Você está na página 1de 7

Colgio Municipal de Adustina

Prof: Edlamar Santana Disciplina: EDUCAO FSICA Srie: 3 ANO Data: / 06 /13 Turno: MATUTINO Turma:

ALUNO: _________________________________________________________ ALUNO ALU

Aluno:____________________________________________________ AVALIAO DA II UNIDADE ___________________________ As questes devem ser respondidas no espao preparado, visto que suficiente e adequado. VER_________ Valem (0,3 ponto) Sendo 12 dissertativas e 8 objetivas com igual valor. ______MMMMMMMM_____________________________________ _____________________________________________

CLULAS IMORTAIS CONTAM AOS CIENTISTAS A HISTRIA DA EVOLUO DA HUMANIDADE


Estas clulas formam um livro, conservado em tanques de nitrognio lquido que guarda informaes desconhecidas sobre a humanidade. Os captulos contam diferentes detalhes da saga do homem na terra: suas andanas pelos continentes, casamentos ancestrais e os ataques de doenas. (adaptado de, "O Globo") O processo de autoduplicao do DNA d significado hereditariedade permitindo revelar a histria da evoluo da humanidade. "... suas andanas pelos continentes, casamentos ancestrais e os ataques de doenas" podem ser estudados atravs de observaes de caractersticas morfolgicas e fisiolgicas da clula. O DNA capaz de controlar e interferir nas caractersticas morfolgicas e fisiolgicas da clula.

01-

(Ufrj 2008) Se extrairmos o DNA total de clulas de msculo, bao e rim de um mesmo indivduo, verificaremos que os tecidos apresentam genomas idnticos. Os RNA mensageiros das clulas desses trs tecidos sero os mesmos? Justifique sua resposta.

02-

(Unifesp 2006) Uma fita de DNA tem a seguinte sequencia de bases

5'ATGCGT3'.

a) Considerando que tenha ocorrido a ao da DNA-polimerase, qual ser a sequencia de bases da fita complementar?

b) Se a fita complementar for usada durante a transcrio, qual ser a sequencia de bases do RNA resultante e que nome recebe esse RNA se ele traduzir para sntese de protenas?

03-

(G2) Sabendo-se que um determinado segmento de DNA apresenta capacidade de transcrever e que apresenta uma sequencia de bases ACTCCGCTT / TGAGGCGAA, quais poderiam ser as sequencias de bases do RNA por ele produzido?

04-

(Unesp 2003) Em um segmento da cadeia ativa de DNA, que servir de molde para a fita de RNA mensageiro, h 30 timinas e 20 guaninas. No segmento correspondente da fita complementar do DNA h 12 timinas e 10 guaninas. Levando-se em considerao essas informaes, responda. a) Quantas uracilas e quantas guaninas comporo a fita do RNA mensageiro transcrito do DNA ativado?

b) Quantos aminocidos devero compor a cadeia de polipeptdeos que ser formada?

05- (G2) Um segmento de RNA mensageiro apresenta a sequencia de bases nitrogenadas a seguir: AAA UUC GGG GAU.
a) Quais so as bases do segmento de DNA que deu origem a esse RNA?

b) Quantos nucleotdeos existem no DNA que deu origem a essa molcula de RNA mensageiro?

06-

(Unirio 2002) A figura a seguir mostra um trecho da estrutura do cido desoxirribonucleico, ressaltando a interao entre as duas cadeias do polmero. Na figura, A,

C, G e T representam as bases adenina, citosina, guanina e timina, respectivamente.


As linhas pontilhadas indicam as pontes de hidrognio que so formadas entre as bases aminadas e que contribuem para manter unidas as duas cadeias do DNA. Essas pontes de hidrognio podem ser rompidas por calor, o que produz a dissociao das cadeias. Esse processo reversvel chama-se de desnaturao. A temperatura necessria para desnaturar o DNA depende de vrios fatores, mas um deles a composio dos nucleotdeos de um determinado DNA. Observe as duas sequencias de DNA a seguir e determine qual delas precisar de uma temperatura de desnaturao maior. Justifique a sua resposta.

1) ACTTTAAAGATATTTACTTAAA TGAAATTTC TATAAATGAATTT 2) GCTAGGCCGATGCGGCGTGGA CGATCCGGCTACGCCGCACCT

07- (G2) Considere a sequencia de bases nitrogenadas de um segmento de DNA: AAA GGC ATT e Responda:
a) Qual a sequencia de bases da hlice complementar a esse segmento?

b) Qual a sequencia de bases do RNA mensageiro transcrito a partir desse segmento?

08-

(G2) No desenho a seguir, que representa a estrutura da molcula de DNA, o que representam os nmeros 1, 2 e 3 respectivamente?

09-

(G2) Quais so as diferenas observadas nos nucleotdeos que entram na composio do DNA em relao aos que entram na composio do RNA?

10-

(Fuvest 89) O desenho a seguir mostra a sntese de um polipeptdio a partir da molcula de DNA num certo organismo. Esse organismo um procarioto ou um eucarioto? Por qu?

11-

(Unicamp 2002) A indstria do entretenimento tem mostrado imagens ilusrias de robs de fico como o jovial R2D2 e o chato C3PO, de "Guerra nas Estrelas", e o Exterminador do Futuro. Entre os brinquedos japoneses, h uma srie de robs que imitam movimentos de seres humanos e de animais. Isso deixa as pessoas desapontadas quando se deparam com os robs reais, que executam tarefas repetitivas em fbricas. Eles no so to esplndidos como os anteriormente citados, mas significam menos esforo muscular no mundo real. (Adaptado de James Meek, "Robs mais baratos tomam fbricas europeias", "O Estado de S. Paulo", 23/9/2000.) a) Uma das diferenas entre robs e seres humanos que nos homens existem quatro grupos de molculas orgnicas. Quais so esses grupos? Explique o que essas molculas tm em comum na sua composio.

b) O sistema robtico armazena energia em baterias. Indique dois rgos ou tecidos de armazenamento de energia nos seres humanos. Que composto armazenado em cada um desses rgos ou tecidos?

12-

(Ueg 2005) A figura a seguir refere-se hereditariedade: a) Qual a caracterstica do DNA, enquanto molcula mandatria da informao gentica, que permite a transmisso dessa informao do organismo para seus descendentes? b) A ocorrncia de mutaes importante para a evoluo da espcie?

Justifique suas respostas.

13-

(UNICENTRO 2007) Com relao a genes, cidos nucleicos e o fluxo da informao gentica, correto afirmar: a) que a diferena entre as bases pricas e pirimdicas est no nmero de pontes de hidrognio, sendo 3 pontes de hidrognio para as bases pricas e 2 pontes de hidrognio para as bases pirimdicas.

b) que a duplicao do DNA bidirecional e semiconservativa. c) que o fluxo da informao gentica no ocorre, em circunstncia alguma, de RNA para DNA, mas ocorre sempre de DNA para RNA. d) que, em eucariotos, os genes so transcritos no citoplasma. e) que, composicionalmente, DNA e RNA diferem entre si apenas pela presena das bases nitrogenadas Timina e Uracila, respectivamente.

14-

(UNIOESTE 2008) Escolha a alternativa cujas associaes entre as duas colunas esto todas corretas. COLUNA 1: COLUNA 2: a. cdigo gentico I. Organela que traduz a fita de RNAm. b. ribossomo II. Sntese de protenas a partir da leitura de RNAm. c. traduo III. Trinca de nucleotdeos, em RNAm, que codifica um aminocido. d. cdon IV. Correspondncia entre cdons e aminocidos por eles codificados. e. anticdon V. Trinca de nucleotdeos no RNAt, complementar ao RNAm. a) a-V; b-III; c-II; d-I; e-IV. b) a-III; b-II; c-II; d-V; e-IV. c) a-V; b-IV; c-III; d-II; e-I d) a-IV; b-I; c-II; d-III; e-V. e) a-I; b-II; c-III; d-IV; e-V.

15-

(UFSC 2009) O DNA a molcula biolgica responsvel pela codificao da informao gentica nos seres vivos. Sobre esse assunto, CORRETO afirmar que: MARQUE AS ALTERNATIVAS CORRETAS: 01) a molcula de DNA formada por duas cadeias caracterizadas por sequencias de bases nitrogenadas. 02) na molcula de DNA podem existir oito diferentes tipos de complementao de bases nitrogenadas. 04) a quantidade de adenina presente em uma das cadeias exatamente igual quantidade de timina da cadeia complementar. 08) na molcula de DNA podem existir cinco diferentes tipos de bases nitrogenadas. 16) no processo de mitose, cada molcula de DNA d origem a quatro molculas de DNA exatamente iguais.

16-

(UEPG 2008) A respeito da molcula de DNA, assinale o que for correto. MARQUE AS ALTERNATIVAS CORRETAS. 01) Durante a duplicao do DNA, as pontes de hidrognio que ligam as bases nitrogenadas se rompem, e as duas fitas se separam. Cada uma das fitas originais, ento separadas, serve agora como molde para a produo de fitas novas. 02) Alm da capacidade de se duplicar, o DNA tambm fabrica RNA. A duplicao uma propriedade que permite a transmisso da informao gentica s clulas-filhas, ao passo que a produo de RNA relaciona-se sntese de protenas, no citoplasma. 04) O DNA uma molcula constituda por duas cadeias de nucleotdeos, em cada uma das quais os nucleotdeos esto ligados uns aos outros pelos fosfatos. As duas cadeias esto ligadas uma outra pelas suas bases nitrogenadas, por meio de pontes de hidrognio, e essas ligaes ocorrem entre pares de bases especficas. Sendo assim, a adenina liga-se somente timina, e a citosina liga-se sempre guanina. Toda essa estrutura apresenta-se torcida e em forma de dupla-hlice. 08) O DNA sempre tem a forma de dupla-hlice e sempre constitudo por apenas quatro tipos de nucleotdeos. Na verdade, uma molcula de DNA pode diferir da outra pelo nmero total de nucleotdeos. Embora o menor DNA conhecido tenha ao redor de 5.500 nucleotdeos, a maioria das molculas de DNA tem algumas centenas de milhares de nucleotdeos. Assim, varia muito o tamanho de uma molcula para outra. Alm do tamanho, as molculas de DNA diferem pela sequencia dos pares de bases.

17-

(UTFPR 2008) Os cidos nucleicos so macromolculas essenciais vida. Todos os

organismos vivos contm cidos nucleicos na forma de DNA (cido desoxirribonucleico) e RNA (cido ribonucleico). Alguns vrus s contm DNA, enquanto outros s possuem RNA. Sobre as funes do DNA e do RNA esquematizadas a seguir foram feitas as seguintes afirmativas:

I) A duplicao do DNA (em 1) semiconservativa, cada nova molcula contm metade da velha. II) O processo de transcrio (em 2) acontece somente com a presena da enzima transcriptase reversa. III) A traduo (em 3) transforma uma sequencia de nucleotdeos em uma sequencia de aminocidos. IV) As protenas so macromolculas formadas pela unio de aminocidos unidos por ligaes peptdicas. V) DNA e RNA so macromolculas formadas por unidades chamadas nucleotdeos. Esto corretas somente as afirmativas: a) I, II, III e IV. b) I, III, IV e V. c) II, III e V. d) III, IV e V. e) I, II, III e V.

18- (UEMS)

Indique a caracterstica abaixo que no est relacionada ao RNA: a) encontrado no nuclolo, cromossomas e citoplasma. b) Suas bases pirimdicas so citosina e uracila. c) Cora-se pela reao de Feulgen. d) Tm sequncias de nucleotdeos que codificam sequncias especficas de aminocidos. e) Tem fita nica e pareamento de bases.

19- (UFMS) Com relao natureza do material gentico assinale as alternativas corretas.
(01) Alm das diferenas na sua composio qumica, o DNA e o RNA apresentam diversidade quanto sua estrutura molecular. (02) As caractersticas funcionais de uma protena variam conforme o nmero e a posio dos aminocidos na sua molcula. (04) Os aminocidos possuem na sua composio qumica bsica o grupo cido carboxlico (COOH), o grupo amino (NH2), bsico, e a diferena entre um aminocido e outro est no Radical (R) que se liga a esses grupos. (64) Quem determina a sequencia, o nmero e os tipos de aminocidos que fazem parte da composio da protena a sequencia de bases do RNA mensageiro que lhe deu origem.

20- (Unicap-PE) Julgue as afirmativas: Como verdadeiras ( V ) ou falsas (F ).


( V ) A engenharia gentica permite introduzir genes artificialmente construdos em outras clulas, nas quais eles podero realizar os processos de replicao e transcrio. ( F ) Clonagem molecular a transferncia de genes de um organismo para outro. Sem alterao do seu gentipo. ( V ) O projeto genoma tem como objetivo principal localizar, nos 23 pares de cromossomos, os 100 mil genes humanos.
A avaliao no dever medir a quantidade de acertos, e sim o repensar sobre os acertos e possveis enganos cometidos com o entendimento do momento em relao atividade proposta. Esse entendimento poder amadurecer e alcanar um nvel superior a partir das reflexes em anlise. Acredito na avaliao como forma de reflexo confirmao do conhecimento e aprendizagem.

DESEJO UMA BOA REFLEXO PARA TODOS.

PROF EDLAMAR SANTANA