Você está na página 1de 1255

Na fotossntese, ocorrem vrios fenmenos importantes, com exceo de:

a) absoro de luz pelas clorofilas e converso de energia luminosa em energia qumica;


b) reduo de CO2 pelos hidrognios provenientes da gua;
c) libertao de O2 proveniente da lise do dixido de carbono;
d) sntese de ATP, utilizando-se luz;
e) fotofosforilao e reduo.

RESPOSTA: C

O conhecimento biolgico atual leva a crer que a evoluo inerente a todos os seres vivos. Assim,
aponte, dentre as alternativas abaixo, qual dos princpios era defendido por Darwin em sua teoria da
evoluo dos organismos vivos.

A) A evoluo ocorre de forma lenta e gradual, sob influncia da seleo natural.


B) As catstrofes naturais, como a queda do meteoro que causou a extino dos dinossauros, so
eventos necessrios evoluo das espcies.
C) O criacionismo explica o surgimento de todas as criaturas.
D) Os genes esto sob influncia do ambiente; por isso, sofrem mutaes.
E) A utilizao repetida de um rgo promove sua hipertrofia, e a descendncia desta caracterstica
herdada pela prole.

Resposta: A
Justificativa:
Apesar de seu desconhecimento sobre a existncia dos genes, Darwin defendia que a seleo natural
atuava de forma lenta e gradual (gradualismo), selecionando caractersticas vantajosas s espcies,
deixando-as mais aptas e adaptadas ao ambiente, enquanto que as menos adaptadas seriam extintas.
Assim, no sustentou teorias criacionistas ou o catastrofismo. Alm disso, a obteno de uma
caracterstica no curso de vida de uma espcie no implica a transferncia desta aos descendentes.

Ainda hoje os vrus constituem microrganismos que fascinam por sua simplicidade, seu potencial
patognico e sua distribuio na natureza. As estruturas mostradas abaixo representam diferentes
tipos virais, os quais tm em comum o fato de que:

A B

A) so conhecidos como bacterifagos.


B) possuem autonomia reprodutiva.
C) sintetizam protenas dentro de clulas.
D) possuem material gentico de DNA.
E) possuem um envelope lipoproteico.
Resposta: C
Justificativa:
Os vrus dependem da clula para reproduzirem-se e sintetizar enzimas e protenas do capsdio, uma
vez que no possuem ribossomos. Possuem material gentico de DNA ou RNA, sendo que alguns,
mas no todos, possuem envelope lipoprotico. Ainda, no possvel afirmar que ambos os vrus
mostrados acima so bacterifagos.
As clulas so consideradas as unidades bsicas dos seres vivos. Contudo, podem variar em sua
morfofisiologia, dependendo do organismo que compem. Assim, observe a figura da clula abaixo
e aponte a alternativa que correlaciona corretamente as estruturas numeradas de 1 a 5 e suas
respectivas funes.

A) 1. fotossntese
B) 2 metabolismo energtico.
C) 3 diviso celular.
D) 4 sntese de protenas.
E) 5 processamento e secreo protica.
Resposta: D
Justificativa:
1 - Complexo Golgiense processamento e secreo de protenas.
2 - Ncleo abriga o material gentico (DNA) que comanda a diviso celular.
3 - Mitocndria metabolismo energtico.
4 - Ribossomos sntese protica.
5 - Retculo Endoplasmtico transporte celular.
O animal mostrado na foto abaixo:

A) est na base da cadeia alimentar.


B) excreta principalmente cido rico.
C) apresenta fecundao externa.
D) possui respirao branquial e sistema circulatrio aberto.
E) taxonomicamente, est includo na Classe Chondricthyes.
Resposta: E
Justificativa:
O tubaro um predador e, portanto, est no pice da cadeia alimentar. So animais que excretam
uria, possuem sistema circulatrio fechado, respirao branquial e fecundao interna. Pertencem
Classe dos peixes cartilaginosos (Chondricthyes).
Considerando as preocupaes atuais da sociedade com o ambiente, aponte, dentre as alternativas
abaixo, os exemplos que no deveriam ser seguidos:

A) Reciclagem de pilhas e baterias.


B) Uso de sacolas retornveis.
C) Descarte de lixo em aterros a cu aberto.
D) Uso de energia elica.
E) Racionamento de gua.
Resposta: C
Justificativa:
O descarte de lixo em aterros a cu aberto aumenta a proliferao de doenas e a contaminao de
fontes naturais de gua, dentre outros prejuzos ambientais.
No perodo de chuvas em vrias regies do Brasil, bastante comum o aumento do nmero de
casos de doenas transmitidas por insetos e/ou artrpodes, como, por exemplo:

A) Doena de Chagas e AIDS.


B) Esquistossomose e Gripe Mundial.
C) Giardase e Malria.
D) Dengue e Febre Amarela.
E) Lepra e Leptospirose.
Resposta: D
Justificativa:
Dentre as alternativas, somente a Dengue e a Febre Amarela so doenas causadas conjuntamente
por insetos, o mosquito Aedes aegypti.
O desenvolvimento embrionrio humano possui uma srie de fases que culmina com a expulso do
feto no momento do nascimento. Contudo, em casos raros, pode ocorrer gravidez ectpica, que o
desenvolvimento do blastocisto:

A) no intestino.
B) no ovrio.
C) na parede do tero.
D) na tuba uterina.
E) na vagina.
Resposta: D
Justificativa:
Cerca de 98% dos casos de gravidez ectpica ocorrem na tuba uterina e, em rarssimos casos, na
cavidade abdominal.
Considere o gene da calvcie, dominante no homem e recessivo na mulher. A seguir, observe a
Tabela abaixo que mostra os gentipos dos pais e fentipos possveis dos filhos, e aponte a
alternativa que faz a correspondncia correta:

Gentipo Fentipos dos filhos


HOMEM MULHER
a) CC x CC Calvo Calva
b) CC x cc No-Calvo Calva
c) Cc x cc No-Calvo Calva
d) cc x cc Calvo No-Calva
e) Cc x CC No-Calvo No-Calva
Resposta: A
Justificativa:
Os gentipos CC e Cc (mas no cc) produzem calvcie no homem, enquanto que somente CC
produz calvcie na mulher. Assim, o resultado do cruzamento de CC x CC geraria somente
gentipos CC, produzindo homens calvos ou mulheres calvas na prole.
Dentre as cerca de 8,5 milhes de espcies de organismos vivos presentes hoje em nosso planeta,
mais de 7,5 milhes so animais. Essa enorme diferena em nmero parece estar vinculada
enorme flexibilidade conferida por caractersticas da arquitetura do corpo dos animais, que os
tornam aptos a viver nos mais diferentes hbitats do planeta, o que certamente deve ter contribudo
para a diversificao do grupo. Dentre as grandes mudanas ocorridas no processo evolutivo,
podemos destacar trs importantes: aquisio da multicelularidade, aquisio do trato digestivo e
aquisio de segmentao corporal. Apresente uma consequncia favorvel que cada uma dessas
mudanas trouxe aos organismos.

A) Aquisio de multicelularidade:
B) Aquisio de trato digestivo:
C) Aquisio de segmentao corporal:
As razes primrias dos vegetais vasculares so o principal stio de absoro de gua e de sais
minerais. A entrada desses compostos feita por difuso, por meio dos pelos absorventes, na
epiderme das razes. Para chegar at o cilindro central das razes, devem percorrer o crtex, pelas
vias simplasto e apoplasto. No cilindro central, apenas uma dessas vias permanece.

a) Qual essa via?


b) Qual a importncia de que apenas essa via acontea a partir do cilindro central?
Durante o desenvolvimento embrionrio, fontes constantes de oxignio, energia e nutrientes so
imprescindveis para manter as altas taxas de proliferao e migrao celular. O embrio necessita
tambm de gua, tanto para hidratao das clulas quanto para evitar a aderncia inapropriada das
estruturas em formao. Precisa, ainda, eliminar resduos metablicos txicos, que se formam ao
longo dos processos de desenvolvimento, e se proteger de substncias txicas, variao trmica e
outras adversidades do ambiente. Os embries dos vertebrados mais primitivos, como os peixes
(Anamniotas), se desenvolvem em ntimo contato com o ambiente aqutico, onde a maior parte
dessas necessidades pode ser facilmente suprida. O aparecimento de ovos amniticos permitiu que o
desenvolvimento embrionrio de certos vertebrados, como as aves (Amniotas), ocorresse em
ambiente terrestre. Para isso, desenvolveram-se os anexos embrionrios mnio (ou mnion), crion
(ou crio), saco vitelino e alantoide. Explique a importncia de cada um dos anexos no processo de
desenvolvimento at a ecloso do indivduo, considerando as necessidades expostas acima.

A) mnio
B) Crion
C) Sacp vitelino
D) Alantoide
Um fabricante oferece diferentes tipos de elementos filtrantes de gua para consumo humano. Os
filtros de cermica, com uma malha de poros de at 200 nm, so considerados os mais eficientes
para evitar que a gua contenha microorganismos. Explique a razo pela qual esses filtros so
considerados esterilizantes.
No heredograma abaixo, os indivduos afetados por uma anomalia gentica apresentam-se pintados
de preto.

a) Proponha uma hiptese para explicar geneticamente essa anomalia, abordando o nmero de
genes envolvidos e o tipo de interao allica e de herana cromossmica (sexual ou autossmica).

b) Indique os gentipos dos indivduos afetados e de seus pais.

indivduo afetado gentipo pais gentipo


II:1 I:1
II:3 I:2
II:5 I:3
III:2 I:4
III:3 II:8
Considere o seguinte experimento: duas plantas cresceram em ambientes completamente isolados. A
planta A cresceu com suprimento de dixido de carbono normal, mas foi regada com gua contendo
tomos de oxignio radioativo. A planta B desenvolveu-se com suprimento de gua normal, mas
numa atmosfera com dixido de carbono que continha tomos de oxignio radioativo. Cada planta
cresceu realizando fotossntese. Foram ento analisados, para deteco de radioatividade, o
oxignio da atmosfera e os acares das plantas. Em qual sistema (A ou B) ser encontrado
oxignio radioativo e em qual ser encontrado o acar radioativo?
Explique suas escolhas. Reao simplificada da fotossntese: dixido de carbono + gua + luz
acar + oxignio
O quadro abaixo apresenta algumas colees biolgicas existentes no estado do Paran.

Museu de Histria Natural Capo da Imbuia (MHNCI): Anfbios, Crustceos,


Miripodos, Moluscos, Mamferos, Peixes e Rpteis.
Museu de Zoologia da UEL (MZUEL): Abelhas, Anfbios, Aves, Mamferos, Peixes e Rpteis.
Departamento de Zoologia da UFPR (DZUP): Cnidrios, Insetos e Mamferos.

Os curadores dos trs museus realizaram uma reunio para trocar exemplares, de modo que todos os
museus acabem tendo o mesmo nmero de filos de animais. Descobriram que, para isso, bastaria
um dos museus doar uma parte de uma coleo ao museu com o menor nmero de filos.

a) Identifique o museu que receber a doao.


b) Identifique o museu que far a doao e qual coleo ter uma parte doada.
Com quantos filos cada museu ficar?
A partir de apenas 20 tipos diferentes de aminocidos, uma clula pode produzir aproximadamente
20.000 diferentes tipos de protenas, como, por exemplo, hemoglobina, colgeno e miosina. Essa
produo acontece pela ligao dos aminocidos em sequncias especficas, que so diferentes
para cada protena. Entretanto, a mesma protena (por exemplo, hemoglobina) tem exatamente a
mesma sequncia de aminocidos todas as vezes que produzida numa mesma clula. Explique
como a clula controla essa produo, para que todas as hemoglobinas sejam iguais.
Em plantas contendo flores que possuem ambos os aparelhos reprodutores (masculino e
feminino), a autopolinizao geralmente evitada de vrias maneiras, como pelo posicionamento
do estigma mais alto que as anteras, ou pela abertura de pistilo e anteras em momentos
diferentes. Apresente uma explicao para a evoluo desses mecanismos que impedem
autofecundao acarreta.
a) Na figura ao lado, que representa de forma simplificada o sistema circulatrio em humanos, a
quais letras correspondem, respectivamente, veia e artria pulmonar?

b) A trombose venosa profunda (TVP) resulta da formao de um trombo (cogulo de sangue) numa
veia profunda da perna. Na TVP pode ocorrer obstruo, parcial ou total, da passagem do sangue.
Em algumas situaes, o cogulo se desprende e transportado pelo sangue. Nesse caso, em qual
das pores do sistema circulatrio indicadas na figura ele chegar primeiro?

c) Indique, ordenando as letras, o percurso que esse cogulo faria para ir de D at A.


A gua essencial a existncia de vida no planeta Terra. Sobre a importncia da gua nos sistemas
biolgicos, analise as proposies abaixo.

0-0) Vrias propriedades da gua se devem a ligaes de hidrognio, que mantm a coeso entre as
molculas de gua no estado lquido.
1-1) O citosol, o plasma, o suor e a urina so exemplos de solues cujo principal solvente a gua.
2-2) A porcentagem de gua no corpo humano aumenta com a idade, mas menor nas clulas
embrionrias, nos ossos e no crebro.
3-3) A desidratao provocada pelo exerccio leva taquicardia, pois o menor volume sanguneo faz
o corao aumentar o ritmo dos batimentos para manter a homeostase.
4-4) Com a febre, sintoma comum de infeces bacterianas, ocorre aumento da temperatura
corporal, que pode ser controlada com a
ingesto de grandes quantidades de gua, timo regulador trmico.
VVFVF
Justificativa:
0-0) Verdadeiro: as molculas de gua esto unidas por ligaes de hidrognio, formadas quando
um tomo oxignio, com carga eltrica parcial negativa de uma molcula, atrai um hidrognio com
carga eltrica parcial positiva de uma molcula vizinha.
1-1) Verdadeiro: a gua o solvente universal encontrado em 70% do corpo humano, sendo
presente em grande proporo no citosol celular, no plasma sanguneo, no suor e na urina.
2-2) Falso: a porcentagem de gua no corpo humano decresce com a idade, sendo maior nas clulas
embrionrias e no crebro, e, menor,
nos ossos.
3-3) Verdadeiro: a homeostase hdrica do corpo humano depende da quantidade de gua disponvel
para manter o equilbrio das concentraes de soluto dentro e fora das clulas. Assim, a perda
excessiva de gua momentaneamente compensada com o aumento dos batimentos cardacos que
abastecem as clulas com nutrientes e carregam as excretas no sangue para serem eliminadas
atravs da urina.
4-4) Falsa: apesar da funo de regulao trmica, a ingesto de gua no elimina a causa do
sintoma da febre, que a infeco.
Leveduras, como Saccharomyces cerevisiae, so organismos com uma srie de aplicaes nas
indstrias de alimento e farmacutica. Sobre esses organismos, considere as afirmativas abaixo.

0-0) De acordo com o Sistema de Domnios, as leveduras pertencem ao Domnio Eukaria, e so


caracterizadas por organizao unicelular e metabolismo exclusivamente anaerbio, o que
possibilita que sejam utilizadas em processos de fermentao.
1-1) As leveduras diferenciam-se das microalgas por no realizarem fotossntese e apresentarem. na
parede celular. a quitina, um composto tambm presente na carapaa de crustceos e no
exoesqueleto de insetos.
2-2) Ao se reproduzirem, as leveduras podem apresentar crescimento exponencial ao longo do
tempo, como o representado pela linha ascendente no grfico abaixo.

3-3) A fermentao de acares da cana de acar pelas leveduras, gera 4 molculas de ATP como
saldo energtico para a sobrevivncia celular, e etanol.
4-4) O gs carbnico produzido com a descarboxilao do piruvato na gliclise realizada pelas
leveduras utilizado na carbonatao da cerveja e responsvel pelo crescimento da massa do po.
FVVFV
Justificativa:
0-0) Falso: apesar de serem unicelulares e pertencerem ao Domnio Eukaria, que abriga os
organismos eucariontes, as leveduras so capazes de realizar metabolismo aerbico ou anaerbico.
1-1) Verdadeiro: leveduras no possuem pigmentos fotossintetizantes como as microalgas, sendo
quimiorganotrficos. Possuem quitina na parede celular rgida, composto tambm presente em
alguns grupos animais, como os citados acima.
2-2) Verdadeiro: organismos unicelulares que se dividem por bipartio ou brotamento (como as
leveduras) aumentam o nmero de clulas de forma exponencial ao longo do tempo, como
mostrado no grfico.
3-3) Falso: neste processo, a gliclise gera 4 ATPs, dos quais 2 so consumidos no incio da via
metablica (reaes endotrmicas), sendo o saldo energtico de apenas 2 ATPs.
4-4) Verdadeiro: o gs carbnico um dos produtos metablicos da fermentao dos carboidratos
presentes na farinha de trigo, fazendo a massa do po crescer. A carbonatao se refere aplicao
desta propriedade na reao que gera a espuma da cerveja.
O presidente americano Barack Obama, premiado com o Nobel da Paz em 2009, assinou um tratado
internacional de no proliferao de armas nucleares. Considerando o efeito de radiaes nos
organismos vivos, analise as afirmativas seguintes.
0-0) A radiao ultravioleta emitida em cmaras de bronzeamento artificial pode determinar a
formao de dmeros de timina na molcula de
DNA, como mostrado na figura abaixo, e, no caso de exposio excessiva, pode causar cncer de
pele.

1-1) Os raios X podem provocar modificaes moleculares das reas irradiadas, como a produo
de radicais livres nas clulas; da o motivo por que devem ser evitadas exposies a esses raios em
curtos intervalos de tempo.
2-2) A radiao liberada nos testes nucleares realizados na Coria do Norte no permanece no
ambiente nem faz mal sade humana, pois so de baixa intensidade.
3-3) Compostos radioativos, como o Cobalto-60, emitem raios gama, geralmente utilizados para
impedir a multiplicao de microrganismos em alimentos empacotados.
4-4) O vazamento da radiao emitida por aparelhos de micro-ondas, que fazem vibrar molculas
de gua nos alimentos, aquecendo-os, pode provocar queimaduras, uma vez que o corpo humano
principalmente composto por gua.
VVFVV
Justificativa:
0-0) Verdadeiro: a radiao ultravioleta (UV) provoca a formao de dmeros de pirimidinas. Cerca
de 50% das vezes, entre timinas, 40%
das vezes entre timina e citosina, e, cerca de 10% das vezes, entre citosinas. Tambm, a exposio
direta ao sol (e raios UV de
cmaras de bronzeamento artificial) sem o uso de protetor solar pode causar o cncer de pele.
1-1) Verdadeiro: o raio-X uma radiao ionizante, que gera radicais livres altamente reativos que
podem levar formao de substncias
txicas no interior celular, como superxidos.
2-2) Falsa: a radiao nuclear permanece no ambiente por muitos anos e, assim, pode afetar a sade
humana aps exposies com diferentes graus de intensidade.
3-3) Verdadeiro: o Cobalto 60 um radioistopo que emite radiao ionizante, a qual atravessa
embalagens e atinge microrganismos
presentes no alimento, impedindo sua multiplicao.
4-4) Verdadeiro: o aparelho micro-ondas emite radiao eletromagntica que faz vibrar molculas
de gua (dentre outras) do alimento, produzindo calor. Assim, seu vazamento pode produzir
queimaduras.
A gripe causada pelo Influenza A H1N1 tem provocado uma pandemia sem precedentes, com
gravidade somente comparada gripe espanhola do incio do sculo passado. Sobre estes vrus,
observe a figura abaixo e considere as afirmaes que se seguem.

0-0) Os vrus Influenza se ligam s clulas alvo por meio de espculas (1), que tambm so
utilizadas para diferenciar os tipos de Influenza.
1-1) Aps a entrada na clula, o nucleocapsdeo deposita no ncleo celular o material gentico de
RNA (2), que replicado (3) e transcrito em RNAm (4).
2-2) O RNAm traduzido (5) em protenas das espculas (6) e enzimas, dentre estas, a transcriptase
reversa que volta ao ncleo celular (7) para sintetizar DNA viral.
3-3) A probabilidade que a disseminao desses vrus seja ainda maior nos perodos de inverno da
Amrica do Norte e da Europa.
4-4) As vacinas produzidas contra o vrus da gripe so geralmente pouco eficientes devido
variao antignica das espculas H (hemaglutinina) e N (neuraminidase), o que dificulta o
reconhecimento dos vrus pelos anticorpos.
VVFVV
Justificativa:
0-0) Verdadeiro: os vrus Influenza possuem espculas H (hemaglutinina) e N (neuraminidase), o
que permite sua diferenciao, por exemplo: H1N1 (Influenza humano), H5N1 (Influenza aviria)
etc; se ligam s clulas alvo por meio de espculas H.
1-1) Verdadeiro: os vrus Influenza apresentam material gentico de RNA que replicado, para
formar cpias do material gentico viral e transcrito em RNAm, para a sntese de protenas.
2-2) Falso: os vrus Influenza no possuem a enzima transcriptase reversa e no transcrevem seu
RNA em DNA. Algumas protenas se dirigem ao ncleo (7) para auxiliar na composio do
nucleocapsdeo viral. As espculas virais, formadas no citoplasma, se associam primeiramente a
membrana celular (6) e, aps o brotamento da clula, estes vrus carregam uma parte da membrana
com as espculas
para compor o envelope viral.
3-3) Verdadeiro: as baixas temperaturas no inverno aumentam a frequncia de doenas respiratrias
na populao, entre elas, a gripe, aumentando a chance de novas recombinaes genticas ou
mutaes nos subtipos virais.
4-4) Verdadeiro: as espculas H e N representam os principais antgenos virais do Influenza que
estimulam a produo de anticorpos. Todavia, frequentemente, sofrem modificaes decorrentes de
mutaes ou recombinaes genticas, o que dificulta suas utilizaes como alvos de vacinas.
As vacinas representam algumas das principais ferramentas humanas para o combate s infeces.
Sobre este assunto, leia a tabela abaixo, onde consta o calendrio bsico de vacinao adotado no
Brasil, para crianas, e considere as afirmaes feitas a seguir.

0-0) Vacinas como a BCG, aplicadas para preveno da tuberculose, so realizadas em dose nica,
pois so muito eficientes em estimular linfcitos B de memria, responsveis pela produo de
anticorpos.
1-1) O ttulo de anticorpos no sangue no se altera aps a aplicao da primeira dose de vacinas,
como a Tetravalente e a Hepatite B; da a
necessidade da administrao de novas doses da vacina.
2-2) A VORH, aplicada contra rotavrus humanos em trs doses, no induz uma boa imunidade na
maioria das pessoas, diferente da vacina contra febre amarela, que somente precisa de um reforo.
3-3) A vacina VOP, contra a poliomielite, uma das vacinas mais modernas do mundo, pois a
simples administrao de uma gotinha contendo antgenos do vrus suficiente para induzir
imunidade.
4-4) Vacinas de DNA, diferentemente das vacinas mostradas na tabela acima, induzem imunidade
aps a introduo de sequncias genticas microbianas, que se fundem ao cromossomo humano na
clula do hospedeiro.
VFFVF
Justificativa:
0-0) Verdadeiro: vacinas oferecidas em dose nica possuem antgenos eficientes em induzir a
proliferao de clulas B de memria, que geralmente produzem imunidade durante toda a vida do
indivduo.
1-1) Falso: a primeira dose de vacinas como a Tetravalente aumenta o ttulo de anticorpos, mas
pode induzir a produo de um nmero
limitado de clulas B de memria, sendo necessrias novas aplicaes.
2-2) Falso: independentemente do esquema de aplicao, as vacinas so produzidas para induzir
imunidade contra os agentes infecciosos na maioria das pessoas vacinadas.
3-3) Verdadeiro: vacinas orais so consideradas modernas, pois induzem excelente imunidade
atravs do simples contato do antgeno com a mucosa intestinal.
4-4) Falsa: as vacinas de DNA no se fundem ao cromossomo celular, permanecendo as sequncias
genticas contidas em plasmdios no citoplasma, de onde sero gerados os antgenos microbianos
que induziro imunidade no hospedeiro.
A descoberta de uma grande jazida de petrleo e gs natural na camada pr-sal tem sido
comemorada pelo governo brasileiro e pela Petrobras, que estima uma reserva de cerca de 100
bilhes de barris do leo. Sobre este assunto, podemos afirmar que:
0-0) o petrleo encontrado derivado de organismos marinhos mortos que se depositaram ao longo
de milhes de anos no fundo do oceano e se fossilizaram.
1-1) motores de automveis que empregam gasolina, liberam na atmosfera gases do efeito estufa,
como monxido de carbono, dixido de
enxofre e clorofluocarbono.
2-2) a produo de biodiesel, a partir de plantas como o girassol e a soja, fornece uma alternativa
energtica renovvel, mas pouco vivel no Brasil, uma vez que a maioria das espcies oleaginosas
so consumidas na alimentao.
3-3) a prospeco do gs natural, um bem renovvel, permitir a independncia energtica do Brasil
em relao Bolvia, principal fornecedor brasileiro deste produto.
4-4) a queima do leo diesel libera dixido de nitrognio que, ao reagir com o vapor dgua
atmosfrico, produz cido sulfrico, que precipita nas chamadas chuvas cidas.
VFFFF
Justificativa:
0-0) Verdadeiro: combustveis como o petrleo, o gs natural e o carvo mineral so produtos da
decomposio de plantas e de animais que fossilizaram ao longo de milhes anos.
1-1) Falso: a liberao de monxido de carbono na atmosfera principalmente resultante da queima
incompleta de molculas orgnicas proveniente de motores a combusto de veculos automotores.
Contudo, o dixido de enxofre derivado da queima industrial de combustveis como o carvo
mineral e o leo diesel. J a liberao de clorofluocarbono (CFC) derivada da utilizao de
aparelhos
aerosis.
2-2) Falso: apesar de algumas plantas oleaginosas serem utilizadas na alimentao, sua utilizao
como biodiesel no representa um
fator limitante, considerando tratar-se de um bem renovvel cuja produo somente depende da
existncia de terras frteis para o
plantio.
3-3) Falso: o gs natural, assim como o petrleo, um derivado fssil, sendo, portanto, um bem no
renovvel.
4-4) Falso: a reao do dixido de nitrognio com o vapor dgua atmosfrico produz o cido
ntrico, presente nas chuvas cidas.
A preocupao da sociedade com o ambiente tem motivado algumas empresas a adotarem prticas
de sustentabilidade como uma maneira de agregar valor comercial aos seus produtos. Sobre este
assunto, considere as proposies abaixo.

0-0) O estmulo ao uso de sacolas retornveis por algumas empresas produz benefcio ao meio
ambiente, uma vez que sacolas plsticas no so biodegradveis.
1-1) O tratamento dos resduos gerados pelas empresas, antes do despejo em fontes naturais de gua
potvel, so prticas que devem ser incentivadas.
2-2) Um projeto de Lei aprovado no Recife impede o comrcio de latas de ao. Tal iniciativa se
deve ao fato de que latas de ao no so reciclveis e tm se acumulado no ambiente.
3-3) O tratamento da gua contaminada por corantes ou metais pesados pelas indstrias permite sua
reutilizao como gua potvel para consumo humano.
4-4) A utilizao da energia solar ou de termoeltricas so formas baratas e ecologicamente corretas
que poderiam ser adotadas pelas empresas.
VFFFF
Justificativa:
0-0) Verdadeiro: os plsticos so produzidos a partir de polmeros, como o polietileno, no
degradado naturalmente por microrganismos na natureza.
1-1) Falso: o despejo de qualquer tipo de resduo, tratado ou no, em fontes naturais de gua potvel
deve ser inibido, considerando os danos ao meio ambiente e a carncia dessas fontes no planeta.
2-2) Falso: as latas de ao so reciclveis; contudo o gasto com energia para reciclagem deste
material alto em comparao com as latas de alumnio. Assim, a maioria das empresas tem optado
pelas latas de alumnio, sendo que as latas de ao possuem atualmente baixo valor no mercado da
reciclagem e tm se acumulado no ambiente.
3-3) Falso: corantes e metais pesados descartados na gua so extremamente txicos e possuem
remoo incompleta aps tratamentos qumicos e/ou biolgicos. Assim, as guas contaminadas so
inviveis ao consumo humano como gua potvel, somente sendo reutilizadas em outros processos
como, por exemplo, o resfriamento de equipamentos.
4-4) Falsa: a utilizao de energia solar, apesar de ecologicamente correta, ainda demanda a
utilizao de equipamentos caros, o que inviabiliza seu uso em larga escala. Termoeltricas
geralmente utilizam combustveis fsseis como gasolina, petrleo e gs natural, que so queimados
em cmaras de combusto para produo de energia calorfica, sendo, portanto, uma forma de
gerao energtica cara e ecologicamente danosa.
Os animais desenvolveram, ao longo da evoluo, uma srie de adaptaes ecolgicas para resistir
s variaes de temperatura nas diferentes regies do planeta. Sobre este tema, analise o que se
considera a seguir.

0-0) Animais pecilotrmicos, como alguns lagartos, desenvolveram um mecanismo de adaptao


temperatura, que consiste em expor a cabea ao sol a fim de esquentar o sangue e aquecer o corpo o
suficiente para entrar em atividade.
1-1) Animais homeotrmicos respondem metabolicamente s baixas temperaturas, consumindo uma
quantidade maior de alimentos ricos em carboidratos e lipdios.
2-2) Para tolerar temperaturas elevadas, cobras que vivem em regies desrticas se movimentam
encostando somente parte do corpo na areia quente, enquanto ratos silvestres se escondem em tocas.
3-3) A fim de tolerar baixas temperaturas, os ursos polares acumulam carboidratos como reserva
energtica para depois hibernar por at um ano, enquanto que algumas aves migram para regies
mais quentes.
4-4) Para diminuir a temperatura corporal, alguns animais se adaptaram evolutivamente reduzindo a
pelagem e, assim, retendo menos calor; outros, aumentaram as taxas de evaporao de gua.
VVVFV
Justificativa:
0-0) Verdadeiro: o aquecimento do sangue com a xposio de partes do corpo ao sol aumenta a
atividade metablica do organismo, fazendo com que tais animais se tornem mais ativos.
1-1) Verdadeiro: o consumo de alimentos ricos em calorias, como carboidratos e lipdios, auxilia na
manuteno dos estoques energticos (glicognio, triglicerdeos etc.) necessrios para manter a
homeostase trmica em baixas temperaturas.
2-2) Verdadeiro: a exposio alternada de pequenas partes do corpo a superfcies quentes, como a
areia do deserto, uma estratgia eficiente que algumas cobras desenvolveram. J os roedores,
animais de pequeno porte, se protegem do sol e da desidratao escondendo-se em suas tocas
durante o dia, sendo mais ativos noite.
3-3) Falso: ursos hibernam no perodo do inverno, tempo em que geralmente duram suas reservas
energticas de gordura acumuladas. Aves migratrias geralmente voam para regies tropicais.
4-4) Verdadeiro: a diminuio da pelagem ajuda na no reteno do calor, facilitando a evaporao.
A evaporao produzida com o suor, por exemplo, auxilia no resfriamento do corpo em atividade.
As plantas do semirido nordestino realizam uma srie de adaptaes morfofisiolgicas para
sobreviverem ao ambiente seco e rido. Sobre estas adaptaes, correto fazer as seguintes
afirmaes.

0-0) Apesar do clima seco, a regularidade da precipitao pluviomtrica no semirido, mostrada no


grfico abaixo, a principal responsvel pela sobrevivncia das plantas.

1-1) A caatinga representa um bioma tpico do semirido e rico em biodiversidade, caracterizado


por uma vegetao xerfita, que perde a folhagem durante a estao seca.
2-2) As adaptaes morfofisiolgicas observadas abaixo no Mandacaru so folhas modificadas para
diminuir a perda de gua por evaporao.

3-3) A presena de cutcula espessa e de tricomas na epiderme foliar so adaptaes que conservam
a umidade nos perodos sem chuva.
4-4) Plantas xerfitas possuem um nmero maior de estmatos, em comparao com plantas no
xerfitas, o que constitui uma vantagem em ambientes secos.
FVVVV
Justificativa:
0-0) Falso: o grfico mostra a irregularidade de chuvas ao longo dos anos, prevalecendo a baixa
precipitao pluviomtrica, tpica do semirido nordestino. Assim, as plantas tiveram de se adaptar
morfofisiologicamente ao longo da evoluo para conseguir sobreviver em tais condies
climticas.
1-1) Verdadeiro: a caatinga um dos ecossistemas brasileiros mais ricos em biodiversidade com
prevalncia de plantas (xerfitas) adaptadas reduzida umidade.
2-2) Verdadeiro: os espinhos so modificaes foliares que reduzem a perda de gua e servem de
proteo contra predadores.
3-3) Verdadeiro: plantas do semirido apresentam vrias camadas de clulas da epiderme foliar e
secretam cutina, formando uma cutcula semiimpermevel. Os tricomas so pelos epidrmicos que
conservam o microambiente mido.
4-4) Verdadeiro: a abertura de um nmero maior de estmatos permite uma troca gasosa mais
eficiente nos curtos perodos de chuva.
A Empresa Brasileira de Pesquisa Agropecuria (Embrapa) tem se especializado na produo de
espcies de plantas transgnicas, portadoras de genes que conferem resistncia a certas pragas
agrcolas. Considerando os gentipos de plantas produzidos em laboratrio, analise o que se afirma
a seguir.

0-0) Devido resistncia a pragas, os clones de plantas transgnicas tm vantagem evolutiva frente
s espcies selvagens.
1-1) Em plantas utilizadas na alimentao, a transgenia altera a composio de aminocidos da
cadeia polipeptdica codificada pelo gene alterado, produzindo protenas com menor valor nutritivo.
2-2) As tcnicas de engenharia gentica demandam a utilizao de bactrias para a multiplicao de
plasmdios vetores nos quais foram introduzidos os genes de interesse.
3-3) O consumo de plantas transgnicas na alimentao gera alergias e intoxicaes no produzidas
pelos gentipos selvagens.
4-4) Caso uma praga acometa um gentipo de uma dada espcie de planta transgnica, todos os
seus clones sero igualmente susceptveis.
FFVFV
Justificativa:
0-0) Falso: a vantagem evolutiva ocorre com os sucessivos cruzamentos entre diferentes gentipos
de plantas, aumentando a variabilidade gentica e as chances de sobrevivncia e adaptao ao meio
ambiente. O sucessivo replantio de clones de plantas no produz vantagem evolutiva frente s
espcies selvagens.
1-1) Falso: alteraes pontuais na composio da cadeia polipeptdica, como ocorre na transgenia,
no influenciam o valor nutritivo do
alimento de origem vegetal, pois os aminocidos derivados da quebra proteoltica, durante a
digesto, so normalmente utilizados para sntese de novas protenas.
2-2) Verdadeiro: plasmdios so utilizados como vetores para genes de interesse. So ento
includos em bactrias, que, ao se dividirem por bipartio, multiplicam naturalmente tais genes.
3-3) Falso: de maneira geral, a liberao do consumo de plantas transgnicas no Brasil, como a soja,
infere a inocuidade do produto.
No existem provas de que haja alergias ou intoxicaes relacionadas a esses gentipos. Assim,
uma pessoa alrgica linhagem transgnica tambm poder ser alrgica linhagem selvagem.
4-4) Verdadeiro: uma vez que tal populao possui o mesmo gentipo, seria menos adaptvel ao
meio ambiente e, portanto, mais susceptvel a alguma praga, cuja transgenia no tenha produzido
resistncia.
O avano nas tcnicas de diagnstico de doenas genticas tem levado algumas pessoas a realizar
procedimentos radicais para prevenir o aparecimento dos sintomas, como, por exemplo, a extrao
cirrgica das mamas para evitar o cncer. A propsito desse tema, analise o que afirmado abaixo.

0-0) As pessoas podem carregar em seus gentipos alelos recessivos deletrios; mas estes somente
se manifestam quando em condio de homozigose.
1-1) Casamentos entre parentes de primeiro grau podem produzir anormalidades genticas, pois o
casal tem maior chance de possuir um mesmo alelo deletrio.
2-2) O diagnstico de alelos recessivos, em condio heterozigtica para Anemia Falciforme, em
ambos os componentes de um casal, geralmente os encoraja a ter filhos aps o aconselhamento
gentico.
3-3) Se um alelo deletrio dominante, mas apenas a homozigose leva o indivduo morte, este
alelo comporta-se como um alelo letal recessivo na determinao da sobrevivncia.
4-4) A probabilidade de um casal no aparentado, ambos heterozigticos para um alelo recessivo
deletrio, ter filhos com alguma doena associada a esse gene 0%.
VVFVF
Justificativa:
0-0) Verdadeiro: a maioria dos genes deletrios na populao possui carter recessivo e, portanto,
no se expressa no fentipo quando em heterozigose. Isto explica o baixo percentual de doenas
genticas no conjunto da populao.
1-1) Verdadeiro: casamentos consanguneos aumentam a frequncia de certos genes na prole e a
probabilidade de expresso no fentipo de genes deletrios em homozigose.
2-2) Falso: a Anemia Falciforme uma doena grave e letal. Assim, a opo por filhos geralmente
desencorajada no aconselhamento gentico quando so identificados no casal genes recessivos para
a doena.
3-3) Verdadeiro: alelos letais dominantes, em homozigose ou heterozigose, levam o indivduo
morte. Contudo, se um alelo dominante somente provoca a morte quando se manifesta em
homozigose, comporta-se como um alelo letal recessivo na determinao da sobrevivncia.
4-4) Falso: na descendncia do casal, h 25% de chance de a prole apresentar o fentipo derivado
dos alelos deletrios.
O corpo humano possui cerca de 5 a 6 litros de sangue, que essencial para a sobrevivncia e o
funcionamento de clulas, tecidos e rgos. Considerando o conhecimento sobre o tecido
sanguneo, analise as proposies abaixo.

0-0) As hemcias so clulas anucleadas, de origem mesodrmica, sem mitocndrias e ricas em


hemoglobina; so produzidas com o estmulo da eritropoetina.
1-1) Processos hemorrgicos intensos produzem o choque hipovolmico, o que pode levar morte,
em razo da perda de plaquetas e dos fatores de coagulao sangunea.
2-2) Clulas T citotxicas so linfcitos que amadurecem no Timo; so especializadas na produo
de antgenos e clulas de memria
durante as infeces.
3-3) Neutrfilos e macrfagos so fagcitos originrios da medula ssea vermelha, sendo que os
primeiros possuem ncleo trilobado, e os segundos, um grande ncleo na regio central da clula.
4-4) Eosinfilos so clulas que combatem infeces parasticas, enquanto os basfilos produzem
aumento da permeabilidade vascular atravs da secreo de histamina.
VFFVV
Justificativa:
0-0) Verdadeiro: os eritroblastos, durante a diferenciao, expelem o ncleo e produzem grande
quantidade de hemoglobina, transformando-se em reticulcitos. Estes expelem as mitocndrias e os
ribossomos, transformando-se em hemcias. A produo de hemcias estimulada pelo hormnio
eritropoetina.
1-1) Falso: o choque hipovolmico ocorre devido ao dbito de volume sanguneo para circular nos
capilares e irrigar os tecidos e rgos. Nessas condies, ocorre aumento dos batimentos cardacos e
da frequncia respiratria e baixa da presso arterial.
2-2) Falso: clulas T citotxicas (linfcitos T CD8) tm como funo principal o reconhecimento e
a destruio de clulas infectadas por microrganismos ou clulas anormais, como as cancergenas.
3-3) Verdadeiro: neutrfilos so fagcitos que migram rapidamente para os stios de infeco, em
especial nas infeces bacterianas; macrfagos, alm de agirem como fagcitos, processam em seu
interior antgenos e os apresentam na membrana celular para ativar outros grupos celulares da
resposta imune; possuem as caractersticas celulares descritas acima.
4-4) Verdadeiro: eosinfilos so importantes em infeces parasticas liberando seus grnulos
txicos aos invasores; a histamina liberada pelos basfilos aumenta a permeabilidade vascular, de
forma a permitir o extravasamento de clulas da resposta imune do endotlio para o tecido onde se
encontram os antgenos.
Aps a escolha do Rio de Janeiro para sediar as Olimpadas em 2016, alguns atletas brasileiros
afirmaram j estarem se preparando para este grande evento. Considerando a regulao integrada
dos vrios sistemas do corpo humano durante o exerccio fsico, podemos afirmar o seguinte:

0-0) o estresse dos atletas, antes das competies, controlado com uma grande descarga de
dopamina pela medula suprarrenal, que suprime a atividade do sistema nervoso central.
1-1) a descarga de adrenalina pela hipfise, no organismo de um atleta do salto em distncia,
provoca aumento do fluxo sanguneo, do corao para os msculos das pernas, antes da competio.
2-2) no desafio da maratona, o tremendo desgaste fsico e a desidratao fazem o crtex suprarrenal
liberar mineralocorticoides para promover a reabsoro de sdio e a excreo de potssio.
3-3) em um atleta da natao, por exemplo, a quebra do glicognio para o fornecimento de acar
ao sangue dependente da liberao de glucagon pelo pncreas.
4-4) a ingesto de hormnios esteroides derivados da testosterona proibida nos jogos olmpicos.
Tal prtica pode pode influenciar, nas mulheres, o desenvolvimento de caractersticas sexuais
masculinas.
FFVVV
Justificativa:
0-0) Falso: a dopamina associada ao sentimento de prazer e relaxamento; produzida por
neurnios, em vrias reas do crebro, e tambm liberada, como neuro-hormnio, pelo hipotlamo.
Tem ao sobre o sistema nervoso simptico e no afeta diretamente o sistema nervoso central.
1-1) Falso: a adrenalina produzida pela medula suprarrenal e estimula o aumento da concentrao
de glicose no sangue, alm de provocar vasoconstrio na pele, nas mucosas e nos rins, alm de
taquicardia.
2-2) Verdadeiro: a perda excessiva de gua atravs do suor leva produo de hormnio
mineralocorticoide, de forma a regular o nvel desses ons no sangue.
3-3) Verdadeiro: o glucagon produzido pelo pncreas garante a disponibilidade de acar no sangue
durante o exerccio, atravs da quebra do glicognio armazenado no fgado.
4-4) Verdadeiro: o aumento do tnus muscular uma das caractersticas obtidas com a
administrao de esteroides; considerada uma prtica antidesportiva.
O corao e os pulmes humanos desempenham uma srie de atividades em conjunto, para garantir
o transporte de oxignio s clulas e a remoo do gs carbnico liberado como produto da
respirao celular. Sobre a integrao morfofuncional destes rgos, observe a figura abaixo e
considere as afirmaes a seguir.

0-0) A presso parcial de gs oxignio (PO2) no interior dos pulmes maior que a do sangue
presente nos capilares sanguneos pulmonares; da ocorrer a difuso do oxignio dos alvolos para o
sangue.
1-1) Na hematose, ocorre a difuso de gs carbnico, que est combinado hemoglobina sangunea,
na forma de carbo-hemoglobina, para os alvolos.
2-2) O corao um rgo oco, com quatro cmaras, das quais as duas superiores bombeiam
sangue para as duas inferiores, o qual flui em um s sentido, devido s vlvulas artrioventriculares.
3-3) A contrao dos trios, chamada de sstole atrial, provoca a sada do sangue diretamente para as
artrias pulmonares, que possuem pequeno dimetro para facilitar as trocas gasosas no pulmo.
4-4) A aorta recebe sangue do ventrculo esquerdo, rico em oxignio, e o envia para o resto do
corpo, enquanto que as veias promovem o
retorno da circulao sangunea.
VVVFV
Justificativa:
0-0) Verdadeiro: A PO2 do ar dos pulmes maior (104 mm Hg) que a do sangue nos capilares
pulmonares (40 mm Hg). Tais diferenas de presso levam a difuso do oxignio dos alvolos para
o sangue, onde a PO2 menor. O mesmo ocorre com o gs carbnico, que se difunde do sangue dos
capilares, onde a PCO2 maior (45 mm Hg), para os alvolos, onde a PCO2 menor (40 mm Hg).
1-1) Verdadeiro: na hematose, cerca de 23% do gs carbnico derivado do metabolismo celular
associa-se a grupos amina da molcula de hemoglobina (formando carbo-hemoglobina) e se difunde
do sangue para os alvolos, de onde liberado para o ambiente.
2-2) Verdadeiro: as cmaras superiores (trios) bombeiam sangue para as cmaras inferiores
(ventrculos). As vlvulas atrioventriculares evitam que o sangue retorne aos trios.
3-3) Falso: a contrao ou sstole atrial provoca a sada do sangue para os ventrculos. O ventrculo
direito impulsiona o sangue para o pulmo atravs de artrias de grande dimetro (artrias
pulmonares). Somente ao chegar aos pulmes, as artrias diminuem em calibre formando capilares
para realizar as trocas gasosas, como mostrado na figura.
4-4) Verdadeiro: o ventrculo esquerdo recebe sangue ricamente oxigenado dos pulmes e o
bombeia atravs da aorta para o resto do corpo. Nos tecidos, a aorta diminui o calibre formando
capilares para promover a nutrio e a oxigenao das clulas e a remoo de excretas e gs
carbnico. Estas retornam ao corao atravs das veias.
Sobre o desenvolvimento embrionrio do zigoto, derivado da reproduo sexuada de vrios grupos
animais e do homem, observe a figura abaixo e considere as afirmativas que se seguem.

0-0) A sequncia de eventos mostrados de A a G representa o processo de segmentao holoblstica


que resultar na formao de clulas-tronco, chamadas blastmeros.
1-1) Na reproduo humana, aps a formao da mrula, mostrada em H, ocorre a compactao a
fim de evitar a separao entre essas clulas no aparelho reprodutor feminino.
2-2) Aps a formao de dezenas de clulas, visvel em H, originada uma cavidade, preenchida de
lquido, chamada blastocele (I); o embrio, nessa condio, chamado de gstrula.
3-3) Na gastrulao, as clulas que daro origem aos msculos do animal migram para o interior do
embrio; as clulas que daro origem pele migram para a superfcie.
4-4) A notocorda, presente nos cordados, formada a partir da organizao ntero-posterior de
clulas do mesoderma do embrio, na forma de um basto, e tem o papel de orientar a diferenciao
do sistema nervoso.
VVFVV
Justificativa:
0-0) Verdadeiro: as primeiras clulas produzidas na segmentao do zigoto so blastmeros, clulas
indiferenciadas (clulas-tronco), de
tamanho homogneo, como mostrado na figura; os blastmeros so tpicos de uma segmentao
holoblstica.
1-1) Verdadeiro: no incio da segmentao, uma srie de divises celulares rpidas formaro um
aglomerado de clulas, a mrula, mostrado em H. Uma vez que a zona pelcida degradada, ocorre
uma compactao, que mantm as clulas unidas e evita sua liberao ao acaso, no trato reprodutor
feminino.
2-2) Falso: com a formao da blastocele, o embrio chamado de blstula.
3-3) Verdadeiro: com a migrao de clulas para o interior do embrio, a blastocele desaparece, e
so formados os folhetos germinativos, endoderma e mesoderma, dos quais, o ltimo dar origem
s clulas musculares. As clulas que migram para a periferia do embrio formaro o folheto
germinativo ectoderma, que dar origem pele.
4-4) Verdadeiro: apesar das clulas do sistema nervoso serem originadas do ectoderma, a notocorda
tem origem mesodrmica; tem como funes dar suporte ao tubo nervoso e orientar a diferenciao
do sistema nervoso.
A reproduo humana envolve aspectos biolgicos, culturais e religiosos que so considerados na
escolha do casal por ter filhos. Sobre aspectos ligados ao controle da natalidade, pode-se afirmar o
que segue.

0-0) A plula-do-dia-seguinte abortiva, pois a interao de seus princpios ativos com o embrio
fertilizado produz a destruio do mesmo.
1-1) Mulheres com ciclo menstrual regular de 28 a 30 dias podem ter relaes sexuais do primeiro
ao nono dia do ciclo com chances mnimas de engravidar.
2-2) Os testes de farmcia para deteco da gravidez identificam a presena do hormnio
gonadotrofina corinica na urina, produzido em maior quantidade em mulheres grvidas.
3-3) A utilizao de camisinha somente previne a gravidez se for utilizada em associao com
uma pomada espermicida.
4-4) A promiscuidade e a falta de uso da camisinha, alm de aumentarem as chances de uma
gravidez indesejada, acentuam a probabilidade de incidncia do vrus HIV e da AIDS.
FVVFV
Justificativa:
0-0) Falso: a plula-do-dia-seguinte no possui ao direta na destruio do vulo fertilizado.
1-1) Verdadeiro: mulheres, com ciclo menstrual regular de 28 a 30 dias, tm chances mnimas de
engravidar do primeiro ao nono dia do ciclo menstrual, pois a ovulao geralmente ocorre entre o
dcimo segundo e o dcimo quinto dia do ciclo, perodo em que as chances de
engravidar so grandes.
2-2) Verdadeiro: o hormnio citado tem a funo de ativar o corpo lteo (corpo amarelo), mantendo
elevadas as taxas de estrgeno e progesterona; por isso, um timo indicador da existncia de
gravidez.
3-3) Falso: a camisinha fornece uma barreira fsica que impede o contato do smen e/ou fludos
corporais com o parceiro(a), prevenindo a gravidez e as DSTs.
4-4) Verdadeiro: a promiscuidade nas relaes sexuais sem o uso da camisinha o principal
responsvel pela disseminao do HIV e pela ocorrncia da AIDS; tambm contribui para a
ocorrncia da gravidez indesejada.
Joo est enfrentando a maratona do vestibular e, para tanto, alm de estudar bastante, se prepara
comendo uma dieta equilibrada em nutrientes e fazendo exerccios fsicos regularmente. No dia da
prova, leva uma garrafa dgua e uma barrinha de cereal, para garantir, respectivamente, sua
hidratao e o suprimento energtico para seu crebro em atividade. Sobre este assunto, observe a
figura abaixo e considere as afirmativas que se seguem.

0-0) O transporte de molculas e ons nutrientes para dentro das clulas de Joo, geralmente ocorre
por um mecanismo de difuso facilitada (1) por protenas de membrana.
1-1) O transporte de molculas e ons, ilustrado em (1 e 2), suplementar para a nutrio celular,
mas desnecessrio, uma vez que essas substncias podem atravessar passivamente a membrana (3),
sem a necessidade de protenas transportadoras.
2-2) O metabolismo de carboidratos como a glicose, presente na barra de cereal de Joo, libera ons
hidrognio que so carreados pelas co-enzimas NAD e FAD at as cristas mitocondriais, onde
gerado ATP e gua.
3-3) Caso Joo realize exerccios fsicos intensos antes das provas, um processo fermentativo de
produo de cido ltico poder ocorrer em suas clulas musculares, expresso pela equao abaixo:

4-4) A produo de Glucagon pelo pncreas aumenta a glicogenlise, essencial s clulas cerebrais
de Joo, que so dependentes do consumo de glicose.
FFVVV
Justificativa:
0-0) Falso: na difuso facilitada no ocorre gasto de energia (1), sendo que molculas que se
encontram em maior gradiente de concentrao fora da clula, penetram o ambiente intracelular por
meio de determinadas protenas de membrana plasmtica (2).
1-1) Falso: o balano das concentraes de alguns ons dentro e fora da clula, por exemplo, o sdio
e o potssio, dependem de protenas transportadoras que funcionam como bombas que os
capturam e transportam atravs da membrana, mantendo a homeostase.
2-2) Verdadeiro: o metabolismo de carboidratos, particularmente no Ciclo de Krebs, libera ons
hidrognios captados pelo NAD e FAD para participao na cadeia de transporte de eltrons (CTE),
nas cristas mitocondriais, cujos produtos finais so ATP e gua.
3-3) Verdadeiro: a equao expressa que a degradao da glicose gera 2 molculas de ATP a partir
de ADP e fosfato, alm de cido ltico e gua.
4-4) Verdadeiro: o Glucagon estimula a quebra do glicognio liberando glicose no sangue; as
clulas cerebrais tm a glicose como principal fonte energtica, a qual quase completamente
oxidada.
No Brasil o nmero de adeptos do vegetarianismo estrito, ou seja, aqueles que somente admitem
vegetais na dieta, vem crescendo nos ltimos anos. Considerando este tipo de dieta e o processo de
digesto dos alimentos realizado pelos rgos ilustrados abaixo, considere as afirmativas a seguir:

0-0) Dietas vegetarianas so ricas em vitaminas, tais como Riboflavina (B2) e Filoquinona (K), que
so importantes na respirao celular e na coagulao sangunea, respectivamente.
1-1) O consumo estrito de legumes, frutas, verduras e cereais no fornece todos os aminocidos
essenciais, necessrios constituio de protenas e enzimas.
2-2) Protenas vegetais ingeridas so degradadas por ao da pepsina, produzida pelo rgo 1, e
da quimotripsina e tripsina, secretadas pelo rgo 2 no intestino.
3-3) a ausncia do rgo 3, no compromete a capacidade de digerir gorduras vegetais, mas a
ausncia do rgo 4, impede a secreo de enzimas tais como a RNAse, DNAse e Lipase.
4-4) a reduo cirrgica do tamanho do rgo 1 em pessoas com obesidade mrbida, diminui a
produo de gastrina, o que leva a reduo de peso de forma semelhante a quem somente ingere
vegetais.
VFFVF
Justificativa:
0-0) Verdadeiro: a vitamina B2 encontrada em vegetais de folha e a vitamina K, em vegetais
verdes, tomate e castanha, por exemplo. Possuem os papis descritos acima.
1-1) Falso: a combinao correta de alimentos de origem vegetal preenche as necessidades
nutricionais humanas, pois todos os vinte aminocidos, essenciais e no essenciais, podem ser
encontrados nessa dieta.
2-2) Falso: o Pncreas (4) produz e secreta a quimotripsina e a tripsina como parte do suco
pancretico.
3-3) Verdadeiro: a Vescula Biliar (3) somente armazena a Bile produzida no fgado, que tem a
funo de auxiliar na digesto de gorduras; as enzimas citadas so presentes no suco pancretico
(4).
4-4) Falso: a reduo de peso em pessoas que realizaram cirurgia de reduo de estmago (1) est
associada restrio da ingesto dos alimentos, e conseqente diminuio na absoro de nutrientes
e calorias.
Considerando o aumento da longevidade humana em vrias partes do mundo, dados preliminares do
Instituto Brasileiro de Geografia e Estatstica (IBGE) mostraram o envelhecimento da populao
brasileira, com mais de 28 mil pessoas em todo o pas com idade superior aos 100 anos. Sobre este
assunto, considere as assertivas:

0-0) medida que as pessoas envelhecem, ocorre encurtamento dos cromossomos devido perda
de segmentos, como quele exemplificado pela rea marcada com um crculo, no cromossomo
ilustrado abaixo.

1-1) a ao do hormnio calcitonina produzido pela tireide auxilia na preveno da osteoporose,


uma doena comum em idosos.
2-2) pessoas idosas devem se vacinar todos os anos contra a gripe comum, ao contrrio de pessoas
jovens que so mais resistentes imunologicamente.
3-3) procedimentos estticos como a injeo na face de botox, toxina botulnica bacteriana,
contraem os msculos deixando a pele sem rugas, prevenindo o envelhecimento.
4-4) pessoas que no realizam exerccio fsico tm diminudo o condicionamento cardiovascular, e
envelhecem mais rapidamente.
FVVFF
Justificativa:
0-0) Falso: a figura mostra o centrmero, sendo que os segmentos perdidos encontram-se nas
extremidades dos cromossomos, os telmeros.
1-1) Verdadeiro: a osteoporose causa diminuio da absoro de clcio pelos ossos, expondo-os a
fraturas; o hormnio citado auxilia no balano das concentraes de clcio nos ossos, incorporando-
o quando este est em excesso no sangue.
2-2) Verdadeiro: a gripe comum provoca sintomas mais profundos em pessoas idosas, devido a uma
resposta imune mais deficiente; ao contrrio de pessoas jovens, que geralmente no precisam se
vacinar.
3-3) Falso: botox provoca o relaxamento muscular, diminuindo as marcas de expresso e as
rugas. Contudo, no previnem o envelhecimento do organismo.
4-4) Falso: apesar de o exerccio fsico prevenir doenas cardiovasculares e melhorar a qualidade de
vida, o envelhecimento comum a todos os seres humanos.
No ano de 2010, o respeitado cientista americano Craig Venter, cuja equipe j havia elucidado o
cdigo gentico humano em 2000, anunciou a produo de vida artificial. Em seu experimento, um
genoma bacteriano foi sintetizado em laboratrio e inserido em uma bactria de outra espcie, que
estava livre de seu prprio material gentico. A seguir, esta passou a reproduzir-se de forma
independente, sob o comando de seu novo genoma sinttico. Considerando tal descoberta e os
princpios que caracterizam a vida tal como a conhecemos, considere as assertivas a seguir:

0-0) o experimento acima confirma a teoria da gerao espontnea, proposta para explicar a origem
da vida a partir de compostos inertes.
1-1) bactrias com material gentico sinttico no so realmente seres vivos, segundo os princpios
da teoria celular.
2-2) como a clula recipiente do material gentico sinttico no fora sintetizada artificialmente, no
pode-se afirmar que o experimento gerou vida artificial.
3-3) crescimento, metabolismo e resposta a estmulos devem estar presentes na bactria
artificialmente produzida, para que seja considerada viva.
4-4) o experimento descrito ilustra o design inteligente, pensamento que reafirma o criacionismo
como responsvel pelo surgimento da vida no planeta.
FFFVF
Justificativa:
0-0) Falso: no experimento descrito, a vida foi observada com a reproduo celular, o que
consistente com a teoria vigente da Biognese, ou seja, um organismo vivo somente pode ser
gerado a partir de outro.
1-1) Falso: a teoria celular afirma que para ser considerado um ser vivo, este deve ser formado
por, no mnimo, uma clula. Assim, a bactria artificial preenche este requisito.
2-2) Falso: apesar da clula recipiente do genoma sinttico no ter sido construda artificialmente,
as clulas descendentes se originaram devido informao gentica artificial.
3-3) Verdadeiro: as caractersticas descritas so tpicas dos seres vivos e devem estar presentes na
bactria gerada artificialmente.
4-4) Falso: o criacionismo atribui o surgimento da vida a causas sobrenaturais ou religiosas, o que
no o caso no experimento descrito.
A caricatura abaixo, de 1871, mostra como muitos cientistas receberam as idias evolutivas de
Darwin. Tal teoria tambm foi desafiada no passado recente pelo famoso bilogo evolucionista
Stephen Jay Gould, morto em 2002. Diferente de Darwin, Gould acreditava que a evoluo pode ter
dado saltos, considerando a descontinuidade do registro fssil de muitas espcies. Apesar disso, os
cientistas modernos concordam que as mutaes foram importantes no processo evolutivo. Sobre
este assunto, considere as alternativas que se seguem:

0-0) mutaes produzem protenas defeituosas nas populaes animais e vegetais de dada espcie e,
portanto, so responsveis por processos de extino em massa.
1-1) mutaes silenciosas, como as que ocorrem nos introns da molcula de DNA, no geram
modificaes no fentipo, assim no devem ser importantes do ponto de vista evolutivo.
2-2) espera-se que a deleo de nucleotdeos de sequncias gnicas na molcula de DNA altere a
seqncia da cadeia polipeptdica, produzindo assim variabilidade gentica.
3-3) ao observar os cdons para os aminocidos Alanina e Glicina, abaixo, possvel concluir que,
se o cdigo gentico degenerado, mutaes nesses cdons no influenciam no fentipo dos
organismos de uma populao.
Alanina: GCU, GCC, GCA, GCG
Glicina: GGU, GGC, GGA, GGG
4-4) as mutaes devem afetar as clulas somticas para influenciarem no aparecimento de
caractersticas vantajosas aos indivduos da prole.
FVVFF
Justificativa:
0-0) Falso: mutaes desvantajosas no acometem populaes de organismos, mas um ou poucos
indivduos da populao. Por serem eventos raros, no comprometem a perpetuao da espcie.
1-1) Verdadeiro: mutaes silenciosas, como aquelas que ocorrem em regies sem informao
gentica (introns), no alteram a estrutura da cadeia protica codificada pelos genes da molcula de
DNA.
2-2) Verdadeiro: as delees alteram a seqncia de leitura dos cdons e, consequentemente, dos
aminocidos presentes na cadeia polipeptdica.
3-3) Falso: apesar do cdigo gentico ser degenerado, somente mutaes no terceiro nucleotdeo
dos cdons ilustrados acima no
promoveriam modificaes no fentipo. Contudo, mutaes em outros nucleotdeos poderiam
alterar a cadeia protica.
4-4) Falso: modificaes nas clulas germinativas so responsveis pela herana gentica e o
aparecimento de fentipos vantajosos na prole.
Independentemente da corrente de pensamento, a origem da diversidade biolgica fascina pela sua
complexidade. Assim, organismos que aparentemente so muito diferentes entre si, podem
apresentar similaridades decorrentes do processo evolutivo que os aproximam taxonomicamente. Se
compararmos, por exemplo, a anatomia e o funcionamento do sistema circulatrio de vrios grupos
de vertebrados, podemos perceber que:

0-0) aves apresentam sistema circulatrio fechado, duplo e completo, sendo filogeneticamente mais
relacionadas aos peixes que aos rpteis.
1-1) a maioria dos rpteis possui circulao fechada e dupla, mas incompleta, como nos anfbios,
evolutivamente mais prximos.
2-2) peixes sseos e cartilaginosos possuem somente um trio e um ventrculo para impulsionar o
sangue venoso at as brnquias, onde este oxigenado.
3-3) anfbios e aves, apesar de distantes filogeneticamente, possuem em comum trs cavidades no
corao, dois trios e um ventrculo, e circulao fechada.
4-4) mamferos possuem corao com quatro cmaras, assim como os crocodilianos, no qual no
ocorre mistura de sangue venoso e arterial.
FVVFV
Justificativa:
0-0) Falso: peixes so mais antigos na escala evolutiva, sendo que as aves so filogeneticamente
mais relacionadas aos rpteis.
1-1) Verdadeiro: nos rpteis, exceto nos crocodilianos, h duas aurculas e um ventrculo separados
parcialmente por um septo incompleto, como nos anfbios.
2-2) Verdadeiro: os peixes possuem circulao simples, ou seja, somente circula sangue venoso no
corao; o sangue retorna ao corpo lentamente aps oxigenado nas brnquias.
3-3) Falso: aves possuem quatro cavidades no corao, assim como os mamferos.
4-4) Verdadeiro: crocodilos e mamferos possuem dois trios e dois ventrculos e circulao
fechada.
Plantas, animais e microrganismos representam um patrimnio gentico de extrema importncia
para o planeta, considerando tambm suas potencialidades biotecnolgicas. Sobre este assunto,
considere as assertivas abaixo:

0-0) para identificar genes de interesse, o DNA extrado das clulas pode ser e clonado
artificialmente milhares de vezes atravs de uma reao em cadeia da polimerase (PCR).
1-1) enzimas de restrio cortam o DNA aleatoriamente, de forma a produzir pequenos fragmentos
cromossmicos com as seqncias de nucleotdeos desejadas.
2-2) antes de serem implantados em outros organismos, os genes de interesse so includos em
plasmdios, que funcionam como unidades de
transferncia.
3-3) plantas e animais transgnicos no possuem a capacidade de se recombinar com espcies
selvagens no ambiente.
4-4) vacinas de DNA se constituem de genes do agente patolgico que, aps includos nas clulas
do indivduo vacinado, sero expressos e induziro a produo de anticorpos contra os antgenos
gerados.
VFVFV
Justificativa:
0-0) Verdadeiro: aps extrado das clulas, o DNA multiplicado in vitro (clonado) com auxlio de
uma DNA polimerase, da o nome dado a tcnica de PCR.
1-1) Falso: enzimas de restrio cortam o DNA em um locus especfico, em reao do tipo
chavefechadura.
2-2) Verdadeiro: plasmdios so elementos genticos de origem bacteriana onde so armazenados os
genes de interesse para transferncia entre organismos.
3-3) Falso: organismos transgnicos tm sua capacidade reprodutiva preservada.
4-4) Verdadeiro: genes de um vrus, por exemplo, que fossem inseridos na clula do hospedeiro
seriam expressos de forma independente do cromossomo celular, produzindo protenas (antgenos)
que induziriam a ativao de clulas B produtoras de anticorpos.
O novo cdigo florestal, proposto no congresso nacional brasileiro, diminui de 30 m para 15 m a
proteo das margens dos riachos com mais de 5 m de largura, nas reas de proteo permanente
(APPs). Sobre os problemas enfrentados para garantir a conservao e preservao ambiental,
considere as alternativas abaixo:

0-0) Manguezais, como os que entrecortam a cidade do Recife, no so consideradas reas de


proteo permanente, pois abrigam uma pobre diversidade biolgica.
1-1) uma explorao econmica sustentvel, mesmo nas margens de rios e nascentes de reas de
proteo permanente, no provoca danos ambientais e, portanto, deveria ser estimulada.
2-2) queimadas para produo de pastos eliminam sais minerais no solo, que seriam absorvidos nas
razes das plantas e transportados atravs do floema para as partes areas.
3-3) caso o descarte de resduos de indstrias em fontes de gua potvel provoque a extino de um
organismo consumidor primrio em uma cadeia alimentar, seus consumidores secundrios e
tercirios tambm podero ser afetados.
4-4) a cultura de plantas in vitro com adio de fitormnios como, por exemplo, as auxinas, que
estimulam o desenvolvimentos dos frutos, pode ser uma forma de preservar espcies de plantas
ameaadas.
FFFVV
Justificativa:
0-0) Falso: Manguezais so ecossistemas ricos e protegidos como reas de Proteo Permanente.
1-1) Falso: reas de proteo permanente possuem o objetivo de resguardar parcelas do ambiente
natural da interferncia humana e, portanto, no admitem qualquer tipo de explorao econmica.
2-2) Falso: o xilema carreia gua e sais minerais do solo s partes areas.
3-3) Verdadeiro: a extino de um organismo de uma cadeia alimentar, independente do nvel
trfico, provoca desequilbrio ecolgico, de forma que os outros organismos tambm podero ser
extintos.
4-4) Verdadeiro: a cultura de plantas in vitro, estimuladas por diferentes tipos de hormnios
vegetais, como o citado acima, tem sido utilizada na pesquisa e preservao de diferentes espcies
de plantas.
As microalgas tm sido apresentadas como as principais fontes de biodiesel no futuro, uma vez que
boa parte de sua massa seca leo. Considerando a biologia desses organismos e o impacto dessa
tecnologia para o meio ambiente, correto afirmar:

0-0) microalgas so seres unicelulares com parede celular celulsica, que habitam os oceanos como
parte do fitoplncton marinho e constituem a base da cadeia alimentar desse ambiente.
1-1) muitas microalgas como os dinoflagelados produzem toxinas, o que elimina a possibilidade de
serem utilizadas como fonte de biodiesel.
2-2) o depsito do CO2 liberado pelas indstrias em tanques de cultivo de microalgas, como
reagente para fotossntese, poderia diminuir os danos a camada de oznio.
3-3) a produo de biodiesel a partir de microalgas tambm vantajosa frente ao de plantas
oleaginosas, uma vez que as primeiras no necessitam de vastas reas de cultivo.
4-4) considerando o clima nordestino e as necessidades metablicas das microalgas, a regio do
semi-rido uma potencial rea de cultivo e produo de biodiesel.
VFVVV
Justificativa:
0-0) Verdadeiro: as microalgas so seres fotossintetizantes e produtores na cadeia alimentar, com as
caractersticas destacadas.
1-1) Falso: a utilizao de microalgas para obteno de leo e produo de biodiesel independe da
capacidade de certas espcies em gerar toxinas.
2-2) Verdadeiro: o CO2 poderia ser convertido em oxignio pelas microalgas, diminuindo os danos
a atmosfera.
3-3) Verdadeiro: o cultivo de microalgas pode ser realizado em tanques que ocupam reas pequenas
em comparao com plantas cultivadas no campo.
4-4) Verdadeiro: microalgas so seres auttrofos; para realizar a fase clara da fotossntese dependem
da irradiao solar, que disponvel na maioria do ano no semi-rido nordestino.
Vrias espcies animais no Brasil e na Amrica do Sul esto na lista de animais ameaados de
extino como, por exemplo, o Veado-catingueiro e a Ararinha azul, hoje encontrados raramente no
semi-rido nordestino. Sobre este assunto, considere as alternativas abaixo:

0-0) uma das indicaes da extino de uma espcie animal a captura freqente de indivduos
jovens, quando comparado com o nmero de adultos ou velhos capturados.
1-1) a coleta de espcies ameaadas no Brasil por turistas, para colees particulares no exterior,
deve ser estimulada como forma de preservao.
2-2) a expanso da atividade agropecuria, como por exemplo a da cana-de-acar em vrios
estados brasileiros, pode ser apontada como uma das causas da extino de espcies da fauna
brasileira.
3-3) manter animais da fauna ameaados de extino em zoolgicos, uma forma de preservar
espcies.
4-4) a procriao em cativeiro de espcies ameaadas e posterior soltura no ambiente, no uma
alternativa vivel, considerando a domesticao do animal.
VFVVF
Justificativa:
0-0) Verdadeiro: a captura freqente de animais jovens mostra que os animais no esto chegando
fase adulta, possivelmente devido caa ou destruio de seu habitat natural.
1-1) Falso: a coleta e exportao de espcies da fauna brasileira por turistas constitui crime de
biopirataria.
2-2) Verdadeiro: a expanso de pastagens e de reas de cultivo, por exemplo, produzem danos
srios ao ambiente natural e s espcies que nele habitam, o que contribu para a extino de
espcies.
3-3) Verdadeiro: zoolgicos possuem a funo de educao ambiental e tambm de manuteno de
espcies ameaadas.
4-4) Falso: tal procedimento tem sido realizado para minimizar o impacto humano sobre as
populaes de animais selvagens ameaados de extino, que, de maneira geral, no so,
verdadeiramente domesticveis .
Apesar do aumento da expectativa de vida do brasileiro, as principais causas de mortes no planeta
ainda se devem a doenas infecciosas comuns, especialmente nos pases em desenvolvimento. A
Secretaria Estadual de Sade de Pernambuco, por exemplo, registrou de janeiro a agosto de 2010,
552 casos suspeitos de leptospirose, sendo 92 confirmados. Sobre esta doena, considere as
alternativas:

0-0) a leptospirose causada por organismos sem carioteca ou mitocndrias, e com uma nica
molcula de DNA circular em seu interior.
1-1) as chuvas, como as que arrasaram cidades como Barreiros, no litoral sul pernambucano, no
influenciam no aumento no nmero de casos da doena.
2-2) a leptospirose considerada uma endemia, ou seja, est limitada s regies norte e nordeste do
Brasil.
3-3) a leptospirose tem o rato como principal veiculador da doena, atravs de mordeduras
desferidas na pele.
4-4) assim como a leptospirose, doenas como a amebase e clera, poderiam ser evitadas com a
adoo preventiva de prticas higinicosanitrias.
VFFFV
Justificativa:
0-0) Verdadeiro: a doena causada por bactrias, organismos com as caractersticas acima
descritas.
1-1) Falso: enchentes e alagamentos carregam lixo e esgoto onde encontrada a bactria, de forma
que aumentam a incidncia de casos da doena.
2-2) Falso: a doena ocorre em vrias regies do pas, particularmente no perodo de chuvas, em
reas onde o escoamento de gua e esgoto deficiente produzindo alagamentos.
3-3) Falso: a urina do rato contamina a gua com a bactria que atravessa a pele, principalmente
atravs de ferimentos abertos.
4-4) Verdadeiro: a existncia de esgoto sanitrio e gua tratada, so exemplos de prticas que
poderiam evitar as doenas acima.
Leia as notcias abaixo:

Dezessete hospitais de Braslia esto


contaminados com bactria resistente a
antibiticos.
Jornal Zero Hora
...bactrias presentes na boca de tubares
tigre e cabea-chata, apontados como
responsveis pelos ataques na costa de
Pernambuco, so resistentes aos
antibiticos...
Jornal do Comrcio

Sobre este assunto, considere as alternativas abaixo:

0-0) Frederick Griffith mostrou que se duas linhagens da bactria Streptococcus pneumoniae, uma
viva e no patognica (1) e outra patognica (2), esta morta pelo calor, so misturadas e injetadas
em um rato, como ilustrado abaixo, o animal morre. Assim, pode-se concluir que os mecanismos de
transferncia gentica entre as duas bactrias, tambm poderiam explicar a obteno de resistncia a
antibiticos por algumas bactrias encontradas em hospitais.

1-1) bactrias que nunca tomaram contato com antibiticos tambm podem ser naturalmente
resistentes aos mesmos.
2-2) a automedicao de antibiticos pode determinar a seleo de bactrias resistentes como parte
de um processo de seleo natural, em que quelas mais aptas sobrevivem enquanto que as
susceptveis so eliminadas.
3-3) quando se reproduzem em um tubo de ensaio, bactrias de uma nica espcie produzem clones,
caso no haja influncia de fatores qumicos ou fsicos que possam induzir mutaes.
4-4) vtimas sobreviventes de incidentes com tubares so igualmente susceptveis a infeces por
bactrias resistentes e no resistentes no ambiente hospitalar.
VVVVF
Justificativa:
0-0) Verdadeiro: o experimento realizado pela primeira vez por Frederick Griffith, ilustra a
transformao gentica bacteriana.
1-1) Verdadeiro: a existncia de genes de resistncia faz parte do processo evolutivo bacteriano,
como o caso das bactrias presentes na boca de tubares, que nunca tomaram contato com
antibiticos.
2-2) Verdadeiro: o uso indiscriminado de antibiticos seleciona as estirpes resistentes que passam a
prevalecer na populao, aumentando o risco de disseminao de seus genes de resistncia entre
bactrias de diferentes espcies.
3-3) Verdadeiro: bactrias se reproduzem por bipartio, gerando clones.
4-4) Falso: apesar de bactrias no resistentes a antibiticos tambm causarem enfermidades,
quelas resistentes produzem maior risco para o tratamento.
O britnico Robert Edwards, responsvel pela criao da tcnica de fertilizao in vitro, foi o
grande ganhador do prmio Nobel de medicina de 2010. Tal tcnica permitiu recentemente a uma
brasileira que no poderia gerar filhos, fecundar seu vulo com o espermatozide do marido in vitro
e, em seguida, utilizar sua me como barriga de aluguel para gerar o filho por inseminao artificial,
como ilustrado abaixo.
Sobre este assunto, considere as alternativas a seguir:

0-0) genealogicamente, a av no compartilha qualquer caracterstica gentica com o neto gerado,


apesar de ter sido gestado pela mesma.
1-1) caso a me biolgica seja hemoflica, uma doena causada por um alelo recessivo ligado ao
cromossomo X, e tenha um menino, este ser hemoflico.
2-2) as clulas tronco do embrio, mostradas na figura, em 1, so indiferenciadas e poderiam ser
utilizadas em terapias para corrigir leses em rgos vitais.
3-3) aps a inseminao artificial e implantao do embrio, este desenvolve-se formando
blastocisto, cujas as clulas perifricas chamadas de trofoblasto, auxiliam na formao da placenta.
4-4) a reposio hormonal de estrgeno em mulheres que chegaram menopausa, possibilita s
mesmas ter filhos em idades mais avanadas.
FVVVF
Justificativa:
0-0) Falso: genealogicamente, o filho gerado (segunda gerao) possui caractersticas herdadas dos
pais e dos avs, o que inclui a av que foi me de aluguel.
1-1) Verdadeiro: se a mulher tiver um menino, bastaria a presena de um alelo da doena no
cromossomo X para o fentipo de hemoflico.
2-2) Verdadeiro: embries carregam clulas tronco que tm sido utilizadas experimentalmente em
terapias de doenas graves, como aquelas que acometem o sistema nervoso central.
3-3) Verdadeiro: a blstula ou blastocisto formado aps a mrula e antes da gastrulao; o
trofoblasto libera gonadotrofina corinica, mantendo os nveis de progesterona que sustentam a
gravidez e tambm d origem placenta.
4-4) Falso: a reposio de estrognio diminui alguns sintomas da menopausa, mas no restaura a
ovulao.
A Lei Seca mudou o comportamento de muitos brasileiros que tinham por hbito ingerir bebidas
alcolicas e dirigir, o que aumentava significativamente o nmero de acidentes de trnsito. Sobre
este assunto, considere as alternativas a seguir:

0-0) os acidentes de trnsito causados por pessoas alcoolizadas ocorrem porque o lcool provoca
relaxamento e bom humor, levando a diminuio da ateno no volante.
1-1) a ingesto de lcool estimula o sistema nervoso central provocando a abertura dos canais de
clcio nas sinapses e o aumento da liberao de neurotransmissores.
2-2) uma vez que o lcool chega corrente sangunea, a ingesto de gua ou comida no elimina
seus efeitos no organismo.
3-3) aps ingerir freqentemente bebidas alcolicas, o organismo ganha tolerncia, assim somente
causa dependncia em pessoas mais fracas para bebida.
4-4) o consumo moderado de vinho tinto, sob orientao mdica, ou ainda de suco de uvas
vermelhas, auxilia na eliminao de gorduras como o LDL da corrente sangunea, prevenindo
doenas cardiovasculares.
FFVFV
Justificativa:
0-0) Falso: os sintomas provocados pela ingesto de lcool que levam aos acidentes so a
coordenao reduzida, a euforia, o prejuzo de
julgamento, humor instvel, sonolncia, dentre outros.
1-1) Falso: o lcool provoca a depresso do SNC, inibio da abertura dos canais de clcio e da
liberao de neurotransmissores.
2-2) Verdadeiro: uma vez na corrente sangunea, o lcool exerce seus efeitos sobre o SNC.
3-3) Falso: a ingesto freqente de lcool provoca dependncia, independente do grau de resistncia
da pessoa aos seus efeitos no organismo.
4-4) Verdadeiro: a ingesto moderada de vinho tinto produz os benefcios descritos, prevenindo a
arteriosclerose, assim como o consumo do suco de uva, devido a presena de flavonides.
Em Recife, o Centro de Hemoterapia de Pernambuco (HEMOPE) realiza anualmente campanhas de
doao de sangue, com vistas ao abastecimento dos hospitais e atendimento s pessoas que
necessitam de transfuso sangunea. Sobre este assunto, considere as alternativas abaixo:

0-0) pessoas que afirmam ter utilizado drogas injetveis trinta dias antes podero ser impedidas de
doar sangue, porque os pacientes receptores podero se tornar viciados.
1-1) a transfuso de plaquetas geralmente realizada em pessoas hospitalizadas com dificuldades
de coagulao sangunea.
2-2) pessoas com sangue do tipo AB, possuem ambos os alelos em co-dominncia e anticorpos anti-
A e anti-B.
3-3) ao tentar doar sangue, Rodrigo descobriu que pessoas como ele que j tiveram hepatite B no
podem ser doadores, uma vez que o vrus
causador da doena realiza ciclo lisognico e pode estar incubado.
4-4) Mariana praticou sexo sem preservativo, mas, para se precaver, realizou no dia seguinte um
teste para deteco de anticorpos anti-HIV, cujo resultado saiu logo a seguir e foi negativo, de forma
que est apta a doar sangue.
FVFVF
Justificativa:
0-0) Falso: drogas injetveis utilizadas um ms antes da doao, no so mais detectveis no sangue
ou transmitidas atravs deste aos pacientes receptores; contudo, tal hbito aumenta o risco de
contaminao com doenas que se transmitem pelo sangue, como a AIDS.
1-1) Verdadeiro: a exposio das plaquetas ao colgeno leva a formao do cogulo, importante
para evitar sangramentos, particularmente em pacientes com dificuldade de coagulao sangunea,
como os leucmicos, por exemplo.
2-2) Falso: pessoas com sangue do tipo AB possuem alelos co-dominantes e antgenos A e B, mas
no anticorpos anti-A ou anti-B.
3-3) Verdadeiro: a Hepatite B, uma doena geralmente transmitida por via sexual ou contato com
agulhas ou sangue contaminado, causada pelo HBV, um vrus de DNA que incorpora seu material
gentico ao DNA humano e pode permanecer incubado por muitos anos.
4-4) Falso: considerando o perodo de janela imunolgica, um dia aps a relao sexual
desprotegida, Mariana ainda no teria anticorpos anti-HIV suficientes para serem detectados no
sangue e, consequentemente, o resultado do exame pode ser falso-negativo. recomendado que
aguarde pelo menos um ms antes de realizar o teste.
Em vrias partes do mundo, a tatuagem vista como moda e/ou livre expresso de pensamento e
comportamento, especialmente pelo pblico jovem. Sobre este assunto, observe a figura abaixo, que
mostra a regio da pele em que a tinta que colore as tatuagens injetada, e considere as assertivas
que se seguem:

0-0) o folheto germinativo que origina a camada da pele onde fixada a tatuagem, a mesma que
origina os vasos sanguneos.
1-1) apesar da constante renovao celular da epiderme, a tinta das tatuagens permanece na pele por
anos porque injetada na derme.
2-2) as tintas usadas nas tatuagens no so reconhecidas como corpos estranhos e, portanto, no
so eliminadas devido a resposta
imune do hospedeiro.
3-3) a exposio da pele tatuada ao sol no recomendada, pois estimula a produo de melanina
sobre a camada da pele onde injetada a tinta, dificultando sua visualizao.
4-4) tatuagens no so recomendadas a pessoas com diabetes, devido aos problemas de coagulao
sangunea, e a pessoas com o vrus HIV, devido ao risco de infeces.
VVFVV
Justificativa:
0-0) Verdadeiro: como mostrado na figura, a tinta injetada na derme, cuja origem embrionria a
mesma dos vasos sanguneos, a mesoderme.
1-1) Verdadeiro: no ocorre constante renovao celular na derme, como na epiderme, que
formada por glndulas, fibras colgenas, etc.,
2-2) Falso: aps a tatuagem ocorre reao inflamatria seguida de cicatrizao, mostrando que
ocorre reao imune; em alguns casos
tambm h reao alrgica.
3-3) Verdadeiro: o estmulo dos melancitos com a luz solar deixa a pele bronzeada, dificultando a
visualizao da tatuagem.
4-4) Verdadeiro: a dificuldade de coagulao sangunea atrapalha a cicatrizao; pessoas
HIVpositivas podem estar imunologicamente deficientes e, portanto, susceptveis a infeces
secundrias. Ainda, a reutilizao de agulhas pode transmitir o vrus a outras pessoas.
Colnquima e esclernquima so tecidos comumente encontrados em caules e razes. O colnquima
um tecido plstico, enquanto que o esclernquima um tecido elstico. Considere uma rvore e
seus galhos, em um dia de muito vento. Os galhos todos balanam vigorosamente. Voc acha que os
tecidos localizados internamente nos galhos devem ser plsticos ou elsticos? Qual tecido voc
espera encontrar no interior dos galhos? Explique sua escolha.
Estmatos so estruturas vegetais especializadas que ocorrem principalmente nas folhas e que
apresentam dois estados funcionais caractersticos, aberto e fechado. Diferentes condies
ambientais, apresentadas na tabela abaixo, acarretam a abertura ou fechamento dessas estruturas.

a) Preencha a tabela, identificando qual o comportamento que os estmatos tero em cada


condio apresentada.

Condio ambiental Comportamento dos estmatos


Intensidade luminosa Alta
Baixa
Suprimento de gua Alto
Baixo
Concentrao de CO2 Alta
Baixa

b) Explique um desses comportamentos (apenas um).


Para manter o pH sanguneo em limites compatveis com a sobrevivncia (7,35 < pH < 7,45), o
organismo lana mo de uma srie de mecanismos de controle. Um deles o sistema tampo do
bicarbonato, representado pela equao:

Levando-se em considerao a equao apresentada, qual o efeito sobre o pH sanguneo:

a) do vmito, com perda do contedo estomacal?


b) da diarreia, com perda do contedo intestinal?
Lisossomos so organelas importantes nos processos de digesto intracelular. Possuem enzimas
que catalisam a hidrlise de praticamente todos os tipos de macromolculas. Essas enzimas
funcionam em pH cido (em torno de 5), que o pH encontrado no interior dessas vesculas.
Sobre os lisossomos, responda:

a) Qual o nome geral dado s enzimas digestivas que ficam em seu interior?
b) Qual a importncia, para a sade da clula, de que essas enzimas funcionem bem apenas em pH
cido?
Um cruzamento de drosfilas (moscas-da-fruta) fmeas de olhos vermelhos com machos de olhos
brancos produziu, em F1, 100% de machos e fmeas de olhos vermelhos. A seguir, o
cruzamento de machos e fmeas de F1 produziu, na gerao F2, 75% de moscas com olhos
vermelhos (50% fmeas + 25% machos) e 25% de moscas de olhos brancos (todos machos).
Explique como surge essa desigualdade de fentipos.
Certos insetos apresentam um aspecto que os assemelha bastante, na cor e s vezes at na
forma, com ramos e mesmo folhas de algumas plantas. Esse fato de extrema utilidade para o
inseto, j que o protege contra o ataque de seus predadores. Faa uma interpretao do processo
evolutivo que os levou a tal situao adaptativa:

a) do ponto de vista da teoria do Uso e Desuso, de Lamarck.


b) do ponto de vista da teoria da Seleo Natural.
consensual, entre pesquisadores em biologia, que a vida iniciou no ambiente marinho e que
nele se formou a maioria dos grupos/filos animais. A colonizao do ambiente terrestre, nesse
contexto, representou um enorme salto evolutivo. Essa colonizao provavelmente ocorreu em
perodos geolgicos distintos, em eventos independentes para diferentes grupos. Dentre as
principais barreiras para a colonizao do ambiente terrestre esto os problemas de perda de
gua pela respirao e pela superfcie do corpo e os mecanismos de sustentao do corpo.
Preencha a tabela com as caractersticas que permitiram/permitem o uso do ambiente terrestre e
que representem solues aos problemas indicados no cabealho das colunas para os grupos
taxonmicos listados nas linhas. Se, para um grupo taxonmico, uma ou mais dessas barreiras
no tiver sido efetivamente resolvida, utilize a sigla ADA (=ainda dependente do ambiente
aqutico).

Perda de gua Sustentao do corpo


pela respirao pela superfcie do corpo
Cnidaria
Insecta
Aracnae
Peixes
Anfbios
Rpteis
Na sndrome de Down, geralmente ocorre uma trissomia do cromossomo 21, ou seja, a pessoa
apresenta trs cpias (cromtides) desse cromossomo, ao invs de apenas duas. Na maioria dos
casos de sndrome de Down, a terceira cpia do cromossomo 21 originada devido a um erro
durante a formao dos gametas do pai ou da me. Que tipo de erro, durante a formao dos
gametas do pai ou da me do portador de sndrome de Down, leva a uma trissomia como essa?
Com o aumento do comrcio globalizado entre pases, damos oportunidade para que
espcies que outrora existiam em uma regio do planeta se dispersem para reas onde
no existiam previamente. Foi assim com o mexilho- dourado, uma espcie de molusco
originrio do sudeste asitico que encontrou condies perfeitas para sua sobrevivncia em
guas continentais da bacia do Prata. Essa espcie, provavelmente, veio de carona na
gua usada como lastro em navios mercantes. Conseguiu se estabelecer em rios
argentinos, brasileiros e uruguaios, causando enormes problemas ambientais e econmicos.
O sucesso de estabelecimento dessa espcie na Amrica do Sul (e de outras espcies
consideradas exticas em locais onde no existiam previamente) depende da inter- relao
entre dois conceitos ecolgicos: nicho ecolgico e habitat. Assim:
a) Defina esses dois conceitos (nicho ecolgico e habitat) de forma objetiva.

Nicho ecolgico
Habitat:

b) Explique como uma anlise integrada desses dois conceitos permite prever o risco de
colonizao de um determinado ambiente por uma espcie extica.
Parasitas utilizam diferentes estratgias para sobreviver e proliferar. Plasmodium falciparum
(causador da malria) e Taenia saginata (causadora da tenase) precisam de dois diferentes
hospedeiros para completar seus ciclos de vida. Para cada um desses parasitas, cite o local,
dentro dos organismos hospedeiros, onde se alojam, e explique a importncia de se alojarem
nesses locais para o sucesso de seus ciclos de vida.

Plasmodium:
Taenia:
Aps publicar os resultados de seus experimentos que levaram construo da primeira clula
bacteriana controlada por um genoma sinttico, Craig Venter declarou: - Esta a primeira criatura
do planeta capaz de se replicar cujo pai um computador.
Em relao a esse experimento inovador, correto afirmar que:

(A) o genoma sinttico construdo equivalia ao de uma bactria com um dos maiores genomas
conhecidos.
(B) um erro na insero de uma nica base nitrogenada no genoma sinttico pode prejudicar o
funcionamento do genoma.
(C) o genoma sinttico desenvolveu seu prprio citoplasma.
(D) o DNA da bactria hospedeira foi retirado de seu ncleo celular.
(E) as bactrias so organismos especiais para esse tipo de experimento por no apresentarem
recombinao gentica.
B
A farinha popularizada com o nome de rao humana o resultado de uma mistura de produtos
base de fibras. Uma receita amplamente difundida dessa farinha contm os seguintes componentes:
fibra de trigo, leite de soja em p, linhaa marrom, acar mascavo, aveia em flocos, gergelim com
casca, grmen de trigo, gelatina sem sabor, guaran em p, levedura de cerveja e cacau em p.
Com base na receita e em seus constituintes, assinale com V (verdadeiro) ou F (falso) as afirmaes
que seguem.

[ ] A receita rica nas fontes alimentares de vitaminas do complexo B.


[ ] A levedura de cerveja utilizada em pesquisa como modelo experimental.
[ ] A receita rica nas fontes alimentares das vitaminas A e C.
[ ] O acar mascavo no apresenta restrio de uso pelos diabticos dependentes de insulina.
A sequncia correta de preenchimento dos parnteses, de cima para baixo,
(A) V - V - F - F.
(B) V - F - V - V.
(C) F - V - V - F.
(D) F - V - F - V.
(E) V - F - V - F.
A
A figura abaixo mostra dois peixes identificados pelos nmeros 1 e 2 que apresentam adaptaes
fisiolgicas para sobreviver em diferentes ambientes. As setas indicam o fluxo de sais e de gua em
cada peixe.

Considere as seguintes afirmaes, sobre caractersticas desses peixes.


I - O peixe 1 hipertnico em relao ao ambiente.
II - O peixe 1 capta sais por transporte ativo.
III - O peixe 2 perde gua para o meio por osmose.

Quais esto corretas?

(A) Apenas I.
(B) Apenas II.
(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.
E
Assinale a alternativa que preenche corretamente as lacunas do enunciado abaixo, na ordem em que
aparecem.
Os ........ encontram-se nos centros organizadores de ........ da maioria dos eucariontes e esto
envolvidos na formao do fuso mittico.

(A) ribossomos - microfilamentos


(B) lisossomos - filamentos intermedirios
(C) centrolos - microtbulos
(D) ribossomos - filamentos intermedirios
(E) centrolos - microfilamentos
C
A coluna da esquerda, abaixo, apresenta diferentes fases da meiose; a da direita, as fontes de
variabilidade gentica de duas dessas fases.
Associe adequadamente a coluna da direita da esquerda.

1- Prfase I
2- Anfase I
3- Prfase II
4- Metfase II
5- Anfase II

[ ] permutao
[ ] segregao independente de homlogos

A sequncia correta de preenchimento dos parnteses, de cima para baixo,


(A) 1 e 2.
(B) 2 e 3.
(C) 3 e 4.
(D) 4 e 5.
(E) 5 e 1.
A
A fotossntese consiste em um processo metablico pelo qual a energia da luz solar utilizada na
converso de dixido de carbono e de gua em carboidratos e oxignio.
Com relao a esse processo, considere as seguintes afirmaes.

I - A produo de carboidratos ocorre na etapa fotoqumica.


II - A gua a fonte do oxignio produzido pela fotossntese.
III - A etapa qumica ocorre no estroma dos cloroplastos.

Quais esto corretas?


(A) Apenas I.
(B) Apenas II.
(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.
D
Assinale a alternativa que preenche corretamente as lacunas do enunciado abaixo, na ordem em que
aparecem.
A ........ o processo no qual os folhetos germinativos embrionrios so formados. Nos vertebrados,
o folheto denominado ........ originar o corao, os vasos e as clulas sanguneas.

(A) clivagem - ectoderma


(B) gastrulao - mesoderma
(C) neurulao - endoderma
(D) clivagem - endoderma
(E) gastrulao - ectoderma
B
O esquema abaixo mostra alguns dos componentes do tecido conjuntivo frouxo.

Assinale a alternativa correta em relao ao tecido conjuntivo frouxo.

(A) Nele no ocorre vascularizao.


(B) Ele apresenta distribuio corporal restrita.
(C) A clula marcada com a seta 1 um fibroblasto.
(D) A clula marcada com a seta 2 uma hemcia.
(E) As fibras assinaladas com as setas 3 so de actina e miosina.
C
O Programa Nacional de Imunizao do Ministrio da Sade disponibiliza, na rede pblica, vacinas
imprescindveis para a sade de crianas de diferentes idades.
Assinale a alternativa que apresenta apenas doenas virais que podem ser prevenidas pelo uso de
vacinas previstas pelo programa citado.

(A) tuberculose - hepatite B - difteria - meningite


(B) poliomielite - ttano - pneumonia - febre amarela
(C) sarampo - febre tifide - coqueluche - hepatite B
(D) poliomielite - rubola - caxumba - sarampo
(E) difteria - ttano - coqueluche - varicela
D
Diversos rgos vegetais fazem parte de nossa alimentao. Em termos biolgicos, a abbora, o
tomate e o pimento constituem:

(A) frutos verdadeiros.


(B) pseudofrutos.
(C) legumes.
(D) infrutescncias.
(E) frutos partenocrpicos.
A
Em 1993, o pesquisador e surfista Kary Mullis ganhou o prmio Nobel de qumica pela descoberta
e aplicao das propriedades da enzima Taq polimerase, isolada da bactria Thermus aquaticus,
encontrada em fontes hidrotermais. A enzima realiza a duplicao artificial do DNA por meio de
uma reao em cadeia da polimerase (PCR), e tal propriedade tem sido aplicada em testes de
mapeamento gentico humano. Sobre os processos de replicao celular e in vitro do DNA,
considere as proposies que se seguem.

0-0) Devido ao tamanho relativamente menor e mais alta taxa metablica, organismos procariotos
replicam o DNA mais rapidamente que organismos eucariotos.
1-1) A enzima DNA polimerase pareia novos nucleotdeos a cada uma das fitas mes do DNA,
medida que a forquilha de replicao promove a separao das mesmas no ncleo celular.
2-2) Na diviso celular, uma das fitas novas do DNA ser produzida de forma contnua, no sentido
oposto forquilha de replicao, enquanto a outra ser produzida em partes, depois unidas por
enzimas.
3-3) Na PCR, a separao da dupla fita do DNA realizada elevando-se a temperatura at prximo
de 100oC; o incio da replicao depende da unio de oligonucleotdeos especficos ao DNA.
4-4) A confiabilidade dos testes de paternidade com a anlise do DNA chega a 99,9 %, porque um
grande nmero de genes de todos os cromossomos do suposto pai e do suposto filho so analisados.
VVFVF
Justificativa:
0-0) Verdadeiro: seres procariotos, menores em dimenso celular, possuem alta taxa metablica em
comparao aos eucariotos, que repercute na rpida absoro de nutrientes que so transformados
no interior da clula e utilizados na realizao de trabalho, como a replicao do DNA.
1-1) Verdadeiro: a replicao do DNA semiconservativa, e, portanto, cada fita me do DNA
pareada a uma nova fita.
2-2) Falso: as fitas do DNA so antiparalelas; na replicao a fita contnua produzida no mesmo
sentido do movimento da forquilha de replicao.
3-3) Verdadeiro: na PCR, a alta temperatura quebra temporariamente as ligaes de hidrognio
entre as fitas de DNA, permitindo a unio de oligonucleotdeos (primers) pelo DNA polimerase, que
iro compor a nova cadeia da dupla fita.
4-4) Falso: geralmente so comparadas unidades repetidas de pares de bases (microssatlites) em
cerca de apenas 13 locos polimrficos dos cromossomos.
A energia no pode ser criada ou destruda, mas apenas transformada de uma forma a outra.
Considerando que as reaes metablicas so o meio que a clula possui para transformar energia
potencial em energia cintica e, portanto, realizar trabalho celular, considere as proposies a
seguir.

0-0) A participao de enzimas no conjunto das reaes metablicas celulares diminui a energia de
ativao dos compostos reagentes.
1-1) Alm de energia, a oxidao de cidos graxos e carboidratos, tanto na respirao aerbica de
eucariotos quanto na fermentao de procariotos, gera como produtos finais gs carbnico e gua.
2-2) A fermentao de carboidratos gera um saldoenergtico de 2 ATPs, que resulta da transferncia
de fosfatos inorgnicos para molculas de adenosina difosfato.
3-3) As reaes do ciclo do cido ctrico que ocorrem na matriz mitocondrial liberam ons
hidrognio que convertem as coenzimas NAD e FAD em suas formas reduzidas.
4-4) A teoria quimiosmtica aponta que a passagem de ons H+ atravs da enzima ATP sintetase,
localizada na membrana das cristas mitocondriais, responsvel pelo principal saldo energtico da
respirao celular.
VFVVV
Justificativa:
0-0) Verdadeiro: as enzimas aumentam a velocidade das reaes qumicas nos sistemas biolgicos,
diminuindo a energia de ativao necessria transformao dos compostos metabolizados.
1-1) Falso: a fermentao gera um produto final de alta energia a partir do cido pirvico, como o
etanol ou o cido ltico.
2-2) Verdadeiro: a equao qumica que resume a reao dada por: C6H12O6 + 2 ADP +Pi 2
C3H4O3 + 2 ATP + 2 NADH + 2H+
3-3) Verdadeiro: as coenzimas NAD e FAD se tornam reduzidas em NADH e FADH2. Taisons
hidrognios so carreados por essas coenzimas para as cristas mitocondriais e participam da cadeia
de transporte de eltrons (CTE).
4-4) Verdadeiro: a enzima ATP sintetase adiciona fosfatos inorgnicos s molculas de ADP,
gerando ATP, medida que os prtons hidrognios a atravessam. A reao de hidrognios com o
oxignio (ltimo aceptor daCTE) produz gua no interior celular.
Joana sofre um acidente automobilstico e machucase bastante devido ao no uso do cinto de
segurana. Durante o perodo de sua recuperao, ocorre a regenerao de seus tecidos e rgos
lesados e a cicatrizao de suas feridas. Sobre este assunto, considere as proposies a seguir.

0-0) A produo em excesso de paratormnio e a deficincia de vitamina A deixam a pessoa mais


susceptvel a fraturas nos casos de acidentes.
1-1) Leses teciduais induzem processos de regenerao que promovem a substituio das clulas
danificadas por outras do mesmo rgo; no incio da mitose, tais clulas condensam os
cromossomos evitando-se que sofram quebras.
2-2) As cicatrizes que geralmente resultam de acidentes so formadas devido atividade de
condroblastos que migram para a regio danificada, produzindo matria amorfa e tecido conjuntivo
fibroso.
3-3) Neurnios podem permanecer na interfase do ciclo celular por toda a vida; da a dificuldade na
regenerao de reas do encfalo afetadas por acidentes.
4-4) Para evitar a perda excessiva de sangue, as plaquetas aderem s fibras colgenas dos vasos
sanguneos nas regies lesadas, o que culmina com a converso de fibrinognio em fibrina.
VVFVV
Justificativa:
0-0) Verdadeiro: o excesso de paratormnio induz o aumento de osteoclastos que digerem a matriz
ssea; a deficincia de vitamina A aumenta a atividade de osteoclastos em relao de osteoblastos,
provocandofraqueza ssea (osteoporose) e, portanto, a chance de fraturas.
1-1) Verdadeiro: na regenerao, ocorre substituio de clulas; o incio da mitose marcado pela
prfase, fase em que os cromossomos se condensam.
2-2) Falso: os fibroblastos so as clulas que participam do processo de cicatrizao formando
matria amorfa e tecido fibroso.
3-3) Verdadeiro: clulas neuronais adultas geralmente no completam o ciclo celular, permanecendo
na interfase.
4-4) Verdadeiro: a tromboplastina liberada pelas clulas catalisa a converso de protrombina a
trombina. Esta converte o fibrinognio em fibrina.
O princpio de Hardy-Weinberg tem sido utilizado pelos evolucionistas como uma importante
ferramenta para compreender as frequncias gnicas nas populaes dos seres vivos. Sobre esse
assunto, considere as afirmativas a seguir.

0-0) A quantidade de indivduos ou o isolamento reprodutivo de uma parte da populao no


interferem no equilbrio gnico.
1-1) Em uma populao sob influncia de processos evolutivos, tais como migrao e deriva gnica,
as frequncias de alelos nos descendentespermanecem inalteradas.
2-2) Como so fenmenos raros, as mutaes no provocam alterao nas frequncias de alelos de
uma populao com inmeros tipos de cruzamentos possveis.
3-3) Na hiptese de prevalecerem na populao cruzamentos entre indivduos com caractersticas
fenotpicas vantajosas, a mesma tende a permanecer em equilbrio gnico.
4-4) Supondo que as frequncias dos alelos A e a, no ligados ao sexo, numa populao em
equilbrio gnico, sejam, respectivamente, 0,7 e 0,3, a probabilidade de se formar na populao
indivduos AA de 49 %.
FFFFV
Justificativa:
0-0) Falso: a populao deve ser grande, de modo que possam ocorrer todos os cruzamentos
possveis. O isolamento reprodutivo de parte da populao tambm interferiria no equilbrio gnico.
1-1) Falso: as frequncias de alelos nos descendentes devem permanecer inalteradas somente
quando no h influncia de fatores evolutivos, o que no o caso.
2-2) Falso: mutaes so fatores evolutivos que podem interferir nas frequncias allicas.
3-3) Falso: uma das condies para o equilbrio gnico que haja cruzamentos ao acaso entre
indivduos de diferentes gentipos napopulao. Assim, no deve haver influncia de fatores
evolutivos como a seleo natural, que seleciona indivduos com caractersticas vantajosas ao longo
do tempo.
4-4) Verdadeiro: considerando a unio dos gametas: frequncia (A) 0,7 x a frequncia (A) 0,7 =
0,49 (49 %).
O uso de agrotxicos na lavoura tem por objetivo evitar algumas pragas agrcolas, que causam
grandes prejuzos econmicos. Contudo, esse uso feta tambm populaes naturais de insetos e
organismos, os quais muitas vezes poderiam realizar o controle natural das pragas. Considerando o
efeito dos agrotxicos nas populaes de insetos e nas suas relaes ecolgicas, observe o grfico
abaixo e analise as afirmaes a seguir.

0-0) A herbivoria dos insetos A e B transfere energia dos produtores para os demais nveis trficos
da cadeia alimentar.
1-1) O uso do agrotxico 1 diminuiu a populao de insetos pragas, enquanto que os insetos A
mostraram-se resistentes.
2-2) A populao de insetos A estabelece entre si uma relao ecolgica de sociedade, caracterizada
por organismos iguais geneticamente.
3-3) A populao de insetos A competiu com os insetos pragas, produzindo o controle biolgico
daqueles que sobreviveram ao agrotxico 1.
4-4) Os insetos pragas no so susceptveis ao agrotxico 2 e possuem uma relao ecolgica
negativa com a populao de insetos A.
VVFVV
Justificativa:
0-0) Verdadeiro: os insetos so consumidores primrios que captam energia a partir do consumo de
plantas (produtores) e transferem para os demais consumidores da cadeia alimentar.
1-1) Verdadeiro: a adio do agrotxico 1 (tempo 0) produz uma curva descendente populacional de
insetos pragas, acentuada aps 15 dias, que no interferiu na populao de insetos A.
2-2) Falso: Indivduos organizados em sociedades no so iguais geneticamente, ou seja, no so
clones.
3-3) Verdadeiro: a competio entre a populao aumentada de insetos A resistente ao agrotxico 1
e a populao residual de insetos pragas (aps a adio do agrotxico 1) produziu o controle
biolgico dos insetos pragas (competio interespecfica).
4-4) Verdadeiro: a populao de insetos pragas aumentou aps 45 dias e no foi susceptvel ao
agrotxico 2. Trata-se de uma relao ecolgica negativa, pois pelo menos uma espcie sofre
prejuzo em razo da competio entre si.
O plantio de rvores um valioso ensinamento s geraes futuras com vistas a contrabalancear os
efeitos em nosso planeta do acmulo de gases nocivos atmosfera. Considerando as taxas de
fotossntese e as trocas gasosas das plantas com o ambiente, observe o grfico abaixo e as
afirmativas que se seguem.

0-0) Plantas de sombra possuem ponto de compensao ftico mais baixo que plantas de sol,
pois necessitam de intensidades luminosas menores.
1-1) Quando todo o gs oxignio liberado na fotossntese consumido na respirao celular, a
planta no mais realiza trocas gasosas, independente da intensidade luminosa.
2-2) O ponto de compensao ftico, mostrado em B, representa a intensidade luminosa que as
plantas necessitam receber diariamente para poderem crescer.
3-3) Se a intensidade luminosa for inferior ao ponto de compensao ftico, a matria orgnica
produzida com a fotossntese ser insuficiente para a planta crescer.
4-4) Sob condies ideais, as taxas de fotossntese aumentam at atingir um ponto de saturao
luminosa, mostrado em A, no qual deixam de aumentar.
VFFVV
Justificativa:
0-0) Verdadeiro: plantas de sombra so menos dependentes da intensidade luminosa e, portanto,
apresentam pontos de compensao ftico (B) mais baixos.
1-1) Falso: as condies para que no haja trocas gasosas ocorrem quando todo o gs oxignio
liberado na fotossntese consumido na respirao, e todo o gs carbnico produzido na respirao
consumido na fotossntese, em uma dada intensidade luminosa.
2-2) Falso: as plantas necessitam receber intensidade luminosa superior ao ponto de compensao
ftico, mostrado em B, pelo menos por algumas horas ao dia, para crescerem.
3-3) Verdadeiro: com o aumento da intensidade luminosa, superior ao ponto de compensao ftico
(B), ocorre aumento da fotossntese e da produo de glicose como fonte energtica para o
crescimento da planta.
4-4) Verdadeiro: aps atingir o ponto de saturao luminosa (A), no ocorre incremento nas taxas de
fotossntese.
A popularizao de carros bicombustveis no Brasil fez o consumidor utilizar uma mquina
calculadora antes de abastecer o veculo, de forma a tentar prever a relao custo-benefcio no uso
do etanol ou da gasolina. Neste caso, a vantagem financeira ao abastecer com etanol real quando
seu valor no ultrapassa 70 % do valor da gasolina. Mas e o custo ambiental dessa escolha? Sobre
esse assunto, considere as afirmaes seguintes.

0-0) Nos meses de inverno, ocorre resfriamento do solo, e a conveco que dispersa os poluentes
para as camadas superiores da atmosfera interrompida.
1-1) So vantagens derivadas da utilizao de etanol em relao a gasolina, a maior eficincia
energtica e o fato de ser ele um combustvel renovvel.
2-2) As queimadas para o plantio da cana de acar causam poluio atmosfrica, mas boa parte do
gs carbnico liberado reabsorvido durante o crescimento da planta.
3-3) A utilizao de gasolina adulterada com resduos de enxofre libera gases nocivos camada de
oznio, tais como o dixido de enxofre.
4-4) A combusto da gasolina libera para a atmosfera monxido de carbono, o qual perigoso para
a sade humana, pois pode provocar asfixia.
VFVFV
Justificativa:
0-0) Verdadeiro: o fenmeno ocorre devido inverso trmica, que provoca acmulo de poluentes
prximo superfcie do planeta.
1-1) Falso: a gasolina apresenta uma maior eficincia energtica em relao ao etanol; ou seja, um
veculo abastecido com gasolina pode se deslocar por uma distncia maior.
2-2) Verdadeiro: o processo de fotossntese absorve gs carbnico, particularmente durante o
crescimento da planta.
3-3) Falso: o dixido de enxofre no est dentre os gases que provocam dano camada de oznio,
mas relacionado s chuvas cidas.
4-4) Verdadeiro: o monxido de carbono impede a ligao do oxignio hemoglobina.
O ambiente marinho possivelmente inclui a maior diversidade biolgica do planeta. Dentre os
organismos que habitam esse ecossistema, o ilustrado abaixo, popularmente conhecido como
caravela, bastante comum na regio costeira do nordeste brasileiro. Sobre as caractersticas do
filo ao qual pertence a caravela, considere as assertivas seguintes.

0-0) formada por uma colnia de diferentes plipos especializados, que exercem em conjunto
funes de flutuabilidade, captura da presa, defesa, dentre outras.
1-1) Inclui animais da classe Anthozoa (antozorios), como os corais, cujos plipos produzem um
esqueleto de carbonato de clcio que resiste mesmo aps a sua morte.
2-2) onvora, ou seja, se alimenta de animais e algas, que so arrastados para a cavidade
gastrovascular, onde ocorre a digestointracelular.
3-3) Possui o corpo formado por espculas, que no esto organizadas como um tecido verdadeiro; o
contato com as espculas pode produzir queimaduras na pele.
4-4) Pode reproduzir-se por brotamento ou sexualmente, mas as espcies so monicas, ou seja,
hermafroditas.
VVFFF
Justificativa:
0-0) Verdadeiro: a caravela (Classe Hydrozoa) tpico do filo Cnidaria e representa plipos de
diferentes espcies com diversas funes, que agem como uma colnia.
1-1) Verdadeiro: o filo inclui os antozorios, tais como as anmonas e os corais.
2-2) Falso: so carnvoros, com digesto extra e intracelular.
3-3) Falso: as caractersticas descritas so de organismos do filo Porfera, que possuem espculas e
hbito filtrador, como as esponjas, dentre outros.
4-4) Falso: h espcies monicas e diicas; tambm pode haver fecundao interna e externa.
No ano de 2011, um novo ataque de tubaro voltou a acontecer com um surfista que desobedeceu
aos avisos que proibiam a prtica do esporte em uma praia do Recife. Sobre esses animais,
considere as afirmaes seguintes.

0-0) So animais triblsticos, deuterostmios, metamerizados, com sistema digestrio completo e


presena de tubo nervoso dorsal durante o desenvolvimento embrionrio.
1-1) Pertencem ao filo dos protocordados, pois apresentam coluna vertebral cartilaginosa e no
ssea como os demais vertebrados.
2-2) Pertencem mesma classe das raias, ambos com sistema nervoso desenvolvido; na regio da
cabea, as ampolas de Lorenzine captam as correntes eltricas das presas.
3-3) Apresentam uma nadadeira dorsal proeminente, cauda heterocerca e bexiga natatria que
regula a profundidade na lmina dgua.
4-4) So diicos com fecundao interna; os machos apresentam um par de clspers que so
introduzidos na cloaca da fmea para transferncia espermtica.
VFVFV
Justificativa:
0-0) Verdadeiro: as caractersticas descritas so tpicas dos cordados.
1-1) Falso: a coluna vertebral cartilaginosa no os exclui como vertebrados do filo dos cordados.
2-2) Verdadeiro: os condrictes incluem tubares, caes, raias e quimeras. O sistema nervoso
complexo com regies bem diferenciadas, dentre elas, as ampolas de Lorenzine com a funo
descrita.
3-3) Falso: peixes cartilaginosos no apresentam bexiga natatria; a velocidade e a disposio das
barbatanas dos tubares garantem a sua flutuabilidade.
4-4) Verdadeiro: a reproduo dos tubares ocorre como descrito; algumas espcies so ovparas ou
ovovivparas.
A bactria Escherichia coli possui como habitat natural o intestino humano e o de vrios
gruposanimais. Contudo, algumas espcies so resistentes a antibiticos e geram infeces graves,
alm de intoxicaes alimentares. No ano de 2011, um surto epidmico causado por uma E. Coli, na
Alemanha, foi atribudo ao consumo de brotos de soja contaminados. Sobre esse assunto, observe a
figura abaixo e considere as proposies que se seguem.

0-0) A contaminao por fezes animais ou humanas de fontes naturais de gua ou reas cultivadas,
alm da falta de higiene na manipulao de alimentos, podem ser responsveis por surtos
epidmicos.
1-1) Uma E. coli comensal pode vir a se tornar patognica, devido insero de genes de outra
bactria atravs de um vrus bacterifago.
2-2) No ecossistema intestinal, bactrias no patognicas podem transferir plasmdios de resistncia
a antibiticos atravs de uma pili sexual para outras bactrias.
3-3) Os eosinfilos so fagcitos importantes ativados pela resposta imune no controle de infeces
bacterianas, como as que causaram a morte de pessoas na Alemanha.
4-4) O uso de antibiticos contra infeces bacterianas s indicado nos casos em que o organismo
humano no gera resposta imunolgica de defesa.
VVVFF
Justificativa:
0-0) Verdadeiro: o contato de alimentos cultivados com fezes no solo, ou atravs de mos
contaminadas, por falta de higiene pessoal, uma forma comum de contaminao.
1-1) Verdadeiro: durante o ciclo viral, um vrus bacterifago pode incluir, no capsdio
recmformado, fragmentos de DNA bacteriano, que podem ser transferidos para outra clula
(transduo).
2-2) Verdadeiro: o processo descrito a conjugao bacteriana, na qual uma pili sexual transfere
fragmentos de DNA de uma clula doadora para uma receptora.
3-3) Falso: eosinfilos so fagcitos importantes em infeces parasticas; neutrfilos so os
principais fagcitos ativados durante infeces bacterianas.
4-4) Falso: o uso de antibiticos visa diminuir a carga de patgenos que esto causando a infeco,
independentemente do estado imunolgico do hospedeiro.
Recentemente, o Ministrio da Sade havia limitado a 48 semanas o fornecimento gratuito da droga
interferon, atravs do Sistema nico de Sade (SUS), para pacientes infectados com o vrus da
hepatite C (HCV). Depois, aumentou este prazo para 72 semanas, beneficiando pacientes que no
obtiveram a cura da doena no prazo anterior. Considerando que este um vrus com material
gentico de RNA fita simples (cadeia positiva), protegido por um capsdio envelopado, observe a
figura abaixo e analise as proposies a seguir.

0-0) So possveis formas de transmisso das hepatites as tatuagens, transfuses sanguneas, picadas
de inseto e relaes sexuais desprotegidas.
1-1) Aps o desnudamento viral (1), o HCV sintetiza protenas do capsdio (2), e um RNA
intermedirio de cadeia negativa (b) serve de molde para replicao do RNA viral de cadeia positiva
(a).
2-2) O ciclo viral mostrado ltico, uma vez que, aps a sntese dos componentes da partcula viral,
ocorre montagem (3) e liberao dos vrions (4) para o meio extracelular.
3-3) A hepatite uma doena heptica aguda ou crnica; assim a deteco de anticorpos anti- HCV
pode indicar uma infeco atual ou anterior.
4-4) Vacinas utilizadas para prevenir infeces virais induzem a produo de anticorpos e clulas B
de memria, enquanto o tratamento com interferon impede a entrada do vrus nas clulas alvo.
FVVVF
Justificativa:
0-0) Falso: picadas de inseto no transmitem a hepatite.
1-1) Verdadeiro: as etapas descritas fazem parte do ciclo de replicao do vrus, mostradas na
figura.
2-2) Verdadeiro: o ciclo ltico, pois gera partculas virais completas (virons), que saem da clula
para infectar novos alvos.
3-3) Verdadeiro: a infeco induz a produo de anticorpos anti-HCV, mesmo aps a cura da
doena; tais anticorpos permanecem no organismo.
4-4) Falso: o tratamento com interferon ativa a resposta imune contra o vrus, destruindo clulas
infectadas.
Uma srie de verminoses acomete o homem, especialmente na infncia, como os helmintos -
Ascaris lumbricoides (lombriga) e Enterobius vermicularis (oxiro) - que podem ser veiculados por
alimentos. Sobre esse assunto, considere as afirmativas abaixo.

0-0) Nematelmintos, como A. lumbricoides e E. vermicularis, possuem o corpo cilndrico,simetria


bilateral e pseudoceloma.
1-1) A A. lumbricoides, depois de ingerida, migra do intestino para os alvolos pulmonares atravs
da corrente sangunea.
2-2) A ascaridase provoca a barriga dgua, doena caracterizada pelo aumento do fgado e do
bao, o que gera uma expanso abdominal.
3-3) No ciclo de vida de E. vermicularis, as fmeas migram noite do intestino grosso para a regio
anal, onde pem seus ovos.
4-4) A descarga de dejetos humanos ou animais no solo pode transmitir a oxiuriose e a ascaridase;
assim, andar calado pode prevenir ambas as doenas.
VVFVF
Justificativa:
0-0) Verdadeiro: as caractersticas descritas so tpicas dos nematelmintos.
1-1) Verdadeiro: depois de instalado no pulmo, o verme maduro provoca acessos de tosse ao
chegar traqueia; depois retornam ao intestino.
2-2) Falso: a barriga dgua provocada por Schistosoma e provoca a esquistossomose. A
ascaridase provoca problemas intestinais, infeces pulmonares e, nos casos graves, leses no
fgado.
3-3) Verdadeiro: a deposio de ovos na regio anal provoca coceiras que fazem o hospedeiro
humano contaminar as unhas e veicular overme atravs do contato com as mos.
4-4) Falso: a via oral a porta de entrada dos vermes descritos; assim, andar calado no est dentre
as medidas preventivas contra esses vermes, pois os mesmos no penetram atravs da pele, como
ocorre, por exemplo, com a ancilostomose (Ancylostoma duodenale). Por outro lado, a lavagem das
mos poderia ser eficiente.
Leia a notcia abaixo, observe a figura e considere as proposies que vm a seguir.

Uma mulher de 38 anos, que mora em Trs Pontas, na Regio Sul de Minas Gerais, tem uma
gravidez inusitada. Ela possui uma m-formao chamada tero didelfo, que fez com que ela
tivesse dois rgos. H oito meses, Juca Maria de Andrade espera por gmeos, uma menina e um
menino, e cada um deles foi formado em um tero diferente.
Fonte: g1.globo.com

0-0) A diferenciao anatmica do tero de Juca permite concluir que cada ovrio libera um
ovcito secundrio a cada ms de forma independente, aumentando a chance de gerar gmeos.
1-1) A ovulognese de Juca iniciou quando ela estava no tero de sua me, e foi continuada aps
seus ovcitos primrios serem ativados pelo hormnio progesterona.
2-2) O desenvolvimento do ovcito secundrio na segunda diviso da meiose estaciona na metfase
II e, assim, somente completado aps a fecundao.
3-3) Juca gerou gmeos fraternos ou dizigticos, pois vulos distintos foram fecundados cada qual
por um espermatozide.
4-4) O gmeo do sexo masculino pode possuir alelos localizados no cromossomo X sem alelos
correspondentes no cromossomo Y.
FFVVV
Justificativa:
0-0) Falso: a ovulao mensal libera geralmente um ovcito a cada ms, independentemente da
anormalidade anatmica observada no tero de Jucia. Assim, liberao de dois ovcitos um
fenmeno raro observado em mulheres que possuem ou no essa condio.
1-1) Falso: os ovcitos primrios so ativados pelo hormnio folculo estimulante (FSH).
2-2) Verdadeiro: a ovulao mensal feminina libera um ovcito secundrio que amadurece
plenamente aps a fecundao pelo espermatozoide.
3-3) Verdadeiro: a fecundao de vulos distintos produz gmeos fraternos ou dizigticos (no
idnticos).
4-4) Verdadeiro: o fenmeno explica algumas caractersticas genticas ligadas ao sexo e
conhecido como hemizigose.
O ndice de massa corporal (IMC) tem sido utilizado como um parmetro de avaliao da obesidade
e pode ser calculado como: IMC = massa (Kg)/ altura x altura (m). No caso de indivduos adultos,
um IMC entre 18,5 e 24,9 considerado ideal para uma pessoa saudvel. Entre 25 e 29,9, ocorre
sobrepeso e acima de 30,0, so descritos diferentes graus de obesidade. Com um valor de IMC
acima de 40,0, o indivduo considerado com obesidade mrbida. Sobre este assunto, analise as
afirmativas seguintes.

0-0) Pessoas com IMC acima de 40 no perdem peso com a realizao de exerccios fsicos e
devem se submeter a uma cirurgia de reduo de estmago
1-1) Pessoas com IMC acima de 30 geralmente possuem espessa camada de tecido adiposo junto
pele, o que permite maior isolamento trmico em regies geladas, em comparao com pessoas
magras.
2-2) A ingesto de gorduras na dieta, independentemente do IMC, auxilia na absoro de vitaminas
lipossolveis, tais como as vitaminas A e K, cujas deficincias causam, respectivamente,
xeroftalmia e hemorragias.
3-3) Indivduos com grande massa muscular em relao altura, como atletas halterofilistas, podem
ser saudveis apesar de apresentarem IMC acima de 30.
4-4) Pessoas com IMC acima de 30, mas com colesterol do tipo LDL normal, no esto propensas
ao desenvolvimento da arterosclerose.
FVVVV
Justificativa:
0-0) Falso: a realizao de exerccios fsicos e a ingesto de alimentos de baixa caloria auxiliam na
diminuio do sobrepeso, mesmo em pessoas com IMC alto, independentemente de uma eventual
necessidade cirrgica.
1-1) Verdadeiro: a gordura funciona como isolante trmico que auxilia na manuteno da
temperatura corporal.
2-2) Verdadeiro: a deficincia das vitaminas lipossolveis A e K causa as enfermidades descritas.
3-3) Verdadeiro: o clculo do IMC considera a massa, que pode ser alta em indivduos musculosos e
no obesos.
4-4) Verdadeiro: o LDL elevado (mau colesterol) est associado a arteroscleorose.
O desgaste do corpo humano em uma prova de ultramaratona no gelo da Antrtica, a uma
temperatura de -15 C, foi recentemente documentada na televiso. No ano de 2011, a prova teve
um brasileiro como vencedor, cuja resistncia fsica e psicolgica foi superior dos outros atletas.
Na regulao fisiolgica do corpo humano, a fim de proteg-lo contra a hipotermia, considere as
seguintes situaes.

0-0) Devido economia de energia para o aquecimento corporal, ocorre maior eliminao de gua
atravs da urina; da a necessidade de a hidratao ser elevada.
1-1) Ocorre aumento da glicognese devido atividade da insulina, de forma a resguardar as
reservas energticas e a garantir o aquecimento corporal.
2-2) Os calafrios no corpo geram calor, pois provocam contrao dos msculos esquelticos; este
processo depende da presena de ons Ca2+ para manter a miosina e a actina unidas.
3-3) O sangue oxigenado retorna ao corao pelas veias pulmonares, que o bombeia para a
artriaaorta e da para o resto do corpo, aquecendo os principais rgos internos.
4-4) Devido ao maior consumo calrico do organismo, a disponibilidade de nutrientes para o
crebro diminui produzindo reduo da capacidade mental.
VFVVV
Justificativa:
0-0) Verdadeiro: a economia de energia essencial para o aquecimento dos principais rgos
internos.
1-1) Falso: no frio, ocorre maior necessidade calrica; ocorre, ento, maior glicogenlise (quebra de
glicognio).
2-2) Verdadeiro: os filamentos de actina deslizam sobre os filamentos de miosina; na ausncia de
ons Ca2+ ocorre a separao entre miosina e actina, produzindo o relaxamento muscular.
3-3) Verdadeiro: a irrigao sangunea do corpo ocorre como descrito e tambm serve para manter
aquecidos os rgos internos.
4-4) Verdadeiro: o gasto de energia para aquecer o corpo resulta no efeito descrito.
Atualmente, so disponveis pela internet, testes de paternidade que se baseiam na probabilidade de
certas caractersticas genticas herdadas do suposto pai aparecerem no fentipo da criana.
Considerando os gentipos e fentipos no quadro abaixo, analise as proposies que seguem.

Me Biolgica Criana Suposto Pai


Tipo Sanguneo A (IAi) Rh + (Rr) B (IBi) Rh - (rr) AB (IAIB) Rh - (rr)
Cor dos Olhos Castanho Claro Azul (BABA e Castanho Claro
(BMBA e GAGA) GAGA) (BMBA e GAGA)
Orelhas Lbulo aderente (ss) Lbulo aderente (ss) Lbulo solto (Ss)

0-0) Como a criana possui olhos azuis, a paternidade do suposto pai est descartada.
1-1) Apesar de possuir fator Rh negativo, a criana tinha 50% de chance de nascer com fator Rh
positivo e 25% de chance de nascer com sangue tipo B ou tipo A.
2-2) Considerando que a cor dos olhos determinada por pelo menos dois loci gnicos, possvel
concluir que o alelo BM episttico sobre o BA.
3-3) Como o pai possui lbulo da orelha solto, e a me lbulo aderente, a criana tinha 50% de
chance de nascer com os lbulos soltos ou aderentes.
4-4) Caso seja confirmada a identidade do pai, possvel concluir que havia 3,12 % de chance de a
criana nascer com sangue tipo B, olhos azuis e lbulo da orelha aderente.
FFVVV
Justificativa:
0-0) Falso: a expresso de ambos os genes, BABA e GAGA,condiciona fentipo de olhos azuis;
como os pais tambm possuem gentipo GAGA, a variao no fentipo depende do resultado
dacombinao de BMBA (me) com BMBA (pai). A paternidade no est descartada, pois sendo a
me BMBA e o pai BMBA, h 25% de chance de a criana nascer com os olhos azuis.
1-1) Falso: o cruzamento Rr x rr produz 50% de chance de a criana nascer com fator Rh positivo.
Contudo, se a criana nasceu com sangue tipo B, o cruzamento IAi x IAIB produz 50% de chance
de a criana nascer com sangue tipo A, 25% de chance de nascer com o tipo B, e 25% de nascer
com sangue AB.
2-2) Verdadeiro: a comparao dos gentipos da me e da criana mostra que o alelo BM
dominante e impede a expresso de BA, ou seja, BM episttico sobre BA.
3-3) Verdadeiro: o cruzamento de Ss (pai) com ss (me) produz 50% de chance de a criana nascer
com os lbulos soltos ou aderentes.
4-4) Verdadeiro: as probabilidades independentes de a criana nascer com sangue tipo B, olhos
azuis e lbulo da orelha aderente, so respectivamente: 25% (1/4); 25% (1/4) e 50% (1/2). A
expresso do conjunto dessas caractersticas dada por x x = 1/32, ou seja, 0,0312 (3,12%).
Considere o enunciado abaixo e as trs propostas para complet-lo.
Fleming, um microbiologista, ao examinar placas de cultivo semeadas com bactrias, observou que
elas eram incapazes de crescer perto de uma colnia de fungos contaminantes. A identificao
posterior dos antibiticos comprovou a hiptese formulada pelo pesquisador de que os fungos
produzem substncias que inibem o crescimento das bactrias.
Sabendo-se que Fleming aplicou em sua pesquisa o mtodo cientfico, correto afirmar que
1 - ele formulou uma hiptese de pesquisa tendo como base a observao de que as bactrias no
proliferavam em determinado ambiente.

2 - ele realizou experimentos de acordo com predies decorrentes da formulao de uma hiptese,
ou seja, a de que substncias produzidas por fungos inibem o crescimento bacteriano.

3 - ele concluiu, baseado em suas reflexes sobre a reproduo de fungos, que a substncia por eles
produzida inibia a diviso mittica de bactrias.

Quais esto corretas?

(A) Apenas 1.
(B) Apenas 2.
(C) Apenas 3.
(D) Apenas 1 e 2.
(E) 1, 2 e 3.
D
Em certas espcies de rpteis, a temperatura de incubao do ovo durante certo perodo do
desenvolvimento o fator determinante na proporo sexual.
O grfico abaixo refere-se proporo sexual dependente da temperatura observada em trs
espcies de rpteis.

Com base nos dados apresentados no grfico, considere as afirmaes abaixo.

I - Para a espcie nmero 1, temperaturas entre 28C e 30C daro origem a indivduos de somente
um dos sexos.

II - Para a espcie nmero 3, uma variao de temperatura de apenas 1C pode transformar uma
maioria de fmeas em maioria de machos.

III - Para a espcie nmero 2, os ovos geram machos em temperaturas frias e fmeas em
temperaturas quentes.

Quais esto corretas?

(A) Apenas I.
(B) Apenas II.
(C) Apenas III.
(D) Apenas I e II.
(E) I, II e III.
B
Os cidos nucleicos so polmeros que atuam no armazenamento, na transmisso e no uso da
informao gentica.
Com base na estrutura e funo destes polmeros, assinale com V (verdadeiro) ou F (falso) as
afirmaes abaixo.

[ ] Seus monmeros so denominados nucleotdeos.


[ ] Seus monmeros esto unidos por meio de ligaes fosfodisteres.
[ ] Suas bases nitrogenadas esto diretamente ligadas aos fosfatos.
[ ] Suas bases nitrogenadas podem ser pricas ou pirimdicas.

A sequncia correta de preenchimento dos parnteses, de cima para baixo,


(A) V - V - F - V.
(B) V - F - V - F.
(C) F - V - V - F.
(D) F - F - V - V.
(E) V - F - F - V.
A
No bloco superior, abaixo, so citados dois componentes do sistema de membranas internas de uma
clula eucaritica; no inferior, funes desempenhadas por esses componentes.
Associe adequadamente o bloco inferior ao superior.

1 - retculo endoplasmtico liso


2 - sistema golgiense
[ ] modificao de substncias txicas
[ ] sntese de lipdeos e esteroides
[ ] secreo celular
[ ] sntese de polissacardeos da parede celular vegetal.

A sequncia correta de preenchimento dos parnteses, de cima para baixo,


(A) 1 - 2 - 2 - 1.
(B) 1 - 1 - 2 - 2.
(C) 1 - 2 - 2 - 2.
(D) 2 - 2 - 1 - 1.
(E) 2 - 1 - 1 - 1.
A
A membrana plasmtica uma estrutura que atua como limite externo da clula, permitindo que
esta realize suas funes.
Com relao membrana plasmtica, considere as afirmaes abaixo.

I - Sua estrutura molecular tem como componentes bsicos lipdeos e protenas.


II - Os fosfolipdeos apresentam uma regio hidroflica que fica voltada para o ambiente no
aquoso.
III - O esteroide colesterol um lipdeo presente na membrana plasmtica de clulas animais e
vegetais.

Quais esto corretas?


(A) Apenas I.
(B) Apenas II.
(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.
A
Durante as fases da respirao celular aerbia, a produo de CO2 e gua, ocorre, respectivamente,:

(A) na gliclise e no ciclo de Krebs.


(B) no ciclo de Krebs e na cadeia respiratria.
(C) na fosforilao oxidativa e na cadeia respiratria.
(D) no ciclo de Krebs e na fermentao.
(E) na gliclise e na cadeia respiratria.
B
O quadro abaixo representa o cdigo gentico universal.

A molcula de RNA mensageiro com a sequncia CGAAUGACAAAAGGAUAACGU produz o


segmento de protena

(A) Met - Tre - Lis - Gli - Arg.


(B) Tre - Arg - Met.
(C) Arg - Met - Tre - Lis - Gli.
(D) Met - Tre - Lis - Gli.
(E) Leu - Arg - Met - Tre - Lis - Gli.
D
Assinale a alternativa que preenche corretamente as lacunas do enunciado abaixo, na ordem em que
aparecem.
Em mamferos, o ........ e as clulas trofoblsticas interagem com o tero materno para formar
a ........, a qual fornece nutrientes e atua nas trocas gasosas do embrio.

(A) saco vitelino - cavidade amnitica


(B) alantoide - vilosidade corinica
(C) alantoide - placenta
(D) crion - placenta
(E) mnio - vilosidade corinica
D
O quadro abaixo apresenta, na primeira linha, tipos de antgenos; na segunda, clulas
apresentadoras desses antgenos; e, na terceira, clulas que interagem com as apresentadoras no
contexto especificado.

Assinale a alternativa que apresenta a sequncia de termos que correspondem, respectivamente, aos
nmeros 1, 2 e 3 no quadro.

(A) clulas mortas - linfcitos T auxiliares (CD4) - clula B


(B) vrus - clulas de memria - clula dendrtica
(C) parasitas - clulas de memria - linfcitos T citotxicos (CD8)
(D) clulas mortas - linfcitos T citotxicos (CD8) - clula dendrtica
(E) vrus - linfcitos T auxiliares (CD4) - clula B
E
Assinale com V (verdadeiro) ou F (falso) as afirmaes abaixo, referentes aos protozorios.
[ ] Os radiolrios e os foraminferos apresentam espcies que fazem parte do plncton.
[ ] As amebas so dotadas de clios e de, no mnimo, dois ncleos.
[ ] Os flagelados causam, em humanos, doenas como a leishmaniose e a toxoplasmose.
[ ] os esporozorios so organismos exclusivamente parasitas, desprovidos de um vacolo contrtil.

A sequncia correta de preenchimento dos parnteses, de cima para baixo, :

(A) V - V - F - V.
(B) V - F - V - F.
(C) F - V - V - F.
(D) F - F - V - V.
(E) V - F - F - V.
E
A figura abaixo apresenta algumas das caractersticas compartilhadas por grupos de plantas.

Adaptado de: SADAVA et al. Vida: a cincia da biologia. 8. ed. Porto Alegre: Artmed, 2009.

As caractersticas associadas aos nmeros 1 e 2 representam, respectivamente, a presena de :

(A) esporfito haploide e folhas verdadeiras.


(B) gametfito haploide e sementes.
(C) esporfito haploide e estmatos.
(D) embrio protegido e tecido vascular.
(E) embrio protegido e sementes.
D
As estruturas sexuais das angiospermas so as flores. Com relao s estruturas florais, correto
afirmar que:
(A) as anteras contm os megasporngios, que produzem o plen.
(B) a superfcie terminal do pistilo que recebe os gros de plen chamada estame.
(C) as folhas externas estreis constituem o clice.
(D) as flores so designadas perfeitas quando apresentam clice e corola.
(E) plantas em que ocorrem tanto flores mega como microesporangiadas so denominadas dioicas.
C
Assinale a alternativa correta, em relao conduo da seiva bruta em angiospermas.
(A) O fluxo da seiva bruta ocorre das folhas para outras partes da planta atravs do floema.
(B) A explicao para a seiva bruta mover-se pela planta dada pela hiptese do fluxo por presso.
(C) A transpirao aumenta a presso osmtica e promove o fluxo da gua desde as razes at as
folhas, no interior do xilema.
(D) A absoro de CO2 na fotossntese pode aumentar o fluxo da seiva bruta para as folhas.
(E) Ao retirarmos um anel ao redor do caule (anel de Malpighi), possvel verificar a morte da
planta pela interrupo do fluxo da seiva bruta.
C
Os caros so quelicerados que, para os humanos, podem causar reaes alrgicas na pele e no
sistema respiratrio. Assinale a alternativa que apresenta somente animais quelicerados.

(A) aranha - pulga - tatuzinho-de-jardim


(B) aranha - escorpio - carrapato
(C) joaninha - pulga - carrapato
(D) joaninha - lacraia - opilio
(E) lacraia - escorpio - tatuzinho-de-jardim
B
Assinale a alternativa que preenche corretamente as lacunas do enunciado abaixo na ordem em que
aparecem. O desenvolvimento padro das ........ caracte-riza-se por fecundao ........ , desenvolvi-
mento ........ e ........ .

(A) rs - interna - indireto - viviparidade


(B) tartarugas - externa - direto - ovoviviparidade
(C) aves - externa - indireto - oviparidade
(D) aves - interna - direto - ovoviviparidade
(E) tartarugas - interna - direto - oviparidade
E
Assinale a alternativa que preenche corretamente as lacunas do enunciado abaixo, na ordem em que
aparecem.
A ........ humana contm dois tipos de fotorreceptores: os cones e os bastonetes. Os cones
contribuem pouco para a viso noturna por ........ .
(A) retina - terem menor sensibilidade luz
(B) crnea - serem menos abundantes que os bastonetes
(C) ris - terem maior sensibilidade luz
(D) retina - absorverem igualmente todos os comprimentos de onda
(E) crnea - serem responsveis pela percepo das cores
A
Leia a tira abaixo.

Disponvel em: http://www2.uol.com.br/niquel/seletas_vampiros.shtml. Acesso em: 22 nov. 2011.

As sanguessugas, como as citadas na tira, produzem nas glndulas salivares a substncia chamada
hirudina, um peptdeo inibidor de trombina.
A hirudina provoca a no coagulao do sangue, pois
(A) a tromboplastina no ser liberada aps o rompimento das plaquetas.
(B) a trombina no catalisar a reao de transformao do fibrinognio em fibrina.
(C) a tromboplastina no se ligar protrombina para sua converso em trombina.
(D) as hemceas no se rompero para o incio do processo de coagulao sangunea.
(E) a trombina ser bloqueada em sua transformao em tromboplastina.
B
Darwin sofreu durante a maior parte de sua vida adulta de uma doena debilitante que pode ter sido
a Sndrome dos Vmitos Cclicos (SVC). A hiptese corrente sugere que a doena seja provocada
por uma mutao mitocondrial j descrita na literatura. Sabe-se que a me e o tio materno de
Darwin apresentavam os mesmos sintomas que ele. Sabe-se, tambm, que Darwin era casado com
uma prima em primeiro grau, que no apresentava a sndrome, e que o casal teve vrios filhos e
filhas, no havendo nenhum sindrmico entre eles. Com base no exposto acima, assinale a
alternativa correta.

(A) A SVC pode ter padro de herana dominante ligado ao sexo.


(B) A inexistncia de filhos sindrmicos est de acordo com a hiptese da origem mitocondrial da
doena de Darwin.
(C) De acordo com a hiptese da origem mitocondrial, tanto a av quanto o av materno de Darwin
podem ter passado a sndrome para seus filhos.
(D) A consanguinidade entre Darwin e sua esposa sustenta a hiptese de herana mitocondrial da
sndrome.
(E) De acordo com a hiptese da origem mitocondrial da sndrome, todas as filhas de Darwin
devem ser portadoras do gene mutado.
B
Em rabanetes, um nico par de alelos de um gene controla a forma da raiz. Trs formas so
observadas: oval, redonda e longa. Cruzamentos entre estes trs tipos apresentam os seguintes
resultados:

Qual a proporo de prognie esperada do cruzamento oval x oval?

(A) 3 ovais : 1 longo


(B) 1 redondo: 1 longo
(C) 1 oval: 2 redondos: 1 longo
(D) 3 redondos: 1 longo
(E) 1 redondo: 2 ovais: 1 longo
E
Um dos maiores problemas mundiais de sade pblica a infeco hospitalar. Recentemente,
constatou-se que a bactria Klebsiella pneumoniae, responsvel pela pneumonia e por infeces da
corrente sangunea, tornou-se resistente a todos os antibiticos utilizados atualmente. Essa
resistncia, por sua vez, foi propagada por conjugao para a bactria Escherichia coli, que vive nos
intestinos de animais de sangue quente e onipresente em nosso ambiente.
Considere as afirmaes abaixo, sobre a situao apresentada.
I - A utilizao de antibiticos exerce presso seletiva para a aquisio de resistncia.
II - A utilizao de antibiticos causa mutaes que conferem resistncia s bactrias.
III - As bactrias podem adquirir resistncia sem terem sido expostas aos antibiticos.

Quais esto corretas?

(A) Apenas I.
(B) Apenas II.
(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.
C
Assinale a alternativa correta, com relao s estruturas anlogas.

(A) Elas surgem a partir de convergncia evolutiva.


(B) Elas derivam de estruturas existentes em um ancestral comum.
(C) Elas evidenciam os parentescos evolutivos entre as espcies.
(D) Elas tm a mesma origem embriolgica nas diferentes espcies.
(E) Elas podem apresentar diferentes funes nas espcies.
A
Com relao biomassa e distribuio de energia nos diferentes nveis trficos, considere as
seguintes afirmaes.
I - Na maioria dos ecossistemas terrestres, a quantidade de biomassa inversamente proporcional
quantidade de energia qumica disponvel nas molculas orgnicas.
II - Na maioria dos ecossistemas terrestres, as plantas fotossintetizantes dominam tanto em relao
quantidade de energia que representam quanto em relao biomassa que contm.
III - Na maioria dos ecossistemas aquticos, uma pequena biomassa de produtores pode alimentar
uma biomassa muito maior de consumidores primrios.

Quais esto corretas?


(A) Apenas I.
(B) Apenas II.
(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.
D
Considere as seguintes afirmaes sobre as interaes intraespecficas desarmnicas.
I - O canibalismo sexual observado em fmeas de louva-a-deus um exemplo desse tipo de
interao.
II - Esse tipo de interao no ocorre em plantas.
III - A disputa por fmeas entre machos de uma espcie exemplifica esse tipo de interao.

Quais esto corretas?


(A) Apenas I.
(B) Apenas II.
(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.
C
As chuvas cidas so causadas pelas alteraes humanas nos ciclos do:
(A) carbono e do fsforo.
(B) carbono e do enxofre.
(C) carbono e da gua.
(D) nitrognio e do enxofre.
(E) nitrognio e do fsforo
A
O efeito estufa leva ao aquecimento global que, a longo prazo, pode ocasionar derretimento das
calotas polares, aumento dos nveis dos mares e alterao nos ciclos das chuvas.
Com base nas causas do efeito estufa, assinale com V (verdadeiro) ou F (falso) as afirmaes
abaixo.
[ ] O metano um potente gs-estufa que contribui para o aquecimento global.
[ ] Depsitos massivos de metano presos sob camadas de gelo muito antigas que esto derretendo
iro agravar o efeito estufa nos prximos anos.
[ ] O aumento da concentrao de fsforo atmosfrico intensifica o efeito estufa.
[ ] Duas grandes fontes de emisso de metano so a flatulncia dos ruminantes e as plantaes de
arroz.

A sequncia correta de preenchimento dos parnteses, de cima para baixo, :

(A) V - V - F - V.
(B) V - F - V - F.
(C) F - V - V - F.
(D) F - F - V - V.
(E) V - F - F - V.
D
A figura acima representa uma membrana celular, estrutura essencial por limitar o contedo da
clula e regular a troca de substncias entre os meios intra e extracelular. Nesse sentido, podemos
afirmar que:

0-0) a imagem representa o modelo de mosaico-fluido.


1-1) o item 1, na figura, representa uma protena globular.
2-2) o item 2, na figura, representa a parte hidrofbica dos lipdios.
3-3) a membrana celular possui protenas associadas aos lipdios, o que est representado pelo item
3 da figura.
4-4) em funo de sua constituio qumica, substncias lipossolveis podem atravessar a
membrana por difuso simples.
VFVVV
Justificativa:
0-0) Verdadeira. A imagem representa o modelo de membrana celular conhecido como mosaico-
fluido, no qual uma bicamada de lipdios est associada s protenas.
1-1) Falsa. O item 1, na figura, representa a parte hidroflica do lipdio de membrana, que fica
voltada para a parte externa da membrana.
2-2) Verdadeira. O item 2 est indicando a regio hidrofbica dos lipdio, que fica voltada para a
regio interna da membrana.
3-3) Verdadeira. O modelo de mosaico-fluido prev a presena de protenas associadas, que na
figura esto representadas no item 3.
4-4) Verdadeira. Por ser baseada em lipdios, substncias lipossolveis atravessam a membrana por
difuso simples.
A micrografia acima de uma organela celular encontrada em grande quantidade em clulas que
possuem alto gasto energtico. Acerca dessa organela, analise as afirmaes a seguir.

0-0) Trata-se de uma organela essencial ao processo de fotossntese.


1-1) uma organela que est associada ao processo de respirao celular.
2-2) nessa estrutura que ocorre a sntese de ATP.
3-3) A funo dessa organela a sntese de glicose, fonte principal de energia.
4-4) nessa organela que ocorre o ciclo de Krebs.
FVVFV
Justificativa:
0-0) Falsa. A micrografia de uma mitocndria, e a fotossntese est associada ao cloroplasto.
1-1) Verdadeira. A mitocndria responsvel pelo processo de respirao interna da clula,
produzindo energia.
2-2) Verdadeira. A mitocndria produz energia na forma de ATP para as necessidades celulares.
3-3) Falsa. A mitocndria no produz glicose; ela a quebra para produzir ATP.
4-4) Verdadeira. O ciclo de Krebs parte do processo de sntese de ATP.
Uma grande contribuio de Mendel foi demonstrar que as caractersticas hereditrias so
determinadas por fatores distintos, que so separados e recombinados em cada gerao. Atualmente,
esses fatores so chamados de alelos. A figura acima representa uma possvel combinao de
alelos ao longo das geraes de onas. A partir dessa representao, podemos concluir que:

0-0) alelos recessivos s expressam sua caracterstica quando em homozigose.


1-1) filhos de cruzamento entre heterozigotos e homozigotos dominantes no podem expressar
caracterstica recessiva.
2-2) o cruzamento entre parentes aumenta a possibilidade de expresso dos caracteres recessivos.
3-3) o melanismo em onas associado a um alelo dominante.
4-4) o indivduo designado pela letra X homozigoto.
VVVVF
Justificativa:
0-0) Verdadeira. A homozigose essencial para a expresso de caracteres recessivos.
1-1) Verdadeira. Como homozigotos dominantes no possuem alelos recessivos, seus filhos no
expressam recessividade.
2-2) Verdadeira. A probabilidade de parentes possurem os mesmos alelos maior, por isso seus
filhos possuem maior probabilidade de expressarem a recessividade.
3-3) Verdadeira. O melanismo em onas est associado a um alelo dominante, diferentemente do
que ocorre em outros felinos.
4-4) Falsa. Se o indivduo X fosse homozigoto, no poderia ter filhos expressando caracterstica
recessiva.
Algumas condies patolgicas humanas so transmitidas geneticamente atravs da parte no
homloga dos cromossomos sexuais, situao conhecida como herana ligada ao sexo.
Consequentemente:

0-0) a hemofilia mais comum em homens, pois essa caracterstica pode se expressar em
hemizigose.
1-1) apenas as mes podem transmitir a hemofilia, e aos filhos do sexo masculino.
2-2) o daltonismo se expressa com maior frequncia em mulheres.
3-3) as filhas de pai daltnico tm 50% de chances de possurem o gene para essa condio.
4-4) estando localizada no cromossomo X, uma condio recessiva precisa estar em homozigose
para se expressar em mulheres, o que no ocorre nos homens.
VVFFV
Justificativa:
0-0) Verdadeira. Embora ligado ao cromossomo X, a hemofilia mais comum nos homens porque,
neste caso, essa caracterstica se expressa com um nico alelo recessivo.
1-1) Verdadeira. Filhos do sexo masculino s podem receber do pai o cromossomo Y, que no est
associado hemofilia. Se ele hemoflico, obrigatoriamente recebeu esse gene da me.
2-2) Falsa. Por estar ligado ao cromossomo X, o daltonismo mais comum nos homens, porque,
neste caso, essa caracterstica se expressa com um nico alelo recessivo.
3-3) Falsa. Como possuem apenas um cromossomo X e este o que possui o gene ligado ao
daltonismo, todos os gametas X produzidos por pais daltnicos levam essa caracterstica.
4-4) Verdadeira. Como mulheres possuem dois cromossomos X, a recessividade s se expressa em
homozigose. Como os homens possuem apenas um cromossomo X, essa condio pode se
expressar com um nico alelo.
O processo de surgimento de novas espcies que se adaptam a ambientes diversos est na base do
aumento da biodiversidade e influenciado por fatores biticos e abiticos. Darwin soube observar
esse processo, associ-lo ao trabalho de outros pesquisadores, e propor leis que o descrevem. Nesse
sentido, podemos afirmar o que segue.

0-0) As ideias de Malthus sobre crescimento populacional e produo de alimentos foram


fundamentais para as concluses de Darwin.
1-1) A variao nas caractersticas dos filhotes foi assumida por Darwin como a base sobre a qual
atua a seleo natural.
2-2) O isolamento de parte de uma populao pode contribuir para a formao de uma nova espcie.
3-3) A transmisso das caractersticas dos organismos bem-sucedidos aos descendentes essencial
para a evoluo, mas Darwin no conseguiu explic-la.
4-4) Sntese moderna se refere releitura das ideias de Darwin sob a luz da Gentica.
VVVVV
Justificativa:
0-0) Verdadeira. As ideias de Malthus sobre crescimento da populao e crescimento da oferta de
alimentos foram fundamentais para a formulao dos conceitos de competio e seleo natural.
1-1) Verdadeira. Para ser produtora de evoluo, a seleo natural precisa atuar sobre caractersticas
que variem entre os indivduos, eliminando os menos adaptados e favorecendo os que apresentem
caractersticas adequadas.
2-2) Verdadeira. As populaes isoladas sofrem diferentes presses de seleo e, como no ocorre
cruzamento, isso provoca distanciamento no processo evolutivo, podendo produzir novas espcies.
3-3) Verdadeira. O mecanismo da hereditariedade ainda no era compreendido, e Darwin props sua
necessidade, mas no soube explic-la, o que foi considerado uma fragilidade de sua teoria, na
poca.
4-4) Verdadeira. A partir do desenvolvimento da Gentica, as ideias de seleo natural sobre a
variabilidade na descendncia associada transmisso dos caracteres puderam ser reinterpretadas,
com um conhecimento mais aprofundado sobre os processos hereditrios, o que resultou na sntese
moderna, tambm conhecida como neodarwinismo.
Ao longo do desenvolvimento da Biologia, a forma de classificao dos organismos se modificou,
conforme os conhecimentos se acumularam, modificando o peso da analogia e da homologia para
esse processo. Atualmente, so levadas em considerao as relaes de parentesco, o que tem sido
possvel a partir da aplicao das modernas tcnicas de Gentica. No que se refere a essas relaes,
podemos considerar que:

0-0) as relaes filogenticas entre os organismos revelam seu parentesco e o caminho percorrido
por eles ao longo da evoluo.
1-1) se duas espcies apresentam diferenas fenotpicas marcantes, no podem pertencer a um
mesmo txon.
2-2) evolutivamente, as baleias esto mais prximas dos homens do que dos tubares, como mostra
a homologia com os primeiros.
3-3) se dois organismos pertencem a um mesmo txon, ento apresentam mais analogias do que
homologias.
4-4) a semelhana entre o corpo de um golfinho e o de um tubaro pode ser chamada de
convergncia evolutiva.
VFVFV
Justificativa:
0-0) Verdadeira. A relao filogentica est baseada no parentesco associado ao processo evolutivo,
o que est ligado homologia das caractersticas.
1-1) Falsa. As caractersticas fenotpicas so muito influenciadas pelo modo como o animal se
adaptou a um ambiente, e pode acontecer de animais aparentados apresentarem caractersticas
fenotpicas muito diferentes, e de animais pouco aparentados apresentarem caractersticas
semelhantes.
2-2) Verdadeira. As baleias esto mais prximas dos homens do que dos tubares. Estes apresentam
muitos caracteres anlogos, mas os seres humanos apresentam relaes homlogas com as baleias.
3-3) Falsa. As analogias e homologias no esto estreitamente relacionadas. Entretanto, homologias
esto mais relacionadas com o parentesco evolutivo e, por isso, mais associadas s relaes
taxonmicas.
4-4) Verdadeira. O processo de convergncia evolutiva leva organismos no aparentados a
apresentarem semelhanas, em funo de possurem modos de vida similares.
Aracndeos como os caros, e insetos como vespas e piolhos, acima ilustrados, possuem em comum
a presena de um exoesqueleto e corpo com partes articuladas; mas possuem nmeros de pares de
patas diversos e diferenas na presena ou ausncia de asas. Sobre as relaes entre esses animais,
podemos fazer as afirmaes a seguir.

0-0) Apesar das semelhanas, esses animais no apresentam nenhuma relao filogentica.
1-1) Todos pertencem ao filo dos artrpodes.
2-2) Piolhos so mais parecidos com os caros, mas so mais prximos das vespas por filogenia.
3-3) Todos os animais representados acima pertencem mesma classe.
4-4) A figura apresenta animais pertencentes a um filo, duas classes e trs espcies.
FVVFV
Justificativa:
0-0) Falsa. Os organismos apresentados so todos aparentados e includos no filo artropoda.
1-1) Verdadeira. Todos eles so artrpodes, por possurem partes articuladas e corpo recoberto com
exoesqueleto.
2-2) Verdadeira. Vespas e piolhos pertencem classe dos insetos, e os caros so aracndeos.
3-3) Falsa. Piolhos so insetos e apresentam suas caractersticas bsicas, como trs pares de pernas
e corpo dividido em cabea, trax e abdmen.
4-4) Verdadeira. Na figura, todos os animais pertencem ao filo artropoda, s classes aracnida e
insecta e a trs diferentes espcies.
Fungos so organismos que constituem atualmente um reino prprio, com algumas caractersticas
semelhantes aos vegetais e outras semelhantes aos animais. Possuem grande importncia
econmica, tanto do ponto de vista mdico quanto do industrial e alimentcio. Em relao a esses
organismos, analise as afirmaes seguintes.

0-0) Assim como os vegetais, suas clulas possuem normalmente parede celular base de celulose.
1-1) Haustrios so hifas especializadas de fungos parasitas.
2-2) Os fungos so organismos eucariontes.
3-3) Assim como os animais, os fungos podem produzir quitina.
4-4) Os fungos so organismos que podem depositar reservas na forma de glicognio.
FVVVV
Justificativa:
0-0) Falsa. Como os vegetais, os fungos apresentam parede celular, mas sua composio de
quitina, e no de celulose.
1-1) Verdadeira. As hifas podem assumir formas diversas, conforme o tipo de fungo e sua funo.
Rizoides sustentam o fungo, e haustrios absorvem o alimento das clulas de outros organismos.
2-2) Verdadeira. As clulas de fungos possuem ncleo organizado caracterstico dos eucariontes.
3-3) Verdadeira. Uma das semelhanas entre fungos e animais que os fungos produzem quitina.
4-4) Verdadeira. Fungos podem depositar reservas na forma de glicognio, assim como os animais.
A circulao sangunea obedece aos mesmos princpios fsicos da movimentao de fluidos em
tubos. Para garantir as necessidades do organismo, esse mecanismo tem que possuir algumas
caractersticas essenciais. Considerando essas caractersticas, analise o que se afirma a seguir.

0-0) A movimentao do sangue ocorre principalmente pela diferena de presso entre o sistema
arterial e o venoso.
1-1) Os vasos arteriais so menos musculosos e deformam mais que os venosos. Isso permite
maiores resistncia e presso no sistema arterial.
2-2) Nem sempre o sistema circulatrio nos animais fechado, podendo existir vasos abertos nas
extremidades para alguns tipos de animais.
3-3) No homem, a circulao pode ser dividida em sistmica e pulmonar.
4-4) Vasos venosos diferem dos arteriais, entre outras coisas, por possurem vlvulas que facilitam o
retorno do sangue ao corao.
VFVVV
Justificativa:
0-0) Verdadeira. Os fluidos sempre correm de um ponto de menor presso para um de maior
presso. Essa diferena provocada pelo trabalho cardaco.
1-1) Falsa. Vasos arteriais so mais musculosos e menos deformveis e, por isso, permitem maiores
resistncia e presso sangunea.
2-2) Verdadeira. Em invertebrados, geralmente, a circulao aberta.
3-3) Verdadeira. A circulao sistmica leva o sangue do corao para o corpo, exceto para o
pulmo, que irrigado.
4-4) Verdadeira. Uma das caractersticas das veias a existncia de vlvulas que ajudam na
circulao.
O sistema nervoso composto principalmente por clulas especializadas que desempenham as
funes de captao, processamento e acmulo de informaes, alm de participar no controle geral
do organismo, juntamente com o sistema endcrino. Sobre essas clulas, analise as afirmativas
abaixo.

0-0) Os neurotransmissores so mensageiros qumicos lanados na circulao sangunea para


transmitir informaes a outras clulas.
1-1) A mielina uma caracterstica essencial para o funcionamento de todos os neurnios.
2-2) Nas sinapses qumicas, no existe continuidade entre as membranas celulares dos neurnios.
3-3) Os potenciais de ao so alteraes eltricas do tipo tudo-ou-nada que trafegam ao longo dos
axnios e ocorrem por movimentao de Na+ e K+ atravs das membranas neuronais.
4-4) Apresentar microvilosidades uma caracterstica das clulas do sistema nervoso.
FFVVF
Justificativa:
0-0) Falsa. Os neurotransmissores so os agentes qumicos responsveis pela transmisso de
informaes, mas so lanados nas sinapses, e no na corrente sangunea.
1-1) Falsa. Existem neurnios que funcionam sem mielina, conhecidos como neurnios
amielnicos.
2-2) Verdadeira. As sinapses qumicas so estruturas que se comunicam quimicamente, sem
justaposio das membranas celulares.
3-3) Verdadeira. Os potenciais de ao levam as informaes pelos axnios atravs da
movimentao de ons Na+ e K+, e so do tipo tudo-ou-nada.
4-4) Falsa. As microvilosidades so caractersticas das clulas do sistema digestrio, e no do
sistema nervoso.
A respirao um processo de trocas gasosas que ocorre de forma caracterstica, de acordo com o
modo de vida do organismo, sempre obedecendo s leis fsico-qumicas que regem os gases. Quanto
respirao humana, analise o que se afirma a seguir.

0-0) A fixao do O2 hemoglobina menor em grandes altitudes.


1-1) Para que ocorra expirao, a presso intrapulmonar deve ser menor que a atmosfrica.
2-2) A difuso de CO2 dos tecidos para o sangue maior nos msculos do que nos pulmes, e
aumenta com a atividade fsica.
3-3) A entrada de ar nos pulmes ocorre quando aumenta o volume pulmonar por contrao do
diafragma.
4-4) A expanso do trax pela movimentao das costelas aumenta a presso intrapulmonar e
permite a expirao.
VFVVF
Justificativa:
0-0) Verdadeira. A fixao do O2 depende da presso. Em grandes altitudes, a presso atmosfrica
menor, e tambm a fixao do O2 hemoglobina.
1-1) Falsa. Os gases seguem do ponto de maior presso para o de menor presso. Assim, para que
ocorra expirao, a presso dentro do pulmo deve ser maior que a atmosfrica.
2-2) Verdadeira. O CO2 se difunde do msculo para o sangue porque est submetido a maior
presso nos msculos, onde mais produzido se houver atividade fsica. Nos pulmes, a maior
movimentao do sangue para os alvolos.
3-3) Verdadeira. A contrao do diafragma aumenta a cavidade torcica e permite a entrada de ar.
4-4) Falsa. A expanso do trax pela movimentao das costelas aumenta o volume pulmonar, por
isso reduz a presso e permite a inspirao.
As imagens acima representam uma clula animal e uma clula vegetal. Com base nessa imagem,
analise as proposies apresentadas abaixo.

0-0) A imagem A no pode ser representao de clula vegetal, por no apresentar lisossomo.
1-1) A imagem B certamente representa uma clula animal.
2-2) A imagem A tambm representaria bem uma clula bacteriana.
3-3) A clorofila pode ser encontrada na organela indicada pela letra b.
4-4) A representao est incorreta, porque a organela indicada pela letra c no ocorre em clulas
vegetais.
FVFVF
Justificativa:
0-0) Falsa. A imagem A representa uma clula vegetal, pois apresenta parede celular e cloroplasto.
1-1) Verdadeira. As clulas animais no apresentam parede celular nem cloroplastos.
2-2) Falsa. A imagem no representaria bem uma clula bacteriana, porque claramente uma clula
eucarionte, e as bactrias so procariontes.
3-3) Verdadeira. A clorofila se localiza no cloroplasto, que na figura est representada pela letra b.
4-4) Falsa. A organela indicada por c a mitocndria, que ocorre tanto em clulas vegetais quanto
em clulas animais.
A imagem acima representa o ciclo de vida de um parasita que pode causar srios problemas de
sade em seres humanos. Observando essa imagem, podemos afirmar que:

0-0) as progltides se formam na carne do porco e so ingeridas pelo homem.


1-1) nessa parasitose, o porco assume o papel de hospedeiro definitivo.
2-2) pelo ciclo apresentado, a ingesto acidental de alimentos contaminados com fezes humanas
pode levar formao de cisticercos no organismo humano.
3-3) o amarelo e a ascaridase so parasitoses que apresentam o mesmo ciclo vital.
4-4) o ciclo apresentado o da tenase.
FFVFV
Justificativa:
0-0) Falsa. As progltides so expelidas pelas fezes humanas. O que se forma na carne do porco so
os cisticercos.
1-1) Falsa. O hospedeiro definitivo o que apresenta o parasito em sua fase adulta. Neste caso, o
homem, e no o porco.
2-2) Verdadeira. Em caso de ingesto de alimentos que contenham os ovos da Tnia, o homem
tambm pode desenvolver os cisticercos, condio conhecida como cisticercose humana.
3-3) Falsa. Amarelo e ascaridase so provocados por outros tipos de vermes, que apresentam ciclo
de vida bem diferente.
4-4) Verdadeira. A imagem representa o ciclo vital da Tnia.
Os vrus so responsveis por inmeras doenas que afetam vegetais e animais, incluindo seres
humanos. As doenas virais provocam prejuzos econmicos por afetar a produo de alimentos e
por gerar custos na rea da sade. Sobre esses agentes, podemos fazer as seguintes afirmaes:

0-0) possuem sistemas de produo de energia altamente eficientes.


1-1) possuem estrutura geralmente simples, sendo formados estruturalmente por protenas e cidos
nucleicos.
2-2) os capsdeos so as estruturas proteicas que contm os cidos nucleicos virais.
3-3) podem possuir RNA ou DNA como cido nucleico.
4-4) dependem do metabolismo das clulas que infectam para se reproduzir.
FVVVV
Justificativa:
0-0) Falsa. Os vrus no possuem sistemas de produo de energia. Aproveitam os mecanismos das
clulas que infectam para essa finalidade.
1-1) Verdadeira. Os vrus geralmente so simples e sua estrutura composta de protenas e cidos
nucleicos.
2-2) Verdadeira. A parte proteica dos vrus conhecida como capsdeo, e protege o cido nucleico.
3-3) Verdadeira. Dependendo do tipo de vrus, o cido nucleico pode ser DNA ou RNA.
4-4) Verdadeira. Como no possuem metabolismo, os vrus necessitam das clulas que infectam
para desempenhar as funes necessrias reproduo.
O grfico acima representa uma estimativa da populao de duas espcies ao longo de 90 anos. A
partir de 1985, foi permitida a caa da espcie B. Sabendo que se trata de predador e presa, o
grfico nos leva a concluir que:

0-0) a espcie A deve ser a predadora, porque normalmente apresenta maior populao.
1-1) a partir de 2005, a populao de A deve crescer indefinidamente.
2-2) a espcie B predadora, pois, quando sua populao aumenta, a populao da espcie A
diminui.
3-3) se as duas populaes esto variando juntas, ento a relao entre as espcies de simbiose.
4-4) a populao de A depende da populao de B, e vice-versa.
FFVFV
Justificativa:
0-0) Falsa. Os predadores apresentam normalmente menor populao do que as suas presas, que
esto mais abaixo na pirmide alimentar.
1-1) Falsa. A tendncia a populao de A cessar o crescimento e mesmo reduzir a sua populao
por esgotamento dos recursos naturais que utiliza para sua sobrevivncia.
2-2) Verdadeira. Quando aumenta a populao dos predadores, a populao da presa diminui, o que
aparece no grfico para as populaes de A e B.
3-3) Falsa. A ocorrncia de simbiose no implica variao conjunta das populaes. Alm disso, no
enunciado, j se disse que se trata de predador e presa, o que exclui a simbiose.
4-4) Verdadeira. As populaes de A e B se afetam mutuamente, pois predadores e presas so
interdependentes. Os predadores dependem das presas para alimentao e aumento populacional, e
as presas tm sua populao controlada por esse processo.
A caatinga um bioma que ocorre exclusivamente no Brasil. Seu nome vem do tupi-guarani, e
significa mata branca, uma referncia a seu aspecto no perodo seco. Em relao caatinga,
analise as afirmaes seguintes.

0-0) Um dos grandes impactos sofridos por esse bioma deve-se derrubada da mata para produo
de carvo.
1-1) O polo gesseiro de Pernambuco gera uma presso negativa sobre a caatinga, por ter como fonte
bsica de energia a matria vegetal.
2-2) A caatinga um bioma importante por ocupar grande parte do Nordeste brasileiro, embora seja
muito pobre em biodiversidade.
3-3) A caatinga no oferece uma preocupao especial em termos de conservao, por no abrigar
espcies endmicas.
4-4) A caatinga um bioma que no exclusivo do Nordeste do Brasil, ocorrendo, tambm, em
reas do estado de Minas Gerais.
VVFFV
Justificativa:
0-0) Verdadeira. A produo de carvo tem sido uma atividade econmica comum em regies de
caatinga, e uma fonte de energia muito procurada.
1-1) Verdadeira. A produo de gesso depende de suprimento energtico constante que, na maior
parte, tem sido oriundo do carvo produzido na caatinga.
2-2) Falsa. Apesar da aparncia pouco exuberante se comparada com as florestas midas, a caatinga
apresenta grande diversidade biolgica e uma das mais altas taxas de endemismo.
3-3) Falsa. A caatinga um bioma extremamente importante, por apresentar grande quantidade de
espcies endmicas, adaptadas especificamente a esse ambiente.
4-4) Verdadeira. Embora esteja localizada, na maior parte, no Nordeste, a caatinga tambm ocorre
em Minas Gerais.
O gs carbnico e o oxignio esto envolvidos no metabolismo energtico das plantas. Acerca
desses gases pode-se dizer que:

a) o oxignio produzido apenas noite;


b) o oxignio produzido apenas durante o dia;
c) o gs carbnico produzido apenas noite;
d) o gs carbnico produzido apenas durante o dia;
e) o oxignio e o gs carbnico so produzidos dia e noite.
RESPOSTA: B
Leia a tira abaixo.

Com base nos dados apresentados na tira acima e em seus conhecimentos sobre a presena de vida
na Terra, considere as afirmaes abaixo.

I - A presena de metano poderia ser indcio de vida em Marte, uma vez que algumas espcies
procariontes conhecidas produzem metano atravs da reduo de CO2.
II - A atmosfera de Marte apresenta os mesmos componentes da atmosfera atual da Terra, mas, em
nosso planeta, o oxignio o componente predominante.
III - A capacidade de quebrar molculas de gua, na Terra, levou liberao de O2, o que abriu
caminho para a evoluo das reaes de oxidao aerbicas.

Quais esto corretas?


(A) Apenas I.
(B) Apenas II.
(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.
C
Sabe-se que a replicao do DNA semiconservativa.
Com base nesse mecanismo de replicao, assinale com V (verdadeiro) ou F (falso) as afirmaes
abaixo.

[ ] O DNA original atua como molde, e cada novo DNA possui uma fita antiga e outra nova.
[ ] Os quatro ribonucleosdeos trifosfatados, dATP, dGTP, dCTP e dUTP, devem estar presentes.
[ ] O DNA deve ser desnaturado (desenrolado) para tornar-se acessvel ao pareamento das novas
bases.
[ ] A enzima DNA polimerase adiciona nucleotdeos novos de acordo com o molde de DNA.

A sequncia correta de preenchimento dos parnteses, de cima para baixo,


(A) V - V - F - F.
(B) F - V - V - V.
(C) V - F - V - V.
(D) F - V - F - F.
(E) F - F - F - V.
C
Considere o enunciado abaixo e as quatro propostas para complet-lo.
No processo de transporte, atravs da membrana, pode ocorrer :

1 - a difuso facilitada, um tipo de transporte passivo.


2 - o transporte passivo, a favor do gradiente de concentrao.
3 - o transporte ativo, feito com gasto de energia.
4 - a difuso simples, independemente do gradiente de concentrao.

Quais propostas esto corretas?

(A) Apenas 2.
(B) Apenas 2 e 4.
(C) Apenas 1, 2 e 3.
(D) Apenas 1, 2 e 4.
(E) Apenas 1, 3 e 4.
C
Com relao s estruturas celulares encontradas nas clulas eucariontes, considere as afirmaes
abaixo.
I - O citoesqueleto e os centrolos so encontrados somente em clulas animais.
II - O cloroplasto e a parede celular so encontrados somente em clulas vegetais.
III - O complexo golgiense e os lisossomos so encontrados somente em clulas animais.

Quais esto corretas?

(A) Apenas I.
(B) Apenas II.
(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.
B
A fotossntese e a respirao celular, em termos energticos e metablicos, so caracterizadas,
respectivamente, como processos:
(A) endotrmicos e anablicos.
(B) endotrmicos e catablicos.
(C) exotrmicos e anablicos.
(D) exotrmicos e catablicos.
(E) isotrmicos e catablicos.
B
A figura abaixo representa o ciclo celular de uma clula eucaritica.

Assinale a alternativa correta em relao interfase.


(A) A interfase o perodo em que no ocorre diviso celular, e a clula permanece sem atividade
metablica.
(B) As clulas que no se dividem so normalmente mantidas em G0.
(C) O nuclolo desaparece durante o G1.
(D) A quantidade de DNA permanece constante durante o perodo S.
(E) O G2 caracteriza-se pela presena de cromossomos constitudos de uma nica cromtide.
B
Assinale a afirmativa correta, referente s doenas sexualmente transmissveis (DST).
(A) A sfilis causada por um protozorio e, se no tratada, pode levar a alteraes no sistema
nervoso, circulatrio e urinrio.
(B) A gonorria causada por um vrus que pode ser tratado com antibiticos.
(C) A tricomonase provocada por uma bactria, e sua maior ocorrncia em homens.
(D) A pediculose pubiana causada por um inseto que provoca coceira na regio pubiana.
(E) O cncer de colo de tero causado pelo HPV, e seu avano pode ser controlado com
antifngicos.
D
Considere a figura abaixo, que representa uma vista lateral de um joelho humano.

Assinale a alternativa que apresenta os tipos dos tecidos conjuntivos que correspondem,
respectivamente, aos nmeros 1, 2, 3 da figura.
(A) cartilaginoso - denso - frouxo
(B) reticular - frouxo - cartilaginoso
(C) frouxo - reticular - frouxo
(D) cartilaginoso - frouxo - denso
(E) frouxo - cartilaginoso - denso
A
Bactrias so agentes causadores de diversas doenas, e algumas delas podem ser muito graves.
Considere as afirmaes abaixo, a respeito de doenas.

I - A clera causada por um vibrio, que eliminado junto com as fezes.


II - A gastrite bacteriana causada pela Helicobacter pylori, que pode levar ao cncer.
III - A dengue hemorrgica causada por bactrias, do tipo bacilo, eliminadas no sangue.

Quais esto corretas?

(A) Apenas I.
(B) Apenas III.
(C) Apenas I e II.
(D) Apenas II e III.
(E) I, II e III.
C
Assinale a alternativa que preenche corretamente as lacunas do enunciado abaixo, na ordem em que
aparecem.
As dicotiledneas apresentam ........ e ........, o que lhes permite crescimento secundrio.
(A) protoderme - procmbio
(B) cmbio vascular - felognio
(C) coifa - procmbio
(D) protoderme - felognio
(E) coifa - anis anuais
B
A coluna da esquerda, abaixo, lista quatro grupos de plantas atuais; a da direita, caractersticas
desses grupos.
Associe adequadamente a coluna da direita da esquerda.
1 - Brifita
2 - Pteridfita
3 - Gimnosperma
4 - Angiosperma
[ ] plantas avasculares que apresentam rizoides
[ ] plantas sem sementes que apresentam esporngios
[ ] plantas com estrbilos que apresentam sementes nuas

A sequncia correta de preenchimento dos parnteses, de cima para baixo,


(A) 3 - 2 - 1.
(B) 3 - 1 - 4.
(C) 1 - 4 - 3.
(D) 2 - 3 - 4.
(E) 1 - 2 - 3.
E
A coluna da esquerda, abaixo, apresenta caractersticas de diferentes grupos de invertebrados; a da
direita, trs grupos de invertebrados.
Associe adequadamente a coluna da direita da esquerda.
1 - Rdula como estrutura para alimentao
2 - Locomoo realizada pelo sistema ambulacrrio
3 - Corpo composto de exoesqueleto
4 - Presena de respirao por espirculos
[ ] Crustceos
[ ] Moluscos
[ ] Equinodermas

A sequncia correta de preenchimento dos parnteses, de cima para baixo,


(A) 3 - 4 - 1.
(B) 3 - 1 - 2.
(C) 1 - 4 - 3.
(D) 2 - 1 - 4.
(E) 1 - 2 - 3.
B
Observe os esquemas abaixo que representam sistemas circulatrios de vertebrados.

Em relao aos dois esquemas, considere as seguintes afirmaes.


I - O vertebrado do esquema A possui brnquias; o do B, pulmes.
II - O esquema A representa circulao simples; o B, circulao dupla.
III - O esquema A caracterstico de anfbios.

Quais esto corretas?

(A) Apenas I.
(B) Apenas III.
(C) Apenas I e II.
(D) Apenas II e III.
(E) I, II e III.
C
A coluna da esquerda, abaixo, lista cinco estruturas que fazem parte do sistema nervoso; a da
direita, caractersticas de trs dessas estruturas.
Associe adequadamente a coluna da direita da esquerda.
1 - bulbo
2 - cerebelo
3 - hipfise
4 - hipotlamo
5 - medula espinhal
[ ] responsvel pelo controle das funes motoras do corpo.
[ ] Possui grupos de neurnios envolvidos no controle de respirao e circulao.
[ ] Possui o centro do controle para manuteno da temperatura corporal.

A sequncia correta de preenchimento dos parnteses, de cima para baixo,


(A) 3 - 5 - 4.
(B) 2 - 4 - 3.
(C) 3 - 5 - 1.
(D) 2 - 1 - 4.
(E) 5 - 1 - 3.
D
Assinale com V (verdadeiro) ou F (falso) as afirmaes abaixo, referentes fisiologia respiratria
humana.
[ ] O principal msculo respiratrio o diafragma.
[ ] O dixido de carbono (CO2) , principalmente, transportado dissolvido no plasma como
bicarbonato (HCO3-).
[ ] A enzima anidrase carbnica, presente no plasma, participa no transporte de oxignio.
[ ] A mioglobina funciona como a reserva de oxignio para os msculos.

A sequncia correta de preenchimento dos parnteses, de cima para baixo,


(A) V - F - V - V.
(B) F - F - V - F.
(C) F - V - F - V.
(D) V - V - F - V.
(E) V - V - V - F.
D
A puberdade o perodo de maturao sexual em humanos. Essa fase do desenvolvimento
caracteriza-se pelo:
(A) aumento da produo de gonadotropinas e de esteroides sexuais.
(B) decrscimo da produo do hormnio luteinizante.
(C) incio da produo de esteroides sexuais, como a testosterona e o estradiol.
(D) aumento da produo dos hormnios trficos da neuro-hipfise.
(E) decrscimo da produo de andrgenos, de estrgenos e de progesterona.
A
O estudo de gmeos utilizado para a anlise de caractersticas genticas humanas. Gmeos
monozigticos, exceto por raras mutaes somticas, so geneticamente idnticos. Os gmeos
dizigticos, por outro lado, tm, em mdia, 50% de seus alelos em comum. O quadro abaixo
apresenta a concordncia obtida para gmeos mono e dizigticos em um estudo relacionado a trs
diferentes caractersticas.

Com base no quadro acima e em seus conhecimentos de gentica, assinale com V (verdadeiro) ou F
(falso) as afirmaes abaixo.

[ ] A cor dos olhos parece ter influncia ambiental, uma vez que a concordncia em gmeos
dizigticos baixa.
[ ] A tuberculose no tem influncia gentica, j que apresenta o mesmo baixo grau de
concordncia nos dois tipos de gmeos.
[ ] A presso alta parece ser influenciada tanto por fatores genticos, quanto por fatores ambientais.
[ ] A cor dos olhos e a presso alta apresentam o mesmo grau de influncia ambiental, uma vez que
compartilham uma concordncia de 40% entre os gmeos dizigticos.

A sequncia correta de preenchimento dos parnteses, de cima para baixo, :

(A) V - V - F - V.
(B) V - F - V - F.
(C) F - F - V - V.
(D) V - F - F - V.
(E) F - V - V - F.
E
Um estudante de biologia suspeita que uma determinada caracterstica recessiva em ces ligada ao
sexo. Aps um nico cruzamento entre um macho com fentipo dominante e uma fmea com
fentipo recessivo, obtida uma prole constituda de trs machos com fentipo recessivo e quatro
fmeas com fentipo dominante.
Com base nesse experimento, assinale a alternativa correta.

(A) O resultado obtido compatvel com herana ligada ao sexo, mas no exclui herana
autossmica.
(B) O resultado obtido exclui herana ligada ao sexo.
(C) O resultado obtido compatvel com herana ligada ao sexo e exclui herana autossmica.
(D) O resultado obtido compatvel com herana autossmica, desde que os pais sejam
homozigotos.
(E) O resultado obtido compatvel com herana autossmica, e as propores da prole esto de
acordo com o esperado.
A
Analise as informaes abaixo, relacionadas aos mecanismos de isolamento reprodutivo.
1 - Os sapos do gnero Scaphiopus vivem em diferentes tipos de solo.
2 - Existem insetos que se acasalam em diferentes horrios, durante a noite.
3 - As fmeas de vagalumes no respondem aos sinais de luz emitidos pelos machos de outras
espcies.
4 - O plen de uma espcie de angiosperma transferido ao estigma de outra espcie, mas os tubos
polnicos no atingem os vulos, por crescerem lentamente.

Com relao s informaes apresentadas, assinale a alternativa correta.

(A) Em 1, o mecanismo de isolamento mecnico, e os parceiros potenciais encontram-se.


(B) Em 1 e 2, os mecanismos de isolamento so, respectivamente, de habitat e de tempo, e os
parceiros potenciais no se encontram.
(C) Em 2 e 3, os mecanismos de isolamento so etolgicos, e os parceiros potenciais encontram-se,
mas no copulam.
(D) Em 3, o mecanismo de isolamento mecnico, e os parceiros potenciais no se encontram.
(E) Em 4, o mecanismo de isolamento reprodutivo ps-zigtico.
B
Na figura abaixo, os nmeros esquerda indicam a porcentagem da diferena entre os DNAs de
primatas superiores; os nmeros direita, uma estimativa dos milhes de anos transcorridos desde
que eles tiveram um ancestral em comum.

Com base nos dados apresentados na figura, assinale com V (verdadeiro) ou F (falso) as afirmaes
abaixo.
[ ] O parentesco entre os humanos e os chimpanzs mais prximo do que o de qualquer um dos
dois com os macacos do Velho Mundo.
[ ] Gorilas e chimpanzs so mais similares entre si do que com os humanos, uma vez que os
humanos se separaram antes da divergncia ocorrida entre gorilas e chimpanzs.
[ ] Humanos, gorilas e chimpanzs so equidistantes em sua estrutura gentica geral.
[ ] A distncia gentica que separa os humanos dos chimpanzs menor do que a existente entre as
duas espcies de gibes, mostradas na figura.
A sequncia correta de preenchimento dos parnteses, de cima para baixo,
(A) V - V - F - V.
(B) V - F - V - F.
(C) F - F - V - V.
(D) V - F - F - V.
(E) F - V - V - F.
D
Considere as afirmaes abaixo sobre os fsseis.
I - Partes de organismos so consideradas fsseis, somente se encontradas em rochas sedimentares.
II - O processo de fossilizao requer condies ambientais especficas, o que contribui para a sua
raridade.
III - Fsseis mais antigos podem ser encontrados na camada superior do sedimento, em funo das
movimentaes da crosta terrestre.

Quais esto corretas?


(A) Apenas I.
(B) Apenas II.
(C) Apenas I e III.
(D) Apenas II e III.
(E) I, II e III.
D
O mapa abaixo representa os principais biomas brasileiros.

Assinale a alternativa correta com relao aos biomas representados.


(A) O 2 pobre em recursos hdricos.
(B) O 3 caracteriza-se pela presena de vegetao caduciflia.
(C) O 4 caracteriza-se pela presena de vegetais com pneumatforos.
(D) O 5 o que perdeu a maior parte de sua rea original.
(E) O 6 caracteriza-se pela inundao de grandes reas, nos meses de cheia.
E
Ao longo do tempo, ocorrem mudanas na repartio de energia, na estrutura das espcies e nos
processos de uma comunidade biolgica, e essa sequncia de mudanas denominada sucesso
ecolgica. Com relao sucesso ecolgica, considere as afirmaes abaixo.

I - O estgio inicial de uma sucesso caracteriza-se pela presena de plantas pioneiras que exibem
altas taxas de crescimento.
II - A sucesso secundria leva mais tempo para atingir o clmax, do que a primria.
III - O estgio de clmax caracteriza-se por baixa diversidade de espcies, em funo do aumento
dos nichos ecolgicos.

Quais esto corretas?


(A) Apenas I.
(B) Apenas III.
(C) Apenas I e II.
(D) Apenas II e III.
(E) I, II e III.
A
Assinale com V (verdadeiro) ou F (falso) as afirmaes abaixo, referentes a alteraes do equilbrio
ambiental.

[ ] A borracha, o plstico e o isopor so exemplos de materiais no biodegradveis.


[ ] Os lixes a cu aberto so responsveis pela proliferao de animais que causam doenas, como
a leptospirose.
[ ] Nos aterros sanitrios, o lixo contamina o solo.
[ ] As pilhas e baterias so ricas em metais pesados e devem ser recolhidas e depositadas em aterros
sanitrios.

A sequncia correta de preenchimento dos parnteses, de cima para baixo,


(A) V - F - V - V.
(B) F - F - V - F.
(C) F - V - F - V.
(D) V - V - V - F.
(E) V - V - F - F.
E
A figura abaixo apresenta trs padres hipotticos de curvas de sobrevivncia, frequentemente
encontrados na natureza.

Assinale com V (verdadeiro) ou F (falso) as afirmaes abaixo, referentes a essas curvas.


[ ] A curva I ilustra uma situao na qual a probabilidade de sobrevivncia aproximadamente
igual, durante a maior parte da vida.
[ ] A curva II caracteriza organismos com poucos descendentes e muito investimento parental.
[ ] A curva III tpica de organismos em que a sobrevivncia baixa entre os jovens.
[ ] A curva III caracteriza organismos com muitos descendentes e nenhum cuidado parental.

A sequncia correta de preenchimento dos parnteses, de cima para baixo, :

(A) V - V - F - F.
(B) F - V - V - V.
(C) V - F - V - V.
(D) F - V - F - F.
(E) F - F - V - V.
C
Clulas procariontes e eucariontes possuem tanto aspectos em comum quanto aspectos que as
diferenciam. A figura abaixo representa esses tipos celulares indicando alguns de seus componentes.
Em relao s caractersticas dessas clulas e aos aspectos indicados na figura, podemos afirmar o
que segue.

0-0) Tanto procariontes quanto eucariontes possuem o mecanismo replicativo/hereditrio na forma


de cidos nucleicos.
1-1) Clulas procariontes no possuem os ribossomos, que so necessrios produo de protenas
nas clulas eucariontes.
2-2) Por possurem parede celular, as clulas A e C so certamente procariontes.
3-3) A clula A no possui material nuclear e, portanto, tambm no possui os genes, sendo assim
uma clula procarionte.
4-4) A clula A procarionte, e as clulas B e C so eucariontes.
VFFFV
JUSTIFICATIVAS:
0-0) VERDADEIRA - Os cidos nucleicos constituem o mecanismo hereditrio tanto em
procariontes quanto em eucariontes.
1-1) FALSA - Tanto clulas procariontes quanto clulas eucariontes possuem os ribossomos.
2-2) FALSA. - A clula C representa uma clula vegetal, que possui parede celular e tambm
eucarionte.
3-3) FALSA. - A clula A representa, de fato uma clula procarionte, mas a inexistncia de ncleo
organizado no implica falta de material nuclear e de genes.
4-4) VERDADEIRA. - A clula A no possui ncleo organizado, diferentemente das clulas B e C,
que so eucariontes.
Respirao e fotossntese so fenmenos bioqumicos que interagem sinergicamente, um
fornecendo matria prima para as necessidades do outro. A figura abaixo apresenta esquema de um
cloroplasto e uma mitocndria, participantes desses fenmenos, e uma representao bioqumica da
relao entre os dois processos. Sobre esses fenmenos, podemos fazer as afirmaes seguintes.

0-0) O processo bioqumico que ocorre em A essencial para a funo dos organismos produtores
na cadeia trfica.
1-1) O processo bioqumico que ocorre em B encontrado apenas nas clulas animais.
2-2) Embora a relao entre A e B seja cclica, ela s se mantm com energia externa, que
capturada por A e acrescentada ao sistema.
3-3) Na figura, o C6H12O6 resultante do processamento de gs carbnico, gua e energia solar nas
mitocndrias dos vegetais.
4-4) A reao qumica que ocorre em B pode ser resumida pela equao:
6O2 + C6H12O6 6CO2 + 6H2O + Energia
VFVFV
JUSTIFICATIVAS:
0-0) VERDADEIRA. - O que ocorre em A a fotossntese e a base de produo dos alimentos que
mantm a cadeia trfica.
1-1) FALSA. - O que ocorre em B a respirao, que ocorre nas mitocndrias e est presente tanto
em clulas animais quanto em clulas vegetais.
2-2) VERDADEIRA. - O sistema apenas se mantm com acrscimo de energia, que capturada na
forma de luz pelos cloroplastos, representados na figura por A.
3-3) FALSA. - A produo de matria orgnica, a partir de matria inorgnica e energia solar, se d
nos cloroplastos e no nas mitocndrias.
4-4) VERDADEIRA. - A reao que ocorre em B a respirao, que pode ser resumida por essa
equao.
Diversos fatores podem interferir na taxa de fotossntese, alterando a velocidade com que ocorre o
processo ou limitando-o. A figura abaixo apresenta curvas com a taxa de fotossntese sob diferentes
condies de luz, temperatura e concentrao de CO2. Analise essas curvas para avaliar as
proposies seguintes.

0-0) A curva A se inclina em 500 lm/ft2 porque limitada pela baixa temperatura.
1-1) A curva B se inclina aps 1000 lm/ft2 porque limitada pela alta concentrao de CO2.
2-2) As curvas mostram que a luminosidade , de fato, o nico fator limitante para o processo de
fotossntese.
3-3) As curvas mostram que temperatura, concentrao de CO2 e luminosidade esto diretamente
relacionadas com a fotossntese.
4-4) Nenhuma das trs curvas pode representar a taxa de fotossntese porque elas no apresentam o
que, de fato, ocorre nas condies propostas.
FFFVF
JUSTIFICATIVAS:
0-0) FALSA. - A limitao da curva A pela baixa concentrao de CO2, isso pode ser visto porque
a curva B representa a mesma temperatura e existe maior taxa de fotossntese.
1-1) FALSA. - Quanto mais CO2 maior a taxa de fotossntese. A curva B limitada pela
temperatura, pois, na curva C, ocorre maior taxa de fotossntese com a mesma concentrao de CO2
e maior temperatura.
2-2) FALSA. - As curvas mostram que a concentrao de CO2 e a temperatura podem limitar o
processo de fotossntese.
3-3) VERDADEIRA. - A temperatura, concentrao de CO2 e a luminosidade apresentam
correlao positiva com a taxa de fotossntese, e isso representado nos grficos.
4-4) FALSA. - As curvas so bem representativas da variao na taxa de fotossntese quando se
muda luminosidade, temperatura e concentrao de CO2.
Um grupo de cientistas japoneses descobriu mutaes em borboletas expostas radiao na rea em
torno da central atmica de Fukushima, epicentro da crise nuclear de 2011. A liberao em massa de
material radioativo no meio ambiente causou "danos fisiolgicos e genticos" s borboletas
Zizeeria sp., comuns no Japo. Este tipo de borboletas tem um ciclo de vida aproximado de um
ms, e so excelentes "indicadores ambientais". Quanto replicao do material gentico e s
mutaes ocorridas, podemos afirmar o que segue.

0-0) A radiao de Fukushima induziu mutaes rapidamente nas clulas de borboletas apenas por
se tratar de um animal de curto ciclo reprodutivo.
1-1) Assim como ocorreu em Fukushima, as mutaes sempre so provocadas pelos agentes
mutagnicos como a radiao e provocam alteraes deletrias.
2-2) A DNA-polimerase tambm atua na correo de erros de duplicao.
3-3) A DNA-polimerase atua de forma unidirecional sobre a dupla hlice de DNA.
4-4) As mutaes do tipo insero ocorrem por incluso de nucleotdeos na cadeia original, o que
pode mudar significativamente o produto final.
FFVFV
JUSTIFICATIVAS:
0-0) FALSA. - A velocidade de induo das mutaes no depende do ciclo reprodutivo do animal,
embora dependa disso para aparecer na descendncia.
1-1) FALSA. - As mutaes tambm podem ocorrer por erros espontneos durante o processo de
replicao do material gentico.
2-2) VERDADEIRA. - Ocasionalmente podem ocorrer erros de duplicao provocados por agentes
mutagnicos. Uma das aes da DNA-polimerase a substituio de bases, corrigindo esses erros
de duplicao.
3-3) FALSA. - A ao da DNA-polimerase ocorre de forma bidirecional, polimerizando novas
cpias a partir dos dois braos da fita original de DNA.
4-4) VERDADEIRA. - Ocasionalmente podem ocorrer erros de duplicao provocados pela
incluso de novos nucleotdeos na cadeia. Esse tipo de mutao chamado de mutao por
insero.
O daltonismo gentico uma perturbao da percepo visual caracterizada pela incapacidade de
diferenciar cores, manifestando-se muitas vezes pela dificuldade em distinguir o verde do vermelho.
Se os alelos D e d esto associados ao daltonismo, ento correto fazer as afirmaes seguintes.

0-0) Filhas de mes com gentipo XDXd possuem 50% de chances de serem portadoras apenas se
seus pais forem normais.
1-1) Homens portadores do alelo Xd expressam a condio de daltonismo assim como todos os seus
filhos e filhas.
2-2) Para essa condio no existe o pai portador normal.
3-3) Como o gene do daltonismo recessivo, em nenhuma hiptese, um casal ter 100% de chances
de ter todos os seus filhos daltnicos.
4-4) Pai daltnico no transmite gene dessa condio aos filhos do sexo masculino.
VFVFV
JUSTIFICATIVAS:
0-0) VERDADEIRA. - Sendo heterozigtica, a me possui 50% de chances de passar cada alelo,
recessivo ou dominante, para os filhos. Sendo do sexo feminino, isso equivale a 50% de chances de
serem portadoras, caso o pai seja normal.
1-1) FALSA. - Sendo ligado ao cromossomo X, existe a possibilidade de terem filhas normais,
desde que a me seja normal.
2-2) VERDADEIRA. - Como est ligado ao cromossomo X, e os homens possuem apenas um,
possuindo o alelo, mesmo sendo esse recessivo, o pai expressa a alterao
3-3) FALSA. - Em caso de me daltnica e pai daltnico, todos os filhos sero daltnicos.
4-4) VERDADEIRA. - O gene da hemofilia est ligado ao cromossomo X. Dessa forma, os gametas
com cromossomos Y no carregam esse gene, e, portanto, apenas as mes podem passar esse alelo
aos filhos do sexo masculino.
As ideias de que os organismos evoluem no surgiram com Darwin, pois, desde a antiga Grcia,
existiram pensadores que defenderam essa posio. As ideias evolucionistas careciam de uma base
convincente, e Darwin apresentou essa base. Sobre a histria da evoluo e seus mecanismos,
analise as proposies seguintes.

0-0) As mutaes geralmente so deletrias e, por isso, no contribuem para o processo evolutivo.
1-1) A especiao ocorre sempre de forma gradual e contnua.
2-2) O lobo placentrio europeu e o lobo marsupial da Tasmnia so exemplos de convergncia
adaptativa.
3-3) A teoria da evoluo por seleo natural se apoia necessariamente na presena de variao nas
caractersticas dos descendentes.
4-4) Mesmo entre os cientistas da poca, a teoria da Evoluo de Darwin causou choque por
antagonizar as ideias de fixismo das espcies, defendida por Lamark at ento.
FFVVF
JUSTIFICATIVAS:
0-0) FALSA. - Embora a taxa de mutao seja geralmente baixa e boa parte das alteraes seja
deletria, existem mutaes positivas sobre as quais as foras seletivas podem atuar, colaborando
para o processo de evoluo.
1-1) FALSA. - A formao de novas espcies um processo complexo que ocorre em funo de
fatores cuja influncia no linear e gradual. Dessa forma, a especiao ocorre principalmente em
momentos propcios em que formam as irradiaes adaptativas, seguidas de perodos com pouca
modificao.
2-2) VERDADEIRA. - Na convergncia adaptativa, organismos no aparentados evoluem
apresentando caractersticas muito parecidas, em funo do tipo de ambiente em que vivem e da
forma como exploram esse ambiente; esse o caso do lobo europeu e do lobo marsupial.
3-3) VERDADEIRA. - Segundo Darwin, a Seleo Natural age sobre variaes que existem nas
proles. Sem essas variaes, no poderia haver a eliminao dos menos adaptados e a reproduo
dos bem sucedidos, base do processo evolutivo.
4-4) FALSA. - Embora tenha causado choque mesmo entre os cientistas, as ideias de Darwin no
eram completamente antagnicas s ideias de Lamarck, que tambm era evolucionista. Diferiam,
entretanto, nas explicaes dadas ao processo da evoluo.
A figura abaixo apresenta alguns tecidos vegetais. Analise-a para avaliar as proposies seguintes.

0-0) Em A, as estruturas identificadas pelo nmero 1 tm a funo de efetuar trocas gasosas e fazer
a regulao hdrica do vegetal.
1-1) A estrutura indicada pelo nmero 3 chamada coifa e tem a funo de proteger o tecido
subjacente durante o crescimento radicular.
2-2) O tecido indicado pelo nmero 2 conhecido como mesnquima. constitudo principalmente
de clulas rgidas, em sua maioria, mortas, para resistir s tenses provocadas pelo crescimento
radicular.
3-3) O esclernquima um tecido rgido, formado principalmente por clulas mortas, quando
maduro, e com funo de sustentao.
4-4) Xilema e floema constituem o tecido de conduo que permite a circulao da seiva,
constituda essencialmente de matria orgnica, e da seiva com matria inorgnica,
respectivamente.
VVFVF
JUSTIFICATIVAS:
0-0) VERDADEIRA. - As estruturas so os estmatos, e sua funo transpirao e trocas gasosas.
1-1) VERDADEIRA. - A coifa uma estrutura presente nas razes em crescimento e tem a funo
de proteger o mesnquima.
2-2) FALSA. - O tecido indicado realmente o mesnquima; entretanto, no rgido e nem morto,
pois a partir dele se diferenciam vrios tipos celulares que permitem o crescimento do vegetal.
3-3) VERDADEIRA. - O esclernquima o tecido de sustentao por excelncia e, quando
maduro, se constitui de clulas mortas e rgidas.
4-4) FALSA. - Xilema conduz seiva bruta, essencialmente inorgnica, e o floema conduz a seiva
elaborada, com grande quantidade de matria orgnica.
Os organismos vegetais so altamente diversificados e apresentam variaes na estrutura e na
fisiologia, conforme sua histria evolutiva e a necessidade de adaptao ao ambiente. Em relao s
plantas, certo que:

0-0) embora no possuam frutos, as gymnospermas produzem sementes.


1-1) as angiospermas incluem plantas com flores e sem flores, sendo as que possuem flores mais
importantes para nossa vida.
2-2) entre as adaptaes aos ambientes ridos, podemos encontrar folhas modificadas em espinhos,
fechamento dos estmatos nas horas mais quentes do dia e acmulo de gua no caule e nas razes.
3-3) tropismos so movimentos de crescimento da planta em funo de um estmulo, a exemplo do
contato de algum objeto, como as gavinhas de trepadeiras.
4-4) as auxinas so hormnios que participam dos processos fisiolgicos dos vegetais, como
regulao do crescimento.
VFVVV
JUSTIFICATIVAS:
0-0) VERDADEIRA. - As gymnospermas constituem um grupo de plantas vasculares, produtoras
de sementes, mas no produzem frutos, o que caracterstico das angiospermas.
1-1) FALSA. - O grupo das angiospermas inclui apenas plantas com flores.
2-2) VERDADEIRA. - Folhas em forma de espinhos, fechamento dos estmatos nas horas mais
quentes do dia e acmulo de gua no caule e nas razes so adaptaes caractersticas aos climas
ridos.
3-3) VERDADEIRA. - Os tropismos direcionam o crescimento da planta. Podem ser direcionados
por vrios tipos de estmulo, como a luz no fototropismo, e o contato com objeto no tigmotropismo,
que tem como exemplo as gavinhas de trepadeiras.
4-4) VERDADEIRA. - Auxinas, giberelinas e etileno so hormnios vegetais importantes na
regulao do crescimento e outras funes metablicas dos vegetais.
As iguanas marinhas de Galpagos (Amblyrhynchus cristatus) esto sujeitas a variaes de
temperatura provocadas pelo seu hbito de se alimentar no mar e se aquecer nas rochas. Para
entender sua adaptao, um pesquisador estudou como se comportam o consumo de oxignio e a
frequncia cardaca dessas iguanas em duas temperaturas. Analise o grfico e avalie as proposies
que o seguem.
0-0) O grfico mostra que, quando aumenta o consumo de O2, aumenta tambm a frequncia
cardaca, o que normal, pois, para que se aumente o uso de O2, deve haver mais fluxo de sangue
distribuindo esse O2 nos sistemas.
1-1) O grfico est errado porque, como as iguanas so pecilotrmicas, seu corpo sempre est frio.
2-2) O grfico mostra a completa independncia dos sistemas respiratrio e cardaco, o que
caracterstico dos vertebrados.
3-3) Assim como as aves, o corao dos rpteis possui quatro cmaras bem definidas e separadas;
dessa forma, o grfico representa bem o que ocorre na natureza.
4-4) Pelo grfico, podemos deduzir que, em maiores temperaturas, existe um aumento no trabalho
cardaco. Isso mais evidente em espcies pecilotrmicas porque sua temperatura varia com o
ambiente.
VFFFV
JUSTIFICATIVAS:
0-0) VERDADEIRA. - As funes cardaca e respiratria devem estar acopladas para que o O2
captado no sistema respiratrio seja distribudo pelo corpo adequadamente.
1-1) FALSA. - Os grficos esto corretos e representam o que, de fato, ocorre no ambiente.
2-2) FALSA. - O grfico mostra exatamente que os dois sistemas esto correlacionados.
3-3) FALSA. - O corao dos rpteis no apresenta quatro cmaras separadas.
4-4) VERDADEIRA. - Pelo grfico, na maior temperatura, maior o trabalho cardaco, e as
espcies pecilotrmicas esto mais sujeitas a isso.
A circulao do sangue um processo essencial na vida dos vertebrados, e o processo de evoluo
propiciou o aparecimento de caractersticas especficas para garantir essa funo nos diversos
grupos animais. Quanto a essas caractersticas, podemos afirmar que:

0-0) Artrias e veias se diferenciam, entre outras coisas, porque artrias possuem uma espessa
camada muscular, e as veias possuem vlvulas que subdividem seu lmen em pequenas cmaras.
1-1) Nas aves, assim como nos mamferos, o sangue propelido por um corao de quatro cmaras.
2-2) Ao longo da evoluo, o corao, nas diversas classes de vertebrados, aumentou o nmero de
cmeras atriais e ventriculares.
3-3) O sistema circulatrio pode ser do tipo aberto em vertebrados das classes menos evoludas.
4-4) No homem, a presso arterial depende diretamente da frequncia cardaca e do volume de
lquidos em circulao.
VVVFV
JUSTIFICATIVAS:
0-0) VERDADEIRA. - As artrias so vasos resistivos que apresentam camada muscular espessa
enquanto as veias, no. J as veias so subdivididas internamente por vlvulas que impedem o
retorno sanguneo, dirigindo o fluxo para o trio.
1-1) VERDADEIRA. - Aves e mamferos possuem corao semelhante com quatro cavidades por
onde o sangue venoso e o arterial circulam sem mistura.
2-2) VERDADEIRA. - Ao longo do processo evolutivo, o corao aumentou o nmero de cmaras,
sendo formado por apenas 2 cmaras nos peixes, 3 cmaras nos anfbio e 4 nas aves e mamferos,
embora vrios rpteis apresentem 5 cmaras.
3-3) FALSA. - Em todos os vertebrados, o sistema circulatrio do tipo fechado, diferentemente
dos invertebrados que podem apresentar os dois tipos de circulao.
4-4) VERDADEIRA. - Embora existam outros fatores, a frequncia cardaca e o volume de lquido
em circulao afetam diretamente a presso arterial.
O sistema nervoso e o sistema endcrino transmitem informaes eltricas ou qumicas para
coordenar e regular as funes orgnicas, integrando o funcionamento do organismo. No que se
refere a essa ao integradora dos sistemas nervoso e endcrino, analise as proposies seguintes.

0-0) As aes do sistema nervoso central e do sistema endcrino so coordenadas por uma glndula
de primeiro nvel, conhecida como hipfise.
1-1) Os hormnios possuem ao difusa em relao aos neurotransmissores, que atuam de forma
mais localizada.
2-2) O hipotlamo tem ao integradora dos dois sistemas, influenciando tanto as funes neurais
quanto as funes endcrinas.
3-3) A hipfise secreta hormnios reguladores que controlam outras glndulas. O cortisol um
exemplo disso.
4-4) O hormnio ACTH faz parte da cadeia hormonal que atua em situaes de estresse.
FVVFV
JUSTIFICATIVAS:
0-0) FALSA. - A hipfise coordena as funes de grande parte das glndulas endcrinas, mas ela
prpria regulada pelo sistema nervoso central atravs do hipotlamo.
1-1) VERDADEIRA. - Os hormnios atuam atravs do sistema circulatrio, e sua ao espalhada,
atingindo vrias partes do organismo; j os neurotransmissores so liberados em sinapses e sua ao
restrita a essa regio.
2-2) VERDADEIRA. - O hipotlamo recebe informaes de vrias reas do sistema nervoso central
e atua sobre o sistema endcrino atravs da hipfise, bem como pode comandar funes pelo
sistema nervoso autnomo.
3-3) FALSA. - O hipotlamo realmente secreta hormnios reguladores, mas o cortisol no um
hormnio hipotalmico e, sim, um hormnio secretado pelas adrenais.
4-4) VERDADEIRA. - O ACTH um hormnio hipofisrio que estimula as adrenais a produzirem
o cortisol como uma defesa fisiolgica em situaes de estresse.
A respirao humana influenciada por fatores internos e externos ao organismo. Esses fatores
podem acelerar ou reduzir o ritmo respiratrio, conforme as necessidades do corpo. Acerca desse
tema, analise as afirmaes seguintes.

0-0) Em caso de menor eficincia na eliminao de CO2, o pH sanguneo poder baixar.


1-1) Ao nvel do mar, o principal gs que influencia o ritmo respiratrio o oxignio.
2-2) O diafragma ativo tanto na inspirao quanto na expirao.
3-3) O centro regulador automtico do ritmo respiratrio se localiza no bulbo.
4-4) A entrada de ar nos pulmes ocorre quando a presso atmosfrica maior que a presso
pulmonar.
VFFVV
JUSTIFICATIVAS:
0-0) VERDADEIRA. - O acmulo de CO2 tende a reduzir o pH porque, dissolvido no plasma, o
CO2 reage com a gua produzindo cido carbnico.
1-1) FALSA. - Ao nvel do mar, a alta presso de O2 no ar no limitante para a respirao e por
isso no modula o ritmo. Nessas condies, o principal fator de regulao a presso de CO2
sangunea.
2-2) FALSA. - A inspirao se d com a contrao do diafragma, mas a expirao ocorre com seu
relaxamento.
3-3) VERDADEIRA. - O principal centro de automatismo respiratrio se encontra no bulbo, tronco
enceflico, assim como qumio-receptores que ajudam a modular o ritmo respiratrio pela sua
funo de monitoramento.
4-4) VERDADEIRA. - A presso pulmonar varia de menor a maior que a atmosfrica em funo da
alterao no volume pulmonar durante o ciclo respiratrio. O ar sempre se desloca do ponto de
maior presso para um de menor presso. Na inspirao, a presso pulmonar menor que a
atmosfrica e, na expirao, a presso pulmonar maior.
As parasitoses so responsveis por inmeros prejuzos sanitrios e econmicos no mundo, por
afetar a sade de seres humanos e animais e, em algumas regies, chegam a ser consideradas um
flagelo. Quanto s parasitoses, analise as afirmaes abaixo.

0-0) Alm dos vermes, os artrpodes constituem importante grupo com espcies bem adaptadas
vida parasitria.
1-1) Os cisticercos de Taenia solium normalmente so encontrados no intestino humano e so
eliminados pelas fezes.
2-2) Nos cestoda, a perda de partes do corpo, conhecidas como progltides, parte essencial do
ciclo de vida e est relacionada com a reproduo.
3-3) O amarelo, provocado pelo Ancylostoma duodenale, caracterstico de regies secas ou
desrticas, onde considerado um flagelo.
4-4) O amarelo, a ascaridase e a filariose so parasitoses provocadas por vermes nematoides.
VFVFV
JUSTIFICATIVAS:
0-0) VERDADEIRA. - Muitos parasitas so artrpodes.
1-1) FALSA. - As tnias produzem ovos que so eliminados pelas fezes juntamente com as
subdivises do corpo do verme, conhecidas como progltides. Os cisticercos normalmente se
formam na carne dos animais utilizados como alimento e podem contaminar, caso essa carne seja
consumida sem cozimento adequado.
2-2) VERDADEIRA. - O corpo dos cestoda subdividido e apresentas partes conhecidas como
progltides que, quando maduras, possuem os ovos e so eliminadas junto com estes pelas fezes.
3-3) FALSA. - O Ancylotoma caracterstico de regies quentes e midas, pois seus ovos, ao
carem em ambientes com umidade adequada, se transformam em larvas que podem penetrar pela
pele contaminando outras pessoas.
4-4) VERDADEIRA. - A ascaridase, o amarelo e a filariose so provocados por vermes
pertencentes ao filo nematoda, que possui espcies de vida livre e espcies parasticas que incluem
as mais comuns parasitoses humanas.
Os vrus so agentes microscpicos que infectam clulas para se reproduzirem, assumindo o
controle de seu metabolismo e levando morte celular. Sobre esses agentes, analise as afirmaes
seguintes.

0-0) So formados essencialmente por protenas e cidos nucleicos, mas alguns tipos podem possuir
um envelope externo de natureza lipdica.
1-1) A poliomielite, a AIDS, a gripe aviria e a malria so doenas causadas por vrus.
2-2) Como os vrus j possuem cidos nucleicos, eles no precisam do material nuclear das clulas
infectadas para se reproduzirem.
3-3) J que no possuem metabolismo prprio, so incapazes de evoluir e modificar suas
caractersticas.
4-4) Sempre possuem DNA como cido nucleico.
VFFFF
JUSTIFICATIVAS:
0-0) VERDADEIRA. - Os vrus so formados apenas por protenas e cidos nucleicos e no
possuem lipdios, exceto aqueles que possuem envelope externo.
1-1) FALSA. - A malria provocada por protozorio e no por vrus.
2-2) FALSA. - O material gentico viral precisa se fundir ao material gentico das clulas
infectadas para controlar seu metabolismo e se reproduzirem.
3-3) FALSA. - Os vrus evoluem, modificando suas caractersticas, s vezes muito rapidamente, o
que pode dificultar a produo de vacinas eficientes.
4-4) FALSA. - Existem vrus que possuem DNA, mas tambm existem vrus com RNA.
Os organismos se relacionam de vrias formas. Algumas dessas relaes so harmnicas, e outras,
desarmnicas. Quanto a essas relaes, analise o que afirmado a seguir.

0-0) Os liquens representam uma relao simbitica entre bactrias e fungos.


1-1) A relao entre o caranguejo-ermito e a anmona exemplo de comensalismo.
2-2) Na protocooperao, os indivduos se beneficiam, mas no so dependentes um do outro.
3-3) As micorrizas so exemplos de mutualismo.
4-4) O comensalismo pode ser utilizado como sinnimo de simbiose obrigatria.
FFVVF
JUSTIFICATIVAS:
0-0) FALSA. - Os lquens representam uma relao simbitica entre algas e fungos.
1-1) FALSA. - Na relao caranguejo-ermito e anmona os dois organismos se beneficiam sem
obrigatoriedade de manter a relao. Isso a caracterstica da protocooperao, ou mutualismo
facultativo. No comensalismo, apenas um se beneficia sem que o outro seja prejudicado.
2-2) VERDADEIRA. - Na protocooperao, os dois organismos se beneficiam sem obrigatoriedade
de manter a relao.
3-3) VERDADEIRA. - As micorrizas, associaes de fungos e razes, um exemplo de relao em
que os dois organismos se beneficiam, conhecido como mutualismo.
4-4) FALSA. - O comensalismo a relao em que um dos organismos se beneficia sem prejudicar
o outro; na simbiose os dois organismos so beneficiados.
Segundo a ONU, a populao do planeta Terra atingiu 7,2 bilhes de pessoas em 2013. De acordo
com as projees de crescimento demogrfico apresentadas por essa entidade, a populao mundial
deve chegar a 8,1 bilhes de pessoas em 2025 e a 9,6 bilhes, em 2050. Com base nessas
informaes e considerando o grfico abaixo, analise as proposies que seguem.

0-0) A tendncia do crescimento populacional no mundo pode ser representada pela curva de
nmero 1, pois sero tomadas medidas a fim de evitar o crescimento excessivo da populao
mundial.
1-1) O crescimento da populao humana tem seguido o perfil de curva S, e a tendncia uma
inclinao, conforme representado na curva de nmero 2.
2-2) Todas as tendncias apresentadas nas curvas de nmeros 1, 2 e 3 so igualmente possveis,
conforme as medidas adotadas pelos governos mundiais para a reduo do crescimento
populacional.
3-3) O grfico mostra que, em funo do avano tecnolgico, a resistncia ambiental no oferece
limites para que o crescimento populacional humano siga o seu potencial bitico.
4-4) O crescimento populacional humano no obedece s mesmas leis de crescimento observadas
em outras populaes animais.
FVFFF
JUSTIFICATIVAS:
0-0) FALSA. - Mesmo com a doo de medidas drsticas no se conseguir estabilizar o
crescimento populacional de imediato.
1-1) VERDADEIRA. - O crescimento populacional em geral segue o perfil em S, e as previses
para o crescimento da populao mundial seguem esse perfil.
2-2) FALSA. - As tendncias de nmero 1 e 3 no so representativas do que pode acontecer no
crescimento da populao mundial.
3-3) FALSA. - As projees atuais mostram uma inclinao na curva de crescimento humano, que
tende a apresentar o mesmo perfil de outras espcies, se distanciando de seu potencial bitico.
4-4) FALSA. - Nenhum dado ou tendncia mostra que a populao humana no esteja sujeita s
mesmas leis de crescimento.
Em uma famlia, o pai possui uma doena determinada por um alelo dominante de um gene
localizado no cromossomo X. A me possui fentipo normal quanto a essa doena. O casal tem
quatro filhos, dois homens e duas mulheres. Apresente o heredograma dessa famlia usando os
smbolos a seguir.
Indique quantas molculas de DNA existem no ncleo de uma clula somtica humana que se
encontra no estgio G1 da intrfase. Justifique sua resposta.
Cada cromtide de um cromossomo possui uma molcula de DNA. A espcie humana possui 23
pares de cromossomos. No estgio G1 da interfase cada cromossomo possui apenas uma cromtide.
O herpes genital uma doena infecciosa causada pelo vrus HSV-2, geralmente transmitido por
meio de relaes sexuais. Quando um mdico detecta o HSV-2 em uma mulher grvida, costuma
recomendar que o parto seja realizado por cesariana, uma interveno cirrgica que extrai o feto
diretamente do tero. Apresente a razo desse cuidado.
A cesariana evita o contato, que provavelmente aconteceria no parto normal, do recm-nascido com
o tecido infectado pelo vrus HSV-2.
Os liquens so uma associao cooperativa entre fungos e algas. Tal associao permite que esses
organismos habitem ambientes inspitos tais como rochas nuas, onde no sobreviveriam
independentemente. Osbenefcios proporcionados pelo fungo para a alga podem incluir: proteo
contra a dessecao e radiao excessiva, fixao e proviso de nutrientes minerais retirados do
substrato. Explique por que a alga fundamental para a sobrevivncia do fungo nesse exemplo de
associao cooperativa.
O fungo um organismo heterotrfico incapaz de produzir seu prprio alimento a partir de fontes
inorgnicas. As algas so seres autotrficos capazes de produzir matria orgnica a partir de
substncias inorgnicas pelo processo de fotossntese. Essa matria orgnica serve de nutriente para
o fungo.
O grfico a seguir mostra a correlao entre a massa corporal dos animais e o custo em energia de
trs tipos de locomoo por eles usados: natao, corrida e vo.

Sob a suposio de que os animais que nadam esto bem adaptados para tal, a natao ,
sabidamente, o meio mais eficiente de locomoo. Indique qual das trs curvas representa a
natao. Justifique sua resposta.
A curva C representa a natao pois o grfico mostra que dada uma massa corporal, os animais
representados na curva C so sempre os que apresentam menor custo energtico do transporte.
Uma parceria internacional definiu como meta distribuir, entre 2008 e 2010, gratuitamente, cerca de
300 milhes de mosquiteiros tratados com inseticidas durveis para proteger todos os leitos em
regies africanas de alta transmisso de uma determinada doena causada por protozorio.
Identifique qual das doenas listadas ao lado poderia ser o foco dessa ao. Justifique sua resposta.
Malria. Das doenas listadas, ela a nica que tem como agente causador um protozorio
(Plasmodium) e cujo agente transmissor, o mosquito (Anopheles), pode ser evitado pela utilizao
de mosquiteiros tratados com inseticidas.
A reproduo de muitas espcies de mariposas facilitada por substncias volteis lanadas no ar
chamadas feromnios. Tais substncias so produzidas por fmeas e capazes de atrair machos a
milhares de metros de distncia. Cada feromnio atrai machos da espcie da fmea que os produziu.
A eficincia dos feromnios est relacionada a grandes diferenas morfolgicas entre machos e
fmeas (dimorfismo sexual), como mostram as figuras abaixo. Armadilhas contendo feromnios so
utilizadas para eliminar mariposas consideradas pragas das lavouras.

Fmea Macho

1. Explique por que o uso de armadilhas de feromnios considerado ambientalmente mais seguro
para as demais espcies de insetos silvestres do que o uso de inseticidas.

2. Explique a importncia do dimorfismo sexual das antenas para a reproduo das mariposas.
1. As armadilhas so especficas; elas s atraem machos da espcie de mariposa que se quer
controlar. Os inseticidas matam insetos de muitas espcies.

2. As mariposas do sexo masculino percebem os feromnios por meio dos receptores olfativos
localizados nas antenas. As antenas plumosas dos machos tm grande superfcie relativa, o que
facilita a percepo de molculas dos feromnios no ar e, portanto, a localizao das fmeas.
Um grande nmero de plantas produz certas substncias, chamadas flavonides, que so lanadas
no solo pelas razes. No solo, os flavonides atraem bactrias do gnero Rhizobium que penetram
no tecido das razes. As razes das plantas tambm se associam a fungos, formando as micorrizas.
Esse tipo de interao entre indivduos que pertencem a espcies diferentes chamado mutualismo.
Apresente o benefcio obtido pelas plantas nessas associaes com bactrias e o benefcio obtido
nas associaes com fungos.
As bactrias do gnero Rhizobium fixam o nitrognio atmosfrico na forma de nitratos, permitindo
sua utilizao pelas plantas. Os fungos ampliam a capacidade de captao de gua e sais minerais
pelas razes das plantas.
As variaes na cor e na forma do fruto de uma espcie diploide de planta esto relacionadas s
variaes nas sequncias do DNA em duas regies especficas, vc e vf. Duas plantas dessa espcie,
uma delas apresentando frutos vermelhos e redondos (Planta A), outra apresentando frutos brancos
e ovais (Planta B), tiveram essas regies cromossmicas sequenciadas. As relaes observadas entre
o fentipo da cor e da forma do fruto e as sequncias de pares de nucleotdeos nas regies vc e vf
nessas duas plantas esto mostradas nos quadros a seguir:

Identifique as sequncias de pares de nucleotdeos das regies cromossmicas vc e vf de uma


terceira planta resultante do cruzamento entre a Planta A e a Planta B. Justifique sua resposta.
As plantas A e B so homozigticas para as regies vc e vf, logo, cada uma delas produzir
apenas um tipo de gameta em relao a essas regies. A planta resultante do cruzamento ser
necessariamente heterozigtica.
A hiptese sobre a origem das clulas eucariticas com maior nmero de adeptos a hiptese da
endossimbiose sequencial proposta pela bioqumica Lynn Margulis. De acordo com essa hiptese,
podemos dizer que as clulas dos animais tm dois genomas e as das plantas tm trs; nos dois
casos, os genomas funcionam de forma integrada. Identifique em quais organelas das clulas dos
animais e das plantas esto localizados esses genomas.
Nos animais h um genoma no ncleo das clulas e outro nas mitocndrias. Nos vegetais h um
genoma no ncleo, um na mitocndria e outro no cloroplasto.
Os grficos a seguir apresentam o crescimento de uma espcie de bactria e de um vrus
bacterifago em ciclo ltico, ambos em ambientes sem limitao de recursos.

Identifique qual grfico (A ou B) representa o crescimento das bactrias e qual representa o


crescimento dos bacterifagos. Justifique sua resposta.
Bactria, B; bacterifago, A. As bactrias possuem diviso binria, por isso seu nmero dobra a
cada ciclo. Os bacterifagos so vrus que infectam as bactrias e utilizam seu metabolismo para
formar novos vrus. A cada ciclo ltico, um nico bacterifago gera muitos outros.
Embora o superaquecimento global seja considerado um grave problema ambiental, com
consequncias negativas do ponto de vista ecolgico, econmico e social, uma hiptese otimista
previu que esse fenmeno poderia levar a um aumento de at 30% da produo agrcola. Os
resultados da experincia descrita a seguir, entretanto, contradizem essa hiptese.

Ps de aipim cultivados em condies de atmosfera e temperatura idnticas s esperadas


para daqui a 50 anos produziram maiores quantidades de caules e folhas, mas seus
tubrculos (principal poro comestvel localizada sob o solo) se mostraram at 50% menores.
Alm disso, as folhas destas plantas se tornaram mais txicas do que o normal.

Com esses argumentos em mente, avalie o esquema a seguir, que mostra algumas vias metablicas
dos ps de aipim.

Com base no esquema acima, explique os resultados do experimento descrito.


A glicose produzida com a maior taxa de fotossntese foi mobilizada preferencialmente para a
sntese de celulose (principal componente das folhas e caules) e glicosdeos, cujo metabolismo gera
cianeto (altamente txico). Com isso a produo de amido foi reduzida.
A intoxicao por monxido de carbono (CO) considerada grave e pode levar morte. O grfico
ao lado mostra a variao do fluxo sanguneo no crebro em funo da concentrao de
hemoglobina ligada ao CO no sangue circulante.

A variao na intensidade do fluxo sanguneo observada no grfico contribui para a sobrevivncia


do organismo intoxicao por CO? Justifique sua resposta.
Sim. O aumento do fluxo sanguneo permite um maior aporte da hemoglobina que contm o
oxignio necessrio para a respirao celular.
A passagem de gua atravs da membrana plasmtica se d principalmente por canais proteicos
especficos denominados aquaporinas. A vasopressina, tambm conhecida como ADH, regula a
diurese (produo de urina) nas diversas situaes fisiolgicas, alterando a quantidade de
aquaporinas na membrana das clulas do tbulo renal responsveis pela reabsoro de gua. A
tabela a seguir mostra as concentraes normais de alguns solutos no plasma e as respectivas
concentraes apresentadas por um paciente com diarria.

Soluto Valores normais Paciente


Glicose 100 130
Na+ 135 a 145 155
K+ 3,5 a 5,0 7,0

Determine se a quantidade de aquaporinas na membrana plasmtica das clulas dos tbulos renais
do paciente, considerando os padres mais regulares, deve estar maior ou menor do que a de um
indivduo normal. Justifique sua resposta.
A quantidade de aquaporinas dever ser maior no paciente. A elevada concentrao de solutos
indica desidratao causada pela diarria e, portanto, a necessidade de reabsorver gua, reduzindo
sua perda na urina.
Um paleontlogo, aps anos de estudos de um determinado stio de fsseis, resolveu tentar
reconstruir a variao do ambiente da regio estudada. Conforme sua hiptese, essa reconstruo
possvel considerando-se apenas as caractersticas das espcies fsseis detectadas nas diversas
camadas sedimentares do local e sua datao. Com base no registro de anos de pesquisas na rea
sumarizado abaixo, elabore uma descrio do ambiente dessa rea em cada perodo registrado,
apresentando argumentos que suportem sua deciso, com base nas caractersticas biolgicas das
espcies amostradas.

Competio um processo que envolve duas ou mais espcies que utilizam os mesmos recursos.
Nicho, habitat e nvel trfico so conceitos utilizados para se descrever a associao de uma espcie
com o meio (bitico e abitico) em que vive. Esses conceitos so fundamentais para a compreenso
do ecossistema. Considerando os conceitos de nicho, habitat e nvel trfico, defina qual deles o
mais eficiente na deteco de processos de competio entre duas espcies, justificando porque ele
superior aos outros dois.
Uma mulher que apresenta tipo sanguneo B tem um filho cujo tipo sanguneo O. Ela vai justia
atribuindo a paternidade da criana a um homem cujo tipo sanguneo AB. Se voc fosse
consultado pelo juiz, qual seria seu parecer? Justifique.
Em seu livro A Origem das Espcies, Charles Darwin diz que se considerarmos uma pequena regio
isolada, qualquer que seja (uma ilha ocenica, por exemplo), com um nmero de espcies que a
habitam bastante reduzido, veremos que a maior parte dessas espcies foi produzida nesse lugar e
em nenhuma outra parte do mundo. Faa um comentrio sobre esse trecho do livro de Darwin,
explicando, luz da moderna teoria da evoluo, o fenmeno observado por ele.
Um reservatrio uma barreira artificial, feita principalmente em rios, para a reteno de grandes
volumes de gua, a qual utilizada principalmente para abastecer zonas residenciais, agrcolas e
industriais, ou para a produo de energia eltrica. Um dos problemas observados em reservatrios
o crescimento excessivo de macrfitas aquticas, devido presena de altos teores de nutrientes
na coluna dgua e de reas protegidas que abrigam essas plantas. As macrfitas aquticas, de
maneira geral, se caracterizam por apresentar propagao vegetativa, tecido aerenquimtico,
sementes pequenas e em grande nmero, sistema radicial bem desenvolvido e folhas coriceas.
Dentre as caractersticas mencionadas, indique as duas que favorecem o crescimento excessivo
dessas plantas em reservatrios e justifique sua escolha.
A figura abaixo representa a ponta de uma raiz de alho, vista ao microscpio de luz. As linhas
tracejadas A e B representam duas posies onde poderia ser cortada a raiz.

a) Qual dos dois cortes (A ou B) certamente inibir a continuidade do crescimento da raiz?


b) Com base nos conhecimentos de botnica, justifique sua resposta.
O atual modelo de estrutura da membrana plasmtica celular conhecido por modelo do mosaico
fluido, proposto em 1972 pelos pesquisadores Singer e Nicholson. Como todo conhecimento em
cincia, esse modelo foi proposto a partir de conhecimentos prvios. Um importante marco nessa
construo foi o experimento descrito a seguir. Hemcias humanas, que s possuem membrana
plasmtica (no h membranas internas) foram lisadas (rompidas) em soluo de detergente, e os
lipdios foram cuidadosamente dispersos na superfcie da gua. Foi ento medida a rea ocupada
por esses lipdios na superfcie da gua e ficou constatado que ela correspondia ao dobro do valor
da superfcie das hemcias.

a) Que concluso foi possvel depreender desse experimento, com relao estrutura das
membranas celulares?
b) Baseado em que informao foi possvel chegar a essa concluso?
O cultivo de clulas possibilita o estudo de diversos processos moleculares sob condies bastante
controladas. O seguinte experimento foi realizado para comparar clulas em cultivo normais com
clulas mutantes: no meio de cultivo foram colocados nutrientes necessrios ao crescimento das
clulas, como polissacardeos, protenas e lipdios. Todas essas substncias so normalmente
endocitadas. A tabela abaixo mostra os produtos metablicos obtidos depois de as clulas
permanecerem por 24 horas no meio.

A partir dos dados acima apresentados, responda:


a) Qual a organela celular envolvida no defeito apresentado pelas clulas mutantes?
b) Qual a provvel causa do defeito apresentado?
O esquema abaixo apresenta a diviso dos diversos reinos de seres vivos, de acordo com algumas
caractersticas marcantes.

a) Identifique os reinos A, B e C do esquema.


b) Alm de envoltrio nuclear, cite mais duas caractersticas que permitem diferenciar o reino A dos
demais.
Aps a fecundao, o zigoto humano passa por um perodo de intensa proliferao celular,
denominado clivagem, originando um concepto multicelular conhecido como blastocisto. Mais
tarde, esse concepto sofrer o processo de gastrulao e prosseguir em diversas etapas de
desenvolvimento, com uma durao mdia total de 38 semanas contadas a partir da fecundao.

a) Em que locais do aparelho reprodutor feminino humano normalmente ocorrem a fecundao, a


clivagem e a gastrulao?

b) Que partes dos embries humanos esto formadas ao final da gastrulao?


c) Se a durao do desenvolvimento humano de 38 semanas em mdia, por que, clinicamente, so
consideradas 40semanas?
Para discutir ecologia, a professora citou uma das estrofes do Hino da Campanha da Fraternidade
2011, promovida pela Igreja Catlica, cujo lema Fraternidade e a Vida no Planeta:

(...)
Olha as florestas: pulmo verde e forte!
Sente esse ar que te entreguei to puro...
Agora, gases disseminam a morte;
O aquecimento queima o teu futuro.
(...)

Sobre essa estrofe do hino, os alunos fizeram as seguintes afirmaes:

I. O primeiro verso uma meno funo fotossinttica das florestas, estabelecendo uma analogia
entre essa funo e a exercida pelo pulmo dos vertebrados, pois cada uma dessas funes retira da
atmosfera e nela libera os mesmos gases.
II. O segundo verso uma referncia atmosfera primitiva da Terra, a qual permitiu o aparecimento
das primeiras molculas orgnicas e, posteriormente, dos primeiros organismos vivos.
III. O terceiro verso faz referncia poluio atmosfrica. Gases txicos so liberados pela
atividade humana, comprometendo a sade das populaes e dos demais organismos.
IV. O quarto verso referncia direta s queimadas, que tm por objetivo a formao de pastos em
detrimento da conservao da mata nativa.

correto o que se afirma em:

(A) III, apenas.


(B) IV, apenas.
(C) I e II, apenas.
(D) III e IV, apenas.
(E) I, II, III e IV.
A
Uma novidade dos cientistas: Combate dengue com a ajuda do prprio mosquito transmissor

Para os animais, o ato sexual o caminho para a perpetuao da espcie. Um objetivo primordial
que est se invertendo - pelo menos para o Aedes aegypti, o mosquito transmissor da dengue. Por
meio de manipulao gentica, uma populao de machos criada em laboratrio recebeu um gene
modificado que codifica uma protena letal prole. Quando esses machos cruzam com fmeas
normais existentes em qualquer ambiente, transmitem o gene prole, que morre ainda no estgio
larval. A primeira liberao na natureza desses animais geneticamente modificados no Brasil foi
aprovada em dezembro de 2010 pela Comisso Tcnica Nacional de Biossegurana (CTNBio). A
linhagem dever ser liberada no municpio de Juazeiro, no estado da Bahia.
(Evanildo da Silveira. Pesquisa FAPESP, fevereiro de 2011. Adaptado.)

Sobre a notcia, pode-se afirmar corretamente que os mosquitos:

(A) transgnicos liberados no ambiente iro se reproduzir e aumentar em nmero, substituindo a


populao original.
(B) criados em laboratrio, quando liberados no ambiente, iro contribuir com a reduo do
tamanho populacional das geraes seguintes.
(C) geneticamente modificados so resistentes infeco pelo vrus causador da dengue, o que
reduz a probabilidade de transmisso da doena.
(D) so portadores de uma mutao em um gene relacionado reproduo, tornando-os estreis e
incapazes de se reproduzirem e transmitirem a dengue.
(E) modificados produzem prole vivel somente se cruzarem com fmeas, tambm modificadas,
portadoras do mesmo gene.
B
Em geral, os cromossomos sexuais nos mamferos so iguais nas fmeas e diferentes nos machos.
Nestes, o cromossomo do tipo Y possui genes, tamanho e morfologia diferentes daqueles do
cromossomo do tipo X. Nas aves, ocorre o contrrio. A fmea apresenta cromossomos sexuais
diferentes; nesse caso, chamados de tipo Z, o maior, e de tipo W, o menor. As figuras A e B
representam, respectivamente, os cromossomos de um homem e de um macho de arara-azul. Em A
so representados, no destaque, os cromossomos sexuais de uma mulher (XX) e, em B, no destaque,
os cromossomos sexuais de uma arara-azul fmea (ZW).

Considerando tais informaes, correto afirmar que:

(A) tanto em aves quanto em mamferos, o conjunto de espermatozoides carregar sempre um


cromossomo sexual de um mesmo tipo.
(B) tanto em aves quanto em mamferos, o conjunto de vulos carregar sempre um cromossomo
sexual de um mesmo tipo.
(C) na gametognese de fmeas de aves, aps a metfase I, as duas clulas resultantes da diviso
anterior apresentaro cromossomos sexuais de mesmo tipo.
(D) na gametognese de machos de mamferos, aps a metfase II, as duas clulas resultantes da
diviso anterior apresentaro cromossomos sexuais de mesmo tipo.
(E) tanto na prole de aves quanto na de mamferos, o zigoto que herdar o menor cromossomo sexual
ser do sexo masculino.
D
Suponha a seguinte situao hipottica:
Em pleno ms de dezembro, um botnico est em um barco no oceano Atlntico, exatamente no
ponto que corresponde interseco de duas linhas imaginrias: a linha do equador e o meridiano
de Greenwich. Na figura, a seta indica esse ponto. No barco, h dois vasos contendo duas plantas da
mesma espcie, que foram cultivadas em condies idnticas. Uma delas foi cultivada no litoral do
Par e, a outra, no litoral do Gabo, ambos os locais cortados pela linha do equador. Suponha que as
duas plantas apresentam a mesma eficincia fotossinttica e que, partindo do ponto de interseco
das linhas, o botnico possa se deslocar ao longo da linha do equador ou do meridiano de
Greenwich.

Com relao eficincia fotossinttica das plantas aps o deslocamento em relao quela do ponto
de origem, e considerando apenas a variao da incidncia dos raios solares, correto afirmar que:

(A) a eficincia fotossinttica de ambas as plantas no ir se alterar se o botnico navegar para


maiores latitudes, em qualquer sentido.
(B) a planta do Par apresentar maior eficincia fotossinttica se o botnico navegar para maiores
longitudes, em sentido leste, mas a planta do Gabo apresentar eficincia fotossinttica diminuda.
(C) a planta do Par apresentar maior eficincia fotossinttica se o botnico navegar para maiores
longitudes, em sentido oeste, mas a planta do Gabo apresentar eficincia fotossinttica diminuda.
(D) ambas as plantas mantero, aproximadamente, a mesma eficincia fotossinttica se o botnico
navegar para maiores longitudes, tanto em sentido leste quanto para oeste.
(E) ambas as plantas tero a eficincia fotossinttica aumentada se o botnico navegar para maiores
latitudes ao norte, mas tero a eficincia fotossinttica diminuda se navegar para o sul.
D
Universitrios moradores de uma mesma repblica resolveram, cada um, preparar um bolo.

Repblica de alunos da Unesp.


(Guia de Profisses / ACI - Unesp.)

Juliana preferiu usar fermento qumico em p. Misturou o fermento ao leite fervente, esperou que
esfriasse, adicionou os ovos, a manteiga, o acar e a farinha, e colocou o bolo para assar em forno
a gs previamente aquecido.

Guilherme fez o mesmo, porm, ao invs de usar fermento qumico, preferiu usar fermento
biolgico.

Mariana tambm usou fermento biolgico, que foi misturado farinha, ao acar, manteiga, aos
ovos e ao leite frio, e a massa foi imediatamente colocada em forno a gs previamente aquecido.

Roberto agiu exatamente como Mariana, mas, ao invs de colocar o bolo no forno a gs, de
imediato colocou-o em forno de micro-ondas.

Rafael tambm fez o mesmo que Mariana, mas optou pelo fermento qumico.

Apenas um bolo cresceu, e foi dividido por todos.

Considerando-se as reaes qumicas e os processos biolgicos que fazem o bolo crescer, pode-se
afirmar corretamente que o bolo saboreado pelos estudantes foi aquele preparado por:

(A) Juliana.
(B) Guilherme.
(C) Mariana.
(D) Roberto.
(E) Rafael.
A
No filme Eu sou a lenda, um vrus criado pelo homem espalhou- se por toda a populao de Nova
Iorque. As vtimas do vrus, verdadeiros zumbis, vagam noite pela cidade, procura de novas
vtimas. No filme, Robert Neville (Will Smith) um cientista que, sem saber como, tornou-se
imune ao vrus. A obsesso de Neville encontrar outros que, como ele, no esto infectados, e
possibilitar um mecanismo para a cura. A cura vem atravs do sangue: amostras de sangue de
pessoas doentes que melhoraram depois de infectadas pelo vrus, quando administradas a outros
doentes, podem promover a melhora.

(I Am Legend, Francis Lawrence,


Warner Bros. Pictures, 2007.)

Considerando-se o contido na sinopse do filme, pode-se inferir que, mais provavelmente, o


princpio biolgico utilizado por Neville para debelar a doena a administrao de:

(A) soro, composto de anticorpos presentes no sangue de pacientes contaminados.


(B) soro, composto de antgenos presentes no sangue de pacientes contaminados.
(C) vacina, composta de anticorpos presentes no sangue de pacientes contaminados.
(D) vacina, composta de antgenos presentes no sangue de pacientes contaminados.
(E) vrus atenuados, presentes no sangue de pacientes que melhoraram ou no sangue de pessoas
imunes.
A
Para o insetrio da feira de cincias de uma escola, a professora instruiu os alunos a coletar insetos
de diferentes espcies e os trazer para a sala de aula, onde seriam identificados, preservados e
montados para a exposio.

Exemplo de insetrio para exposio ou coleo cientfica.

Dentre os exemplares coletados, havia trs espcies de aranhas; uma de centopeia; quatro espcies
de besouro; uma de lagartixa; duas espcies de liblula; quatro vespas, todas da mesma espcie; trs
carrapatos, tambm de uma nica espcie; duas espcies de borboletas; duas de formigas; uma de
louva-a-deus; e uma de escorpio.

O nmero de espcies de insetos coletado pelos alunos para compor o insetrio :

(A) 24.
(B) 19.
(C) 18.
(D) 14.
(E) 12.
E
Alm do Horizonte

Numa frequncia que seus olhos no captam - enxergamos o mundo por uma fresta do espectro
eletromagntico - passam pulsos curtos e manifestam-se fluxos constantes de energia. (...) Se fosse
possvel enxergar no infravermelho prximo, frequncia prxima da luz visvel, voc teria os olhos
grandes com que uflogos descrevem supostos aliengenas surpreendidos em incurses
dissimuladas pela Terra. Mas o olho humano foi pacientemente esculpido pelo Sol, embora uma
ideia como esta possa parecer um pouco surpreendente. Nossos olhos so detectores biolgicos de
uma parte da energia emitida por uma estrela amarela de meia-idade. Se fosse uma estrela vermelha
e envelhecida, nosso olho seria maior.
(Ulisses Capozzoli. Scientific American Brasil, fevereiro 2011. Adaptado.)

Neste fragmento de texto, o autor estabelece uma interessante correlao entre um fenmeno fsico
e um fenmeno biolgico. Com base nas afirmaes ali contidas, pode-se afirmar corretamente que:

(A) os fenmenos da fsica, como o espectro luminoso, no tm influncia sobre as formas dos
organismos, uma vez que estas so determinadas pela seleo natural. Se fosse o contrrio, nosso
olho seria bem maior.
(B) o tamanho e a conformao do olho humano so consequncias diretas da ao do sol sobre o
desenvolvimento de cada indivduo, desde a sua concepo at a forma adulta, o que justifica
afirmar que nosso olho foi esculpido pelo Sol.
(C) o tamanho e a conformao do olho humano resultaram da ao da seleo natural. A seleo
um processo que tem, entre seus agentes, os fenmenos fsicos, tais como a radiao solar.
(D) o tamanho e a conformao do olho humano so resultados da seleo natural. Contudo,
desenvolveram-se no sentido contrrio ao esperado em relao ao dos raios solares e do
espectro luminoso.
(E) o tamanho e a conformao do olho humano resultaram da ao de fenmenos fsicos, como a
radiao solar. Estes se sobrepem aos fenmenos biolgicos, como a seleo natural.
C
Solues so misturas homogneas de duas ou mais substncias. A gua um solvente muito eficaz
para solubilizar compostos inicos. Quando um composto inico se dissolve em gua, a soluo
resultante composta de ons dispersos pela soluo.

O composto que representa melhor a soluo esquematizada na figura :

(A) MgCl2 .
(B) KCl.
(C) K2SO4 .
(D) Fe2O3 .
(E) MgCO3 .
A
A meiose caracteriza-se pela ocorrncia de apenas uma duplicao do material gentico para cada
duas divises nucleares, e responsvel pela formao de clulas haplides a partir de clulas
diplides. Em relao a esse tipo de diviso celular, CORRETO afirmar que:

01. o crossing over ocorre na prfase da meiose I e caracteriza-se pela permuta entre os segmentos
das cromtides irms do mesmo cromossomo.
02. a reduo, pela metade, do nmero cromossmico confere meiose uma importncia
fundamental na manuteno do nmero constante de cromossomos da espcie.
04. a meiose ocorre durante o processo de produo das clulas reprodutivas e possibilita o aumento
da variabilidade gentica dos seres vivos que a realizam.
08. a primeira diviso meitica reducional, enquanto a segunda equacional, j que a partir delas
so formadas duas clulas diplides e quatro clulas haplides, respectivamente.
16. na anfase I ocorre a separao dos pares de homlogos, havendo a migrao polar dos
cromossomos duplicados.
32. as anfases I e II so semelhantes entre si, medida que os centrmeros se dividem e as
cromtides de cada dade migram para o plo da clula.
64. na metfase I, os pares de cromossomos homlogos duplicados encontram-se na placa
equatorial da clula.
Corretas: 02, 04, 16 e 64.
Soma: 86.
Sessenta clulas de um animal, com a constituio representada na figura, sofrem meiose.

So esperados, apresentando a constituio ABC,


a) 30 espermatozides.
b) 60 espermatozides.
c) 90 espermatozides.
d) 120 espermatozides.
e) 180 espermatozides.
A
Ao final da meiose, sero produzidas 240 clulas filhas (espermatozides). A probabilidade de que
uma dessas clulas apresente a constituio gnica ABC de 1/8 (1/2 A 1/2 B 1/2 C); assim,
esperam-se 30 espermatozides com esse gentipo.
A figura representa uma anfase de uma clula diplide animal.Essa clula est em mitose ou em
meiose? Justifique, informando o nmero diplide de cromossomos em uma clula somtica desse
animal.
Essa clula se encontra em meiose, na anfase II. Isso porque observamos a migrao de cromtides
irms para plos opostos, numa clula haplide, originalmente com 3 cromossomos duplicados.
Uma clula somtica diplide desse organismo possui, portanto, 6 cromossomos.
A perpetuao da vida em nosso planeta deve-se caracterstica mais tpica dos seres vivos: sua
capacidade de se reproduzir.

Sobre os mecanismos de reproduo, assinale a(s) proposio(es) CORRETA(S).

01. Os gametas so formados por diviso meitica; a gametognese feminina d origem a quatro
vulos e a gametognese masculina d origem a quatro espermatozides.
02. A reproduo assexuada d origem a clones de um indivduo e pode ser observada em bactrias,
algas, fungos, plantas e animais.
04. A reproduo assexuada d origem a clones de um indivduo e s acontece em bactrias, algas e
fungos.
08. A reproduo sexuada importante porque promove a variabilidade gentica da descendncia.
16. A clonagem de seres vivos uma tcnica muito recente, que s pde ser concretizada com o
avano da biotecnologia.
32. Gmeos monozigticos podem ser considerados clones um do outro.
64. A fertilizao in vitro (tcnica para a formao de bebs de proveta) um tipo de clonagem.
42
01- F
02-V
04-F
08-V
16-F
32-V
64-F
A planta do guaran Paullinia cupana tem 210 cromossomos. Outras sete espcies do gnero
Paullinia tem 24 cromossomos. Indique a afirmao correta:

a) As espcies do gnero Paullinia que tm 24 cromossomos produzem gametas com 24


cromossomos.
b) Na meiose das plantas do gnero Paullinia que tm 24 cromossomos ocorrem 24 bivalentes.
c) Paullinia cupana diplide, enquanto as outras sete espcies so haplides.
d) Os gametas de Paullinia cupana tm 105 cromossomos.
e) O endosperma da semente de Paullinia cupana tem 210 cromossomos.
D
a) A clula de um animal, esquematizada a seguir, encontra-se na anfase da primeira diviso da
meiose. O que permite essa concluso?

b) Utilize os contornos a seguir para representar duas clulas desse animal: uma, em anfase II da
meiose e a outra, em anfase da mitose.
a) Isto se conclui porque a figura mostra a separao dos cromossomos homlogos. Este fato
ocorre na primeira diviso da meiose.

b)
Analise o grfico a seguir.

Com base no grfico e nos conhecimentos sobre a meiose, correto afirmar:

a) A linha horizontal contnua (no-tracejada) representa a variao no nmero de cromossomos


durante a meiose.
b) A permuta entre os cromossomos homlogos deve ocorrer aps o tempo 2 e antes do tempo 5.
c) A separao dos cromossomos homlogos ocorre entre o tempo 10 e o tempo 11.
d) A linha horizontal tracejada corresponde variao na quantidade de DNA durante a meiose.
e) A replicao do DNA, que ocorre durante a fase S da interfase, tem incio no tempo 0.
B
As anomalias cromossmicas so bastante freqentes na populao humana; um exemplo disso
que aproximadamente uma a cada 600 crianas no mundo nasce com sndrome de Down. Na grande
maioria dos casos, isso se deve presena de um cromossomo 21 extranumerrio. Quando bem
assistidas, pessoas com sndrome de Down alcanam importantes marcos no desenvolvimento e
podem estudar, trabalhar e ter uma vida semelhante dos demais cidados.

Sobre as anomalias do nmero de cromossomos, CORRETO afirmar que:

01. podem ocorrer tanto na espermatognese quanto na ovulognese.


02. ocorrem mais em meninas do que em meninos.
04. ocorrem somente em filhos e filhas de mulheres de idade avanada.
08. esto intimamente ligadas separao incorreta dos cromossomos na meiose.
16. ocorrem ao acaso, devido a um erro na gametognese.
32. ocorrem preferencialmente em populaes de menor renda, com menor escolaridade e pouca
assistncia mdica.
64. podem acontecer devido a erros na duplicao do DNA.
25
01-V
02-F
04-F
08-V
16-V
32-F
64-F
Assinale o grfico que representa corretamente a quantidade de DNA no ncleo de uma clula de
mamfero durante as fases da meiose. Considere MI = 1- diviso e MII = 2- diviso.
a)

b)

c)

d)

e)
B
Considerando que uma espcie de ave apresenta 2n = 78 cromossomos correto afirmar:

a) Um gameta tem 39 cromossomos autossomos e 2 cromossomos sexuais.


b) Um gameta tem 38 cromossomos autossomos e 2 cromossomos sexuais.
c) Um gameta tem 38 cromossomos autossomos e 1 cromossomo sexual.
d) Uma clula somtica tem 77 cromossomos autossomos e 1 cromossomo sexual.
e) Uma clula somtica tem 78 cromossomos autossomos e 2 cromossomos sexuais.
C
Considerando uma clula com 6 cromossomos (2n = 6), que esteja em processo de diviso, o
esquema a seguir representa uma:

a) anfase I da meiose.
b) metfase I da meiose.
c) anfase mittica.
d) metfase mittica.
e) metfase II da meiose.
A
Considere que as abelhas da espcie Partamona helleri possuem 34 cromossomos, sendo que as
fmeas originam-se por reproduo sexuada e os machos, por partenognese. esperado que
fmeas e machos tenham nos ncleos de suas clulas somticas, respectivamente,

a) 34 e 17 cromossomos.
b) 68 e 34 cromossomos.
c) 17 e 34 cromossomos.
d) 34 e 68 cromossomos.
e) 51 e 17 cromossomos.
A
No esquema a seguir, a clula I representa uma clula diplide com um par de cromossomos
homlogos, e as setas indicam os eventos caractersticos de ciclos celulares: fase S da interfase e as
divises celulares, mitose e meiose.

De acordo com os eventos caractersticos da fase S do ciclo celular e das divises celulares
representadas na figura acima, o espao vazio da(s) clula(s) preenchido por cromossomos da
seguinte forma:

a) clula I - cromossomos

b) clulas II e III - cromossomos respectivamente.

c) clulas IV e V - cromossomos respectivamente.

d) clulas VI e VII - cromossomos respectivamente.

e) clulas VIII e IX - cromossomos respectivamente.


E
No homem, a cada ejaculao so liberados milhes de espermatozoides, cada um deles carregando
um lote haploide de 23 cromossomos.
Considerando-se apenas a segregao independente dos cromossomos na prfase I da meiose,
podemos afirmar corretamente que, em termos estatsticos, no volume de um ejaculado estaro
presentes at

a) 223 espermatozoides geneticamente diferentes, cada um deles carregando um conjunto


cromossmico que difere do conjunto cromossmico de outro espermatozoide, uma vez que cada
um deles carrega cromossomos de diferentes pares.
b) 223 espermatozoides geneticamente diferentes, cada um deles carregando um conjunto
cromossmico que difere do conjunto cromossmico de outro espermatozoide na sua composio
de alelos.
c) 232 espermatozoides geneticamente diferentes, cada um deles carregando um conjunto
cromossmico que difere do conjunto cromossmico de outro espermatozoide, uma vez que cada
um deles carrega cromossomos de diferentes pares.
d) 232 espermatozoides geneticamente diferentes, cada um deles com apenas um dos homlogos de
cada par.
e) 23 23 espermatozoides geneticamente diferentes, cada um deles carregando um conjunto
cromossmico que difere do conjunto cromossmico de outro espermatozoide na sua composio
de alelos.
B
O gato domstico (Felis domestica) apresenta 38 cromossomos em suas clulas somticas. No
ncleo do vulo normal de uma gata so esperados:

a) 19 cromossomos simples e 19 molculas de DNA.


b) 19 cromossomos duplicados e 38 molculas de DNA.
c) 38 cromossomos simples e 38 molculas de DNA.
d) 38 cromossomos simples e 19 molculas de DNA.
e) 19 cromossomos duplicados e 19 molculas de DNA.
A
O grfico representa as mudanas (quantitativas) no contedo do DNA nuclear durante eventos
envolvendo diviso celular e fecundao em camundongos.

Os intervalos C-D, L-M e P-Q correspondem, respectivamente, a fases em que ocorrem a

a) replicao, meiose II e mitose.


b) meiose I, meiose II e replicao.
c) mitose, meiose I e fecundao.
d) mitose, meiose I e meiose II.
e) mitose, meiose II e fecundao.
C
Os esquemas A, B e C abaixo representam fases do ciclo de uma clula que possui 2n = 4
cromossomos.

a) A que fases correspondem as figuras A, B e C? Justifique.


b) Qual a funo da estrutura cromossmica indicada pela seta na figura D?
a) Figura A: metfase da mitose, em que os quatro cromossomos duplicados, no-pareados, da
clula diplide, esto presos s fibras do fuso, no equador da clula.
Figura B: metfase II da meiose. A clula haplide, o que demonstra que a separao dos
homlogos j ocorreu; os cromossomos (um de cada tipo) esto ligados ao fuso na regio equatorial
da clula.
Figura C: metfase I da meiose. Os cromossomos homlogos esto pareados e presos s fibras do
fuso, no equador da clula.

b) O centrmero, indicado pela seta na figura D, permite a ligao do cromossomo s fibras do fuso.
Sabendo-se que uma determinada espcie de vertebrado possui nmero cromossmico 2n=50,
assinale a alternativa que associa corretamente o tipo de clula sua quantidade de cromossomos.

a) hepatcito - 25
b) ovognia - 25
c) neurnio - 50
d) fibra muscular - 25
e) vulo - 50
C
As clulas somticas em questo sofrem diviso mittica e apresentam nmero diplide de
cromossomos. Este mesmo tipo de diviso ocorre tambm nas clulas da linhagem germinativa, em
seu estgio inicial, portanto, quando so ovognias. Os ovcitos e vulos sofrem diviso meitica,
reduzindo seu nmero diplide metade e, dessa maneira, apresentam nmero haplide. O tipo de
clula que apresenta o nmero correto de cromossomos o neurnio, pois dividiu-se mitoticamente
e no reduziu a sua quantidade de cromossomos.
A figura mostra uma preparao histolgica corada de ponta de raiz de cebola. Que clulas, dentre
as numeradas de 1 a 5, correspondem a intrfase, metfase e anfase do ciclo celular? Justifique sua
resposta, considerando apenas as informaes fornecidas pela figura.
Intrfase: clula 5 - O ncleo tem aspecto homogneo, no se vendo cromossomos
individualizados.
Metfase: clula 2 - Cromossomos situados na regio equatorial da clula.
Anfase: clula 4 - Separao das cromtides irms (novos cromossomos), com seu afastamento
em direo aos plos da clula.
O grfico mostra a variao da quantidade de DNA de uma clula somtica durante as diversas
fases de sua vida.

No grfico, a mitose propriamente dita e a interfase correspondem, respectivamente, aos perodos


de tempo

a) 4 a 6 e 1 a 4.
b) 2 a 4 e 3 a 5.
c) 3 a 5 e 1 a 3.
d) 1 a 3 e 4 a 6.
e) 2 a 5 e 3 a 5.
A
A mosca de frutas (Drosophila melanogaster) apresenta 08 cromossomos nas clulas somticas.
correto afirmar, portanto, que uma clula somtica do referido inseto apresenta

a) 04 cromtides em G1.
b) 08 cromtides em G2.
c) 32 centrmeros na metfase.
d) 16 cinetcoros na prfase.
D
Certos frmacos, como a colchicina, ligam-se s molculas de tubulina e impedem que elas se
associem para formar microtbulos.
Quando clulas em diviso so tratadas com essas substncias, a mitose interrompida na metfase.
Clulas contendo dois pares de cromossomos homlogos foram tratadas com colchicina, durante
um ciclo celular. Aps o tratamento, essas clulas ficaram com:

a) quatro cromossomos.
b) dois cromossomos.
c) seis cromossomos.
d) dez cromossomos.
e) oito cromossomos.
E
O esquema representa clulas, 2n= 4 cromossomos, em diferentes fases de um processo de diviso
celular.

Com base no esquema, correto afirmar, EXCETO:


a) A clula representada em II apresenta cromossomos duplicados.
b) As duas clulas resultantes da diviso, mostradas em VI, so haplides.
c) Em III, fase denominada metfase, no ocorre pareamento de cromossomos.
d) No se observa no esquema a separao dos cromossomos homlogos.
B
Um pesquisador analisou clulas em diviso das gnadas e do trato digestrio de um macho de uma
nova espcie de mosca.
A partir de suas observaes, fez as seguintes anotaes:
Nas clulas do tecido I, em uma das fases da diviso celular, vem-se 8 cromossomos, cada um
deles com uma nica cromtide, 4 deles migrando para um dos plos da clula e os outros 4
migrando para o plo oposto.
Nas clulas do tecido II, em uma das fases da diviso celular, vem-se 4 cromossomos, cada um
deles com duas cromtides, 2 deles migrando para um dos plos da clula e os outros 2 migrando
para o plo oposto.
Pode-se afirmar que as clulas do tecido I e as clulas do tecido II so, respectivamente,

a) da gnada e do trato digestrio. Essa nova espcie de mosca tem 2n = 2.


b) da gnada e do trato digestrio. Essa nova espcie de mosca tem 2n = 4.
c) do trato digestrio e da gnada. Essa nova espcie de mosca tem 2n = 8.
d) do trato digestrio e da gnada. Essa nova espcie de mosca tem 2n = 2.
e) do trato digestrio e da gnada. Essa nova espcie de mosca tem 2n = 4.
E
Uma clula somtica com 8 cromossomos durante a fase G1 da interfase, ao entrar na diviso
mittica, apresentar na metfase ________ cromossomos metafsicos, cada um com ________.

a) 4 - 1 cromtide
b) 4 - 2 cromtides
c) 8 - 1 cromtide
d) 8 - 2 cromtides
e) 16 - 2 cromtides
D
As caractersticas abaixo, correspondem aos animais do filo Porfera, EXCETO :

a) So animais que possuem o corpo dotado de muitos poros.


b) So exclusivamente aquticos e a maioria marinho.
c) Possuem sistema digestrio completo (boca e nus).
d) So organismos filtradores, isto , se alimentam de partculas existentes na gua.
C
Os filos que estudamos: Porferos, Cnidrio, Platelmintos, Nematelmintos, Aneldeos, Moluscos e
Artrpodes, pertencem a qual reino?

a) Reino Monera
b) Reino Protista
c) Reino dos Fungos
d) Reino dos Animais.
D
A esquistossomose uma parasitose humana causada pelo Schistosoma mansoni. A respeito desse
parasita INCORRETO afirmar que:

a) alm do homem, possui um outro hospedeiro.


b) tem sexos separados, isto , h machos e fmeas.
c) pertence ao mesmo filo da Taenia solium.
d) possui mais do que um estgio larval.
e) adquirido pelo homem por meio da ingesto de alimentos contaminados com as larvas.
E
As caractersticas abaixo, correspondem aos animais do filo Artrpodes, EXCETO :

a) So animais de corpo segmentado.


b) So exclusivamente aquticos.
c) Possuem pernas articuladas.
d) Possuem exoesqueleto, que trocado (ecdise) quando o animal precisa crescer.
B
As figuras abaixo mostram o isolamento, por um longo perodo de tempo, de duas populaes de
uma mesma espcie de planta em consequncia do aumento do nvel do mar por derretimento de
uma geleira.

a) Qual o tipo de especiao representado nas figuras? Explique.

b) Se o nvel do mar voltar a baixar e as duas populaes mostradas em B recolonizarem a rea de


sobreposio (Figura C), como poderia ser evidenciado que realmente houve especiao? Explique.
O esquema abaixo representa o mais recente sistema de classificao do Reino Plantae.

a) Os algarismos romanos representam a aquisio de estruturas que permitiram a evoluo das


plantas. Quais so as estruturas representadas por I, II e III? Qual a funo da estrutura representada
em I?

b) A dupla fecundao caracterstica das angiospermas. Em que consiste e quais os produtos


formados com a dupla fecundao?
O grfico abaixo mostra o crescimento da populao de uma determinada bactria in vitro.

a) Compare as tendncias de crescimento populacional nos perodos A e C. Em qual desses perodos


a tendncia de crescimento maior? D uma explicao para o fato de essas tendncias serem
diferentes nesses perodos.

b) O crescimento da populao de bactrias ocorre por reproduo assexuada, enquanto em


eucariotos ocorre, principalmente, por reproduo sexuada, que permite maior variabilidade
gentica. Na meiose, alm da separao independente dos cromossomos, um outro evento celular
constitui importante fonte de variabilidade gentica em espcies com reproduo sexuada. Que
evento esse? Explique.
Os seres vivos tm nveis de organizao acima do organismo, e a Ecologia a rea da Biologia que
estuda as relaes entre os organismos e destes com o ambiente em que vivem. Dentre os vrios
nveis de organizao podem ser citados a Populao, a Comunidade e o Ecossistema.

a) As figuras abaixo representam a biomassa de nveis trficos em dois tipos de ecossistemas.


Relacione cada uma das figuras com um ecossistema. Justifique.

b) Explique como o dixido de enxofre (SO2), liberado na atmosfera por diversas indstrias, pode
afetar as populaes dos diferentes nveis trficos da pirmide A.
As figuras abaixo mostram o crescimento corporal de dois grupos de invertebrados at atingirem a
fase adulta.

a) Identifique um grupo de invertebrados que pode ter o crescimento corporal como o representado
na figura A e outro como o representado na figura B. Justifique.

b) D duas caractersticas morfolgicas que permitam diferenciar entre si dois grupos de


invertebrados relacionados com o grfico A.

Uma dona de casa, querendo preparar uma caldeirada de frutos do mar, obteve uma receita que,
alm de vegetais e temperos, pedia a incluso de cao, camaro, lagosta, mexilho e lula. Ela
nunca havia preparado a receita e no conhecia os animais. O filho explicou que esses animais
eram: um peixe cartilaginoso (cao), crustceos (camaro e lagosta) e moluscos (mexilho e lula).

a) Indique duas caractersticas exclusivas dos moluscos que podero permitir sua identificao pela
dona de casa.

b) Ao comprar o peixe, a dona de casa no encontrou cao e comprou abadejo, que um peixe
sseo. Alm da diferena quanto ao tipo de esqueleto, indique outras duas diferenas que os peixes
sseos podem apresentar em comparao com os peixes cartilaginosos.
Os moluscos so animais de corpo mole, geralmente protegido por concha. So divididos em trs
grupos principais de acordo com suas caractersticas. Assinale a alternativa que representa o nome
dos grupos dos moluscos e exemplos de seus representantes:

a) Gastrpodes: caramujo, lesma; Bivalves: ostra, mexilho e Cefalpodes: Polvo, lula.


b) Poliquetos: verme de fogo; Oligoquetos: minhoca e Hirudneos: sanguessuga.
c) Insetos: moscas; Crustceos: Camaro e Aracndeos: aranha.
d) Gastrpodes: ostra, lula; Bivalves: Polvo e caracol; Cefalpodes: lesma e mexilho.
A
Os Nematelmintos so animais de corpo cilndrico e extremidades afiladas. A ascaridase, a
ancilostomose, a filariose e a oxiurose so doenas causadas por nematelmintos. Eles so os
primeiros animais na escala evolutiva a possurem:

a) sistema digestrio completo (boca e nus).


b) sistema respiratrio.
c) sistema circulatrio.
d) sistema reprodutor.
A
Os platelmintos so animais de corpo achatado, que muitas vezes so responsveis por causar
doenas nos seres vivos. Assinale a alternativa que contm apenas doenas causadas por
PLATELMINTOS:

a) esquistossomose, tenase e cisticercose.


b) Ascaridase e esquistossomose.
c) Amarelo e tenase .
d) Filariose e cisticercose.
A
So animais de corpo segmentado dividido em anis. Habitam ambientes aquticos e terrestres. So
divididos em trs classes principais: Poliquetos, Oligoquetos e Hirudneos. As caractersticas citadas
acima se referem aos:

a) moluscos
b) artrpodes
c) porferos
d) aneldeos.
LETRA D
So animais de corpo segmentado dividido em anis. Habitam ambientes aquticos e terrestres. So
divididos em trs classes principais: Poliquetos, Oligoquetos e Hirudneos. As caractersticas citadas
acima se referem aos:

a) moluscos
b) artrpodes
c) porferos
d) aneldeos.
D
Uma criana foi internada em um hospital com convulses e problemas neurolgicos. Aps vrios
exames, foi diagnosticada cisticercose cerebral. A me da criana iniciou, ento, um processo contra
o aougue do qual comprava carne todos os dias, alegando que este lhe forneceu carne contaminada
com o verme causador da cisticercose. A acusao contra o aougue:

a) no tem fundamento, pois a cisticercose transmitida pela ingesto de ovos de tnia eliminados
nas fezes dos hospedeiros.
b) no tem fundamento, pois a cisticercose no transmitida pelo consumo de carne, mas, sim, pela
picada de mosquitos vetores.
c) no tem fundamento, pois a cisticercose contrada quando a criana nada em lagoas onde vivem
caramujos hospedeiros do verme.
d) tem fundamento, pois a cisticercose transmitida pelo consumo de carne contaminada por larvas
em forma de cisto, os cisticercos.
A
No exame, a olho nu, nas fezes de uma criana foi constatada a presena de uma estrutura
esbranquiada, similar a pedaos de macarro, cujo nome tcnico proglote. Sua me foi informada
por algumas pessoas que no havia motivos para preocupao, uma vez que eram pedaos de um
animal que morreu e estava se desmanchando.
Assinale a resposta correta:

a) a opinio das pessoas est correta, pois se apenas um pedao do bicho ele deve ter morrido.
b) as pessoas deram me uma informao errada, pois a proglote o bicho inteiro e no s um
pedao.
c) de acordo com as informaes do exame, o menino deve estar com lombriga.
d) a me deve se preocupar e procurar um mdico, pois a presena da proglote indica que seu filho
est com uma tnia adulta em seu intestino.
B
Lagoa Azul est doente
Os vereadores da pequena cidade de Lagoa Azul estavam discutindo a situao da sade no
municpio. A situao era mais grave com relao a trs doenas: doena de chagas,
esquistossomose e ascaridase (lombriga). Na tentativa de prevenir novos casos, foram apresentadas
vrias propostas.

Proposta 1: promover uma campanha de vacinao.


Proposta 2: promover uma campanha de educao da populao a noes bsicas de higiene,
incluindo fervura da gua.
Proposta 3: construir rede de saneamento bsico.
Proposta 4: melhorar as condies de edificao das moradias e estimular o uso de telas nas portas e
janelas e mosquiteiros de fil.
Proposta 5: realizar campanha de esclarecimento sobre o perigo de banhos em lagoas.
Proposta 6: aconselhar o uso controlado de inseticidas.
Proposta 7: drenar e aterrar as lagoas do municpio.

Para o combate da ascaridase, a proposta que ter maior benefcio social se implementada pela
prefeitura ser:
a)1 b)3 c)4 d)5 e)6
B
Em locais onde no se utilizam instalaes sanitrias para defecao, as pessoas que andam
descalas podem adquirir uma parasitose intestinal que as deixa fracas e anmicas, devido a
diarrias e sangramentos da parede do intestino provocados pelas cerdas existentes na cabea do
verme parasita. Esse verme :

a) o esquistossomo
b) a lombriga
c) o ancilstomo
d) o sanguessuga
C
Os tatus-bolinhas do quadro pertencem a um determinado filo do Reino Animal:

Observe as caractersticas dos organismos estilizados no quadrinho: h segmentao do corpo e


pernas articuladas. Apenas com essas duas caractersticas possvel classificar os organismos
em qual filo? ________________________
LETRA B
Os cnidrios so animais aquticos que so temidos pelos banhistas. De onde vem esse medo:

a) Do fato dos cnidrios serem animais que lembram o monstro mitolgico, medusa.
b) Da formao de quilmetros de corais, que podem machucar os banhistas.
c) Devido a crenas sem fundamento, pois no h porque temer esses animais.
d) Da capacidade que esses animais tm de provocar irritaes e queimaduras
quando entram em contado com a pele, devido ao lquido produzido pelo cnidcito.
D
Identifique as doenas que so causadas por cada verme representado nos ciclos abaixo:

____________________ _______________

_______________________________
Um menino adquiriu um verme que o mdico no conseguia identificar. Com base nas pistas dadas
abaixo, ajude na identificao desse verme.

I. Trata-se de um verme causador de doena.


II. A carne de vaca e de porco no capaz de transmiti-lo.
III. Ele pode ser transmitido atravs de gua contaminada com ovos.
IV. Ele no penetra na pele.
V. um verme que vive no intestino humano.
VI. Em grande nmero podem causar asfixia.

Nome do Verme: _______________________________________


ASCARIDASE
Identifique o filo que est sendo citado de acordo com as caractersticas

Caractersticas Filo
So aquticos, exclusivamente marinhos, chamados
popularmente de esponjas. Possuem o corpo dotado de poros,
nutrem-se por filtrao.
So exclusivamente aquticos, a maioria marinho, o corpo
pode ser em forma de plipo ou medusa, a digesto
intracelular e extracelular, so capazes de provocar irritaes
e queimaduras quando entram em contado com a pele, devido
ao lquido produzido pelo cnidcito. Ex.: gua-viva
So animais de corpo cilndrico e extremidades afiladas, os
primeiros na escala evolutiva a possurem sistema digestrio
completo. Muitos so parasitas, responsveis por causar
doenas nos seres vivos, como a lombriga, o ancilstomo, o
oxiros e as filarias.
So animais de corpo segmentado, dividido em anis.
Habitam ambientes aquticos e terrestres. So divididos em
trs classes principais: Poliquetos, Oligoquetos e Hirudneos.
Animais de corpo segmentado, pernas articuladas e que
possuem exoesqueleto de quitina que trocado, todas as vezes
que o animal vai crescer.
Responda corretamente a cruzadinha abaixo:
1. Animais que possuem o corpo dotado de poros, so exclusivamente aquticos e filtradores.
2. Animais que possuem clula de defesa chamada cnidcitos, tambm chamados de celenterados.
3. Os platelmintos e nematelmintos so chamados popularmente de ....
4. Doena causada pela ingesto de carne de porco ou boi contaminada com larvas de tnia.
5. Doena causada pelas filarias, tambm chamada de elefantase e transmitida pelo mosquito
Culex
6. Tambm chamada de barriga-dgua, essa doena transmitida atravs de gua contaminada com
cercarias de esquistossomos.
7. Processo de troca do exoesqueleto que realizado pelos artrpodes todas as vezes que o animal
vai crescer, tambm chamado de muda.
8. Nome popular do nematelminto causador da ascaridase.
9. Doena causada pelo nematelminto Enterobius vermicularis (oxiros) que vive no intestino
grosso causando inflamaes e caracterizada por coceira anal intensa, principalmente durante a
noite.
10. So vermes de corpo segmentado, dividido em anis.
11. Animais de corpo segmentado, pernas articuladas e que possuem exoesqueleto de quitina.
12. Protege o corpo dos moluscos, tambm pode ser chamada de valva.
13. Grupo de moluscos representado pelas lesmas e caramujos que geralmente possuem a concha
em espiral.

1 I
2 N
3 V
4 E
5 R
6 T
7 E
8 B
9 R
10 A
11 D
12 O
13 S
A membrana plasmtica constituda de uma bicamada de fosfolipdeos, onde esto mergulhadas
molculas de protenas globulares. As protenas a encontradas:

a) esto dispostas externamente, formando uma capa que delimita o volume celular e mantm a
diferena de composio molecular entre os meios intra e extracelular.
b) apresentam disposio fixa, o que possibilita sua ao no transporte de ons e molculas atravs
da membrana.
c) tm movimentao livre no plano da membrana, o que permite atuarem como receptores de
sinais.
d) dispem-se na regio mais interna, sendo responsveis pela maior permeabilidade da membrana
a molculas hidrofbicas.
e) localizam-se entre as duas camadas de fosfolipdeos, funcionando como um citoesqueleto, que
determina a morfologia celular.
C
A membrana plasmtica, apesar de invisvel ao microscpio ptico, est presente:

a) em todas as clulas, seja ela procaritica ou eucaritica.


b) apenas nas clulas animais.
c) apenas nas clulas vegetais.
d) apenas nas clulas dos eucariontes.
e) apenas nas clulas dos procariontes.
A
As clulas animais apresentam um revestimento externo especfico, que facilita sua aderncia,
assim como reaes a partculas estranhas, como, por exemplo, as clulas de um rgo
transplantado. Esse revestimento denominado:

a) membrana celulsica.
b) glicoclix.
c) microvilosidades.
d) interdigitaes.
e) desmossomos.
B
As clulas animais diferem das clulas vegetais porque estas contm vrias estruturas e organelas
caractersticas. Na lista abaixo, marque a organela ou estrutura comum s clulas animais e
vegetais.

a) vacolo d) membrana celular


b) parede celular e) centrolo
c) cloroplastos
D
As microvilosidades presentes nas clulas do epitlio intestinal tm a funo de:

a) aumentar a aderncia entre uma clula e outra.


b) produzir grande quantidade de ATP, necessria ao intenso metabolismo celular.
c) sintetizar enzimas digestivas.
d) secretar muco.
e) aumentar a superfcie de absoro.
E
Assinale com X a afirmativa correta relativa s clulas procariota e eucariota:

a) Possuem basicamente membrana plasmtica, citoplasma (ausncia de carioteca).


b) Apresentam material nuclear organizado, envolvido pela carioteca.
c) A clula procariota tem seu material nuclear disperso no citoplasma, enquanto a eucariota
apresenta carioteca, que envolve o material nuclear localizado na regio central da clula.
C
Assinale, dentre as estruturas abaixo, aquela que representa EXCEO especializao da
membrana plasmica:

a) desmossomos.
b) plos absorventes na razes dos vegetais.
c) microvilosidades intestinais.
d) axnio.
e) clios.
E
Na maioria das clulas vegetais, encontram-se pontes citoplasmticas que estabelecem continuidade
entre clulas adjacentes. Estas pontes so denominadas:

a) microtbulos.
b) polissomos.
c) desmossomos.
d) microvilosidades.
e) plasmodesmos.
E
Na mucosa intestinal, as clulas apresentam grande capacidade de absoro devido presena de:

a) desmossomas
b) vesculas fagocitrias
c) microvilosidades
d) flagelos
e) clios
C
O modelo abaixo representa a configurao molecular da membrana celular, segundo Singer e
Nicholson. Acerca do modelo proposto, assinale a alternativa incorreta.

a) O algarismo 1 assinala a extremidade polar (hidrfila) das molculas lipdicas.


b) O algarismo 2 assinala a extremidade apolar (hidrfoba) das molculas lipdicas.
c) O algarismo 3 assinala uma molcula de protena.
d) O algarismo 4 assinala uma molcula de protena que faz parte do glicoclix.
e) O algarismo 5 assinala uma protena extrnseca estrutura da membrana.
D
O reforo externo da membrana celular nos vegetais :

a) rgido, celulsico e colado membrana plasmtica.


b) elstico, celulsico e colado membrana plasmtica.
c) rgido, celulsico e capaz de se descolar da membrana plasmtica.
d) elstico, celulsico e capaz de se destacar da membrana plasmtica.
e) rgido e de natureza exclusivamente proteica.
C
Os seres vivos, exceto os vrus, apresentam estrutura celular. Entretanto, no h nada que
corresponda a uma clula tpica, pois, tanto os organismos unicelulares como as clulas dos vrios
tecidos dos pluricelulares so muito diferentes entre si. Apesar dessa enorme variedade, todas as
clulas vivas apresentam o seguinte componente:

a) retculo endoplasmtico.
b) membrana plasmtica.
c) aparelho de Golgi.
d) mitocndria.
e) cloroplasto.
B
Quimicamente, a membrana celular constituda principalmente por:

a) acetonas e cidos graxos.


b) carboidratos e cidos nucleicos.
c) celobiose e aldedos.
d) protenas e lipdios.
e) RNA e DNA.
D
Sabe-se que clulas epiteliais acham-se fortemente unidas, sendo necessria uma fora considervel
para separ-las. Isto se deve ao:

a) do ATP, que se prende s membranas plasmticas das clulas vizinhas.


b) da substncia intercelular.
c) dos desmossomos.
d) dos centrolos.
e) da parede celular celulsica.
C
Quando se coloca uma clula da epiderme inferior da folha de Tradescantia zebrina em uma
soluo hipertnica, ocorre:
I- movimento de soluto e de solvente entre as clulas e a soluo externa.
II- destruio da clula.
III- sada de solvente da clula.
IV- plasmlise.
Assinale:
a) Se apenas as afirmativas III e IV forem corretas.
b) Se apenas as afirmativas I e II forem corretas.
c) Se apenas as afirmativas II e IV forem corretas.
d) Se apenas as afirmativas I e III forem corretas.
e) Se apenas a afirmativa I for correta.
A
Membrana celular das clulas intestinais, combinadas com molculas de protenas transportadoras
denominadas permeases. Esse processo denominado:

a) transporte de massa.
b) difuso facilitada.
c) endocitose.
d) transporte ativo.
e) osmose.
B
Todas as clulas possuem uma membrana plasmtica que separa o contedo protoplasmtico do
meio extracelular. A existncia e integridade da membrana importante porque:

a) regula trocas entre a clula e o meio s permitindo a passagem de molculas de fora para dentro
da clula e impedindo a passagem no sentido inverso.
b) possibilita clula manter a composio intracelular diversa da do meio ambiente.
c) impede a penetrao de substncias existentes em excesso no meio ambiente.
d) exige sempre consumo energtico para a captao de alimentos do meio externo.
e) impede a sada de gua do citoplasma.
B
Clulas vegetais, como as representadas na figura A, foram colocadas em uma
determinada soluo e, no fim do experimento, tinham aspecto semelhante ao da figura B.

Comparando as concentraes do interior da clula na situao inicial ( I ), da soluo externa ( II )


e do interior da clula na situao final ( III ), podemos dizer que:

a) I maior que II.


b) I maior que III.
c) I menor que II.
d) I igual a III.
e) III maior que II.
C
Quando ganhamos flores, se quisermos que elas durem mais tempo, devemos mergulh-las dentro
dgua e cortarmos, em seguida, a ponta da sua haste. Este procedimento feito com o objetivo de
garantir a continuidade da conduo da seiva bruta. Tal fenmeno ocorre graas diferena de
osmolaridade entre a planta e o meio onde ela est, que so respectivamente:

a) hipotnica e isotnico.
b) isotnica e hipotnico.
c) hipertnica e isotnico.
d) hipotnica e isotnico.
e) hipertnica e hipotnico.
E
Um peixe tipicamente marinho introduzido em um tanque contendo gua doce. Analisando o
balano osmtico, podemos dizer que:

a) o corpo do peixe perde gua para o meio externo.


b) a perda de gua do corpo do peixe para o meio externo impedida pela presena de escamas e
muco.
c) a gua do meio externo, menos concentrada, penetra no corpo do peixe que mais concentrado.
d) a gua do meio externo, mais concentrada, penetra no corpo do peixe que menos concentrado.
e) o corpo do peixe entra automaticamente em equilbrio com a gua circundante, evitando a
entrada ou a sada de gua.
C
Certos tipos de molculas atravessam isoladamente a membrana plasmtica e penetram no
citoplasma. Tambm existem processos nos quais grande quantidade de material passa para o
interior da clula. Sobre estes ltimos, assinale a opo correta.

a) A transferncia de partculas visveis, tanto ao microscpio ptico quanto ao eletrnico, para o


interior da clula conhecida pela denominao de micropinocitose.
b) Fagocitose o termo utilizado para definir o englobamento de pequenas quantidades de lquidos
pela superfcie da clula.
c) Na micropinocitose, para o englobamento de partculas ocorrem depresses na membrana
plasmtica que se transformam em vesculas muito pequenas, visveis somente ao microscpio
eletrnico.
d) O englobamento de partculas slidas visveis, tanto ao microscpio ptico quanto ao eletrnico,
recebe a denominao de pinocitose.
e) Em cultura de tecidos, as clulas demonstram uma intensa atividade de englobamento de
partculas slidas, observveis somente ao microscpio eletrnico e denominada de fagocitose.
C
Trs funis, contendo substncias diferentes, porm em mesmas quantidades, foram colocados em
um recipiente com uma determinada soluo. Aps algum tempo, o nvel das substncias no interior
dos funis mostrava-se como no esquema abaixo:

Com base nestes dados, podemos afirmar que a concentrao da soluo no recipiente :

a) 0,5 %
b) 1,0 %
c) 1,5 %
d) 2,0 %
e) 2,5 %
B
Clulas vegetais plasmolisaram-se ao entrar em contato com uma determinada soluo. Sobre tal
fenmeno pode-se dizer que:

a) na plasmlise o soluto move-se do meio hipotnico para o hipertnico.


b) clulas trgidas plasmolisam-se quando entram em contato com uma soluo hipotnica.
c) a soluo era hipertnica em relao concentrao do suco celular.
d) plasmlise a perda de gua pela clula para uma soluo hipotnica.
e) para ocorrer a deplasmlise necessrio submeter as clulas a uma soluo hipertnica.
D
prtica comum temperarmos a salada com sal, pimenta-do-reino, vinagre e azeite. Porm, depois
de algum tempo, observamos que as folhas vo murchando. Isto se explica porque:

a) o meio mais concentrado que as clulas.


b) o meio menos concentrado que as clulas.
c) o meio apresenta concentrao igual das clulas do vegetal.
d) as clulas do vegetal ficam trgidas quando colocadas em meio hipertnico.
e) por uma razo diferente das citadas acima.
A
O esquema abaixo representa a concentrao de ons dentro e fora dos glbulos vermelhos. A
entrada de K+ e a sada de Na+ dos glbulos vermelhos pode ocorrer por:

a) transporte passivo. d) difuso.


b) plasmlise. e) transporte ativo.
c) osmose.
E
Fagocitose :

a) englobamento de partculas slidas grandes pela clula.


b) englobamento de partculas lquidas pela clula.
c) processo de formao de membranas.
d) um tipo de exocitose.
e) um mecanismo de difuso por membranas.
A
A incorporao de gotculas no citoplasma, por invaginao da membrana plasmtica, formando
vesculas, denomina-se:

a) fagocitose. d) pinocitose.
b) clasmocitose. e) plasmlise.
c) endocitose.
D
No desenho abaixo, observamos trs tubos de ensaio contendo solues de diferentes concentraes
de NaCl e as modificaes sofridas pelas hemcias presentes em seu interior. Em relao a este
desenho, assinale a alternativa correta:

a) Em 1 a soluo isotnica em relao hemcia; em 2 a soluco hipertnica em relao


hemcia e em 3 a soluo hipotnica hemcia.
b) As hemcias em 1 sofreram alterao de volume, porm em 2 ocorreu plasmlise e em 3
turgncia.
c) Considerando a concentrao isotnica de NaCl = 0,9 %, a soluo 2 certamente possui uma
concentrao de NaCl inferior a 0,9 % e a soluo 3, uma concentra de NaCl superior a 0,9 %.
d) As hemcias do tubo 2 sofreram perda de gua para a soluo, enquanto as do tubo 3
aumentaram seu volume, depositando-se no fundo.
e) A plasmlise sofrida pelas hemcias do tubo 2 ocorreu em razo da perda de NaCl para o meio.
C
O citoplasma de uma clula eucaritica est compreendido no espao entre as membranas nuclear e
citoplasmtica. Sobre esse componente celular, CORRETO afirmar:

01. uma mistura complexa de substncias orgnicas e inorgnicas.


02. Ao microscpio eletrnico, apresenta-se heterogneo.
04. Existem, em seu interior, vrias organelas que desempenham funes definidas.
08. Pode-se observar facilmente o seu movimento de ciclose em clulas vegetais.
16. Todas as organelas citoplasmticas so comuns a todas as clulas de todos os grupos de seres
vivos.
32. No apresenta microtbulos em seu interior.
Assinale a opo que contem a soma das afirmaes corretas:

a) 22
b) 18
c) 15
d) 61
e) 16
C
O termo ciclose empregado para designar:

a) movimentos citoplasmticos que no acarretam alteraes da forma celular e que podem arrastar
determinadas estruturas e incluses.
b) uma estrutura circular dos cromossomos das bactrias.
c) uma srie de movimentos circulares de hemceas em torno de cogulos.
d) a formao de anis nos cromossomos de certas moscas.
e) a propriedade dos leuccitos de atravessar paredes de vasos sangneos e assim circular por entre
os tecidos.
A
Considere as seguintes estruturas celulares:
I- retculo endoplasmtico.
II- complexo de Golgi.
III- grnulos de secreo.

A seqncia de estruturas em que seria encontrado um aminocido radioativo, desde a entrada at


sua sada da clula, , respectivamente:
a) III, II, I
b) II, I , III
c) III, I, II
d) I, II, III
e) II, III, I
D
Um material sintetizado por uma clula "empacotado" para ser secretado para o meio externo no:

a) retculo endoplasmtico d) nuclolo


b) complexo de Golgi e)vacolo secretor
c) lisossomo
B
Alm de armazenar secrees, como o suco pancretico, essa organela pode sintetizar
polissacardios, como os que compoem o muco intestinal, no homem.
A organela a que se refere o texto acima o:

a) ribossomo
b) ergastoplasma
c) retculo endoplasmtico
d) condrioma
e) complexo de Golgi
E
A clula um estrutura que realiza suas vrias funes de uma maneira dinmica.

O esquema acima, de uma clula em atividade, s NO mostra a:

a) correlao funcional existente entre organelas celulares.


b) captura de substncias pela clula num processo denominado endocitose.
c) circulao de substncias por vesculas membranosas da clula.
d) liberao de excreo lipdica para o meio extracelular onde vo atuar.
e) produo, armazenagem e atuao de enzimas digestivas.
D
O aspecto comum do Complexo de Golgi em clulas animais, deduzido atravs de observaes ao
microscpio eletrnico, de:

a) vesculas formadas por membrana dupla, a interna sem granulaes e com dobras voltadas para o
interior.
b) vesculas formadas por membrana dupla em que a membrana interna, granulosa, emite
prolongamentos em forma de dobras para o interior.
c) membranas formando tubos anastomosados com dilataes em forma de discos.
d) membranas lisas delimitando vesculas e sacos achatados que se dispem paralelamente.
e) membranas granulosas delimitando vesculas e sacos achatados que se dispem paralelamente.
D
Os grnulos que, ao microscpio eletrnico, so vistos sobre o retculo endoplasmtico so os:

a) ribossomos.
b) mitocndrios.
c) citocromos.
d) corpsculos de Golgi.
e) vacolos de pinocitose.
A
O ergastoplasma a regio formada por cavidades tubulares, em cuja periferia situam-se numerosos
ribossomos, constituindo local de:

a) circulao celular d) respirao celular


b) digesto proteica e) sintese de lipdios
c) sntese proteica
C
Uma clula animal que sintetiza, armazena e secreta enzimas, dever ter bastante desenvolvidos o:

a) retculo endoplasmtico granular e o complexo de Golgi.


b) retculo endoplasmtico agranular e o complexo de Golgi.
c) retculo endoplasmtico granular e os lisossomos.
d) complexo de Golgi e os lisossomos.
e) complexo de Golgi e o condrioma.
A
A estrutura representada no desenho abaixo :

a) o complexo de Golgi, corpsculo rico em cidos nucleicos, presente no ncleo de clulas


secretoras.
b) o complexo de Golgi, responsvel pela sntese de enzimas da cadeia respiratria, presente no
citoplasma de vegetais inferiores.
c) a mitocndria, orgnulo responsvel pela respirao celular.
d) o complexo de Golgi, que tem por funo armazenar substncias a serem secretadas pela clula.
e) a mitocndria, orgnulo rico em DNA, RNA e enzimas, preente tanto no ncleo como no
citoplasma das clulas secretoras.
D
A sntese de lipdios ocorre no:

a) nuclolo. d) retculo endoplasmtico liso.


b) citosol. e) retculo endoplasmico rugoso.
c) citoesqueleto.
D
A sntese de protenas para exportao em eucariontes acontece principalmente ao nvel de:

a) envoltrio nuclear.
b) ribossomos nucleares.
c) membranas do complexo de Golgi.
d) membranas do retculo endoplasmtico rugoso.
e) membranas do retculo endoplasmtico liso.
C
Na clula nervosa, ao contrrio do corpo celular, o axnio no apresenta substncia de Golgi nem
retculo endoplasmtico rugoso. Alm disso h pouqussimos ribossomos no axnio. O texto acima
permite deduzir que o axnio uma regio do neurnio que:

a) apresenta intensa sntese de lipdios.


b) dispe de numerosos grnulos glicdicos.
c) provavelmente inativa para sntese proteica.
d) apresenta uma intensa sntese de hormnios.
e) provavelmente muito ativa para sntese proteica.
C
A estrutura apontada pela seta 1 derivada do(da) e chama-se, respectivamente:

a) do conjunto de lisossomos, acrossoma.


b) da membrana nuclear, peroxissomo.
c) do complexo de Golgi, acrossomo.
d) das mitocndrias, condrioma.
e) do complexo de Golgi, ergastoplasma.
C
Nas clulas, a destruio de organelas funo das organelas chamadas:

a) lisossomos. d) complexo de Golgi


b) mitocndrias. e) retculo endoplasmtico
c) centro celular
D
Certos tipos de leuccitos so atrados pelas bactrias invasoras, sofrem mudans em sua forma e
englobam essas bactrias as quais destroem por ao degradativa de enzimas. Esse fenmeno,
chamado fagocitose, somente se completar permitindo a digesto do material englobado, desde que
o vacolo formado se una organela celular denominada:

a) ribossomo d) microfilamento
b) microtbulo e) peroxissomo
c) lisossomo
C
Para que ocorra a digesto no interior de uma ameba, necessrio que os fagossomos fundam-se a:

a) lisossomos.
b) mitocndrias.
c) ribossomos.
d) cinetossomos.
e) desmossomos.
A
A utilizao racional da radioatividade em vrios campos da pesquisa tem permitido a compreenso
de fenmenos importantes. Por exemplo, possvel fornecer a uma cultura de clulas aminocidos
marcados com istopos radioativos e, atravs de tcnicas especiais, acompanhar seu trajeto na
clula. Se isto for feito com um aminocido que entra na composio das enzimas digestivas de um
macrfago, em que organela citoplasmtica haver maior concentrao deste aminocido?

a) Mitocndria.
b) Ribossoma.
c) Retculo endoplasmtico liso.
d) Lisossoma.
e) Aparelho de Golgi.
D
Durante a metamorfose dos anfbios, a cauda desaparece ao mesmo tempo em que os seus
constituintes celulares so digeridos e seus produtos so utilizados no desenvolvimento do animal.
A organela que participa ativamente deste processo :

a) o lisossoma.
b) o peroxissoma.
c) a mitocndria.
d) o plasto.
e) o centrolo.
A
A inativao de todos os lisossomos de uma clula afetaria diretamente a:

a) sntese proteica.
b) digesto intracelular.
c) sntese de aminocidos.
d) circulao celular.
e) secreo celular.
B
Qual a alternativa da tabela abaixo cujos termos preenchem corretamente a frase seguinte?
Os lisossomos tm como funo I e so produzidos na organela chamada II .

I II
sntese de protenas cloroplasto
sntese de acares cloroplasto
digesto intracelular retculo endoplasmtico
sntese de protenas retculo endoplasmtico
digesto intracelular complexo de Golgi
E
Considere os seguintes eventos:
I- Fuso do fagossomo com lisossomo.
II- Atuao das enzimas digestivas.
III- Clasmocitose.
IV- Formao do fagossomo.
A seqncia correta em que esses eventos ocorrem no processo de englobamento e digesto
intracelular de partculas em uma clula :

a) I - II - III - IV d) IV - I - II - III
b) II - I - III - IV e) II - III - I - IV
c) III - I - IV - II
D
O esquema a seguir representa basicamente o processo da digesto intracelular. As estruturas
numeradas 1, 2, e 3 representam, respectivamente:

a) ergastoplasma, fagossomo e vacolo digestivo.


b) retculo endoplasmtico liso, complexo de Golgi e vacolo digestivo.
c) retculo endoplasmtico liso, ergastoplasma e complexo de Golgi.
d) ribossomos, ergastoplasma e fagossomo.
e) ergastoplasma, complexo de Golgi e vacolo digestivo.
D
A organela celular que atua na regresso da cauda dos girinos, durante a sua metamorfose,
denomina-se:

a) complexo de Golgi d) lisossomo


b) condrioma e) flagelo
c) ergastoplasma
D
O processo de regresso da cauda dos girinos, durante sua metamorfose denomina-se:

a) autofagia d) hidrlise
b) autlise e) citose
c) autotrofia
B
Certos tipos de leuccitos so atrados pelas bactrias invasoras, sofrem mudans em sua forma e
englobam essas bactrias as quais destroem por ao degradativa de enzimas. Esse fenmeno,
chamado fagocitose, somente se completar permitindo a digesto do material englobado, desde que
o vacolo formado se una organela celular denominada:

a) ribossomo d) microfilamento
b) microtbulo e) peroxissomo
c) lisossomo
A
Considere as seguintes funes atribudas a uma organela celular:
I- Vescula com enzimas.
II- Realiza digesto de materiais endgenos e exgenos
III- Forma-se a partir do complexo de Golgi.
Esta organela designada:

a) lisossomo d) plasto
b) mitocndria e) ribossomo
c) dictiossomo
A
De acordo com o esquema a seguir, na autlise ocorre:

a) danificao da membrana do nmero 5.


b) destruio da membrana do nmero 1.
c) no formao do nmero 2.
d) fuso dos nmeros 4 e 5.
e) rompimento da membrana do nmero 4.
E
Considere as seguintes funes atribudas a uma organela celular:
I- Armazenamento de substncias.
II- Secreo celular.
III- Formao de lisossomas.

Esta organela :

a) plasto.
b) mitocndria.
c) complexo golgiense.
d) retculo endoplasmtico.
e) vacolo.
C
Assinale a afirmativa correta sobre a maneira como os seres vivos retiram a energia da glicose.

a) O organismo, como precisa de energia rapidamente e a todo tempo, faz a combusto da glicose
em contato direto com o oxignio.
b) Como a obteno de energia no sempre imediata, ela s obtida quando a glicose reage com o
oxignio nas mitocndrias.
c) A energia, por ser vital para a clula, obtida antes mesmo de a glicose entrar nas mitocndrias
usando o oxignio no citoplasma, com liberao de duas (02) molculas de ATP (gliclise).
d) A energia da molcula de glicose obtida atravs da oxidao dessa substncia pela retirada de
hidrognios presos ao carbono (desidrogenaes), que ocorre a nvel de citoplasma e mitocndrias.
e) A obteno de molculas de ATP feita por enzimas chamadas desidrogenases (NAD) depois que
a molcula de oxignio quebra a glicose parcialmente no hialoplasma (gliclise).
D
As mitocndrias se originam a partir

a) dos centrolos.
b) do retculo endoplasmtico rugoso.
c) do retculo endoplasmtico liso
d) do complexo de Golgi.
e) de mitocndrias pr-existentes.
E
Clulas do fgado possuem at duas mil mitocndrias, ocupando cerca de 1/5 do seu volume. O
nmero alto de mitocndrias nestas clulas pode ser explicado porque as clulas hepticas:

a) so maiores que as demais clulas do corpo.


b) apresentam respirao aerbica.
c) tm grande atividade metablica.
d) tm volume citoplasmtico maior que o nuclear.
e) produzem enzimas digestivas em grande quantidade.
C
O microscpio eletrnico permite constatar a presena de duas membranas, a externa que lisa e a
interna com invaginaes que se apresentam sob a forma de cristas ou de tbulos. No interior,
formando uma espcie de recheio, encontra-se uma substncia chamada matriz, muito rica em
protenas.
O texto acima descreva a estrutura tpica de:

a) ribossomo d) lisossomo
b) mitocndria e) vacolo
c) peroxissomo
B
Ao analisar os tecidos conjuntivo e muscular, nota-se que esta organela celular existe em maior
nmero nas clulas musculares; isto devido maior necessidade de que estas clulas
apresentam para manter seu metabolismo que mais acelerado.
A lacuna corretamente preenchida por:

a) sntese proteica d) sntese glicdica


b) sntese de enzimas e) sntese de ATP
c) sntese lipdica
E
A liberao de O2 e a fixao de CO2 realizadas pelas plantas verdes representam as trocas gasosas
da:

a) respirao aerbica d) transpirao


b) respirao anaerbica e) fermentao alcolica
c) fotossntese
C
Os tilacides fazem parte dos:

a) cloroplastos d) desmossomos
b) ribossomos e) nuclolos
c) lisossomos
a
No interior de cloropastos e mitocndrias so encontradas pequenas quantidades de DNA, RNA e
ribossomos. Tais componentes permitem que os cloroplastos sejam capazes de realizar:

a) fluorescncia e sntese lipdica.


b) fotossntese e secreo celular.
c) autoduplicao e sntese proteica.
d) ciclo de Krebs e sntese de ATP.
e) fermentao anaerbica e sntese de clorofila.
C
Observe o esquema e na tabela a seguir, assinale a alternativa que identifica corretamente as
organelas e os processos celulares representados em I e II:
C
Cientistas propem a hiptese de que certas organelas originaram-se de organismos que h mais de
um bilho de anos passaram a viver simbionticamente com eucariotos antigos. Apiam-se no fato
de que essas organelas possuem DNA prprio, semelhante ao das bactrias, podendo-se auto-
replicar. Essas organelas so:

a) mitocndrias e ribossomos.
b) mitocndrias e cloroplastos.
c) mitocndrias e dictiossomos.
d) dictiossomos e cloroplastos.
e) dictiossomos e cloroplastos.
B
O desenho abaixo corresponde a um corte transversal da ultra-estrutura de:

a) microvilosidade. d) estereoclio
b) clio ou flagelo. e) pseudpodo
c) axnio.
B
A movimentao em meio lquido, captura de alimento ou limpeza de superfcie so problemas que
podem ser resolvidos por clulas dotadas de flagelos (espermatozides humanos) ou de clios
(Paramecium, protozorio de gua doce). A organela capaz de originar os clios e os flagelos
denominada:

a) microfilamento. d) ncleo.
b) centrolo. e) cromossomo.
c) nuclolo.
B
A propsito de clios e flagelos correto afirmar:

a) Os clios so responsveis pela locomoo de procariontes e os flagelos, de eucariontes.


b) S se encontram os clios em relao com o movimento vibrtil de clulas fixas e os flagelos em
relao com a locomoo de seres unicelulares.
c) Ambos so estruturas de funo idntica que se distinguem por diferenas quanto ao tamanho e
ao nmero por clula.
d) Os clios determinam a movimentao de fluidos extracelulares, o que no pode ser realizado
pelos flagelos.
e) O movimento flagelar ativo e consome energia, em oposio ao movimento ciliar, que passivo
e provocado pelas correntes lquidas intracitoplasmticas.
C
Um clio cortado transversalmente e examinado ao microscpio eletrnico revela em seu interior:

a) uma fibra central


b) duas microfibrilas centrais e dezoito perifricas
c) cinco microfibrilas centrais
d) onze microfibrilas centrais e outras perifricas
e) nove trios de microtbulos perifricos
B
Os orgnulos celulares em questo podem ser encontrados, ao mesmo tempo, em uma:

a) hemcia
humana. b) clula
bacteriana.
c) clula
meristemtica de
uma angiosperma.
d) clula
embrionria de um
mamfero.
e) clula de
cianofcea.
D
A carioteca formada por:

a) duas membranas proteicas com poros.


b) uma membrana proteica sem poros.
c) uma membrana lipoproteica com poros.
d) duas membranas lipoproteicas com poros.
e) duas membranas lipoproteicas sem poros.
D
Acerca do ncleo interfsico, assinale a alternativa incorreta:

a) A cromatina que se encontra desespiralizada denominada eucromatina.


b) O nuclolo verdadeiro ou plasmossomo representa um local de sntese de RNA ribossmico.
c) O nuclolo falso representa um acmulo de heterocromatina, pois um novelo de cromonemas.
d) Os cromossomos so visveis como longos filamentos espiralizados e corados por corantes
cidos.
e) A carioteca uma grande bolsa achatada que delimita o nucleossomo.
D
Uma clula humana, com caritipo de 46 cromossomas e quantidade de DNA equivalente a 5.6
picogramas (pg), apresentar na fase inicial da metfase da mitose, respectivamente, um caritipo e
uma quantidade de DNA correspondente a:

a) 23 e 5.6 pg.
b) 23 e 11.2 pg.
c) 46 e 11.2 pg.
d) 92 e 5.6 pg.
e) 92 e 11.2 pg.
C
A cromatina, presente no ncleo interfsico, aparece durante a diviso celular com uma
organizao diferente, transformando-se nos:

a) crommeros d) cromocentros
b) cromossomos e) cromonemas
c) centrmeros
B
Na aula de Biologia o grande Prof. Ricardo fez a seguinte afirmao: A produo de ribossomos
depende, indiretamente, da atividade dos cromossomos.
Em seguida pediu a seus alunos que analisassem a afirmao e a explicassem. Foram obtidas cinco
explicaes diferentes, que se encontram abaixo citadas
Assinale a nica explicao correta:

a) Os cromossomos so constitudos essencialmente por RNA ribossmico e protenas, material


utilizado na produo de ribossomos.
b) Os cromossomos so constitudos essencialmente por RNA mensageiro e protenas, material
utilizado na produo de ribossomos.
c) Os cromossomos contm DNA; este controla a sntese de ribonucleoprotenas que formaro o
nuclolo e que, posteriormente, faro parte dos ribossomos.
d) Os cromossomos so constitudos essencialmente por RNA transportador e protenas, material
utilizado na produo de ribossomos.
e) Os cromossomos, produzidos a partir do nuclolo, fornecem material para a organizao dos
ribossomos.
C
Dos constituintes celulares abaixo relacionados, qual est presente somente nos eucariontes e
representa um dos critrios utilizados para distingui-los dos procariontes?

a) DNA. d) Envoltrio nuclear.


b) Membrana celular. e) RNA.
c) Ribossomo.
D
Qual das seguintes estruturas celulares responsvel pela formao dos ribossomos?

a) Retculo endoplasmtico
b) Complexo de Golgi
c) Centrolo
d) Nuclolo
e) Lisossomo
D
Os nuclolos originam-se:

a) de invaginaes da membrana celular


b) da diviso de outros nuclolos
c) da solidificao do suco nuclear
d) da concentrao de ribossomos
e) de cromossomos especiais
D
Nas clulas em intrfase, o material gentico aparece na forma de:

a) carioteca d) cromatina
b) fuso acromtico e) cariolinfa
c) nuclolo
D
Observe o esquema abaixo:

I e II indicam:

a) cromtides-irms
b) cromtides homlogas
c) cromossomos homlogos
d) cromossomos-no-homlogos
e) cromossomos-filhos
A
Com respeito ao cromossomo abaixo esquematizado, sabemos que:

a) o nmero 1 indica a constrio secundria.


b) ele do tipo metacntrico.
c) o nucleotdio est indicado pelo nmero 2.
d) o nmero 3 indica o telmero.
e) o centrmero est indicado pelo nmero 4.
A
Dados os esquemas de cromossomos, podemos classific-los, conforme a posio do centrmero:

a) Os cromossomos I e II so metacntricos e o III submetacntrico.


b) Os cromossomos I e III so metacntricos e o II acrocntrico.
c) Os cromossomos I, II e III so metacntricos.
d) Apenas o cromossomo III metacntrico.
e) Os cromossomos I, II e III so, respectivamente, metacntrico, submetacntrico e acrocntrico.
E
Clula diplide aquela em que:

a) existem dois cromossomos no-homlogos.


b) o caritipo formado por dois conjuntos haplides.
c) o caritipo formado por dois conjuntos diplides.
d) cada cromossomo apresenta dois centrmeros.
e) No existe tal clula.
B
Em determinada espcie animal, o nmero diplide de cromossomos 22. Nos espermatozides,
nos vulos e nas clulas epidrmicas dessa espcie sero encontrados, respectivamente:

a) 22, 22 e 44 cromossomos.
b) 22, 22 e 22 cromossomos.
c) 11, 11 e 22 cromossomos.
d) 44, 44 e 22 cromossomos.
e) 11, 22 e 22 cromossomos.
C
A pironina cora especificamente o RNA. Se corarmos clulas com esse corante, aparecem como
estruturas pironinoflicas:

a) cromatina e retculo endoplasmtico liso.


b) retculo endoplasmtico granuloso e retculo liso.
c) nuclolo e cromatina.
d) nuclolo e retculo endoplasmtico granuloso.
e) lisossomos e retculo endoplasmtico rugoso.
D
Relacione as fases da mitose: anfase, telfase, metfase e prfase, com os respectivos nmeros das
figuras acima:

a) 4 - 3 - 2 - 1
b) 3 - 4 - 2 - 1
c) 1 - 2 - 3 - 4
d) 2 - 3 - 4 - 1
e) 3 - 1 - 2 - 4
B
Qual o constituinte cromossmico diretamente relacionado com seu movimento durante a diviso
celular?

a) telmero
b) crommero
c) centrmero
d) cromtide
e) intrfase
C
Espiralizao da cromatina, duplicao dos centrolos e formao do fuso so ocorrncias
mitticas. Assinale a fase em que isto ocorre.

a) metfase
b) anfase
c) telfase
d) prfase
e) intrfase
C
Os tens abaixo se referem mitose e todos eles esto corretos, exceto:

a) um processo de diviso celular importante para o crescimento dos organismos.


b) Ocorre nas clulas somticas de animais e vegetais.
c) Uma clula-me origina duas clulas-filhas com o mesmo nmero de cromossomos.
d) A duplicao do DNA ocorre na fase da metfase.
e) Na fase da telfase, forma-se uma nova membrana nuclear em torno dos cromossomos e o
citoplasma se divide.
E
O grfico abaixo revela a variao de DNA durante as diversas fases da vida celular. Com relao
ao grfico, correto afirmar que:

(Quantidade de DNA por ncleo)

2C

G1 S G2 M G1 S

Intrfase Mitose Intrfase

a) durante o perodo G1, a clula realiza uma intensa sntese de DNA.


b) no decorrer do perodo S, a quantidade de DNA aumenta progressivamente e ocorre a duplicao
do DNA.
c) no fim da Intrfase, a clula tem uma quantidade de DNA menor que no seu incio.
d) no perodo de mitose propriamente dito, a quantidade de DNA mantm-se constante.
e) nos perodos de G1 e S, a quantidade de DNA mantm-se constante.
B
Uma clula somtica que tem 4 cromossomos, ao se dividir, apresenta na metfase:

a) 4 cromossomos distintos, cada um com uma cromtide.


b) 4 cromossomos distintos, cada um com duas cromtides.
c) 4 cromossomos, pareados 2 a 2, cada um com duas cromtides.
d) 4 cromossomos, pareados 2 a 2, cada um com uma cromtide.
e) 2 cromossomos, cada um com duas cromtides.
B
A maioria das reaes qumicas da clula, incluindo a duplicao de DNA, a sntese de RNA e a
produo de protenas celulares, ocorre, principalmente, durante a:

a) prfase. d) telfase.
b) metfase. e) intrfase.
c) anfase.
E
A figura a seguir representa o tecido meristemtico de uma planta, onde podem ser observadas
clulas em diferentes fases de diviso. Qual das alternativas corresponde seqncia do processo
mittico?

a) a b c d e f
b) c f e a b d
c) f b a e d c
d) e f c a b d
e) f e c b d a
B
A colchicina uma substncia que despolimeriza as fibras do fuso de diviso, impedindo que este
se forme. Em um meio de cultura foram colocadas 5 clulas, em diferentes estgios do ciclo celular:
duas estavam em intrfase, duas estavam em prfase e a ltima estava em telfase. Imediatamente
depois colocou-se colchicina. Aps um certo tempo, contando-se as clulas presentes em tal meio,
espera-se encontrar um total de quantas clulas?

a) seis. d) nove.
b) sete. e) dez.
c) oito
A
Considerando uma clula com 6 cromossomas (2n=6) que esteja em diviso, o esquema ao lado
representaria uma:

a) anfase I da
meiose.
b) metfase I da
meiose.
c) metfase II da
meiose.
d) anfase II da
meiose.
e) anfase
mittica.
E
A ordem correta das subfases da prfase :

a) leptteno - paquteno - zigteno - diplteno - diacinese.


b) leptteno - diplteno - zigteno - paquteno - diacinese.
c) leptteno - diplteno - paquteno - zigteno - diacinese.
d) leptteno - paquteno - diplteno - zigteno - diacinese.
e) leptteno - zigteno - paquteno - diplteno - diacinese.
E
Durante a prfase da primeira diviso meitica, ocorre a troca de fragmentos entre cromossomas
homlogos, possibilitando uma maior variabilidade gentica. A esse evento d-se o nome de:

a) formao de bivalentes.
b) formao de ttrades.
c) citocinese.
d) intercinese.
e) "crossing-over"
C
Durante a prfase da primeira diviso meitica, ocorre a troca de fragmentos entre cromossomas
homlogos, possibilitando uma maior variabilidade gentica. A esse evento d-se o nome de:

a) formao de bivalentes.
b) formao de ttrades.
c) citocinese.
d) intercinese.
e) "crossing-over"
E
Uma evidente diferena existente entre a anfase da mitose e as anfases I e II da meiose que os
cromossomos em migrao para os plos celulares so:

a) irmos nas anfases I e II e homlogos na anfase da mitose.


b) homlogos nas anfases I e II e irmos na anfase da mitose.
c) homlogos na anfase I e irmos na anfase II e na anfase da mitose.
d) irmos na anfase I e anfase da mitose e homlogos na anfase II.
e) irmos nas anfases I e II e anfase da mitose.
C
Assinale a frase errada, em relao meiose:

a) Os cromossomos j entram duplicados na prfase I.


b) A formao das ttrades ocorre no paquteno.
c) A permutao nada mais do que a troca de segmentos entre cromtides-irms
d) O quiasma, figura observada no diplteno, conseqncia da permutao.
e) Na metfase I, a placa equatorial est formada por pares de cromossomos.
C
Quando uma clula conclui a sua primeira diviso meitica, resultam:

a) duas clulas diplides.


b) quatro clulas diplides.
c) quatro clulas haplides.
d) duas clulas haplides.
e) duas clulas somticas.
D
Relacione as fases meiticas (coluna I) com os respectivos fenmenos (coluna II):

Coluna I Coluna II
1) zigteno [ ] Migrao dos cromossomos homlogos para os plos
2) paquteno [ ] pareamento dos homlogos
3) diplteno [ ] migrao dos cromossomos irmos para os plos.
4) anfase I [ ] visualizao dos quiasmas.
5) anfase II [ ] ocorrncia do crossing-over

A seqncia correta, de cima para baixo, na coluna II

a) 4, 1, 2, 3, 5 d) 4, 1, 3, 2, 5
b) 4, 1, 5, 2, 3 e) 4, 2, 5, 1, 3
c) 4, 1, 5, 3, 2
C
Sabe-se que a seqncia da espermatognese a seguinte:
espermatognia espermatcito I espermatcito II espermtide espermatozide.
Pergunta-se quantos espermatozides sero produzidos, respectivamente, a partir de 100
espermtides e 100 espermatcitos I.

a) 400 e 400 d) 200 e 400


b) 400 e 100 e) 100 e 400
c) 100 e 800
E
Assinale a alternativa correta:

a) No perodo de diferenciao da ovognese ocorrem transformaes maiores do que no mesmo


perodo, na espermatognese.
b) Os ovcitos primrios so bem maiores do que os espermatcitos primrios.
c) O perodo germinativo na mulher dura quase toda a vida.
d) No perodo de diferenciao da espermatognese o complexo de Golgi modifica-se, originando a
cauda do espermatozide.
e) As divises celulares que ocorrem nas gametogneses so todas meiticas.
B
A figura abaixo caracterstica da Meiose porque s nesse tipo de diviso celular acontece:

a) separao dos centrolos.


b) formao do fuso acromtico.
c) manuteno da carioteca.
d) pareamento dos cromossomos homlogos.
e) duplicao das cromtides.
D
Considerando que uma espcie possua n de cromossomas nas clulas somticas 2n=6, a clula
apresentada na figura abaixo evidencia esses cromossomas em:

a) metfase mittica.
b) metfase I.
c) metfase II.
d) anfase mittica.
e) anfase II.
D
Das afirmativas abaixo:
I- O crossing-over permite a recombinao dos genes localizados em cromossomos
homlogos.
II- Meiose um tipo de diviso celular na qual uma clula diplide d origem a quatro
clulas haplides.
III- A intrfase um perodo de grande atividade metablica no ncleo. nessa fase que o
DNA se duplica e o RNA sintetizado.

a) apenas a afirmativa I correta.


b) apenas a afirmativa II correta.
c) apenas a afirmativa III correta.
d) apenas duas afirmativas so corretas.
e) todas as afirmativas so corretas.
E
Considere as seguintes etapas da fotossntese:

I. reduo do NADP
II. fotlise da gua
III. sntese de glicose
IV. participao do CO2 na fase puramente qumica.

A ordem em que ocorrem essas etapas :


a) I II III IV
b) II I IV III
c) II IV I III
d) II I III IV
e) IV III II I
RESPOSTA: B
Em A Origem das Espcies, Charles Darwin introduz a noo da rvore da vida ilustrando a sua
concepo de evoluo biolgica, idia central e unificadora da Biologia. Estudos contemporneos
em nvel molecular incorporam a esse modelo a noo de transferncia horizontal de informao
gentica. A rvore que organiza o mundo vivo em trs Domnios, tambm apresentada na ilustrao,
destaca dois episdios importantes de transferncia horizontal que marcaram a histria da vida.

Com base nessas informaes,


a) identifique dois aspectos do pensamento de Darwin que esto expressos na metfora
da rvore;
b) justifique a importncia da transferncia horizontal da informao gentica para a evoluo dos
eucariotos.
a) A chamada rvore da Vida, representada em A Origem das Espcies, ilustra as relaes de
parentesco entre as espcies e traz duas ideias fundamentais da Teoria da Evoluo: a origem
comum de todos os seres vivos e a descendncia com modificao.
b) A rvore que representa os trs Domnios de Carl Woese (1977) presente na ilustrao, tambm
esquematiza o fenmeno da transferncia horizontal de informao gentica, que agrega ao modelo
original de Darwin a ideia de uma outra forma de aquisio de novas caractersticas - a
recombinao de informaes genticas - fenmeno que no se restringe aos eventos pontuais
referidos na ilustrao. Para os eucariotos, a transferncia horizontal de informao entre os
diferentes domnios pode ter sido fundamental para a grande variabilidade observada entre os
pluricelulares.
O olho humano um rgo extremamente complexo; atua como uma cmera, coletando, focando e
convertendo a luz em um sinal eltrico traduzido em imagens pelo crebro. [...] Mesmo Charles
Darwin admitiu, em A Origem das Espcies, que pode parecer absurdo pensar que a estrutura ocular
se desenvolveu por seleo natural. No entanto, apesar da falta de evidncias de formas
intermedirias naquele momento, Darwin acreditava que o olho evolura dessa maneira. No foi
fcil encontrar evidncias para essa teoria, mas os cientistas j tm uma viso clara de como
surgiram nossos olhos to complexos. (LAMB, 2011, p. 46).

Considerando as informaes do texto e os conhecimentos sobre a estrutura e a fisiologia do olho


humano:

a) justifique a dificuldade de se encontrar evidncias diretas da evoluo do olho humano e


apresente uma abordagem que possa ter contribudo para os cientistas obterem uma viso clara da
evoluo desse rgo;
b) apresente as estruturas envolvidas na focalizao e converso da luz em um sinal eltrico
traduzido em imagens pelo crebro.
a) A ausncia de evidncias diretas da evoluo do olho humano, que seriam registros fsseis, se
justifica pelo fato de que tecidos moles dificilmente fossilizam. Uma abordagem cientfica que
supera esta dificuldade inclui estudos comparativos da estrutura do olho entre espcies existentes e
anlises de embries em desenvolvimento, com especial ateno para a comparao das estruturas,
aliando contribuies da Gentica, da Evoluo e da Embriologia.
b) A focalizao realizada por um sistema de lentes - cristalino e suas interfaces com as cmaras
do bulbo ocular - humor aquoso e humor vtreo. O cristalino - principal lente - uma estrutura
transparente, de natureza proteica em forma de uma lente biconvexa que confere nitidez e foco
imagem luminosa coletada. O humor aquoso um meio lquido que preenche a cavidade anterior do
olho e o humor vtreo constitui um meio gelatinoso que ocupa a cavidade posterior do olho,
constituindo o seu maior volume. Esses meios transparentes funcionam como lentes lquidas que
contribuem para focalizar a luz na retina.
A converso da luz em um sinal eltrico traduzido em imagens pelo crebro realizada na retina,
que forma a camada mais interna do olho e se constitui de vrias camadas de neurnios e
fotorreceptores - cones e bastonetes. Os estmulos captados pelos fotorreceptores so direcionados
pelo nervo ptico at o centro da viso, na parte posterior do crebro, que decodifica os sinais, com
a percepo da imagem.
Embora as espcies animais possuam morfologia tremendamente variada, a sua grande diversidade
de formas pode ser categorizada em um nmero relativamente pequeno de planos corpreos. [...]
Como todas as caractersticas dos organismos, o plano corpreo dos animais evoluiu, alterando-se
ao longo do tempo. Algumas dessas mudanas evolutivas aparentemente ocorreram cedo na histria
da vida animal. (CAMPBELL, 2010, p. 658).

Com base na anlise da ilustrao e em conhecimentos sobre a histria evolutiva dos animais,
a) justifique a posio dos platelmintos e cordados na rvore filogentica representada;
b) apresente um argumento que explique a posio marginal das esponjas.
a) Platelmintos e cordados compartilham a simetria bilateral, mas se diferenciam basicamente pelo
destino do blastporo - orifcio que comunica o arqunteron (intestino primitivo que originar a
cavidade digestria do adulto) com o exterior. No decorrer do desenvolvimento, o blastporo dar
origem boca nos platelmintos, chamados por esta razo de protostmios; nos cordados, o
blastporo dar origem ao nus - sendo por isso chamados de deuterostmios, uma vez que a boca
forma-se posteriormente.
b) A posio marginal das esponjas se justifica pelo fato de no apresentarem tecidos verdadeiros
nem rgos, apesar de serem considerados organismos multicelulares.
Estudos com mutaes em plantas revelam trs classes de genes de identidade de rgos (genes
hometicos), associados ao padro espacial dos verticilos florais - modelo ABC. A figura ilustra a
relao entre a atividade dos genes A, B e C e a formao de estruturas florais em um modelo
derivado desses estudos.

A partir da anlise da ilustrao e dos conhecimentos sobre as estruturas reprodutivas nas plantas
com flores,
a) explique a repercusso de cada uma das mutaes no processo de formao dos verticilos florais.
b) apresente o significado biolgico da mutao envolvendo o gene C, segundo o modelo.
a) A formao dos verticilos florais est associada atividade sequencial de genes reguladores -
genes hometicos. Mutaes nesse genes comprometem a organizao bsica da flor. Assim, pode-
se evidenciar que a mutao no gene A inviabiliza o desenvolvimento de spalas e ptalas; no gene
B, a mutao bloqueia a formao de ptalas e estames; uma mutao no gene C resultar na
ausncia de carpelo e de estames.
b) Uma mutao no gene C compromete a funo reprodutora da planta, resultando em esterilidade,
vez que estaro ausentes os dois verticilos envolvidos diretamente com a reproduo.
Vivemos em um mundo no qual a humanidade pode ter se tornado uma fora geolgica, ou seja, um
fenmeno capaz de transformar a paisagem planetria. Uma influncia to evidente, que j se
discute a incluso de mais uma poca - o Antropoceno - na tabela do tempo geolgico da Terra -
conforme ilustra a figura. A partir de meados do sculo XVIII, os humanos alteraram diretamente as
paisagens em 40% a 50% do planeta e marcas de sua influncia afetam mais de 83% da superfcie
terrestre ( a chamada pegada antrpica). Impacto semelhante s ocorreu no Cambriano, quando
uma nova bactria aumentou significativamente os nveis de oxignio atmosfrico, a partir de uma
atividade metablica especfica. (MARTINI, 2011, p. 39).

Com base nessas informaes e considerando a histria ecolgica do planeta, apresente um


argumento que justifique a comparao da pegada antrpica com o holocausto do oxignio,
destacando uma consequncia de cada um dos fenmenos referidos.
Observe a figura e assinale a alternativa que corresponde aos nomes das estruturas I, II, III, IV, V e
VI, respectivamente.

a) I- Pednculo, II- receptculo floral, III- clice, IV- corola, V- pistilos, VI- estames;
b) I- Receptculo floral, II- pednculo, III- clice, IV- corola, V- estames, VI- carpelo;
c) I- Carpelo, II- estame, III- corola, IV- clice, V- pistilo, VI- receptculo floral;
d) I- Pednculo, II- receptculo floral, III- estame, IV- corola, V- carpelo, VI- estame;
e) I- Perignio, II- perianto, III- clice, IV- corola, V- estames, VI- carpelo.
RESPOSTA: B
Marque a alternativa incorreta:
a) A maioria das flores apresenta os quatro tipos de verticilos florais - gineceu, androceu, corola e
clice, sendo por isso chamada de flores completas.
b) O androceu um conjunto de estames. Os estames so constitudos por filete e antera.
c) A flor, assim como o estrbilo das gimnospermas, um ramo especializado em que h folhas
frteis com esporngios, os esporofilos.
d) A autofecundao uma estratgia que as plantas desenvolveram a fim de aumentarem a sua
produo de frutos, por isso ela muito vantajosa para a espcie.
e) O gineceu o aparelho reprodutor feminino da planta.
RESPOSTA: D
A autofecundao no vivel para a planta, pois ao se autofecundar ocorre uma diminuio nas
chances de se formarem novas combinaes gnicas na descendncia e, consequentemente, de a
prole se adaptar a possveis variaes ambientais.
Um gro de plen pode fecundar um vulo da mesma planta em um processo chamado de
autofecundao, mas algumas plantas desenvolveram estratgias para que isso no ocorra. Em uma
dessas estratgias, as plantas amadurecem os estames primeiro em um fenmeno chamado de:
a) Heterostilia;
b) Dicogamia;
c) Autofecundao;
d) Protoginia;
e) Protandria.
RESPOSTA: E
Heterostilia: quando os elementos das flores possuem tamanhos diferentes para evitar a
autofecundao.
Dicogamia: estratgia desenvolvida por algumas plantas que consiste no amadurecimento de
estames e ovrios em pocas diferentes.
Autofecundao: quando um gro de plen fecunda um vulo da mesma planta.
Protoginia: quando os carpelos ou pistilos amadurecem primeiro que os estames.
Protandria: quando os estames amadurecem primeiro que os carpelos ou pistilos.
As flores so estruturas que tm funo na reproduo sexual das plantas angiospermas, onde se
podem distinguir diferentes verticilos florais, entre os quais:

a) Tpalas: conjunto de ptalas de cores diferentes;


Corola: conjunto de spalas;
Gineceu: sistema reprodutor masculino;

b) Corola: conjunto de spalas;


Clice: conjunto androceu-gineceu;
Perianto: conjunto de ptalas;

c) Corola: conjunto de spalas;


Gineceu: sistema reprodutor masculino;
Perianto: conjunto androceu-gineceu;

d) Clice: conjunto de ptalas;


Androceu: sistema reprodutor feminino;
Perignio: conjunto de ptalas iguais;

e) Clice: conjunto de spalas;


Androceu: sistema reprodutor masculino;
Gineceu: sistema reprodutor feminino.
RESPOSTA: E
Tpalas: quando ptalas e spalas se assemelham na cor e na textura so chamadas de tpalas;
Perignio: conjunto de tpalas;
Corola: conjunto de ptalas;
Clice: conjunto de spalas;
Gineceu: sistema reprodutor feminino;
Androceu: sistema reprodutor masculino;
Perianto: formado pelo conjunto do clice e da corola.
O fato de, em algumas flores, o gineceu e o androceu amadurecerem ao mesmo tempo

a) Garante florao mais prolongada da espcie;


b) Propicia maior produtividade de frutos;
c) Favorece a autofecundao;
d) Reduz as chances de autofecundao;
e) Impede a autofecundao.
RESPOSTA: C

A autofecundao ocorre quando um gro de plen fecunda um vulo da mesma planta. A


autofecundao no muito boa para a planta, pois ao se autofecundar ocorre uma diminuio nas
chances de se formarem novas combinaes gnicas na descendncia e, consequentemente, de a
prole se adaptar a possveis variaes ambientais.
Cruzando-se ervilhas verdes vv com ervilhas amarelas Vv, os descendentes sero:

a) 100% vv, verdes;


b) 100% VV, amarelas;
c) 50% Vv, amarelas; 50% vv, verdes;
d) 25% Vv, amarelas; 50% vv, verdes; 25% VV, amarelas;
e) 25% vv, verdes; 50% Vv, amarelas; 25% VV, verdes.
RESPOSTA: c

O enunciado nos diz que as ervilhas verdes so homozigticas com gentipo recessivo (vv), e que
as ervilhas amarelas so heterozigticas com gentipo dominante (Vv). Ao cruzarmos esses
indivduos teremos:

A partir da resoluo acima podemos concluir que 50% dos descendentes possuem gentipo Vv, ou
seja, cor amarela, e os outros 50% possuem o gentipo vv, ou seja, cor verde.
Um gato da cor marrom foi cruzado com duas fmeas. A primeira fmea era da cor preta, e teve 7
filhotes da cor preta e 6 filhotes da cor marrom. J a outra fmea, tambm era da cor preta, e teve
14 filhotes, sendo todos eles da cor preta. A partir desses cruzamentos marque a opo que contm
os gentipos do macho, da primeira e da segunda fmea respectivamente.
a) Aa, aa, aa.
b) AA, aa, aa.
c) aa, AA, aa.
d) Aa, Aa, AA.
e) Aa, AA, Aa.
RESPOSTA: d
Sabemos que a cor preta dominante sobre a cor marrom, e por esse motivo j podemos dizer que o
macho tem um gene recessivo, enquanto as duas fmeas possuem pelo menos um dos genes
dominantes, pois ambas tiveram filhotes da cor preta.
O enunciado nos disse que a primeira fmea teve filhotes da cor marrom e da cor preta, sendo
assim, podemos concluir que essa fmea possui um dos genes dominante e o outro gene recessivo,
sendo ento heterozigota (Aa). Dessa forma, o cruzamento desses indivduos obter a seguinte
descendncia:

Sendo que os gentipos Aa definiro a cor preta e os gentipos aa definiro a cor marrom. Diante
disso conclumos que a primeira fmea tem gentipo Aa, pois teve, em sua descendncia, filhotes de
cor preta e de cor marrom.
Retornando ao enunciado mais uma vez, vemos que a segunda fmea teve filhotes apenas de cor
preta. Nesse caso podemos concluir que essa fmea homozigota dominante (AA), e o cruzamento
com o macho de cor marrom (aa) ficou da seguinte forma:
Observe que os todos os descendentes desse cruzamento possuem gentipo dominante, e por esse
motivo so todos da cor preta
Com relao ao escurecimento da pele, analise as proposies abaixo e, em seguida, assinale a
opo correta.

I) Com a exposio aos raios solares h uma intensificao da sntese de melanina.


II) Os raios solares escurecem a melanina j existente.
III) Com os raios solares os genes dos melancitos bloqueiam a sntese de tirosinase, ampliando a
sntese de melanina.
IV) Quanto mais intensa for a exposio solar, mais melancitos que se encontram na derme
migram para a epiderme, escurecendo a pele e protegendo-a.

a) Somente I, II e IV esto corretas.


b) Somente I e II esto corretas.
c) Somente II e IV esto corretas.
d) Somente I e III esto corretas.
e) Somente I, II e III esto corretas.
E
A alcaptonria uma doena determinada por um gene autossmico recessivo, resultante da
deficincia da enzima oxidase do cido homogentsico, ou alcaptona, que se acumula no sangue e
eliminado pela urina, que se torna escura em contato com o ar. Os principais agravos so
escurecimento das cartilagens e propenso artrite.
Considerando o heredograma abaixo, calcule a probabilidade do casal IV-1 e IV-2 ter uma criana
alcaptonrica.

a) 0
b)
c) 1/8
d) 1/16
e) 1/24
E
Sejam as seguintes caractersticas:

I) Tegumento constitudo por epiderme mucosa e fina camada crnea.


II) Circulao dupla incompleta.
III) Respirao cutnea, branquial e pulmonar.
IV) Animais pecilotrmicos.

Qual das opes abaixo possui tais caractersticas?

a) sapo-boi
b) gato
c) guar
d) lambari
e) jararaca
A
Com relao respirao celular, analise as sentenas abaixo e, em seguida, assinale a opo
correta:

I) O NAD+ desempenha papel central no metabolismo energtico das clulas, captando eltrons de
alta energia, liberados na degradao de molculas orgnicas e fornecendo-os, em seguida, aos
sistemas de sntese de ATP.
II) A gliclise uma etapa anaerbica do processo de degradao da glicose, pois no necessita de
gs oxignio para ocorrer.
III) O ciclo de Krebs tem incio com uma reao entre a acetil-CoA e o cido oxalactico, em que
liberada a molcula de coenzima A e formada uma molcula de cido ctrico.
IV) A sntese da maior parte do ATP gerado na respirao celular est acoplada reoxidao das
molculas de NADH e FADH2, que se transformam em NAD+ e FAD, respectivamente.
V) A maior parte do NADH produzida no interior da mitocndria, durante a transformao do
cido pirvico em acetil-CoA e o ciclo de Krebs.

a) Somente I e III esto corretas.


b) Somente II e III esto corretas.
c) Somente II, III e IV esto corretas.
d) Somente I, II, III e V esto corretas.
e) I, II, III, IV e V esto corretas.
E
Assinale a opo onde se encontra exemplo de protocooperao.

a) relao entre bfalos e pssaros


b) associao entre determinados fungos e as razes de certas plantas
c) relao existente entre corais
d) relao entre samambaias que vivem sobre rvores
e) relao entre os fungos que secretam antibiticos, impedindo a multiplicao de bactrias
A
Segundo dados do Instituto Nacional do Cncer (INCA, 2010), o tumor de mama o tipo de cncer
mais comum nas mulheres da regio Sudeste (65 novos casos em cada 100.000 mulheres) e o
segundo mais comum entre as mulheres da regio Norte (17/100.000), sendo superado aqui apenas
pelo cncer de pele no melanoma (25/100.000). De um modo geral, podemos dizer que a
carcinognese refere-se ao desenvolvimento de tumores malignos, devido ocorrncia de uma
ruptura dos mecanismos reguladores da multiplicao celular e, sem que seja necessrio ao tecido,
uma clula comea a crescer e a dividir-se desordenadamente. Em relao carcinognese,
correto afirmar:

(A) A carcinognese inicia-se sempre pela induo de agentes carcinognicos, que podem ser
qumicos, fsicos ou biolgicos.
(B) Os agentes carcinognicos qumicos incluem substncias qumicas presentes no meio ambiente,
mas no incluem fatores intrnsecos dos organismos, como fatores produzidos em processo
inflamatrio, e hormnios.
(C) Os raios ultravioleta podem causar o cncer de pele porque radiaes tm capacidade de induzir
mutaes cromossmicas, uma vez que agem na meiose provocando a no-disjuno de homlogos.
(D) Entre os agentes biolgicos, bactrias e vrus foram implicados como agentes indutores de
cncer em animais e no homem.
(E) Os tumores malignos apresentam duas propriedades peculiares: formao de cpsula e
comprometimento distncia (metstase). A metstase definida como o comprometimento
distncia por uma parte do tumor que no guarda relao direta com o foco primrio.
D
Situada na regio norte da Amrica do Sul, a floresta amaznica possui uma extenso de
aproximadamente 7 mil quilmetros quadrados, espalhada pelos estados da regio Norte do Brasil e
por outros pases da Amrica do Sul.
Sobre esse bioma, correto afirmar que
(A) uma floresta tropical fechada, formada em boa parte por rvores de grande porte, situando-se
prximas uma das outras. O solo dessa floresta muito rico, pois possui uma espessa camada de
nutrientes orgnicos.
(B) a camada superficial do solo formada pela decomposio de folhas, frutos e animais mortos.
Esse rico hmus matria essencial para as milhares de espcies de plantas e rvores que se
desenvolvem nessa regio.
(C) o clima que encontramos na regio desta floresta o tropical. Nesse tipo de clima, tanto as
temperaturas como o ndice pluviomtrico so elevados.
(D) A retirada da cobertura vegetal permitiria a perda de parte dos nutrientes do solo, que seriam
levados pelas chuvas constantes. Entretanto, devido espessura da camada de hmus, o solo
amaznico ainda teria boa fertilidade para utilizao na agricultura.
(E) As guas amaznicas possuem caractersticas diferentes, resultantes da geologia das bacias
fluviais da Amaznia. Os chamados rios de gua branca ou turva, como o Solimes ou o Madeira,
percorrem terras pobres em minerais e suspenses orgnicas. Os chamados rios de gua preta, como
o Negro, oriundos de terras arenosas ricas em minerais, so transparentes e coloridos em marrom
pelas substncias do hmus.
B
Vrias espcies de helmintos so agrupadas dentro do filo Nematoda, ou vermes cilndricos. As
principais novidades evolutivas que surgiram nesse filo, em comparao com os vermes achatados
(Platelmintos), foram:
(A) a presena de trs folhetos germinativos; uma cavidade interna chamada pseudo-celoma; e o
sistema digestrio completo.
(B) a presena de trs folhetos germinativos; uma cavidade interna chamada celoma; e o sistema
circulatrio fechado.
(C) a presena de trs folhetos germinativos; ausncia de cavidade interna; e sistema digestrio
completo.
(D) a presena de dois folhetos germinativos; uma cavidade interna chamada pseudo-celoma; e o
sistema digestrio completo.
(E) a presena de trs folhetos germinativos; uma cavidade interna chamada celoma; e o sistema
digestrio completo.
A
Os processos celulares esto interligados de tal forma que cada organela, cada componente do
citoquesqueleto e o citosol encontram-se direta ou indiretamente vinculados a eventos fisiolgicos
celulares. Uma forma de correlao fisiolgica direta, entre membrana, citoplasma e ncleo, est
indicada na alternativa:
(A) A duplicao dos centrolos direciona a mobilizao dos microtbulos e consequente
redistribuio de organelas para futuras clulas filhas.
(B) Fagocitose de bactrias resulta na formao de um fagolisossomo, o qual transporta, durante a
digesto, molculas bsicas ao citosol que podem ser direcionadas s atividades das demais
organelas, como lipdios, aminocidos, monossacardeos e nucleotdeos.
(C) A exocitose pode ser observada tanto na liberao de enzimas de digesto extracelular, como na
liberao de neurotransmissores dentro de uma fenda sinptica. Ambos os processos necessitam de
sinais extracelulares para ocorrer.
(D) O bloqueio da difuso de O2 para dentro da clula afeta a respirao celular, o que leva ao
declnio comprometedor das atividades mitocondriais e induz morte celular programada.
(E) Receptores de superfcie induzem reaes enzimticas em cascata que resultam na fosforilao
de protenas de membrana nuclear e desintegrao desta, o que marca o incio do processo de
diviso celular.
E
O Ministrio da Sade implantou um eficaz Programa Nacional de Controle da Dengue (PNCD),
que, por meio das aes desenvolvidas em todo o Brasil, com parcerias entre Estados e Municpios,
contribui com a reduo de casos. Destaca-se, dentre as aes do PNCD, ampla divulgao sobre
caracterizao, preveno e profilaxia da dengue, assim como sobre os mitos e erros mais comuns
no entendimento dessa doena. Considera-se um mito comum sobre a dengue:
(A) Em estudos epidemiolgicos, a dengue clssica aparece como a manifestao mais comum,
com febre entre 39-40C, dor de cabea, dor no corpo, nusea e vmitos.
(B) O Par est na rea de risco muito alto de transmisso, com a maioria de casos autcnes, uma
vez que apresenta caractersticas geogrficas e climticas favorveis ao vetor.
(C) As transmisses concentram-se apenas nos perodos chuvosos, podendo ocorrer tambm em
estaes no chuvosas.
(D) Pacientes que adquirem dengue pela segunda vez apresentaro a forma hemorrgica. Assim,
vela de citronela, andiroba, repelentes e fumac so fundamentais no combate dengue.
(E) Existem quatro formas de sorotipo circulantes no Brasil: DENV 1, DENV 2, DENV 3 e DENV
4, e os surtos epidemiolgicos ocorrem por alternncia destes.
D
Trufa: de comer?
Quando se fala em trufas em Pelotas, logo se lembra do doce, mas tambm existem alguns
cogumelos (Filo Ascomycota) que se formam debaixo da terra e que apresentam esse mesmo nome
(Figura 1). Esses fungos so muito utilizados na culinria e tm alto valor no mercado, mais de US$
3.000,00 por quilo.

http://www.pelliccioli.com.br/culinaria/especiarias_produtos/trufas.html.

Com base em seus conhecimentos e nos textos, correto afirmar que os fungos so organismos:

(a) eucariotos, e todos os fungos so comestveis, assim como a trufa.


(b) eucariotos e obtm alimento por absoro de nutrientes do meio.
(c) procariotos, e alguns fungos podem ser parasitas.
(d) procariotos, e sua reproduo tem as fases assexuada e sexuada.
(e) autotrficos, e apresentam parede celular de quitina, assim como os insetos.
D
possvel criar vida a partir do zero?

Foi divulgada a criao de uma bactria sinttica. Um genoma foi feito com substncias qumicas
em um sintetizador qumico e inserido em uma clulanatural, uma bactria.
Scientific American Brasil, N 98, Julho 2010, p. 26-27. [Adapt.]

Com base em seus conhecimentos e no texto, correto afirmar que:

(a) foi criada a vida no laboratrio, pois o genoma sozinho capaz de gerar a vida, formando
protenas, lipdios, acares e gua.
(b) foi criada a vida de um eucarioto, uma bactria desprovida de organelas.
(c) no foi criada uma nova vida, foi sintetizado artificialmente apenas o material gentico da
clula. Alm deste, uma bactria possui citoplasma, membrana plasmtica e ribossomos.
(d) foi criada uma nova vida injetando o ncleo sinttico em uma clula eucariota natural. Isso
refora a teoria do criacionismo.
(e) no foi criada uma nova vida, foi sintetizado em laboratrio apenas o ncleo da clula. Alm
deste, uma bactria possui outras organelas como o complexo de Golgi.
(f) I.R.
C
A figura mostra os biomas que ocorrem no Rio Grande do Sul.

Com base na figura e em seus conhecimentos, correto afirmar que o Bioma que ocorre:
(a) na Metade Sul do Rio Grande do Sul o Pampa, que se caracteriza pelo predomnio de
gramneas em reas de plancie.
(b) no extremo nordeste do Rio Grande do Sul a Mata Atlntica, que se caracteriza pelo
predomnio de gramneas em reas montanhosas.
(c) na Metade Sul do Rio Grande do Sul o Pampa, que se caracteriza pelo predomnio de rvores
de grande porte em reas de plancie.
(d) no extremo oeste do Rio Grande do Sul a Mata Atlntica, que se caracteriza pelo predomnio
de arbustos e rvores de pequeno porte com tronco retorcido.
(e) no extremo sul do Rio Grande do Sul o Pampa, que se caracteriza pelo predomnio de matas de
araucria em reas de plancie.
(f) I.R.
A
Jornal Zero
Hora, 03/02/2011

A agricultura e a pecuria contribuem para as emisses antrpicas de metano (CH4), dixido de


carbono (CO2) e xido nitroso (N2O) atmosfera. O aumento da concentrao desses gases
provoca o aquecimento da superfcie terrestre e destruio da camada de oznio na estratosfera.
Pesq. agropec. bras., Braslia, v.39, n.3, p.277-283, mar. 2004
Com base em seus conhecimentos e nos textos, correto afirmar que
(a) as vacas, ao contrrio das fbricas, no contribuem para o aumento do efeito estufa, pois no
liberam gs poluente.
(b) as fbricas no contribuem para o aumento do efeito estufa, pois todas possuem filtros
antipoluentes.
(c) tanto as fbricas quanto as vacas contribuem para o aumento do efeito estufa, pois ambas
liberam grande quantidade de xido nitroso.
(d) as vacas contribuem para o aumento do efeito estufa ao liberarem xido nitroso; e as fbricas, ao
liberarem metano.
(e) as vacas tambm contribuem para o aumento do efeito estufa, atravs da liberao de metano.
(f) I.R.
E
Abelhas buscam nctar em flores de vrias espcies e levam plen de uma para outra, promovendo
sua fecundao. Assim, as plantas produzem frutos que alimentam morcegos, aves e outros animais:
estes dispersam suas sementes, aumentando as chances de gerarem novas plantas. Formigas
defendem vegetais contra ataques e estes fornecem a elas abrigos para viver. So muitos os
exemplos de interaes entre animais e plantas, e desvendar a estrutura dessas redes de parcerias
fundamental para compreender importantes processos ecolgicos - como a polinizao e a disperso
de sementes.
Cincia Hoje, v.47, n.277, dezembro de 2010 [adapt.].

Com base em seus conhecimentos e no texto, considerando as relaes ecolgicas descritas como
obrigatrias, correto afirmar que, dessas relaes ecolgicas:

(a) a relao morcego-planta interespecfica com efeito negativo, por envolver herbivorismo.
(b) a relao abelha-planta mutualstica, ou seja, as espcies envolvidas so beneficiadas.
(c) todas envolvem parasitismo, ou seja, uma espcie se alimenta da outra.
(d) todas envolvem predatismo, exceto a relao abelha-planta que de protocooperao.
(e) a relao formigas-vegetais intraespecfica do tipo comensalismo.
(f) I.R.
B
Ao alterar as caractersticas naturais dos rios, gerando ambientes semelhantes a lagos, as grandes
barragens afetam a comunidade de peixes. O represamento prejudica muitas espcies, em especial
as que fazem longas migraes, e favorece outras. As introdues de espcies no nativas para
aumentar o rendimento de pesca - atividade que era realizada e atualmente proibida - tambm teve
forte impacto nas bacias hidrogrficas brasileiras. As espcies no nativas tm, em geral, maior
tolerncia a condies adversas, alta capacidade de adaptao e oportunismo alimentar. Observe a
figura que mostra as curvas de riquezas de espcies de peixes em trs diferentes perodos, na
represa de Tucuru, no Rio Tocantins.

Cincia Hoje, v.49, n.293, junho/2012 [adapt.]

Com base no texto e no grfico correto afirmar que houve:

(a) o aumento da biodiversidade de peixes na fase de estabilizao da represa devido introduo


de espcies no nativas, as quais so mais tolerantes s novas condies.
(b) a reduo da biodiversidade de peixes promovida pela ao antrpica, decorrente do
desequilbrio ecolgico em funo do represamento do rio.
(c) a reduo da biodiversidade de peixes devido pesca predatria de espcies no nativas, as
quais so menos competitivas do que as que fazem longas migraes.
(d) o aumento da biodiversidade de peixes, devido maior migrao de espcies para reproduo ao
longo do leito do rio e introduo de espcies no nativas.
(e) o equilbrio da biodiversidade de peixes na represa devido introduo de espcies no nativas e
ao crescimento das populaes de peixes nativos.
(f) I.R.
A
Os ambientes aquticos possuem comunidades fitoplanctnicas com variedade, abundncia e
distribuio prprias que dependem de caractersticas abiticas e biticas. Em geral, quando
extrada e analisada uma amostra do fitoplncton de um corpo hdrico, principalmente mananciais
com circulao relativamente fechada, como lagos e represas, comum a presena de
cianobactrias, clorofceas e diatomceas. A qualidade da gua dos mananciais deve ser monitorada
para utilizao em abastecimento pblico. Entre os parmetros a serem avaliados est a densidade
de cianobactrias. Estes organismos, bem como outros grupos fitoplanctnicos, podem gerar
problemas para o tratamento da gua, como odor, sabor e colmatao de filtros das estaes de
tratamento de gua. Alm disso, a ocorrncia de floraes de cianobactrias gera preocupao pela
potencial produo de toxinas. Em monitoramento realizado em mananciais de captao de gua no
Rio Grande do Sul, foi observada a ocorrncia de floraes de cianobactrias potencialmente
txicas em trs locais avaliados.
Revista Brasileira de Recursos Hdricos, v.17, n.2 - Abr/Jun 2012.

correto afirmar que:


(a) os ambientes aquticos, como os relatados no texto (lagos e represas), apresentam menor
abundncia de fitoplnctons quando comparados a ambientes aquticos com grande movimento de
gua, como rios e corredeiras.
(b) as cianobactrias so fitoplnctons que, por no serem fotossintetizantes, ao contrrio das
clorofceas, so utilizadas no ecossistema aqutico apenas como alimento para o zooplncton.
(c) os fitoplnctons relatados no texto, comuns na regio abissal dos biomas aquticos, alm de
serem indicadores da qualidade da gua para consumo humano, so organismos produtores na
cadeia alimentar.
(d) as cianobactrias relatadas no texto, apesar de preocuparem pela possibilidade de produo de
toxinas nos mananciais de captao de gua para uso humano, so organismos produtores na cadeia
alimentar aqutica.
(e) as cianobactrias, organismos heterotrficos que compem as comunidades fitoplanctnicas, so
prejudiciais ao ecossistema aqutico eutrofizado, por produzirem toxinas que contaminam os seres
bentnicos.
(f) I.R.
B
Observe a sequncia de figuras que faz referncia ao Bioma Cerrado.

<http://ww
w.cantacantos.com.br/blog/?p=2382>

Considerando a rea original de 204 milhes de hectares, o bioma Cerrado j perdeu, at 2008,
47,84% de sua cobertura de vegetao.
MINISTRIO DO MEIO AMBIENTE. Plano de ao para preveno e controle do desmatamento
e das queimadas: cerrado. Braslia: MMA, 2011. 200 p.

Os textos fazem referncia :

(a) reduo da vegetao do Cerrado - bioma que se caracteriza por apresentar matas de araucria -,
devido ao desmatamento para ocupao agropecuria.
(b) reduo da vegetao do Cerrado - bioma que se caracteriza por apresentar vegetao arbrea
esparsa, formada por pequenas rvores e arbustos -, devido ao desmatamento para ocupao
agropecuria.
(c) perda da biodiversidade do Cerrado - bioma composto predominantemente por plantas
gramneas - devido s queimadas da vegetao para ocupao agropecuria.
(d) ao antrpica positiva no Cerrado - bioma que se caracteriza pela presena de floresta densa
formada com rvores de grande porte - devido ao aumento na produo de alimentos.
(e) perda da biodiversidade vegetal do Cerrado - bioma que se caracteriza pela presena de rvores
de grande porte, formando floresta densa - devido expanso das reas agrcolas.
(f) I.R.
D
O turu (Teredo) um molusco que vive na gua e consegue reduzir barcos e deques de madeira a
escombros. Na Amaznia e na Ilha de Maraj, ele vive em rvores dos manguezais em estado de
putrefao. So como cupins de madeira molhada. Fora os estragos que pode causar, o turu um
alimento e tanto. Esse molusco fornece habitats para bactrias, as quais vivem dentro das suas
clulas e nunca foram observadas vivendo independente deles. As bactrias digerem a madeira roda
pelo turu e aumentam a injeo de nitrognio, por meio do aproveitamento do ar dissolvido na gua
do mar. Espera-se que daqui a alguns milhes de anos essas bactrias se tornem componentes
completamente integrados da engenharia celular dos turus.
http://www.coisasinteressantes.com.br/blog/?p=9 e <http://www.sms.si.edu/irlspec/teredo_navalis.htm>,
acessados dia 17/09/2012 s 19:30h e Revista Conhecer, Junho 2012, n 36 - [Adapt.].

01 - Um exemplo de uma organela, que no passado, segundo a teoria da endosimbiose, teria sido
uma bactria que passou a viver dentro de outra clula e se tornou interdependente o(a)

(a) mitocndria.
(b) ncleo.
(c) retculo endoplasmtico.
(d) lisossomo.
(e) acrossomo.
(f) I.R.

02 - Com base na questo anterior, correto afirmar que:

(a) o turu e a bactria pertencem ao mesmo Reino, o Animalia. Esse reino composto por
organismos unicelulares ou multicelulares, procariotos ou eucariotos e todos so heterotrficos.
(b) o turu um animal invertebrado do Filo Mollusca, assim como os caramujos, polvo, ostras,
mariscos e minhocas. Esse Filo tem, como caracterstica principal, corpo mole e no segmentado.
(c) a bactria um organismo unicelular, autotrfico, pertencente ao Reino Plantae, pois ela realiza
fotossntese e assim obtm a energia necessria para a sua sobrevivncia.
(d) os organismos citados pertencem a reinos diferentes, sendo que as bactrias pertencem ao Reino
Monera, que compreende organismos unicelulares, procariotos, autotrficos ou heterotrficos.
(e) o turu e a bactria so organismos que apresentam muitas diferenas morfolgicas, por isso so
classificados em reinos diferentes, sendo que o molusco classificado no Reino Animallia e a
bactria no Reino Fungi.
(f) I.R.

03 - Com base na primeira questo, correto afirmar que o turu apresenta:

(a) respirao branquial e reproduo sexuada.


(b) respirao pulmonar e reproduo sexuada.
(c) respirao cutnea e reproduo sexuada.
(d) respirao pulmonar e reproduo assexuada.
(e) respirao branquial e reproduo assexuada.
(f) I.R.
B
A mata Atlntica uma floresta tropical que apresenta muitas caractersticas da floresta Amaznica.
A diferena mais expressiva entre ambas est provavelmente na topografia do terreno que ocupam:
a floresta Amaznica ocupa plancies e planaltos no interior do Brasil, enquanto a mata Atlntica
ocorre na regio costeira, em plancies e montanhas como a serra do Mar. A mata Atlntica se
estendia por todo litoral brasileiro, do Rio Grande do Sul at o Piau. Est reduzida a pouco mais de
7% da rea original exibindo, hoje, o ttulo de uma das mais devastadas do mundo. Mesmo muito
reduzida e fragmentada, a mata Atlntica apresenta enorme importncia socioambiental.
Aproximadamente 62% da populao brasileira vivem em seu domnio, cerca de 110 milhes de
pessoas.

Cobertura original e atual da mata Atlntica, segundo levantamento parcial realizado recentemente
pela organizao no governamental (ONG) SOS Mata Atlntica e pelo Instituto Nacional de
Pesquisas Espaciais (INPE).
(a) a influncia de El Nio nas variaes climticas tem influenciado na diminuio dessa mata na
regio Nordeste.
(b) o avano aleatrio das culturas de cana-deacar e arroz irrigado, principalmente nas ltimas
dcadas, tem reduzido a cobertura vegetal na faixa litornea do Brasil.
(c) o extrativismo vegetal, aliado a atividades agrcolas, desde o perodo colonial, tem sido o
principal motivo da devastao da mata Atlntica.
(d) a atividade econmica do sculo XVIII foi dominada, de forma predatria, pelo cultivo do caf
com os desmatamentos de encostas e drenagens de rios.
(e) o ciclo do soja tambm contribuiu, no sculo XX, para a diminuio da rea de mata Atlntica.
Para cada hectar que se abriu para a lavoura, destruram-se de 5 a 10 hectares pelo fogo
descontrolado.
(f) I.R.
C
Os manguezais so biomas litorneos, desde o Amap at Santa Catarina. Possuem vegetao
arbustiva caracterstica, solo lodoso, onde a gua doce se acumula e, por ocasio da mar alta, se
mistura com a gua do mar. Formam-se junto desembocadura de rios e em litorais protegidos da
ao direta do mar, tais como baas de guas paradas ou litorais guarnecidos por diques de areia.

Mar enchente

Mar vazante

Baseado no texto e em seus conhecimentos, assinale, nas alternativas abaixo, aquela que indica a
importncia dos manguezais.
(a) So regies altamente produtivas e economicamente importantes para as populaes caiaras
que vivem em suas proximidades.
(b) A baixa disponibilidade de nutrientes minerais e de matria orgnica faz do mangue uma fonte
de alimento para diversas espcies marinhas.
(c) Grande quantidade de mamferos terrestres utiliza-se dos manguezais com a finalidade de
obteno de alimentos e proteo contra variaes climticas.
(d) So extremamente importantes para animais marinhos que a obtm alimentos e condies de
reproduo, tais como: lulas, siris, tubares e camares.
(e) So longas extenses inundveis que funcionam como verdadeiro mata-borro, absorvendo
gua quando das enchentes e retendo gua quando das secas.
(f) I.R.
A
Descobertas recentes de pesquisadores israelenses mostram que a figueira foi a primeira planta a ser
cultivada pelo homem, h mais de 11 mil anos. Nas florestas tropicais, ela se destaca pelo
importante papel ecolgico que desempenha, alimentando grande nmero de aves, morcegos e
macacos, entre outros animais. Alm disso, a forma como se reproduz considerada excepcional
entre as plantas. A polinizao feita exclusivamente por diminutas vespas-de-figo, pertencentes
famlia Agaonidae, que em geral tm menos de 2 mm. Os ovos dessas vespas s se desenvolvem
dentro do figo.
Cincia Hoje, vol. 42, n 249 - junho 2008.[Adapt.]

01 - Com base no texto e em seus conhecimentos, correto afirmar que a figueira e a vespa-do-figo
estabelecem uma relao
(a) intra-especfica harmnica, do tipo sociedade, em que os participantes se mantm
anatomicamente separados.
(b) intra-especfica harmnica, do tipo comensalismo, em que um componente obtm proteo ao se
associar a outro, sem lhe causar prejuzo.
(c) interespecfica harmnica, do tipo inquilinismo, em que apenas um participante se beneficia,
sem causar prejuzo ao outro.
(d) interespecfica harmnica, do tipo mutualismo, em que os participantes se beneficiam e mantm
uma relao de dependncia.
(e) interespecfica harmnica do tipo parasitismo, em que um componente vive no organismo de
outro, de outra espcie, para dele se alimentar.
(f) I.R.

02 - O figo - onde se desenvolvem as larvas da vespa-do-figo - pode ser classificado como um


(a) fruto simples, desenvolvido a partir do receptculo de uma flor com muitos ovrios.
(b) pseudofruto mltiplo, proveniente do desenvolvimento dos ovrios de muitas flores de uma
inflorescncia, que crescem juntos em uma nica estrutura.
(c) fruto agregado ou composto, desenvolvido a partir do pednculo ou do receptculo de uma s
flor.
(d) pseudofruto carnoso do tipo baga, com vrias sementes facilmente separveis dele.
(e) pseudofruto deiscente, apresentando a caracterstica de abrir-se naturalmente quando atinge a
maturidade.
(f) I.R.
B/D
As fibras musculares so responsveis pelos movimentos, e podem ser divididas em duas categorias
principais: as fibras de contrao rpida (fibras brancas) e as de contrao lenta (fibras vermelhas).
Os msculos esquelticos apresentam os dois tipos de fibras em propores diferentes. Hoje so
bem conhecidos os fatores biolgicos que controlam a proporo dos dois tipos de fibras nos
msculos.
J possvel criar, em laboratrio, camundongos com alteraes genticas (doping gentico), que
tm maior proporo de um tipo de fibra muscular.
Cincia Hoje, vol. 42, n 251, Agosto de 2008 [adapt.].
Analise as afirmativas:
I. A colorao avermelhada da fibra vermelha dada pela presena de mioglobina e mitocndrias,
que so importantes para a produo de ATP. Um exemplo de msculo onde esse tipo de fibra
predomina so os msculos peitorais de aves migratrias.
II. O uso de anabolizante considerado doping qumico. Ele faz aumentar a massa muscular, devido
transformao do tecido adiposo em tecido muscular.
III. Para corredores de maratona (longa distncia) vantajoso ter mais fibras brancas, enquanto que
para corredores de 100m (curta distncia) mais vantajoso ter msculos ricos em fibras vermelhas.
IV. Tanto as fibras vermelhas quanto as brancas so clulas musculares estriadas esquelticas. Elas
apresentam vrios ncleos perifricos e citoplasma rico em actina e miosina, que atuam no processo
de contrao.

Esto corretas as afirmativas


(a) I e IV.
(b) I e III.
(c) II e IV.
(d) II e III.
(e) I, II, III e IV.
(f) I.R.
A
O que surgiu antes: o ovo ou a galinha? Este um problema retrico que parece insolvel apenas se
desconsiderarmos a evoluo dos organismos como descritos por Charles Darwin h quase 150
anos. Antes que as galinhas surgissem, outros animais j se reproduziam por meio de ovos. Assim, o
ovo, como estrutura reprodutiva, surgiu antes da galinha. Porm, continuamos tendendo a pensar
que a oviparidade seja rara, mas na verdade a viviparidade que a exceo entre os animais.
Cincia Hoje, vol. 42, n 250, Julho de 2008 [adapt.].
Com base no texto e em seus conhecimentos, correto afirmar que:
(a) as espcies vivparas no formam ovos envoltos por cpsulas e os embries desenvolvem-se
dentro da me. Os animais vivparos tm placenta, exceto os cangurus e demais marsupiais cujos
filhotes completam a maior parte do desenvolvimento fora do tero.
(b) o ovo das espcies ovovivparas pode variar muito de tamanho entre os animais, mas uma
clula relativamente grande do organismo ao qual pertence, por causa do volume do seu ncleo.
(c) espcies ovparas pem ovos protegidos por cpsulas e o embrio desenvolve-se no interior do
ovo, enquanto que as espcies ovovivparas retm os ovos at a ecloso. Os tubares apresentam
tanto espcies ovparas quanto ovovivparas.
(d) a gema, considerando o ovo da galinha, a clula-ovo (ovcito) que poder ser fertilizada. A
clara a principal reserva nutritiva, que servir para o desenvolvimento do ovo at a formao do
pinto.
(e) o surgimento dos ovos com casca permitiu que o ancestral dos vertebrados terrestres sasse da
gua e garantiu aos anfbios sucesso na colonizao do ambiente terrestre.
(f) I.R.
C
J se desconfiava que a doena de Alzheimer pudesse ser uma nova forma de diabetes melito.
Agora, tudo indica, veio a comprovao. Segundo recente (e promissora) linha de pesquisa, a perda
de memria, que o principal sintoma desta doena, pode ser causada por mecanismos que
envolvem problemas na recepo de insulina pelas clulas nervosas, semelhante ao que ocorre em
um tipo de diabetes melito.
Cincia Hoje, vol. 41 - n 243 [adapt.]
Com base no texto e em seus conhecimentos sobre a diabetes melito, assinale a alternativa correta.
(a) Problemas na recepo de insulina pelas clulas nervosas uma das caractersticas da diabetes
tipo I, em que a produo normal de insulina pelas clulas alfa do pncreas no afetada.
(b) Ao afirmar que os receptores de insulina - hormnio produzido pelas clulas beta do pncreas -
tm dificuldade de capt-la, para forar sua sada das clulas, os pesquisadores esto se referindo
diabetes tipo I.
(c) A insulina - hormnio produzido pelas clulas alfa do pncreas - sofre uma reduo drstica na
sua produo, nos indivduos portadores de diabetes melito tipo II.
(d) A causa da captao exagerada de glicose pelas clulas, caracterstica da diabetes melito tipo II,
pode ser o aumento acentuado da funo de seus receptores.
(e) Na diabetes melito tipo II, apesar da produo de insulina pelas clulas beta do pncreas, o
organismo no consegue responder a ela, devido a alteraes nos seus receptores especficos.
(f) I.R.
E
Para quem sofre de insuficincia renal aguda, a hemodilise um tratamento espordico, mas para
os pacientes crnicos, nem mesmo o transplante elimina por completo a necessidade das sesses de
dilise, ainda que possam se tornar menos freqentes. Em mdia, a doena se desencadeia entre os
40 e 59 anos de idade, mas cada vez maior o nmero de jovens e de idosos nas salas de nefrologia,
submetidos a esse tratamento. A necessidade disso reside na importncia dos rins para o
funcionamento adequado do organismo.
Dirio Popular, 15 de outubro de 2008 [adapt.].
Com base no texto e em seus conhecimento, correto afirmar que os rins exercem no organismo,
entre outras aes,
(a) a regulao da presso arterial - atravs da secreo do hormnio antidiurtico -, a manuteno
do equilbrio entre os eletrlitos e a eliminao de substncias teis em excesso no sangue.
(b) a excreo de produtos nitrogenados e a secreo dos hormnios renina e peptdeo natriurtico
atrial, responsveis pela excreo de sdio e diminuio da presso arterial.
(c) a regulao do diabetes melito - impedindo a excreo de glicose na urina -, a reabsoro de
produtos nitrogenados e a regulao da presso arterial.
(d) a reabsoro de substncias teis, a regulao do volume de lquidos, a regulao da secreo de
potssio - fundamental para manter a ATPase Na+/K+ (ou bomba de Na+/K+) da membrana
plasmtica.
(e) a regulao da secreo de potssio, que, junto ao sdio, atua no funcionamento da ATPase
Na+/K+ da membrana plasmtica e a filtrao do sangue que penetra atravs de sua ramificao
venosa.
(f) I.R.
D
De acordo com a primeira lei de Mendel confira as afirmaes abaixo e marque a que apresentar
informaes incorretas.

a) Em cada espcie de ser vivo o nmero de cromossomos constante, e isso ocorre porque na
formao dos gametas esse nmero reduzido metade e depois, na fecundao, restabelece-se o
nmero inicial.

b) Cada carter determinado por um par de fatores que se separam na formao dos gametas, indo
um fator do par para cada gameta, que , portanto, puro.

c) Quando os alelos de um par so iguais, fala-se em condio heterozigtica (para a qual Mendel
usava o termo puro), e quando os alelos so diferentes, fala-se em condio homozigtica (para a
qual Mendel usava o termo hibrido).

d) Um mesmo carter pode apresentar duas ou mais variveis, e a varivel de cada carter
denominada fentipo.

e) O termo gentipo pode ser aplicado tanto ao conjunto total de genes de um indivduo como a
cada gene em particular.
RESPOSTA: c
Quando os alelos de um par so iguais, fala-se em condio homozigtica(para a qual Mendel usava
o termo puro), e quando os alelos so diferentes, fala-se em condio heterozigtica (para a qual
Mendel usava o termo hbrido).
O meio ambiente pode influenciar o funcionamento do nosso organismo de vrias formas, desde a
alterao de funes fisiolgicas, das quais geralmente no nos damos conta, at alteraes na nossa
percepo sensorial e estado de nimo. Por exemplo, nas grandes festas musicais que se estendem
madrugada adentro, conhecidas como raves, o consumo de lcool e bebidas estimulantes, como
os energticos, chega a nveis alarmantes. No contexto da ideia de diverso, a mistura destas duas
substncias pode trazer consequncias devastadoras para o organismo humano. A pessoa que
consome o energtico junto com o lcool reduz o efeito deste, uma vez que o estimulante diminui o
efeito depressor do lcool sobre o sistema nervoso. Esta ao dos energticos reduz a percepo da
embriaguez, e leva as pessoas a ingerir mais lcool, as quais no se do conta dos riscos envolvidos.
Uma superdosagem desta substncia aumenta a frequncia cardiorrespiratria e pode provocar
irritao estomacal e intestinal. O que a princpio euforia e excitao, pode transformar-se em
tontura e desmaio.
Sobre o assunto do texto acima, pode-se afirmar CORRETAMENTE que:
01. o sistema nervoso responde pela coordenao e controle do funcionamento do organismo,
independentemente da ao do sistema endcrino.
02. o efeito estimulante das bebidas energticas consequncia da liberao de
neurotransmissores, como a dopamina, que provocam sensao de prazer.
04. glicdios ou carboidratos so fontes de energia para o nosso organismo.
08. em nvel celular, a organela citoplasmtica responsvel pela produo de energia o lisossomo.
16. a longo prazo, o consumo de lcool em grandes quantidades no provoca alteraes
cardiovasculares, nem prejuzo nas funes hepticas.
32. o controle da frequncia cardiorrespiratria uma das funes que podem ser atribudas ao
sistema nervoso autnomo.
64. a interao entre o consumo excessivo de lcool e bebida energtica no traz danos fisiolgicos
ao organismo.
38
Sobre o
assunto do texto, assinale a(s) proposio(es) CORRETA(S).

01. A energia necessria para o movimento descrito gerada pela musculatura do tipo lisa, j que o
movimento lento e contnuo.
02. A fonte primria de energia dos msculos provm da molcula de adenosina trifosfato (ATP),
presente nas clulas.
04. A cigarra mencionada no texto (Philaenus spumarius) um artrpode, pertencente ao grupo dos
aracndeos.
08. Os mecanismos de produo de energia na clula envolvem a participao direta de organelas
celulares, como os lisossomos.
16. O exemplo de movimento citado no texto (salto) incomum e pode parecer desnecessrio entre
os insetos, j que todos possuem asas e podem voar.
32. Em geral uma contrao muscular resultado da interao entre filamentos contrteis que
deslizam em direes contrrias.
34
A figura abaixo representa uma das hipteses para explicar a filogenia animal.

Aps analisar o grfico, assinale a(s) proposio(es) CORRETA(S) quanto evoluo dos
animais.
01. Todos os animais representados possuem ancestralidade comum.
02. A caracterstica mais importante usada para separar os animais em filos distintos a sua
distribuio no ambiente.
04. Os equinodermos so representados na figura acima por animais como minhocas, caramujos e
vermes cilndricos.
08. Peixes, anfbios e cobras so animais cordados.
16. Os rpteis no aparecem representados nesta figura.
32. Os cnidrios, representados pelas esponjas do mar, so animais muito simples e no apresentam
tecidos verdadeiros.
64. Os animais se caracterizam por serem pluricelulares, eucariontes e hetertrofos.
73
Sobre esse
assunto, CORRETO afirmar que:

01. a incompatibilidade entre grupos sanguneos deve-se a uma reao imunolgica entre protenas
dissolvidas no plasma sanguneo e molculas presentes na membrana das hemcias.
02. ao obter enzimas capazes de suprimir a reao imune, os cientistas podem alterar a herana
gentica das pessoas quanto ao tipo sanguneo.
04. a herana dos grupos sanguneos do sistema ABO determinada por um gene com alelos
mltiplos (polialelia).
08. o sangue das pessoas que apresentam o tipo O recebe essa denominao pois no apresenta o
antgeno A ou B (aglutinognio A ou aglutinognio B) nem as aglutininas anti-A ou anti-B.
16. existe um pequeno nmero de pessoas na populao mundial que pode ser erroneamente
classificado como pertencente ao grupo sanguneo O (falso O), embora no possuam gentipo
correspondente a esse grupo (fentipo Bombaim).
32. para cada fentipo sanguneo existente no sistema ABO s existe um gentipo possvel que o
determine.
21
Aps ler o
excerto acima, analise e assinale a(s) proposio(es) CORRETA(S).

01. O leite materno, tratado na obra Iracema como licor da vida, considerado um alimento
completo para o recm-nascido, contendo gua, sais minerais e at anticorpos fundamentais para
sua sade.

02. As glndulas sudorparas, que produzem o suor, so um exemplo de glndula endcrina.

04. Quando o autor diz que o sangue dilua-se todo nas lgrimas e no chegava aos seios, est
afirmando que o funcionamento da glndula mamria no tem relao com a circulao sangunea.

08. A oxitocina o hormnio que, alm de estimular os movimentos de contrao uterina no parto,
estimula a contrao da musculatura lisa das glndulas mamrias na expulso do leite materno.

16. A produo do leite materno no tem relao direta com o ato de suco do seio materno pelo
recm-nascido.

32. As lgrimas e o leite produzidos pela me so exemplos de secrees produzidas pelas glndulas
excrinas.
41
O uso domstico dos recursos hdricos tem preocupado as autoridades ambientais de todo o mundo,
tanto no que diz respeito ao desperdcio de gua quanto sua conservao.
Um estudo publicado recentemente na Revista Biotemas (www.biotemas.ufsc.br) d conta de que
possvel criar peixes (tilpias) em lagoas de estabilizao de efluentes domsticos tratados. Segundo
o artigo: O sistema de criao de peixes melhorou a qualidade do efluente gerado, reduzindo as
concentraes de nitrognio orgnico total e diminuindo os slidos suspensos. As anlises de
coliformes fecais, Salmonella sp. e Staphylococcus aureus dos efluentes e da carne dos peixes
produzidos ficaram dentro dos padres exigidos pela OMS (Organizao Mundial de Sade).
A respeito do assunto, assinale a(s) proposio(es) CORRETA(S).
01. Quando uma quantidade excessiva de matria orgnica lanada nos rios e lagos pode haver um
fenmeno biolgico conhecido como eutrofizao.
02. O nitrognio, sob qualquer forma que se apresente na natureza, no participa da composio
qumica dos seres vivos.
04. A anlise quanto variao e quantificao de coliformes fecais um importante indicador do
grau de poluio da gua por esgotos domsticos.
08. Salmonelas e estafilococos presentes nas guas so bactrias muito comuns, responsveis pelo
fenmeno biolgico conhecido como mar vermelha.
16. Existem bactrias capazes de fixar o nitrognio atmosfrico e transferi-lo para o solo e para
algumas plantas, como o feijo e a soja.
32. A gua tratada dos efluentes domsticos das lagoas de estabilizao citadas no texto acima, por
ser txica no pode ser usada para nenhuma finalidade humana.
21
Seu Jos da Silva, um pequeno criador de porcos do Oeste do Estado de Santa Catarina, desejando
melhorar a qualidade de sua criao, comprou um porco de raa diferente daquela que ele criava.
Preocupado com as consequncias de criar este animal junto com os outros porcos, ele discute com
seu um vizinho sobre o assunto.
Parte de seu dilogo transcrito abaixo:
SR. JOS - O porco que comprei e apelidei de Napoleo maior, mais forte e possui peso acima da
mdia da raa que crio. Alm disso, possui manchas marrons pelo corpo todo. Gostaria que boa
parte de minha criao tivesse estas caractersticas.
VIZINHO - Seu Jos, isto vai ser muito difcil de conseguir; melhor o senhor comprar outros porcos
com esse jeito.
Com base nos conhecimentos de gentica, assinale a(s) proposio(es) CORRETA(S) sobre o
assunto.
01. As preocupaes do Sr. Jos no se justificam, pois animais com fentipos distintos apresentam,
obrigatoriamente, gentipos distintos para as mesmas caractersticas.
02. O vizinho do Sr. Jos tem razo, pois no se pode obter mistura de caractersticas cruzando
animais de raas diferentes na mesma espcie.
04. Atualmente no se pode criar e cruzar porcos de raas diferentes, pois impossvel controlar a
seleo das caractersticas geneticamente desejadas.
08. As manchas na pele do porco Napoleo so uma caracterstica determinada geneticamente; j o
peso e o tamanho resultam somente da oferta de boa alimentao.
16. Quando duas raas distintas entram em contato e seus membros passam a cruzar-se livremente,
as diferenas raciais tendem a desaparecer nos descendentes devido mistura de genes.
32. O melhoramento gentico em animais que apresentam caractersticas de valor comercial
necessariamente prejudicial ao ser humano, j que no ocorre naturalmente.
64. Muitas caractersticas animais, como a fertilidade, a produo de carne e a resistncia a doenas,
so condicionadas por genes e dependem muito das condies nas quais os animais so criados.
80
A figura abaixo representa, ao centro, o esquema de uma estrutura vegetal chamada estmato.

A respeito da estrutura acima e de seu papel fisiolgico, assinale a(s) proposio(es)


CORRETA(S).
01. O funcionamento dos estmatos est associado aos mecanismos de transporte de seiva no
vegetal.
02. A seta II da figura indica a presena de cloroplastos nas clulas estomticas.
04. Os estmatos so estruturas encontradas em vrias partes do vegetal, especialmente no caule.
08. A seta III indica as clulas-acessrias ou subsidirias; atravs delas ocorre a eliminao da gua
por transpirao para o exterior do vegetal.
16. Os estmatos so estruturas muito versteis, participando inclusive dos mecanismos de defesa
vegetal, pois podem produzir e eliminar substncias txicas.
32. A seta I indica a abertura estomtica que ocorre entre as clulas-guarda e por onde se realizam
as trocas gasosas nos vegetais.
64. O funcionamento do estmato controlado por fatores intracelulares, sendo independente de
fatores externos como a luminosidade e a umidade.
35
Sobre as formaes fitogeogrficas ou Biomas existentes no Brasil, assinale a(s) proposio(es)
CORRETA(S).
01. O Cerrado uma formao fitogeogrfica caracterizada por uma floresta tropical que cobre
cerca de 40% do territrio brasileiro, ocorrendo na Regio Norte.
02. O Mangue ocorre desde o Amap at Santa Catarina e desenvolve-se em esturios, sendo
utilizados por vrios animais marinhos para reproduo.
04. A Caatinga caracterizada por ser uma floresta mida da regio litornea do Brasil, hoje muito
devastada.
08. O Pampa ocorre na Regio Centro-Oeste onde o clima quente e seco. A flora e a fauna dessa
regio so extremamente diversificadas.
16. A Floresta Amaznica est localizada nos estados do Maranho e do Piau e as rvores tpicas
dessa formao so as palmeiras e os pinheiros.
32. O Pantanal ocorre nos estados do Mato Grosso do Sul e do Mato Grosso, caracterizando-se
como uma regio plana que alagada nos meses de cheias dos rios.
64. A Mata Atlntica uma formao que se estende de So Paulo ao Sul do pas, onde predominam
rvores como o babau e a carnaba, e est muito bem preservada.
34
Em 2009 comemora-se 200 anos do nascimento de Charles Darwin e 150 anos da publicao do
livro A Origem das Espcies, obra que coroou um extenso trabalho de Darwin e foi um marco no
estudo da Biologia.
Sobre evoluo, assinale a(s) proposio(es) CORRETA(S).
01. O francs Jean Baptiste Lamarck contribuiu de maneira significativa com o trabalho de Darwin,
pois ele j defendia a ideia de que a modificao das espcies era devido seleo natural.
02. Uma das bases da teoria de Darwin foi a Lei da Herana dos Caracteres Adquiridos, que,
embora com mais de 200 anos, se mantm atual at os dias de hoje.
04. Segundo a hiptese da seleo natural, grandes modificaes nos indivduos so transmitidas de
pai para filho.
08. No livro A Origem das Espcies, Darwin formulou a hiptese de que o ambiente selecionava os
mais aptos (seleo natural), que tinham mais chances de sobreviver e deixar descendentes.
16. Os fsseis, a semelhana embriolgica entre as espcies e a existncia de estruturas vestigiais
desprovidas de funo nos animais so evidncias da evoluo.
32. Segundo Darwin, o aparecimento de novas mutaes influenciado pelo meio ambiente.
24
Um extraterrestre que resolvesse estudar a composio qumica das formas de vida em nosso
planeta poderia concluir, de maneira correta, que ela baseada em compostos de carbono, gua e
sais minerais.
Assinale a(s) proposio(es) CORRETA(S). 01. Nos seres vivos as substncias mais abundantes
so: gua (70% a 85%), lipdios (10% a 15%), glicdios (7% a 10%) e protenas (2% a 3%).
02. Os ons clcio desempenham importante funo nos processos da contrao muscular e da
coagulao do sangue.
04. Os compostos proteicos miosina e hemoglobina tm como principal elemento na sua
composio os ons magnsio.
08. Os glicdios desempenham papel importante na estrutura dos cidos nucleicos, os quais so
importantes na transmisso das caractersticas dos seres vivos.
16. Os fosfolipdios, uma classe especial de lipdios, so essenciais na formao das membranas
celulares.
32. Todos os aminocidos, essenciais e no essenciais, utilizados por nossas clulas na formao das
protenas, so necessariamente obtidos atravs da alimentao.
26
Dentre os vrios mecanismos de transporte em nvel de membrana celular, podemos citar a osmose.
De maneira simplificada, a figura abaixo esquematiza as condies para a ocorrncia da osmose.

Com relao ao processo osmtico, assinale a(s) proposio(es) CORRETA(S). 01. Haver
passagem de gua do lado A para o lado B.
02. Na natureza o meio hipertnico ceder molculas de soluto para o meio hipotnico at que se
estabelea um equilbrio.
04. Se A fosse o meio intracelular de uma clula humana e B gua pura, com certeza esta clula iria
estourar.
08. Se A fosse o meio intracelular de uma clula vegetal e B gua pura, a parede celulsica
impediria que sua membrana celular se rompesse.
16. A presso osmtica gerada pela passagem do solvente do lado B para o lado A.
32. As clulas de nosso corpo encontram-se banhadas por uma soluo isotnica; desta forma, a
passagem da gua do meio extracelular para o intracelular ocorre por osmose.
28
Assinale a(s) proposio(es) CORRETA(S). O ciclo celular dividido em duas etapas: Diviso
Celular e Interfase. Nesta ltima etapa (Interfase), subdividida em G1 - S - G2, a clula realiza seu
metabolismo e se prepara, quando necessrio, para a etapa da diviso celular.
01. O tempo que as clulas permanecem na etapa chamada de Interfase o mesmo entre os
diferentes tipos celulares.
02. No perodo do desenvolvimento embrionrio, o ciclo celular compreende etapas de Interfases
longas e etapas de divises celulares rpidas.
04. Na fase S da Interfase ocorre o processo de duplicao do DNA.
08. Durante a Interfase o DNA est em plena atividade, formando o RNA com as informaes para
a sntese proteica.
16. Em G2 a quantidade de DNA a mesma que em G1.
32. A frequncia com que as clulas entram em diviso celular varia com o tipo e o estado
fisiolgico de cada uma delas.
64. Na etapa chamada de diviso celular, pode ocorrer tanto a mitose como a meiose, em qualquer
clula do corpo humano.
44
As figuras abaixo mostram procedimentos cirrgicos no aparelho reprodutor masculino e feminino
denominados de vasectomia (Figura 1) e ligao tubria (Figura 2).

AMABIS e MARTHO. Biologia das clulas. 2. ed. So Paulo: Moderna, 2004. p. 369.

Assinale a(s) proposio(es) CORRETA(S).


01. Um homem que se submete vasectomia (mostrada na Figura 1) tem preservada a capacidade
de ejacular normalmente.
02. Uma mulher submetida ao procedimento de ligao tubria (mostrada na Figura 2) mantm a
produo de vulos (ovcitos secundrios), mas estes no podem ser alcanados pelos
espermatozoides.
04. Os ovrios continuaro produzindo os hormnios FSH (hormnio estimulante do folculo), LH
(hormnio luteinizante), estrognio e progesterona mesmo depois da cirurgia.
08. O homem vasectomizado mantm a produo normal do hormnio testosterona, uma vez que
este lanado diretamente na corrente sangunea.
16. Ambos os procedimentos cirrgicos so considerados mtodos anticonceptivos e so eficientes
na preveno de doenas sexualmente transmissveis.
32. Como um homem vasectomizado no mais elimina espermatozoides, no pode mais transmitir o
vrus da AIDS para seus parceiros sexuais.
64. No caso da mulher submetida ao procedimento de ligao tubria (mostrada na Figura 2), com o
passar dos anos, os vulos (ovcitos secundrios) acharo um novo caminho at o tero, por isso
este procedimento cirrgico deve ser sempre repetido a cada dez anos.
11
O esquema abaixo mostra de maneira simplificada o ciclo do nitrognio na natureza. As letras A, B,
C, D e E indicam processos metablicos que ocorrem neste ciclo.

Sobre este ciclo, CORRETO afirmar que:


01. o processo mostrado em A realizado somente por bactrias simbiontes que vivem no interior
das razes de leguminosas.
02. as mesmas bactrias que realizam o processo A, realizam os processos D e E.
04. o esquema mostra que produtos nitrogenados originados de animais ou vegetais podem ser
reaproveitados no ciclo.
08. o processo mostrado em D constitui uma etapa fundamental no ciclo, chamada de fixao do
nitrognio.
16. as plantas podem se utilizar diretamente da amnia e no dependem do processo que ocorre em
C para obter os produtos nitrogenados.
32. o processo mostrado em E indica que os animais excretam a amnia.
64. o nitrognio importante para os seres vivos, pois entra na composio molecular dos
aminocidos e dos cidos nucleicos.
68
As figuras abaixo mostram o verso das cdulas de real atualmente em circulao:

Sobre a imagem de animais representados nas cdulas, assinale a(s) proposio(es) CORRETA(S).
01. As cdulas possuem imagens de duas classes de animais.
02. Todos os animais representados nas cdulas pertencem ao filo dos Cordados.
04. O animal representado na cdula de R$ 100,00 da mesma classe dos golfinhos.
08. Os animais representados nas cdulas de R$ 1,00, R$ 5,00 e R$ 10,00 possuem caractersticas
comuns, como a respirao atravs de brnquias.
16. O animal representado na cdula de R$ 2,00 pertence classe dos rpteis.
32. Os mamferos so representados nas cdulas de R$ 10,00, R$ 20,00 e R$ 50,00.
64. Em termos evolutivos a classe representada pelo animal na cdula de R$ 100,00 a mais antiga
de todas as apresentadas nas notas.
82
A cobertura vegetal original do estado de Santa Catarina compreende dois tipos de formao:
florestas e campos. As florestas, que ocupavam 65% do territrio catarinense, foram bastante
reduzidas por efeito de devastao. As florestas nas reas do planalto serrano apresentam-se sob a
forma de florestas mistas de conferas (araucrias) e latifoliadas e, na baixada e encostas da Serra do
Mar, apenas como floresta latifoliada. Os campos ocorrem como manchas dispersas no interior da
floresta mista. Os mais importantes so os de So Joaquim, Lages, Curitibanos e Campos Novos.
Texto adaptado de: ATLAS ESCOLAR DE SANTA CATARINA. Secretaria de Estado de
Coordenao Geral e Planejamento. Subsecretaria de Estudos Geogrficos e Estatsticos. Rio de
Janeiro: Aerofoto Cruzeiro, 1991. p. 26. Imagem disponvel em: <http://www.plantasonya.com.br/dicas-e-
curiosidades/gimnospermas.html> Acesso em: 14 set. 2010.

A foto mostra e o texto cita as conferas (araucrias), uma representante do grupo das
gimnospermas. Sobre este grupo, CORRETO afirmar que:
01. o grupo das gimnospermas evolutivamente mais recente do que o grupo das angiospermas.
02. ao longo do processo evolutivo das plantas, as gimnospermas apresentaram uma novidade
evolutiva em relao s pteridfitas: a presena de sementes.
04. outra novidade importante apresentada pelas gimnospermas em relao ao grupo das
pteridfitas ocorre no processo da fecundao. Este, nas gimnospermas, independente da presena
de gua no estado lquido.
08. as araucrias so plantas monoicas, isto , plantas que possuem em um mesmo indivduo flores
masculinas e femininas.
16. o processo de polinizao das gimnospermas dependente de insetos e pssaros, os quais so
atrados pelos nectrios na base de suas flores.
32. as conferas so vegetais que no atingem grandes alturas (com altura mdia de 10 metros), com
exceo das araucrias.
06
Leia atentamente o trecho da obra de Joo Cabral de Melo Neto.

Este trecho faz a previso da vida futura de um menino que aprender a engatinhar e caminhar com
aratus e goiamuns. Estes dois animais, assim como outras espcies de caranguejos, so
representantes dos crustceos. Assinale a(s) proposio(es) CORRETA(S).
01. Os crustceos pertencem a um filo que tem como principais caractersticas os apndices
articulados e a presena de um exoesqueleto.
02. Entre os crustceos, o nmero de patas e apndices articulados varivel entre as diferentes
espcies.
04. No hbitat relacionado ao texto acima encontramos aratus e goiamuns, e tambm plantas com
razes respiratrias.
08. Os crustceos so animais que vivem exclusivamente em ambientes aquticos, sejam marinhos
ou de gua doce.
16. O exoesqueleto de alguns crustceos pode ser impregnado de substncias calcrias.
32. O berrio dos goiamuns e aratus rico em nutrientes trazidos pelos rios.
64. Quando o autor fala dos anfbios caranguejos quer dizer que anfbios e caranguejos tm
respirao branquial na fase larval da vida e pulmonar quando adultos.
53
A figura abaixo mostra o aparelho digestrio humano.

SOARES, J. Lus. Biologia no terceiro milnio. So Paulo: Scipione, 1999. 2 v. (Adaptado)

Com respeito a este aparelho, assinale a(s) proposio(es) CORRETA(S).


01. A estrutura A indica uma regio comum aos aparelhos digestrio e respiratrio.
02. Os alimentos e os lquidos que entram pela boca so levados ao estmago pela estrutura B pela
ao da gravidade.
04. Na cavidade bucal ocorre a ao de enzimas (exemplo: ptialina) sobre o amido, transformando-o
em maltose e dextrinas.
08. O rgo indicado em D produz algumas substncias que so lanadas diretamente no duodeno e
outras que so lanadas diretamente na corrente sangunea.
16. Indivduos com a doena conhecida como amarelo ou ancilostomase tm em C o local tpico
da fixao do parasita Ancylostoma braziliensis.
32. Nas paredes do intestino delgado temos a presena das vilosidades e, nestas, as clulas epiteliais
se apresentam com microvilosidades para aumentar a rea de absoro.
64. Quando existe excesso da glicose no sangue ela convertida em amido no local indicado por D.
45
O heredograma abaixo mostra uma famlia onde encontramos indivduos no afetados (quadrados e
crculos brancos) e afetados por uma anomalia (quadrados e crculos pretos).

Segundo a 1a e a 2a lei de Mendel, a anlise deste heredograma nos permite concluir


CORRETAMENTE que:
01. o padro de herana da anomalia autossmico dominante.
02. o indivduo III - 4 com certeza heterozigoto.
04. a chance do indivduo II - 3 ser heterozigoto de 50%. 08. os indivduos do casal II - 1 e II - 2
so heterozigotos.
16. trata-se de uma herana, ligada ao sexo, de padro recessivo.
32. a possibilidade do casal II - 3 e II - 4 ter outra filha afetada pela anomalia de 25%.
64. a chance do casal III - 4 e III - 5 ter outro filho do mesmo sexo que IV - 1 no entanto afetado
de 16,6%.
72
A adaptao de estruturas ou sistemas de revestimento interno ou externo dos seres vivos est
relacionada com o ambiente em que vivem. Sobre tais estruturas ou sistemas, assinale a(s)
proposio(es) CORRETA(S).
01. As minhocas utilizam seu revestimento externo como auxiliar na respirao.
02. No revestimento externo de muitas folhas a epiderme produz cutina, formando uma pelcula
altamente permevel sada de gua por toda a superfcie foliar.
04. Os artrpodes, em geral, possuem um sistema de revestimento externo do corpo extremamente
rgido e totalmente permevel gua.
08. Nos seres humanos, o revestimento interno do estmago apresenta pequenas dobras,
denominadas microvilosidades, que aumentam a capacidade de absoro de nutrientes.
16. Alguns vermes parasitas intestinais apresentam seu corpo revestido por uma cutcula resistente
que os protege da ao de cidos estomacais.
32. Externamente, o caule de plantas arbreas possui camadas de clulas mortas suberificadas com
capacidade de fotossntese.
64. A extremidade da raiz de uma planta coberta por um capuz chamado coifa, formado por
clulas parenquimticas que protegem o meristema apical.
81
As migraes sazonais so um fenmeno intrigante para os zologos que estudam o comportamento
animal. Tais hbitos so observados em muitas espcies de aves, peixes e mamferos. Sobre este
comportamento e suas caractersticas, assinale a(s) proposio(es) CORRETA(S).
01. A piracema um fenmeno que ocorre no pantanal matogrossense e se caracteriza pela
migrao de peixes na estao das cheias dos rios.
02. O plncton marinho constitudo por seres que nadam ativamente e migram das guas frias em
busca de guas mais quentes e calmas.
04. Segundo a Teoria Moderna da Evoluo ou Teoria Sinttica, a migrao um dos fatores que
podem afetar a composio gnica de uma populao.
08. Atualmente sabe-se que as migraes ocorrem naturalmente e no esto relacionadas s
mudanas climticas no planeta ou escassez de alimento em uma determinada rea.
16. Animais que migram em bando, como as aves, ou em cardumes, como os peixes, no utilizam
mecanismos sofisticados de orientao geoespacial.
32. As baleias que migram para o litoral de Santa Catarina vm em busca de guas mais frias e
repletas de alimento.
05
Utilizando-se Microscopia Eletrnica de Transmisso foram obtidas as imagens abaixo. Na Figura
A, observa-se um plasmcito obtido da medula ssea de cobaia (aumento de 25.000 X). Na Figura
B, observa-se uma clula pancretica de um morcego (aumento de 95.000 X).

Com relao s estruturas apontadas pelas setas, assinale a(s) proposio(es) CORRETA(S).
01. A estrutura indicada pelo nmero 2 a menos condensada do ncleo e corresponde ao
nucleoplasma.
02. A estrutura indicada pelo nmero 3 o retculo endoplasmtico liso.
04. A estrutura indicada pelo nmero 1 corresponde aos lisossomos responsveis pela digesto
celular.
08. Nas regies escuras no ncleo, indicada pelo nmero 2, encontra-se a maior concentrao de
DNA.
16. A estrutura indicada pelo nmero 4 corresponde a um cloroplasto, pois se visualiza nitidamente
a estrutura lamelar do granum.
32. As organelas presentes nas Figuras A e B no apresentam membranas de separao com o
citoplasma.
64. Dentro da estrutura indicada pelo nmero 4 ocorrem etapas da cadeia respiratria e do ciclo de
Krebs.
72
A figura abaixo representa parte do grfico que mostra os efeitos do hormnio vegetal denominado
AUXINA sobre a raiz e o caule de uma planta.

Com base no grfico acima, assinale a(s) proposio(es) CORRETA(S).


01. Concentraes de auxinas inferiores a 1/10 mol/l inibem tanto o crescimento do caule como o
da raiz.
02. As auxinas nas concentraes entre 1/1.000 e 1/10.000 mol/l tm efeito estimulante no
crescimento do caule e da raiz.
04. Concentraes superiores a 1/1.000.000 mol/l tm o efeito de estimular o crescimento da raiz.
08. O mximo efeito de estmulo de crescimento do caule e da raiz obtido com a mesma
concentrao do hormnio.
16. O estmulo mximo de crescimento do caule ocorre em concentraes que inibem o crescimento
da raiz.
32. A raiz muito mais sensvel do que o caule s baixas concentraes do hormnio auxina, tanto
no estmulo quanto na inibio de seu crescimento.
64. Pode-se concluir que concentraes menores de auxina estimulam mais o crescimento do caule
do que o da raiz.
48
A figura abaixo representa um corte longitudinal do olho humano.

Sobre as estruturas assinaladas acima e sua funo, assinale a(s) proposio(es) CORRETA(S).
01. A imagem de um objeto se forma por completo na estrutura III.
02. Em III temos a camada pigmentada do olho.
04. A estrutura I corresponde a uma lente chamada cristalino.
08. A abertura indicada em II a crnea e pode ser transplantada entre seres humanos.
16. A estrutura IV composta por clulas fotossensveis, os cones e os bastonetes.
32. A miopia e a hipermetropia decorrem da formao incorreta da imagem na estrutura I.
64. A ris atua regulando a quantidade de luz que penetra no interior do globo ocular.
80
Em uma populao hipottica em equilbrio de Hardy-Weinberg, um gene possui dois alelos. Sabe-
se que a frequncia do alelo recessivo de 0,4. Calcule o percentual esperado de indivduos
heterozigotos nesta populao e assinale a resposta obtida no carto-resposta.
48
Evidncias indicam que a Terra tem aproximadamente 4,5 bilhes de anos de idade. A partir de sua
formao at o aparecimento de condies propcias ao desenvolvimento de formas vivas, milhes
de anos se passaram. Sobre a origem da vida e suas hipteses, assinale a(s) proposio(es)
CORRETA(S).
01. O aparecimento da fotossntese foi muito importante, pois atravs deste fenmeno alguns seres
vivos passaram a ter capacidade de formar molculas energticas.
02. Segundo a hiptese heterotrfica, os primeiros seres vivos obtinham energia atravs de
processos qumicos bem simples como a respirao aerbica.
04. As hipteses heterotrfica e autotrfica foram baseadas em fatos comprovados que levaram
formulao da Lei da Evoluo Qumica.
08. Os processos qumicos nos seres vivos ocorrem dentro de compartimentos isolados do meio
externo, em funo da existncia de uma membrana citoplasmtica.
16. Em 1953, Stanley L. Miller, simulando as provveis condies ambientais da Terra no passado,
comprovou a possibilidade da formao de molculas complexas como protenas e glicdios.
32. H um consenso entre os cientistas quanto impossibilidade de serem formadas molculas
orgnicas fora do ambiente terrestre.
64. A capacidade de duplicar molculas orgnicas foi uma etapa crucial na origem dos seres vivos.
73
O Cdigo Gentico universal por ser praticamente o mesmo em todos os seres vivos, embora
existam rarssimas excees a esta universalidade. Ele tambm chamado de degenerado, porque
para a codificao de quase todos os aminocidos existem mais de um cdon, conforme mostrado
na Tabela do Cdigo Gentico, a seguir:

Ao final da traduo de um RNA mensageiro foi formado um polipeptdio que apresenta os


seguintes aminocidos em suas posies relativas:

Assinale a(s) proposio(es) CORRETA(S).


01. O RNA mensageiro que forma este polipeptdio apresenta 7 (sete) pares de bases nitrogenadas.
02. Se o cdon do RNA mensageiro que codifica o segundo aminocido for modificado na sua
terceira base (de G para A), a cadeia polipeptdica ser formada faltando um aminocido.
04. Existem no total 16 sequncias possveis de RNA mensageiro para formarem este polipeptdio.
08. Os aminocidos da primeira e da segunda posio so exemplos da razo pela qual o cdigo
gentico chamado de degenerado.
16. A presena do cdon UAA no RNA mensageiro faz com que a maquinaria de traduo
(ribossomo + RNA mensageiro) seja desmontada.
32. Pela anlise da tabela do cdigo gentico podemos afirmar que o aminocido da 7 (stima)
posio pode ser codificado por apenas um cdon.
64. Uma mutao no DNA pode ou no levar a modificaes na sequncia dos aminocidos deste
polipeptdio.
80
O sangue de uma pessoa foi submetido a uma variao de pH em trs momentos distintos. O grfico
abaixo representa a medida do percentual de saturao de O2 na hemoglobina, em funo da
presso desse gs no sangue humano (PO2) durante esses trs momentos.

Analisando o grfico acima, assinale a(s) proposio(es) CORRETA(S).


01. Quando o pH do sangue estiver com valor igual a 7,4 e a presso de O2 estiver entre 30 e 60
mmHg, verifica-se uma maior saturao de O2 na hemoglobina.
02. O maior percentual de saturao de O2 na hemoglobina ocorre quando a presso desse gs no
sangue atinge os 30 mmHg.
04. Para se atingir faixas superiores a 60% de saturao de O2 na hemoglobina necessrio que a
presso de O2 no sangue no ultrapasse os 30 mmHg.
08. Quando a presso de O2 no sangue atinge 30 mmHg, o pH sanguneo de 7,6 o que permite
uma ligao mais eficiente do O2 com a hemoglobina.
16. O percentual de saturao de O2 na hemoglobina diretamente proporcional presso deste gs
no sangue e dependente do valor do pH sanguneo.
32. Quando a presso de O2 no sangue atinge 30 mmHg, o percentual de saturao de O2 na
hemoglobina tem o mesmo valor, independente do pH sanguneo.
17
Um determinado gene hipottico possui dois alelos denominados A e a. Uma enzima de restrio
capaz de clivar (quebrar) o segmento de DNA que corresponde ao alelo A em duas partes de
diferentes tamanhos medidos em pares de bases (pb). A mesma enzima no capaz de clivar o
segmento de DNA do alelo a.
Foram colhidas clulas de trs indivduos (1, 2 e 3) e obtido o trecho do DNA que corresponde ao
gene citado. Estes fragmentos foram ento misturados com a enzima de restrio, e aps o
procedimento, o material foi submetido a uma eletroforese em gel de agarose.
O resultado da digesto revelado pela eletroforese representado esquematicamente abaixo. As
faixas claras horizontais representam o tamanho dos fragmentos de DNA obtidos.

Com base no resultado, assinale a(s) proposio(es) CORRETA(S).


01. O indivduo 01 possui duas cpias do alelo A.
02. O indivduo 02 possui duas cpias do alelo a.
04. O indivduo 03 possui um alelo A e um alelo a.
08. O indivduo 02 possui um alelo A e um alelo a.
16. O alelo A quando clivado origina 2 fragmentos com cerca de 700 pb.
32. O alelo a possui um tamanho de aproximadamente 300 pb.
64. Os fragmentos maiores do gene A ficam mais prximos do polo positivo.
00
Considerando o acima exposto, assinale a(s) proposio(es) CORRETA(S).

01. As plulas anticoncepcionais contm hormnios que mimetizam a ao dos estrgenos e da


progesterona, bloqueando a produo de vulos pelos ovrios.
02. Alm dos hormnios encontrados nas plulas anticoncepcionais, outras substncias lanadas no
ambiente podem interferir no desenvolvimento do sistema reprodutor dos animais.
04. O estrgeno naturalmente produzido no ovrio humano e responsvel por provocar a
proliferao das clulas do endomtrio.
08. A menstruao resultado da queda nas taxas de estrgenos e progesterona, o que, em mulheres
que utilizam plula anticoncepcional, mimetizado pela interrupo da ingesto do
anticoncepcional por alguns dias.
16. A urina produzida pelo sistema excretor contm apenas substncias txicas ao organismo, como
representado pelo EE2.
32. As alteraes apresentadas nos peixes do sexo masculino se explicam porque o EE2 bloqueia a
produo de testosterona.
45
A busca por novas formas de imunizao uma constante na humanidade. Sobre este tema, assinale
a(s) proposio(es) CORRETA(S).

01. Vacinas so mtodos de imunizao ativa, que contm em sua composio anticorpos contra o
agente infeccioso.
02. Vacinas e soros so mtodos de imunizao que agem de forma semelhante na estimulao do
sistema imunolgico.
04. As vacinas contm antgenos que induzem o organismo a produzir anticorpos especficos.
08. Um antgeno pode ser caracterizado como uma molcula capaz de promover a ativao do
sistema imune, sendo esta molcula endgena ou exgena.
16. Espera-se que uma vacina induza a produo de anticorpos inespecficos.
32. Alergias e doenas autoimunes so respostas imunes nocivas ao organismo.
38
Um pesquisador, realizando vrios cruzamentos com coelhos, determinou que os genes A e B
estavam a uma distncia de 10 UR (unidades de recombinao). Ao realizar o cruzamento entre
indivduos AABB X aabb, obteve indivduos AaBb. Estes duplo-heterozigotos foram ento
cruzados com indivduos aabb, obtendo-se 90 filhotes. Quantos destes filhotes espera-se que
possuam o mesmo gentipo de seus pais?
81
A rvore filogentica abaixo se refere evoluo do grupo de vertebrados terrestres denominado
Diapsida. Estudos paleontolgicos realizados nas ltimas dcadas evidenciam vnculos evolutivos
entre dinossauros e aves modernas, como a semelhana na postura dos ovos, na construo dos
ninhos e at em detalhes da anatomia ssea.

Analise a rvore filogentica acima e assinale a(s) proposio(es) CORRETA(S).


01. Uma forte evidncia do parentesco entre dinossauros e aves foi a descoberta de penas em fsseis
de dinossauros, estrutura antes vista como exclusiva das aves.
02. Os dinossauros, assim como as aves, por possurem fecundao interna e colocarem ovos com
casca, eram independentes do meio aqutico para sua reproduo.
04. Entre os representantes vivos, os pterossauros so os parentes mais prximos das aves
modernas.
08. As penas tiveram sua origem em animais com capacidade de voo, sendo importantes para esta
finalidade por serem estruturas leves e impermeveis gua.
16. Todos os animais representados no grupo Diapsida possuem ovo amnitico.
32. A extino dos pterossauros ocorreu h aproximadamente 200 milhes de anos, no perodo
Jurssico.
64. Todos os grupos representados na rvore filogentica possuem representantes vivos na
atualidade.
26
A fotossntese influenciada por diversos fatores ambientais, entre eles o da luminosidade,
mostrada no grfico abaixo.

Com relao luminosidade e aos fatores que influenciam a fotossntese, assinale a(s)
proposio(es) CORRETA(S).
01. A taxa relativa de fotossntese influenciada diretamente pela luminosidade, independentemente
da temperatura ambiente.
02. Em todas as faixas de temperatura, a fotossntese realizada com a mesma intensidade.
04. A quantidade de gs carbnico presente no ar (entre 0,03% e 0,04%) muito inferior
quantidade que as plantas tm capacidade para utilizar no processo da fotossntese.
08. A disponibilidade de gua no um fator que influencie a fotossntese.
16. Temperaturas 40 C no prejudicam a fotossntese nem outras reaes metablicas na clula,
pois, nesta faixa de temperatura, as enzimas passam a funcionar com mais eficincia.
32. Todos os comprimentos de onda da luz tm a mesma eficincia no processo da fotossntese.
64. A abertura e fechamento dos estmatos, importantes elementos na fotossntese, ocorre por
influncia da luminosidade, da concentrao de gs carbnico na atmosfera e pela disponibilidade
de gua.
96
A fim de realizar um trabalho de Biologia, um estudante adicionou misturas de ingredientes em
cinco garrafas plsticas pequenas, conforme o quadro abaixo. Imediatamente aps a insero dos
ingredientes, o estudante colocou bales no gargalo das garrafas, como demonstrado na ilustrao
abaixo.

Aps 10 minutos de incubao, o estudante conferiu os resultados.


Em relao aos resultados deste experimento, assinale a(s) proposio(es) CORRETA(S).
01. Nas garrafas 1 e 2 houve produo de gs e os bales inflaram.
02. No ocorreu produo de gs na garrafa 2.
04. O fermento biolgico composto de leveduras e a produo de gs resultado da fermentao,
um processo de respirao aerbica desenvolvido por estes organismos.
08. O gs liberado aps a reao de fermentao o CO2. Alm dele, atravs da quebra da glicose,
a fermentao promove a produo de ATP e pode ter como subproduto o lcool.
16. O balo da garrafa 1 inflou-se mais, em comparao com o da garrafa 2, porque o carboidrato
presente na garrafa 1 predominantemente um dissacardeo, enquanto o da garrafa 2 um
polissacardeo.
32. Temperaturas muito altas impedem a reao de fermentao por degradarem os carboidratos
envolvidos antes que as leveduras possam ter acesso a eles.
28
O neurnio uma clula altamente especializada, didaticamente dividida em trs regies: dendritos,
corpo celular e axnio, conforme a figura abaixo.

Considere o esquema de uma clula neural e assinale a(s) proposio(es) CORRETA(S).


01. Um neurnio em repouso apresenta concentraes dos ons de sdio e potssio semelhantes s
encontradas no meio extracelular.
02. Em um neurnio em repouso, a superfcie interna da membrana plasmtica eletricamente
negativa em relao superfcie externa.
04. Quando o impulso nervoso ocorre, h abertura dos canais de sdio e ocorre grande influxo deste
on para o interior da clula atravs de transporte ativo.
08. O impulso nervoso ocorre sempre no sentido 3 2 1.
16. Se colocado em meio hipertnico, o neurnio acima ter sada de gua por osmose, um tipo de
transporte de membrana que utiliza ATP.
32. Se colocado em meio hipotnico, o neurnio acima ter uma entrada passiva de gua por
osmose, sendo a homeostase celular facilmente restabelecida por bombas de gua que ocorrem em
toda membrana plasmtica.
32
Os seres humanos desenvolveram uma sociedade baseada na utilizao de combustveis fsseis,
entre eles o carvo. O acmulo de matria orgnica vegetal, ocorrido no perodo Carbonfero h 300
milhes de anos, gerou as reservas de carvo hoje exploradas. Porm, este processo de acmulo no
mais aconteceu em funo do surgimento dos fungos, seres vivos capazes de degradar lignina e
celulose.
Considerando o exposto acima, assinale a(s) proposio(es) CORRETA(S).
01. Os fungos so seres hetertrofos que apresentam parede celular composta de quitina,
caracterstica compartilhada por algumas espcies de algas unicelulares.
02. Juntamente com as bactrias, os fungos compem um grupo de seres vivos decompositores da
matria orgnica e responsveis pela ciclagem dos nutrientes na cadeia trfica.
04. Alguns fungos podem ser encontrados em associaes simbiticas com outros organismos. A
associao de fungos com plantas forma as micorrizas e a de fungos com algas, os lquens.
08. As leveduras so fungos unicelulares capazes de realizar a fermentao, processo bioqumico
utilizado na produo de alimentos como o iogurte.
16. A lignina e a celulose so molculas encontradas principalmente no citoplasma de clulas
vegetais.
18
Considerando o exposto acima, assinale a(s) proposio(es) CORRETA(S).
01. As mutaes originadas pela radiao nas borboletas em Fukushima, citadas no artigo,
restringem-se aos fentipos e no afetaram seus gentipos.
02. Segundo Darwin, em seu clebre livro A Origem das Espcies por meio da Seleo Natural, as
mutaes so o principal agente de variabilidade entre as espcies.
04. As mutaes gnicas e a recombinao gnica contribuem para a variabilidade gentica das
populaes.
08. Uma mutao s ocorre quando envolve a mudana de um cdon no DNA.
16. Mutaes somente ocorrem em algumas regies da cadeia de DNA.
32. Todas as mutaes so perceptveis no fentipo dos indivduos que as possuem.
64. Apesar de ocorrerem muitas mutaes ao longo da cadeia de DNA, elas podem ser corrigidas
por mecanismos que envolvem enzimas especializadas no reparo.
66
Os tecidos epiteliais so encontrados em uma variedade de organismos animais ou vegetais
desempenhando diferentes funes. Com relao a este tecido, assinale a(s) proposio(es)
CORRETA(S).
01. Os epitlios dos animais caracterizam-se por possurem muita substncia intercelular e ausncia
de junes celulares.
02. Os tecidos epiteliais tm como principal caracterstica o fato de serem uniestratificados.
04. As microvilosidades so especializaes presentes no epitlio dos alvolos e tm como principal
funo aumentar a capacidade de trocas gasosas (hematose).
08. A pele o melhor exemplo de tecido epitelial de revestimento.
16. O epitlio de revestimento das folhas o principal responsvel pela fotossntese.
32. Alguns epitlios so responsveis pela produo de secrees como a adrenalina, a tiroxina e o
leite.
64. Todos os tecidos epiteliais so originados a partir da mesoderme na embriognese.
01
01. O vrus
usado nas pesquisas citadas no texto do tipo:
(A) rotavrus
(B) retrovrus
(C) arbovrus
(D) coronavrus

02. Um vrus, formado por uma hlice simples de RNA contendo 51103 bases nitrogenadas, sofreu
o seguinte processo de manipulao em um experimento:
- dois fragmentos de RNA, identificados como X e Y, contendo cada um 103 e 104 bases,
respectivamente, foram retirados de seu genoma;
- apenas um fragmento de RNA, contendo n bases, foi introduzido nele.
Admita que o nmero total de bases, aps a modificao, equivalia ao quinto termo de uma
progresso geomtrica, na qual o nmero de bases dos fragmentos X e Y correspondia,
respectivamente, ao primeiro e ao terceiro termos dessa progresso.
No experimento, a quantidade n de bases nitrogenadas contidas no fragmento introduzido no vrus
foi igual a:
(A) 3 10 2
(B) 5 10 3
(C) 6 10 4
(D) 4 10 5
1. B
2. C
Outra doena encontrada no Brasil causada por um arbovrus da mesma famlia do vrus da dengue,
e que tambm pode ter como vetor o Aedes aegypti, a febre denominada:

(A) ter
(B) palustre
(C) amarela
(D) maculosa
C
A maioria dos seres autotrficos capta a energia da radiao luminosa que recebem. No entanto,
seus pigmentos fotossintetizantes so capazes de absorver essa radiao, com eficincia, apenas
para determinadas freqncias.
O grfico abaixo mostra o espectro de absoro de luz desses pigmentos, encontrados em um
determinado fitoplncton:

Uma mesma quantidade desse fitoplncton foi adicionada a cada um de quatro recipientes, contendo
meio de crescimento adequado.
Durante determinado tempo, os recipientes foram mantidos sob temperatura constante e iluminados
com a mesma quantidade de energia. Foram usados, porm, comprimentos de onda diferentes,
como mostra a tabela:

Ao final do experimento, o nmero de clulas em cada um foi contado.


A maior e a menor quantidade de clulas foram encontradas, respectivamente, nos recipientes de
nmeros:
(A) 1 e 4
(B) 2 e 3
(C) 2 e 4
(D) 3 e 1
C
Pasteur realizou no sculo XIX experimentos, nos quais esterilizava meios de cultura em frascos
que posteriormente eram fechados hermeticamente. Esclarea a contribuio desses experimentos
para:

a) o conhecimento da origem da vida;


b) o desenvolvimento da medicina na poca.
Faa um esquema de uma clula vegetal.

a) Nomeie com legendas as estruturas representadas.


b) Destaque duas estruturas que no aparecem em clulas animais e indique a funo de cada uma
delas.
Compare neurnios com nervos.
Escreva um texto explicando o que permutao gnica (crossing over). Em seu texto todos os
conceitos abaixo devem estar relacionados de forma coerente:

Cromtides-homlogas
Materno
Alelo
Paterno
Recombinao gnica
Diversidade
Como pode ser intencionalmente evitada a formao do zigoto na espcie humana? Cite dois
exemplos.
Qual o hormnio humano cuja funo similar da auxina nas plantas? Explique a sua resposta.
Explique, resumidamente, como diferem os coraes dos principais grupos de vertebrados: peixes,
anfbios, rpteis e mamferos.
Quais so duas principais tendncias evolutivas observadas no processo reprodutivo da seqncia:
Brifitas, Pteridfitas, Gimnospermas e Angiospermas?
Explique o que homeostase e como ela controlada na espcie humana.
Quase todos os animais criados para o consumo humano so herbvoros, como os gados bovino,
caprino, suno, ovino, entre outros.

Qual o fundamento ecolgico que explica o motivo das criaes de consumidores de segunda
ordem serem raras e menos viveis?
Os conhecimentos de restaurao florestal tomaram grande impulso nos ltimos anos. Estes plantios
tiveram como objetivo a recuperao da flora, controle da eroso e assoreamento, proteo fauna,
restabelecimento do equilbrio ecolgico, melhoria do clima, recreao, lazer, embelezamento do
ambiente, e muito mais. O mecanismo pelo qual as florestas tropicais se renovam pela
recomposio de locais perturbados que ocorrem em diferentes pontos da mata denominado
sucesso secundria. O plantio de espcies florestais nativas contribui com o processo de acelerao
da formao de florestas densas que, acontecendo de forma natural, levaria muito tempo para seu
restabelecimento.

Dadas as afirmaes sobre o assunto,

I. Nas sucesses, a comunidade que existe num dado momento fundamental para que uma outra
comunidade, diferente da primeira se estabelea. As diversas comunidades se sucedem, at que se
atinja um estgio de relativa estabilidade e equilbrio denominada comunidade clmax, que se
instala de forma permanente.
II. Quando a sucesso ocorre numa rea em que ho h mais vida aparente, como um campo
abandonado ou uma floresta aps um incndio, trata-se de uma sucesso primria.
III. A grande estabilidade da comunidade clmax deve-se principalmente a sua grande diversidade
de espcies.

est(o) correta(s):

A) III, apenas.
B) I e III.
C) I, apenas.
D) II e III.
E) I, II e III.
B
O HIV (sigla de Human Immunodeficiency Virus - vrus da imunodeficincia humana) o agente
causador da aids (sigla da expresso inglesa Acquired Immunodeficiency Syndrome - Sndrome da
Imunodeficincia Adquirida). O HIV ataca principalmente determinadas clulas do sangue,
sobretudo os linfcitos T auxiliadores (clulas CD4), que comandam todo o sistema de defesa
contra as infeces.
Sobre os vrus, podemos afirmar, exceto:

A) diferem de todos os seres vivos por serem acelulares.


B) so constitudos principalmente por duas classes de substncias qumicas: protenas e cidos
nucleicos, que pode ser DNA (cido desoxirribonucleico) ou RNA (cido ribonucleico).
C) so considerados parasitas intracelulares obrigatrios.
D) o HIV contm a enzima transcriptase reversa que permite produzir molculas de DNA a partir
das molculas de RNA, exatamente ao contrrio do que costuma ocorrer nas clulas.
E) alm do DNA cromossmico, os vrus tambm podem conter pequenas molculas circulares
adicionais de DNA - os plasmdios.
E
O ciclo celular o perodo que se inicia com o surgimento de uma clula a partir de outra
preexistente, e termina quando ela se divide em duas cluas-filhas.
O ciclo celular dividido em duas etapas: interfase e diviso celular. A interfase compreende o
perodo entre duas divises consecutivas e a diviso celular compreende dois processos: mitose
(diviso do ncleo) e citocinese (diviso do citoplasma).
Com base no enunciado da questo e observando a figura abaixo, caracterize as fases que
complementam o ciclo celular, associando corretamente as opes apresentadas.

[ ] As cromtides irms se separam, puxadas para polos opostos devido ao encurtamento dos
microtbulos do fuso.
[ ] Ocorre a formao da placa metafsica.
[ ] Incio da formao do fuso acromtico ou fuso mittico, bem como do processo de condensao
dos cromossomos.
[ ] Perodo em que o DNA cromossmico est sendo duplicado.
[ ] Caracteriza-se pela descondensao dos cromossomos e reconstituio de uma nova carioteca ao
redor de cada conjunto cromossmico.

A sequncia correta :
A) 3 - 2 - 1 - 5 - 4
B) 1 - 2 - 3 - 4 - 5
C) 3 - 2 - 1 - 4 - 5
D) 2 - 3 - 1 - 5 - 4
E) 5 - 4 - 1 - 2 - 3
A
O principal componente do sistema nervoso o neurnio, um tipo de clula altamente especializada
em receber, conduzir e transmitir mensagens a outras clulas. A regio entre dois neurnios
chamada sinapse; as substncias qumicas que transmitem as mensagens de um neurnio a outro
pela sinapse so chamadas mediadores, mensageiros qumicos ou neurotransmissores. Os cientistas
descobriram que, em muitas doenas do sistema nervoso, a quantidade desses mensageiros fica
alterada. O consumo habitual de drogas, como a cocana, o tabaco e a maconha, tambm produz
efeito semelhante.
Dadas as afirmaes sobre o assunto,

I. Quando o neurnio devidamente estimulado, ocorre uma onda de alteraes eltricas em sua
membrana, sempre dos dendritos em direo ao axnio.
II. As sinapses nervosas ocorrem, em geral, entre o axnio de um neurnio e o dendrito de outro,
mas tambm pode haver sinapses entre um axnio e um corpo celular, entre dois axnios, ou entre
um axnio e uma clula muscular, neste caso, chamada sinapse neuromuscular.
III. Dentre outras, algumas substncias que atuam como neurotransmissores so: acetilcolina,
adrenalina (ou epinefrina), neuroadrenalina (ou norepinefrina), dopamina e serotonina.

est(o) correta(s):

A) I, apenas.
B) II, apenas.
C) III, apenas.
D) I e III.
E) I, II e III.
E
Sabemos que os casamentos consanguneos aumentam muito as probabilidades de nascimento de
crianas portadoras de defeitos genticos. Isto explicado pelo fato de muitas doenas hereditrias
serem condicionadas por genes recessivos, ou seja, que somente se expressam quando em dose
dupla. Os indivduos aparentados, por terem gentipos muito semelhantes, tem grandes chances de
possurem genes recessivos para a mesma anomalia. Quanto maior o parentesco, maior esta
possibilidade.
Analisando a figura abaixo, que apresenta um heredograma que trata do albinismo, anomalia
hereditria condicionada por um gene recessivo, e que caracteriza a ausncia parcial ou total do
pigmento melanina na pele, cabelos e olhos, podemos afirmar:

I. Nos indivduos 1 - 2 - 3 - 4, o gene para o albinismo est presente, apesar de no se manifestar.


II. Os indivduos 7 - 10 - 11 - 12 so albinos, apresentando o gene para o albinismo em homozigose.
III. Se o indivduo 13 casar com um albino, todos seus filhos sero albinos.

est(o) correta(s):

A) I, apenas.
B) II, apenas.
C) I e II.
D) I, II e III.
E) II e III.
C
Lagosta, escorpio, gafanhoto, dentre outros artrpodes possuem um exoesqueleto com articulaes
nas patas. Ao mesmo tempo que esse esqueleto serve como proteo e sustentao, as articulaes
permitem que as patas executem movimentos como o de andar, correr, cavar, nadar, triturar,
inocular veneno, copular etc.
Com referncia ao grupo dos artrpodes, assinale a opo correta.

A) Os artrpodes so altamente diversificados com excepcional capacidade de adaptao aos mais


variados ambientes e modos de vida. Muitas espcies de microcrustceos, por exemplo, so
importantes componentes do zooplncton, marinho e de gua doce. Na Antrtida, o Krill (Euphausia
sp.) a principal fonte de alimento para muitos animais marinhos, como peixes, focas e baleias.
B) O maior nmero de artrpodes terrestre, bem adaptados aos campos, desertos e matas, como
insetos, aracndeos, diplpodos (lacraias) e quilpodos (piolhos-de-cobra).
C) Os insetos cumprem importante papel ecolgico nos ecossistemas: polinizam flores; vivem
associados a outras espcies animais e vegetais; servem de alimento para outros animais, e at
produzem alimento, caso do mel produzido pelas abelhas; as minhocas, por sua vez, so de grande
importncia para a vida nos solos.
D) O grande grupo dos artrpodes mostra duas linhas evolutivas: a dos antenados, representados
por insetos, diplpodos e quilpodos (um par de antenas), crustceos (dois pares de antenas) e a dos
quelicerados. Estes ltimos no tm antenas e sim um par de quelceras que so apndices
articulados, com vrias formas e funes, localizados na regio bucal. Nas aranhas, as quelceras se
encarregam da inoculao do veneno; nos escorpies, elas tm funo preensora; os carrapatos no
apresentam quelceras.
E) O corpo dos crustceos apresenta cefalotrax, estrutura resultante da fuso da cabea com o
trax, e abdome. Nos siris e caranguejos o abdome ausente.
A
No ser humano, a fecundao, ou fertilizao ocorre quando o ovcito e o espermatozoide se
encontram na tuba uterina. Dos milhes de espermatozoides lanados na vagina em uma relao
sexual, somente algumas centenas costumam chegar ao ponto da tuba uterina em que vai ocorrer a
fecundao e a formao de uma clula-ovo ou zigoto. Os espermatozoides produzem enzimas que
facilitam o acesso at o vulo que, por sua vez, produz substncias que impedem a entrada de
outros espermatozoides. O zigoto recm-formado levado para o tero pelas contraes musculares
da tuba e tambm pelo movimento dos clios existentes nas clulas desta regio.
Sobre a reproduo humana, assinale a opo correta.

A) Se ocorre gravidez, o embrio recm-implantado produz um hormnio denominado prolactina,


que estimula a atividade do corpo-amarelo e mantm elevados no sangue da gestante as taxas de
estrgeno e de progesterona, o que impede a menstruao.
B) A gravidez ou gestao somente tem incio por volta do 7 dia aps a concepo, com a
implantao do blastocisto na mucosa uterina, fenmeno chamado de nidao.
C) Aps a formao do zigoto, ocorre a primeira diviso meitica, da qual resultaro as duas
primeiras clulas, ou blastmeros, que iro compor a mrula.
D) A placenta promove a comunicao nutricional entre a me e o filho, produzindo estrgeno e
progesterona, em quantidades cada vez menores, at o final da gravidez.
E) Na 4 semana de vida, o embrio j tem 2,5cm de comprimento e aparncia tipicamente humana,
passando a ser chamado de feto.
B
A Biologia compreende a cincia que estuda os organismos vivos. Contudo, nem sempre a
existncia de vida em um organismo facilmente caracterizada.

Isto pode ocorrer porque:


A) a independncia metablica no fundamental para um ser vivo, como o caso dos vrus.
B) o crescimento celular ou do conjunto de clulas do organismo pode ser inexistente em seu ciclo
de vida.
C) nem todos os organismos possuem clulas reprodutivas.
D) a reao e o movimento, tpicos dos seres vivos, podem no ser facilmente observveis, como
nas plantas.
E) pode no ocorrer variabilidade gentica, como nas bactrias, que se dividem por bipartio.
D
Uma alimentao balanceada deve ser rica em protenas, macromolculas importantes para o
funcionamento dos seres vivos, uma vez que desempenham funes estruturais e enzimticas. Sobre
este assunto, observe a figura abaixo representando diferentes estruturas proticas e assinale a
alternativa correta.

A) A sequncia linear de aminocidos representada em 1 e 4 denominada estrutura primria.


B) Os dobramentos observados nas cadeias proticas em 2 e 3 devem-se a reaes de repulso entre
aminocidos distantes entre si.
C) Protenas como a albumina, que apresentam somente uma cadeia polipeptdica, poderiam ser
representadas em 4.
D) As estruturas 2 e 3 so chamadas, respectivamente, de alfa-hlice e beta-hlice.
E) Caso a estrutura 5 fosse uma enzima submetida a alta temperatura, esta seria desnaturada mas
no ocorreria mudana em sua forma espacial.
C
Seres unicelulares e multicelulares multiplicam-se na natureza por mecanismos caractersticos. As
fotos abaixo, por exemplo, mostram diferentes momentos do processo de diviso celular de um
organismo. Ao observ-las atentamente, pode-se concluir que:

A) as fases 1 e 2 se sucedem durante a diviso celular de procariontes.


B) as fases 1, 2 e 3, ocorrem aps a fase S do ciclo celular.
C) na prfase (1), os cromossomos condensam-se, e ocorre formao do fuso acromtico.
D) na metfase (2), os cromossomos saem da regio mediana da clula em direo aos plos.
E) a telfase (3) marca o incio da fase M da diviso celular.
B
Vrios mtodos contraceptivos so disponveis nas farmcias ou fornecidos gratuitamente pelo
Sistema nico de Sade (SUS) populao brasileira, e alguns ainda evitam doenas sexualmente
transmissveis. A esse propsito, correto afirmar que:

A) a transmisso do vrus HIV no prevenida com o uso de preservativos (camisinha),


considerando que os vrus so filtrveis.
B) a sfilis uma doena viral que pode causar feridas genitais conhecidas como cancros.
C) a gonorria provoca secreo purulenta (corrimento) na uretra do homem, mas no na mulher.
D) os papilomavrus humanos geralmente produzem verrugas genitais.
E) a AIDS uma doena controlada com coqueteis de drogas antivirais; assim, no oferece mais
risco de morte.
D
Os tecidos humanos so formados por clulas especializadas que exercem funes diferenciadas e
apresentam morfologias caractersticas. Sobre este assunto, observe as fotomicrografias abaixo e, a
seguir, aponte a alternativa que indica os tecidos 1, 2, 3 e 4, nessa ordem.

A) Nervoso; Muscular; Epitelial; Adiposo.


B) Muscular; Nervoso; Epitelial; Adiposo.
C) Adiposo; Muscular; Nervoso; Epitelial.
D) Muscular; Epitelial; Nervoso; Adiposo.
E) Nervoso; Muscular; Adiposo; Epitelial.
E
Joo casa-se com Maria, sua prima. Considerando o parentesco entre ambos, resolvem fazer um
aconselhamento gentico e descobrem que, apesar de saudveis, Joo e Maria possuem alelos
recessivos para a doena X, que em Maria ocorre em heterozigose.
Considerando que tal doena condicionada por um gene que age como dominante no homem e
como recessivo na mulher, correto afirmar que Joo e Maria:

A) se tiverem filhos homens, todos tero a doena.


B) se tiverem filhas, nenhuma ter a doena.
C) se tiverem filhos homens, possuem 25% de chance de nascerem com a doena.
D) se tiverem filhas, possuem 75% de chance de nascerem com a doena.
E) independentemente do sexo, todos os filhos tero a doena.
B
A tecnologia do DNA recombinante tem produzido uma srie de avanos no setor agropecurio
brasileiro. A insero de um gene da bactria Bacillus thuringiensis em algumas variedades de
plantas, por exemplo, as torna resistentes a certas pragas. Sobre essas tecnologias, correto afirmar:

A) a transferncia de qualquer gene de um organismo a outro produz variabilidade gentica; da, os


transgnicos serem resistentes a pragas.
B) plasmdios virais so utilizados como vetores de genes de interesse que sero transferidos a um
organismo.
C) a resistncia de uma planta transgnica a uma praga se deve ao do produto do gene inserido
na planta, e no presena do gene em si.
D) plantas naturalmente resistentes a pragas no passam necessariamente esta caracterstica prole;
da, a necessidade das tcnicas de engenharia gentica.
E) a clonagem de plantas com caractersticas de resistncia a pragas as torna menos susceptveis
extino ao longo da evoluo, segundo as leis da seleo natural.
C
luz do conhecimento atual, observe a ilustrao abaixo e aponte a alternativa que melhor
responde a pergunta: o homem originrio do macaco?

A) A espcie Homo sapiens se distingue de outros homindeos e, portanto, no se originou dos


macacos, que so primatas.
B) Os gneros Homo e Australopithecus representam o homem moderno e conviveram na mesma
poca com os macacos; assim, no so seus descendentes.
C) Chimpanzs so bpedes e parecidos morfologicamente com o homem; portanto, os chimpanzs
deram origem ao homem.
D) Os seres humanos e chimpanzs possuam um ancestral em comum e divergiram ao longo da
evoluo.
E) Os seres humanos e chimpanzs convergiram ao longo da evoluo desenvolvendo
caractersticas anlogas.
D
Observando a histria em quadrinhos abaixo, que ilustra de forma bem humorada como a natureza
funciona, correto concluir que:

A) animais consumidores um dia se tornaro presas.


B) as plantas podem agir como consumidores finais da cadeia alimentar.
C) ocorre aumento do saldo energtico de um nvel trfico para outro, dos produtores aos
decompositores.
D) o mimetismo comum em vrios grupos animais como estratgia para capturar as presas.
E) as relaes entre os animais da cadeia alimentar ilustrada so desarmnicas e intraespecficas.
D
Empreendimentos humanos baseados nos princpios da responsabilidade ambiental tm sido
desenvolvidos em vrias partes do mundo, como as ecovilas, assentamentos humanos
sustentveis e ecologicamente corretos. Em tais empreendimentos, no desejvel que:

A) a energia gerada tenha fonte elica, solar ou de moinho de gua.


B) os veculos usados para transporte funcionem com motores eltricos.
C) o lixo orgnico e rejeitos humanos sejam separados daquele destinado reciclagem e depositado
em reas abertas para facilitar a deteriorao.
D) a gua derivada de chuvas seja armazenada ou que aquela utilizada para banho seja aquecida
com energia solar.
E) as construes sejam realizadas com materiais reciclveis e tijolos ecolgicos feitos de barro
prensado.
C
Infeces virais tm diferentes efeitos sobre o organismo humano de acordo com o acometimento
dos rgos alvo. Observe a figura abaixo mostrando possveis destinos de clulas infectadas por
vrus, e dos vrus em si, quando estes so liberados de clulas infectadas no corpo humano. Sobre
esse assunto, correto afirmar:

A) Vrus que realizam ciclo ltico (1) inserem seu material gentico na clula, geralmente levandoa
morte, como o Influenza H1N1, causador da gripe mundial.
B) Vrus que possuem ciclo lisognico (2) levam a clula morte ao sair da mesma, mas somente
aps um perodo de latncia.
C) A produo de clulas cancergenas comum durante as infeces virais, como ocorre com a
infeco causada pelo papilomavrus humano (HPV).

D) Caso um vrus seja muito patognico como o HIV, por exemplo, qualquer clula do organismo
pode ser infectada por ele (4).

E) Anticorpos neutralizam vrus liberados na corrente sangunea (5) e dentro de clulas infectadas.
A
Os processos fotossintticos garantem a disponibilidade de oxignio na atmosfera, essencial vida
no planeta. Considerando que a fotossntese das plantas ocorre em paralelo com vrios outros
processos fisiolgicos, observe a figura abaixo e aponte a alternativa correta.

A) O processo fotossinttico (1) consome gs carbnico derivado da queima de combustveis


fsseis e gera o saldo energtico de ATPs necessrios autonomia autotrfica das plantas.
B) A seiva bruta carreada pelo xilema (2) da planta uma soluo aquosa de sais minerais como o
Nitrognio, Fsforo e Potssio, que funcionam como macronutrientes.
C) A seiva elaborada carreada pelo floema (3) uma soluo de acares, vitaminas e aminocidos
produzidos na respirao celular (4).
D) Solos com presena de substncias tais como Ferro, Cobre, Cloro e Mangans so txicos s
plantas provocando prejuzos em seu crescimento.
E) A fotossntese (1) e a respirao celular (4) so processos que dependem da irradiao solar para
acontecerem.
B
Animais aquticos e terrestres de diferentes classes possuem adaptaes morfofisiolgicas para
excreo de compostos txicos do organismo de forma a manter a homeostase. Sobre este assunto,
correto afirmar que:
A) mamferos, como os golfinhos, assim como outros mamferos terrestres, eliminam compostos
nitrogenados principalmente na forma de uria.
B) peixes, como os tubares, eliminam principalmente amnia na gua derivada do metabolismo de
aminocidos.
C) rpteis, como o camaleo, eliminam principalmente uria, esta gerada a partir da amnia, atravs
da urina.
D) anfbios, como as tartarugas marinhas, eliminam principalmente cido rico, menos txico que a
amnia.
E) insetos eliminam amnia e uria especialmente quando trocam o exoesqueleto durante o
crescimento.
A
Durante um ato-reflexo a medula espinal pode fazer o corpo responder a estmulos em uma
velocidade surpreendente. Por exemplo, quando o mdico testa os reflexos do paciente realizando
um teste patelar, ou seja, batendo com um martelinho em seu joelho, correto afirmar que:

1) a resposta ao estmulo ocorre de forma independente do encfalo.


2) um neurnio sensitivo e um neurnio motor participam da elaborao da resposta motora.
3) um neurnio associativo faz a conexo entre o neurnio sensitivo e o neurnio motor durante a
resposta motora.

Est (o) correta (s) apenas:

A) 1
B) 3
C) 1 e 3
D) 2 e 3
E) 1 e 2
E
No homem, o ato reprodutivo depende da regulao hormonal para a produo e o amadurecimento
dos espermatozides. Assim, observe atentamente a figura abaixo e aponte a alternativa correta.

A) As gonadotrofinas so liberadas na puberdade sob controle da hipfise.


B) O hormnio folculo estimulante induz a produo de testosterona (T) pelas clulas de Leydig,
que por sua vez regula a sntese de hormnio luteinizante.
C) O hormnio luteinizante junto com a testosterona induz as clulas de Sertoli a produzir
espermtides que amadurecem em espermatozides.
D) A regulao negativa do hormnio liberador de gonadotrofinas diminui a produo de
testosterona, principal responsvel pelas caractersticas sexuais masculinas.
E) A inibina regula negativamente o hipotlamo, diminuindo a sntese de hormnio folculo
estimulante.
D
As proposies abaixo referem-se aos caracteres gerais dos seres vivos.

0 0 - A presena de cidos nuclicos pode ser considerada uma caracterstica universal dos seres
vivos.
1 1 - Para permanecer vivo e funcionar de modo eficiente um organismo deve manter as condies
dentro de seu corpo razoavelmente constantes, processo denominado homeostase.
2 2 - A reproduo um processo importante para a manuteno do nmero de indivduos de uma
espcie, mas um organismo consegue viver sem reproduzir-se.
3 3 - Anabolismo e catabolismo constituem os dois processo bsicos do metabolismo.
4 4 - O crescimento dos seres vivos decorre da incorporao e da transformao de alimentos,
ocorrendo de fora para dentro do corpo, ou seja, substncias so adicionadas parte externa do
organismo.
VVVVF
As afirmaes abaixo relacionam-se com o Histrico da Citologia e com os mtodos utilizados
nesse ramo da Biologia.

0 0 - Aristteles, que viveu de 384 a 322 a.C., foi o primeiro a descrever, com detalhes, uma clula.
1 1 - A Teoria Celular, de autoria de Schleiden e Schwann, afirma que todos os seres vivos,
inclusive os vrus, so formados por clulas.
2 2 - Um dos instrumentos muito utilizados em estudos citolgicos o microscpio ptico. Uma
lmina contendo uma gota de sangue humano observada ao microscpio com uma objetiva de
40X e ocular de 5X. Desse modo, uma hemcia vista com um aumento de 200 vezes.
3 3 - O microscpio eletrnico permite observar clulas com aumentos superiores a 100 000 vezes e
capaz de mostrar a estrutura detalhada de clulas procariticas e eucariticas.
4 4 - Os corantes constituem uma ferramenta muito eficaz para evidenciar certas estruturas
celulares. Assim, se for utilizada uma soluo alcolica de iodo para observar clulas vegetais
vivas, pode-se ter certeza de que elas permanecero vivas durante o estudo.
FFVVF
As afirmaes a seguir referem-se a vrus e a clulas procariticas e eucariticas.

0 0 - A parede celular confere forma e protege a clula procaritica.


1 1 - Os vrus s sobrevivem se estiverem alojados em clulas procariticas.
2 2 - AIDS uma molstia causada por um vrus ao passo que a sfilis causada por um organismo
procarionte.
3 3 - Todas as clulas eucariticas so autotrficas.
4 4 - Mitocndrias esto presentes nas clulas eucariticas e nos vrus, mas esto ausentes nas
clulas procariticas.
VFVFF
As seguintes proposies relacionam-se com processos de diviso celular.

0 0 - Durante a mitose, a separao das cromtidesirms de cada cromossomo e sua migrao para
plos opostos da clula completam-se na metfase.
1 1 - O Homo sapiens sapiens caracterizado, entre outros aspectos, por apresentar clulas com 2n
= 46. Isso significa que todas as suas clulas, inclusive os gametas, tm 46 cromossomos.
2 2 - O fenmeno da permutao entre partes de cromossomos homlogos ocorre tanto na mitose
como na meiose.
3 3 - Um dos papis da meiose reduzir o nmero cromossmico para contrabalanar o aumento
que ocorre durante a fecundao.
4 4 - Nos grficos abaixo I representa o ciclo da mitose e II, o ciclo da meiose.
FFFVV
As proposies abaixo relacionam-se Gentica.

0 0 - Em ervilhas, todas as vagens que se formam em plantas heterozigticas para cor dos
cotildones contm exclusivamente sementes amarelas, uma vez que o alelo que determina
sementes amarelas dominante sobre o que determina sementes verdes.
1 1 - Na espcie humana, o alelo a impede a sntese de melanina. Assim, pessoas aa so albinas,
enquanto as que possuem o alelo dominante A tm pigmentao normal. Um casal de pigmentao
normal que tenha uma criana albina no tem possibilidade de ter uma segunda criana com essa
caracterstica.
2 2 - No heredograma abaixo, os smbolos escuros representam pessoas daltnicas, caracterstica
determinada por um gene localizado no cromossomo X. No se pode saber se a mulher 5
portadora do alelo para daltonismo ou no.

3 3 - O esquema abaixo indica o nmero de unidades de recombinao entre dois lcus gnicos.
Isso significa que a porcentagem de permutao entre os genes considerados 8,5%.

4 4 - Uma mulher, cujo sangue do tipo B, tem um filho de sangue O e atribui a paternidade a um
homem, tambm de sangue O. Como o pai da criana s pode ter este grupo sangneo, no
necessrio fazer o teste de DNA para comprovar a afirmao da mulher.
V2F0134
Indique a proposio que completa, de forma correta, a afirmativa abaixo:

Por meiose, uma clula ________ com ________ cromossomos formar _______ clulas -
_________________, com _________ cromossomos cada uma.

a) 2n, 20, 02, 2n, 20.


b) Diploide, 10, 04, haploides, 05.
c) Diploide, 46, 04, haploides, 23.
d) n, 10, 02, 2n, 05.
e) Haploide, 05, 04, n, 20.
f) 2n, 30, 04, n, 15.
RESPOSTA: c
Por meiose, uma clula diploide com 46 cromossomos formar 4 clulashaploides, com 23
cromossomos cada uma.
As afirmaes abaixo relacionam-se com origem e evoluo dos seres vivos.

0 0 - A hiptese heterotrfica supe que os primeiros seres vivos surgiram em ambiente terrestre e,
depois, migraram para o oceano.
1 1 - Lamarck enfatizou a importncia das adaptaes dos seres vivos ao ambiente em que vivem,
mas no h nenhuma evidncia a favor do mecanismo que ele props para explicar a evoluo.
2 2 - Segundo Darwin, a natureza seleciona os indivduos bem adaptados e elimina os mal
adaptados ao meio ambiente. Os descendentes dos primeiros, que herdarem as caractersticas
vantajosas, tambm so preservados.
3 3 - A teoria atual da evoluo, que tambm centrada na seleo natural, afirma que, para que esta
possa atuar, preciso que no haja variabilidade.
4 4 - H bactrias mutantes que so resistentes a certo antibitico. Os seus descendentes herdam
essa mutao, sobrevivem e se multiplicam em presena do antibitico, enquanto as bactrias que
no tm essa caracterstica so eliminadas. Depois de algum tempo, restam apenas as resistentes ao
antibitico. Este exemplo mostra como opera a seleo.
V124F03
As afirmaes seguintes referem-se a populaes e a relaes entre organismos de uma
comunidade.

0 0 - Uma populao na qual a soma das taxas de natalidade e mortalidade seja praticamente igual
soma das taxas de imigrao e emigrao est em equilbrio com o ambiente.
1 1 - Competio por luz, espao ou alimento mais intensa entre espcies de habitats diferentes.
2 2 - No esquema abaixo, que representa as relaes trficas entre quatro populaes de uma
comunidade, A, C e D so consumidores, podendo A ser decompositor.

3 3 - As pirmides de biomassa e de energia que representam uma comunidade tm sempre a mesma


forma. Se a de biomassa for invertida, como a da figura abaixo, a de energia tambm o ser.

4 4 - Entre os microrganismos que participam do ciclo do nitrognio esto bactrias auttrofas


quimiossintetizantes, cianobactrias - que so fotossintetizantes - e bactrias decompositoras, que
so hetertrofas.
V24V134F013
O conjunto de afirmaes que segue abrange conhecimentos sobre relaes ecolgicas e problemas
ambientais.

0 0 - Quando ocorre o que mostra o grfico abaixo com duas populaes reunidas em um mesmo
meio de cultura, conclui-se que a relao entre elas s pode ser a de presa-predador.

1 1 - Durante a sucesso ecolgica que ocorre em uma regio que sofreu desmatamento, os tipos de
animais e de vegetais mudam continuamente. As espcies que predominam nos estgios iniciais
nem sempre so importantes nos estgios finais nem na comunidade clmax.
2 2 - Em conseqncia de atividades humanas, estoaumentando o efeito estufa e a poluio de rios,
lagos e lenis d'gua subterrneos.
3 3 - Entre os biomas que esto sendo rapidamente destrudos em conseqncia de atividades
humanas esto as florestas tropicais como a Amaznica e a Mata Atlntica.
4 4 - Um problema associado aos poluentes que alguns, como o DDT, acumulam-se nas cadeias
alimentares, alcanando alta concentrao nos predadores do ltimo nvel trfico.
V1234V02F0
As proposies seguintes referem-se a alguns grupos de seres vivos.

0 0 - Diversas doenas causadas por vrus esto sendo controladas atravs da vacinao - varola,
sarampo, poliomielite so exemplos. Quando o vrus tem outro hospedeiro alm do homem, o
controle tambm pode ser feito atravs do combate ao transmissor, como ocorre no caso da febre
amarela.
1 1 - Os procariontes que causam doenas so minoria. Muito mais comuns so espcies que, direta
ou indiretamente, so vitais para o ser humano.
2 2 - Uma classe dos protozorios constituda exclusivamente por organismos parasitas. So eles
os Esporozorios, grupo ao qual pertence o Plasmodium, causador da malria.
3 3 - O reino Protista inclui organismos que, como todos os protozorios flagelados, apresentam
cloroplastos e fazem fotossntese. Um exemplo a Euglena.
4 4 - Na figura abaixo, que representa um cogumelo, a seta indica a regio onde se formam os
esporos, que garantem a reproduo desse tipo de fungo.
V0124F3
As afirmativas a seguir referem-se s caractersticas gerais dos reinos Vegetal e Animal, bem como
de seu desenvolvimento.
0 0 - Supem-se que as brifitas tenham sido as primeiras plantas e os anfbios, os primeiros
vertebrados a invadirem o ambiente terrestre.
1 1 - Quando se faz uma comparao entre os ciclos de vida de um musgo e de uma pteridfita
isosporada, verifica-se que o gametfito do musgo hermafrodita e que o da pteridfita diico.
2 2 - O endoesqueleto de todos os vertebrados constitudo somente por tecido sseo.
3 3 - Durante o desenvolvimento embrionrio da maioria dos mamferos, o saco vitelnico
rudimentar porque o embrio nutrido pelo marspio.
4 4 - O tubo polnico uma estrutura necessria para os processos reprodutivos de todas as
angiospermas.
V04F123
As afirmaes abaixo referem-se aos sistemas excretores, reguladores e reprodutores dos seres
vivos.
0 0 - H uma estreita relao entre o tipo de excreta nitrogenado que os vertebrados eliminam e o
hbitat em que vivem. Amnia excretada exclusivamente pelos animais aquticos e cido rico
exclusivo dos animais terrestres.
1 1 - Enquanto os hormnios dos animais regulam diversas funes, os hormnios dos vegetais
atuam exclusivamente no crescimento, sendo responsveis pelos tropismos e nastismos. No tm
funo alguma na reproduo nem no enraizamento das plantas.
2 2 - Uma pessoa toca em um objeto muito quente, sente dor e retira imediatamente a mo. A
sensao de dor foi percebida e avaliada no seu crebro, mas a "ordem" para retirar a mo veio da
medula.
3 3 - Sabendo como se forma o saco embrionrio existente nos vulos das angiospermas e como se
forma o endosperma das sementes dessas plantas, correto afirmar que, se as clulas deste tecido
apresentarem 30 cromossomos, os ncleos do saco embrionrio apresentaro 10.
4 4 - O grfico abaixo mostra as variaes nas quantidades de hormnios no sangue das mulheres
durante o ciclo menstrual. Os dados mostram que o hormnio luteinizante (LH) atinge seu pico no
14o dia do ciclo, aproximadamente, que a poca em que ocorre a menstruao.
V23F014
As afirmaes abaixo relacionam-se com os sistemas de trocas gasosas, transporte e nutrio dos
seres vivos.
0 0 - Brnquias, pulmes e pele, capazes de efetuar trocas gasosas entre o animal e o ambiente,
caracterizam-se por apresentar pequena espessura e superfcie mida para permitir a difuso de O2
e CO2.
1 1 - Num experimento, enzimas do aparelho digestrio humano foram distribudas eqitativamente
por quatro tubos de ensaio, nas condies expressas na tabela a seguir.

2 2 - Quatro exemplares de uma mesma espcie de planta, de tamanhos iguais, foram colocados em
quatro recipientes com gua. Cada recipiente foi submetido a uma diferente intensidade luminosa
pelo mesmo perodo, e o gs produzido pelas plantas foi coletado, medido e identificado como
sendo oxignio. Os resultados constam do grfico abaixo.

3 3 - Durante as pocas de estiagem, quando o solo se torna muito seco, as plantas defendem-se
abrindo os estmatos e realizando ampla transpirao estomatar.
4 4 - Nos animais que possuem sistema de transporte, esse sempre utilizado para levar O2 do
ambiente at as clulas e CO2 das clulas para o ambiente.
V012V123F34
As afirmaes abaixo referem-se aos componentes inorgnicos, orgnicos das clulas e aos
componentes do citoplasma.
0 0 - Na gua, as regies carregadas de cada molcula so atradas para regies com carga oposta de
molculas vizinhas, formando pontes fracas, as pontes de hidrognio.
1 1 - Muitas das protenas das clulas so enzimas, substncias que garantem s reaes qumicas
que constituem o metabolismo ocorrerem na velocidade adequada. O grfico abaixo mostra que
temperaturas extremas prejudicam o poder catalisador dessas substncias.

2 2 - As clulas vegetais tm celulose em suas paredes e muitas delas possuem plastos que
armazenam amido. Celulose e amido so exemplos de carboidratos que tm, respectivamente,
funo estrutural e funo energtica.
3 3 - Lisossomos esto presentes nas clulas dos animais e faltam nas clulas dos vegetais.
4 4 - Os cidos nuclicos so cadeias de polinucleotdeos. Tambm so nucleotdeos o ATP e o
ADP, substncias indispensveis ao metabolismo celular.
VVVVV
As proposies que seguem relacionam-se com organelas celulares e com metabolismo energtico.
0 0 - As clulas animais rompem-se quando imersas em gua destilada, enquanto as clulas vegetais
tornam-se trgidas. Essa diferena deve-se a dois componentes das clulas vegetais que faltam nas
clulas animais: parede celulsica e vacolo.
1 1 - Observando-se, ao microscpio, clulas em diviso, nota-se que os nuclolos permanecem
inalterados durante todo o processo, mas a carioteca fragmentase.
2 2 - A figura abaixo indica corretamente as trocas de substncias que ocorrem entre os cloroplastos
e as mitocndrias de uma clula.

3 3 - Quimiossntese um processo exclusivo de certas bactrias que usam CO2 para sintetizar
substncia orgnica, mas no usam energia luminosa.
4 4 - Sempre que utilizam glicose, os organismos que realizam fermentao e os que tm respirao
aerbica obtm a mesma quantidade de energia por mol de substrato oxidado.
VFFVF
As proposies abaixo referem-se ao processo da gametognese esquematizado a seguir e a
mtodos anticoncepcionais.

0 0 - As fases representadas na figura so originadas somente por meiose.


1 1 - Na espcie humana, as trs fases comeam e terminam na puberdade, mantendo-se os gametas
resultantes durante a vida toda dos indivduos.
2 2 - Na espermatognese humana, masculina e feminina, cada clula diplide existente no final da
fase de multiplicao origina quatro gametas haplides.
3 3 - O uso da camisinha nas relaes sexuais impede a transmisso da AIDS, mas no tem efeito
sobre a transmisso de doenas como sfilis e herpes genital.
4 4 - Um mtodo anticoncepcional eficiente consiste no uso das "plulas" pelas mulheres, ou seja o
uso de hormnios femininos que inibem a meiose e, portanto, a formao de vulos.
FFFFF
As afirmaes abaixo relacionam-se com tecidos dos animais.
0 0 - No sistema respiratrio humano, h rgos revestidos internamente por um tecido formado por
clulas dotadas de clios, que se dispem muito juntas, e entre as quais h clulas especializadas em
secretar muco.
1 1 - Os trs grupos de clulas representados na figura abaixo pertencem, respectivamente, ao tecido
cartilaginoso, tecido muscular estriado e tecido muscular liso.

2 2 - Os tecidos conjuntivos so constitudos por clulas imersas em uma matriz. No sangue, que
faz parte desse grupo de tecidos, o plasma o fluido extracelular no qual esto os glbulos
vermelhos, os glbulos brancos e as plaquetas.
3 3 - O tecido sseo o nico tecido dos animais constitudo por clulas mortas devido
impregnao de clcio.
4 4 - Embora as clulas nervosas variem em estrutura, um neurnio tpico de vertebrado apresenta
trs regies: dendrito, axnio e terminal sinptico.
VVVFF
As proposies a seguir relacionam-se Gentica.
0 0 - No cruzamento abaixo, se o alelo A1 for dominante, espera-se obter trs fentipos em F2.

1 1 - No cruzamento acima, se o alelos A1 e A2 forem codominantes, em F2 o nmero de fentipos


ser igual ao de gentipos.
2 2 - Um indivduo do grupo sanguneo A,Rh pode doar sangue para indivduos A,Rh; A,Rh+;
AB,Rh e AB,Rh+.
3 3 - O gene responsvel pela hemofilia, doena hereditria humana, est localizado no
cromossomo X. Por isso, a probabilidade de afetar indivduos do sexo feminino maior.
4 4 - Os genes letais so identificados em cruzamentos por causarem desvios em relao s
propores esperadas pela Primeira Lei de Mendel.
FVVFV
As afirmativas seguintes referem-se evoluo das idias sobre hereditariedade.
0 0 - Segundo a pangnese, cada rgo ou parte do corpo de um organismo vivo produziria
partculas hereditrias chamadas gmulas que seriam transmitidas aos descendentes no momento da
concepo.
1 1 - O microscpio foi importante para descartar o prformismo pois os citologistas no viam no
interior dos vulos e dos espermatozides nada que se assemelhasse a uma criatura em miniatura.
2 2 - A teoria cromossmica da herana foi desenvolvida pelo monge Gregor Mendel, a partir dos
seus trabalhos com ervilhas.
3 3 - Hoje sabe-se que os "fatores" de Mendel correspondem aos cromossomos das clulas.
4 4 - A engenharia gentica s se desenvolveu a partir dos estudos da dupla hlice do RNA.
VVFFF
A enorme diversidade dos seres atuais resultado de um longo processo de evoluo biolgica. As
proposies abaixo referem-se teoria da evoluo.
0 0 - Os rgos vestigiais e os fsseis so considerados evidncias do processo evolutivo.
1 1 - A figura abaixo representa os embries de diferentes vertebrados. As semelhanas so
explicadas por convergncia adaptativa.

2 2 - As asas das aves e dos insetos so estruturas homlogas pois apresentam a mesma funo.
3 3 - No existe nenhum exemplo de mecanismo evolutivo agindo atualmente nos seres humanos.
4 4 - Darwin explicou a adaptao dos organismos aos seus ambientes por meio da seleo natural.
VFFFV
Os seres vivos so adaptados no apenas ao ambiente fsico, mas tambm uns aos outros. As
afirmaes abaixo referem-se s relaes ecolgicas entre os seres de uma comunidade.
0 0 - Colnias e sociedades representam relaes harmnicas intra-especficas. As colnias formam
um conjunto funcional integrado e as sociedades so grupos de organismos que apresentam
cooperao.
1 1 - A competio nunca ocorre entre indivduos da mesma espcie, pois isso poderia acarretar
adestruio da populao.
2 2 - O eremita um caranguejo que se abriga em conchas vazias de caramujos. Sobre a concha
vivem uma ou vrias anmonas. As anmonas ganham mobilidade e os caranguejos se beneficiam
dos mecanismos de defesa, numa associao chamada amensalismo.
3 3 - A predao constitui um mecanismo regulador da densidade populacional tanto para as presas
como para os predadores.
4 4 - O herbivorismo a mais importante associao da natureza pois atravs dele que a energia
dos produtores pode se difundir para os demais nveis trficos.
VFFVV
Analise as proposies abaixo que se referem a alguns grupos de organismos.
0 0 - Todos os vrus so formados por uma cpsula protica que envolve o material gentico,
apresentam pouco citoplasma e so inquilinos de clulas animais e vegetais.
1 1 - Bactrias so procariontes que podem ser decompositores, parasitas, mutualistas, de vida livre,
hetertrofos ou auttrofos.
2 2 - Saccharomyces cereviseae um fungo utilizado na fabricao de vinho e cerveja, pois tem a
capacidade de realizar fermentao, processo durante o qual liberado o etanol.
3 3 - As plantas so organismos eucariontes pluricelulares e auttrofos. Em todas elas, a fecundao
tornou-se independente da existncia de gua para a locomoo dos gametas masculinos.
4 4 - Os organismos do reino Animalia so pluricelulares, eucariontes e hetertrofos.
FVVFV
As afirmaes a seguir referem-se a organismos dos reinos Protista, Vegetal e Animal.
0 0 - As figuras abaixo mostram o agente etiolgico e o vetor da malria.

1 1 - As brifitas no alcanam grandes dimenses porque no possuem vasos condutores.


2 2 - As angiospermas representam o nico grupo do reino Vegetal capaz de produzir sementes.
3 3 - Vermes parasitas do homem pertencem, principalmente, s classes Cestoda e Trematoda do
filo Platyhelminthes, bem como ao filo Nemathelminthes.
4 4 - Das classes de vertebrados, as que apresentam adaptaes para a vida em ambiente terrestre
mido so as dos Amphibia e Reptilia.
FVFVF
As proposies abaixo referem-se reproduo de organismos pluricelulares, bem como ao seu
desenvolvimento embrionrio.
0 0 - Considere os seguintes ciclos de vida:

1 1 - Os indivduos hermafroditas possuem ambos os sistemas reprodutores, masculino e feminino.


Em algumas espcies de hermafroditas, um indivduo pode fertilizar seus prprios vulos, enquanto
em outras, ocorrem cruzamentos entre indivduos diferentes.
2 2 - O esquema abaixo mostra um corte transversal do embrio de um vertebrado.

3 3 - Nas angiospermas, o fruto e a semente desenvolvemse, respectivamente, a partir do vulo e do


ovrio da flor.
4 4 - Flores ricas em nctar geralmente so polinizadas por insetos e beija-flores.
VVFFV
As afirmaes abaixo referem-se estrutura e s funes de plantas e de animais.
0 0 - Nas angiospermas e nos mamferos, a camada superficial do epitlio pluriestratificado, que
forma a epiderme, constituda por clulas mortas que tm por funo principal proteger o
organismo contra a perda excessiva de gua.
1 1 - A troca de gases no sistema respiratrio humano ocorre nos alvolos, enquanto nos vegetais
essa troca ocorre nas clulas que se encontram na superfcie da planta.
2 2 - O transporte de nutrientes orgnicos realizado pelos vasos lenhosos nas plantas e pelos vasos
sangneos nos animais.
3 3 - Para que as gemas laterais de uma planta se desenvolvam, necessrio que essas estruturas
no sejam influenciadas pelas auxinas da gema apical, enquanto uma criana cresce sob influncia
do hormnio somatotropina.
4 4 - Plantas carnvoras utilizam as secrees de certo tipo de tricoma para digerir sua presa
(geralmente um inseto) ao passo que os vertebrados possuem glndulas de vrios tipos, localizadas
em diversos rgos, para produzir as enzimas necessrias digesto de seu alimento.
FFFVV
Onde existe uma clula, deve ter existido uma clula preexistente, da mesma forma que o animal
surge de um animal e a planta de uma planta... Ao longo de todas as formas de vida, seja entre
organismos animais ou vegetais ou seus componentes, domina uma lei eterna de desenvolvimento
contnuo.
Rudolf Virchow, 1858

Observe os dois princpios dessa teoria a que o texto se refere, em seguida, assinale a alternativa
correta:
I. as clulas so unidades estruturais bsicas e fisiolgicas de todos os organismos vivos, exceto,
vrus;
II. as clulas so entidades distintas e os blocos construtores dos organismos mais complexos.

( a ) Teoria da Endossimbiose;
( b ) Teoria Organismal;
( c ) Teoria da Compartimentao: vasto sistema de membranas que forma numerosos
compartimentos;
( d ) Teoria Celular;
( e ) Teoria da Abiognese.
D
Assinale a alternativa que preenche as lacunas, abaixo, corretamente:

No fenmeno denominado ovulao na espcie humana, o que chamamos de vulo , de fato, um


_________, cuja _________ somente se completar se houver a fecundao.

( a ) ovognia / mitose;
( b ) corpo lteo / meiose;
( c ) ovcito primrio / mitose;
( d ) ovcito secundrio / mitose;
( e ) ovcito secundrio / meiose.
E
Analisando os tipos de clulas dos tecidos conjuntivos. Quais clulas possuem as caractersticas
abaixo:

I- presentes no tecido adiposo; tem quando adulta forma arredondada, com grande vacolo central
contendo lipdios. Armazenam substncias energticas para momentos de necessidade;
II- presentes nas cartilagens; tem forma arredondada e ncleo central;
III- presente nos ossos; tem ncleo central e longos prolongamentos citoplasmticos.

Assinale a alternativa correta:


( a ) I- Plasmcitos, II- Macrfagos, IIIFibroblastos.
( b ) I- Adipcitos, II- Condroblastos, IIIOsteoblastos.
( c ) I- Osteoblastos, II- Eosinfilos, IIIAdipcitos.
( d ) I- Adipcitos, II- Osteoblastos, IIIEritrcitos.
( e ) I- Condrcitos, II- Adipcitos, IIIOsteoclastos.
B
Trecho do livro A escalada do Everest de 1953 do autor Jonh Hunt, que relata a primeira
expedio a atingir o cume do Monte Everest a 8.850 metros de altitude. A essa altitude o
metabolismo dos humanos sofre alteraes profundas que podem levar morte, por isso os
escaladores fazem uso de oxignio adicional em garrafas pressurizadas. Diferentemente, as aves
podem manter alta atividade metablica, mesmo a altitudes elevadas devido a adaptaes que
aumentam as trocas de gases respiratrios.

Sobre o sistema respiratrio das aves, assinale a alternativa incorreta:

( a ) O ar inspirado no se mistura com o ar velho, diferente de como ocorre nos mamferos.


( b ) Presena de sacos areos que armazenam o ar, porm, no realizam as trocas gasosas.
( c ) A respirao das aves pulmonar.
( d ) O fluxo de ar contnuo e unidirecional atravs dos pulmes.
( e ) Presena de mecanismos de transporte ativo que aumentam suas trocas gasosas respiratrias.
B
No trecho da msica, acima, so citados vrios animais, sendo alguns pertencentes ao Filo
Chordata. Este filo compreende alguns grupos de invertebrados e todos os animais vertebrados.
Seus representantes so encontrados em todos os hbitats, sejam terrestres, marinhos ou de gua
doce e, por isso, apresentam estratgias reprodutivas muito variveis. Considerando os animais do
Filo Chordata citados na msica, assinale a alternativa que correlaciona a classe a qual pertencem
com o tipo de fecundao.

(a) Cephalopoda: vivparos; Aves: ovparos; Mammalia: vivparos


(b) Chondrichthyes: ovparos, ovulparos ou ovovivparos ; Aves: ovulparos; Mammalia: vivparos
(c) Reptilia: ovulparos; Aves: ovulparos; Mammalia: vivparos
(d) Osteichthyes: ovparos, ovulparos, ovovivparos ou vivparos; Aves: ovparos; Mammalia:
vivparos
(e) Malacostraca: ovparos, ovulparos ou ovovivparos; Aves: ovulparos; Mammalia: vivparos
C
Sua extremidade envolvida por um tecido em forma de capuz, a coifa, que protege o meristema
apical de eventuais danos durante a sua penetrao no solo. Seu meristema apical origina, alm da
coifa, os trs primeiros meristemas da planta: protoderme, meristema fundamental e procmbio.

Todas essas caractersticas pertencem:


( a ) raiz;
( b ) ao caule;
( c ) folha;
( d ) ao fruto;
( e ) flor.
B
Escolha a alternativa que melhor completa a frase:

As clulas do tecido epitelial glandular produzem substncias chamadas de secrees, que podem
ser utilizadas em outras partes do corpo ou eliminadas do organismo. Essas secrees podem ser
___(1)___, quando espessas e ricas em muco; ___(2)___, quando fluidas e ricas em protenas; ou
___(3)___, quando secrees mucosas e serosas ocorrem juntas.

( a ) (1) excrinas (2) mistas (3) endcrinas.


( b ) (1) mistas (2) mucosas (3) serosas.
( c ) (1) acinosa (2) tubulosa (3) tbuloacinosa.
( d ) (1) mucosas (2) serosas (3) mistas.
( e ) (1) mistas (2) excrinas (3) endcrinas.
Vrias substncias, tais como alguns remdios para emagrecer, venenos, pesticidas, entre outros,
agem interferindo no processo de fosforilao oxidativa. O fluorocarbonil-cianeto fenilhidrazona
(FCCP) um composto encontrado em agrotxicos capaz de impedir a passagem de prtons atravs
da ATPsintase.

Assim, ao analisar as clulas de uma pessoa que tenha sido intensamente exposta ao FCCP, a maior
parte dessa substncia ser encontrada:

( a ) Nos peroxissomos.

( b ) Na mitocndria.

( c ) Nos lisossomos.

( d ) No retculo endoplasmtico.

( e ) No complexo de Golgi.
As reaes acima se referem a:

( a ) A: fotossntese; B: gliclise.

( b ) A: quimiossntese; B: respirao.

( c ) A: fotossntese; B: respirao.

( d ) A: quimiossntese; B: gliclise.

( e ) A: fotossntese - fase clara; B: fotossntese - fase de carboxilao.


Com relao aos Chondrichthyes, analise os itens a seguir:

I. Seus representantes so os tubares, quimeras e raias.

II. So cordados, vertebrados, gnatostmios que possuem esqueleto formado por cartilagem.

III. A natao torna-se mais gil pela presena de grupos musculares segmentados ao longo do
corpo como tambm pela existncia de nadadeiras peitorais e plvicas que agilizam a
movimentao do peixe.

IV. Apresentam boca terminal, brnquias protegidas pelo oprculo e bexiga natatria.

Esto corretos os itens da alternativa: ( a ) I e II.

( b ) II, III e IV.

( c ) I, II e IV.

( d ) I, II, III.

( e ) I, II, III e IV.


O desenvolvimento das plantas em suas diversas manifestaes regulado por hormnios vegetais,
ou fitormnios. Observe o quadro abaixo:

Agora, dentre as principais funes dos hormnios, escolha a alternativa que completa o quadro
corretamente:

( a ) I- Citocinina, II- Giberelina, III - Etileno, IV- cido abscsico e V-Auxina.

( b ) I- Etileno, II- cido abscsico, III- Giberelina, IV- Auxina e V- Citocinina.

( c ) I- Auxina, II- Giberelina, III- Citocinina, IV- cido abscsico e V- Etileno.

( d ) I- cido abscsico, II- Auxina, III- Etileno, IV- Citocinina e V- Giberelina.

( e ) I- Auxina, II- Citocinina, III- Giberelina, IV- Etileno e V- cido abscsico.


O filo Mollusca, do qual o polvo faz parte, o segundo maior do reino Animalia em nmero de
espcies descritas. Assinale a alternativa que apresenta somente representantes deste filo:

( a ) Lulas (Cephalopoda), Estrelas-do-mar (Asteroidea) e Mexilhes (Bivalvia).

( b ) Lesmas (Gastropoda), Dentlios (Scaphopoda) e Mexilhes (Bivalvia).

( c ) Mexilhes (Bivalvia), Minhocas (Oligochaeta) e Lulas (Cephalopoda).

( d ) Lesmas (Gastropoda), Lulas (Cephalopoda) e Medusas (Scyphozoa).

( e ) Dentlios (Scaphopoda), Lulas (Cephalopoda) e Medusas (Scyphozoa).


Quando se poda uma roseira observa-se um rpido crescimento das gemas laterais para a formao
de ramos vegetativos. Isto ocorre porque as gemas laterais:

a) passam a produzir menos auxinas;


b) intensificam a produo de etileno e giberelinas;
c) recebem menos citocininas;
d) passam a receber mais auxinas;
e) recebem menos auxinas.
RESPOSTA: E
Se cruzarmos dois gatos, sendo ambos heterozigticos (Aa), obteremos:

a) Apenas indivduos Aa;


b) Indivduos AA e aa, na proporo de 3:1, respectivamente;
c) Indivduos AA e aa, na proporo de 2:1, respectivamente;
d) Indivduos AA, Aa e aa, na proporo de 1:2:1, respectivamente.
RESPOSTA: Se os dois gatos so heterozigticos, logicamente os dois tero o gentipo Aa, dessa
forma:

Conforme a resoluo acima, podemos concluir que os descendentes desse cruzamento tero
gentipo AA, Aa e aa na proporo de 1:2:1 respectivamente.
As parasitoses intestinais esto entre as infeces mais comuns em todo o Mundo, cuja elevada
prevalncia est associada com a pobreza e com o subdesenvolvimento. Sobre as parasitoses
intestinais e os seus agravantes, verifica-se o seguinte:
a) A prevalncia de parasitoses alta em locais nos quais as condies de vida e de saneamento
bsico so ainda satisfatrias, visto que o conhecimento dos princpios de higiene pessoal e dos
cuidados na preparao dos alimentos no suficiente para minimizar a facilidade de reinfeco em
reas endmicas.
b) A populao humana que vive em condies precrias de saneamento bsico, de abastecimento
de gua, de habitao e da falta de hbitos de higiene pessoal e coletiva a mais propensa
aquisio de enteroparasitoses, por isso, h a necessidade de formulao e aplicao de medidas
polticas intersetoriais que garantam o acesso universal aos servios de sade.
c) Para haver um maior controle das enteroparasitoses, necessrio, ainda, conhecer os seus agentes
etiolgicos, normatizar, coordenar e avaliar as aes estratgicas de preveno e controle, visto que
a identificao dos principais fatores de risco e o desenvolvimento de atividades de educao
continuada para profissionais da sade no contribuem efetivamente para este controle.
d) Ascaridase, tricurase, infeces por ancilostomdeos e algumas helmintases intestinais esto
listadas entre as doenas negligenciadas e so restritas s regies tropicais, concentradas nas
populaes mais pobres e ocasionam altas taxas de mortalidade na Amrica Latina.
B
Uma investigao gentica pode comear com a observao de uma variao detectada na
morfologia ou fisiologia, isto , um fentipo variante. O fentipo da calvcie um desses, sendo
expresso distintamente em homens e mulheres: dominante nos homens e recessivo nas mulheres.
Esse tipo de evento ocorre, por exemplo, devido presena de hormnios sexuais em taxas
diferentes nos dois sexos e independe de o gene C se localizar em cromossomo sexual ou
autossmico, conforme se observa a seguir.

O padro de calvcie uma herana:


a) autossmica dominante
b) restrita ao sexo
c) influenciada pelo sexo
d) autossmica recessiva
C
Nos ecossistemas em que os fatores abiticos so favorveis, nota-se maior quantidade de seres
vivos e maior biodiversidade, incluindo sua diversidade gentica e ecolgica. No quadro a seguir
esto apresentados dados que se referem fixao do carbono e produo de oxignio em
diferentes ambientes.

Com base nos dados acima, a ao de maior ameaa e de gravidade ao suprimento de gs oxignio
atmosfrico a:
a) transformao de estepes em reas desertificadas e savnicas.
b) substituio da composio vegetacional local para monoculturas.
c) poluio das guas marinhas afetando o ciclo de vida do fitoplncton.
d) explorao intensiva do solo, gerando modificaes na constituio de macronutrientes.
C
Po, mel, macarro, carne, batata, feijo e arroz so diferentes alimentos que a populao humana
ingere para a manuteno do metabolismo energtico do seu organismo. A composio nutricional
dos alimentos geralmente apresentada em percentuais nos rtulos, como apresentado a seguir.

Sobre a composio nutricional apresentada, verifica-se o seguinte:


a) O consumo de alimentos com alto %VD de fibras ajuda a controlar as taxas de glicemia e de
colesterol, bem como melhora o trabalho do intestino e ainda aumenta a sensao de saciedade,
diferentemente da ingesto de gorduras.
b) O sdio com %VD no to elevado, presente no sal de cozinha e em alimentos industrializados -
salgadinhos de pacote, molhos prontos e embutidos - atua na regulao hdrica e independente da
quantidade consumida minimiza a reteno de lquidos e mantm a presso arterial.
c) O consumo de gorduras saturadas retarda o metabolismo, gerando um menor gasto calrico pelo
organismo e favorecendo o %VD consumido, visto que essas substncias atuaro na construo e
manuteno dos tecidos e rgos do nosso organismo.
d) As protenas encontradas em alimentos de origem animal e vegetal, como carne, pele de frango,
queijos, toucinho, leite integral e verduras, quando ingeridas com alto %VD, podem aumentar o
risco de doenas cardiovasculares.
A
A Terra proporciona um pano de fundo em eterna mudana para o desenvolvimento das
comunidades biolgicas. Os milhes de anos da histria da Terra incluem mudanas no clima e em
outras condies fsicas, rearranjos dos continentes e bacias ocenicas, crescimento e desgaste das
cadeias de montanhas e uma evoluo contnua das formas de vida. A consequncia mais bvia
desta histria a distribuio heterognea de uma biodiversidade existente no planeta.

Sobre a classificao e a distribuio da diversidade biolgica em reinos, como ilustrado no


diagrama acima, verifica-se que o reino:
a) monera compreende organismos unicelulares, aclorofilados e eucariticos.
b) fungi compreende organismos pluricelulares, clorofilados e procariticos.
c) protista compreende organismos unicelulares, clorofilados e procariticos.
d) plantae compreende organismos pluricelulares, clorofilados e eucariticos.
D
As algas Laminaria (alga parda conhecida como Kombu) e Porphyra (alga vermelha conhecida como
nori), por serem excelentes fontes de vitaminas e sais minerais, so utilizadas na alimentao humana.
Sobre as algas, tem-se o seguinte:

a) ainda que as algas tenham elevado poder nutricional, os polissacardeos-alginatos e gar so utilizados
para fins industriais.
b) assim como as leveduras, as algas possuem alto teor de Iodo, favorecendo a diminuio de bcio na
espcie humana.
c) as clulas das algas possuem parede celular composta por quitina e glicose, o que favorece a sua
ingesto na alimentao humana.
d) assim como os protozorios, as algas liberam substncias txicas capazes de inibir o desenvolvimento
de outras espcies, desencadeando o processo de mar vermelha.
A
A foto acima alude Guerra do Vietn, que durou 21 anos e utilizou como ttica para localizar inimigos
nas densas florestas da regio o agente laranja. Ele era lanado por avies sobre extensas reas de
florestas e foi desenvolvido com base na atuao dos fitormnios na absciso foliar. Quando lanado
nestas reas, o primeiro efeito do agente laranja foi:

a) a produo de razes adventcias.


b) a queda das folhas.
c) a maturao dos frutos.
d) o alongamento das clulas caulinares.
B
Na Bahia, a doena conhecida como vassoura-de-bruxa provocou grande perda na produo de cacau.
Os agentes etiolgicos podem ser fungos e vrus, que provocam:

a) o esfarrapamento dos frutos em cerdas como vassoura, sem alterao dos meristemas.
b) a ramificao de hifas presas planta, como cerdas em uma vassoura.
c) a formao na planta de ramos em longos feixes, lembrando uma vassoura.
d) o alongamento dos frutos em ramos, como vassoura, decorrentes do seu apodrecimento.
C
A funo primria do sistema digestrio o fornecimento de gua, ons e nutrientes para o corpo. Nem
todos os animais possuem um sistema digestrio, entretanto, aos que possuem, algumas variaes podem
ocorrer, como no caso dos mamferos ruminantes (bois, cabras, camelos, girafas, etc), cujos estmagos
possuem mais de uma cavidade.
Sobre estas variaes em ruminantes, tem-se que os estmagos so divididos em:

a) dois compartimentos que favorecem a digesto do capim ingerido pelos mamferos ruminantes.
b) trs compartimentos, o que permite melhor aproveitamento dos vegetais utilizados como alimento
exclusivo.
c) quatro compartimentos que permitem melhor aproveitamento dos nutrientes utilizados como alimento
exclusivo, como ocorre com as aves granvoras e os crocodilianos.
d) quatro compartimentos, o que permite a digesto da celulose no estmago dos ruminantes pelas
bactrias presentes.
D
Alguns protozorios atuam como parasitas do ser humano e outros seres vivos como, por exemplo, o
Trichomonas vaginalis. Esse parasita capaz de promover danos na mucosa tubria, com destruio das
tubas uterinas e impedimento da passagem dos gametas. Sobre a doena causada pelo T. vaginalis,
verifica-se que:

a) o protozorio infecta a cavidade bucal e o intestino.


b) a infeco de repetio predispe infertilidade feminina.
c) a parasitose no causa sintomas adversos nos homens.
d) a transmisso inclui vias de contaminao no sexuais.
B
Leia as afirmaes abaixo relativas transmisso dos caracteres na reproduo sexuada.

I - Os caracteres so transmitidos dos pais para os filhos devido a informaes contidas no sangue
dos pais, que se concentram no esperma do homem e nas excrees vaginais da mulher.
II - Os caracteres so transmitidos dos pais para os filhos devido a informaes contidas no interior
das clulas reprodutoras masculinas e femininas, chamadas gametas, que se unem na fecundao.
III - Os cromossomos existem aos pares nas clulas e os genes ocupam um lugar definido no
cromossomo, chamado locus gnico, assim, os genes tambm existem aos pares. Os pares de
cromossomos semelhantes so chamados cromossomos homlogos, e os pares de genes que
ocupam um mesmo locus nestes cromossomos so chamados genes alelos.

Das afirmaes acima est (esto) correta (s):

a) I, apenas
b) II e III, apenas
c) III, apenas
d) II, apenas
e) I, II e III.
RESPOSTA: b
A alternativa I est errada porque os caracteres dos pais so transmitidos aos filhos atravs de
informaes contidas nos gametas (espermatozoide e vulo) do pai de da me.
O gs carbnico age como um gs estufa e suas concentraes na atmosfera tm mudado no
decorrer dos anos, conforme apresentado na figura a seguir.

RICKLEFS, R. E. A economia da natureza. Rio de Janeiro: Guanabara Koogan, 2009. p. 473.

Sobre este assunto, CORRETO afirmar:

a) o aumento na concentrao de CO2 foi maior nos ltimos 30 anos, atingindo a estabilidade a
partir do ano 2000.
b) os nveis crescentes de CO2 na atmosfera, a partir de 1860, podem ter sido ocasionados pela
diminuio da temperatura mdia da Terra.
c) a diminuio da concentrao de CO2, na atmosfera, antes de 1960, pode ter sido causada pelo
menor consumo de carvo, leo e gs para produo de energia.
d) antes de 1860, a concentrao de CO2 na atmosfera era escassa numa ordem de 280ppm, havendo
um aumento para mais de 350ppm, durante os ltimos 150 anos.
D
Pesquisas genticas esto sendo realizadas com a finalidade de estabelecer as rotas de migrao das
primeiras populaes humanas que deixaram a frica. Em uma dessas rotas, foram comparadas
sequncias de DNA em mais de mil voluntrios de 54 regies do planeta. Os resultados mostraram
que a espcie humana descende de uma populao reduzida que veio da frica h 70 mil anos,
quando, provavelmente, ocorreu algum tipo de desequilbrio ecolgico que quase causou a extino
da espcie, resultando numa reduo da variao gentica nos descendentes. O processo evolutivo
que explica essa situao denominado:
a) crossing over
b) deriva gentica
c) migrao
d) mutao
B
No processo evolutivo das plantas, algumas estruturas adaptativas foram essenciais para garantir a
sobrevivncia nos diferentes locais em que elas so encontradas. So exemplos dessas estruturas:

a) acleo e bulbo
b) espinho e catafilo
c) claddio e gavinha
d) haustrio e pneumatforo
D
Estudos sobre comunidades de espcies em ilhas tm levado ao desenvolvimento de princpios
gerais sobre a distribuio da diversidade biolgica, como o modelo representado na figura a seguir.

PRIMACK, Richard B.; RODRIGUES, Efraim. Biologia da conservao. Londrina: Planta, 2001. p. 79.

A partir da interpretao da figura pode-se concluir que:

a) a relao entre a riqueza de espcies e a rea da ilha aumenta com o tamanho da ilha.
b) as condies adversas nas ilhas menores explicam a reduo no nmero de espcies nessas ilhas.
c) as ilhas maiores apresentam maior riqueza de espcies, estando estas mais vulnerveis extino
ao longo do tempo.
d) no existe uma relao evidente entre o nmero de espcies e o tamanho da ilha.
A
A que reino e classe pertence a abelha?
RESPOSTA: A abelha pertence ao reino animal, pois um ser pluricelular, hetertrofo e eucarionte.
E pertence classe dos insetos, pois possuem simetria bilateral, corpo segmentado, um par de
antenas, 2 pares de asas, 3 pares de pernas dentre outras caractersticas.
Durante a mitose, as cromtides separam-se e migram para os polos da clula, medida que os
microtbulos das fibras cinetocricas se encurtam progressivamente. Considerando-se que, nessa
fase da mitose, as cromtides movem-se na mesma velocidade, aproximadamente 1,0 micrmetro
por minuto, CORRETO afirmar:

a) os cromossomos anafsicos estaro em repouso em relao aos polos, se a acelerao escalar for
constante e igual a zero.
b) os cromossomos realizam movimento acelerado at a telfase, se a velocidade escalar e a
acelerao escalar tiverem sinais contrrios.
c) os cromossomos realizaro movimento uniforme em direo aos polos durante a anfase, apesar
de acelerados durante a metfase e retardados durante a telfase.
d) os cromossomos realizaro movimento variado, se a velocidade escalar instantnea for crescente
logo aps a metfase e decrescente imediatamente antes da telfase.
D
Parte da evoluo dos seres vivos, desde sua origem, pode ser cronologicamente classificada da
seguinte forma:

As medidas de tempo apresentadas na terceira coluna podem ser reescritas como:

a) 0,0035 tera-anos, 1,5 mega-anos e 70x10 anos.


b) 3,5 giga-anos, 1,5x10 anos e 700 mega-anos.
c) 3,5x10 anos, 1,5 giga-anos e 70x10 anos.
d) 3,5 giga-anos, 1,5 giga-anos e 7x10 anos.
A atmosfera terrestre atual composta de gases como nitrognio, oxignio, dixido de carbono,
argnio, nenio, hlio, metano, criptnio, hidrognio e xennio, alm de substncias como vapor de
gua. O oxignio livre e, especialmente, o oznio formam uma camada protetora de raios
ultravioleta e outras radiaes. Sobre a constituio da atmosfera primitiva e da atmosfera atual,
CORRETO afirmar:

a) a fora da gravidade permitiu a conteno de gases e partculas, principalmente acima da


troposfera, que posteriormente compuseram a atmosfera primitiva.
b) o aquecimento e o campo gravitacional da Terra primitiva permitiram a formao de coacervatos
em acmulos de gua.
c) os gases e a presso atmosfrica distribuem-se em razo inversa ao longo da troposfera,
mesosfera, ionosfera e exosfera.
d) por causa da menor fora da gravidade acima da troposfera, forma-se uma camada de ar rarefeito
que no bloqueia as radiaes solares nocivas aos organismos vivos.
A
A clula vegetal revestida externamente pela parede celular. Considerando-se o componente mais
abundante na sua constituio, CORRETO afirmar que essa parede apresenta natureza:

a) inorgnica.
b) lipdica.
c) polissacardica.
d) protica.
C
Acerca dos componentes celulares e suas respectivas funes, est CORRETA a seguinte
associao:

a) centrolos - sntese de lipdeos.


b) complexo golgiense - sntese de protenas.
c) peroxissomo - sntese de carboidratos.
d) retculo endoplamtico no granuloso (liso) - sntese de esteroides.
D
A mitose, embora seja um processo contnuo, dividida em fases. A fase da mitose em que os
cromossomos so observados com maior nitidez e grau de condensao e em que geralmente
utilizada no estudo de caritipos a:

a) anfase
b) metfase
c) prfase
d) telfase
D
A placenta um anexo envolvido no processo de desenvolvimento embrionrio e estabelece as
relaes materno-fetais at o nascimento. Dentre as funes que exerce, CORRETO afirmar que a
placenta:

a) impede a passagem de bactrias que causam rubola e toxoplasmose.


b) participa do processo de clivagem na formao da gstrula.
c) produz o hormnio ocitocina que favorece a expulso do feto.
d) realiza trocas gasosas e metablicas na relao feto-me.
D
Para os seres vertebrados terrestres, manter a temperatura de seu corpo a uma temperatura
independente da temperatura ambiente fundamental. Os mecanismos termorreguladores que
garantem essa independncia podem ser de dois tipos: a ectotermia e a endotermia. Sobre esses
mecanismos termais, CORRETO afirmar:

a) a ectotermia o processo segundo o qual os animais aquecem seus corpos por meio da produo
de calor pelo metabolismo interno.
b) a endotermia empregada pela generalidade das aves e dos mamferos, enquanto a ectotermia
empregada pela generalidade dos rpteis.
c) os animais endotrmicos so aqueles que aquecem seus corpos por meio de fontes externas de
calor, como o sol ou uma rocha aquecida.
d) a ectotermia empregada pela generalidade das aves e dos mamferos, enquanto a endotermia
empregada pela generalidade dos rpteis.
B
A respeito do olho humano, CORRETO afirmar:

a) as clulas fotorreceptoras esto contidas na retina e so responsveis pela colimao da luz que
entra atravs da pupila, fazendo o feixe estimular o nervo ptico rapidamente.
b) o cristalino uma lente delgada e transparente, formada por protena e tem a caracterstica de
mudar a sua forma para focalizar a imagem, sendo que, quando um objeto est longe, o cristalino
torna-se mais arredondado.
c) os bastonetes so fotorreceptores de forma reta e delgada, que cobrem quase toda a retina e
funcionam mais eficientemente na determinao de cores e em altas intensidades luminosas.
d) os cones so clulas fotorreceptoras que permitem a percepo de cores durante o dia e so
sensveis s cores primrias azul, verde e vermelho. As cores intermedirias so combinaes destas
trs.
D
Nos humanos, a reduo da temperatura abaixo de 35 C denominada hiportermia. Sobre esse
assunto, CORRETO afirmar:

a) a submerso do corpo humano em gua gelada uma ao hipotrmica mais potente que a
exposio ao ar atmosfrico gelado.
b) em humanos, os mecanismos de induo de hiportermia envolvem a regulao de calor estocado
por vasodilatao e pelo calafrio.
c) em reao hipotermia, o ser humano utiliza a presena de pelos e de tecido rico em gordura sob
a pele como mecanismos de termognese.
d) o organismo humano se adapta melhor ao frio que ao calor, pois eleva sua temperatura corporal
por fonte externa de calor, como a luz solar.
A
O intervalo de frequncia das ondas sonoras audveis para o ouvido humano varia de 20 a 20.000
Hz. Sons altos produzem poluio sonora e, em funo disso, em algumas fbricas, os trabalhadores
utilizam protetores auditivos. A curto e a mdio prazo, a poluio sonora pode produzir nas pessoas:

a) alteraes de comportamento, nusea, vmitos e hipertenso.


b) irritao, alteraes de comportamento e diminuio da audio.
c) irritao, coceira, alteraes de comportamento e surdez.
d) nusea, alteraes de comportamento e surdez completa.
B
Quando ocorre um ferimento com sangramento, as fibras musculares do vaso sanguneo danificado
contraem-se, diminuindo o fluxo do sangue. Para que se inicie a coagulao nesse local,
necessria a liberao da seguinte enzima:

a) colgeno
b) fibrina
c) fibrinognio
d) tromboplastina
D
Os sistemas de classificao dos seres vivos apiam-se em caractersticas morfolgicas e,
atualmente, filogenticas, as quais visam agrupar os organismos, segundo afinidades naturais. Com
base nos sistemas atuais de classificao, figuram, no mesmo grupo, os seguintes organismos:

a) algas e plantas.
b) algas e protozorios.
c) bactrias e fungos.
d) vrus e protozorios.
B
O grau de turgescncia das clulas-guarda fator determinante para a abertura ou fechamento dos
estmatos. No entanto, a entrada ou sada de gua dos vacolos das clulas-guarda depende da
integrao de vrios fatores que atuam simultaneamente, como ilustrado no grfico a seguir.

A respeito do tema e, aps a anlise do grfico, possvel reconhecer os seguintes fatores que
influenciam os movimentos de abertura e fechamento dos estmatos:

a) gs oxignio (1), on sdio (2) e gs carbnico (3).


b) luz solar (1), cido abscsico (2) e gs carbnico (3).
c) luz solar (1), on potssio (2) e gs carbnico (3).
d) luz solar (1), on potssio (2) e gs oxignio (3).
C
Os fungos so importantes organismos popularmente conhecidos como leveduras, bolores, mofos e
cogumelos de chapu. Participam ativamente de processos de fermentao, como no caso da
fabricao de vinho e de po, que dependem de produtos liberados pelas leveduras durante sua
atividade fermentativa. Os principais produtos das reaes qumicas que interessam mais
diretamente fabricao do vinho e do po so:

a) cido ltico e lcool etlico.


b) lcool etlico e cido actico.
c) lcool etlico e gs carbnico.
d) gs carbnico e cido ltico.
C
As floraes so fenmenos que ocorrem em ecossistemas aquticos quando h uma proliferao de
cianobactrias em dias quentes. Nesse processo, h a liberao de toxinas que esto diretamente
relacionadas sade humana. Acerca das cianobactrias e suas caractersticas, CORRETO
afirmar:

a) possuem acinetos que permitem sua flutuao na gua.


b) possuem heterocistos que realizam a fixao de nitrognio.
c) so organismos heterotrficos e assimilam O2.
d) so organismos quimiossintetizantes e liberam CO2.
B
A fotossntese um mecanismo importante para manuteno metablica de plantas e algas. A
fotossntese pode ser representada pela seguinte equao qumica:
Clorofila
6CO2 + 6H2O + Luz C6H12O6 + 6O2

Acerca desse processo, CORRETO afirmar:

a) endotrmico e anablico.
b) exotrmico e catablico.
c) libera CO2 e sintetiza clorofila a.
d) produz gua e sais inorgnicos.
A
O sistema circulatrio dos insetos permite uma circulao de hemolinfa no to rpida, mas esses
animais podem conseguir quantidades representativas de energia. A respeito desses organismos,
CORRETO afirmar:

a) armazenam amido como fonte energtica.


b) contm pigmentos exclusivos para o transporte de CO2.
c) possuem um corao acessrio que bombeia hemolinfa.
d) so anaerbicos e liberam O2.
C
Quais so as caractersticas nutricionais do mel?
Observe a anatomia do olho e marque a alternativa correta.

a) I. Crnea; II. ris; III. Cristalino; IV. Nervo ptico; V. Retina;


b) I. Retina; II. Cristalino; III. Nervo ptico IV. ris; V. Crnea;
c) I. Crnea; II. Retina; III. Cristalino; IV. Nervo ptico; V. ris;
d) I. Cristalino; II. ris; III. Nevo ptico; IV. Crnea; V. Retina;
e) I. Crnea; II. Cristalino; III. ris; IV. Nervo ptico; V. Retina.
RESPOSTA: O mel uma substncia produzida pelas abelhas, possui sabor doce e rico em
protenas, sais minerais, vitaminas B, C, D, E, enzimas, dextrinas, aminocidos, alm de hormnios
naturais e essenciais. O mel auxilia no combate a micro-organismos, melhora o sistema
imunolgico e muito bom no tratamento de doenas.
RESPOSTA: A
Os fungos representam o segundo maior grupo de organismos existentes no planeta Terra, sendo
suplantados apenas pelos insetos. O impacto ecolgico destes seres vivos fundamental, haja vista
que so um dos principais decompositores da biosfera. Pertencentes ao Reino Fungi, compreendem
os bolores, os cogumelos, as orelhas-de-pau e as leveduras. Pode-se afirmar que estes organismos
so:

a) eucariontes, heterotrficos e, geralmente, multicelulares.


b) procariontes, auxotrficos e, geralmente, unicelulares.
c) procariontes, heterotrficos e, nunca, multicelulares.
d) eucariontes, auxotrficos, e, nunca, unicelulares.
A
A tabela acima apresenta os gentipos correspondentes aos fentipos do sistema ABO. Sobre as
interaes allicas envolvidas nesse sistema, pode-se afirmar:

a) a recessividade e a dominncia incompleta so observadas nos tipos A e AB, respectivamente.


b) a recessividade observada no tipo O decorre da ausncia de antgeno na superfcie das hemcias.
c) a dominncia incompleta possivelmente observada em graus de intensidade variveis nos tipos
A e B.
d) nos tipos B e AB, as interaes allicas so as dominncias completa e incompleta,
respectivamente.
C
Na atualidade, h um quadro diversificado de doenas infecciosas e crnico-degenerativas,
transmissveis e no transmissveis. Sobre essas doenas e suas respectivas transmisses, pode-se
afirmar que:

a) a leptospirose causada por um vrus, transmitido por roedores infectados gerando dores
musculares, nusea e vmitos.

b) a dengue causada pela picada do mosquito Aedes aegypti, transmitida pelo bacterifago
presente nas gotculas de saliva do vrus.

c) a amebase causada por uma bactria, transmitida atravs da ingesto de gua ou alimentos
contaminados por cepas ou cistos.

d) a sfilis causada por uma bactria e pode ser transmitida por via sexual ou, quando a me est
contaminada, por via congnita.
D
As protenas so macromolculas presentes em seres vivos e desempenham papis importantes nos
diversos sistemas biolgicos. Um fragmento hipottico de uma protena, em que R1 e R2
representam as pores restantes dessa molcula, est representado a seguir:

Baseando-se na anlise dessa estrutura e das propriedades desses compostos, conclui-se que:
a) a ligao qumica entre o nitrognio e o carbono com hibridizao sp3 conhecida como ligao
peptdica.
b) essas molculas diminuem a energia de ativao das reaes qumicas nos sistemas biolgicos.
c) a sequncia em que os aminocidos esto ligados representa a estrutura secundria dessa
molcula.
d) na formao das protenas, os aminocidos naturais e secundrios so obtidos a partir de fontes
naturais.
B
Solos deficientes de nitrognio so enriquecidos por adubao com compostos base de nitratos.
Entretanto, o uso indiscriminado desses compostos pode levar a sua absoro por alguns tipos de
plantas que sero destinadas ao consumo humano. No organismo, o on nitrato convertido em on
nitrito e pode causar danos a quem o ingeriu. Para contornar esse problema, pode-se empregar a
adubao natural, em que a fertilizao do solo se d pelo plantio de leguminosas. Sobre esse
assunto, tem-se o seguinte:
a) o nitrognio nos dois ons descritos apresenta o mesmo nmero de oxidao e so utilizados
como conservantes de alimentos.
b) o armazenamento de pigmentos clorofilianos e caratenoides nas clulas da cenoura a caracteriza
como uma planta leguminosa.
c) o plantio de leguminosas adequado, pois elas contm bactrias fixadoras de nitrognio em
ndulos de suas razes.
d) o emprego de nitrato de sdio na adubao do solo aumenta a sua acidez, o que favorece o
cultivo de plantas leguminosas.
C
Qual a diferena da abelha rainha para as outras abelhas?
RESPOSTA: A abelha rainha a nica abelha fmea que possui os rgos sexuais completamente
formados, ela nasce de um ovo e alimentada com geleia real (alimento rico em protenas). Ela
copula com vrios zanges e sua funo colocar ovos, tendo uma vida aproximada de 5 anos. J as
abelhas operrias tm funes distintas como produzir cera, construir o favo, cuidar das larvas,
vivendo cerca de 4 meses.
Na figura abaixo, esto esquematizados dois importantes processos celulares (I e II).
De acordo com a figura, responda:

a) Qual processo fisiolgico est envolvido nas representaes I e II, respectivamente? Qual
organela celular especializada para realizao de cada processo?
b) Como os processos I e II esto envolvidos no fluxo energtico de uma cadeia alimentar?
A gametognese fundamental para o sucesso reprodutivo dos animais. No homem, a
espermatognese um processo que garante a produo dos gametas e ocorre nos testculos. A
figura abaixo ilustra algumas fases desse processo.

De acordo com a figura,


a) classifique cada uma das fases indicadas;
b) quais so as porcentagens dos gentipos no final da diviso meitica?
c) explique dois eventos, que ocorrem na espermatognese, que garantem a variao gnica na
reproduo sexuada.
Segundo a pesquisa do Instituto Nacional de Pesquisa de Polticas Pblicas do lcool e Outras
Drogas (Inpad) da Universidade Federal de So Paulo (Unifesp), em 2011 o consumo de cocana
intranasal (cheirada) foi mais elevado que a pulmonar (crack e oxi), com 2,3 milhes de usurios
adultos e 226 mil adolescentes. Na forma de crack e oxi, o nmero de usurios foi de 1 milho de
adultos e 18 mil adolescentes (Empresa Brasil de Comunicao-EBC). De acordo com o estudo,
27% dos usurios dos dois tipos de cocana - em p, de uso nasal, e em pedra, fumando -
consumiram a droga todos os dias ou ao menos duas vezes por semana, no ano passado. Quase
metade (48%) do total de usurios dos dois tipos de cocana foi identificada como dependente
qumico, mas apenas 30% destes disseram ter a inteno de interromper o uso de drogas.
Disponvel em: <www.agenciabrasil.ebc.com.br/noticia/2012-09-05>. Acesso em: 04 set. 2013. (Adaptado).

Com base no texto, o nmero de usurios que consomem os dois tipos de cocana todos os dias ou
no mnimo duas vezes por semana de

a) 828.342 usurios
b) 956.880 usurios
c) 956.961 usurios
d) 896.320 usurios

A quantidade de pessoas que desejam interromper o uso de drogas

a) 510.336
b) 1.123.240
c) 287.064
d) 1.063.200
38 - B
39 - A
Os grficos abaixo representam o efeito inibitrio de dois antibiticos (I e II) sobre a sntese
protica em culturas de Staphylococcus aureus. As setas nos grficos indicam o momento em que
foram administrados os antibiticos nas culturas.

Com base nos grficos, explique a atuao dos antibiticos I e II sobre a sntese protica.
A distino fundamental entre clulas procariontes e eucariontes a ausncia e a presena de ncleo
circundado por membranas, respectivamente. Em relao a outras diferenas entre essas clulas,
verifica-se que, em procariontes,

a) as clulas medem de 10 a 100 m, enquanto, em eucariontes, as clulas medem de 1 a 10 m.


b) o DNA circular com algumas histonas, enquanto, em eucariontes, h cromossomos complexos
com protenas histnicas e no histnicas.
c) a nutrio ocorre por fotossntese, enquanto, em eucariontes, a nutrio ocorre por absoro e
ingesto.
d) observam-se movimentos intracelulares, enquanto, em eucariontes, no se observam movimentos
intracelulares.
B
Na espcie humana, a ocorrncia de um ferimento com sangramento faz com que as fibras
musculares do vaso sanguneo danificado se contraiam, diminuindo o dimetro do vaso e,
consequentemente, do fluxo sanguneo. Tal ao s possvel devido liberao de:

a) trombina, que, na presena de ons sdio e de vitamina D do sangue, catalisa uma reao qumica
propiciando a transformao da trombina em protrombina, que, por sua vez, catalisa a reao de
transformao de fibrinognio em fibrina, formando uma rede de fios no ferimento, estancando a
sada de sangue.
b) tromboplastina, que, na presena de ons magnsio e de vitamina E do sangue, catalisa uma
reao qumica propiciando a transformao da protrombina em trombina, que, por sua vez, catalisa
a reao de transformao de fibrina em fibrinognio, formando uma rede de fios no ferimento,
estancando a sada de sangue.
c) fibrinognio, que, na presena de ons potssio e de vitamina A do sangue, catalisa uma reao
qumica propiciando a transformao da protrombina em trombina, que, por sua vez, catalisa a
reao de transformao de tromboplastina em fibrina, formando uma rede de fios no ferimento,
estancando a sada de sangue.
d) tromboplastina, que, na presena de ons clcio e de vitamina K do sangue, catalisa uma reao
qumica propiciando a transformao da protrombina em trombina, que, por sua vez, catalisa a
reao de transformao de fibrinognio em fibrina, formando uma rede de fios no ferimento,
estancando a sada de sangue.
D
As protenas so polmeros de aminocidos, cuja sequncia determinada geneticamente. Vinte
aminocidos diferentes so codificados por trincas de bases do DNA, conforme determinado pelo
cdigo gentico. Em relao a esse cdigo, verifica-se que

a) a combinao de duas bases nitrogenadas em grupos de trs resulta em 60 trincas possveis.


b) cada polipeptdio tem uma sequncia especfica de aminocidos determinada pelo gene.
c) quatro trincas no codificam aminocidos, visto que determinam o fim do polipeptdeo.
d) o cdigo degenerado, visto que cada protena pode ser codificada por uma mesma trinca.
B
A maioria dos insetos passa por sucessivas mudas ou ecdises, do ovo at a fase adulta, cujo controle
feito pelo hormnio ecdisona. Na dcada de 1970, foi descoberto um hormnio vegetal, o
brasinosterol, cuja estrutura qumica muito semelhante ao hormnio ecdisona. Pesquisas recentes
relatam que o brasinosterol, se administrado em insetos, bloqueia o efeito da ecdisona. De acordo
com as informaes acima, responda:

a) Qual a vantagem para o meio ambiente do uso potencial do brasinosterol na agricultura?

b) Por que os insetos ametbolos, como a traa-de-livro, poderiam ser menos susceptveis ao
tratamento com brasinosterol do que os insetos hemimetbolos, como o gafanhoto?
Vrias aves apresentam disperso, que uma forma de deslocamento dependente de fatores como
barreiras geogrficas.

a) Os pingins, que nadam desde o sul da Argentina at o litoral do Rio de Janeiro, no apresentam
disperso. Explique.

b) Explique duas adaptaes das aves para o vo que tenham relao com o peso corporal.
A exposio prolongada de pessoas a campos eletromagnticos de baixa frequncia foi associada a
quebras da molcula de DNA e a outros danos genmicos. A respeito desse assunto, CORRETO
afirmar:

a) o efeito potencialmente deletrio desses campos sobre o genoma acumulativo.


b) o DNA, aps a ao desses campos magnticos, torna-se definitivamente danificado.
c) qualquer ao deletria desses campos magnticos constitui especulao sem valor cientfico.
d) a exposio aos campos de baixa frequncia no decorre em danos celulares, apesar dos danos
genmicos.
A
Os rins mantm o equilbrio hdrico no corpo por meio da regulao da quantidade e dos
componentes do lquido dentro e fora das clulas. Quaisquer distrbios dos canais de gua nos
nfrons, ou do hormnio antidiurtico (ADH), podem levar a doenas, como a desidratao. O
grfico abaixo representa duas situaes diferentes, em que as duas curvas se sobrepem at a
metade da poro D do nfron.

Com base nas informaes acima:

a) explique qual curva poderia representar uma pessoa com desidratao;


b) quais so as partes do nfron onde o ADH atua?
Aproximadamente 47% da energia solar que alcana as camadas superiores da atmosfera chega
superfcie da Terra. Essa energia um fator abitico importante para a biodiversidade dos
ecossistemas. Acerca dessa energia, CORRETO afirmar:

a) os raios absorvidos pela atmosfera tornam oblqua a incidncia dos raios solares nas regies
temperadas e polares, diminundo a produo de matria orgnica.
b) os raios difundidos por nuvens, oznio e vapor de gua propagam-se, favorecendo igualmente a
produo de matria orgnica do equador aos polos.
c) os raios refratados pela atmosfera incidem perpendicularmente sobre a zona equatorial terrestre,
que se favorece de maior produo de matria orgnica.
d) os raios refletidos por nuvens e poeira interceptam os raios solares que incidem sobre a Terra,
diminuindo a produo de matria orgnica nos polos terrestres.
C
Leia o texto.
Sade investiga quatro casos suspeitos em Gois
Goianos que beberam caldo de cana em cidades do litoral de Santa Catarina SC
vo se submeter a exames para verificar se foram contaminados pelo Mal de Chagas. A
principal suspeita das autoridades de sade de que a contaminao pelo Tripanosoma
cruzi (T. cruzi) tenha acontecido pela moagem do barbeiro (inseto hospedeiro do
protozorio) juntamente com os caules da cana de acar para a produo de garapa.
Nessa hiptese, teria acontecido nos casos confirmados em SC uma hiperinfeco, por
causa da grande quantidade de parasitas lanados na circulao sangunea juntamente
com o caldo de cana.
O POPULAR, Goinia, 29 mar. 2005.

O texto relata uma forma diferente de contaminao do homem pelo T. cruzi. Explique:

a) Como ocorre a forma habitual de transmisso da doena de Chagas?


b) Dois fatores que vm contribuindo para o aumento desses insetos transmissores da doena de
Chagas na zona urbana.
Considere a seguinte situao hipottica: de uma usina termonuclear escapa radiao nuclear para
uma rea desabitada e contamina a grama da regio, alterando a sua cor de verde para amarela, aps
alguns anos. Na regio, vive uma espcie de grilos verdes que so alvos de predadores, como aves.
Nesse contexto, essa espcie de insetos sobreviver s mudanas no ecossistema quando acorrer o
seguinte fenmeno:

a) pelo uso e desuso, as geraes consecutivas de grilos verdes se adaptarem irradiao.


b) os gentipos melhor adaptados forem selecionados por uma condio ecolgica, eliminando os
que so desvantajosos.
c) forem dotados de reguladores internos que oscilam com a frequncia especfica da radiao
nuclear e possibilitaro a mudana de sua cor.
d) a prole dos grilos irradiados herdar um mecanismo de mimetizao de cor, provocado por leses
na superfcie corporal.
B
Os cogumelos so fungos comumente encontrados em troncos de rvores, onde suas hifas nutrem-se
de molculas orgnicas que so os componentes presentes nesses troncos. Um indivduo, ao se
alimentar desse fungo, considerado:

a) consumidor primrio.
b) consumidor secundrio.
c) consumidor tercirio.
d) consumidor quaternrio.
B
Nos estudos de populaes, a condio necessria para que o equilbrio de Hardy-Weinberg seja
verificado a seguinte:

a) a populao considerada deve ser pequena.


b) as migraes e as mutaes devem ocorrer na populao.
c) as frequncias allicas devem se alterar ao longo das geraes.
d) os cruzamentos devem ocorrer aleatoriamente.
D