Você está na página 1de 5

Indexao bioIgica mItipIa e RT-PCR para deteco de vrus

Iatentes em macieiras
Fabio N. Silva
1
, Osmar Nickel
2
, Thor V.M. Fajardo
2
& Amauri Bogo
1
1
Departamento de Fitotecnia, Universidade do Estado de Santa Catarina, 88520-000, Lages, SC, Brasil;
2
Embrapa Uva e Vinho,
95700-000, Bento Gonalves, RS, Brasil
Autor para correspondncia: Osmar Nickel, e-mail: nickelcnpuv.embrapa.br
SHORT COMMUNICATION / COMUNICAO
Parte da Dissertao de Mestrado do primeiro autor. Universidade do
Estado de Santa Catarina. Lages SC. 2007.
A ocorrncia generalizada de viroses latentes de
macieiras (Malus aomestica Borkh.) causadas por Apple
stem grooving virus (ASGV, gnero Capillovirus), Apple
chlorotic leaf spot virus (ACLSV, gnero Trichovirus) e
Apple stem pitting virus (ASPV, gnero Foveavirus), todos
pertencentes a Iamilia Flexiviriaae, na Regio Sul do Brasil,
Ioi relatada anteriormente (Nickel et al., 2001). A inIeco
muito comumente latente, embora varias doenas de
relevncia econmica estejam associadas a estes virus em
espcies IrutiIeras rosaceas como mas, pras, cerejas e
damascos, entre outras. Em combinaes de copas e porta-
enxertos sensiveis, as inIeces provocam Iorte reduo
da produo, seguida de declinio e morte em poucos anos
(Kinnard et al., 1996). O diagnostico de virus de plantas
lenhosas requer estratgias e mtodos especifcos devido
a Iatores como a distribuio desuniIorme, o titulo viral
futuante, o hospedeiro e o isolado viral (Candresse et al.,
1995). O mtodo-padro de indexao de virus em Iruteiras
lenhosas a enxertia individual de cada material a ser
indexado e da cv. de indicadora sobre um porta-enxerto, que
Iunciona apenas como suporte para o sistema (International
Working Group on Fruit Tree Viruses, 2004). O mtodo
implica em manipular plantas enxertadas, geralmente, por
meses a anos. Condies ambientais imprevisiveis e a Ialta
de sensibilidade das indicadoras a certos isolados virais
podem aIetar a expresso de sintomas (James, 1999).
O presente trabalho visou avaliar a viabilidade de
um protocolo de indexao biologica multipla em casa de
vegetao dos chamados virus latentes, que unisse todas
RESUMO
O objetivo deste trabalho Ioi avaliar a viabilidade da indexao biologica multipla de virus latentes de macieiras em indicadoras
lenhosas. O mtodo consistiu na enxertia de cinco espcies de indicadoras e duas borbulhas da cultivar a ser indexada em um unico porta-
enxerto. Concluiu-se que a efcacia e a sensibilidade do mtodo biologico multiplo adequada para a deteco confavel de Apple stem
grooving virus (ASGV), Apple stem pitting virus (ASPV) e Apple chlorotic leaf spot virus (ACLSV) em programas de limpeza clonal e
certifcao de matrizes de Iruteiras. A RT-PCR confrmou o diagnostico biologico de ASPV e ASGV. Entretanto, ACLSV diagnosticado
pela indicadora LL-S5 no Ioi detectado por RT-PCR em trs dos nove acessos analisados. O gene de proteina capsidica de ACLSV de um
dos acessos estudados Ioi clonado e sequenciado; a regio de pareamento dos iniciadores de PCR Ioi comparada com dados do Genbank
como subsidio a interpretao da no amplifcaode certos isolados de ACLSV.
Palavras-chave: Malus aomestica, Apple stem grooving virus, Apple stem pitting virus, Apple chlorotic leaf spot virus, Flexiviriaae, gene
de proteina capsidica.
ABSTRACT
Biological multiple indexing and RT-PCR detection of latent viruses in apple plants
This study aimed to evaluate the suitability oI a multiple biological indexing method oI latent apple viruses. The method consisted
oI graIting fve indicator species and two buds oI the plant to be indexed on to one rootstock. Results showed that the sensitivity and eIfcacy
oI the MBI is adequate Ior reliable detection oI Apple stem grooving virus, (ASGV), Apple stem pitting virus (ASPV) and Apple chlorotic
leaf spot virus (ACLSV) oI mother plant stock in certifcation programs. Sample analysis by RT-PCR confrmed the results oI the diagnosis
oI ASPV and ASGV by multiple biological indexing. However, it did not detect ACLSV diagnosed by LL-S5 in three out oI nine analyzed
accessions. The coat protein gene oI one oI the accessions studied was cloned and sequenced. The annealing sites oI primers used in
unsuccessIul amplifcation attempts were compared with data oI the Genbank to explain the non-amplifcation oI certain ACLSV isolates.
Keywords: Malus aomestica, Apple stem grooving virus, Apple stem pitting virus and Apple chlorotic leaf spot virus, Flexiviaae, coat
protein gene.
157
Tropical Plant Pathology 33 (2) March - April 2008
Tropical Plant Pathology, vol. 33, 2, 157-161 (2008)
Copyright by the Brazilian Phytopathological Society. Printed in Brazil
www.sbfto.com.br
Tropical Plant Pathology 33 (2) March - April 2008 158
F.N. Silva et al.
indicadoras em um unico porta-enxerto, reduzindo assim
substancialmente custos da indexao biologica, e comparar
seus resultados com aqueles da analise molecular por RT-
PCR. A clonagem e o sequenciamento do gene de proteina
capsidica de um isolado de ACLSV, e a comparao da
sequncia da regio de pareamento dos iniciadores, Ioram
realizados como subsidio para explicar a no deteco
por RT-PCR de alguns isolados positivos para ACLSV na
indexao biologica.
No marco da Iormao de um banco de germoplasma
de ma Ioram analisados acessos de macieiras antigas,
de Iundos de quintais, mantidos na Estao Experimental
de Fruticultura Temperada da Embrapa Uva e Vinho em
Vacaria-RS, coletados em diversas regies do Rio Grande
do Sul (RS) (acesso A05, Vacaria/RS, aprox. 40 anos; acesso
A010, No-Me-Toque/RS, aprox. 35 anos; acesso A011,
Colorado/RS, aprox. 50 anos; acesso A014, Carazinho/RS,
aprox. 40 anos; acessos A015 e A018, Muliterno/RS, aprox.
50 anos) todas de origem desconhecida. Trs amostras, de
aprox. 35 anos, acesso M176 (Delicious`), acesso M177
(Golden Delicious`) e acesso MR1789 (Malus spp. sem
especifcao) Ioram coletadas de banco de germoplasma
de Santa Catarina (gentilmente cedidas pelo Dr. A. Pereira,
Estao Experimental, Epagri, So Joaquim SC).
Foram utilizadas cinco espcies de indicadoras
lenhosas: Malus aomestica cvs. Virginia Crab (para ASGV,
ASPV), Radiant Crab (ASPV), Lord Lambourne-S5
(ACLSV), Spy 227 (ACLSV, ASPV) e Malus micromalus
GMAL 723.a (ASGV). Anteriormente as enxertias, as
estacas das indicadoras Ioram mantidas em cmara Iria a 4
o
C
durante um ms para acumulo de horas-Irio, Iavorecendo a
brotao. Uma estaca de cada uma das cinco indicadoras, de
57 cm de comprimento, Ioi enxertada, no outono de 2005,
em um mesmo porta-enxerto oriundo de sementes de M.
aomestica cv. Gala de um ano de idade e cerca de 70 a 80 cm
de altura. As estacas das indicadoras em cada porta-enxerto
Ioram espaadas 8-10 cm de distncia uma da outra. Na base
de cada porta-enxerto Ioram enxertadas duas borbulhas do
material a ser indexado. Cada planta-candidata Ioi avaliada
em porta-enxertos, cada um contendo as cinco indicadoras.
Os controles positivos consistiram de isolados de ASPV e
ACLSV de uma inIeco mista da cv. Braeburn (Vacaria
RS) e de um isolado de ASGV da cv. Baronesa (Caador
SC) mantidos em banco de isolados virais da Embrapa Uva
e Vinho. As plantas Ioram mantidas em casa de vegetao a
temperatura ambiente e avaliadas quinzenalmente durante 2
ciclos vegetativos de primavera por 2 anos.
Extratos de RNA total de cada amostra Ioram obtidos
de 300 mg de tecido de casca de ramos, fores e Iolhas por
adsoro em particulas de dioxido de silicio (Sigma-Aldrich
S-5631) (Rott & Jelkmann, 2001) e usados para sintese de
cDNA e PCR, utilizando-se os iniciadores ACLSV 7233r:
5CAGACCCTTATTGAAGTCGAA 3, posio 7213-
7233; ACLSV 6875s: 5` GGCAACCCTGGAACAGA
3, posio 6875-6891; ACLSV 7365r: 5
CTAAATGCAAAGATCAGTCGAC 3, posio 7343-
7365; ACLSV 6784s: 5 ATGGCAGCAGTTCTGAATTTG
3, posio 6784-6805; ACLSV 7429r: 5
CACACTTGAGCACACAACACA 3, posio 7409-
7429; ACLSV 6751s: 5 CAGTTTGCTCGACAGAACCA
3, posio 6751-6770; ASPV 9262r: 5
ATAGCCGCCCCGGTTAGGTT 3, posio 9243-
9262; ASPV 8993s: 5 CTCTTGAACCAGCTGATGGC
3, posio 8993-9012; ASGV 6396r: 5
CTGCAAGACCGCGACCAAGTTT 3, posio 6373-
6396; ASGV 5941s: 5 ATGAGTTTGGAAGACGTGCTTC
3, posio 5641-5663. As condies de desnaturao,
pareamento e extenso Ioram: ASPV: desnaturao a 95
o
C,
10 min., 35 ciclos de amplifcao (desnaturao, 1 min. a
94
o
C; pareamento, 1min. a 50
o
C; e extenso, 1 min. a 72
o
C)
e uma extenso fnal a 72
o
C, 10 min; ASGV: desnaturao
a 95
o
C, 2 min., 34 ciclos de amplifcao (desnaturao,
40 seg. a 94
o
C; pareamento, 40 seg. a 50
o
C; e extenso, 1
min. a 72
o
C) e uma extenso fnal a 72
o
C, 5 min; ACLSV:
desnaturao a 94
o
C, 2 min., 34 ciclos de amplifcao
(desnaturao, 40 seg. a 94
o
C; pareamento, 50 seg. a 48
o
C;
e extenso, 40 seg. a 72
o
C ) e uma extenso fnal a 72
o
C, 5
min.
Quando no indicado de outra Iorma, a clonagem
Ioi executada segundo Sambrook & Russel (2001) com
pequenas adaptaes. O Iragmento de ACLSV amplifcado
com os iniciadores 6784s e 7429r, de 645 pb, Ioi ligado ao
vetor pCR 2.1 com o TA Cloning Kit (Invitrogen) conIorme
instrues do Iabricante e a construo Ioi utilizada para
transIormar clulas competentes de Escherichia coli DH10B.
O Iragmento de interesse de quatro clones recombinantes
Ioi sequenciado em ambas orientaes usando os iniciadores
M13 senso e complementar (Invitrogen) em sequenciador
automatico ABI Prism 3700 (Applied Biosystems).
A seqncia obtida Ioi analisada e comparada com as
seqncias do GenBank, utilizando-se a Iuno BLAST do
NCBI (http://www.ncbi.nlm.nih.gov).
As indicadoras utilizadas neste estudo desenvolveram
os sintomas Ioliares classicos de inIeco por virus latentes
de macieiras nos controle positivos. DiIerenas de brotao
observadas entre as indicadoras podem ser atribuidas
ao termoperiodismo, uma caracteristica intrinseca das
Iruteiras de clima temperado, decorrente da exigncia de
Irio determinada pelo genotipo de cada cultivar/espcie
de indicadora. Os resultados obtidos neste trabalho com
a indexao multipla de ASGV, ASPV e ACLSV esto
contidos na Tabela 1, que engloba os resultados dos dois
periodos de leituras. Concluiu-se que o desempenho do
mtodo adequado em efcacia de deteco, sensibilidade
e confabilidade e similar a indexao simples de dupla
enxertia (International Working Group on Fruit Tree Viruses,
2004). Considerando-se o mesmo numero de 3 repeties
da indexao convencional e 5 espcies de indicadoras, a
indexao multipla tem a vantagem da reduo no numero
de plantas enxertadas em 80, reduzindo assim o custo
da indexao. O segundo periodo de avaliao confrmou
as inIeces de ASPV e ASGV ja observadas no primeiro
159
Tropical Plant Pathology 33 (2) March - April 2008
Indexao biologica multipla e RT-PCR para deteco de virus...
periodo. O aparecimento dos sintomas de ACLSV somente na
segunda enIolhao de LL-S5 pode ser devido a concentrao
e/ou as caracteristicas biologicas do isolado viral ou ainda a
interao especifca do isolado viral com a indicadora (Forsline
et al., 1996; James, 1999). Essa reao pode ser explicada pela
grande diversidade gentica e biologica de ACLSV, que implica
na presena de isolados menos virulentos, com sintomas as
vezes imperceptiveis na indicadora (Candresse et al., 1995;
Cieslinska et al., 1995). A presena do virus nas gemas usadas
como inoculo determinada tanto pela cultivar como pelo
isolado viral e depende de sua capacidade de multiplicao e
movimento (Fridlund, 1982). A presena de ASGV no acesso
M176, detectado pela RT-PCR (Tabela 1), mas testada negativa
em Virginia Crab em duas enIolhaes caracteriza um escape
natural em sistemas biologicos, resultante da relao isolado
viral-indicadora. Em analogia, em estudo de 18 isolados
europeus, trs isolados de ASGV positivos na indicadora M.
micromalus Ioram negativos em Virginia Crab e um isolado
de ASGV no Ioi detectado no teste biologico por nenhuma
das duas indicadoras, enquanto todos os quatro isolados Ioram
detectados pela RT-PCR (Kirby et al., 2001; James, 1999).
As analises de extratos de acidos nuclicos totais de casca de
ramos e fores viabilizaram resultados reproduziveis para os trs
virus, enquanto os de Iolhas Ioram inconsistentes (resultados
no mostrados). Utilizando-se os iniciadores 6875s e7233r,
considerados de amplo espectro, que fanqueiam um Iragmento
de 358 pb, no se conseguiu a deteco dos isolados de ACLSV
dos acessos A010, A011 e A015, diagnosticados positivos
para ACLSV pela indexao biologica em LL-S5 (Tabela 1),
apesar da localizao das sequncias desses iniciadores no
gene da proteina capsidica (CP), regio melhor conservada
entre isolados de ACLSV que determina a baixa diversidade
sorologica desse virus (Candresse et al., 1995). Observao
similar Ioi Ieita com isolados de Grapevine leafroll-associatea
virus-2 em videiras (Bertazzon & Angelini, 2004). Os autores
atribuiram o Iato a grande variabilidade gentica dos virus e
ao consequente no reconhecimento das sequncias virais
pelos iniciadores, impedindo seu pareamento. Os iniciadores
6875s e 7233r amplifcaram Iragmentos de varios isolados de
ACLSV, mas no viabilizaram a amplifcao de um isolado
polons de ameixeiras (Cieslinska et al., 1995). Com os
pares de iniciadores 7365r/6784s e 7429r/6751s sintetizados
com base nas sequncias do isolado P863 de ameixeira,
numero de acesso no GenBank M58152, no ocorreu
a amplifcao de nenhum dos Iragmentos esperados.
Entretanto, usando-se o iniciador homologo 6784s com o
complementar 7429r, obteve-se do acesso MR1789, mas
no do acesso M176, a amplifcao de um Iragmento de
645 pb (Figura 1), contendo o gene CP completo (582 pb)
do isolado de ACLSV denominado BR1 (numero de acesso
no GenBank EF138602). Na sequncia do gene CP do
isolado BR1 constatou-se identidades de 83 a 94 em nivel
de nucleotideos na comparao com isolados selecionados
pela base de dados. Com o isolado P863 (numero de
acesso M58152), do qual se originaram as sequncias dos
iniciadores 6784s-7429r, a identidade de nucleotideos da
CP do isolado BR1 Ioi de somente 86, aproximando-
se mais (91 a 94) de isolados japoneses (numeros de
acesso AB060963, AB060950 e AB060962). Entretanto, os
mesmos isolados MO31 (AB060963) e P195 (AB060950)
com identidades, respectivamente, de 84 e 85 com o
Iragmento da regio no codifcante do isolado BR1, no
possuem identidade signifcativa com a sequncia do
iniciador 7429r (Figura 2). E plausivel, portanto, propor
Indexao biolgica
1
RT-PCR Acessos
ASGV ASPV ACLSV ASGV ASPV ACLSV
A05 - - - - - -
A010 - - -
A011 -
A014 - - - -
A015 -
A018 - - - - - -
M176 -
M177
MR1789
TABELA 1 - Indexao biologica multipla em indicadoras
lenhosas e por RT-PCR de inIeces latentes de Apple chlorotic
leaf spot virus (ACLSV), Apple stem pitting virus (ASPV) e Apple
stem grooving virus (ASGV) em acessos de macieiras
1) Malus aomestica cvs. Virginia Crab (ASGV), Radiant Crab (ASPV),
Lord Lambourne, seleo LL-S5 (ACLSV), Spy 227 (ASPV) e Malus
micromalus GMAL 723.a (ASGV); Tabela engloba dados de leitura de
dois ciclos vegetativos e resultados de trs repeties por tratamento.
FIG. 1 - Analise de produtos da RT-PCR por eletroIorese em
gel de agarose. 1. Marcador molecular Lambda DNA/PstI; 2.
Controle negativo (agua); 3. Controle positivo (Apple chlorotic
leaf spot virus, cv. Braeburn, Vacaria RS); 4. Acesso M176; 5.
Acesso MR1789; 2-5. iniciadores 6875s-7233r; 6-9 amostras como
em 2-5, iniciadores 6784s-7429r; 10-12 amostras como em 2-5,
iniciadores 6751s-7429r.
Tropical Plant Pathology 33 (2) March - April 2008 160
F.N. Silva et al.
FIG. 2 - Alinhamento de sequncias de nucleotidios dos iniciadores 6784s e 7429r, utilizados na amplifcao do Iragmento de 645 nt
contendo o gene de CP de ACLSV do isolado BR1 (582 pb), acesso de macieira MR1789; A. Extremidade 5, regio de pareamento com
6784s; B. e C., extremidade 3, regio de pareamento com 7429r, B. bloco de isolados com alta variabilidade; C. bloco de isolados com
baixa variabilidade, respectivamente. * isolado BR1. * isolado BR1.
A 6784s: ATGGCAGCAGTTCTGAATTTG 7429r: TGTGT--TGTGTGCTCAAGTG-TG
EF138602*: ..............C...... EF138602*:.....--.............A-A.
AB326224: ..................... AB326224: .....--C.....T.-..A.A-.A
AJ243438: .................C... AJ243438: C....--T---.AAATT--GA-.A
M58152 : ..................... M58152 : .....--..............-..
AM709777: ..................C.A AM709777: AT...--A---..T.-------CA
AM409322: .....G.....G......C.T AM409322: ....-----.T.AA.T..A..TC.
AM408891: .....G.....G......C.T AM408891: ....-----.T.AT.T..A..TC.
D14996 : .....G.....G.....CC.C D14996 : ....C--A-.T..G.TT.A..TCA
AB326223: .....G.....G..C..CC.. AB326223: AA.A-----AA.AA.T..T.A--A
AJ586638: ....................A AJ586638: .....--..C...T.T..A.A-.A
AB060961: .....G........A...C.T AB060961: .....AT.TAA..TGTGTT.A-..
AB060958: .....G.....G.....CC.C AB060958: ....CAT.TG..TTAATGTCAA.T
ABO60950: ...........K.....YY.W ABO60950: sem identidade significativa
AB060962: ..................... AB060962: idem
AB060963: ..................... AB060963: idem
7429r: TGTGT--TGTGTGCTCAAGTG-TG
DQ834688: .....--......T.T..A.A-.A
DQ834689: .....--......T.T..A.A-..
DQ329162: C....--......T.T..A.A-.A
AJ586641: .....--........TT.A.A-.T
AJ586625: .....--........T..A.A-.A
DQ329161: .....--......T.T..A.A-.A
AB326224: .....--C.....T.-..A.A-.A
AJ586624: .....--......T.T..A.A-.A
AJ586626: .....--......T.T..A.A-.A
AJ586628: .....--......T.T..A.A-..
AJ586621: .....--......T.T..-..-..
AJ586632: ....C--......T.T.....-..
AJ586634: ....C--......TCT.....-..
AJ586653: .....--.........TGA..-..
M58152 : .....--..............-..
B C
que a no amplifcao de Iragmentos de isolados de
ACLSV com a combinao de iniciadores 6784s/7429r
seja devida a variabilidade gentica desses isolados na
regio de pareamento com o iniciador 7429r. Enquanto
no terminal 5 do gene CP as sequncias so altamente
conservadas (Figura 2A), na extremidade 3 na regio de
pareamento do iniciador de cDNA Iormam-se, claramente,
2 grupos de isolados, respectivamente, com baixa e alta
identidade com a sequncia do iniciador 7429r (Figura
2B-C). A no adequao deste iniciador para a deteco
de um grupo de isolados de ACLSV pode redundar em
Ialsos negativos. Entretanto, como nestas analises Ioram
utilizados somente iniciadores patogeno-especifcos sem
controles internos para amplifcao de genes vegetais,
os resultados negativos de algumas reaes podem,
adicionalmente, ser atribuidos a degradao do RNA ou
a presena de inibidores da atividade da transcriptase
reversa ou da Taq polimerase e no a ausncia do patogeno
(Menzel et al., 2003).
Se por um lado as restries aos mtodos
imunoenzimaticos (ELISA) decorrem, basicamente, da
futuao do titulo viral, da sazonalidade do diagnostico e
da ocorrncia de serotipos (Cieslinska et al., 1995), e,
por outro lado, os mtodos biologicos so vulneraveis
a relao isolado viral vs. indicadora, a variabilidade
gentica dos isolados virais exige estratgias especifcas
para evitar Ialsos negativos no diagnostico por RT-PCR
(Bertazzon & Angelini, 2004). Conclui-se que o risco
de escape intrinseco a ambos os mtodos avaliados.
Aliar a indexao biologica multipla em indicadoras de
reao Ioliar rapida a RT-PCR para casos especifcos de
certifcao de material de elite uma estratgia Iactivel
e econmica para obter-se maior confabilidade no
diagnostico de virus latentes de IrutiIeras rosaceas.
AGRADECIMENTOS
Os autores agradecem ao Dr. Francisco J.L. Arago
(Embrapa Recursos Genticos e Biotecnologia, Brasilia, DF)
pelo sequenciamento dos clones de ACLSV aqui obtidos.
REFERNCIAS BIBLIOGRFICAS
Bertazzon N, Angelini E (2004) Advances in the detection oI
grapevine leaIroll-associated virus 2 variants. Journal oI Plant
Pathology 86:283-290.
Candresse T, Lanneau M, Revers F, Grasseau N, Macquaire G,
German S, Malinowski T, Dunez J (1995) An immuno-capture PCR
assay adapted to the detection and the analysis oI the molecular
variability oI the apple chlorotic leaI spot virus. Acta Horticulturae
386:136-147.
Cieslinska M, Malinovski T, Zawadzka BJ (1995) Studies on
several strains oI Apple chlorotic leaf spot virus (ACLSV) isolated
Irom diIIerent Iruit tree species. Acta Horticulturae 386:63-71.
Forsline PL, Hoch J, Lamboy WF, Hu JS, McFerson JR, Golino DA,
Gonsalves D (1996) Comparative eIIectiveness oI symptomatology
and ELISA Ior detecting two isolates oI grapevine leaIroll on graIt-
inoculated Cabernet Franc. American Journal oI Enology and
Viticulture 47:239-243.
Fridlund PR (1982) Distribution oI chlorotic leaI spot virus-
inIected buds on various lengths oI apple budsticks in successive
years. Acta Horticulturae 130:85-88.
International Working Group on Fruit Tree Viruses (2004) Detection
oI virus and virus-like diseases oI Iruit trees. Acta Horticulturae
657:575-596.
James D (1999) A simple and reliable protocol Ior the detection
oI apple stem grooving virus by RT-PCR and in a multiplex PCR
161
Tropical Plant Pathology 33 (2) March - April 2008
Indexao biologica multipla e RT-PCR para deteco de virus...
Recebiao 26 Maro 2007 - Aceito 18 Janeiro 2008 - TPP 7028
Eaitor Associaao. F. Murilo Zerbini
assay. Journal oI Virological Methods 83:1-9.
Jelkmann W (1994) Nucleotide sequences oI Apple stem pitting
virus and oI the coat protein gene oI a similar virus Irom pear
associated with vein yellows disease and their relationship with
potex- and carlavirus. Journal oI General Virology 75:1535-1542.
Kinard GR, Scott SW, Barnett OW (1996) Detection oI apple
chlorotic leaI spot and apple stem grooving virus using RT-PCR.
Plant Disease 80:616-621.
Kirby MJ, Guise CM, Adams AN (2001) Comparison oI bioassays
and laboratory assays Ior apple stem grooving virus. Journal oI
Virological Methods 93:167-173.
Menzel W, Zahn V, Maiss E (2003) Multiplex RT-PCR-ELISA
compared with bioassay Ior the detection oI Iour apple viruses.
Journal oI Virological Methods 110:153-157.
Nickel O, Fajardo TVM, Jelkmann W, Kuhn GB (2001) Sequence
analysis oI the capsid protein gene oI an isolate oI Apple stem
grooving virus, and its survey in southern Brazil. Fitopatologia Fitopatologia
Brasileira 26:655-659.
Radaelli P, Nickel O, Schons J, Arago FJL, Fajardo TVM (2006)
Diagnostico biologico e molecular e analise da sequncia de
nucleotideos do gene da proteina capsidial de um isolado do Apple
stem pitting virus. Fitopatologia Brasileira 31:657-662. Fitopatologia Brasileira 31:657-662.
Rott ME, Jelkmann W (2001) Characterization and detection oI
several flamentous viruses oI cherry: adaptation oI an alternative
cloning method (DOP-PCR), and modifcation oI an RNA extraction
protocol. European Journal oI Plant Pathology 107:411-420.
Sambrook J, Russel D (2001) Molecular Cloning, A Laboratory
Manual. 3
rd
ed. New York MY. Cold Spring Harbor Laboratory
Press.