioreactor capable of simultaneous nitrification and denitrification for

199

application to industrial wastewater


Engineering Journal, 41: 59-66, 2008.

treatment.

Biochemical

MOSQUERA-CORRAL, A., DE KREUK, M.K., HEIJNEN, J.J, VAN


LOOSDRECHT, M.C.M. Effects of oxygen concentration on Nremoval in an aerobic granular sludge reactor. Water Research, 39:
2676-2686, 2005a
MOSQUERA-CORRAL, A., VSQUEZ-PADN, J.R., ARROJO, B.,
CAMPOS, J.L., MNDEZ, R. Nitrifying granular sludge in a
Sequencing Batch Reactor. In: Aerobic Granular Sludge. Water and
Environmental Management Series. London: IWA Publishing, 2005b,
63-70.
MOTA, F.S.B., VON SPERLING, M. Nutrientes de esgoto sanitrios:
utilizao e remoo. Rio de Janeiro: ABES, 2009. 425p.
MOTA, S. Introduo engenharia ambiental. 4ed. Rio de Janeiro:
ABES, 2006. 388p.
MOY, B.Y.P., TAY, J.H., TOH, S.K., LIU, Y., TAY, S.T.L. High
organic loading influences the physical characteristics of aerobic sludge
granules. Letter Applied Microbiology, 34: 407-412, 2002.
MUDA, K., ARIS, A., SALIM, M.R., IBRAHIM, Z., YAHYA, A.,
VAN LOOSDRECHT, M.C.M., AHMAD, A., NAWAHWI, M.Z.
Development of granular sludge for textile wastewater treatment. Water
Research, 44: 4341-4350, 2010.
MUNCH, E.V., LANT, P., KELLER, J. Simultaneous nitrification and
denitrification in bench-scale sequencing batch reactors. Water
Research, 30 (2): 277-284, 1996.
NEIWPCC - New England interstate water pollution control
commission. Sequencing batch reactor design and operational
considerations. September 2005.
NI, B., XIE, W., LIU, S., YU, H., WANG, Y., WANG, G., DAI, X.
Granulation of activated sludge in a pilot-scale sequencing batch reactor
for the treatment of low-strength municipal wastewater. Water
Research, 43: 751-761, 2009.

200

NI, B.J., YU, H.Q., SUN, Y.J. Modeling simultaneous autotrophic and
heterotrophic growth in aerobic granules. Water Research, 42: 15831594, 2008.
NING, Z., PATRY, G.G., SPANJERS, H. Identification and
quantification of nitrogen nutrient deficiency in the activated sludge
process using respirometry. Water Research, 34 (13): 3345-3354,
2000.
OCHOA, J.C., COLPRIM, J., PALACIOS, B., PAUL, E.,
CHATELLIER, P. Active heterotrophic and autotrophic biomass
distribution between fixed and suspended systems in a hybrid biological
reactor. Water Science & Technology, 46 (1-2): 397-404, 2002.
PATUREAU, D., BERNET, N., BOUCHEZ, T., DABERT, P.,
DELGENES, J.P., MOLETTA, R. Biological nitrogen removal in a
single aerobic reactor by association of a nitrifying ecosystem to an
aerobic denitrifier, Microirgula aerodenitrificans. Journal of
Molecular Catalysis B: Enzymatic, 5: 435-439, 1998.
PATUREAU, D., BERNET, N., MOLETTA, R. Combined nitrification
and denitrification in a single aerated reactor using the aerobic
denitrifier Comamonas sp. strain SGLY2. Water Research, 31 (6):
1363-1370, 1997.
PAUL, E., WOLFF, D.B., OCHOA, J.C., COSTA, R.H.R. Recycled and
virgin plastic carriers in hybrid reactor for wastewater treatment. Water
Environment Research, 79 (7): 765-774, 2007.
PLATTES, M., FIORELLI, D., GILL, S., GIRARD, C., HENRY, E.,
MINETTE, F., ONAGY, O., SCHOSSELER, P.M. Modeling and
dynamic simulation of a moving bed bioreactor using respirometry for
the estimation of kinetic parameters. Biochemical Engineering
Journal, 33: 253-259, 2007.
PIVELI, R.P., KATO, M.T. Qualidade das guas e poluio: aspectos
fsico-qumicos. So Pauto: ABES, 2006. 285p.

201

POCHANA K., KELLER J. Study of factors affecting simultaneous


nitrification and denitrification (SND). Water Science & Technology.
39 (6): 61-68, 1999.
POLLARD, P.C. A quantitative measure of nitrifying bacterial growth.
Water Research, 40: 1569-1576, 2006.
POLPRASERT C., SAWAITTAYOTHIN, V. Nitrogen mass balance
and microbial analysis of constructed wetlands treating municipal
landfill leachate. Water Science & Technology, 54 (11-12):147-54,
2006.
PRODES - ANA. Programa Despoluio de Bacias Hidrogrficas da
Agncia
Nacional
de
guas.
Disponvel
em:
<http://www.ana.gov.br/prodes/default.asp>. Acessado no dia 17 de
fevereiro de 2010.
PUJOL, S.B. Biogrnulos aerbicos em reator seqencial em
batelada para o tratamento de efluente de biodigestor proveniente
da suinocultura. Dissertao (Mestrado em Cincias do Solo) Universidade Federal de Santa Maria, Santa Maria - RS, 2008.
QIN, L., LIU, Y. Aerobic granulation at different settling times.
Wastewater purification: aerobic granulation in sequencing batch
reactors. Boca Raton: CRC Press, 2008, 51-67.
RAHIMI, Y., TORABIAN, A., MEHRDADI, N., SHAHMORADI, B.
Simultaneous nitrificationdenitrification and phosphorus removal in a
fixed bed sequencing batch reactor (FBSBR). Journal of Hazardous
Materials, 185 (2-3): 852-857, 2011.
RITTMANN, B.E., MCCARTY, P.L. Environmental Biotechnology:
principles and aplications. McGraw Hill, 2001.
ROBERTSON, L.A., CONELISSE, R., DE VOS, P., HADIOETOMO,
R., KUENEN, J.G. Aerobic denitrification in various heterotrophic
nitrifiers. Antonie van Leeuwenhoek, 56: 289-299, 1989.
ROBERTSON, L.A., VAN NIEL, E.W.J., TORREMANS, R.A.M.,
KUENEN, J.G. Simultaneous nitrification and denitrification in aerobic

202

chemostat cultures of Thiosphaera pantotropha. Applied and


Environmental Microbiology, 54 (11): 2812-2818, 1988.
ROS, M. Respirometry of activated sludge. Technomic Publishing
Company, Lancaster, Pennsylvania. 1993.
RUAN, W., HUA, Z., CHEN, J. Simultaneous nitrification and
denitrification in an aerobic reactor with granular sludge originating
from an upflow anaerobic sludge bed reactor. Water Environment
Research, 78 (8): 792-796, 2006.
SALES, R. Cintica de degradao de efluente txtil por biofilme em
leito fluidizado trifsico aerbio. Dissertao (Mestrado em
Engenharia Ambiental) - Universidade Federal de Santa Catarina,
Florianpolis - SC, 1999.
SANTA CATARINA. Lei n 14.675, de 13 de abril de 2009. Institui o
Cdigo Estadual do Meio Ambiente e estabelece outras providncias.
SANTANNA JR., G.L. Tratamento biolgico de efluentes:
fundamentos e aplicaes. Rio de Janeiro: Intercincia, 2010. 398 p.
SANTOS, A.V., CYBIS, L.F.A., GEHLING, G.R. Determinao do
tempo necessrio para oxidao da matria orgnica facilmente
biodegradvel em reator seqencial em batelada (RSB) com enchimento
esttico. Engenharia Sanitria e Ambiental, 11 (1): 83-91, 2006a.
SANTOS, R.C.O., BARBOSA FILHO, O., GIORDANO, G. Proposta
de um mtodo racional para o dimensionamento de reatores de
tratamento de esgotos por lodos ativados em bateladas para remoo de
carga orgnica. Engenharia Sanitria e Ambiental, 11 (2): 153-161,
2006b.
SCHMIDELL, W. Agitao e aerao em biorreatores. In:
AQUARONE, E., BORZANI, W., SCHMIDELL, W. Biotecnologia
Industrial, v.2, 1.ed. So Paulo: Edgard Blcher Ltda, 2001. p. 277331.
SCHWARZENBECK, N., BORGES, J.M., WILDERER, P.A.
Treatment of dairy effluents in an aerobic granular sludge sequencing
batch reactor. Appl. Microbiol. Biotechnol., 66: 711-718, 2005.

203

SCHWARZENBECK, N., ERLEY, R., WILDERER, P.A. Aerobic


granular sludge in an SBR-sytem treating wastewater rich in particulate
matter. Water Science & Technology, 49 (11-12): 41-46, 2004.
SEN, P., DENTEL, S.K. Simultaneous nitrification-denitrification in a
fluidized bed reactor. Water Science & Technology, 38 (1): 247-254,
1998.
SHE, Z., ZHENG, X., YANG, B., JIN, C., GAO, M. Granule
development and performance in sucrose fed anaerobic baffled reactors.
Journal of Biotechnology, 122 (2): 198-208, 2006.
SHI, X.Y., SHENG, G.P., LI, X.Y., YU, H.Q. Operation of a
sequencing batch reactor for cultivating autotrophic nitrifying granules.
Bioresource Technology, 101: 2960-2964, 2010.
SINGH, M., SRIVASTAVA, R.K. Sequencing batch reactor technology
for biological wastewater treatment: a review. Asia-Pacific Journal of
Chemical Engineering, 2010.
SOUTO, V.S. Utilizao de reatores hbridos de fluxo contnuo e em
bateladas seqenciais para remoo conjunta de carbono e
nitrognio de esgoto urbano. Dissertao (Mestrado em Engenharia
Ambiental) - Universidade Federal de Santa Catarina, Florianpolis SC, 2007.
SPANJERS, H., VANROLLEGHEM, P., OLSSON, G., DOLD, P.
Respirometry in control of activated sludge process: principles.
Scientific and Technical, Report No. 7. London: IWA Publishing,
1998.
SPERANDIO,
M.
Developement
dune
procedure
de
compartimentation dune eau residuaire urbaine et aplication a la
modelisation dynamique de procedes a boues actives. These
doctorat, INSA-Toulouse, France, 1998, 231 p.
SPONZA, D.T. Anaerobic granule formation and tetrachloroethylene
(TCE) removal in an upflow anaerobic sludge blanket (UASB) reactor.
Enzyme and Microbial Technology, 29 (6-7): 417-427, 2004.

204

STAHL, D.A., AMANN, R. Development and aplication of nucleic and


probes. In: STACKEBRANDT, E., GOODFELLOW, M (ed.). Nucleic
acid techniques in bacterial systematic, vol 8, London: Jojn Wiley &
Sons, Ltd., 1991, p. 207-248
SUN, F.Y., YANG, C.Y., LI, J.Y., YANG, Y.J. Influence of different
substrates on the formation and characteristics of aerobic granules in
sequencing batch reactors. Journal of Environmental Sciences, 18 (5):
864-871, 2006.
SURAMPALLI, R.Y., TYAGI, R.D., SCHEIBLE, O.K., HEIDMAN,
J.A. Nitrification, denitrification and phosphorus removal in sequential
batch reactors. Bioresource Technology, 34: 151-157, 1997.
SURMACZ-GORSKA, J., GERNAEY, K., DEMUYNCK, C.,
VANROLLEGHEM, P., VERSTRAETE, W. Nitrification monitoring in
activated sludge by oxygen uptake rate (OUR) measurements. Water
Research, 30 (5): 1228-1236, 1996.
TAY, J.H., LIU, Q.S., LIU, Y. Microscopic observation of aerobic
granulation in sequential aerobic sludge blanket reactor. Journal of
Applied Microbiology, 91: 168-175, 2001a.
TAY, J.H., LIU, Q.S., LIU, Y. The effects of shear force on the
formation, structure and metabolism of aerobic granules. Applied
Microbiology and Biotechnology, 57: 227-233, 2001b.
TAY, J.H., LIU, Q.S., LIU, Y. The role of cellular polysaccharides in
the formation and stability of aerobic granules. Letters in Applied
Microbiology, 33: 222-226, 2001c.
TAY, J.H., LIU, Q.S., LIU, Y. The effect of upflow air velocity on the
structure of aerobic granules cultivated in a sequencing batch reactor.
Water Science & Technology, 49: 35-40, 2004a.
TAY, J.H., LIU, Q.S., LIU, Y., SHOW, K.Y., IVANOV, V., TAY,
S.T.L. A comparative study of aerobic granulation in pilot and
laboratory-scale SBRs. In: Aerobic granular sludge. London: IWA
Publishing, 2005, 125-133.

205

TAY, J.H., PAN, S., HE, Y., TAY, S.T.L. Effect of organic loading rate
on aerobic granulation. I: reactor performance. Journal of
Environmental Engineering, 130 (10): 1094-1101, 2004b.
TAY, J.H., PAN, S., HE, Y., TAY, S.T.L. Effect of organic loading rate
on aerobic granulation. II: characteristics of aerobic granules. Journal
of Environmental Engineering, 130 (10): 1102-1109, 2004c.
TAY, J.H., YAN, Y.G. Influence of substrate concentration on
microbial selection and granulation during start-up of upflow anaerobic
sludge blanket reactor. Water Environment Research, 68 (7): 11401150, 1996.
TAY, J.H., YANG, S.F., LIU, Y. Hydraulic selection pressure-induced
nitrifying granulation in sequencing batch reactors. Applied
Microbiology Biotechnology, 59: 332337, 2002.
TAYLOR, S.M., HE, Y., ZHAO, B., HUANG, J. Heterotrophic
ammonium removal characteristics of an aerobic heterotrophic
nitrifying-denitrifying bacterium, Providencia rettgeri YL. Journal of
Environmental Sciences, 21 (10): 1336-1341, 2009.
THANH, B.X., VISVANATHAN, C., AIM, R.B. Characterization of
aerobic granular sludge at various organic loading rates. Process
Biochemistry, 44: 242-245, 2009.
THANS, F.C. Controle operacional de reator em bateladas
seqenciais (RBS): ajustes na concentrao de oxignio dissolvido
visando remoo de nutriente. Dissertao (Mestrado em
Engenharia Ambiental) - Universidade Federal de Santa Catarina,
Florianpolis - SC, 2008.
THANS, F.C., COSTA, R.H.R., HOFFMANN, H., PLATZER, C.
Controle operacional de reator em bateladas seqenciais (RBS): ajustes
na concentrao de oxignio dissolvido visando a remoo de nutrientes.
In: Congresso Brasileiro de Engenharia Sanitria e Ambiental, 25, 2009,
Recife - PE. Anais... ABES: Rio de Janeiro, 2009. CD-ROM.
TURK, O., MAVINIC, D.S. Benefits of using selective-inhibition to
remove nitrogen from highly nitrogenous wastes. Environ. Technol.
Lett., 8 (9): 419-426, 1987.

206

USEPA. United States Environmental Protection Agency. Manual


Nitrogen Control. EPA/625/R-93/010, 1993.
USEPA. United States Environmental Protection Agency. Nutrient
control design manual. EPA/600/R-10/100, 2010.
USEPA. United States Environmental Protection Agency. Nutrient
control design manual: state of technology review report.
EPA/600/R-09/012, 2009.
USEPA. United States Environmental Protection Agency. Sequencing
batch reactors for nitrification and nutrient removal. EPA/832/R-92003, 1992.
USEPA. United States Environmental Protection Agency. Wastewater
technology fact sheet: ammonia stripping. EPA 832-F-00-019, 2000.
USEPA. United States Environmental Protection Agency. Wastewater
technology fact sheet: sequencing batch reactors. EPA/932/F-99/073,
1999.
VAN HAANDEL, A.C., CATUNDA, P.F.C. Determinao da taxa de
consumo de oxignio em sistemas de tratamento de esgoto. Revista
Engenharia Sanitria. 21 (4): 481-488, 1982.
VAN HAANDEL, A.C., KATO, M., VON SPERLING, M. Remoo
biolgica de nitrognio: aplicaes para o sistema de lodo ativado. In:
MOTA, F.S.B., VON SPERLING, M. Nutrientes de esgoto sanitrios:
utilizao e remoo. Rio de Janeiro: ABES, 2009. 174-226.
VAN HAANDEL, A.C., MARAIS, G.O. O comportamento do
sistema de lodo ativado teoria e aplicao para projeto e operao.
Campina Grande: Epgraf, 1999. 472 p.
VAN LOOSDRECHT, M.C.M, JETTEN, M.S.M. Microbiological
conversions in nitrogen removal. Water Science & Technology, 38 (1):
1-7, 1998.
VANROLLEGHEM, P.A., SPANJERS, H., PETERSEN, B.,
GINESTET, P., TAKCS, I. Estimating (combinations of) activated

207

sludge model n1 parameters and components by respirometry. Water


Science and Technology. 39 (1): 195-214, 1999.
VZQUEZ-PADN, J.R., MOSQUERA-CORRAL, A., CAMPOS, J.L.,
MNDEZ, R., CARRERA, J., PREZ, J. Modelling aerobic granular
SBR at variable COD/N ratios including accurate description of total
solids concentration. Biochemical Engineering Journal, 49: 173-184,
2010.
VERSTRAETE, W., ALEXANDER, M. Heterotrophic nitrification by
Arthrobacter sp. Journal of Bacteriology, 110 (3): 955-961, 1972.
VIJAYALAYAN, P. Investigation on simultaneous nitrification
denitrification and fouling of an aerobic granular membrane airlift
bioreactor. Master thesis, Asian Institute of Technology, Thailand,
2008.
VOGEL. Anlise qumica quantitativa. 6.ed. Rio de Janeiro: LTC,
2002. 488 p.
VON SPERLING, M. Introduo qualidade das guas e ao
tratamento de esgotos Princpios do tratamento biolgico de guas
residurias, v.1. 3.ed. Belo Horizonte: Departamento de Engenharia
Sanitria e Ambiental; Universidade de Minas Gerais, 2005. 452 p.
VON SPERLING, M. Lodos Ativados Princpios do tratamento
biolgico de guas residurias, v.4. 2.ed. Belo Horizonte:
Departamento de Engenharia Sanitria e Ambiental; Universidade de
Minas Gerais, 2002. 428 p.
VON SPERLING, M. Princpios Bsicos de Tratamento de Esgotos
Princpios do tratamento biolgico de guas residurias, v.2. Belo
Horizonte: Departamento de Engenharia Sanitria e Ambiental;
Universidade de Minas Gerais, 1996. 211 p.
WAGNER, M., RATH, G., KOOPS, H.P., FLOOD, J., AMANN, R. In
situ analysis of nitrifying bacteria in sewage treatment plants. Water
Science & Technology, 34: 237-244, 1996.
WALTERS, E., HILLE, A., HE, M., OCHMANN, C., HORN, H.
Simultaneous nitrification/denitrification in a biofilm airlift suspension

208

(BAS) reactor with biodegradable carrier material. Water Research, 43:


4461-4468, 2009.
WAN, J., SPERANDIO, M. Possible role of denitrification on aerobic
granular sludge formation in sequencing batch reactor. Chemosphere,
75: 220-227, 2009.
WANG, B., HE, S., WANG, L., SHUO, L. Simultaneous nitrification
and de-nitrification in MBR. Water Science & Technology, 52 (10):
435-442, 2005a.
WANG, F., YANG, F.L., ZHANG, X.W., LIU, Y.H., ZHANG, H.M.,
ZHOU, J. Effects of cycle time on properties of aerobic granules in
sequencing batch airlift reactor. World Journal of Microbiology &
Biotechnology, 21: 1379-1384, 2005b.
WANG, F., LIU, Y.H., YANG, F.L., ZHANG, X.W., ZHANG, H.M.
Study on the stability of aerobic granules in SBAR-effect of superficial
upflow air velocity and carbon source. In: IWA Workshop on Aerobic
Granular Sludge, 1, Munich, Germany, 2004.
WANG, F., LU, S., WEI, Y., JI, M. Characteristics of aerobic granule
and nitrogen and phosphorus removal in a SBR. Journal of Hazardous
Materials, 164: 1223-1227, 2009.
WANG, J., PENG, Y., WANG, S., GAO, Y. Nitrogen removal by
simultaneous nitrification and denitrification via nitrite in a sequence
hybrid biological reactor. Chinese Journal of Chemical Engineering,
16 (5): 778-784, 2008.
WANG, S.G., LIU, X.W., GONG, W.X., GAO, B.Y., ZHANG, D.H.,
YU, H.Q. Aerobic granulation with brewery wastewater in a sequencing
batch reactor. Bioresource Technology, 98: 2142-2147, 2007.
WANG, Z.W., LIU, Y. Aerobic granulation at different SBR cycle
times. In: LIU, Y (editor). Wastewater purification: aerobic
granulation in sequencing batch reactors. Boca Raton: CRC Press,
2008, 37-67.

209

WANG, Z.W., LIU, Y., TAY, J.H. The role of SBR mixed liquor
volume exchange ratio in aerobic granulation. Chemosphere, 62: 761771, 2006.
WEHRFRITZ, J.M., REILLY, A., SPIRO, S., RICHARDSON, D.J.
Purification of hydroxylamine oxidase from Thiosphaera pantotropha:
Identification of electron acceptors that couple heterotrophic
nitrification to aerobic denitrification. FEBS Letters, 335 (2): 246-250,
1993.
WENJIE, Z., DUNQIU, W., YASUNORI, K., TAICHI, Y., LI, Z.,
KENJI, F. PVA-gel beads enhance granule formation in a UASB
reactor. Bioresource Technology, 99 (17): 8400-8405, 2008.
WICHERN, M., LBKEN, M., HORN, H. Optimizing sequencing
batch reactor (SBR) reactor operation for treatment of dairy wastewater
with aerobic granular sludge. Water Science & Technology, 58
(6):1199-206, 2008.
WILDERER, P.A.; IRVINE, R.L.; GORONSZY, M.C. Sequencing
batch reactor technology. Scientific and Technical, Report No. 10,
London: IWA Publishing, 1997.
WOLFF, D.B. Estudo da tratabilidade de um efluente txtil por
biomassa fixa atravs de um reator de leito fluidizado trifsico
aerbio. Dissertao (Mestrado em Engenharia Ambiental) Universidade Federal de Santa Catarina, Florianpolis - SC, 1997.
WOLFF, D.B. Remoo biolgica de carbono e nitrognio de esgoto
urbano em reatores hbridos utilizando dois materiais suporte
flotantes. Tese (Doutorado em Engenharia Ambiental) - Universidade
Federal de Santa Catarina, Florianpolis - SC, 2005.
WOLFF, D.B., CHAVEZ, J.C.O., PAUL, E., COSTA, R.H.R. Estudo da
biomassa heterotrfica e autotrfica ativa desenvolvida em reatores
hbridos no tratamento de esgoto urbano. In: SINAFERM2003
Simpsio Nacional de Fermentaes, 14. Florianpolis-SC, 2003.
WOLFF, D.B., OCHOA, J.C., COSTA, R.H.R. Repartio da biomassa
ativa desenvolvida em reatores hbridos no tratamento de esgoto

210

sanitrio por respirometria. Revista de Cincia & Tecnologia, 14


(27/28): 57-65, 2006.
WU, C.Y., PENG, Y.Z., WANG, S.Y., MA, Y. Enhanced biological
phosphorus removal by granular sludge: From macro- to micro-scale.
Water Research, 44: 807-814, 2010.
XAVIER, J.B., DE KREUK, M.K., PICIOREANU, C., VAN
LOOSDRECHT, M.C.M. Multi-scale individual-based model of
microbial and bioconversion dynamics in aerobic granular sludge.
Environmental Science & Technology, 41: 6410-6417, 2007.
YANG, S.F., LIU, Q.S., TAY, J.H., LIU, Y. Growth kinetics of aerobic
granules developed in sequencing batch reactors. Letters in Applied
Microbiology, 38: 106-112, 2004.
YE, F.X., SHEN, D.S., FENG, X.S. Anaerobic granule development for
removal of pentachlorophenol in an upflow anaerobic sludge blanket
(UASB) reactor. Process Biochemistry, 39 (10): 1249-1256, 2004.
YILMAZ, G., LEMAIRE, R., KELLER, J., YUAN, Z. Simultaneous
nitrification, denitrification, and phosphorus removal from nutrient-rich
industrial wastewater using granular sludge. Biotechnology and
Bioengineering, 100 (3): 529-541, 2008.
ZHAO, H.W., MAVINIC, D.S., OLDHAM, W.K., KOCH, F.A.
Controlling factors for simultaneous nitrification and denitrification in a
two stage intermittent aeration process treating domestic sewage. Water
Research, 33 (4): 961-970, 1999.
ZHENG, Y.M., YU, H.Q., SHENG, G.P. Physical and chemical
characteristics of granular activated sludge from a sequencing batch
airlift reactor. Process Biochemistry, 40: 645-650, 2005.
ZHENG, Y.M., YU, H.Q., LIU, S.J., LIU, X.Z. Formation and
instability of aerobic granules under high organic loading conditions.
Chemosphere, 63: 1791-1800, 2006.
ZHOU, J., YU, X., WANG, Z., DING, C., CAI, W. A potential
explanation for the effect of carbon source on the characteristics of

211

acetate-fed and glucose-fed aerobic granules. African Journal of


Biotechnology, 9 (33): 5357-5365, 2010.
ZHU, J., LIU, C., WILDERER, P.A. Bio-P removal profile of aerobic
granular activated sludge from an anaerobic/aerobic SBR system. In:
Aerobic granular sludge. Water and Environmental Management
Series. London: IWA Publishing, 2005, 79-86.