Você está na página 1de 97

DNA como molécula da

Hereditariedade
A biomolécula da hereditariedade
Em sendo os cromossomos a unidade física da
herança, qual a molécula da hereditariedade?

Todos vocês já sabem que é o DNA (Ácido


Desoxiribonucléico). Mas como este
conhecimento foi construído, vocês sabem?
Descoberta do DNA
• Em 1869 começou a trabalhar com células
brancas (leucócitos)
• Coletava curativos em hospitais
• Pus é rico em células brancas
• Utilizava solução salina para retirar pus dos
curativos
• O pus tratado com solução alcalina tinha as
células lisadas e o núcleo precipitado
• Dos núcleos isolou um composto químico,
que ele denominou nucleína
• Encontrou nucleína em todas células que
estudou
Friedrich Miescher
• Identificou que a nucleína era rica em
fósforo
• Richard Altmann em 1889 (aluno de
Miescher – trabalhando com esperma de
Salmão) deu o nome de ácidos nucléicos,
substancia somente encontrada nos
cromossomas
Composição química do DNA
• Por volta de 1900 sabia que a nucleína era
constituída por proteínas e ácido
desoxirribonucléico
• Identificou que o DNA era constituído por
nucleotídeos
• E que cada nucleotídeo era constituído um
grupo de fósforo, um açúcar e uma base
nitrogenada
• Imaginava que o DNA era constituído por
blocos de quatro bases nitrogenadas sempre
na mesma ordem
• Este pensamento o fazia pensar que as
Phoebus Aaron Theodor Levene proteínas é que codificavam a informação
genética, pois estas eram constituídas por 20
aminoácidos
DNA como molécula da hereditarieda
Experimento de Frederick Griffith, realizado em 1928
Princípio transformante de Griffiths

•Injeção de bactérias sem parede


celular e não patogênicas
•Camundongos continuam vivos

•Injeção de bactérias com parede


celular e patogênicas
•Camundongos morrem

•Injeção de bactérias com parede


celular e patogênicas mortas por
aquecimento
•Camundongos continuam vivos

•Bactérias sem parede celular são


misturadas com bactérias com
parede celular tratadas com calor
•Camundongos morrem
•Bactérias com parede celular são
recuperadas dos camundongos
mortos
O DNA como molécula da hereditariedade
O principio transformante de Griffiths é o DNA

• Avery- McLoad -McCarthy

Oswald Avery, 1930 Maclyn McCarty, 1936 Colin Munro MacLeod, 1936

The Journal of
Experimental
Medicine
79:137–156.
1944
Experimentos de Avery-McLoad-McCarthy, 1944
Experimentos de Avery-McLoad-McCarthy,
1944
• Bactérias patogênicas mortas por calor
• Preparo do extrato de bactérias
• Tratamento do extrato
– Enzimas para digestão de Carboidratos
– Enzimas para digestão de Lipídeos
– Enzimas para digestão de Ácido Ribonucléico
– Enzimas para digestão de Ácido Desoxirribonucléico
• Extrato tratado misturado com bactérias não patogênicas vivas
• Somente extrato tratado com enzima para digestão do ácido
desoxirribonucléico removeu a capacidade transformante do extrato
de bactérias patogênicas
Alfred Hershey and Martha
Chase, 1952
Alfred Hershey and Martha Chase, 1952

• Experimento com Bacteriófago


• Marcação com S35 e P32
• Enxofre marca proteínas e fósforo marca DNA
• Incubação entre bacteriófago e bactérias
• Separação dos bacteriófagos e bactérias
• S35 no sobrenadante
• P32 no precipitado
• Corrobora os experimentos de Avery-McLoad
Conclusão do trabalho de Avery e
McLoad

A evidência apresentada corrobora a hipótese de que o ácido


nucléico do tipo desoxirribose é a unidade fundamental do princípio
transformante em Pneumococcus Tipo III
Neste momento da aula você deve ser capaz de
defender de maneira convincente que o DNA
é a Molécula da hereditariedade
Composição química do ácido
desoxiribonucléico
Nucleotídios
• Os nucleotídios, unidades básicas dos ácidos
nucléicos, são constituídos de
– Uma base nitrogenada (anel heterocíclico
de átomos de carbono e nitrogênio)
– Uma pentose (açúcar com cinco
carbonos)
– Um grupo fosfato (molécula com um
átomo de fósforo cercado por 4
oxigênios)
Bases Nitrogenadas
• As bases nitrogenadas são de dois tipos:
– Púricas: Adenina (A) e Guanina (G)
– Pirimídicas: Timina (T), Citosina (C) e Uracil (U)

• As purinas são constituídas de dois anéis fundidos de 5 e 6


átomos
• e as pirimidinas de um único anel de 6 átomos

• Apenas quatro tipos diferentes de bases são encontrados em


um dado polímero de ácido nucléico
– No DNA as bases constituintes são A, G, C, e T enquanto no RNA são
A, G, C, e U
• Uracila e Timina são moléculas bastante relacionadas, diferindo apenas
pelo grupo metila encontrado no átomo C5 do anel pirimídico da Timina
Bases Nitrogenadas
Resíduos de Açúcar
• Dois tipos de pentoses são encontrados nos
ácidos nucléicos
– Ribose e desoxirribose
• Diferem uma da outra pela presença ou ausência do
grupo hidroxila no C 2' da pentose. É baseado nesta
característica que os ácidos nucléicos recebem o nome
RNA (ribose) ou DNA (desoxirribose)
Resíduos de Açúcar (desoxiribose)
•Os carbonos da desoxirribose são
numerados sequencialmente da direita
para a esquerda.

•O primeiro carbono é 1' (lê-se como um


linha), o segundo é 2' (dois
linha), e assim sucessivamente.

•A base nitrogenada liga-se ao carbono 1',

•e o grupo fosfato ao carbono 5'.

•O nucleotídeo abaixo é ligado


covalentemente ao carbono
•3'.

•Isto permite que uma longa fita seja


construída.
Resíduos de Açúcar
• A pentose é o elo de ligação
entre a base e o grupo
fosfato
– De um lado, o Nitrogênio 9
das purinas ou o Nitrogênio 1
das pirimidinas liga-se ao C1'
da pentose e, de outro lado, o
grupo carboxila do átomo de
C5' da pentose participa da
ligação éster com o grupo
fosfato
DNA – os nucleotídeos
• Desoxiribonucleotídeos
Estrutura do DNA
• A molécula de DNA é uma dupla
hélice cujas cadeias estão unidas
por pontes de hidrogênio
estabelecidas entre purinas e
pirimidinas complementares

– Adenina sempre pareia


com Timina (A = T)
– e Guanina com Citosina
(G = C)
Nucleotídeos

Ligação fosfodiéster

Genética Humana
Em direção à compreensão da
estrutura do ácido
desoxirribonucléico
Estrutura do DNA
• Erwin Chargaff
– Relação entre quantidade de bases
nitrogenadas em vários organismos
– A=T e C=G

Prof. Rinaldo Pereira


Estrutura do DNA
• Rosalind Franklin, 1952
– Cristalografia de Raio X de DNA em trabalho
colaborativo com Maurice Wilkins
Estrutura do DNA
• James Watson e Francis Crick, 1953
Pontes de hidrogênio Watson-Crick
Estrutura do DNA
• Dupla hélice
antiparalelas
• Sugestão de um
mecanismo de
replicação para o DNA
DNA conformação B
DNA e Histonas
A cromatina
Organização do Cromossomo
Linfócito humano Linfócito de rato

Cromatina
Regiões mais coradas – heterocromatina
Regiões menos coradas - eucromatina
Localização dos cromossomos no
núcleo interfásico
Estrutura cromossômica

• Padrões de cromatina
– Heterocromatina
• Regiões densamente coradas
– Eucromatina
• Regiões pouco coradas
Organização da cromatina

Cromossomo metafásico
Genética Aplicada a Medicina - 2007 - I
Cromatina, cromossomos e meiose

Vamos descrever o que estamos vendo


aqui
Cromossomo

Genética Aplicada a Medicina - 2007 - I


Estrutura cromossômica
Estrutura tri-dimensional dos
cromossomos

Telômeros
Braço curto

Centrômero

Braço longo
Cromátides
Cariótipo Humano
DNA nos cromossomos
DNA nos cromossomos
Nucleossomo
Nucleossomas
Primeiro nível de organização da cromatina

Genética Aplicada a Medicina - 2007 - I


Estrutura do
cromossomo
• Vários níveis de organização
• Do menos condensado
(núcleo na interfáse) ao
mais condensado (núcleo
metafásico)
• DNA e proteínas

Genética Aplicada a Medicina - 2007 - I


Nucleossomo
Estrutura do Nucleossoma
Replicação do DNA
Replicação do DNA

• Em organismos com DNA circular existe


uma única origem de replicação

• Em organismos eucariotos, existem várias


origens de replicação distribuídas ao longo
dos cromossomos
Duplicação cromossômica e DNA

Genética Aplicada a Medicina - 2007 - I -


Prof. Rinaldo Pereira
Replicação do DNA
• A maquinaria da replicação do DNA
– Topoisomerase
• Enzima responsável por remover a torção da dupla fita
• Desempenha este papel rompendo uma ligação fosfodiéster de uma fita
– Helicase
• Responsável pela abertura da dupla fita através do rompimento das pontes
de hidrogênio
– DNA polimerase
• Adição do nucleotídeo complementar ao da fita molde
• Através da quebra das ligações de fosfato do DNTP promove a ligação
fosfodiéster entre OH 3´e o P do carbono 5´
– Primase
• Responsável pela síntese de um pequeno fragmento de RNA (primer) que
dará a OH 3´para DNA polimerase
• É removido durante a replicação
– Ligase
• Responsável por fazer a ligação de 3` OH e 5´P, nos intervalos após remoção
dos primers e síntese de DNA
– Proteínas de ligação a fita simples
• Mantêm o DNA como fita simple após ação da helicase
Replicação do DNA
• Origens de replicação

Forquilhas de replicação

Genética Aplicada a Medicina - 2007 - I -


Prof. Rinaldo Pereira
Origens de replicação: procariotos

Fig. 8-22
Origens de replicação: eucariotos
Origens de replicação: eucariotos
Replicação do DNA

• A replicação do DNA sempre ocorre na direção 5´-3


– Então uma fita será sintetizada de maneira contínua e a outra fita de
maneira discontínua
– Os fragmentos sintetizados de maneira descontínua são chamados de
fragmentos de Okazaki
Helicase
“Priming”
Fig 8-27
Replicação do DNA
Modelo em Procariotos

Genética Aplicada a Medicina - 2007 - I -


Prof. Rinaldo Pereira
Replicação do DNA

Genética Aplicada a Medicina - 2007 - I -


Prof. Rinaldo Pereira
Como um dímero pode sintetizar as
fitas contínua e descontínua ?
Coordenação de síntese da dupla
fita
Replicação do DNA
Ligação fosfodiéster pela DNA polimerase

Genética Aplicada a Medicina - 2007 - I -


Prof. Rinaldo Pereira
Replicação do DNA
Atividade revisora
3´-5´ exonuclease

Genética Aplicada a Medicina - 2007 - I -


Prof. Rinaldo Pereira
Replicação do DNA
Remoção dos fragmentos de Okazaki

Genética Aplicada a Medicina - 2007 - I -


Prof. Rinaldo Pereira
Replicação do DNA
Atividade da enzima Ligase
Replicação nos terminais de cromosomos

telômeros
Replicação dos telômeros

Genética Aplicada a Medicina - 2007 - I -


Prof. Rinaldo Pereira
Replicação dos telômeros
O Genoma Humano
Genomas

Eucariotos Procariotos
DNA
gatagctgccatcggctgacctagagaagacacatcagctgat
cctttggaccctctgacttgagacagaagttctgggcttctcc
tcctgcggcctagctctgagacaatgaacgctacacactgcat
cttggctttgcagctcttcctcatggctgtttctggctgttac
tgccacggcacagtcattgaaagcctagaaagtctgaataact
attttaactcaagtggcatagatgtggaagaaaagagtctctt
cttggatatctggaggaactggcaaaaggatggtgacatgaaa
atcctgcagagccagattatctctttctacctcagactctttg
aagtcttgaaagacaatcaggccatcagcaacaacataagcgt
cattgaatcacacctgattactaccttcttcagcaacagcaag
gcgaaaaaggatgcattcatgagtattgccaagtttgaggtca
acaacccacaggtccagcgccaagcattcaatgagctcatccg
agtggtccaccagctgttgccggaatccagcctcaggaagcgg
aaaaggagtcgctgctgattcggggtggggaagagattgtccc
aataagaataattc
Genomas

gatagctgccatcggctgacctagagaagacacatcagct
gatcctttggaccctctgacttgagacagaagttctgggc
ttctcctcctgcggcctagctctgagacaatgaacgctac
acactgcatcttggctttgcagctcttcctcatggctgtt
tctggctgttactgccacggcacagtcattgaaagcctag
aaagtctgaataactattttaactcaagtggcatagatgt
ggaagaaaagagtctcttcttggatatctggaggaactgg
caaaaggatggtgacatgaaaatcctgcagagccagatta
tctctttctacctcagactctttgaagtcttgaaagacaa
tcaggccatcagcaacaacataagcgtcattgaatcacac
ctgattactaccttcttcagcaacagcaaggcgaaaaagg
atgcattcatgagtattgccaagtttgaggtcaacaaccc
acaggtccagcgccaagcattcaatgagctcatccgagtg
gtccaccagctgttgccggaatccagcctcaggaagcgga
aaaggagtcgctgctgattcggggtggggaagagattgtc
ccaataagaataattc
Tamanhos de Genomas
Sequenciamento de Genomas

Genoma de levedura Genoma de Genoma de


Sacharomyces cerevisae Caenorhabditis elegans Drosophila melanogaster
25/10/1996 11/12/1998 24/03/2000
Organização do genoma humano
• O que as duplas hélices de cada cromossomo
significam?
Projeto Genoma Humano

Conhecer a seqüência nucleotídica


de todos os cromossomos humanos
e dar sentido a elas

Estes artigos foram publicados em 2001 e representaram


o primeiro rascunho do genoma humano

Genética Aplicada a Medicina - 2007 - I -


Prof. Rinaldo Pereira
Sequenciamento de Genomas

Genoma de Genoma de
Arabidopsis thaliana Homo sapiens sapiens
14/12/2000 15/02/2001 e 16/02/2001
Genoma de
Pan troglodytes Genoma de Genoma de
01/09/2005 Mus muscullus Rattus novergicus
05/12/2002 01/04/2005
Genoma de Genoma de
Gallus gallus Cannis familiaris
09/12/2004 05/12/2005
Em 2007 iniciou-se a era dos Genomas Individuais

Craig Venter
James Watson

O primeiro genoma
asiático.
Um chinês (prefere o
anonimato)
Estão trabalhando
para ter 100
seqüências www.1000genomes.org
individuais
Anunciado em 23 de Janeiro de 2008
Genomas Individuais
• Projeto 1000 Genomes – completado em 2016
– http://www.internationalgenome.org/about

https://goo.gl/sPgpDx
Genomas Individuais
• Genomics England
– Sequenciamento de 100.000 genomas de
pacientes com doenças raras e câncer -
https://goo.gl/Kxsvbg
• Geisinger Health System (Plano de Saúde –
EUA)
– Incorporando sequenciamento genômico na
rotina clinica (https://goo.gl/Vxc5Hm)

Genética Aplicada a Medicina - 2007 - I


O futuro
• Cada um de nós poderá ter seu genoma
seqüenciado
• Em se sabendo variações no genoma
associadas a variação normal e patológica,
nosso genoma poderá ser de grande valia
• Ainda não estamos neste ponto
• Vamos discutir isto melhor em nossa aula de
variabilidade genética
Sequenciar genomas para que?
• A sequência de nucleotídeos por si só diz
pouco ou quase nada para nós
• É necessário “anotar “ a informação contida
nesta seqüência
– Quais seqüências possuem informação que
terminarão em uma seqüência de aminoácidos
– Há outras classes de seqüências com papel
funcional (falaremos delas mais tarde)
• Com uma sequência de referência podemos
buscar mais facilmente por diferenças entre
diferentes genomas (Aguardem nossa aula
sobre variabilidade em genomas)
Parte de uma seqüência com informação que
terminará em um seqüência de aminoácidos
Qual o número exato de genes
anotados no genoma humano até
o momento?
https://goo.gl/et53bk

Não se sabe a localização


Genética Aplicada a Medicina - 2007 - I
Genoma Humano
Organização do Genoma Humano
Elementos repetitivos
DNA codificante
• 1, 5 % do genoma humano é codificante
– 5 a 10% desta fração codifica para RNAs não
traduzidos em proteínas
• RNA ribossomal (rRNA)
• RNA transportador (tRNA)
• Micro RNAS (miRNA)
• Pequenos RNAs nucleares (snRNA)
• Pequenos RNAs nucleolares (snoRNA)
– 90 a 95% desta fração codifica para RNAs
mensageiros (mRNA) os quais são traduzidos em
sequências polipeptídicas
Genes codificando para proteínas

• Estimativa mais recente (2004) – 20000 a


25000 genes codificando para proteínas no
genoma humano
• Grande maioria apresentam estrutura
descontínua
Genomas
Sequências que codificam para proteínas

• Sequências regulatórias – sequências de DNA nas quais se ligam proteínas denominadas fatores de
transcrição (FT). Em conjunto com os FT as sequências regulatórias são responsáveis pelo primeiro
ponto de controle na expressão de genes. A maioria dos genes são expressos de maneira
tecido/tempo específico
• Promotor – Sequência de DNA na qual se liga a enzima RNA polimerase
• Inicio da transcrição – Nucleotídeo que marca a primeira base utilizada pela RNA polimerase como
molde para a síntese do mRNA
• Exon – Sequências de nucleotídeos que possuem a informação a ser traduzida em sequência de
aminoácidos
• Intron – Sequências que intercalam os exóns e são removidas durante o processamento dos
mRNAS
• Fim da transcrição – marca o último nucleotídeo transcrito
Atinjimos nossos objetivos?
• Entender a natureza molecular do DNA e RNA
• Associar o processo de duplicação dos cromossomos com a replicação do
DNA
• Compreender os processos básicos da replicação do DNA
• Ter uma ideia geral da maquinaria de replicação
• Entender o conceito de Genoma Humano
• Entender como o genoma humano está organizado
• Entender a estrutura de genes que codificam para proteínas