LILIAN SILVA CATENACCI

ABORDAGEM “ONE HEALTH” PARA VIGILÂNCIA DE ARBOVÍRUS NA MATA

ATLÂNTICA DO SUL DA BAHIA, BRASIL

Ananindeua
2017
 LILIAN SILVA CATENACCI

ABORDAGEM “ONE HEALTH” PARA VIGILÂNCIA DE ARBOVÍRUS NA

MATA ATLÂNTICA DO SUL DA BAHIA, BRASIL

Tese apresentada ao Programa de Pós-graduação

em Virologia do Instituto Evandro Chagas, para
obtenção do título de Doutor em Virologia

Orientadora: Profª Drª Elizabeth Salbé Travassos

da Rosa
Co-orientador: Prof. Dr. Pedro Fernando da
Costa Vasconcelos

Ananindeua
2017
 Dados Internacionais de Catalogação na Publicação (CIP)
Biblioteca do Instituto Evandro Chagas

Catenacci, Lilian Silva.

Abordagem “one health” para vigilância de arbovírus na Mata Atlântica do
sul da Bahia, Brasil. / Lilian Silva Catenacci. – Ananindeua, 2017.
309 f.: il.; 30 cm

Orientadora: Elizabeth Salbé Travassos da Rosa

Coorientador: Dr. Pedro Fernando da Costa Vasconcelos
Tese (Doutorado em Virologia) – Instituto Evandro Chagas, Programa de
Pós-Graduação em Virologia, 2017.

1. Arbovírus. 2. Medicina da conservação. 3. Vigilância entomológica.

4. Animais silvestres. 5. Virologia. I. Travassos da Rosa, Elizabeth Salbé,
orient. II. Vasconcelos, Pedro Fernando da Costa, coorient. III. Instituto
Evandro Chagas. IV. Título.

CDD: 579.2562
 LILIAN SILVA CATENACCI

ABORDAGEM “ONE HEALTH” PARA VIGILÂNCIA DE ARBOVÍRUS NA

MATA ATLÂNTICA DO SUL DA BAHIA, BRASIL

Tese apresentada ao Programa de Pós-graduação

em Virologia do Instituto Evandro Chagas, para
obtenção do título de Doutor em Virologia

Aprovado em: 30/08/2017

BANCA EXAMINADORA

Prof. Dr José Augusto Pereira Carneiro Muniz

Centro Nacional de Primatas

Prof ª Drª Valéria Lima de Carvalho

Instituto Evandro Chagas

Profª Drª Jannifer Oliveira Chiang

Instituto Evandro Chagas

Profª Drª Marcela Uhart

University of California

Profª Drª Marcia Chame

Fundação Oswaldo Cruz (suplente)
A meus pais, irmãos, sobrinhos,
Alessandra Diamantino, vó Liquinha (in
memoriam) e Paulo Barbosa (in
memoriam)
 AGRADECIMENTOS

Aos meus pais, Maria Olivia e José Aristides, por terem sempre me dado exemplo de
comprometimento e honestidade com aquilo e aqueles que acreditam. Por estarem sempre
perto, mesmo com os muitos km que nos separam.

Aos meus irmãos, Vivian e Junior, e meu cunhado Luciano, por estarem sempre juntos,
independente dos desafios e da distância.

Ao meu sobrinho Miguel, por me inspirar a querer cada dia mais e mais ciência e por tantos
ensinamentos que já tem me passado. À Isabel, que só de sorrir, já enche meu dia de
felicidade (mesmo que seja por fotos). Aos meus outros sobrinhos queridos, que me
ensinaram a ser mais forte do que eu podia imaginar.

À veterinária Alessandra Diamantino por me inspirar desde criança nesta profissão e por
tantos ensinamentos passados. Te admiro muito, Alê!

Ao Sebas... com uma generosidade ao próximo inigualável. Foram horas, horas e horas
quebrando a cabeça nos dados e me ensinando a lidar com eles... além das horas de bike,
viagens e puro companheirismo. I adore you!

Aos companheiros Kristel De Vleeschouwer, Leonardo de Oliveira, Camila Cassano, Priscila

Suscke, Gustavo Canale, Ana Cláudia, Leo Neves e Gabriel Santos, que desde 2005 me
deram a confiança e o privilégio de trabalhar e coletar amostras biológicas de espécies
silvestres em vida livre que jamais imaginei ter contato. E pelo compartilhamento de dados de
coleta, financiamentos e muitas, mas muitas idéias....

Aos professores Fernanda Gaiotto e Alexandre Munhoz, que gentilmente aceitaram guardar
todas as nossas amostras coletadas desde 2006 no então único freezer -70C da Universidade
Estadual de Santa Cruz.... para que estas amostras pudessem ser finalmente utilizadas na
pesquisa deste doutorado em 2013.

Ao Professor Muniz, pelas horas de conversa em Florianópolis durante o congresso da

ABRAVAS em 2012; que culminaram com a minha inscrição do doutorado em Virologia do
Instituto Evandro Chagas.

À minha orientadora Dra Elizabeth e co-orientador Dr. Pedro, por aceitarem um projeto novo
e uma orientanda que nunca tinha trabalhado com vírus e com pouca experiência de
laboratório.

Agradeço as horas intermináveis de revisão da Dra Beth, que com certeza engrandecem este
trabalho.

A todos os colegas da Seção de Arbovirologia e Febres Hemorrágicas do Instituto Evandro

Chagas (SAARB), que desde o primeiro dia me ofereceram seus ensinamentos e
principalmente muita paciência. Em especial a Milene Silveira, que sempre acreditou que
podíamos fazer e criar mais! Ushuaia nos espera!
Ao Franko, Liliane e Seu Basílio, que aceitaram trabalhar com as amostras de seres humanos
das comunidades rurais visitadas neste projeto, mesmo em meio ao surto de Chikungunya. E a
Débora Fernandes, por ajudar no laboratório e na tabulação destas amostras. A Lívia Martins,
por me orientar MUITO neste trabalho e acreditar no meu potencial.

Ao Lab de cultura de células, em especial Valéria e Ercília, que com toda dedicação e horas a
mais no lab, ensinavam e conferiam as minhas atividades; além de me acolherem com muita
amizade.

Ao Lab de tentativa de isolamento viral em camundongos, onde tanto aprendi sobre biotérios.
E pelas intermináveis horas de plantão juntos. Muito obrigado pelo carinho e atenção.

Ao Lab de biologia molecular, em especial, Daniela Rodrigues, Ana Alice, Samir, Alessandra
e Sandro; pelos inúmeros ensinamentos em técnicas que só conhecia na teoria quando ainda
estava na graduação. E a Dra Cecília, por ter aceitado, sem nem titubear, o desafio de
trabalhar com a validação de técnicas de mosquitos e com a “novata aqui” ao mesmo tempo.
E de sentar comigo na bancada quando nada estava dando certo. Aos meninos Thito e
Leonardo, meu braço esquerdo e direito para as RT-PCRs. Obrigado por aguentar meu mal-
humor e correria... obrigado pela ajuda de vocês e confiança.

Aos amigos do peito do CIT, Janaina, Rodrigo, Luciano, Rafael, Poliana, João e Rafael, que
me acolheram de braços sempre abertos, me enchendo de esperança, energia, idéias, além de
toda a ajuda no laboratório e os ensinamentos passados. Me senti cuidada por vocês.

Ao Lab. de entomologia, que com toda a paciência tentaram me ensinar a identificar os

mosquitos. Nossa, que admiração por vocês. E obrigado Joaquim por tantos comentários nos
artigos.

À Ercília, Joaquim e Francisco por terem se disponibilizado para a saída de campo de 2014,
incluindo treinamentos nas secretarias municipais de saúde, universidades e coletas de
amostras biológicas.

A todos os terceirizados e demais técnicos e servidores dos laboratórios da SAARB; em

especial Pedro e Ovídio, do biotério e Natividade, minha companheira de futebol. Obrigado
Pedro por me apresentar o carimbó!

Ao Laboratório de Imunopatologia da Universidade Federal do Pará, pela alegria,

aprendizado, dinâmica e competência. E a professora Hellen Thais Fuzii, que entrou na minha
vida acadêmica bem no finalzinho, mas que fez toda a diferença tanto no lab como no meu
emocional. Obrigado por ter me acolhido no colo como filha, segurado minhas lágrimas nos
momentos de exaustão e por ter me levado para comer carangueijo! Adorei!

À Assessoria de Comunicação do Instituto Evandro Chagas, em especial à Camarinha, por

valorizar, incentivar e ajudar a desenvolver atividades educativas que foram entregues as
comunidades rurais visitadas.

A todos os colegas das turmas de mestrado e doutorado da PPGV, além dos funcionários da
secretaria do PPGV, pela troca de informações e compartilhamento das ansiedades, dúvidas,
dicas, etc. durante o período do curso.
Aos meus “amigos de bar” em Belém, Omar, Dario, Douglas, Leno e Diego; e aos meus
amigos do “circuito de bike” de Ananindeua, por me mostrarem que ainda há vida mesmo
com o doutorado. Pouca, mas há...

Agradeço com carinho ao Centro Nacional de Primatas, por ter me hospedado no alojamento
da instituição no primeiro ano do doutorado e no finalzinho dele também.

Aos meus amigos e vizinhos Roberto, Deise e Ângela pelos inúmeros pratos de comida
doados tarde da noite, quando chegava exausta do lab, sem condições para cozinhar. Muito
obrigada.

Aos meus amigos de Ilhéus, em especial Roueda, Camila, Ana Cláudia e Léo, que sempre me
acolheram e ajudaram nas atividades de campo. E que me fazem amar cada vez mais a vida, o
mar, a mata, os sons e as amizades!

Thank you very much to the amazing Saint Louis Zoo (Missouri, USA) for hosting me for a
year and a half during my “sandwich” PhD, and to Dr. Sharon Deem, an unbelievable person,
researcher and advisor. Special thanks to the Conservation Medicine team: Jamie Palmer,
Kathleen Apakupakul, Keri Lammering, and all the volunteers and intern students. My
personal and professional life changed after receiving your knowledge and friendship, ICM. I
love you, guys!

Additional thanks to the University of Missouri-Saint Louis (Missouri, USA) and Dr. Patricia
Parker for giving me the opportunity to go on field trips, take classes at the university and
attend weekly lab meetings.

Thank you to my “music group” in St. Louis and my roommates Emma (American), Samoa
(Papa New Guinea), Mari (Equador), 2-socks (Emma’s cat) and Ketchup (Mari’s dog). Big
hugs to my “American sister” Whitney.

Agradeço ainda aos assistentes de pesquisa Bila, Antonio e Josinei por anos de trabalho e
parceria. Também agradeço os líderes das comunidades rurais visitadas, os diretores das
escolas que permitiram que nossas atividades chegassem as crianças e aos diretores da
REBIO-Una e REVIS-Una, Paulo Cruz e Saturnino Neto, por todo apoio e logística a este
projeto. Bila, ainda estou te devendo um pirarucu seco!!

Não poderia deixar de agradecer a equipe de entomologia da extinta 6ª Dires: Reinaldo, Paulo
(in memoriam) e sua equipe. O veterinário Aloísio, do Centro de Controle de Zoonoses de
Ilhéus, e as pessoas que fazem parte das Secretarias Municipais de Saúde dos municípios
envolvidos nesta pesquisa, em especial Alex, Vilma, Juliana e Yoki. Vocês foram peças
fundamentais para que esta rede de vigilância de arboviroses e epizootias fosse criada.
Contem sempre comigo.

A todos os meus co-autores neste trabalho, com seus valiosos comentários e sugestões. Que
este seja o começo de muitas outras parcerias.

À Professora Lucila, que aceitou ser a revisora de português deste trabalho. E a Regina Maura
Almeida, por me ajudar nos ajustes finais da formatação desta tese.
Aos membros da minha banca de qualificação, Dra Lívia Martins, Dra Ana Cecília Cruz, Dra
Janaína Vasconcelos e Dr. José Muniz, por terem colaborado para o andamento desta tese.

E aos membros da minha banca de doutorado, Dra Jannifer Chiang, Dra Valéria Carvalho,
Dra Marcela Uhart, Dra Marcia Chame e Dr José Muniz pelo aceite em contribuir para o
encerramento desta fase da minha vida.

Encerro agradecendo às instituições que fizeram essa tese de doutorado possível: CAPES,
Universidade Federal do Piauí, Universidade Estadual Santa Cruz, LACEN-Salvador, 6ª
DIRES, Projeto BioBrasil, Instituto de Estudos sócio-ambientais do Sul da Bahia, Instituto de
Pesquisa Bicho do Mato, ICMBIO, Saint Louis Zoo (EUA), WildCare Institute (USA),Wild
Animal Fund (USA), American Association of Zoological Veterinarians (AAZV, USA),
CNPq, Centre for Research and Conservation of the Royal Zoological Society of Antwerp
(Bélgica), Lion Tamarins of Brazil Fund, National Lottery of Belgium, Primate Action Fund,
Zoological Society of London, Fundação o Boticário de Proteção a Natureza e o Flemish
Ministry of Science (Bélgica), Instituto Evandro Chagas, Universidade Federal do Pará e
Secretarias Municipais de Saúde de Ilhéus e Una.

MUITO OBRIGADO!
"Viva como se fosse morrer amanhã
e aprenda como se fosse viver para
sempre."
Mahatma Gandhi
 RESUMO

Ao menos cinco epidemias causadas por arbovírus (Vírus da Febre Amarela, Vírus Dengue,
Vírus Febre do Nilo Ocidental, Vírus Chikungunya e Vírus Zika) têm surgido nos últimos
séculos. Muitos outros arbovírus são zoonóticos, infectando artrópodes e animais selvagens
em seus habitats silvestres, bem como humanos, acidentalmente. Com a intensificação da
agricultura, pecuária, desmatamento, mobilidade de pessoas e densidade humana, o padrão de
interação vírus-vetor-hospedeiro também tem sido alterado. Neste estudo, monitoramos
artrópodes, animais e populações humanas para avaliar o risco de arboviroses em áreas rurais
entremeadas por fragmentos da Mata Atlântica na Bahia, Brasil. Entre 2006 e 2014,
coletamos 196 amostras de sangue de primatas de vida livre (Leontopithecus chrysomelas e
Sapajus xanthosthernos) e 47 amostras de preguiças (Bradypus torquatus e Bradypus
variegatus). Além disso, fezes de micos-leões foram coletadas para testes
coproparasitológicos. Nos mesmos locais onde mamíferos foram amostrados, investigamos
potenciais vetores de arboviroses com capturadores e armadilhas de CDC. Finalmente, em
2014, foram coletados sangue de 523 pessoas de 11 comunidades que viviam perto dos locais
onde os animais silvestres eram monitorados. Embora saudáveis, micos estavam parasitados
com nematódeos e/ou cestódeos. Além disso, durante necropsia de um Leontopithecus
encontrado morto, identificamos o acantocéfalo Prosternochis elegans. A coleta de sangue em
preguiça-de-coleira gerou os primeiros valores hematológicos para esta espécie, que poderá
ser útil em avaliações de saúde. Anticorpos contra 26 arbovírus pertencentes a quatro gêneros
(Flavivirus, Alphavirus, Orthobunyavirus e Phlebovirus) foram investigados. A prevalência
de anticorpos contra arbovírus em mamíferos selvagens foi de 26,8%, sendo maior para B.
torquatus (41%), seguido de L. chrysomelas (25,4%), S. xanthosthernos (14,3%) e B.
variegatus (14,3%). Usando modelos lineares generalizados, descobrimos que a exposição
não estava associada ao sexo ou idade, mas foi maior em preguiças do que micos-leões. Em
humanos, a prevalência foi de 70,3%. Entre os gêneros, Flavivirus apresentou a maior
prevalência tanto para animais (21,1%) como pessoas (69,8%). Os animais silvestres e
pessoas foram expostos a 13 e cinco espécies de arbovírus, respectivamente, quatro dos quais
foram comuns em ambos os hospedeiros (ILHV, DENV-3, EEEV, CARV). Através de
regressões logísticas, constatamos que devido pessoas viverem perto de fragmentos de
floresta e com macacos de vida livre em torno das áreas diminuiu o risco de infecção. Isso
pode ser explicado pelo efeito de diluição, onde aumento da biodiversidade tende a diluir
interações parasita-hospedeiro-ambiente-vetor e consequentemente, risco de doenças.
Finalmente, nossa pesquisa identificou 49 artrópodes, sendo culicídeos com maior abundância
e riqueza. Teste de RT-PCR com primers gênero-específicos foram utilizados para detecção
viral em artrópodes. Seguido por sequenciamento, detectamos ROCV, MAYV, Kamiti river e
Mosquitos flavivirus. A alta prevalência em mamíferos selvagens e humanos, juntamente com
a presença de vetores infectados, sugerem circulação e risco de transmissão de arbovírus nas
áreas amostradas. O risco de exposição pode aumentar com desmatamento e contato entre
pessoas, animais selvagens e vetores. Os resultados foram compartilhados com universidades,
serviços de saúde e meio ambiente, zoológicos e comunidade local. Este estudo apresenta uma
iniciativa para integrar saúde das pessoas, animais e meio ambiente em uma abordagem One
Health.

Palavras-chave: Arbovírus, Vigilância Entomológica, Medicina da Conservação, Virologia,

Animais Silvestres
 ABSTRACT

During recent centuries, five mosquito-borne arboviruses infecting humans (Yellow

Fever virus, Dengue virus, West Nile virus, Chikungunya virus and Zika virus) have emerged.
Many others arbovirus are zoonotic, infecting arthropods and wildlife in their sylvatic
habitats, as well as humans as incidental hosts. Agriculture, animal husbandry, deforestation,
mobility of people and human population densities have all intensified. As a result, patterns of
virus-vector-host interactions have been altered. In this study, we monitored arthropods, wild
animals and humans to assess the risk of arboviruses in deforested and fragmented areas in the
Atlantic Forest of Bahia, Brazil. Between 2006 and 2014, we collected a total of 196 blood
samples from primates (Leontopithecus chrysomelas and Sapajus xanthosthernos) and 47
samples from sloths (Bradypus torquatus and Bradypus variegatus). Additionally, we
collected feces from lion tamarins for coproparasitological tests. In the same sites where
mammals were sampled, we used dip nets and CDC traps to survey mosquito vectors. Finally,
in 2014, we sampled 523 humans from 11 communities that lived near wildlife monitoring
sites. Although all animals seemed healthy, lion-tamarins were parasited with
nematodes/cestodes in their feces. Furthermore, necropsy of a dead lion tamarin identified the
Prosternochis elegans. Blood samples in sloths produced the first hematologic values for this
species, which will be useful for health assessments. We investigated antibodies for 26
arboviruses in 4 genera: Flavivirus, Alphavirus, Orthobunyavirus and Phlebovirus.
Prevalence of arboviral infection for wild mammals was 26.8%, with the highest value in B.
torquatus (41%), followed by L. chrysomelas (25.4%), S. xanthosthernos (14.3%) and B.
variegatus (14.3%). Using a generalized linear model, we found that arboviral infection was
not associated with sex or age, but it was higher in sloths than in lion tamarins. In humans, the
prevalence was 70.3%. Among virus genera, Flavivirus had the highest prevalence in both
animals (21.1%) and humans (69.8%). According to serological tests, wild mammals and
humans were exposed to 13 and five species of arbovirus respectively, four of which were
shared in both hosts (ILHV, CARV, DENV-3, EEEV). Using multivariate logistic
regressions, we found that living close to forest fragments and nearby free-living monkeys
decreased the risk of infection. This could be explained by the dilution effect, which indicates
that increases of biodiversity tend to decrease the risk of diseases. Finally, our surveys
identified 49 arthropod taxa, and culicids with the highest abundance and richness. Using a
molecular biology approach, we evaluated a RT-PCR test with genera-specific primers for
viral detection in arthropods. Followed by sequencing, we detected ROCV, MAYV, Kamiti
and Mosquito flavivirus virus. The high serumprevalence in wild mammals and humans,
added to the presence of insect vectors infected with arbovirus, suggest viral circulation and
risk of transmission across species in the sampled areas. We shared these data with
universities, Health and Environmental Services, zoos and local community participants. This
study represents an important initiative to integrate data on the health of people, wild animals
and the environment in a One Health framework.

Key-words: Arbovirus, Entomologycal Surveillance, Conservation Medicine, Virology,

Wildlife
 LISTA DE ABREVIATURAS E SIGLAS

17D Cepa da vacina antiamarílica

AAZV American Association of Zoological Veterinarians
BSQV vírus Bussuquara
CAAE Certificado de Apresentação para Apreciação Ética
CAPES Coordenação de Aperfeiçoamento de Pessoal de Nível
Superior
CARV vírus Caraparu
CATUV vírus Catu
CCHFV vírus da Febre hemorrágica da Criméia-Congo
CDC Center for Disease Control and Prevention (Centro para
prevenção e controle de doenças)
CEPLAC Comissão Executiva do Plano da Lavoura Cacaueira
CEP Comitê de ética em pesquisa
CEUA Comitê de ética no uso de animais
CFA Cell fusing agent virus
CGLV vírus Changuinola
CHIKV vírus Chikungunya
EEEV vírus da encefalite equina do leste
FC Fixação de Complemento
FHD Febre Hemorrágica da Dengue
GHLT Golden-heahd lion tamarins
GLM Modelo Linear Generalizado
GMAV vírus Guama
GNP Gross National Product (Produto Interno Bruto)
GROV vírus Guaroa
IBAMA Instituto Brasileiro do Meio Ambiente e dos Recursos
Naturais Renováveis
ICM Institute For Conservation Medicine
ICMBio Instituto de Chico Mendes de Conservação em
Biodiversidade
ICOV virus Icoaraci
ICTV Comitê Internacional de Taxonomia Viral
IEC Instituto Evandro Chagas
IH Inibição da Hemaglutinação
ILHV vírus Ilheus
IN Índice de Neutralização
IUCN União Internacional para a Conservsção da Natureza
JEV virus da Encefalite Japonesa
KRV Kaimiti river virus
LACEN Laboratório Central
MAGV virus Maguari
MAYV vírus Mayaro
MCHC Mean corpuscular hemoglobin concentration
MCH Mean corpuscular hemoglobin
MCV Mean corpuscular volume
MIR Taxa mínima de infecção
MRBV virus Morumbi
MUCV vírus Mucambo
MURV vírus Murutucu
NGO Organização não-governamental
NSP Proteínas não-estruturais
OIE Organização Internacional de Epizootias
OMS Organização Mundial de Saúde
ORF Open reading frame
OROV vírus Oropouche
PHEIC Public Health Emergency of International Concern
PIXV vírus Pixuna
PNH Primatas não-humanos
PTV virus Punta Toro
qRT-PCR PCR em tempo real
REBIO-UNA Reserva Biológica de Una
REVIS Refúgio de vida silvestre
RVFV vírus da Febre do Rift Valley
RNA Ácido ribonucleico
ROCV vírus Rocio
RT-PCR Reação em cadeia da polimerase por transcrição reversa
SAARB Seção de Arbovirologia e Febres Hemorrágicas
SH Síndrome hemorrágica
SLEV vírus da Encefalite de Saint Louis
SN Soroneutralização
SN Síndrome neurológica
TCLE Termo de Consentimento Livre e Esclarecido
TOSV vírus Toscana
TCMV vírus Tacaiuma
UESC Universidade Estadual de Santa Cruz
UTIV vírus Utinga
UTR Untranslated region
VEEV vírus da Encefalite Equina Venezuelana
VSV vírus da Estomatite Vesicular
WEEV vírus da Encefalite Equina Oeste
WHO World Health Organization (Organização Mundial de
Saúde)
WNV vírus do Nilo Ocidental
YFV vírus da Febre Amarela
ZIKV vírus Zika
 SUMÁRIO

1 INTRODUÇÃO........................................................................................................ 16
2 REFERENCIAL TEÓRICO................................................................................... 20
2.1 ABORDAGEM “ONE HEALTH”......................................................................... 20
2.2 ANIMAIS SILVESTRES E O DESMATAMENTO DA MATA ATLÂNTICA.. 21
2.3 O MICO-LEÃO-DA-CARA-DOURADA.............................................................. 23
2.4 O MACACO-PREGO-DO-PEITO-AMARELO.................................................... 23
2.3 O BICHO-PREGUIÇA-DE-COLEIRA.................................................................. 24
2.4 A PREGUIÇA-COMUM........................................................................................ 24
2.5 ARTRÓPODES IMPORTANTES PARA SAÚDE PÚBLICA............................. 26
2.6 ARBOVÍRUS.......................................................................................................... 28
2.8.1 Etiologia.............................................................................................................. 28
2.8.2 Classificação e características gerais................................................................ 28
2.8.3 Ciclo de manutenção dos arbovírus.................................................................. 32
2.8.4 As arboviroses e o desafio para saúde pública................................................ 34
2.8.5 Arboviroses emergentes e reemergentes.......................................................... 35
2.8.6 As arboviroses em animais silvestres................................................................ 38
2.8.7 Situação das arboviroses nos municípios envolvidos na pesquisa................. 40
2.9 MÉTODOS DE DIAGNÓSTICO DE ARBOVIROSES........................................ 42
3 OBJETIVOS............................................................................................................. 49
3.1 OBJETIVO GERAL............................................................................................... 49
3.2 OBJETIVOS ESPECÍFICOS.................................................................................. 49
4 MATERIAIS E MÉTODOS.................................................................................... 50
4.1 ÁREA DE ESTUDO............................................................................................... 50
4.2 GRUPO DE ESTUDO E COLETA DE MATERIAL BIOLÓGICO EM
ANIMAIS SILVESTRES, VETORES E HUMANOS................................................. 51
4.3 TESTES LABORATORIAIS................................................................................. 52
4.4 ATIVIDADES DE EDUCAÇÃO EM “ONE HEALTH”...................................... 53
4.5 ANÁLISE DOS DADOS........................................................................................ 53
4.6 ASPECTOS ÉTICOS.............................................................................................. 53
5 RESULTADOS......................................................................................................... 55
6 CONCLUSÕES…………………………………………………………………… 58
REFERÊNCIAS…………………………………………………………………….. 61
APÊNDICES................................................................................................................ 78
APÊNDICE A- artigo “Primates and sloths as sentinels for arboviruses in the
Atlantic Forest, Bahia, Brazil”……………………………………………………….. 79
APÊNDICE B- artigo “Risk factors associates with arboviruses in rural population
of Bahia, Brazil.”………………………………………………………….………….. 111
APÊNDICE C- artigo “Patterns of Hematophagus insect Diversity in Atlantic
Forest Fragments and Agroforestry Systems in Southern Bahia, Brazil.”…………… 141
APÊNDICE D- artigo “New Records of Mosquito Species (Diptera: Culicidae) for
Bahia (Brazil)”.............................................................................................................. 168
APÊNDICE E- artigo “Rapid molecular monitoring of arbovirus in field-caught
arthropods using universal primers.”………………………………………………… 174
APÊNDICE F- artigo “Zika Virus: a Real Threat for Wildlife?”……….…………… 197
APÊNDICE G- artigo “Leontopithecus chrysomelas: 25 anos de experiência em
métodos para captura e coleta de material biológico”.................................................. 212
APÊNDICE H- artigo “First record of hematological values in free-living and
captive maned sloths (Bradypus torquatus, Bradypodidae)”………………………… 241
APÊNDICE I- artigo “Ocurrence of P Prosthenorchis elegans (Diesing, 1861),
Travassos, 1915 in free-living primates from the Atlantic Forest of the Southern of
Bahia, Brazil”………………………………………………………………………… 250
APÊNDICE J- artigo “Intestinal parasites of Leontopithecus chrysomelas in the
Atlantic Forest of southern Bahia: Implications for Primate Conservation”………… 256
APÊNDICE K- artigo “Building network for a sustainable health”…………………. 281
ANEXOS…………………………………………………………………………….. 301
ANEXO A: PARECER Comité de Ética e Pesquisa em seres humanos (CEP)........... 302
Anexo B: PARECER Comitê de ética no uso de animais (CEUA)- coleta amostras
de seres humanos........................................................................................................... 304
ANEXO C: PARECER CEUA- coleta amostras de animais........................................ 305
ANEXO D: Termo de Consentimento Livre e Esclarecido (TCLE)............................ 306
ANEXO E: Termo de Assentimento do Menor............................................................ 308
 16

1 INTRODUÇÃO

Doenças infecciosas são a maior preocupação de saúde pública mundial (WEAVER,

2013). A maioria dessas infecções é de origem viral, sendo reconhecido que a emergência e
reemergência dessas viroses têm sido desencadeadas principalmente por ações antrópicas que
modificam o meio ambiente (VASCONCELOS et al., 2001; VASCONCELOS, 2010;
VASCONCELOS; CALISHER, 2016; WEAVER, 2013; WEAVER; REISEN, 2010).
Devido às recentes epidemias de Zika, chikungunya, febre amarela e dengue no Brasil
(ALTHOUSE et al., 2016; CARDOSO et al., 2017), o Ministério de Saúde tem intensificado o
controle de artrópodes, além da vigilância de epizootias em primatas não-humanos (PNH)
(BRASIL, 2014; FIGUEIREDO et al., 2014; FIGUEIREDO; FIGUEIREDO, 2015). Porém, os
patógenos tornaram-se também uma preocupação constante para os profissionais que trabalham
com conservação e meio ambiente (DEEM et al., 2001; KELLY et al., 2017). Isso porque
muitas viroses são conhecidas por serem patogênicas para a fauna, podendo gerar inclusive
declínio de populações em vida livre; principalmente se asscoaidas com co-infecções de outros
parasitas (ALTHOUSE et al., 2016; BUENO et al., 2016; CARON et al., 2015; CARRION-JR;
PATTERSON, 2012). Neste contexto, o monitoramento de saúde das populações de animais
silvestres que habitam fragmentos florestais passa a ser estratégico não somente para estudos
de saúde pública e transmissão de zoonoses; mas também como sinalizador das condições
gerais do estado de saúde dos ecossistemas (DEEM, 2016; PAULA et al., 2015). E os resultados
desses monitoramentos podem auxiliar em tomadas de decisões para prevenção de surtos, e/ou
epidemias (COSTA; TEIXEIRA, 1999; BAUM et al., 2017; KELLY et al., 2017; MAZET et
al., 2009; TORRES et al., 2003). Da mesma maneira, populações humanas que vivem nas áreas
de interface com ambientes naturais são grupos estratégicos para estudos de saúde pública
(MAZET et al., 2014; WEAVER 2013). Com o avanço do desmatamento, de novas áreas para
manejo e uso do solo, das práticas de colheita e beneficiamento de produtos agrícolas próximos
a estas áreas de mata, ocorre uma aproximação entre pessoas e seus animais domésticos com as
populações de animais silvestres (BIERREGAARD et al., 1992; CASSANO et al., 2014;
COSTA; TEIXEIRA, 1999). Esse possível contato provoca uma intervenção antrópica em
nichos ecológicos, o que pode facilitar a disseminação de agentes virais e o estabelecimento de
novas relações entre hospedeiros, vetores e parasitas (BUENO et al., 2016; CARON et al.,
2015; JOHNSON et al., 2015; KEESING et al., 2006; SCHATZMAYR, 2001). Como
consequências dessas interações podem ocorrer zoonoses, dentre elas, as arboviroses.
 17

As arboviroses são doenças causadas por arbovírus, um grupo de vírus ecologicamente

bem definido, cuja característica epidemiológica principal é a transmissão biológica entre
hospedeiros vertebrados, mediada por artrópodes hematófagos (BEATY et al., 1989;
KARABASTOS, 1985). Os arbovírus têm sido mais bem classificados com base em suas
propriedades físico-químicas. Assim sendo, esses vírus são distribuídos principalmente entre as
famílias Peribunyaviridae, Flaviviridae, Reoviridae, Rhabdoviridae, Phenuiviridae e
Togaviridae (ADAMS et al., 2017). Destacam-se pelo número de componentes de importância
em saúde pública os gêneros Alphavirus, Orthobunyavirus e Flavivirus (ADAMS et al., 2017).
No Brasil alguns vírus têm aparecido regularmente em áreas urbanas (como o vírus
Dengue- DENV e vírus Oropouche- OROV) (KIKUTI et al., 2015; MOURÃO et al., 2009;
RODRÍGUEZ-MORALES et al., 2017; VASCONCELOS et al., 2009; VIEIRA et al., 2015;
ZUCHI et al., 2014) ou rurais (como o vírus Mayaro- MAYV e o vírus da Febre Amarela-
YFV) (FIGUEIREDO et al., 2014; MUÑOZ; NAVARRO, 2012; VASCONCELOS 2010).
Epidemias mais recentes também têm ocorrido com a entrada de dois vírus exóticos: vírus
Chikungunya (CHIKV) no ano de 2014 e vírus Zika (ZIKV) no ano de 2015 (CAMPOS et al.,
2015; FARIA et al., 2016; FIGUEIREDO et al., 2014); além da atual epidemia de febre amarela.
A natureza da doença produzida no homem varia conforme o tipo de arbovírus responsável pela
infecção, podendo apresentar desde doença febril indiferenciada, moderada ou grave, erupções
cutâneas e artralgia, até síndromes neurológicas e síndromes hemorrágicas (HEYMANN et al.,
2016; HUANG et al., 2016; TAVARES-NETO et al., 1986; VASCONCELOS, 2003).
As arboviroses tem um complexo ciclo de transmissão no qual vetores, patógenos e
hospedeiros interagem sob intensa influência de condições ambientais (KEESING et al., 2006;
LAROQUE et al., 2014; PAUTASSO et al., 2013; SWADDLE; CALOS, 2008; TRAN et al.,
2017; VASCONCELOS et al., 2001). Assim, amostragem de vetores somado a vigilância de
epizootias deveriam ser as primeiras ferramentas para avaliar o risco de transmissão de
arbovírus para os seres humanos numa área rural ou peri-urbana. Deveriam também, ser as
principais ferramentas para a realização de monitoramento de arboviroses a longo prazo
(PAUTASSO et al., 2013), uma vez que as informações geradas poderiam auxiliar na
investigação da epidemiologia dessas arboviroses, na execução de medidas preventivas e até no
desenvolvimento de planos estratégicos para surtos e epidemias que viessem a surgir, sejam nas
populações humanas, sejam nos animais domésticos e/ou silvestres.
O Brasil se destaca como importante protagonista em arboviroses no mundo devido
diversos fatores: possui a maior diversidade de arbovírus, com mais de 200 cepas isoladas
(CASSEB et al., 2013; FIGUEIREDO, 2007; FIGUEIREDO; FIGUEIREDO, 2015), maior
 18

biodiversidade de fauna, que disponibiliza uma ampla variedade de hospedeiros e vetores

(CASSANO et al., 2009; FRAGOSO-MOURA et al., 2016); possui clima tropical, que facilita
o aumento e manutenção de população de vetores (CATENACCI et al,. 2017;
VASCONCELOS, 2003); tem um enorme tráfico ilegal de animais silvestres (LEVACOV et
al,. 2011), que aumenta a chance de circulação viral dentro do país; é um país de grande
destinação turística, que favorece a entrada e saída de cepas virais (CLETON et al., 2012;
FARIA et al., 2016); e possui a segunda maior taxa mundial de desmatamento (FAO, 2016),
que favorece a alteração drástica de ecossistema e da ecoepidemiologia de doenças. Este país
possui ainda a segunda maior taxa de desigualdade social no mundo, que favorece a criação de
bolsões de pobreza com déficit em saneamento básico de água e esgoto (KIKUTI et al., 2015)
e baixo investimento econômico em áreas de saúde e educação básica para a população
(SOLBERGH et al., 2014), que dificulta medidas preventivas (WALLACE et al., 2015).
Esta pesquisa foi desenvolvida na região do sul da Bahia, Brasil, que pertence ao
domínio da Mata Atlântica e apresenta características peculiares para estudos de saúde pública.
O intenso fluxo de turistas, o mosaico de ambientes com marcante presença de fragmentos
florestais entremeados em povoados rurais (ALGER; CALDAS, 1994), que sobrevivem de
agricultura e criação de animais domésticos (VIVO, 1997), além da alta biodiversidade da
região (CASSANO et al., 2009; 2014), podem favorecer a emergência e reemergência de
diversas arboviroses. Soma-se a isto o escasso número de trabalhos clínico-sanitários nos
animais selvagens da região e as dificuldades de acesso dos agentes de saúde coletiva nas
propriedades rurais (SOLLBERG et al., 2014; VLEESCHOUWER et al., 2011).
Em 2005 foi organizado e iniciado um projeto de forma integrado com parceiros locais,
nacionais e internacionais buscando suprir as necessidades regionais com relação ao tema de
saúde pública e conservação ambiental. Levou-se em consideração a importância da fauna no
sul da Bahia, a necessidade do conhecimento de possíveis enfermidades presentes na região e
os seus respectivos potenciais zoonóticos, a incidência de doenças em humanos no sul da Bahia,
o modo de subsistência das famílias residentes e as principais pressões antrópicas no uso da
terra. Consideraram-se as espécies silvestres o mico-leão-da-cara-dourada (Leontopithecus
chrysomelas), o macaco-prego-do-peito-amarelo (Sapajus xanthosthernos) e o bicho-preguiça
de coleira (Bradypus torquatus) como “espécies sentinelas”, uma vez que os mesmos são
endêmicos desta região, ameaçadas de extinção (IUCN, 2015), visíveis, passíveis de captura,
sensíveis às alterações ambientais, além de estarem potencialmente expostos a uma variedade
de doenças, incluindo a febre amarela (MANGINI et al., 2006). As pesquisas previamente
desenvolvidas com as espécies silvestres descrevem a ecologia e biologia dessas, obtendo dados
 19

de dieta, comportamento, tamanho e característica das áreas de uso, densidade populacional,

etc (CATENACCI et al., 2016; OLIVEIRA et al., 2011; VLEESCHOUWER et al., 2011). As
populações de animais foram e continuam sendo monitoradas através do uso de radiotelemetria,
sendo os indivíduos habituados à coleta de dados e passíveis a ela. Foi realizada uma avaliação
clínico-sanitária, incluindo coleta de material biológico para estudos de ocorrência e
prevalência de anticorpos para arboviroses, prevalência e identificação de parasitas intestinais,
exames hematológicos dos animais silvestres, além de estudos entomológicos nas áreas
amostradas (CATENACCI et al., 2017). Os resultados deste trabalho culminaram com uma
investigação também sobre a prevalência de arboviroses nas comunidades rurais de humanos
do entorno onde os animais/insetos foram capturados. Esta pesquisa, que se transformou na tese
de doutorado apresentada aqui, permitiu aprofundar investigações sobre a epidemiologia de
arboviroses e parasitoses intestinais na Mata Atlântica da Bahia, investir em melhorias no
diagnóstico de arboviroses em artrópodes e animais silvestres e em promover ações de saúde e
educação para as populações humanas dessa região.
Este trabalho vai ao encontro de documentos técnicos emitidos pelo Ministério da Saúde
(BRASIL, 2014) e pela Organização Mundial de Saúde (WHO, 2017), no qual a vigilância
epidemiológica da febre amarela e de outras arboviroses deve ser constituída pela vigilância
entomológica, pela vigilância de casos humanos, além da vigilância de epizootias de primatas
não humanos, atuando também na investigação sob a forma passiva. Segundo o Ministério da
Saúde (2014), torna-se necessário investigar os padrões de dispersão de arboviroses, de seus
hospedeiros e vetores e relacioná-los com as mudanças constantes dos ecossistemas onde todos
estão inseridos.
 20

2 REFERENCIAL TEÓRICO

2.1 ABORDAGEM “ONE HEALTH”

O conceito “One Health” surge como uma abordagem multidisciplinar e holística

visando estudar e correlacionar a saúde das pessoas, do meio ambiente e de animais silvestres
e domésticos (DASZAK et al., 2004). Em um mundo globalizado, novas abordagens para
prevenir, tratar e controlar doenças são extremamente necessárias (PATZ; HANH, 2014).
Novas enfermidades têm se dispersado mais rápido do que o esperado e isso se deve a diversos
fatores, como pressões antrópicas, que tem possibilitado a diminuição de distâncias entre
ecossistemas e a maior possibilidade de contato entre seres humanos e animais (Figura 1).
Figura 1– Propriedades pandêmicas de viroses zoonóticas transmitidas de animais
para humanos e espalhadas por transmissão secundária entre os humanos

Fonte: Johnson et al., 2015.

As características chaves que potencializam pandemias foram avaliadas por associações com
carga viral e plasticidade do hospedeiro, transmissibilidade entre pessoas e distribuição
geográfica. Atividades humanas facilitam mutações de vírus de RNA gerando capacidade de
infectar uma variedade de hospedeiros, incluindo animais silvestres e domésticos.

É importante definir "saúde" e "doença" no contexto desta tese, uma vez que estes são
termos amplos com diferentes significados, a depender da disciplina, foco de estudo ou mesmo
visão de mundo (DEEM et al., 2008). A Organização Mundial da Saúde define a saúde como
um estado de completo bem-estar físico, mental e social e não apenas a ausência de doença ou
enfermidade (WHO, 1946). Embora este estado possa servir de objetivo louvável, não nos
fornece critérios objetivos para determinar a saúde da vida selvagem ou dos ecossistemas. Em
animais silvestres, a doença pode ser definida como qualquer estado comprometido (não
 21

saudável) em que um indivíduo é incapaz de desempenhar seus papéis ecológicos em um

ecossistema, devido a uma infecção (por exemplo, viral, bacteriana, fúngica, parasita) ou
enfermidade de etiologia não infecciosa (por exemplo, toxinas, traumatismo) (DEEM et al.,
2008). Assim como não é fácil definir estado de saúde em animais silvestres, também é
complicado definir um ecossistema saudável. No entanto, a avaliação da saúde de um
ecossistema pode ser abordada por um dos três métodos: (1) “ecosystem distress syndrome”;
(2) “counteractive capacity”; e (3) “risk analysis” (RAPPORT, 1995). Com cada um desses
métodos, vários indicadores do estresse (doença) e / ou respostas do ecossistema são medidos
permitindo uma avaliação objetiva do estado (saúde) de um ecossistema particular. Em resumo,
a saúde de um indivíduo, população ou ecossistema pode ser melhor considerada como sua
capacidade de responder eficientemente aos desafios (doenças) e efetivamente restaurar e
sustentar um "estado de equilíbrio" (DEEM et al., 2008). Por sua vez, a gestão de saúde desses
três componentes: vida selvagem, ecossistemas e seres humanos, dependem cada vez mais de
atitudes integradas, interdisciplinares e com a visão holística, como a “One Health”, para
obtenção de sucesso.
Este conceito “one health – uma só saúde” também consiste numa estratégia mundial
adotada pela Organização Internacional de Epizotias (OIE) tendo como objetivo a colaboração
interdisciplinar entre entidades e/ou organismos de todos os temas relacionados com a saúde
das pessoas e animais (CONRAD et al., 2009). Além da interdisciplinariedade, são
características fundamentais, dentre os profissionais atuantes nesta área, a busca por parcerias
com diferentes instituições, o uso de metodologias participativas e elaboração de ações e
estratégias práticas com metas bem definidas. Apesar de ser um conceito do início do século
XVIII, “One Health” tem ganhado notoriedade nas últimas décadas, principalmente após a
epidemia de influenza aviária (WALLACE et al., 2014).

2.2 ANIMAIS SILVESTRES E O DESMATAMENTO ACENTUADO DA MATA

ATLÂNTICA

As ações antrópicas e as pressões pelo uso da terra têm sido indicadas como as maiores
causas de perda e degradação de habitats em todo o planeta (DONALD, 2004; HENLE et al.,
2004). As atividades intensificaram-se na segunda metade do século XX, quando houve um
grande desenvolvimento agrícola e incremento na exploração madeireira, o que levou à
devastação de florestas em grande escala (BIERREGAARD et al., 1992; MYERS, 1991;
MYERS et al., 2000). A destruição e a fragmentação de florestas resultantes dessas atividades
 22

são os principais responsáveis pela redução da fauna e flora (GALETTI, 2003) e pelo aumento
da taxa de extinção ocorrida nas últimas décadas (HENLE et al., 2004).
Em meio a ambientes modificados pelo homem, remanescentes de floresta permanecem
na forma de fragmentos isolados. Nestes locais, a redução de habitat, a matriz encontrada no
entorno e as distâncias entre esses fragmentos exercem influência direta no tamanho e na
dinâmica das populações naturais (LAURANCE; VASCONCELOS, 2004). Adicionalmente,
em paisagens perturbadas, a ação de predadores, da caça, a incidência de doenças e do fogo,
entre outros, podem ter seus efeitos potencializados (CULLEN et al., 2001; LAURANCE;
COCHRANE, 2001; WEAVER et al., 2010).
Como o restante da Mata Atlântica, as florestas litorâneas do sul da Bahia sofreram
grande redução em área devido às ações antrópicas, como a pavimentação da BR-101
(MESQUITA, 1996). Esta redução também se deve ao crescimento descontrolado do turismo
e às mudanças no uso da terra de agricultura para pastagem (SAATCHI et al., 2001). Na região
compreendida entre os Rios de Contas e Jequitinhonha a perda de cobertura vegetal foi
amenizada pela implementação da cabruca, sistema agroflorestal no qual o cacau (Theobroma
cacao) é sombreado por árvores da mata nativa (CASSANO, 2014; CASSANO, 2011). Nesta
região, a cacauicultura sofreu uma grande expansão a partir da década de 60, substituindo parte
das florestas maduras. A partir do final da década de 80 a queda na produção e no preço
internacional do cacau resultou em uma intensificação da exploração madeireira em florestas
maduras e cabrucas como alternativa de renda (ALGER; CALDAS, 1994). Estima-se que,
atualmente, permaneçam como floresta em estágio avançado de regeneração de 8-13% da
cobertura original do litoral sul da Bahia, e que menos de 1% dos remanescentes possuam área
superior a 1000 hectares (CASSANO et al., 2009; LANDAU, 2003). A região é particularmente
interessante por ser uma das poucas áreas onde todos os seis gêneros de primatas da Mata
Atlântica ocorrem simpatricamente. Estão presentes três espécies endêmicas, Leontopithecus
chrysomelas, Callithrix kuhli e Cebus xanthosternos, e mais outras cinco espécies: Callithrix
geoffroyi, Callicebus melanochir, Cebus robustus, Alouatta fusca e Brachyteles arachnoides
(PINTO, 1994). Além disso, é possível encontrar duas espécies de preguiças, a Bradypus
torquatus e Bradypus variegatus (IUCN, 2015).
 23

2.3 O MICO-LEÃO-DA-CARA-DOURADA

Os micos-leões (Callitrichidae: Leontopithecus) são primatas neotropicais de pequeno

porte (500-700g) que vivem em grupos sociais pequenos de cinco a seis indivíduos, geralmente
constituídos pelo casal reprodutor, subadultos, juvenis e infantes, dependendo da espécie e
utilizam áreas de vida entre 40 e 320 hectares (RYLANDS, 1993).
O Gênero Leontopithecus, endêmico da Mata Atlântica, possui quatro espécies, L.
caissara, L. rosalia, L. chrysomelas e L. chrysopygus; todas consideradas “Em Perigo (EN)”
de acordo com a lista nacional vigente de espécies ameaçadas (BRAZIL, 2014). Esta
classificação segue os critérios adotados pela União Internacional para a Conservação da
Natureza, com exceção do L. caissara, considerado criticamente ameaçada (IUCN, 2015).
A espécie Leontopithecus chrysomelas (Figura 2a) possui distribuição geográfica
restrita no estado da Bahia, Brasil, com a área de ocorrência de 19.462 km² (PINTO;
RYLANDS, 1997). Apenas uma pequena área de sua ocorrência engloba unidades de
conservação, como a Reserva Biológica de Una (REBIO-Una, Bahia), estando o restante em
áreas particulares (PINTO; RYLANDS, 1997), constituídas principalmente de fragmentos
desconectados (RABOY et al., 2010).
Como principais ameaças têm-se o desmatamento e a alteração de ambientes em toda a
área de distribuição da espécie e a crise cacaueira (RABOY et al., 2010; VLEESCHOUWER,
2011). Além disso, o comércio ilegal de exemplares da espécie, incêndios florestais em áreas
específicas (RYLANDS, 1993) e a presença de posseiros na REBIO-Una resultam em maiores
riscos aos animais.

2.4 MACACO-PREGO-DO-PEITO AMARELO

O macaco-prego-do-peito-amarelo (Figura 2b) era considerado uma subespécie do

Cebus apella, mas em 2001, por apresentar fenótipos e genótipos diferentes, foi considerado
uma espécie válida (CANALE et al., 2013). No entanto, de acordo com estudos na última
década, oito espécies que eram classificadas como a forma robusta e “com tufo” do gênero
Cebus pertencem agora ao gênero Sapajus (SUSCKE, 2014).
O gênero Sapajus tem ampla distribuição geográfica e ocupa diversos habitats, com
características ecológicas distintas, o que mostra o grande sucesso adaptativo do gênero
(SUSCKE, 2014). A distribuição original do S. xanthosthernos é limitada ao norte e oeste pelo
 24

Rio São Francisco, ao leste pelo Oceano Atlântico e ao sul pelo Rio Jequitinhonha. S.
xanthosthernos, comum e abundante no passado, está atualmente à margem da extinção devido
à intensa pressão de caça e destruição extensiva de seu habitat (LERNOULD et al., 2012), sendo
classificada pela União Internacional de Conservação da Natureza (IUCN) como “criticamente
em perigo” (IUCN, 2015). Atualmente habita pequenos fragmentos de mata e áreas de
agrofloresta, entremeadas pelas comunidades rurais (IUCN, 2015).

2.5 PREGUIÇA-DE-COLEIRA

As preguiças que possuem três dedos em ambos os membros são enquadradas na

Família Bradypodidae, gênero Bradypus que inclui as espécies, B. variegatus “preguiça-
comum”, B. tridactilus “preguiça-de-três-dedos”, B. pigmaeus “preguiça-anã” e B. torquatus
“preguiça-de-coleira” (ANDERSON; HANDLEY-JÚNIOR, 2001). Além das três garras,
apresentam membros anteriores maiores que os posteriores, oito a nove vértebras cervicais que
possibilitam uma boa mobilidade do pescoço e homodontia (WETZEL, 1985).
A preguiça-de-coleira (B. torquatus) (Figura 2c), espécie endêmica da Mata Atlântica,
encontra-se distribuída em fragmentos isolados devido ao crescente processo de degradação do
seu hábitat (WETZEL, 1985), além de utilizar plantações de cabruca, como citado para os
primatas neotropicais. Como consequência da redução de hábitat e exploração da espécie
através da caça, suas populações encontram-se bastante reduzidas (BARRETO et al., 2007).
Dessa forma, a espécie está categorizada como "vulnerável de extinção" na lista oficial de
animais ameaçados de extinção BRASIL (2003), e “em perigo de extinção” na lista
internacional de animais ameaçados da IUCN (2015).

2.6. PREGUIÇA-COMUM

A preguiça-comum (B. variegatus) (Figura 2d) é a espécie de preguiça que apresenta a

maior distribuição, a qual ocorre nas florestas tropicais de Honduras até Floresta Amazônica,
voltando a ocorrer na Mata Atlântica brasileira até a Argentina em simpatria com B. torquatus
(EMMONS; FEER, 1997). Oliver e Santos (1991) apresentam um único registro de entrevista
onde afirmam sobre a presença das duas espécies em um único fragmento na Reserva Biológica
de Una (Bahia). Segundo Pinder (1993), as características ecológicas de B. variegatus e B.
torquatus, como o uso de árvores para alimentação e locomoção, sugerem que há competição
entre as espécies, sendo que em áreas onde ocorre sintopia uma espécie tende a ser mais
 25

predominante que a outra (OLIVER; SANTOS, 1991), entretanto, estudos que investiguem as
interações entre as duas espécies devem ser elaborados para suportar essas afirmações.
Como as outras espécies de preguiças, a principal ameaça para a preguiça-comum é a
destruição e fragmentação de habitats (OLIVER; SANTOS, 1991).
Entre as principais estratégias para conservação destes animais silvestres e da
conseqüente conservação da Mata Atlântica do sul da Bahia destaca-se a necessidade da
ampliação do número de unidades de conservação, restauração e manutenção de fragmentos de
matas, além da implementação de corredores ecológicos capazes de permitir o trânsito efetivo
dos animais entre fragmentos de diferentes tamanhos e a investigação do estado de saúde das
populações em vida livre (RABOY; DIETZ, 2004; MUNOZ et al., 2006; VLEESCHOUWER
et al., 2011).

Figura 2 – Foto dos animais envolvidos na pesquisa

Fonte: (A) Zoológico da Antuérpia, Bélgica; (B) Luciano Candinsi; (C) Adriano
Chiarello; (D) Ozg1
(A) Leontopithecus chrysomelas, (B) Sapajus xanthosthernos, (C) Bradypus torquatus,
(D) B. varieagtus
 26

2.7. ARTRÓPODES IMPORTANTES PARA SAÚDE PÚBLICA

Os artrópodes (do grego arthros: articulado e podos: pés, patas, apêndices) pertencem
ao maior filo do reino animal: Arthropoda, sendo os únicos que apresentam exoesqueleto
quitinoso. Nesse filo, encontra-se a classe Insecta, que dentre outras, possui a ordem Diptera.
Nessa ordem estão distribuídos insetos hematófagos, pertencentes as famílias Ceratopogonidae,
Culicidae, Psychodidae e Simuliidae (WRBU, 2017). Os culicídeos são os insetos vetores que
mais atraem a atenção dos especialistas em saúde pública, pois agrupam mosquitos envolvidos
na transmissão de diversos agentes infecciosos (VASCONCELOS, 2010). São conhecidos
vulgarmente como mosquitos, pernilongos, muriçocas ou carapanãs (VASCONCELOS, 2003)
e considerados os animais responsáveis pelo maior número de mortes diretas de pessoas (Figura
3)
 27

Figura 3 – Esquema que identifica os principais animais responsáveis por morte direta de
pessoas no mundo

Fonte: https://www.gatesnotes.com/Health/Most-Lethal-Animal-Mosquito-Week

Os mosquitos apresentam padrões de atividade que dependem de fatores endógenos

(biologia) e fatores exógenos, que correspondem as condições do ambiente, tais como,
precipitação, temperatura, luminosidade, umidade, presença de hospedeiros, abrigos, locais
para desovas e etc (PINTO et al., 2009). Em ambientes florestados têm-se verificado que certas
espécies de culicídeos adultos diferem em suas preferências para o exercício das atividades no
que diz respeito às alturas arbóreas, mostrando estratificação vertical relativa a cobertura
propiciada pela vegetação desse meio (PINTO et al., 2009). Além disso, as intensas
modificações ocorridas em ambientes naturais têm favorecido o aparecimento de vários
ecossistemas artificiais e o estabelecimento de condições favoráveis para o desenvolvimento e
reprodução de culicídeos (FORATTINI, 1995). Essas modificações no ambiente, junto com os
fatores endógenos e exógenos, também podem alterar a dinâmica populacional dos mosquitos,
 28

colocando a população humana e de outros animais sob o risco de doenças provocadas por
agentes transmitidos por estes insetos. Assim, o estudo das populações de insetos hematófagos
fornece informações tanto sobre a diversidade biológica e também proporciona base para
estudos epidemiológicos (SANTOS; CALADO, 2014).
A vigilância entomológica tem sido o instrumento de coleta e avaliação periódica de
dados referentes aos vetores, tanto nas suas relações com hospedeiros vertebrados, incluindo
humanos e animais silvestres, quanto em aspectos ambientais (BRASIL, 2014). Apesar das
campanhas de coleta de entomofauna no Brasil estarem principalmente focadas em Aedes spp.,
outros mosquitos vêm assumindo importância para a saúde pública (CARDOSO et al., 2010).
Apesar de muitos insetos hematófagos silvestres ainda não estarem relacionados com a
transmissão de patógenos, competência e capacidade vetoriais permanecem pouco conhecidas.
É por isso que estudos continuados abordando aspectos ecológicos e de infecção natural dos
insetos, atrelados a estudos das condições de saúde do meio ambiente e dos hospedeiros fazem-
se ainda muito necessários na investigação científica (CARDOSO et al., 2010).

2.8 ARBOVÍRUS

2.8.1 Etiologia

Em 1942, a expressão arthropod-borne virus foi introduzida para descrição do grupo de

vírus de animais que possuíam parte do seu ciclo replicativo em artrórpodes e eram transmitidos
biologicamente a hospedeiros vertebrados através de picadas de insetos. Duas décadas depois,
o Subcomitê Internacional para Nomenclatura Viral recomendou a adoção oficial do termo
arbovírus para designação dos vírus que são mantidos em natureza em ciclos envolvendo
vetores artrópodes hematófagos e hospedeiros vertebrados (CASSEB et al., 2013; CASSEB et
al., 2015; LOPES et al., 2014). Estima-se que haja mais de 545 espécies de arbovírus, dentre as
quais, mais de 150 relacionadas com doenças em seres humanos, sendo parte delas zoonótica.
O único continente isento é o Antártico (CRUZ; VASCONCELOS, 2008).

2.8.2 Classificação e características gerais

Os arbovírus são constituídos por ácido ribonucléico (RNA). O único arbovírus que
possui o ácido desoxirribonucleico (DNA) como material genético até agora conhecido é o vírus
da peste suína africana, membro da família Asfaviridae (CALISHER et al., 1980; CASSEB et
al., 2013; KARABATSOS, 1985; WEAVER; REISEN, 2010). Os arbovírus tem uma variedade
 29

de genomas de RNA, podendo ser segmentados ou não e, apresentar-se com uma ou duas fitas
nucleotídicas. A grande plasticidade genética e altas taxas de mutação presentes nestes vírus,
aliados a diferentes estratégias de replicação, tem possibilitado ampliar o leque de transmissão
e infecções virais em diferentes hospedeiros ao longo do período evolutivo dos arbovírus
(WEAVER; REISEN, 2010).
Os arbovírus são classificados de acordo com suas propriedades antigênicas ou
propriedades físico-químicas. As propriedades antigênicas baseiam-se nos testes sorológicos
convencionais ou de primeira geração estabelecidos por Casals (1957): Inibição da
Hemaglutinação (IH), Soroneutralização (SN) e Fixação de Complemento (FC). Quando dois
os mais vírus demonstram cruzamento sorológico, passam a constituir um grupo antigênico.
Dentro do grupo antigênico, vírus com maior relacionamento são agrupados em subgrupos ou
complexos (VASCONCELOS et al., 2013). Os três primeiros grupos constituídos foram
designados pelas letras: A, B e C e os demais receberam o nome do primeiro vírus isolado no
respectivo grupo (CASALS, 1957).
Segundo as características físico-químicas, os arbovírus são classificados em 13
famílias: Flaviviridae, Asfaviridae, Reoviridae, Rhabdoviridae, Togaviridae, Feraviridae,
Fimoviridae, Jonviridae, Nairoviridae, Peribunyaviridae, Phasmaviridae, Phenuiviridae e
Tospoviridae (ADAMS et al., 2017; GUARDADO-CALVO; REY, 2017; KARABASTOS,
1985). Os arbovírus das famílias Feraviridae, Fimoviridae, Jonviridae, Nairoviridae,
Peribunyaviridae, Phasmaviridae, Phenuiviridae e Tospoviridae (anteriormente pertencentes a
família Bunyaviridae), Flaviviridae, Rhabdoviridae e Togaviridae apresentam acentuada
sensibilidade aos solventes lipídicos (éter e clorofórmio) e a detergentes (desoxicolato de sódio)
enquanto que os membros da família Reoviridae são pouco sensíveis (ou resistentes) aos
mesmos. Essa sensibilidade ou resistência deve-se a presença ou ausência do envelope lipídico,
respectivamente. Via de regra, os arbovírus são labeis em pH ácido e estáveis em pH alcalino.
São rapidamente inativados a 56ºC, mas preservam-se bem quando mantidos à temperatura de
–70 ºC ou, se liofilizados e mantidos à temperatura de –20 ºC (PINHEIRO et al., 1997). Os
arbovírus com genomas RNA não segmentados estão incluídos nas famílias Togaviridae,
Flaviviridae e Rhabdoviridae, enquanto aqueles com genomas segmentados incluem-se nas
demais famílias (GUARDADO-CALVO; REY, 2017; VASCONCELOS et al., 2013).
Ressalte-se, no entanto, que nem todos os membros das citadas famílias são necessariamente
arbovírus. Ressalta-se ainda a existência de arbovírus que não têm taxonomia definida
(ADAMS et al.; 2017; TRAVASSOS DA ROSA et al., 1986).
 30

A família Flaviviridae compreende os gêneros Flavivirus, Pestivirus, Pegivirus e

Hepacivirus (ADAMS et al.; 2017; FIGUEIREDO, 2000; VASCONCELOS, 2013). O gênero
Flavivirus é o único que possui arbovírus e corresponde ao grupo B da classificação antigênica.
Existem mais de 82 flavivírus, dos quais 12 foram descritos no Brasil (ADAMS et al., 2017;
FIGUEIREDO, 2000, 2007). A partícula dos flavivírus mede de 40 a 60 nm de diâmetro, possui
um capsídeo proteico (C) com simetria icosaédrica, envolvido por um envelope lipídico onde
estão inseridas as proteínas de membrana (M) e de natureza glicoproteica (E) (Quadro 1). O
genoma dos flavivírus é formado por RNA de fita simples de polaridade positiva, contendo
aproximadamente 11 kb. Este genoma possui uma pequena região 5’ não codificadora, uma
cadeia aberta de leitura (open reading frame – ORF) com 10.233 nucleotídeos que codificam
inúmeras proteínas, e um terminal 3’ não codificador (untranslated region – UTR), as quais são
importantes para a regulação e expressão do vírus.
O genoma codifica quatro proteínas estruturais: proteína C do capsídeo, proteína do envelope
pré-M, precursora de M e a proteína E. Além destas, o genoma codifica sete proteínas não
estruturais (NS1, NS2A, NS2B, NS3, NS4A, NS4B, NS5) que desempenham funções
reguladoras e de expressão do vírus, como a replicação, virulência e patogenicidade (SANTOS
et al., 2008).
Os flavivírus se destacam entre os arbovírus pelo grande número de infecções que
causam, além da gravidade dos sintomas dos mesmos, chegando a quadros hemorrágicos graves
(TRAVASSSOS-DA-ROSA et al., 1998). Pode-se destacar dentre eles alguns vírus de grande
importância médica, como YFV, DENV (quatro sorotipos), vírus Ilheus (ILHV), vírus Rocio
(ROCV), vírus da Encefalite de Saint Louis (SLEV), vírus do Nilo Ocidental (WNV), vírus da
Encefalite Japonesa (JEV) e ZIKV (MONATH; VASCONCELOS, 2015; VASCONCELOS et
al., 2003;).
A antiga família Bunyaviridae foi extinta no último encontro do Comitê Internacional
de Taxonomia Viral (ICTV) ocorrido em 2016 em Budapeste, Hungria. Os arbovírus que
pertenciam a esta família foram redistribuídos em oito famílias: Feraviridae, Fimoviridae,
Jonviridae, Nairoviridae, Peribunyaviridae, Phasmaviridae, Phenuiviridae e Tospoviridae
(ADAMS et al., 2017; GUARDADO-CALVO; REY, 2017). Três destas novas famílias contém
vírus que causam doenças em humanos, incluindo entre outros: o vírus da Febre Hemorrágica
da Criméia-Congo (CCHFV) (Nairoviridae); o vírus Toscana (TOSV), (Phlebovirus,
Phenuiviridae); e OROV (orthobunyavirus, Peribunyaviridae) (GUARDADO-CALVO; REY,
2017). Todos os bunyavirus, com exceção da família Hantaviridae, são transmitidos por
 31

artrópodes, principalmente mosquitos e carrapatos (CASSEB et al., 2015; GUARDADO-

CALVO; REY, 2017), incluindo a família de vírus de plantas, Tospoviridae.
As partículas virais dos bunyavirus são esféricas, medindo de 80 a 120nm de diâmetro,
sendo dotado de um envoltório formado por lipoproteínas, que apresentam projeções
(gliocoproteínas) que formam o envelope, e portanto, são sensíveis aos solventes lipídicos (éter
e ácido dicloroacético) (VASCONCELOS et al., 2013). O gênero Orthobunyavirus corresponde
entre outros, ao grupo C da classificação antigênica. Possui RNA constituído por três segmentos
designado grande (G), médio (M) e pequeno (P), que codificam uma polimerase, glicoproteínas
do envelope e nucleoproteína, respectivamente (Quadro 1). A simetria é helicoidal e a
polaridade do RNA é negativa (CASSEB et al., 2015; GUARDADO-CALVO; REY, 2017;
VASCONCELOS et al., 2013).
Dentro deste gênero estão incluídos patógenos virais de significante importância
humana e veterinária, tais como: vírus Caraparu (CARV), vírus Catu (CATUV), vírus
Tacaiuma (TCMV) e OROV. O gênero Phlebovirus inclui arbovírus com distintos sorotipos
que mostram variados graus de relacionamento antigênicos por testes sorológicos
convencionais (VASCONCELOS et. al., 2013). A maioria deste gênero são transmistidos por
flebotomíneos, mas o conhecimento acerca de muitos desses agentes é baseado, na maioria das
vezes, em um único isolamento viral obtido de um lote de insetos ou de mamíferos silvestres
ou ainda casos humanos. Como exemplo, tem-se o vírus da Febre do Rift Valley (RVFV), que
acomete humanos e animais domésticos, em especial caprinos e ovinos (CASSEB et al., 2015).
A família Togaviridae compreende os gêneros Alphavirus e Rubivirus. O primeiro é o
maior, incluindo cerca de 40 membros, e é o único que possui importância para o estudo dos
arbovírus, correspondendo sorologicamente ao grupo A dos arbovírus, segundo a classificação
de Casals (1957). Os togavírus são vírus de RNA de cadeia simples envelopados, de aparência
esférica. Os alfavírus possuem cerca de 70 nm de diâmetro, com um capsídeo icosaédrico e um
genoma consistindo de RNA fita simples linear de polaridade positiva, de aproximadamente 11
kb (Quadro 1). Nas extremidades 5’ e 3’ do genoma existem pequenas sequencias não
traduzidas. As ORFs estão divididas em dois módulos: em genes que codificam as proteínas
não estruturais (NSP1, NSP2, NSP3 e NSP4), os quais se encontram nos dois terços da
extremidade 5’, e genes que codificam as estruturais (proteína do capsídeo NA, E3, E2, 6K e
E1), localizados próximos á extremidade 3’ (FAUQUET et al., 2005; SANTOS et al., 2013).
Os representantes do gênero Alphavirus são agentes causadores de uma ampla gama de
doenças em seres humanos e animais, com distribuição cosmopolita. Onze tipos já foram
associados com doença humana, sendo que alguns têm sido responsáveis por epidemias nas
 32

últimas décadas: vírus da Encefalite Equina Leste (EEEV), vírus da Encefalite Equina Oeste
(WEEV), vírus da Encefalite Equina Venezuelana (VEEV), MAYV e CHIKV (CALISHER et
al., 1980).

Quadro 1 – Características gerais dos principais gêneros de arbovírus segundo algumas

características físíco-químicas

Gênero Envelope Simetria Genoma Tamanho

viral partícula
Flavivirus Sim Icosaédrica RNA de fita simples, 45-60 nm
polaridade (+) não
segmentado
Alphavirus Sim Icosaédrica RNA de fita simples, 60-70 nm
polaridade (+) não
segmentado
Orthobunyavirus Sim Helicoidal RNA de fita simples, 80-120 nm
polaridade (-),
segmentado
Phlebovirus Sim Helicoidal RNA de fita simples, 80-120 nm
polaridade (-),
segmentado
Fonte: Adaptado de Santos, 2013.

2.8.3 Ciclos de Manutenção dos arbovírus

De modo geral, os arbovírus se mantêm na natureza através de ciclos silvestres

complexos contendo hospedeiros vertebrados, tais como aves, répteis e mamíferos
(principalmente marsupiais, morcegos, preguiças, primatas não-humanos, entre outros) e
artrópodes hematófagos (como mosquitos, carrapatos, ácaros, culicóides, flebotomíneos, entre
outros), que atuam como vetores transmissores desses vírus (Figura 4). Enquanto nos
hospedeiros o vírus realiza viremia por períodos curtos (em geral 5-7 dias), nos artrópodes o
vírus se mantém durante todo o ciclo de vida do animal. Além disso, transmissão entre
artrópodes também pode ocorrer durante a cópula (via venérea) e através de ovos (transmissão
vertical). Os artrópodes são, portanto, os responsáveis pela manutenção do vírus na natureza,
enquanto os vertebrados atuam na dispersão dos vírus para diferentes ambientes
(FIGUEIREDO, 2000; LOPES et al., 2014; VASCONCELOS et al., 2013).
 33

Figura 4 – Esquema de manutenção de arbovírus em natureza, denominado ciclo silvestre

Vetores: Artrópodes hematófagos

Transmissão
transovariana e venérea****

Ciclo Silvestre de manutenção de arbovírus em natureza*

Hospedeiros acidentais:
Seres humanos***

Hospedeiros naturais: Vertebrados

suscetíveis**
Fonte: adaptado de Fernandes, 2015.
*Artrópodes hematófagos infectados transmitem os arbovírus aos hospedeiros vertebrados suscetíveis durante o
repasto sanguíneo **Na corrente sanguínea dos hospedeiros, os vírus iniciam seus processos naturais de replicação
e iniciam uma viremia suficiente para que estes vertebrados funcionem como hospedeiro de amplificação para os
arbovírus, permitindo que novos artrópodes possam ser infectados em suas “refeições” sanguíneas. ***Entretanto,
como há a presença humana no ambiente, os vetores também infectam acidentalmente seres humanos durante
repasto sanguíneo, dando início às zoonoses conhecidas como arboviroses. **** Além da transmissão vertical, os
arbovírus podem ser transmitidos entre mosquitos, via venérea ou transovariana.

É possível ainda que os ciclos de transmissão já conhecidos sejam naturalmente

modificados em decorrência das mudanças ambientais e demais fatores citados anteriormente,
acrescentando novos hospedeiros suscetíveis a ciclos outrora conhecidos (FARIA et al., 2016;
FIGUEIREDO, 2007). É neste âmbito que se observa o potencial dos arbovírus em causar
zoonoses, onde naturalmente os seres humanos não seriam alvo de infeção (WEAVER et al.,
2010). Vírus como DENV, CHIKV e ZIKV perderam a necessidade de amplificação
enzooótica e atualmente produzem epidemias extensas. Esses são os chamados ciclos urbanos
de manutenção dos arbovírus (WEAVER et al., 2010, LOPES et al., 2014). Como exemplo,
 34

131.749 casos prováveis de dengue no país, 230.410 casos prováveis de febre de chikungunya
e 13.353 casos de febre do ZIKV foram reportados no Brasil em 2017 até a semana
epidemiológica número 25 (1/1/2017 a 24/06/2017) (BRASIL, 2017).
Outros arbovírus originalmente silvestres têm aparecido regularmente em áreas urbanas
(OROV, YFV) ou rurais (MAYV e o YFV) brasileiras (FIGUEIREDO, 2015;
VASCONCELOS, 2003, 2013). Semelhante ao YFV, o OROV se mantém em dois ciclos:
selvagem e urbano (FIGUEIREDO, 1999). Já para MAYV, a maioria das infecções humanas é
esporádica e os ciclos enzoóticos ocorrem em ambientes silvestres, de modo que as pessoas se
infectam ao entrarem nessas áreas para executarem atividades dentro ou próximo a florestas
(SANTOS et al., 2013). Vários surtos de febre do Mayaro têm sido notificados na região
amazônica, geralmente limitados ao interior das florestas ou áreas rurais próximas a elas
(COIMBRA et al., 2007). Em ambos os casos (infecção por YFV e MAYV), o culicídeo Aedes
aegypti provavelmente funciona como vetor em áreas antropizadas. Apesar da quantidade de
vírus necessária para infectar o vetor não ter sido estabelecida, o homem é tido como
amplificador na transmissão do MAYV durante epidemias rurais, por circular com o vírus em
quantidade suficiente para eventualmente infectar os vetores potenciais (COIMBRA et al.,
2007; DE THOISY et al., 2003; MUÑOZ; NAVARRO, 2012; FIGUEIREDO et al., 2014). No
entanto, a maioria dos arbovírus envolvidos com doença em humanos ainda são mantidos na
natureza por meio de ciclos silvestres, nos quais diversas espécies de insetos hematófagos e
vertebrados silvestres atuam como vetores e hospedeiros, e os seres humanos são considerados
hospedeiros acidentais (VASCONCELOS et al., 1998) (Figura 4).

2.8.4 As arboviroses e os desafios para saúde pública

A natureza da doença produzida no homem varia conforme o tipo de arbovírus

responsável pela infecção. As manifestações clínicas das arboviroses em seres humanos podem
variar desde doença febril (DF) indiferenciada, moderada ou grave, erupções cutâneas e
artralgia (AR), a síndrome neurológica (SN) e síndrome hemorrágica (SH). A DF geralmente
se apresenta com sintomas de gripe, como febre, cefaleia, dor retro-orbital e mialgia. A SN
pode manifestar-se como mielite, meningite e/ou encefalite, com mudanças de comportamento,
paralisia, paresia, convulsões e problemas de coordenação. A AR manifesta-se como exantema
ou rash maculopapular, poliartralgia e poliartrite, enquanto que a SH é evidenciada pelas
petéquias, hemorragia e choque combinado com uma redução intensa de plaquetas (CLETON
 35

et al., 2012). Mas a maioria das arboviroses é assintomática ou provoca uma síndrome febril
autolimitada (VASCONCELOS et al., 2013).
De acordo com Marcondes (2009), a estimativa global de doenças infecciosas
transmitidas por mosquitos tem alto impacto em saúde pública, tendo atingido 47,5 milhões de
anos de vida ajustados por incapacidade (DALY) em 2001; representando aproximadamente
15% de todos os DALY atribuídos às doenças infecciosas e parasitárias em todo o mundo. As
arboviroses constituem sério problema global devido a expressiva morbidade e/ou mortalidade
que ocasionam (CAMPOS, 2015; 2016; CRUZ; KIKUTI et al., 2015; VASCONCELOS et al.,
2008).
Estratégias de controle e prevenção baseiam-se em: (1) vacinação (dose única) para
YFV em áreas endêmicas, (2) controle populacional de vetores em áreas urbanas e rurais e (3)
atividade de educação e saúde com a população em geral (WHO, 2017). No entanto, reduzidos
recursos financeiros destinados a programas de saúde, somados aos déficits de saneamento
básico, e ao baixo acesso da população as unidades de saúde, continuam sendo desafios
enfrentados para evitar ou controlar surtos e epidemias causados por arbovírus. Soma-se a isto
os mecanismos de mutação e recombinação genéticas dos vírus RNA como forma de geração
de novos padrões genômicos, que, portanto, dificultam o controle das viroses (FARIA et al.,
2016; SCHATZMAYR, 2001; WEAVER et al., 2010).

2.8.5 Arboviroses emergentes e reemergentes

A febre amarela é uma doença essencialmente de primatas-não humanos, porém com

capacidade de alcançar o homem que penetre em áreas endêmicas sem proteção vacinal,
atingindo a média anual brasileira de 18 casos entre 1986 a 2001 (SCHATZMAYR, 2001;
TORRES et al., 2003). Os riscos de adquirir a doença variam, sendo maior para as pessoas não
vacinadas que se expõem sistematicamente, e é menor para os que evitam as incursões em matas
ou que vivem em áreas indenes dessa arbovirose (NASSAR et al., 1995; VASCONCELOS,
2003; MONATH; VASCONCELOS, 2015). Todas as pessoas não vacinadas que se exponham
às picadas dos transmissores em áreas de floresta, dentro da área endêmica para febre amarela,
especialmente onde esteja ocorrendo circulação do vírus, podem vir a se infectar e adoecer pelo
YFV. Isto inclui as áreas florestais e rurais da América do Sul (VASCONCELOS, 2003). Em
2000, 2001, 2008 e 2009 ocorreram epizootias em primatas, que resultou em um substancial
aumento dos casos humanos de febre amarela (SCHATZMAYR, 2001; TAUIL, 2010). Por
outro lado, com a reinfestação do mosquito Aedes aegypti nas áreas endêmicas de febre amarela,
 36

o risco de reemergência de infecções urbanas passou a ser uma realidade a ser enfrentada
(MONATH; VASCONCELOS, 2015; NASSAR et al., 1995; SOUZA et al., 2015,
VASCONCELOS et al., 2004; VASCONCELOS, 2010). Depois desses anos, o vírus amarílico,
uma vez considerado endêmico somente a uma porção limitada do país (principalmente as
regiões Norte e Centro-Oeste do país) começou a ser detectado sob a forma de surtos em outros
estados do território brasileiro (SOUZA et al., 2011; VASCONCELOS, 2003;
VASCONCELOS et al., 2004; VASCONCELOS, 2010). No final de 2016 deu-se início outra
epidemia de febre amarela silvestre em humanos no Brasil. Atualmente já é reconhecida por ser
a maior da América Latina. Segundo dados da Secretaria de Vigilância em Saúde, até 31 de
maio de 2017, foram notificados ao Ministério da Saúde 3.240 casos suspeitos de febre amarela
silvestre em humanos. Destes, 792 (24,5%) foram confirmados, 519 (16%) casos permanecem
em investigação e 1.929 (59,5%) foram descartados. Do total de casos notificados, 435
evoluíram para óbito (BRASIL, 2017).
Outra arbovirose emergente é a febre do Oropouche. O OROV é um dos arbovírus
causadores de doença febril no Brasil. Apesar disso, pouco se sabe sobre a patogênese da
infecção. É conhecido que os sítios epidêmicos do OROV estavam focados em áreas tropicais
da América Central e do Sul, especialmente na bacia amazônica. Porém, da década de 1980
em diante, o vírus espalhou-se para diferentes estados do norte do país e região nordeste
indicando, em um curto período de tempo, um perigoso potencial de epidemia. Em 2000, uma
cepa foi isolada a partir de um novo hospedeiro, o macaco (Callithrix sp.) na região de Arinos,
estado de Minas Gerais, sudeste do Brasil e em primatas de vida livre no Mato Grosso do Sul e
Goiás (GIBRAIL et al., 2016; BATISTA et al., 2015). Apesar do conhecimento da significante
ocorrência dessa arbovirose, muitos casos permanecem sem diagnóstico, provavelmente por
causa de suas manifestações clínicas, geralmente leves e autolimitadas (GIBRAIL et al., 2016).
A dengue também é uma das arboviroses com uma das maiores preocupações para
vigilância em saúde mundial. Há referência do primeiro surto da doença no Brasil causando
febre, mialgia e artralgia em 1846, no estado do Rio de Janeiro. Provavelmente, outros surtos
ocorreram no nordeste, sudeste e sul do Brasil ainda no século XIX (MONDINI et al., 2007).
A falta de relato de dengue entre 1924 e 1981 tem sido atribuída a erradicação dos mosquitos
Ae. Aegypti (FIGUEIREDO et al., 2000). Porém, nas últimas três décadas, quatro sorotipos de
dengue circulam no território brasileiro, variando a prevalência entre as regiões do país
(FIGUEIREDO et al., 2015). Durante os surtos e epidemias de dengue, 10 milhões de casos da
fase febril aguda foram reportadas e continuam sendo diagnosticados até hoje. Destes, milhares
 37

apresentaram as fases mais graves da doença, resultando em um alto número de mortes

(FIGUEIREDO et al., 2015).
Na Bahia, a primeira epidemia de dengue foi detectada em fevereiro de 1987 em
Ipupiara, pequeno município do sudoeste do estado. O sorotipo identificado foi o DENV-1 e
cerca de 623 casos foram notificados como suspeitos, correspondendo a uma taxa de incidência
em torno de 24.000 casos por 100.000 habitantes (TEIXEIRA et al., 2001). Em 90 dias, o vetor
foi completamente eliminado e o vírus deixou de circular. O DENV-1 só voltou a ser detectado
na Bahia em 1994, e o DENV-2 foi introduzido em uma cidade do extremo sul do estado,
disseminando-se em seguida. O maior pico epidêmico ocorreu em 1996, quando a incidência
atingiu 502 por 100.000 habitantes (TEIXEIRA et al., 2001). No ano de 2002 Bahia ainda
experimentava epidemia dos dois sorotipos quando DENV-3 foi introduzido e produziu o
primeiro caso de Doença Febril Hemorrágica (DFH) no estado (MELO et al., 2007).
Outra arbovirose emergente é a febre do Chikungunya, tendo sido detectado o primeiro
caso no Brasil em uma pessoa residente da cidade de Salvador, Bahia e também no Oriapoque,
Amapá (FARIA et al., 2016). Em 2013, dois genótipos do CHIKV de diferentes regiões do
Caribe e Ásia foram introduzidos no Brasil, espalhando-se rapidamente. Casos de doença por
este vírus se espalharam por todo o país (LOPES et al., 2014).
A circulação autóctone do ZIKV nas Américas foi confirmada pela primeira vez em
fevereiro de 2014 na Ilha de Páscoa. Já em 2015, ZIKV foi introduzido no Brasil produzindo
surtos no nordeste e dispersando em todo o território do país, tornando-se uma epidemia
(FIGUEIREDO et al., 2015). O primeiro caso reportado em humanos no país também foi na
cidade de Salvador, Bahia (CAMPOS; SARDI, 2015). No relatório da Organização Mundial de
Saúde (OMS), de dezembro de 2016, setenta e cinco países ou territórios foram relatados com
VZIK através de transmissão vetorial feita por mosquitos, treze reportaram a transmissão
pessoa a pessoa e vinte e nove reportaram más formações e/ou microcefalia (WHO, 2016). No
Brasil, o Boletim Epidemiológico número 48, volume 29, correspondente à semana
epidemiológica (SE) 52 de setembro de 2017, demonstra entre as unidades da federação que
apresentaram maior taxa de incidência, destacaram-se Tocantins (62,0 casos/100 mil hab.),
Mato Grosso (59,4 casos/100 mil hab) e Goiás (53,3 casos/100 mil hab.)
Apesar de não ser considerada uma arbovirose emergente, inquéritos sorológicos em
humanos realizados no Brasil indicam a presença de anticorpos para ILHV em grande parte das
amostras testadas. E mesmo sem ter sido registrado óbito em humanos até o presente momento,
o ILHV apresenta como espectro clínico desde infecções assintomáticas, como sintomáticas e
um período de viremia curto de três dias (VASCONCELOS et al., 2013). A infecção
 38

sintomática em humanos varia de fortes dores de cabeça, calafrios, mialgia, fraqueza até
quadros de encefalite. Entretanto o número de casos clínicos relatando manifestações
sintomáticas da infecção é baixo, sugerindo que grande parte das infecções seja assintomática
e, portanto, não diagnosticada na fase aguda da doença (AZEVEDO et al., 2010).
Com a diversidade de arbovírus circulantes concomitantemente em território brasileiro,
faz-se necessário um aprofundamento dos aspectos eco-epidemiológicos destas arboviroses
emergentes e re-emergentes. Estudos com animais silvestres e entomofauna são portanto,
essenciais para investigar a atual circulação destes vírus em ambientes naturais e no
planejamento de possíveis intervenções (MONATH; VASCONCELOS, 2015;
VASCONCELOS, 2010; ROCHA et al., 2015).

2.8.6 As arboviroses em animais silvestres

No Brasil coabitam em número bastante elevado de várias espécies de dípteros

hematófagos (mosquitos, flebotomíneos, carrapatos, maruins) (CATENACCI et al., 2017;
CARDOSO et al., 2010) e vertebrados silvestres (CASSANO et al., 2016; CASSEB et al.,
2013; FERREIRA et al., 1994), incluindo primatas não-humanos e preguiças (BATISTA et al.,
2013; CATENACCI et al., 2016; ALMEIDA et al., 2012; GIBRAIL et al., 2016; MORENO et
al., 2013). Esta alta biodiversidade constituem um achado único no mundo e propiciam
condições ambientais bastante favoráveis à manutenção de arbovírus na natureza (ALTHOUSE
et al., 2016; BUENO et al., 2016; FERREIRA et al., 1994; PAULA et al., 2015). Já foi
observado que PNH, tem um papel importante como reservatórios de arbovírus, como o DENV,
YFV e ZIKV (HAYES, 2009; KILBOURN, 2003; TAIPE-LAGOS et al., 2003; THOISY et al.,
2004).
A febre amarela, por exemplo, na América do Sul, é mantida em ciclos epizoóticos que
envolvem primatas e insetos dos gêneros Haemagogus e Sabethes. Os macacos dos gêneros
Alouatta e Ateles são mais sensíveis aos arbovírus e apresentam taxa de letalidade mais elevada.
Já os Callithrix e Cebus infectam-se facilmente, mas apresentam menores taxas de letalidade e
geralmente desenvolvem imunidade (VASCONCELOS, 2003; BRASIL, 2014).
Desde o final de 2016, o Brasil vive a maior epidemia de febre amarela silvestre
(BRASIL, 2017). Segundo dados da vigilância de epizootias, foram notificadas ao Ministério
da Saúde 3850 PNH nas epizootias. Destes, 1.448 permanecem em investigação, 96 foram
descartadas e 642 foram confirmadas para febre amarela por critério laboratorial, vínculo
epidemiológico com epizootias em PNH ou casos humanos confirmados em áreas afetadas
 39

(municípios com evidência de circulação viral) e ampliadas (municípios limítrofes àqueles

afetados), com envolvimento total de 5.553 animais (BRASIL, 2017). Diversos outros
arbovírus utilizam o PNH como hospedeiro natural, como o MAYV (PAUVOLID-CORRÊA
et al., 2014). O vírus Mucambo (MUCV) envolve mosquitos, primatas não humanos e
principalmente roedores, além da capacidade de infecção em humanos de forma acidental
(VASCONCELOS et al., 1991). O OROV já foi isolado a partir de um novo hospedeiro de
macaco (Callithrix sp.) no estado de Minas Gerais (NUNES et al., 2005) e no Mato Grosso do
Sul (BATISTA et al., 2013). O vírus Tacaíuma (TCMV) já foi isolado em mosquitos, animais
silvestres, PNH e em humanos, além de já terem sido encontrados anticorpos em um morador
rural do estado de São Paulo na década de 80 durante estudos sorológicos com o teste de
inibição da hemaglutinação (FIGUEIREDO, 1999).
Outro vírus em destaque é o vírus Ilhéus (ILHV), que foi isolado pela primeira vez em
1944 de um pool de mosquitos Aedes e Psorophora durante uma investigação epidemiológica
de febre amarela, na Cidade de Ilhéus, estado da Bahia (Pereira et al. 2001), em um dos mesmos
municípios onde esta pesquisa está sendo realizada. Os gêneros Coquillettidia, Haemagogus,
Sabethes, Trichoprosopon, Culex e Wyeomyia também podem estar envolvidos na transmissão
natural do vírus. O ciclo de manutenção do vírus em natureza tem sido atribuído a mosquitos
vetores do vírus e aves como reservatórios naturais (PAUVOLID-CORRÊA et al., 2013),
embora tenha havido isolamentos virais e estudos com detecção de anticorpos para ILHV em
roedores silvestres, marsupiais, morcegos e primatas não humanos. Recentemente, o ILHV foi
detectado em um pool de mosquitos Aedes coletados na Região do Pantanal (PAUVOLID-
CORRÊA et al., 2014), além de ter sido demonstrado anticorpos contra o vírus em equinos,
ovinos e jacarés (PAUVOLID-CORRÊA et al., 2013).
O ZIKV foi descoberto em um macaco sentinela na floresta em Uganda em 1947,
surgindo surtos em humanos nas ilhas do pacífico e do caribe 60 anos depois (FARIA et al.,
2016). Em um estudo sobre a saúde de orangotangos de vida livre e animais de cativeiro foi
observada a presença do ZIKV em testes sorológicos, tanto de animais de vida-livre (13%)
quanto de animais de cativeiro (3%) (KILBOURN et al., 2003). No entanto, uma questão que
permanece pouco compreendida é o papel de primatas neotropicais na enzootização do ciclo
silvestre (MONATH; VASCONCELOS, 2015). Poderiam os vetores que habitam áreas peri-
urbanas, como Aedes albopictus, servirem como ponte para o estabelecimento do ciclo
enzooótico nas Américas (ALTHOUSE et al., 2016; BUENO et al., 2016; WEAVER et al.,
2016)? A presente tese conta com um manuscrito abordando ameaças do ZIKV para os animais
silvestres, que será publicado em junho de 2018 como capítulo do livro Fowler's Zoo and Wild
 40

Animal Medicine (apêndice K). No nordeste brasileiro, Favoretto e colaboradores em um

estudo controle da raiva silvestre encontraram duas espécies de primatas neotropicais de vida
livre– Callithrix penincillata e Sapajus robustus- positivos para o ZIKV no exame de RT-PCR
(FAVORETTO et al., 2016).
Acredita-se que as preguiças também desempenham um importante papel para a
epidemiologia de algumas arboviroses no Brasil, como OROV (VASCONCELOS et al., 2013).
A baixa taxa metabólica dos edentatas pode explicar com o alargamento do período de viremia
para diversas viroses, aumentando assim o período de possibilidade de transmissão do vírus
pela picada do inseto hematófago (GILMORE et al., 2001, SEYMOUR et al., 1983 a,b). De
acordo com Medlin e colaboradores (2016), dez arboviroses já foram descritas em preguiças:
SLEV, VEEV, Changuinola virus (CGLV), ILHV, OROV, MAYV, Utinga virus (UTIV),
Murutucu virus (MURV), Punta Toro virus (PTV), e Estomatite Vesicular virus (VSV). No
entanto, nenhum destes estudos foi realizado com a espécie Bradypus torquatus.

2.8.7 Situação das arboviroses nos municípios envolvidos na pesquisa

No município de Ilhéus, na década de 1940, foram obtidos isolamentos do YFV a partir

de primatas doentes e do ILHV, isolado a partir do “pool” de mosquitos Aedes sp. e Psorophora
sp. (PEREIRA et al., 2001).
Já a introdução da dengue no município ocorreu em 1994, e desde então vem se
observando epidemias anuais. Segundo o Boletim Dinâmico da Bahia (BRASIL, 2014). Em
2002 foi detectada a circulação dos sorotipos de DENV-1 e DENV-3, este último introduzido
no Brasil pelo Rio de Janeiro no mesmo ano. Já em 2005 foram registrados 2.424 casos de
dengue, sendo sete casos de Febre Hemorrágica do Dengue (FHD), um com Síndrome do
Choque do Dengue (SCD) e um caso que evoluiu com complicações e óbito. No ano de 2009,
foram registrados 4.250 casos de Febre do Dengue (FD), 132 casos de FHD e 30 casos de
dengue com complicações, sendo que, nesse ano foi isolado o sorotipo de DENV- 2 na zona
norte do município, área urbana, bairro Malhado.
Em 2010, foram notificados 1.613 casos, distribuídos em toda a sua área geográfica,
mas mais concentrado em nove bairros urbanos. Segundo a secretaria do município, apesar do
enfrentamento da doença ter contado com estratégias implementadas (distribuição de 2.030
capas para tanques e tonéis, bloqueio de foco para todos os casos notificados em tempo
oportuno, ações educativas em igrejas, associações e escolas, implantação do diflubenzuron
 41

como projeto piloto do município), estas ações não causaram impacto no controle do agravo,
havendo persistência da circulação viral durante todo o ano. Dos casos de dengue notificados
no ano de 2010, 65 casos tiveram apresentação clínica de FHD e dengue com complicações.
Foi registrada a ocorrência de um óbito por dengue no bairro do Malhado.
No ano de 2011, foram notificados 1.726 casos de dengue, e, dentre esses, seis casos de
FHD e dois casos de dengue com complicações, em crianças menores de 11anos. No ano de
2012, foram notificados 2.834 casos de dengue, distribuídos de forma homogênea no território
municipal urbano, e dentre estes, 12 casos de FHD, seis casos de dengue com complicações,
ocasionando um óbito. Das 30 amostras para isolamento viral, encaminhadas ao LACEN-
Bahia, cinco, tiveram resultado positivo para o sorotipo de DENV-4, o que caracterizou o risco
para epidemia, devido à condição de suscetibilidade universal da população local ao DENV-4.
Em 2013 foram notificados 2.570 casos de dengue, sendo dois casos confirmados de FHD e um
óbito de dengue com complicações (BRASIL, 2014).
Com relação ao município de Una, durante o ano de 2014, foram informados pelas
unidades de saúde e registrados no Sistema de Informação de Agravos e Notificações (SINAN)
25 casos suspeitos de dengue. Destes, um foi classificado como dengue, 22 foram descartados
e dois permaneceram sem diagnóstico. No mesmo período do ano anterior, tinham sido
notificados 849 casos de dengue, houve um decréscimo de 91.17%. Porém, a própria secretaria
afirma que este número pode ter diminuído em decorrência do atraso no processo de digitação
das Fichas de Notificação Individual, além do tempo decorrido entre a data de captação do caso
e a data de entrada do dado no sistema de informação. Segundo ainda o Boletim Dinâmico da
Bahia (BRASIL, 2014), o maior número de casos de dengue ocorreu em indivíduos adultos,
entre 22 e 34 anos, com mediana igual a 25 anos. O município ainda não possui o diagrama de
controle da dengue, o que dificulta estimar a frequência esperada desse agravo numa
determinada área ou período.
A falta de informação sobre os casos de dengue em áreas rurais dos dois municípios
estudados dificulta o acompanhamento histórico da arbovirose nas áreas amostradas, assim
como avaliação das medidas de controle e prevenção que têm sido empregadas, como cobertura
vacinal, controle de vetores ou ações educativas. Das onze comunidades rurais visitadas
durante o estudo, por exemplo, somente três delas possuíam postos de saúde em funcionamento,
sendo que dois deles não contavam com atendimento médico (Lilian Catenacci, comunicação
pessoal).
 42

2.9 MÉTODOS DE DIAGNÓSTICO LABORATORIAL DE ARBOVÍRUS

Os métodos de diagnóstico laboratorial para arbovírus ainda hoje empregados são

principalmente: (1) métodos sorológicos para detecção de antígenos e/ou anticorpos; (2)
métodos virológicos para tentativa de isolamento viral e identificação do vírus isolado no
espécime; e (3) métodos de biologia molecular para detecção, identificação e sequenciamento
do genoma viral (VASCONCELOS et al., 2013).
Os métodos sorológicos são realizados principalmente pelos testes de inibição de
hemaglutinação (IH), fixação do complemento (FC), soroneutralização (SN) e o teste
imunoenzimático – ELISA (enzyme-linked immunosorbent assay) (VASCONCELOS et al.,
2013; SANTOS et al., 2008). Destes, o teste de IH em microplacas é recomendado para
sorologia de triagem e estudos soroepidemiológicos. Trata-se de um teste sensível descrito por
Clarke e Casals (1957), sendo utilizado até os dias atuais em laboratórios especializados para
detecção de anticorpos contra diversos arbovírus. A técnica foi adaptada para um procedimento
de microtitulação por Shope (1963). As amostras de soro, tanto de humanos como de animais
silvestres e domésticos, são submetidas à técnica de IH para detecção de anticorpos.
Basicamente, os soros são inicialmente tratados por acetona e adsorvidos por hemácias de
ganso. Em seguida, são testados na diluição 1:20 contra quatro unidades hemaglutinantes dos
antígenos. Se houver a formação do complexo antígeno-anticorpo, as hemácias sedimentam na
forma de um botão compacto, no fundo do tubo ou da placa. Porém, sem a formação deste
complexo, as hemácias serão aglutinadas pelo antígeno e sedimentarão de forma difusa (Figura
5). Todos os soros positivos são, em seguida, titulados contra os antígenos que os inibem. Por
ser um teste menos específico, pode haver reações cruzadas dentre as espécies de vírus
pertencentes ao mesmo gênero. O surgimento de reações cruzadas deve-se a semelhanças em
proteínas estruturais e epítopos entre arbovírus pertencentes a uma mesma família viral
(TRAVASSOS DA ROSA et al., 2000).
 43

Figura 5 – Esquema do teste de Inibição da Hemaglutinação (IH)

Fonte: Santos, Romano e Wigg, 2002.

Esse teste é ideal para estudos soroepidemiológicos longitudinais e em áreas com

potencial diversidade de arbovírus, uma vez que um amplo painel de detecção de arbovírus
pode ser empregado. É aconselhado que para diagnóstico, deva-se colher duas amostras de soro
do mesmo indivíduo com intervalo mínimo de duas semanas entre elas. Se houver um aumento
do título de anticorpos inibidores da hemaglutinação de pelo menos quatro vezes para um
determinado vírus ou a presença de reação monotípica, pode-se fazer um diagnóstico seguro de
infecção por este vírus. Este aumento de título de anticorpos inibidores da hemaglutinação, de
pelo menos quatro vezes, é chamado de soroconversão (CASSEB et al., 2015; RODRIGUES,
2010). Além disso, o IH trata-se de uma prova laboratorial eficiente para pesquisa com animais
silvestres, devido à necessidade de estudos de potenciais reservatórios e/ou hospedeiros
silvestres para arbovírus (BATISTA et al., 2013). Exposições antigas por arbovírus podem ser
observadas nesse teste, pois anticorpos totais são detectados (SILVA, 2007).
O teste de neutralização (SN), ao contrário do IH, possui alta especificidade na detecção
de anticorpos para arbovírus (BEATY, 1989). No entanto, uma desvantagem deste teste é a
utilização do vírus vivo, que requer demandas extras de biossegurança. A neutralização viral é
definida como a perda da infectividade através da reação do vírus com o anticorpo específico.
A formação de anticorpos humorais contra um determinado vírus é o resultado de uma reação
contra este vírus, seja por infecção natural ou imunização. Anticorpos neutralizantes podem ser
medidos por testes in vivo e in vitro. A diluição seriada do vírus e diluição constante do soro é
 44

a mais empregada em inoculações em camundongos. As misturas vírus-soros são incubadas a

37oC para permitir o processamento da reação e a seguir inoculadas no hospedeiro susceptível.
É importante lembrar que qualquer teste de neutralização só poderá ser considerado se todos os
controles de prova forem executados. Assim, por exemplo, no teste de soroneutralização, deverá
haver soro positivo e soro negativo, controle de camundongos e controle de diluição de vírus
(REED; MUENCH, 1938). Os cálculos para titulação dos soros e suspensão viral são baseados
na fórmula de Reed e Muench:
Fórmula:
Título do vírus = log de diluição > 50% de mortalidade - (% de mortalidade > 50% – 50% ) x log FD
% de mortalidade > 50% – % de mortalidade < 50%
Onde FD: Fator de diluição.

Resultados do teste de neutralização são expressos como índice de neutralização (ILN),

log 10 ou antilogaritmo. O ILN é a diferença entre o título do vírus na presença de soro-controle
negativo e o título do vírus na presença do soro-problema. Um ILN igual ou acima de 1,7 é
frequentemente aceito como limite mínimo para um resultado considerado positivo. Como se
trata de uma técnica trabalhosa e dispendiosa, seu uso fica reservado a dúvidas quanto a
especificidade detectada pelo teste de IH (REED; MUENCH, 1938).
O teste de FC, embora menos sensível que o teste IH, é mais específico e pode ser usado
seletivamente, assim como, o teste de SN que é também altamente específico. É também
bastante utilizado para a identificação de isolamentos virais (SHOPE; SATHER, 1979).
O método de ELISA tem grande utilidade na detecção de anticorpos e tem sido
amplamente utilizado no diagnóstico sorológico por ser bastante sensível, podendo assim
reforçar algumas técnicas clássicas (KUNO et al., 1987). A depender do teste de Elisa a ser
utilizado, placas são sensibilizadas com anticorpos para os vírus estudados, depois o antígeno
é adsorvido e, em seguida, utiliza-se o soro teste (anticorpo); posteriormente adiciona-se o
conjugado; e segue-se com a adição do substrato revelador; a leitura do produto colorimétrico
é feita no espectrofotômetro para microplaca ao comprimento de onda adequado para a cor
produzida (CASSEB et al, 2015).
Todos os testes supracitados são conhecidos como de primeira geração ou testes
clássicos, com exceção do ELISA (VASCONCELOS et al., 2013; CASSEB et al., 2015).
Já para detecção viral e tentativa de isolamento viral, amostras de sangue e vísceras de
humanos, de animais silvestres e pool de artrópodes são inoculados por via intracerebral em
camundongos recém-nascidos e/ou em culturas celulares. Estas técnicas têm a vantagem de
 45

ampliar a quantidade de vírus, facilitando a detecção e identificação futura; permitem a

produção de partículas viáveis que podem ser caracterizadas e estocadas para estudos futuros;
e permitem o isolamento de novas cepas virais (SANTOS et al., 2008).
No caso de tentativa de isolamento viral por inoculação em camundongos, cérebro ou
fígado, ou ambos, de animais que adoeceram após inoculação via intracerebral, são usados para
multiplicação do agente e quando necessário, para novas passagens (TRAVASSOS DA ROSA
et al., 1986). Refere-se como camundongos doentes o desenvolvimento de paralisia e tremores
causados pela replicação de vírus nas células competentes dos sistemas hospedeiros utilizados
(SANTOS et al., 2008). Grande parte dos arbovírus é patogênico para camundongos neonatos,
como também para hamsters e cobaias, que adoecem ao serem inoculados com amostras que
contenham vírus; sendo, portanto, uma importante ferramenta de diagnóstico. No entanto, tem
como principal desvantagem o custo e a manutenção de biotérios, além do tempo de diagnóstico
(que pode demorar até 21 dias) (Figura 6).

Figura 6 – Esquema de procedimento para inoculação de amostras biológicas

para tentativa de isolamento viral através da inoculação em camundongos
neonatos de 2-3 dias

Fonte: SAARB-Instituto Evandro Chagas.

No caso de tentativa de isolamento viral por inoculação em cultura celular, linhagens

provenientes de rim de Chlorocebus aethiops (VERO) e intestino de artrópodes Aedes
albopictus (clone C6/36) têm sido utilizadas, onde a replicação viral pode ser detectada
mediante a alteração da morfologia celular, denominada efeito citopático (CPE) (TRAVASSOS
 46

DA ROSA et al., 1998) (Figura 7). Esta técnica apresenta como uma das vantagens o menor
tempo para diagnóstico (entre 7 e 10 dias, a depender do material inoculado), sendo
fundamental a escolha correta da linhagem celular para que se obtenha melhor permissividade,
susceptibilidade e velocidade de replicação do vírus (SANTOS et al., 2008; TERZIAN, 2008).
Para ambas as tentativas de isolamento, a identificação do agente isolado ou da classe antigênica
a qual pertence o isolado é realizada pela técnica de RIFI, FC, RT-PCR ou sequenciamento
nucleotídico. No entanto, estas técnicas de isolamento viral necessitam que o vírus esteja viável
para que possa haver replicação, efeito citopático ou adoecimento do camundongo.

Figura 7 – Esquema da tentativa de isolamento viral através da inoculação em cultura de células

Vero e Células C636

Fonte: SAARB-Instituto Evandro Chagas.

Nos casos em que não se dispõe de sangue para sorologia e a pesquisa de vírus resultou
negativa ou prejudicada, deve-se procurar antígenos específicos pela técnica de
imunohistoquímica em tecidos, caso o paciente ou animal tenha falecido (VASCONCELOS et
al., 2013).
Para caracterização, detecção e identificação viral, têm-se disponível a microscopia
eletrônica e técnicas de biologia molecular, como reação em cadeia de polimerase (PCR), PCR
em tempo real com posterior sequenciamento genético. Como os arbovírus possuem RNA, a
 47

técnica de PCR para ser usada com estes agentes necessita uma etapa a mais, para que seja
transcrito o RNA em DNA complementar (cDNA) utilizando a enzima transcriptase reversa.
Esta reação é denominada transcrição reversa seguida de reação em cadeia de polimerase (RT-
PCR) (VASCONCELOS et al., 2013) (Figura 8). Brevemente, a partir do cDNA, a PCR irá
amplificar e sintetizar sequências específicas do material genético. Esta reação necessita de um
molde de DNA, um tampão, os quatro desoxinucleotídeos trifosfato-dNTP’s, sequências
iniciadoras (também chamadas de primers) e a DNA polimerase. Os iniciadores são
oligonucleotídicos com sequências que são complementares às sequencias específicas e se
anelam às sequência-alvo do DNA que será amplificado. Os iniciadores determinam a
especificidade e o tamanho do produto amplificado. Quando os iniciadores se ligam ao DNA-
alvo (hibridização), a DNA polimerase, usando os dNTP’s como substrato, inicia a replicação
da sequencia-alvo (extensão). O tampão fornece as condições adequadas para a atividade da
DNA polimerase. Esse processo cíclico é repetido diversas vezes para amplificação do cDNA
original em exponencial. O produto amplificado é denominado amplicon, que pode ser
visualizado após eletroforese em gel. Cada ciclo de PCR envolve três etapas. Na primeira etapa,
o DNA-alvo é desnaturado por aquecimento a mistura. Isso resulta na separação das fitas de
DNA. Na segunda etapa, os reagentes são esfriados para uma temperatura entre 25oC e 60oC,
aproximadamente, para permitir a hibridização dos iniciadores à sequencia-alvo nos sítios
específicos. Na terceira etapa, a temperatura é elevada para permitir a atividade ótima da
polimerase, que adicionará os nucleotídeos, resultando na duplicação e extensão da sequência-
alvo (SANTOS et al., 2008; SANTOS et al., 2013; TERZIAN, 2008).
No caso de amostras de artrópodes e animais silvestres, a utilização de primers
universais na técnica de RT-PCR para diagnóstico de arbovírus apresenta vantagens em relação
ao sequenciamento nucleotídico ou PCR em tempo real, tais como o menor custo de
processamento por amostra e um resultado rápido como triagem (ARMSTRONG et al., 2010;
FIGUEIREDO et al., 1998). Segundo Kuno e colaboradores (1998) primers universais são de
grande valia para saúde pública, pois direciona mais rapidamente os grupos de arbovírus em
caso de surtos, reduz custo de processamento laboratorial e o número de amostras a serem
encaminhadas para o sequenciamento nucleotídico.
 48

Figura 8 – Esquema do teste de RT-PCR para tentativa de detecção do genoma viral

Fonte: Próprio autor, 2017.

Independentemente da tecnologia, sofisticação dos equipamentos ou das técnicas

utilizadas de sequenciamento para a identificação de uma amostra viral, todas as leituras das
sequencias de nucleotídios obtidas devem ser combinadas, por meio de uma etapa conhecida
como "montagem", para que os produtos desse processo possam ser comparados com as
sequências nucleotídicas depositadas no banco de dados conhecido como GenBank (RIBEIRO,
2012). Durante aproximadamente 30 anos após a sua publicação em 1977, o método de Sanger
de terminação de cadeia por didesoxinucleotídeos foi o método de sequenciamento mais
utilizado. A despeito dos contínuos melhoramentos da técnica ao longo do tempo, como a
introdução dos sistemas de eletroforese capilar e a redução dos custos envolvidos, tal método
se mostra caro e demorado para ser empregado em projetos de sequenciamento de genoma
completos (RIBEIRO, 2012). No entanto, ainda continuam sendo muito empregados quando
não há necessidade de se obter o genoma completo (como no caso dos amplicons gerados pelos
primers universais usados no presente estudo) e também pela facilidade de montagem e
alinhamento das sequencias e contigs, se comparada com os sequenciamentos de nova geração
(CARVALHO; SILVA, 2010).
 49

3 OBJETIVOS

3.1 OBJETIVO GERAL

Investigar a ocorrência e prevalência de arbovírus em humanos, animais silvestres e

artrópodes hematófagos na Mata Atlântica do Sul da Bahia durante o período de 2006 a 2014.

3.2 OBJETIVOS ESPECÍFICOS

➢ Avaliar o estado clínico-sanitário dos animais silvestres capturados;

➢ Determinar a prevalência de anticorpos para arbovírus nos animais silvestres
capturados;
➢ Identificar a entomofauna nas mesmas áreas onde os animais silvestres foram
capturados;
➢ Investigar a técnica de RT-PCR com primers gênero-específicos para Flavivirus,
Alphavirus e Orthobunyavirus;
➢ Realizar a tentativa de isolamento viral em mosquitos e em amostras biológicas de
animais silvestres e de populações humanas coletadas nos municípios de Una e Ilhéus,
Bahia;
➢ Determinar a prevalência de anticorpos para arbovírus e os fatores de risco para
populações humanas que vivem próximas às áreas onde animais silvestres e mosquitos
foram capturados;
➢ Desenvolver ações de educação e saúde com a população local, e demais parceiros da
pesquisa.
 50

4 MATERIAL E MÉTODOS

4.1 ÁREA DE ESTUDO

O estudo foi realizado nos municípios de Ilhéus e Una, Bahia, Brasil. Ambos os
municípios pertencem ao domínio de Mata Atlântica do sul da Bahia, caracterizado por Floresta
Tropical Ombrófila Densa, clima tropical com temperatura média máxima de 30,4±2,3°C,
mínima de 21,1±1,3°C, e pluviosidade total de 1.293mm (ALGER; CALDAS, 1994) (Figura
9b). O município de Una apresenta uma população estimada de 22.535 habitantes, enquanto o
município de Ilhéus (adjacente a Una) conta com 178.210 habitantes (BRASIL, 2017). A área
desta pesquisa é caracterizada pela presença de mosaicos de fragmentos florestais, diferentes
tipos de vegetação e/ou pressão antrópica, além de três unidades de conservação: Reserva
Biológica de Una (em Una), Refúgio de Vida Silvestre (em Una), Área de Proteção Ambiental
Lagoa Encantada (em Ilhéus) (Figura 9a). Entremeadas entre os fragmentos florestais, esta área
possui em comum a existência de comunidades rurais, que possuem como atividades de
subsistência a agricultura familiar, a atividade pesqueira e o sistema agroflorestal bastante
diversificado, somando mais de 21 tipos de cultivos agrícolas, com o predomínio da seringueira
(Hevea sp.) e do cacaueiro (Theobroma cacao) (SANTOS, 1999). Além disso, as comunidades
em geral vivem com menos de um salário mínimo por mês e enfrentam dificuldades quanto ao
acesso a serviços de saúde, saneamento básico, estradas e escolas (ALBUQUERQUE et al.,
2007).
 51

Figura 9 – Mapa da área de estudo, apontando a localização geográfica dos pontos de captura de
animais silvestres e artrópodes, além das comunidades visitadas Bahia, Brasil (A) e as temperatura e
pluvisiodade média no ano de 2006 (B)

Fonte: Próprio autor.

4.2 GRUPOS DE ESTUDO E COLETA DE MATERIAL BIOLÓGICO EM ANIMAIS

SILVESTRES, VETORES E HUMANOS

Indivíduos das espécies de preguiças Bradypus torquatus, Bradypus variegatus, e das

espécies de primatas Sapajus xanthosthernos e Leontopithecus chrysomelas foram capturadas
através de contenção física e manual, conforme descrito nos apêndices A, G e H durante o
período de 2006 até 2014. Um total de 128 amostras de fezes e 176 amostras de sangue foram
coletadas, além da realização de avaliação clínica, biometria, marcação e colocação de rádio
colar para monitoramento dos indivíduos (no caso das preguiças) e/ou grupos (no caso dos
macacos) (apêndices G e H). Todas as capturas foram realizadas em parcerias com os estudos
ecológicos em andamento, a fim de maximizar esforços de logística e minimizar estresse aos
animais e custos de campo.
A coleta entomológica foi realizada próxima aos locais onde os animais silvestres foram
capturados, através do uso de armadilhas do tipo CDC e redes de captura seguida de tubo de
 52

Castro. Foi realizada coleta diurna e noturna, além de coleta nas copas e ao nível do solo em
diferentes estações do ano (apêndices C e D).
Residentes rurais pertencentes a 11 diferentes comunidades que viviam próximas ao
local de captura de animais silvestres e artrópodes foram submetidos a um inquérito
epidemiológico, seguido de coleta de sangue total para a pesquisa de arbovírus (apêndice B).

4.3 TESTES LABORATORIAIS

Com exceção das amostras de fezes, armazenadas em frascos estéreis de formol a 10%
(apêndice I e J), todas as amostras coletadas foram submetidas à refrigeração, seguidas de
congelamento a -20o C, -70o C ou imersas no nitrogênio líquido (apêndices A, B e C). Para
avaliação clínico-sanitárias dos animais silvestres, foram utilizados tantos os exames clínicos
realizados durante o monitoramento anestésico (apêndice G), quanto exames laboratoriais,
como hemograma e testes coproparasitológicos (apêndices H, I e J). Tantos os exames
laboratoriais como os coproparasitológicos foram realizados na Universidade Estadual Santa
Cruz (UESC), em Ilhéus, BA. A identificação dos artrópodes e testes para pesquisa de arbovírus
foram realizados na Seção de Arbovirologia e Febres Hemorrágicas do Instituto Evandro
Chagas, em Ananindeua, PA (apêndice C e D).
Para a detecção de anticorpos nas amostras sorológicas de animais silvestres foram
preconizados os testes sorológicos de inibição da hemaglutinação (CLARKE; CASALS, 1958)
e neutralização em camundongos (BEATY et al., 1989) (apêndice A), além de tentativa de
isolamento viral em cultura de células e camundongos (TRAVASSOS DA ROSA et al., 1998)
e testes para detecção do RNA viral, como RT-PCR (KUNO, 1998; SANTOS et al., 2013) e o
sequenciamento nucleotídico (KUNO, 1998).
As amostras biológicas de humanos foram submetidas ao teste sorológico de inibição
de hemaglutinação (CLARKE; CASALS, 1958) e a tentativa de isolamento viral em cultura de
células e camundongos (TRAVASSOS DA ROSA et al., 1998) (apêndice B). Para os
artrópodes, as provas realizadas foram a tentativa de isolamento viral em cultura de células e
camundongos, além das técnicas moleculares descritas para os animais silvestres (apêndice C
e D).
 53

4.4 ATIVIDADES DE EDUCAÇÃO EM “ONE HEALTH”

Todas as atividades desenvolvidas na presente tese de doutorado foram discutidas

previamente com os parceiros locais e internacionais. Além do retorno dos resultados
laboratoriais para as comunidades, realizaram-se rodas de conversa, encontros com os líderes
locais enfatizando a abordagem “One Health” para assuntos relacionados à conservação da
biodiversidade e medidas preventivas para as doenças mais comuns da região. Também foram
realizados treinamentos específicos conforme a demanda dos serviços do setor de saúde, do
setor de meio ambiente e da própria comunidade. Utilizaram-se metodologias participativas
(Planejamento, Processo e Produto) (PÁDUA, 2003), contação de histórias, dinâmicas de
grupos, além da confecção de material educativo para ser distribuído entre os parceiros
(apêndice K).

4.5 ANÁLISE DOS DADOS

Diversos pacotes e programas estatísticos foram utilizados ao decorrer da tese, de

acordo com os objetivos específicos, número de amostras, tipo de variáveis e da complexidade
dos dados a serem analisados. De um modo geral, análises descritivas foram utilizadas para
caracterizar o perfil hematológico das preguiças, o achado de Prosternochis elegans,
identificação de novos artrópodes na Bahia e na descrição das atividades de educação em saúde
(apêndices H, I e K). Testes quantitativos foram empregados nas pesquisas de arboviroses, nos
estudos ecológicos de artrópodes e na investigação de parasitas intestinais (apêndices A, B, C
e J). Para isso, utilizou-se programa BIOestat (Bioestat Program version 5.3; Ayres, Ayres &
Santos, 2007), R (Crawley 2007; R Core teamR) ou SPSS (SPSS Statistics, version 17.0, 2008
SPSS Inc, Chicago, IL, USA). O uso de ferramenta com abordagem ecológica, como curva de
rarefação de espécies também foi empregado para análises dos dados (apêndice C)

4.6 ASPECTOS ÉTICOS

Todos os procedimentos de captura de animais, coleta e transporte de materiais

biológicos foram realizados com aprovação dos órgãos ambientais competentes, além da
aprovação do Comitê de Ética e Experimentação Animal da Universidade Estadual de Santa
Cruz (protocolo nº 004/2008) e do Instituto Evandro Chagas (sob o número 26/2014 e 27/2014,
anexos B e C). Os procedimentos com humanos foram aprovados pelo Comitê de ética e
 54

pesquisa em seres humanos do Instituto Evandro Chagas sob n°794.555 (anexo A). Os
investigados incluídos foram esclarecidos sobre a natureza do estudo e assinaram o Termo de
Consentimento Livre e Esclarecido (TCLE) (anexo D) e o Termo de Assentimento do Menor
(anexo E).
 55

5 RESULTADOS

Um total de 142 animais silvestres, pertencentes a quatro espécies foram capturados no

mínimo uma vez durante o período de 2006 até 2014: 103 Leontopithecus chrysomelas, 22
Bradypus torquatus, sete Bradypus variegatus e sete Sapajus xanthosthernos. Todos os animais
estavam aparentemente sadios baseando-se em exames físicos realizados durante a captura
(apêndice A, G e H). Sempre que possível, amostras de sangue e fezes foram coletadas para
exames hematológicos e parasitológicos, como parte da avaliação clínica dos animais. No caso
das preguiças-de-coleira, B. torquatus, este trabalho apresenta a primeira descrição de valores
hematológicos para a espécie, além da sugestão do achado do corpúsculo de barr em fêmeas
como uma ferramenta para diferenciação sexual desta espécie (apêndice H). Também através
do monitoramento sanitário dos animais silvestres, foi possível identificar uma espécie de
parasita intestinal em mico-leão (apêndice I), além de ovos de nematódeos (Spirurideo,
Ancilostomídeo, Ascarídeo e Oxiurídeo) e cestódeos (Acanthocephalo) em 51,5% (n=66) das
amostras de fezes de grupos de micos-leões, com predomínio de animais habitantes da Reserva
Biológica de Una mais parasitados (n=44) (apêndice J).
Com relação a investigação de anticorpos contra arbovírus nos animais, a
seroprevalência no período foi de 35,2% (número de animais infectados=51), dentre 26
arbovírus investigados. Anticorpos contra o gênero Flavivirus foi o mais encontrado (32.62%,
n=46), seguido de Phlebovirus (4.9%, n=7), Orthobunyavirus (4.2%, n=6) e Alphavirus
(0.71%, n=1). Reações monotípicas encontradas no teste de IH somado ao teste de
neutralização, sugerem que os animais silvestres foram expostos naturalmente a pelo menos 13
arbovírus: YFV, ILHV, ROCV, vírus Cacicapore (CPCV), vírus Bussuquara (BSQV), vírus
Icoaraci (ICOV), EEEV, vírus Caraparu (CARV), DENV-1, DENV-2, DENV-3, SLEV e
UTIV. As preguiças foram os animais com maior prevalência (B. torquatus, 50%, intervalo de
confiança -CI- 30.7-69.3; B. variegatus, 42.9%, CI 15.8-0.75) seguido dos PNH (L.
chrysomelas 33%, CI 24.7-42.6; S. xanthosthernos, 14.3%, CI 2.6-5.13). Os animais foram
mais expostos ao ILHV (15.6%, n=22), com títulos entre 1:20-1:320, seguidos pelo DENV-2
(14.8%, n=20), com 1:20-1:40, DENV-1 (9.9%, n=14), 1:20-1:40 e ROCV (7.1%, n=10), com
títulos entre 1:20-1:160 (apêndice A). Um total de anticorpos contra oito vírus foram comuns
entre as preguiças e os PNH, baseando-se em resultados nos testes de IH (apêndice A).
Amostras de sangue total foram também inoculadas em culturas de células e
camundongos. Nenhum camundongo apresentou sinais de doença, mas uma amostra de um
mico-leão, pertencente a Reserva Biológica de Una, produziu efeito citopático em células Vero
 56

e C636 e após provas moleculares, confirmou-se como sendo um vírus pertencente ao gênero
Alphavirus.
Diante desses resultados com os animais silvestres, em 2014 foram visitadas 11
comunidades que viviam mais próxima aos animais silvestres capturados (apêndice B). Além
do questionário sócio-epidemiológico, 523 residentes destas comunidades aceitaram a coleta
de sangue para investigação de arboviroses. Um total de 65.2% (341/523) das pessoas
apresentaram anticorpos para pelo menos um arbovírus testado. E assim como encontrado nos
animais silvestres, o gênero Flavívirus foi o mais prevalente nas amostras das pessoas (64.4%,
337/523), com títulos entre 1:20-1:1280, seguido de Orthobunyavirus (2.7%, 14/523), com
títulos entre 1:20-1:80 e Alphavirus (1%, 5/523), com títulos entre 1:20-1:80. Foram
encontradas reações monotípicas para DENV-1, DENV-3, EEEV, ILHV e OROV. Dos fatores
de risco analisados, pessoas que vivem nas comunidades que têm a presença de um grande lago,
plantações agroflorestais e estão mais afastadas de fragmentos de floresta estão mais expostas
a serem infectadas com arbovírus (OR Cocoa Farm next to Castelo Novo=3.893, 95% CI = 1.713, 8.847;
OR Cocoa Farm next to Lagoa Encantada=2.921, 95% CI = 1.157, 7.376; OR Lagoa Encantada=2.833, 95% CI
=1.217, 6.596). Também foi observado que a presença de macacos de vida livre ao redor das
comunidades tem efeito protetor para as comunidades, ou seja, menor probabilidade dos seres
humanos se tornarem seropositivos (B = -.608, OR = .544, 95% CI = .321, .925). De acordo
com as modelagens realizadas, nenhuma outra característica, seja demográfica, familiar ou
ambiental foi relacionada com o aumento ou diminuição de risco para infecção de arbovírus
(apêndice B).
Considerando os 7.699 artrópodes capturados durante o estudo, três famílias foram
reportadas: Culicidae, Psychodidae e Ceratopogonidae, totalizando 51 taxas (apêndice C e D).
Estas três famílias ocorreram na área mais preservada, a REBIO-UNA. A família de insetos
mais importante para arbovírus, Culicidae, foi a mais abundante em todos os locais de estudos,
em todos os níveis da floresta estudados (solo e copa) e nas diferentes estações do ano. Dentro
desta família, cinco tribos (Aedini, Cullicini, Mansoniini, Sabethini and Uranotaeniini)
distribuídas em catorze gêneros foram identificadas (Coquillettidia, Culex, Mansonia,
Psorophora, Aedes, Haemagogus, Limatus, Sabethes, Johnbelkinia, Runchomyia,
Trichoprosopon, Anopheles, Uranotaenia e Wyeomyia); dentre estes gêneros, sete espécies
ainda não haviam sido registradas no estado da Bahia: Coquilettidia nigricans, Johnbelkinia
longipes, Limatus pseudomethysticus, Psorophora albipes, Sabethes belisarioi, Sabethes
cyaneus and Sabethes quasicyaneus (apêndice C e D). As amostras de mosquitos identificadas
foram agrupadas em 304 pools, de acordo com a localização de coleta, armadilhas e espécies.
 57

Deste total, 41 foram detectados como vírus pertencentes a família Orthobunyavirus,

Alphavirus ou Flavivirus através da técnica de RT-PCR usando primers gênero-especificos
(apêndice E). Após sequenciamento nucleotídico, as amostras de vírus provenientes de
artrópodes foram identificadas como Mosquito Flavivirus, Kamiti River virus, MAYV, MUCV
and ROCV nos artrópodes Flebotominae, Aedes fulvus, Limatus pseudomethysticus, Hg. (Hag.)
janthinomys, Weyomia phoniomyia spp., Wyeomyia spp., An. (Ano.) species, An. (Nys.)
triannulatus, An. (Ano.) spp., Runchomya spp. (apêndice E).
Durante a realização deste estudo, no mínimo dois encontros anuais foram realizados
com os parceiros envolvidos para apresentação e discussão dos resultados encontrados
(apêndice K). Material educativo, no formato de jogos e folders explicativos, foram
distribuídos, incluindo os residentes das comunidades rurais. Como resultado destes encontros,
um treinamento para coleta de amostras e diagnóstico laboratorial foi realizado pela equipe do
Laboratório Central de Salvador e outros dois treinamentos com o foco na vigilância de
epizootias foram realizados. A comunidade também recebeu informação sobre a importância
da manutenção da fauna para a saúde da região. Cartazes sobre “não matar animais silvestres”
foram colados em ambientes sociais, como igrejas, bares, escolas e centros de saúde. As escolas
das comunidades foram visitadas para receberem informações sobre educação em saúde e
conservação do meio ambiente. Como resultado dessas atividades, os estudantes montaram um
fanzine (como um folder) usando ilustrações e sentenças criadas por eles para também serem
distribuídas entre os parceiros e os demais habitantes das comunidades (apêndice K).
 58

6 CONCLUSÕES

O presente estudo ilustra a importância de pesquisas integradas e multidisciplinares para

a promoção de saúde dos animais domésticos, animais silvestres, população humana e meio
ambiente. Os animais silvestres monitorados, apesar de não apresentarem sintomatologia
clínica compatível com as parasitoses aqui estudadas, evidenciaram a circulação de patógenos
de caráter zoonótico na região de Mata Atlântica do sul da Bahia; e direcionaram investigações
de vigilância entomológica e de arboviroses nas populações humanas que viviam próximo onde
os animais foram capturados.
Dentre os arbovírus investigados, os Flavivirus parecem ser os arbovírus mais
circulantes na região; uma vez que foram detectados anticorpos tanto nos animais como nas
pessoas; além da detecção e identificação deste gênero em amostras de mosquitos. O vírus
Ilheus, descoberto na mesma região do estudo, ainda mantém ciclo de vida nas áreas silvestres
e rurais da região, tendo humanos, preguiças e primatas como hospedeiros. Por outro lado, o
vírus Dengue, conhecido por manter seu ciclo em áreas mais antropizadas, já aparenta estar
sendo transmitido as populações de animais selvagens de vida livre. Diante deste achado,
sugerimos futuras investigações sobre a infecção de DENV em animais silvestres, além de
possíveis vetores silvestres envolvidos nesta transmissão.
Anticorpos contra 14 arbovírus foram encontrados nos hospedeiros, sendo 5 em pessoas
(ILHV, CARV, DENV-3, OROV, EEEV) e 13 em animais silvestres (YFV, ILHV, ROCV,
CPCV, BSQV, ICOV, EEEV, CARV, DENV-1, DENV-2, DENV-3, UTIV, SLEV). ILHV,
DENV-3, EEEV e CARV foram comuns entre os vertebrados. Com relação aos artrópodes,
foram identificados ROCV, MAYV, MUCV, Mosquitos Flavivirus e Kamiti river virus.
ROCV, portanto, foi o único arbovírus comum entre os hospedeiros e vetores.
Os resultados apresentados também indicam que a presença de grandes blocos florestais
preservados e paisagens que mantém uma matriz com predominância de cobertura florestal são
favoráveis para a manutenção da biodiversidade, seja ela de vírus, parasitas intestinais ou
artrópodes. As espécies de artrópodes coletadas somente nas áreas mais preservadas, assim
como o maior número de ovos de parasitas intestinais em micos-leões que habitavam as áreas
mais florestadas e a grande variedade de anticorpos de arbovírus encontrados em animais
silvestres (n=13) corroboram esta idéia.
No entanto, mais do que manter a biodiversidade, a presença de florestas entremeadas
às demais plantações de agricultura familiar e aos sistemas agroflorestais mostraram ter efeito
protetor, ou seja, diminui o risco de transmissão de arbovírus para as populações humanas que
 59

viviam nas comunidades. Acreditamos que estes resultados estejam relacionados pelo efeito de
diluição, no qual quanto maior a biodiversidade de vetores, hospedeiros e ambientes naturais,
menor a probabilidade do surgimento de surtos para uma determinada população. A presença
de macacos ao redor das comunidades e das plantações também diminuiu a probabilidade de
pessoas serem infectadas pelos arbovírus. Ambos os resultados podem ser ferramentas
importantes para justificar políticas públicas que visem a conservação de áreas naturais e sua
fauna; além de poder ser útil para ações de educação à população em geral, uma vez ser comum
observar pessoas matando macacos sadios por acharem que estes animais são os transmissores
de febre amarela.
Sugere-se que nos modelos de fatores de risco para a exposição de arboviroses, sejam
somados como variáveis preditoras densidade e diversidade de bromélias na região, densidade
e diversidade de animais silvestres, distância de rios/córregos das comunidades rurais, tipo de
vestimenta de trabalho nas plantações ou para ingresso nas áreas de mata e frequência de uso
de repelentes. Também enfatizamos a importância do uso de análises multivariadas ou modelos
generalizados para estudos de risco, uma vez que análises univariadas não levam em
consideração as associações e interações entre as variáveis independentes.
Como já descrito em outros trabalhos, esta pesquisa reforça o papel das preguiças e dos
primatas para o monitoramento de arboviroses em uma região e a importância de coleta de
amostras biológicas em diferentes espécies silvestres e de animais domésticos numa mesma
área para melhores dados sobre os arbovírus circulantes.
Espera-se que a técnica de RT-PCR com primers gênero-específicos para amostras de
sangue de animais ou macerados de mosquitos possa representar um grande avanço na detecção
dos principais arbovírus encontrados nas Américas, além de redução de tempo de resposta para
vigilância e custo de processamento. Enfatiza-se a necessidade de estudos futuros para o
aprimoramento dos testes diagnósticos rápidos para amostras de animais silvestres e vetores.
E, por último, nós destacamos a criação de uma rede de atividades e parceiros para
abordar a interface saúde de pessoas-animais-meio ambiente na região. A abordagem holística
de “One Health” permitiu com que cada ano trabalhado mais informações geradas fossem
cruzadas entre as instituições de saúde, do meio ambiente e do público geral. Esta integração,
somados a elementos chaves, como respeito da cultura local, confiança na população rural e
demais parceiros; envolvimento de diversos setores, como órgãos de saúde, de meio ambiente,
universidades, zoológicos e Ongs; uso de metodologias participativas durantes os encontros e
treinamentos; desenvolvimento de técnicas laboratoriais para melhorar diagnóstico; e
 60

desenvolvimento de material educativo para o público geral tenham sido os responsáveis pelo
bom desempenho desta pesquisa.
 61

REFERÊNCIAS

ADAMS, M. J.; LEFKOWITZ, E. J.; KING, A. M. Q.; HARRACH, B.; HARRISON, R. L;

KNOWLES, N. J.; KROPINSKI, A. M.; KRUPOVIC, M.; KUHN, J. H.; MUSHEGIAN, A.
R.; NIBERT, M.; SABANADZOVIC, S.; SANFAÇON, H.; SIDDELL, S. G.; SIMMONDS,
P.; VARSANI, A.; ZERBINI, F. M.; GORBALENYA, A. E.; DAVISON, A. J. Changes to
Taxonomy and the International Code of Virus Classification and Nomenclature Ratified by
the International Committee on Taxonomy of Viruses. Arch. Virol., v. 162, n. 8, p. 2505-2538,
2017.

ALBUQUERQUE, E. C. P. T.; ROCHA, M. M.; OLIVEIRA, R. B. A Comunicação em Áreas

de Proteção Ambiental – o caso da APA da Lagoa Encantada, em Ilhéus. In: CONGRESSO
BRASILEIRO DE CIÊNCIAS DA COMUNICAÇÃO, 30., 2007. Santos. Anais... Santos:
Sociedade Brasileira de Estudos Interdisciplinares da Comunicação, 2007. p. 1-15.

ALGER, K.; CALDAS, M. The Declining Cocoa Economy and the Atlantic Forest of Southern
Bahia, Brazil: Conservation Attitudes of Cocoa Planters. Environmentalist, v. 14, n. 2, p. 107-
119, 1994.

ALMEIDA, M. A. B.; SANTOS, E.; CRUZ, C. J.; FONSECA, D. F.; NOLL, C. A.; SILVEIRA,
V. R.; MAEDA, A. Y.; SOUZA, R. P.; KANAMURA, C.; BRASIL, R. A. Yellow fever
outbreak affecting Alouatta populations in southern Brazil (Rio Grande do Sul State), 2008-
2009. Am. J. Primatol., v. 74, n. 1, p. 68-76, 2012.

ANDERSON, R. P.; HANDLEY-JR, C. O. A new species of three-toed sloth (Mammalian:

Xenarthra) from Panamá, with a review of the genus Bradypus. Proc. Biol. Soc. Wash., n. 114,
v. 1, p. 1-33, 2001.

ALTHOUSE, B. M.; VASILAKIS, N.; SALL, A. A.; DIALLO, M.; WEAVER, S. C.;
HANLEY, A.K. Potential for Zika virus to Establish a Sylvatic Transmission Cycle in the
Americas. PLoS Negl. Trop. Dis., v. 10, n. 12, 2016.

ARMSTRONG, P. M.; ANDREADIS, T. G. Eastern Equine Encephalitis virus in mosquitoes

and their role as bridge vectors. Emerging Infect. Dis., v. 16, n. 12, p. 1869-1874, 2010.

AZEVEDO R. S. S.; BARROS, V. L. R.; MARTINS, L. C., CRUZ, A. C. R.; RODRIGUES,

S. G.; VASCONCELOS, P. F. C. Estudo experimental sobre a patogenicidade do vírus Ilhéus
em hamsters dourados (Mesocricetus auratus). Rev. Pan. Amaz. Saude, v. 1, n. 1, p. 73-80,
2010.

BARRETO, R. Uso do hábitat pela preguiça de coleira Bradypus torquatus Illiger 1811, no sul
da Bahia, Brasil. 2007. 100 f. Dissertação (Mestrado em Zoologia) - Universidade Estadual
Santa Cruz, Ilhéus, 2007.

BATISTA, M. B; RENATO A; ROCHA, T. C. R.; ELIANE C. G..; SILVA, M. A. N.;

WALFRIDO, K. S.; JOAO, N.; RODRIGUES, S. R.; CHIANG, J. O.; VASCONCELOS, P. F.
C. Serosurvey of Arbovirus in Free-Living Non-Human Primates (Sapajus spp.) in Brazil. Int.
J. Environ. Anal. Chem., v. 2, n. 4, p. 1-5, 2015.

BATISTA, P. M.; ANDREOTTI, R.; ALMEIDA, P. S.; MARQUES, A. C.; RODRIGUES, S.

G.; CHIANG, J. O.; VASCONCELOS, P. F. C. Detection of arboviruses of public health
 62

interest in free-living New World primates (Sapajus spp.; Alouatta caraya) captured in Mato
Grosso do Sul, Brazil. Rev. Soc. Bras. Med. Trop., v. 46, n. 6, p. 684-690, 2013.

BATISTA, P. M.; ANDREOTTI, R; CHIANG, J. O.; FERREIRA, M. S.; VASCONCELOS,

P. F. C. Seroepidemiological monitoring in sentinel animals and vectors as part of arbovirus
surveillance in the state of Mato Grosso do Sul, Brazil. Rev. Soc. Bras. Med. Trop., v. 45, n.
2, p. 168-173, 2012.

BAUM, S. E.; MACHALABA, C.; DASZAK, P.; SALERNO, R. H.; KARESH W. B.

Evaluating one health: Are we demonstrating effectiveness? One Health, v. 3, p. 5-10, 2017.

BEATY, B. J.; CALISHER, C. H.; SHOPE, R. E. Arboviruses. In: SCHMIDT, N. J.;

EMMONS, R. W. (Ed.). Diagnostic Procedures for Viral, Rickettsial and Chlamydial
Infections. Washington: American Public Health Association,1989. p.797-855.

BIERREGAARD, R. O.; LOVEJOY, T. E.; KAPOS, V.; SANTOS, A. A.; HUTCHINGS, R.

W. The biological dynamics of tropical rainforest fragments: A prospective comparison of
fragments and continuous forest. Bioscience. v. 42, n. 11, p. 859-866, 1992.

BRASIL. Instituto Brasileiro de Geografia e Estatística. 2017. Disponível em:

<http://ibge.gov.br/cidadesat/painel/painel.php?lang=PT&codmun=291360&search=bahia|ilh
eus|infograficos:-dados-gerais-do-municipio>. Acesso em: 1 jan. 2017.

BRASIL. Instituto Brasileiro de Geografia e Estatística. 2017. Disponível em:

<http://ibge.gov.br/cidadesat/painel/populacao.php?codmun=293250&search=bahia%7Cuna
%7Cinfograficos:-evolucao-populacional-e-piramide-etaria&lang=_ES>. Acesso em: 1 jan.
2017.

BRASIL. Ministério do Meio Ambiente. Lista das Espécies da Fauna Brasileira Ameaçadas
de Extinção. Anexo à Instrução Normativa nº3, de 27 de maio de 2003, do Ministério do Meio
Ambiente. Disponível em: <http://www.ibama.gov.br>. Acesso em: 2 abril 2016.

BRASIL. Ministério do Meio Ambiente. IBAMA. Disponível em: <http://mma.gov.br>, 2007.

Acesso em: 10 ago. 2016.

BRASIL. Ministério da Saúde. Secretaria de Saúde do Estado da Bahia. Boletim dinâmico da

Bahia. 2014. Disponível em: <http://www.saude.ba.gov.br>. Acesso: 1 de jun. 2015.

BRASIL. Ministério da Saúde. Secretaria de Vigilância em Saúde. Guia de Vigilância de

Epizootias em primatas não-humanos e entomologia aplicada à vigilância da febre
amarela. Brasília: MS, 2014, 100 p.

BRASIL. Ministério da Saúde. Secretaria de Vigilância em Saúde. Boletim Informativo de

Febre Amarela, v. 43, p. 1-7, 2017.

BRASIL. Ministério da Saúde. Secretaria de Vigilância em Saúde. Monitoramento dos casos

de dengue febre de Chikungunya e febre pelo Zika. Bol. Epidemiol., v. 48, n. 20, p. 1-10, 2017.

BUENO, M. G.; MARTINEZ, N.; ABDALLA, L.; SANTOS, C. N. D.; CHAME, M. Animals
in the Zika virus Life Cycle: What to Expect from Megadiverse Latin American Countries.
PLoS Negl. Trop. Dis., v.10, n. 12, 2016.
 63

CALISHER, C. H.; SHOPE, R. E.; BRANDT, W.; CASALS, J.; KARABATSOS, N.;
MURPHY, F. A; TESH, R. B.; WIEBE, M. E. Proposed antigenic classification of registered
arboviruses. I. Togaviridae, Alphavirus. Intervirology. v. 14, n. 5-6, p. 229-232, 1980.

CAMPOS, G. S.; BANDEIRA, A. C.; SARDI, S.I. 2015. Zika virus Outbreak, Bahia, Brazil.
Emerging Infect. Dis., v. 21, n. 10, p. 1885-1886.

CAMPOS, G. S.; PINHO, A. C. O.; BRANDÃO, C. J. F.; BANDEIRA, A. C.; SARDI, S. I.

Dengue virus 4 (DENV-4) re-emerges after 30 years in Brazil: cocirculation of DENV-2,
DENV-3, and DENV-4 in Bahia. Braz. J. Infect. Dis., v. 68, n.1, p. 45-49, 2015.

CAMPOS, G. S.; SARDI, S. I.; SARNO, M.; BRITES, C. Zika virus infection, a new public
health challenge. Braz. J. Infect. Dis., v. 20, p. 227-228, 2016.

CANALE, G. R.; GUIDORIZZI, C. E.; KIERULFF, M. C. M.; GATTO, C. A. F. R. First record

of tool use by wild populations of the yellow-breasted capuchin monkey (Cebus xanthosternos)
and new records for the bearded capuchin (Cebus libidinosus). Am. J. Primatol., v. 71, n. 5, p.
366-372, 2009.

CANALE, G. R.; KIERULFF, M. C. M.; CHIVERS, D. J. A Critically Endangered Capuchin

Monkey (Sapajus xanthosternos). Living in a Highly Fragmented Hotspot. In: MARSH, L. K.;
CHAPMAN, C. A. (Coord.). Primates in Fragments. New York: Springer, 2013. p. 299-311.

CARDOSO, C. W.; KIKUTI, M.; PRATES, A. P. P. B.; PAPLOSKI, I. A. D.; TAURO, L. B.;
SILVA M. M. O.; SANTANA, P.; REGO, M. F. S.; REIS, M. G.; KITRON, U.; RIBEIRO, G.
S. Unrecognized Emergence of Chikungunya virus during a Zika virus Outbreak in Salvador,
Brazil. PLoS Negl. Trop. Dis., v. 11, n. 1, p. 1-8, 2017.

CARDOSO, J. C.; PAULA, M. B.; FERNANDES, A.; SANTOS, E.; ALMEIDA, M. A. B.;
FONSECA, D. F.; SALLUM, M. A. M. New Records and Epidemiological Potential of Certain
Species of Mosquito (Diptera, Culicidae) in the State of Rio Grande Do Sul, Brazil. Rev. Soc.
Bras. Med. Trop., v. 43. n. 5, p. 552-56, 2010.

CARDOSO, J. D. C.; BERGO, E. S.; OLIVEIRA, T. M. P.; SANTANA, D. C.; MOTOKI, M.

T.; SALLUM, M. A. M. New Records of Anopheles homunculus in Central and Serra Do Mar
Biodiversity Corridors of the Atlantic Forest, Brazil. J. Am. Mosq. Control. Assoc., v. 28, n.
1, p. 1-5, 2012.

CARON, A.; CAPPELLE, J.; CUMMING, G. S.; GARINE-WICHATITSKY, M.; GAIDET,

N. Bridge hosts, a missing link for disease ecology in multi-host systems. Vet. Res.., v. 46, n.
1, p. 83-94, 2015.

CARRION-JR, R.; PATTERSON J. L. An animal model that reflects human disease: the
common marmoset (Callithrix jacchus). Curr. Opin. Virol., v. 2, n.3, p. 357-362, 2002.

CARVALHO, M. C. C. G.; SILVA, D. C. G. Sequenciamento de DNA de nova geração e suas

aplicações na genômica de plantas. Cienc. Rural., v. 40, n. 3, p. 735-744, 2010.

CASALS, J. Viruses: the versatile parasites; the arthropod-borne group of animal viruses.
Trans. N. Y. Acad. Sci., v. 19, p. 219-235, 1957.
 64

CASSANO, C. R.; BARLOW, J.; PARDINI, R Forest loss or management intensification?

Identifying causes of mammal decline in cacao agroforests. Biol. Conserv., v. 169, p. 14-22,
2014.

CASSANO, C. R.; KIERULFF, M. C. M.; CHIARELLO, A. G. The Cacao Agroforests of the

Brazilian Atlantic Forest as Habitat for the Endangered Maned Sloth Bradypus Torquatus.
Mamm. Biol., v. 76, n. 3, p. 243-250, 2011.

CASSANO, C. R.; SCHROTH, G.; FARIA, D.; DELABIE, J. H. C.; BEDE, L. Landscape and
farm scale management to enhance biodiversity conservation in the cocoa producing region of
southern Bahia, Brazil. Biodivers. Conserv., v. 18, n. 3, p. 577-603, 2009.

CASSANO, C. R; SILVA, M. R.; MARIANO-NETO, E.; SCHROTH, G.; FARIA. Bat and
Bird Exclusion but Not Shade Cover Influence Arthropod Abundance and Cocoa Leaf
Consumption in Agroforestry Landscape in Northeast Brazil. Agric. Ecosyst. Environ., v. 232,
p. 247-253, 2016.

CASSEB A. R.; L. M. N. CASSEB; SILVA, S. P.; VASCONCELOS, P. F. C. Arbovírus:

Importante zoonose na Amazônia Brasileira. Vet. e Zootec., v. 20, n. 3, p. 9-21, 2013.

CASSEB, A. R.; SILVA, S. P.; CASSEB, L. M. N; CHIANG, J. L.; MARTINS, L. C.;

VASCONCELOS, P. F. C. Prevalence of arbovirus antibodies agaisnt the family Bunyaviridae
in water buffaloes. Cienc. Anim. Bras., v. 16, n. 3, p. 428-436, 2015.

CATENACCI, L. S.; DE VLEESCHOUWER, K. M.; NOGUEIRA-FILHO, S. L. G. Seed

Dispersal by Golden-headed Lion Tamarins Leontopithecus chrysomelas in Southern Bahian
Atlantic Forest, Brazil. Biotropica, v. 41, n. 6, p. 744-750, 2009.

CATENACCI, L. S.; FERREIRA, M. S.; MARTINS, L. C.; DE VLEESCHOUWER, K. M.;

CASSANO, C. R.; OLIVEIRA, L. C.; CANALE, G.; DEEM, S. L.; TELLO, J. S.; PARKER,
P.; VASCONCELOS, P. F. C.; TRAVASSOS DA ROSA, E. S. Primates and sloths as sentinels
for arboviruses in the Atlantic Forest, Bahia, Brazil. In: INTERNATIONAL CONFERENCE
OF THE WILDLIFE DISEASE ASSOCIATION, 66., 2017. Chiapas: México, 2017.

CATENACCI, L. S.; NUNES NETO, J.; CASTRO, F. C.; LEMOS; P.; OYAMA, E.; DEEM,
S. L.; TRAVASSOS-DA-ROSA, E. S. New Records of Mosquito Species (Diptera: Culicidae)
for Bahia (Brazil). Int. J. Mosq. Res., v. 4, n. 4, p. 12-16, 2017.

CATENACCI, L. S.; PESSOA, M. S; DE VLEEESCHOUWER, K. M.; NOGUEIRA-FILHO,

S. L. N. Diet and feeding behavior of Leontopithecus chrysomelas (Callitrichidae) in degraded
areas of the Atlantic Forest of South-Bahia, Brazil. Int. J. Primatol., v. 37, n. 2, p. 136-157,
2016.

CECH, D. J.; ALVARADO, Z. J. Collaborating with Communities and Higher Education to

Address the Health-care Needs of Individuals with Disabilities in Ecuador. Front Public
Health, v. 5, n. 91, p. 1-9, 2017.

CHEN, C. Y.; HUANG, K. Y. A.; SHEN, J. H.; TSAO, K. C.; HUANG, Y. C. A Large-Scale
Seroprevalence of Epstein-Barr virus in Taiwan. PLoS ONE, v. 10, n. 1, p 1-11, 2015.

CHOW, V. T.; CHAN, Y. C.; YONG, R.; LEE, K. M.; LIM, L. K.; CHUNG, Y. K.; LAM-
PHUA, S. G.; TAN, B. T. Monitoring of dengue viruses in field-caught Aedes aegypti and
 65

Aedes albopictus mosquitoes by a type-specific polymerase chain reaction and cycle

sequencing. Am. J. Trop. Med. Hyg., v. 58, n. 5, p. 578-586, 1998.

CLARKE, D.H.; CASALS, J. Techniques for hemagglutination and hemagglutination-

inhibition with arthropod-borne viruses. Am. J. Trop. Med. Hyg., v. 7, n. 5, p. 561-573, 1958.

CLETON, N.; KOOPMANS, M.; REIMERINK, J.; GODEKE, G. J.; REUSKEN, C. Come fly
with me: review of clinically important arboviruses for global travelers. J. Clin. Virol., v. 55,
n. 3, p. 191-203, 2012.

COIMBRA, T. L. M.; SANTOS, C. L. S.; SUZUKI, A.; PETRELLA, S. M. C.; BISORDI, I.;
NAGAMORI, A. H.; MARTI, A. T.; SANTOS, R. N.; FIALHO, D. M.; LAVIGNE, S.;
BUZZAR, M. R.; ROCCO, I. M. Mayaro virus: imported cases of human infection in São Paulo
State, Brazil. Rev. Inst. Med. Trop., v. 49, n. 4, p. 221-224, 2007.

CONRAD, P. A.; MAZET, J. A.; CLIFFORD, D.; SCOTT, C.; WILKES, M. Evolution of a
transdisciplinary “One Medicine-One Health” approach to global health education at the
University of California, Davis. Prev. Vet. Med., v. 92, n. 4, p. 268-274, 2009.

CONRAD, P. A.; MEEK, L. A.; DUMIT, J. Operationalizing a One Health approach to global
health challenges. Comp. Immunol. Microbiol. Infect. Dis. v. 36, n. 3, p. 211-216, 2013.

CONSOLI, R. A. G. B.; OLIVEIRA, R. L. Principais mosquitos de importância sanitária

no Brasil. Rio de Janeiro: Fiocruz, 1994, 228 p.

COOK, S.; BENNETT, S. N.; HOLMES, E. C.; DE CHESSE, R.; MOUREAU, G.; DE
LAMBALLERIE, X. Isolation of a new strain of the Flavivirus cell fusing agent virus in a
natural mosquito population from Puerto Rico. J. Gen. Virol., v. 87, n. 4, p. 735-748, 2006.

COSTA, M. C. N.; TEIXEIRA, M. G. L. C. A Concepção de “espaço” na investigação

epidemiológica. Cad Saude Publica, v. 15, n. 2, p. 271-279, 1999.

CRAWLEY, M. J. The R book. Hoboken: John Wiley & Sons, 2013. 1060 p.

CRUZ, A. C. R; VASCONCELOS, P. F. C. Arbovírus no Brasil. Biológico, v.70, n. 2, p. 45-

46, 2008.

CULQUICHICÓN, C.; CARDONA-OSPINA, J. A.; PATIÑO-BARBOSA, A. M.;

RODRIGUEZ-MORALES, A. J. Bibliometric analysis of Oropouche research: impact on the
surveillance of emerging arboviruses in Latin America. F1000 Research, v. 6, n. 194, p. 1-11,
2017.

CULLEN J. R. L.; BODMER, E. R.; VALLADARES-PÁDUA, C. Ecological consequences

of hunting in Atlantic forest patches, São Paulo, Brazil. Oryx. v. 35, n. 2, p. 137-144, 2001.

DASZAK, P.; CUNNINGHAM, A. A.; HYATT, A. D. Emerging Infectious Diseases of

Wildlife-- Threats to Biodiversity and Human Health. Science, v. 287, n. 5452, p. 443-449,
2000.

DASZAK, P.; TABOR, G. M.; KILPATRICK, A. M.; EPSTEIN, J.; PLOWRIGHT, R.

Conservation medicine and a new agenda for emerging diseases. Ann. NY. Acad. Sci., v. 1026,
p. 1-11, 2004.
 66

DAVIS, N. C. The susceptibility of marmosets to Yellow Fever virus. J. Exp. Med., v. 52, p.
405-416, 1930.

DEEM, S. L. Conservation Medicine: A Solution-Based Approach for Saving Nonhuman

Primates. In: WALLER, M. T. (Ed.). Ethnoprimatology. Berlim: Springer, 2016. p. 63-76.

DEEM, S. L.; KARESH, W. B.; WEISMAN, W. Putting theory into practice: wildlife health
in conservation. Conserv. Biol., v. 15, n. 5, p. 1224-1233, 2001.

DEEM, S. L.; PARKER, P. G.; MILLER, E. Building Bridges: Connecting the Health and
Conservation Professions. Biotropica, v. 40, n. 6, p. 662-665.

DIAS-LIMA, A. G.; GUEDES, M. L. S.; SHERLOCK, I. A. Horizontal stratification of the

sand fly fauna (Diptera: Psychodidae) in a transitional vegetation between caatinga and tropical
rain forest, state of Bahia, Brazil. Mem. Inst. Oswaldo Cruz, v. 98, n. 6, p. 733-737, 2003.

DÍAZ, L. A.; DÍAZ, M. P.; ALMIRÓN, W. R.; CONTIGIANI, M. S. Infection by Una virus
(Alphavirus; Togaviridae) and risk factor analysis in black howler monkeys (Alouatta caraya)
from Paraguay and Argentina. Trans. R. Soc. Trop. Med. Hyg., v. 101, n. 10, p. 1039-1041,
2007.

DIETZ, J. M.; PERES, C. A.; PINDER, L. Foraging ecology and use of space in wild golden
lion tamarins (Leontopithecus rosalia). Am. J. Primatol., v. 41, n. 4, p. 289-305, 1997.

DIETZ, J. M.; SOUSA, S. N.; BILLERBECK, R. Population dynamics of golden-headed lion

tamarins Leontopithecus chrysomelas in Una Reserve, Brazil. Dodo, v. 32, p. 115-122, 1996.

DISTLER, T.; JORGENSEN, P. M.; GRAHAM, A.; DAVID, G.; JIMÉNEZ, I. Determinants
and prediction of broad-scale plant richness across the western neotropics. Ann. Mo. Bot.
Gard., v. 96, n. 3, p. 470-491, 2009.

DONALD, P. F. Biodiversity impacts of some agricultural commodity production systems.

Cons. Biol., v. 18, n. 1, p. 17-37, 2004.

EMMONS, L. H.; FEER, F. Neotropical Rainforest Mammals: a field guide. Chicago: The
University of Chicago, 1997. 307 p.

ENGERING, A.; HOGERWERF, L.; SLINGENBERGH, J. Pathogen–host–environment

interplay and disease emergence. Emerg. Microbes Infect., v. 2, n.2, p. 1-7, 2013.

FARIA N. R; AZEVEDO R. S. S; KRAEMER, M. U. G.; SOUZA, M. S.; HILL, S. C.; THÉZÉ,

J.; BONSALL, M. B.; BOWDEN, T. A.; RISSANEN, I.; ROCCO, I. M.; NOGUEIRA, J. S.;
MAEDA, A. Y.; VASAMI, F. G. S.; MACEDO F. L. L.; SUZUKI. A.; RODRIGUES, S. G.;
CRUZ, A. C. R.; NUNES, B. T.; MEDEIROS, D. B. A.; GUERREIRO RODRIGUES, D. S.
G.; QUEIROZ, A. L. N.; SILVA, E. V. P.; HENRIQUES, D. F.; TRAVASSOS DA ROSA, E.
S. T.; OLIVEIRA, C. S.; MARTINS, L. C.; VASCONCELOS, H. B.; CASSEB, L. M. N.;
SIMITH, D. B.; MESSINA, J. P.; ABADE, L.; LOURENÇO, J.; ALCANTARA JUNIOR, L.
C.; LIMA M. M.; GIOVANETTI, M.; HAY, S. I.; OLIVEIRA, R. S.; LEMOS, P. S.;
OLIVEIRA, L. F.; LIMA, C. P. S.; SILVA, S. P.; VASCONCELOS, J. M.; FRANCO, L.;
CARDOSO, J. F.; VIANEZ JÚNIOR, J. L. S. G.; MIR, D.; BELLO, G.; DELATORRE, E.;
KHAN, K; CREATORE, M.; COELHO, G. E; OLIVEIRA, W. K.; TESH, R.; PYBUS, O. G.;
 67

NUNES, M. R. T.; VASCONCELOS, P. F. C. Zika virus in the Americas: Early

epidemiological and genetic findings. Science., v. 352, n. 6283, p. 345-349, 2016.

FAVORETTO, S.; ARAUJO, D.; OLIVEIRA, D.; DUARTE, N.; MESQUITA, F.;
ZANOTTO, P. DURIGON, E. First detection of Zika virus in neotropical primates in Brazil: a
possible new reservoir. BioRxiv, 2016. Disponível em: <https://doi.org/10.1101/049395>
Acesso em: 2 jul. 2016.

FERREIRA, I. B.; PEREIRA, L. E.; ROCCO, I. M.; MARTI, A. T.; SOUZA, L. T. M.;
IVERSSON, L. B. Surveillance of arbovirus infections in the atlantic forest region, State of São
Paulo, Brazil: I. detection of hemagglutination-inhibition antibodies in wild birds between 1978
and 1990. Rev. Inst Med Trop, v. 36, n. 3, p. 265-274, 1994.

FIGUEIREDO, L. T. M. Vírus brasileiros da família Bunyaviridae. In: SIMPOSIO DE

VIROLOGIA MÉDICA, 2., 1999, Ribeirão Preto. Medicina Ribeiräo Preto, v. 32, p. 154-
158, 1999.

FIGUEIREDO, L. T. M. The Brazilian flaviviruses. Microbes Infect. v. 2, n. 13, p. 1643-1649,

2000.

FIGUEIREDO, L. T. M. Arboviroses emergentes no Brasil. Rev. Soc. Bras. Med. Trop., v.

40, n. 2, p. 224-229, 2007.

FIGUEIREDO, L. T. M. Mosquitoes infected with dengue viruses in Brazil. Virol. J., v.7, n.
152, p. 1-5, 2010.

FIGUEIREDO, L. T. M. The recent arbovirus disease epidemic in Brazil. Rev. Soc. Bras. Med.
Trop., v. 48, n. 3, p. 233-234, 2015.

FIGUEIREDO, L. T. M.; BATISTA, W. C.; KASHIMA, S.; NASSAR, E. S. Identification of

Brazilian flaviviruses by a simplified reverse transcription-polymerase chain reaction method
using Flavivirus universal primers. Am. J. Trop. Med. Hyg., v. 59, n. 3, p. 357-362, 1998.

FIGUEIREDO, M. L. G.; FIGUEIREDO, L. T. M. Emerging alphaviruses in the Americas:

Chikungunya and Mayaro. Rev. Soc. Bras. Med. Trop., v. 47, n. 6, p. 677-683, 2014.

FONTOURA, T.; CAZETTA, E.; NASCIMENTO, W; CATENACCI, L. S.; DE

VLEESCHOUWER, K.; RABOY, B. Diurnal frugivores on the Bromeliaceae Aechmea
depressa L.B. Sm. from Northeastern Brazil: the prominent role taken by a small forest primate.
Biota Neotropica, v. 10, n. 4, p. 351-354, 2010.

FORATTINI, O. P.; KAKITANI, I.; MASSAD, E.; MARUCCI, D. Studies on mosquitoes

(Diptera: Culicidae) and anthropic environment: 9- Synanthropy and epidemiological vector
role of Aedes scapularis in South-Eastern Brazil. Rev. Saúde Pública, v. 29, n. 3, p. 199-207,
1995.

FRAGOSO-MOURA, E. N.; OPORTO, L. T.; MAIA-BARBOSA, P. M.; BARBOSA, F. R.

Loss of biodiversity in a conservation unit of the Brazilian Atlantic Forest: the effect of
introducing non-native fish species. Braz. J. Biol., v. 76, n. 1, p. 18-27, 2006.

GALETTI, M.; PIZO, M. A.; MORELLATO, P. C. Estudos de fenologia e dispersão de

sementes In: CULLEN JR, L.; RUDRAN, R.; VALADARES-PÁDUA, C. (Org.). Métodos de
 68

Estudos em Biologia da Conservação & Manejo da Vida Silvestre, Curitiba: UFPR, 2003.
p. 395-422.

GIBRAIL, M. M.; FIACCADORI, F. S.; SOUZA, M.; ALMEIDA, T. N. V.; CHIANG, J. O.;
MARTINS, L. C.; FERREIRA, M. S.; CARDOSO, D. D. P. Detection of antibodies to
Oropouche virus in non-human primates in Goiânia City, Goiás. Rev. Soc. Bras. Med. Trop.,
v. 49, n. 3, p. 357-360, 2016.

GILMORE, D. P.; DA COSTA, C. P.; DUARTE, D. P. Sloth biology: an update on their

physiological ecology, behavior and role as vectors of arthropods and arboviruses. Braz. J.
Med. Biol. Res., v. 34, n. 1, p. 9-25, 2001.

GOMES, A. C.; TORRES, M. A. N.; FERRI, L.; COSTA, F. R.; SILVA, A. M. Finding of
Haemagogus (Conopostegus) leucocelaenus (Diptera: Culicidae), in the municipality of Porto
Alegre, State of Rio Grande do Sul. Rev. Soc. Bras. Med. Trop., v. 40, n. 4, p. 487-488, 2007.

GOMES, A. C.; TORRES, M. A. N.; PAULA, M. B.; FERNANDES, A.; MARASSÁ, A. M.;
CONSALES, C. A.; FONSECA, D. F. Ecologia de Haemagogus e Sabethes (Diptera:
Culicidae) em áreas epizoóticas do vírus da febre amarela, Rio Grande do Sul, Brasil.
Epidemiol E Serviços Saúde, v. 19, n. 2, p. 101-113, 2010.

GUARDADO-CALVO, P.; REY, F. A. The Envelope Proteins of the Bunyavirales. Advances

in Virus Research, v. 98, p. 83-118, 2017.

HAYES, E. B. Zika Virus Outside Africa. Emerg. Infect. Dis., v. 15, n. 9, p. 1347-1350, 2009.

HENLE, K.; DAVOES, K. F.; KLEYER, M.; MARGULES, C. R. Predictors of species

sensitivity to fragmentation. Biodivers. Conserv., v. 13, n. 1, p. 207-251, 2004.

HEYMANN, D. L.; HODGSON, A.; SALL, A. A.; FREEDMAN, D. O.; STAPLES, J. E.,
ALTHABE, F.; BARUAH, K.; MAHMUD, G.; KANDUN, N.; VASCONCELOS, P. F. C.;
BINO, S.; MENON, K. U. Zika virus and microcephaly: why is this situation a PHEIC? The
Lancet, v. 387, n. 10020, p. 719-721, 2016.

HUANG, W. C.; ABRAHAM, R.; SHIM, B. S.; CHOE, H.; PAGE, D. T. Zika virus infection
during the period of maximal brain growth causes microcephaly and corticospinal neuron
apoptosis in wild type mice. Nature Scientific Reports, v. 6, p. 347-393, 2016.

IUCN. INTERNATIONAL UNION FOR CONSERVATION OF NATURE. The IUCN Red

List of Threatened Species. Disponível: <http://www.iucnredlist.org/details/summary/3036/0>.
Acesso em: 15 dec. 2015.

JOHNSON, P. T. J.; OSTFELD, R. S.; KEESING, F. Frontiers in research on biodiversity and

disease. Ecol. Lett., v. 18, n. 10, p. 1119-1133, 2015.

JOHNSON, C. K.; HITCHENS, P. L.; EVANS, T. S.; GOLDSTEIN, T.; THOMAS, K.;
CLEMENTS, A.; JOLY, D. O.; WOLFE, N. D.; DASZAK, P.; KARESH, W. B.; MAZET, J.
K. Spillover and pandemic properties of zoonotic viruses with high host plasticity. Nature.
Scientific Reports, v. 5, p. 1-8, 2017.
 69

KARABATSOS N. International catalogue of arboviruses, including certain other viruses

of vertebrates. 3rd ed. San Antonio - USA: American Society of Tropical Medicine and
Hygiene; 1985.

KEESING, F.; HOLT, R. D.; OSTFELD, R. S. Effects of species diversity on disease risk.
Ecol. Lett., v. 9, n. 4, p. 485-498, 2006.

KELLY, T. R.; KARESH, W. B.; JOHNSON, C. K.; GILARDI, K. V. K.; ANTHONY, S. J,

GOLDSTEIN, T.; OLSON, S. H.; MACHALABA, C.; MAZET, J. A. K. One Health proof of
concept: Bringing a transdisciplinary approach to surveillance for zoonotic viruses at the
human-wild animal interface. Prev. Vet. Med., v. 137, p. 112-118, 2017.

KIKUTI, M.; CUNHA, G. M.; PAPLOSKI, I. A. D.; KASPER, A. M.; SILVA, M. M. O.;
TAVARES, A. S.; CRUZ, J. S.; QUEIROZ, T. L.; RODRIGUES, M. S.; SANTANA, P. M.;
LIMA, H. C. A. V.; CALCAGNO, J.; TAKAHASHI, D.; GONÇALVES, A. H. O.; ARAÚJO,
J. M. G.; GAUTHIER, K.; DIUK-WASSER, M. A.; KITRON, U.; KO, A. I.; REIS, M. G.;
RIBEIRO, G. S. Spatial Distribution of Dengue in a Brazilian Urban Slum Setting: Role of
Socioeconomic Gradient in Disease Risk. PLoS Negl. Trop. Dis., v. 9, n. 7, p. 1-18, 2015.

KILBOURN, A. M.; KARESH, W. B.; WOLFE, N. D.; BOSI, E. J.; COOK, R. A.; ANDAU,
M. Health evaluation of free-ranging and semi-captive orangutans (Pongo pygmaeus
pygmaeus) in Sabah, Malaysia. J. Wildl. Dis., v. 39, n. 1, p. 73-83, 2003.

KUNO, G. Universal diagnostic RT-PCR protocol for arboviruses. J. Virol. Methods, v. 72,
n. 1, p. 27-41, 1998.

KUNO, G.; CHANG, G.J.J.; TSUCHIYA, K.R.; KARABATSOS, N.; CROPP, C.B. Phylogeny
of the Genus Flavivirus. J. Virol., v. 72, n. 1, p. 73-83, 1998.

KUNO, G.; GOMES, I.; GUBLER, D.J. Detecting artificial antidengue IgM immune
complexes using an enzymelinked immunosorbent assay. Am. J. Trop. Med. Hyg., v. 36, n.
1, p. 375-380, 1987.

LANDAU, E.C. Configuração espacial de fragmentos florestais de Mata Atlântica do sul da

Bahia, Brasil. In: PRADO P. I.; LANDAU E. C.; MOURA R. T., PINTO L. P. S.; FONSECA
G. A. B.; ALGER, K (Org). Corredor de Biodiversidade da Mata Atlântica do sul da Bahia.
Ilhéus, IESB/CI/CABS/UFMG/UNICAMP, 2003. 1 CD-ROM

LAROQUE, P. O.; VALENÇA-MONTENEGRO, M. M.; FERREIRA, D. R. A.; CHIANG,

J.O.; CORDEIRO, M.T.; VASCONCELOS, P.F.C.; SILVA, J.C.R. Epidemiologic survey for
arbovirus in galician capuchin monkeys (Cebus flavius) free living in Paraíba and captive
capuchin monkey (Cebus libidinosus) from northeast Brazil. Pesq. Vet. Bras., v. 34, n. 5, p.
462-468, 2014.

LAURANCE, W. F.; COCHRANE, M. A. Synergistic effects in fragmented landscapes. Cons.

Biol., v. 15, n. 6, p. 1488-1489, 2001.

LAURANCE, W. F.; VASCONCELOS, H. L. Ecological effcets of habitat fragmentation in

the tropics. In: SCHROTH, G.; FONSECA, G.; GASCON, C.; VASCONCELOS, H.; IZAC,
A.M.; HERVEY, C. (Org.). Agroforestry and conservation of biodiversity in tropical
landscapes. New Yourk: Island Press, 2004. p. 33-49.
 70

LERNOULD, J. M.; KIERULFF, M. C.; CANALE, G. Yellow- breasted capuchin Cebus

xanthosthernos: support by zoo for it conservations- a success story. Int. Zoo. Yearb., v. 76,
n. 1, p. 71-79, 2012.

LEVACOV, D.; JERUSALINSKY, L.; FIALHO, M. S. Levantamento dos Primatas recebidos

em centros de triagem e sua relação com o tráfico de animais silvestres. In: MELO, F. R.;
MOURTHÉ, I (Org.). Primatologia do Brasil. Belo Horizonte, Sociedade Brasileira de
Primatologia, v. 11, p. 281-305, 2011.

LOPES, N.; NOZAWA, C.; LINHARES, R. E. S. Características gerais e epidemiologia dos

arbovírus emergentes no Brasil. Rev Pan-Amaz Saude, v. 5, n. 3, p. 55-64, 2014.

MANGINI, P. R.; SILVA, J. C. R. Medicina da Conservação. In: CUBAS, Z.C.; SILVA,

J.C.R.; CATÃO-DIAS, J.L (Ed.). Tratado de Animais Selvagens. São Paulo, Roca, 2006,
p.1258-1267.

MARCONDES, C. B. Doenças transmitidas e causadas por artrópodes. São Paulo: Atheneu,

2009. 558p.

MAZET, J. A. K.; CLIFFORD, D. L.; COPPOLILLO, P. B.; DEOLALIKAR, A. B.;

ERICKSON, J. D.; KAZWALA, R. R. A “One Health” Approach to Address Emerging
Zoonoses: The HALI Project in Tanzania. PLoS Med, v. 6, n. 12, p.1-6, 2009.

MAZET, J. A. K; UHART, M. M.; KEYYU, J. D. Stakeholders in One Health. Rev. Sci. Tech.
Int. Off Epizoot., v. 33, n. 2, p. 443-452, 2014.

MEDLIN, S.; DEARDORFF, E. R.; HANLEY, C. S.; VERGNEAU-GROSSET, C.; SIUDAK-

CAMPFIELD, A.; DALLWIG, R.; TRAVASSOS-DA-ROSA, A.; TESH, R. B.; PIA,
MARTIN. M.; WEAVER, S. C.; VAUGHAN, C.; RAMIREZ, O.; SLADKY, K. K.; PAUL-
MURPHY, J. Serosurvey pf selected arboviral pathogens in free-ranging, two-toed sloths
(Cholopepus hoffmanni) and three-toed sloths (Bradypus variegatus) in Costa Rica, 2005–07.
J. Wildl. Dis., v. 52, n. 4, p. 883-892, 2016.

MELO, P. R. S.; REIS, E. A. G.; CIUFFO, I. A.; GÓES, M.; BLANTON, R. E.; REIS, M. G.
The dynamics of dengue virus serotype 3 introduction and dispersion in the state of Bahia,
Brazil. Mem. Inst. Oswaldo Cruz., v. 102, n. 8, p. 905-912, 2007.

MESQUITA, A. C. A atividade madeireira na região cacaueira. In: IESB - Instituto de Estudos

Socioambientais do Sul da Bahia. Alternativas para o desenvolvimento e conservação da
região de Una.Ilhéus, 1996. Resumo de pesquisas.1 CD ROM.

MONATH, T. P.; VASCONCELOS, P. F. C. Yellow fever. J. Clin. Virol., v. 64, p. 160-173,

2015.

MOURÃO, M.P.G.; BASTOS, M.S.; GIMAQUE, J.B.L.; MOTA, B.R.; SOUZA, G.S.;
GRIMMER, G.H.N.; GALUSSO, E.S.; ARRUDA, E.; FIGUEIREDO, L.T.M. Oropouche
Fever Outbreak, Manaus, Brazil, 2007–2008. Emerging Infect. Dis., v.15, n. 12, p. 2063-2064,
2009.

MUÑOZ, D.; ESTRADA, A.; NARANJO, E.; OCHOA, S. Foraging Ecology of howler
monkeys in a Cacao (Theobroma cacao) plantation in Comalcalca, México. Am. J. Primatol.,
v. 68, p. 127-142, 2006.
 71

MUÑOZ, M.; NAVARRO, J. C. Mayaro: a re-emerging Arbovirus in Venezuela and Latin

America. Biomed. Rev. Inst. Nac. Salud., v. 32, n. 2, p. 286-302, 2012.

MYERS, N. Tropical deforestation: The latest situation. Bioscience. v. 41, n. 5, p. 282, 1991.

MYERS, N.; MITTERMEIER, R. A.; MITTERMEIER, C. G.; FONSECA, G. A. B.; KENT,

J. Biodiversity hotspots for conservation priorities. Nature., v. 403, p. 853-858, 2000.

NASSAR, E. S.; CHAMELET, E. L. B.; COIMBRA, T. M.; SOUZA, L. T. M.; SUZUKI, A.;
FERREIRA, I. B.; SILVA, M. V.; ROCCO, I. M.; ROSA, A. P. A. T. Jungle Yellow fever:
clinical and laboratorial studies emphasizing viremia on a human case. Rev. Inst. Med. Trop.
Sao Paulo, v. 37, n. 4, p. 337-341, 1995.

NOVAES-OLIVEIRA, R.; IAMAMOTO, K.; SILVA, M. L. C. R.; ACHKAR, S. M.;

CASTILHO, J. G.; ONO, E. D.; LOBO, R. S. V.; BRANDÃO, P. E.; CARNIELI, P.;
CARRIERI, M. L.; KOTAIT, I.; MACEDO, C. I. Eastern equine encephalitis cases among
horses in Brazil between 2005 and 2009. Arch. Virol., v. 159, n. 10, p. 2615-2620, 2014.

NUNES, M. R. T.; MARTINS, L. C.; RODRIGUES, S. G.; CHIANG, J. O.; AZEVEDO, R. S.

S.; TRAVASSOS DA ROSA A. P. A.; VASCONCELOS, P. F. C. Oropouche virus Isolation,
Southeast Brazil. Emerging Infect. Dis., v. 11, n.10, p. 1610-1613, 2005.

OLIVEIRA, L. C.; NEVES, L. G.; RABOY, B. E.; DIETZ, J. M. Abundance of Jackfruit

(Artocarpus heterophyllus) Affects Group Characteristics and Use of Space by Golden-Headed
Lion Tamarins (Leontopithecus chrysomelas) in Cabruca Agroforest. Environ Manage., v. 48,
n. 2, p. 248-262, 2011.

OLIVER, W. L. R.; SANTOS, I. B. Threatened endemic mammals of the Atlantic Forest

region of South-east Brazil. Jersey, Channel Islands: Wildlife Preservation Trust, 1991.
(Special Scientific Report, 4), 126p.

PADUA, S. M.; TABANEZ, M. F.; SOUZA, M. G. A abordagem participativa na educação

para a conservação da natureza. In: CULLEN JÚNIOR, L.; RUDRAN; VALLADARES-
PADUA (Orgs.). Métodos de Estudos em Biologia da Conservação & Manejo da Vida
Silvestre. Curitiba: UFPR, 2003. v.21, p. 557-593.

PATZ, J. A.; HAHN, M. B. Climate change and human health: an One Health approach. Curr.
Top. Microbiol. Immunol., v. 366, p. 141-171, 2014.

PAULA, M. B.; FERNANDES, A.; MEDEIROS-SOUSA, A. R.; CERETTI-JÚNIOR, W.;

CHRISTE, R.; STROEBEL, R.C.; PEDROSA, L.; ALMEIDA, R. M. M. S.; CARVALHO, G.
C.; PEREIRA, U. D.; JACINTHO, M. C. O.; NATAL. D.; MARRELLI, M. T. Mosquito
(Diptera: Culicidae) fauna in parks in greater São Paulo, Brazil. Biota Neotrop., v. 15, n. 3, p.
1-9, 2015.

PAUTASSO, A.; DESIATO, R.; BERTOLINI, S.; VITALE, N.; RADAELLI, M.C.;
MANCINI, M.; RIZZO, F.; MOSCA, A.; CALZOLARI, M.; PREARO, M.; MANDOLA, M.
L.; MAURELLA, C.; MIGNONE, W.; CHIAVACCI, L.; CASALONE C. Mosquito
Surveillance in Northwestern Italy to Monitor the Occurrence of Tropical Vector-Borne
Diseases. Transbound. Emerg. Dis., v. 60, n. 2, p. 154-161, 2013.
 72

PAUVOLID-CORRÊA, A.; CAMPOS, Z.; JULIANO, R.; VELEZ, J.; NOGUEIRA, R. M. R.;
KOMAR, N. Serological evidence of widespread circulation of West Nile virus and other
flaviviruses in equines of the Pantanal, Brazil. PLoS Negl. Trop. Dis., v. 8, n. 2, p. 1-11, 2014.

PAUVOLID-CORRÊA, A.; KENNEY, J. L.; COUTO-LIMA, D.; CAMPOS, Z. M. S.;

SCHATZMAYR, H. G.; NOGUEIRA, R. M. R.; BRAULT, A. C.; KOMAR, N. Ilheus virus
isolation in the Pantanal, West-Central Brazil. PLoS Negl. Trop. Dis., v.7, n. 7. p. 1-8, 2013.

PAUVOLID-CORRÊA, A.; TAVARES, F.N.; ALENCAR, J.; SILVA, J.S.; MURTA, M.;
SERRA-FREIRE, N.M.; PELLEGRIN, A.O.; GIL-SANTANA, H.; GUIMARÃES, A.É.;
SILVA, E.E. Preliminary investigation of Culicidae species in South Pantanal, Brazil and their
potential importance in arbovirus transmission. Rev. Inst. Med. Trop. São Paulo, v. 52, n.1,
p. 17-24, 2010.

PEREIRA, L. E.; AKEMI, S., COIMBRA, T. L. M.; SOUZA, R. P.; CHAMELET. E. L. B.

Ilheus Arbovirus in Wild Birds (Sporophila Caerulescens and Molothrus Bonariensis). Rev.
de Saúde Pública, v. 35, n. 2, p. 119-23, 2001.

PINDER, L. Body measurements, karyotype, and birth frequencies of maned sloth (Bradypus
torquatus). Mammalia. v. 57, n. 1, p. 43-48, 1993.

PINHEIRO, F. P.; TRAVASSOS DA ROSA, A. P. A.; VASCONCELOS, P. F. C. Arboviroses.

In: VERONESI, R.; FOCCACIA, R. (Ed.). Tratado de Infectologia. São Paulo: Ateneu, 1997.
p. 169-180.

PINTO, C. S.; CONFALONIERI, U. E.; MASCARENHAS, B. M. Ecology of Haemagogus

sp. and Sabethes sp. (Diptera: Culicidae) in relation to the microclimates of the Caxiuanã
National Forest, Pará, Brazil. Mem. Inst. Oswaldo Cruz., v.104, n. 4, p.592-598, 2009.

PINTO, L. P. S. Distribuição geográfica, população e estado de conservação do mico-leão

de cara dourada, Leontopithecus chrysomelas (Callitrichidae, Primates). 1994. 111 p.
Dissertação (Mestrado em Zoologia) – Universidade Federal de Minas Gerais, Belo Horizonte,
1994.

PINTO, L.P.S; RYLANDS, A.B. Geografic, distribuition of the golden-headed lion tamarin,
Leontophitecus chrysomelas: Implications for its management and conservation. Folia
Primatol. v. 68, n. 3-5, p. 161-168, 1997.

RABOY B. E.; DIETZ J. M. Diet, foraging, and use of space in wild golden-headed lion
tamarins. Am. J. Primatol., v. 63, v. 1, p. 1-15, 2004.

RABOY, B. E.; NEVES, L. G.; ZEIGLER, S.; SARAIVA, N. A.; CARDOSO, N.; SANTOS,
G.R.; BALLOU, J. D.; LEIMGRUBER, P. L. Strength of Habitat and Landscape Metrics in
Predicting Golden-Headed Lion Tamarin Presence or Absence in Forest Patches in Southern
Bahia, Brazil. Biotropica, v. 42, n. 3, p. 388-397, 2010.

RAPPORT, D. Ecosystem health. In: Rapport, D.J.; Gaudet, C.L.; Calow, P. (Ed.). Evaluating
and monitoring the health of large-scale ecosystems. Berlim: Springer-Verlag, 1995. p. 5-
31.
 73

R DEVELOPMENT CORE TEAM. R: A language and environment for statistical

computing. R Foundation for Statistical Computing, Vienna, Austria, 2010. Disponível em:
<http://www.R-project.org/>. Acesso em: 12 abr. 2015.

REED, L. J.; MUENCH, H. A simple method of estimating fifty percent end points. Am. J.
Hyg., v. 27, p. 493-497, 1938.

RIBEIRO, A. C. B. Laszlo @ Galaxy: um protótipo de serviço de montagem de genomas a

partir de dados de sequenciamento de próxima geração (NGS). 2012. 245 f. Dissertação
(Mestrado em Biologia Computacional e Sistema) – Instituto Oswaldo Cruz. Rio de Janeiro.

ROCHA, T. C.; BATISTA, P. M.; ANDREOTTI, R.; BONA, A. C. D.; SILVA, M. A. N.;
LANGE, R.; SVOBODA, W. K.; GOMES, E. C.; ROCHA, T. C. DA; BATISTA, P. M;
ANDREOTTI, R; BONA, A. C. D.; SILVA, M. A. N.; LANGE, R.; SVOBODA, W. K.;
GOMES, E. C. Evaluation of arboviruses of public health interest in free-living non-human
primates (Alouatta spp., Callithrix spp., Sapajus spp.) in Brazil. Rev. Soc. Bras. Med. Trop.,
v. 48, n.2, p. 143-148, 2015.

RODRIGUES, S. G.; OLIVA, O. P.; ARAUJO, F. A. A.; MARTINS, L. C.; CHIANG, J. O.;
HENRIQUES, D. F.; SILVA, E. V. P.; RODRIGUES, D. S. G.; PRAZERES, A. S. C.,
TAVARES-NETO. J.; VASCONCELOS, P. F. C. Epidemiologia do vírus da Encefalite de
Saint Louis na Amazônia brasileira e no Estado do Mato Grosso do Sul, Brasil: elevada
prevalência de anticorpos em equinos. Rev. Pan-Amaz. Saúde, v. 1, n. 1, p. 81-86, 2010.

RODRÍGUEZ-MORALES, A. J.; PANIZ-MONDOLFI, A. E.; VILLAMIL-GÓMEZ, W. E.;

NAVARRO, J. C. Mayaro, Oropouche and Venezuelan Equine Encephalitis viruses: Following
in the footsteps of Zika? Travel Med. Infect. Dis., v. 15, p. 72-73, 2017.

RYLANDS, A. B. The ecology of the lions tamarins, Leontopithecus: some intrageneric

differences and comparisions with other callitrichids. In: RYLANDS, A. B. (Org.). Marmosets
and Tamarins: Systematics, Behaviour and Ecology. Oxford: Oxford University Press,
1993, p. 296-313.

SAATCHI, S.; AGOSTI, D.; ALGER, K.; DELABIE, J.; MUSINSKY, J. Examining
fragmentation and loss of primary forest in the Southern Bahia Atlantic Forest of Brazil with
radar imagery. Cons. Biol., v. 15, n. 4, p. 867-875, 2001.

SALLIS, E. S. V.; GARMATZ, S. L.; FIGHERA, R. A.; BARROS, V. L. R. S.; GRAÇA, D.

L. Outbreak of yellow fever in brown howlers. Acta. Sci. Vet., v. 31, n. 2, p. 115-117, 2003.

SANTOS, A. C. M. Análise da expressão IL-2 e TNF-alfa em modelo experimental animal

infectado com o vírus Mayaro (Togavividae: Alphavirus). 2013. 64 f. Tese (Doutorado em
Biologia de Agentes Infecciosos e Parasitários) – Universidade Federal do Pará, Belém, 2013.

SANTOS, G. J. R. Caracterização da caça na região do entorno da Reserva Biológica de Una –

BA. Projeto Remanescentes de Florestas na Região de Una, BA. Ilhéus: Resta Una/PROBIO,
1999.

SANTOS, H. L. C.; MARTINS L. A. F.; PERALTA, R. H. S.; PERALTA, J. M.; MACEDO,

H. W. Frequency of amoebiasis and other intestinal parasitoses in a settlement in Ilhéus City,
State of Bahia, Brazil. Rev. Soc. Bras. Med. Trop., v. 47, n. 1, p. 101-104, 2014.
 74

SANTOS, J. B.; LAUAND, L.; SOUZA, G. S.; MACÊDO, V. O. Socioeconomic factors and
attitudes towards household prevention of American cutaneous leishmaniasis in an endemic
area in southern Bahia, Brazil. Cad. Saúde Pública, v. 16, n.3, p. 701-708, 2000.

SANTOS, N. O. S.; ROMANOS, M. T. V.; WIGG, M. D. Introdução à virologia humana. 2.

ed. Rio de Janeiro: Guanabara-Koogan, 2008. 532 p.

SCHATZMAYR, H. G. Dengue situation in Brazil by year. Mem. Inst. Oswaldo Cruz, v. 95,
p. 179-181, 2000.

SCHATZMAYR, H. G. Emerging and reemerging viral diseases. Cad. Saúde Pública, v. 17,
p. 209-213, 2001.

SEYMOUR, C.; KRAMER, L. D.; PERALTA, P. H. Experimental Saint Louis encephalitis

virus infection of sloths and cormorants. Am. J. Trop. Med. Hyg., v. 2, n. 4, p. 844-853, 1983a.

SEYMOUR C.; PERALTA, P. H.; MONTGOMERY, G. G. Serologic evidence of natural

togavirus infections in panamanian sloths and other vertebrates. Am. J. Trop. Med. Hyg., v.
32, n. 4, p. 854-861, 1983b.

SHOPE, R. E. The use of a microhemagglutination-inibition test to follow antibody response

after arthropod-borne virus infection in a community of forest animals. An. Microbiology, v.
11, p. 167-171, 1963.

SHOPE, R. E.; SATHER, G. E. Arboviruses. In: LENNETTE, E. H.; SCHMIDT, N. J.

(Ed.). Diagnostic procedures for viral, rickettsial and chlamydial infections. Washington
(DC): American Public Health Association, 1979. p. 767-814.

SOLLBERG, I.; SCHIAVETTI, A.; MORAES, M. E. B. Agricultural management in the Una’s

Wildlife Refuge: a perspective of conservation by agroforestry. Rev. Árvore, v. 38, n. 2, p.
241-250, 2014.

SOUZA, R. L.; SANTOS, R. F.; NUNES-NETO. J.; MONTEIRO, H. A.; VASCONCELOS,

P. F. C. Monitoramento Entomológico em área de ocorrência de Febre Amarela Silvestre no
Oeste da Bahia. Revista Bahiana de Saúde Pública, v. 39, p. 136-141, 2015.

SWADDLE, J. P.; CARLOS, S. E. Increased Avian Diversity Is Associated with Lower

Incidence of Human West Nile Infection: Observation of the Dilution Effect. PLoS One, v. 3,
n. 6, p. 1-8, 2008.

SUSCKE, P. Socioecologia de Sapajus Xanthosthernos na Reserva Biologica de Una, Sul,

Bahia. 2014. 197 p. Tese (Doutorado em Psicologia) – Instituto de Psicologia, Universidade de
São Paulo, São Paulo, 2014.

TAIPE-LAGOS, C. B.; NATAL, D. Culicidae mosquito abundance in a preserved metropolitan

area and its epidemiological implications. Rev. Saúde Pública, v. 37, n. 3, p. 275-279, 2003.

TAUIL, P. L. Aspectos críticos do controle da febre amarela. Rev. Saúde Pública, v. 44, n. 3,
p. 555-558, 2010.

TAVARES-NETO, J.; TRAVASSOS DA ROSA, A. P.; VASCONCELOS, P. F.; COSTA, J.

M.; TRAVASSOS DA ROSA, J. F.; MARSDEN, P. D. Research on antibodies to arbovirus in
 75

the serum of residents of the village of Corte de Pedra, Valencia, Bahia. Mem. Inst. Oswaldo
Cruz, v. 81, n. 4, p. 351-358, 1986.

TEIXEIRA, M. G.; COSTA, M. C.; BARRETO, M. L.; BARRETO, F. R. Epidemiology of

dengue in Salvador-Bahia, 1995-1999. Rev. Soc. Bras. Med. Trop., v. 34, n. 3, p. 269-274,
2001.

TERZIAN, A. C. B. Diagnóstico molecular de arboviroses brasileiras em soros de pacientes

com doença febril aguda. 2008. 71 p. Dissertação (Mestrado em microbiologia) – Instituto de
Biociências, Letras e Ciências Exatas. Universidade Estadual “Júlio de Mesquita Filho”. São
José do Rio Preto, 2008.

THOISY, B.; DUSSART, P.; KAZANJI, M. Wild terrestrial rainforest mammals as potential
reservoirs for flaviviruses (yellow fever, dengue 2 and St Louis encephalitis viruses) in French
Guiana. Trans. R. Soc. Trop. Med. Hyg., v. 98, n. 7, p. 409-412, 2004.

THOISY, B.; JACQUES, G.; SALAS, R. A.; MORVAN, J.; KAZANJI, M. Mayaro virus in
Wild Mammals, French Guiana. Emerging Infect. Dis., v. 9, n. 10, p. 1326-1329, 2003.

THOISY, B.; LACOSTE, V.; GERMAIN, A.; MUÑOZ-JORDÁN, J.; COLÓN, C.;
MAUFFREY, J. F.; DELAVAL, M.; CATZEFLIS, F.; KAZANJI, M.; MATHEUS, S.;
DUSSART, P.; MORVAN, J.; SETIÉN, A. A.; DEPARIS, X.; LAVERGNE, A. Dengue
infection in neotropical forest mammals. Vector Borne Zoonotic Dis., v. 9, n. 10, p. 157-170,
2009.

TORRES, M. A. N.; SANTOS, E.; ALMEIDA, M. A. B.; CRUZ, L. L.; SPERB, A. F.

Vigilância da Febre Amarela Silvestre no Rio Grande do Sul. In: Bol. Epidemiol. SESARS, v.
5, p. 1-7, 2003.

TRAN, A.; L’AMBERT, G.; BALANÇA, G.; PRADIER, S.; GROSBOIS, V.; BALENGHIEN,
T.; BALDET, T.; LECOLLINET, S.; LEBLOND, A.; GAIDET-DRAPIER, N. An Integrative
Eco-Epidemiological Analysis of West Nile virus Transmission. EcoHealth, v. 10, p. 1-16,
2017.

TRAVASSOS DA ROSA, A. P. A.; PINHEIRO, F. P.; TRAVASSOS DA ROSA, E. S.;

RODRIGUES, S. G.; TRAVASSOS DA ROSA, J. F. S.; VASCONCELOS, P. F. Arboviroses.
In: TONELLI, E; FREIRE, L. M. S. (Org.). Doenças Infecciosas na Infância e Adolescência.
Rio de Janeiro: Medsi, 2000. cap. 68, p. 987-1015.

TRAVASSOS DA ROSA, A. P. A.; TRAVASSOS DA ROSA, E. S.; TRAVASSOS DA

ROSA, J. F. S.; DEGALLIER, N.; VASCONCELOS, P. F. C.; RODRIGUES, S. G.; CRUZ,
A. C. R. Os arbovírus no Brasil: generalidades, métodos e técnicas de estudo. In: Boletim
Técnico, n. 2. Belém: Instituto Evandro Chagas, 1998.

TRAVASSOS DA ROSA, A. P. A; SHOPE, R. E.; TRAVASSOS DA ROSA, J. F. S;

NAKAUTH. C.; VASCONCELOS, P. F. C. Arboviroses: aspectos virológicos. In: Instituto
Evandro Chagas: 50 anos de contribuição às ciências biológicas e à medicina tropical. Belém:
FUNASA, 1986.

FAO. Food and Agriculture Organization of the United Nations. Global Forest Resources
Assessment: How are the world’s forests changing? Rome, 2015. 52 p.
 76

VASCONCELOS, H. B.; AZEVEDO, R. S. S.; CASSEB, S. M.; NUNES NETO, J. P.;

CHIANG, J. O.; CANTUÁRIA, P. C.; SEGURA, M. N. O.; MARTINS, L. C.; MONTEIRO,
H. A. O.; RODRIGUES, S. G.; NUNES, M. R. T.; VASCONCELOS, P. F. C. Oropouche fever
epidemic in Northern Brazil: epidemiology and molecular characterization of isolates. J. Clin.
Virol., v. 44, n. 2, p. 129-133, 2009.

VASCONCELOS, P. F. C. Yellow Fever. Rev. Inst. Med. Trop. São Paulo, v. 36, n. 2, p.
275-293, 2003.

VASCONCELOS, P. F. C. Yellow fever in Brazil: thoughts and hypotheses on the emergence

in previously free areas. Rev. Saúde Pública, v. 44, n. 6, p. 1144-1149, 2010.

VASCONCELOS, P. F. C.; AZEVEDO, R. S. S.; RODRIGUES, S. G.; MARTINS, L. C.;

CHIANG, J. A.; TRAVASSOS DA ROSA, A. P. A. Arboviroses. In: LEÃO, R. N. Q. (Ed).
Medicina Tropical e infectologia da Amazônia. Belém: Samauma, 2013. p. 481-504.

VASCONCELOS, P. F. C.; BRYANT, J. E.; ROSA, A. P. A. T.; TESH, R. B.; RODRIGUES,

S. G.; BARRET, A. D. T. Genetic Divergence and Dispersal of Yellow Fever Virus, Brazil.
Emerging Infect. Dis., v. 10, n. 9, p. 1578-1584, 2004.

VASCONCELOS, P. F. C.; CALISHER, C. H. Emergence of Human Arboviral Diseases in the

Americas, 2000-2016. Vector Borne Zoonotic Dis., v. 16, n. 5, p. 295-301, 2016.

VASCONCELOS, P. F. C.; TRAVASSOS DA ROSA, A. P. A.; PINHEIRO, F. P.; SHOPE, R.

E.; TRAVASSOS DA ROSA, J. F. S.; RODRIGUES, S. G. Arboviruses pathogenic for man in
Brazil. In: TRAVASSOS DA ROSA, A.P.A.; VASCONCELOS, P. F. C.; TRAVASSOS DA
ROSA, J. F. S. An overview of arbovirology in Brazil and neighbouring countries. Belém:
Instituto Evandro Chagas, 1998. p.72-99.

VASCONCELOS, P. F. C.; TRAVASSOS DA ROSA, A. P.; RODRIGUES, S. G.;

TRAVASSOS DA ROSA, E. S.; DÉGALLIER, N.; TRAVASSOS DA ROSA, J. F. Inadequate
management of natural ecosystem in the Brazilian Amazon region results in the emergence and
reemergence of arboviruses. Cad. Saúde Pública, v. 17, supl., p. S155-S164, 2001.

VIEIRA, C. J. S. P.; SILVA, D. J. F.; BARRETO, E. S.; SIQUEIRA, C. E. H.; COLOMBO, T.

E.; OZANIC, K.; SCHMIDT, D. J.; DRUMOND, B. P.; MONDINI, A.; NOGUEIRA, M. L.;
BRONZONI, R. V. M. Detection of Mayaro virus infections during a dengue outbreak in Mato
Grosso, Brazil. Acta Trop., v. 147, p. 12-16, 2015.

VIVO, M. A mastofauna da Floresta Atlântica: padrões biogeográficos e implicações

conservacionistas. REUNIÃO ESPECIAL DA SBPC: Floresta Atlântica: diversidade biológica
e sócio-economica, 5., 1997, Blumenal: Universidade Regional de Blumenau / Sociedade
Brasileira para o Progresso da Ciência. Anais... Blumenal, 1997. p. 60-63.

VLEESCHOUWER, K. M.; OLIVEIRA, L. C.; RABOY, B.; RAGHUNATHAN, N.;

ZEIGLER, S. Golden-headed Lion Tamarin Research in the 21st century: recente advances and
potencial areas of future research. Neotrop. Primates, v. 18, n. 2, p. 72-76, 2011.

WALLACE, R. G.; BERGMANN, L.; KOCK, R.; GILBERT, M.; HOGERWERF, L.;
WALLACE, R.; HOLMBERG, M. The dawn of Structural One Health: a new science tracking
disease emergence along circuits of capital. Soc. Sci. Med., v. 129, p. 68-77, 2014.
 77

WEAVER, S. C. Urbanization and geographic expansion of zoonotic arboviral diseases:

mechanisms and potential strategies for prevention. Trends Microbiol., v. 21, n. 8, p. 360-363,
2013.

WEAVER, S. C.; GARCIA-BLANCO, M. A.; KO, A. I.; RIBEIRO, G. S.; SAADE, G.; SHI,
P.; VASILAKIS, N. Zika virus: History, emergence, biology, and prospects for control.
Antiviral Res., v. 130, p. 69-80, 2016.

WEAVER, S. C.; REISEN, W. K. Present and future arboviral threats. Antiviral Res., v. 85,
n. 2, p. 328-345, 2010.

WETZEL, R. M. The identification and distribution of recent Xenarthra. In: MONTGOMERY,

G. G. (Org.). The evolution and ecology of amadillos, sloths, and vermilinguas. Washington:
Smithsonian Institution Press, 1985. p. 23-46.

WHO. World Health Organization. Zika situation report. Disponível em:

<http://www.who.int/emergencies/zika- virus/situation- report/29- december2016/en/>.
Acesso em: 1 dez. 2016.

WHO. World Health Organization. Constitution of the World Health Organization. New
York, 1946. Disponível em: <http://www.who.int/about/mission/en/>. Acesso em: 1 maio
2016.
 78

APÊNDICES
 79

APÊNDICE A:

CATENACCI, L. S.; FERREIRA, M. S.; MARTINS, L. C.; DE VLEESCHOUWER, K. M.;

CASSANO, C. R.; OLIVEIRA, L. C.; CANALE, G.; DEEM, S. L.; TELLO, J. S.; PARKER,
P.; VASCONCELOS, P. F. C.; TRAVASSOS DA ROSA, E. S. Primates and Sloths as sentinels
for arboviruses in the Atlantic Forest, Bahia, Brazil. EcoHealth. (Submetido)
 80

Arboviruses in wild animals in Brazilian Atlantic Forest

PRIMATES AND SLOTHS AS SENTINELS FOR ARBOVIRUSES IN THE ATLANTIC
FOREST, BAHIA, BRAZIL
Catenacci LS, Ferreira M, Martins LC, De Vleeschouwer KM, Cassano CR, Oliveira LC,
Canale G, Deem SL, Tello JS, Parker P, Vasconcelos PFC, Travassos da Rosa ES.
From the Federal University of Piaui State, Campus Professora Cinobelina Elvas, Bom Jesus,
PI 64900-000 BRA (Catenacci); Virology Graduate Program, Evandro Chagas Institute,
Ananindeua, PA 67030-000 BRA; (Catenacci, Ferreira, Martins, Travasssos da Rosa,
Vasconcelos); Centre for Research and Conservation, Royal Zoological Society of Antwerp,
Antwerp B-2018 Belgium (Catenacci, De Vleeschouwer), Bicho do Mato Instituto de Pesquisa,
Belo Horizonte, MG 30360-082 BRA (Oliveira, De Vleeschouwer) State University of Santa
Cruz, Ilhéus, BA 45662-900 BRA (Cassano), 4 State University of Rio de Janeiro, Faculdade
de Formação de Professores, Rio de Janeiro, RJ 24435-005 BRA (Oliveira); Federal University
of Mato Grosso, Campus Sinop, ICNHS/NEBAM, MT, 78557-000 BRA (Canale), Saint Louis
Zoo Institute for Conservation Medicine, Saint Louis, MO 63110 USA (Deem), Center for
Conservation and Sustainable Development, Missouri Botanical Garden, St. Louis, MO 63110,
USA (Tello), University of Missouri-St Louis, St. Louis, MO 63105 USA (Deem, Parker)
Word-count: 3995
Key words: Arbovirus, Leontopithecus sp., Sapajus sp, Bradypus sp, emerging infectious
diseases, Atlantic Forest.
Correspondence author: Lilian Catenacci
Federal University of Piaui State/ Campus Prof Cinobelina Elvas
Rod municipal Bom Jesus Viana, BR135, km 1, Bom Jesus, Brazil, PI 64900-000 ,
Tel: (89) 9 99001212
Acknowledgments: The authors thank the important contributions of the Municipal and Bahia
State Health Department and the colleagues from the Evandro Chagas Institute for assistance
with the laboratory diagnostics and logistical support in the field. Additional thanks go to
Project BioBrasil/Centre for Research and Conservation, ICMBio and the Bicho-da mata NGO
for their logistical support and ICMBio for permits and help with logistics to conduct research
in the Una Biological Reserve. We also thank the sponsoring institutions that made this project
possible: Saint Louis Zoo WildCare Institute (USA), The Wild Animal Fund, from the
American Association of Zoological Veterinarians (USA), CNPq (Brasil), the Center for
Research and Conservation of the Royal Zoological Society of Antwerp (Belgium), Lion
Tamarins of Brazil Fund, National Lottery of Belgium, Primate Action Fund, Zoological
Society of London, Conservação Internacional, Fundação o Boticário de Proteção a Natureza.
 81

The Flemish Ministry of Science (Belgium) provided structural support to the Center for
Research and Conservation of the Royal Zoological Society of Antwerp.

Abstract:
From 2006 through 2014, seroepidemiological surveys were conducted on non-human primates
and sloths to investigate the possible circulation of arboviruses in Bahia Atlantic Forest, Brazil.
A total of 196 samples were collected from 105 Leontopithecus chrysomelas, 7 Sapajus
xanthosthernos, 21 Bradypus torquatus and 7 Bradypus variegatus. Serum samples were tested
using neutralization test and hemagglutination inhibition test to detect total antibodies against
26 different arboviruses. The overall prevalence of arboviruses was 36.1% (number of infected
individuals = 51, N total= 141), with the genus Flavivirus having the highest prevalence
(32.62%, n=46, N total= 141), followed by Phlebovirus (4.9%, n=7, N total= 141),
Orthobunyavirus (4.2%, n=6, N total= 141) and Alphavirus (0.71%, n=1, N total= 141).
Monotypic reactions suggest that the wild animals were exposed naturally to at least twelve
arboviruses. Added results from the neutralization test, animals were exposed to thirteen
arboviruses. Most of these viruses are maintained in transmission cycles independent of human
hosts, although antibodies against dengue virus serotypes 1, 2 and 3 were found in this study.
To our knowledge, this is the first study reporting exposure to arboviruses in L. chrysomelas,
S. xanthosthernos and B. torquatus. Our results also highlight that the Southern Bahian Atlantic
Forest has a variety of vertebrate hosts and potential vectors, which may support the emergence
or reemergence of arboviruses, including those pathogenic to humans.
 82

INTRODUCTION

Arboviruses are zoonotic and transmitted among vertebrate hosts by hematophagous vectors

(Vasconcelos et al. 2001; Vasconcelos 2010). Due to the emergence and re-emergence of

various arbovirus infections in humans (e.g. dengue, chikungunya, Zika, West Nile virus, and

yellow-fever) in Brazil (Figueiredo 2015; Gyawali et al. 2016; Heymann et al. 2016), studies

focused on identifying these viruses in vectors and hosts are an essential part of active

surveillance.

Neotropical mammals are important hosts in several zoonosis’ cycles and may serve as

sentinels for arbovirus surveillance (de Almeida et al. 2012; Carrion and Patterson 2012).

Arboreal and diurnal mammal species are most frequently infected probably due their activity

time and their use of upper forest layer (canopy) for foraging, at the same hours when vectors

are active (de Thoisy et al. 2004).

In Brazil, numerous arbovirus have been detected in wild primates: Ilhéus virus (ILHV) (

Laroque et al. 2014), Saint Louis Encephalitis vírus (SLEV) (Vasconcelos et al. 2001; Lima et

al. 2010; Laroque et al. 2014; Svoboda et al. 2014.), Rocio virus (ROCV) (Laroque et al.

2014), Bussuquara virus (BSQV) (Moreira G.V. et al.), Mayaro vírus (MAYV) (Mb et al.

2015), Oropouche virus (OROV) and Yellow fever virus (YFV) (Lima et al. 2010; Moreno et

al. 2013; Tranquilin et al. 2013; Almeida et al. 2014). Recently, researchers showed Dengue

virus (DENV) antibodies in Neotropical primates (de Thoisy et al. 2009; Omatsu et al. 2012;

Nakgoi et al. 2014; Ferreira et al. 2014). Similarly, several arboviruses were previously

described in sloths: SLEV, ILHV, West Nile virus, Utinga virus, Venezuelan Equine

encephalitis virus (VEEV), MAYV, Changuinola virus (CGLV), OROV, Murutucu virus

(MURV), Punta Toro virus (PTV), Vesicular Stomatitis virus (VSV) and Rio grande virus

(Tesh et al. 1969; Seymour et al. 1983a,b; Gilmore et al. 2001; Medlin et al. 2016). The low

metabolism of sloth species may result in long-lasting viremia for many viruses, increasing
 83

transmission capabilities (Seymour et al. 1983a,b) and suggesting the importance for

including sloths as sentinels in arbovirus surveys.

The diversity of viruses detected in Neotropical mammals raises a conservation concern: what

is the threat level of virus infections for endemic and endangered wild populations living in

biodiversity hotspots (Vasconcelos and Calisher 2016; Althouse et al. 2016; Bueno et al.

2016), such as the Atlantic Forest? These arthropod-borne diseases, as the arboviruses, have a

complex transmission cycle in which vectors, pathogens and animal hosts interact under

strong influences of environmental conditions (Vasconcelos 2010; Pautasso et al. 2013;

Nakgoi et al. 2014). Anthropogenic activities have a direct influence on the environment,

causing rapid changes in habitat available to wildlife, which ultimately enable spread

emergence of pathogens and zoonotic diseases. The Brazilian Atlantic has been reduced and

fragmented due to deforestation (Ribeiro et al. 2009) with many fragments adjacent to

villages and agroforest systems which potentially expose animals to transmission of potential

pathogens across taxa (Daszak et al. 2004; Engering et al. 2013; Jansen et al. 2015). In

addition, arboviruses and competent vectors (e.g., mosquitoes) may be spread around the

world by people through their travels (Weaver and Reisen 2010; Weaver 2013), resulting in

recent human diseases outbreaks (e.g. Zika and yellow-fever viruses in Brazil) (Faria et teal.

2016).

Primates and sloths have partially overlapping distribution ranges in the Southern Bahia

Atlantic Forest (Oliver and Santos 1991). The golden-headed lion tamarin (Leontopithecus

chrysomelas), the yellow-breasted capuchin monkey (Sapajus xanthosthernos) and the maned

three-toed sloth (Bradypus torquatus) are endemic to the region, and all three are threatened

with extinction (IUCN 2017), while the brown-throated sloth (B. variegatus) is not threatened

and has a wider distribution range than B. torquatus.

 84

In the present study, our goals were to evaluate the influence of host species, sex and age as

sources of variation in arbovirus biodiversity and arbovirus period prevalence in free-living L.

chrysomelas, S. xanthosthernos, B. torquatus and captive B. torquatus and B. variegatus.

MATERIAL AND METHODS

Study sites

Our study was conducted in the Southern Bahia Atlantic Forest, northeastern Brazil, in the

municipalities of Ilhéus and Una. Study sites (Fig. 1) included two protected areas (Una

Biological Reserve and Una Wildlife Refuge), five private areas (Almada, Santa Rita,

Ribeiro, Ozawa, Manoel Rosa and São José farms), one private reserve (Ecoparque de Una),

one rural settlement (Bonfim) and one Zoobotanical Reserve Rehabilitation Center. The

predominant land use in the study region are cacao agroforests, rubber tree plantations,

coconut and cassava plantations (Alger and Caldas 1994; Sollberg et al. 2014). Most

plantations are surrounded by small villages that have family rural labor and poor access to

infrastructure, such as electricity, potable water, sanitation and human and veterinary health

care (Carneiro Santos et al. 2014; Sollberg et al. 2014).

Study group

The samples were collected during health screenings of animals between 2006 and 2014 in

conjunction with ongoing behavioral and ecological studies (Canale et al. 2009; Cassano et al.

2011; Oliveira et al. 2011; Catenacci et al. 2016).

Non-human Primates

One hundred and three L. chrysomelas and seven S. xanthosthernos were captured

individually using Tomahawk live traps baited with bananas and placed on platforms above

ground in areas used by primate groups (Table 1). Once captured, the animals were

maintained overnight in the field lab for processing, and released the following morning at the

site of capture (Miller and Dietz 2006). They were anesthetized by hand injection of ketamine
 85

hydrochloride (10 mg/kg; i.m.) and midazolam hydrochloride (0.3 mg/kg; i.m.) (Catenacci et

al. 2016). During anesthesia, we gave physical examinations and collected biomaterials (e.g.

blood). We collected the following data from each animal: sex, age group, animal

identification, body weight. Biometric data, as well as data pertaining to body temperature

and heart and respiratory rate, were collected (data not reported). Each animal received a

unique tattoo number and/or dye mark for subsequent ease of identification in the field.

Sloths

Seven B. torquatus were hand caught in the tree canopy by a trained climber, placed in a

burlap sack and lowered to the forest floor using a rope (Table 1). These animals were located

and captured using previously placed radio-collars. No anesthesia was administered to any of

the sloths. Adults were sexed based on genitalia and pelage, and all sloths were aged based on

body mass following a previous study (Lara-Ruiz and Chiarello 2005). Sloths were weighed

and morphometric collected. Animals were handled after capture for 15-30 min and released

at the base of the tree where captured.

Additional samples were collected from 14 B. torquatus and seven B. variegatus housed in a

single enclosure (approximately 20 X 50 feet) at the Zoobotanical Reserve Rehabilitation

Center (Table 1). We manually captured the animals and the samples were collected using the

protocol used for free-living sloths as described above.

Sample collection

One to three milliliters of blood were collected from primates using the femoral vein and 3-5

ml of blood from the cephalic vein in sloths. Each blood sample collected was divided into

two aliquots in Eppendorf® microtubes, with one stored immediately in liquid nitrogen, and

the other kept at 4⁰C for 3 hr until centrifugation for serum collection. Sera samples were

then placed in liquid nitrogen and relocated to a -70oC freezer at the Universidade Estadual de
 86

Santa Cruz, Ilhéus, Bahia until air-shipped on dry ice to the Division of Arbovirology and

Hemorrhagic Fevers at the Evandro Chagas Institute (SAARB-IEC), PA, Brazil. Sera samples

were stored at -70⁰C until processed.

Serological test

Sera samples were initially screened by the Hemagglutination Inhibition Test (HI - Clarke et

al. 1958) and adapted by Casal (1967) using a panel containing twenty-six different

arboviruses (Table 2). The samples were screened at a dilution of 1:20 against antigens

containing four hemagglutination units, and positive sera were titrated up (by factors of 2) to a

dilution of 1:1280 (Rodrigues et al. 2010). The positive samples with specific antibodies were

considered monotypic when antibodies were detected against only one virus in the same

genus. The heterotypic reactions were considered when antibodies for more than one virus

was present in a serum sample (Thompson et al. 2012; Casseb et al. 2015).

The heterotypic reactions were confirmed by a separate neutralization test (NT) as described

by Beaty (1989). The titer was defined as the logarithmic neutralization index (LNI), using

log 10 and the sample was considered positive when its LNI was ≥ 1.7

(Reed et al. 1938).

Statistical analysis

We state positive prevalence for any individuals that were positive on any of the serological

tests. In the case of multiples captures from the same animal, an individual was considered

exposed if it was found to be positive at any point during the sampling interval; thus, we

measured period prevalence for 2006 and 2014. Confidence intervals for sero-prevalence

were calculated in all cases using the "Wilson" method in the "binom.confint" function of the
 87

R package "binom" (Lawrence et al. 2001). Additionally, we used a generalized linear model

(GLM) with binomial errors to study if prevalence were significantly different among virus

genera. If the global GLM was significant, we conducted a Tukey post hoc test to identify

what pairs of genera were significantly different (function “ghlt” from package “multcomp”;

Hothorn et al. 2008).

We also studied if virus prevalence varied as a function of host characteristics. We

constructed a GLM with binomial errors, in which the sero-prevalence status of the host (i.e.,

0, 1) was the response variable, and predictors were host species, sex and age. The full model

included the main effects of these predictors, as well as all two- and three-way interactions.

The significance of each term was tested using the function "step" of the R package

"stats"(Crawley 2007; R Core team). This analysis was repeated to investigate variation in the

prevalence of all arboviruses combined, as well as the prevalence of each arbovirus genus

separately.

Finally, to investigate changes in the sero-prevalence patterns of virus species with host

characteristics we took a community ecology approach. We constructed a species composition

matrix where rows were virus species, and columns host species. We extracted 2 derived axes

from this analysis, which summarize the variation in sero-prevalence patterns (virus species)

among hosts. We then used analyses of variance (ANOVA) to test if there were differences

among host species, sex and age in values of axes 1 and 2 from the ordination. Significance

was determined simply by p-values (p < 0.5) of each term in the full model.

Animal Use

All of the procedures complied with legal requirements as set by the Environmental Services

SISBIO permits n° 11885-1, 113/2007, 23069-2, 15025-1, 12787-1, 12787-3, 12787-4,

23457-4, 23457-5, 45513-1 and by the Animal Welfare Committee of Evandro Chagas

Institute, under n°26/2014 and 27/2014.

 88

RESULTS

Hemagglutination Inhibition test results

From the 139 samples tested 35.25% had arbovirus antibodies (confidence interval: 27.8 to

43.49; Table 1), with the highest prevalence for the sloths B. torquatus (50%; CI 30.7-69.3)

and B. variegatus (42.9%; CI 15.8-0.75) followed by L. chrysomelas (33%; CI 24.7-42.6) and

S. xanthosthernos (14.3%; CI 2.6-5.13) (Table 1).

Antibodies against Flavivirus were detected in all species tested. Alphavirus antibodies were

detected only in B. torquatus while Phlebovirus antibodies were detected solely in L.

chrysomelas (Figure 2 and 3). Our statistical analyses indicated significant differences in

prevalence levels among the different virus genera. When all hosts were combined and for L.

chrysomelas alone, we found: (a) Flavivirus had significantly higher prevalence than all other

virus genera (all p-values < 0.001); while (b) other virus genera did not differ from each other

significantly (all p-values > 0.193) (Figure 2 and 3).

Leontopithecus chrysomelas had antibodies belonged to multiple genera, in which five

individuals were seropositive for Phlebovirus and Flavivirus, and one had antibodies against

Phlebovirus, Flavivirus, and Orthobunyavirus. One B. torquatus showed antibodies against

Alphavirus and Flavivirus, and another animal presented antibodies against Flavivirus, and

Orthobunyavirus.

When investigating how virus prevalence changes as a function of host characteristics, we

found little evidence for effects of species, sex or age on sero-prevalence (Figure 3). There is

some weak evidence for an effect of sex on prevalence of antibodies by genera and of each

separately. First, the species effect was retained by the stepwise selection based on AIC, albeit

with a non-significant p-value (p = 0.136) in a model by itself; and second, species was

marginally significant in a model with only main effects (p = 0.093; i.e., with age and sex, but
 89

without interactions). For Orthobunyavirus, species was more clearly significant in a model

with only main effects (p = 0.003), and B. torquatus had higher prevalence for this genus than

the other species (Figure 3). Finally, our analyses of patterns of distribution by virus species

show clear results that different “communities” of viruses infect different host species. In our

ANOVA models, species was clearly and strongly significant when using the second axis (p <

0.001). It is clear that both host species overlap, but also occupy different areas of the spaces

created by the two ordination axes that reflect the patterns of sero-prevalence by virus species

(Figure 4).

Antibodies against 16 of the 26 viruses were found in wild animals, with titers

between 20-320 (Figure 2; Table 3). L. chrysomelas and B. torquatus showed serological

evidence of 13 species of viruses each, with 10 of them shared in both species. The animals

were more likely to be exposed to the ILHV (15.6%, n=22) with titers from 1:20 to 1:320,

followed by DENV-2 (14.8%, n=20) with 1:20-1:40, DENV-1 (9.9%, n=14) with 1:20-1:40

and ROCV (7.1%, n=10) with 1:20-1:160 (Figure 2; Table 3).

The majority, 64.7% of positive samples were monotypic reactions (21 for GHLT,

eight for B. torquatus, three for B. variegatus and one for S. xanthosthernos. The animals

were exposed to 12 species: YFV, ILHV, ROCV, CPCV, BSQV, ICOV, EEEV, CARV,

DENV-1 V, DENV-2, DENV-3 and UTIV (Table 4). Antibodies against DENV-2 (n=7),

ICOV (n=7) and ILHV (n=5) were the most common monotypic reactions in non-human

primates, while the CARV was for the sloths (n=3).

Neutralization test (NT)

Not all samples that showed heterotypic reactions could have a NT performed. However, for

63 samples tested, seroneutralizing antibodies were confirmed in five animals exposed to

ICOV, SLEV, BSQV and ILHV (Table 5).

 90

Longitudinal study with multiple samples from recaptures

Thirty-seven marmosets were caught multiple (from 2 to 5) times throughout the monitoring

period. Of 27 positive L. chrysomelas, seven became seropositive for one of the following

virus: ROCV, CPCV, ILHV, ICOV, TCMV, YFV, DENV-2. The B. torquatus captured

multiple times showed seroconversion to CARV, DENV-2, DENV-3, BSQV, ILHV, UTIV.

The sloth positive for EEEV showed the same antibody titers (1:20) across time and since the

first capture in 2006, followed by three additional in 2006 to 2008.

One of the L. chrysomelas was captured three times over the period 2008 through 2009. In the

first two captures (December 2008 and June 2009), we found antibodies to Flavivirus.

Whereas in a third sample from the same individual, collected in December 2009, antibodies

for Phlebovirus were also present. Another individual had antibodies against Phlebovirus,

Flavivirus, and Orthobunyavirus within a period of six months. For this animal, the first

sample taken in December 2008 was negative for arboviruses. The second sample, collected

in July 2009, had antibodies against the three genera.

DISCUSSION

To the authors’ knowledge, this is the first serological survey for 26 arboviral strains in wild

populations of these Neotropical species. The animals were classified as healthy based on

physical examination findings, although some of the primates had mildly enlarged inguinal

lymph nodes.

The higher arbovirus prevalence in sloths confirms their relevant role as sentinels to alert the

silent circulation of arbovirus in the study area, as suggested by previous studies in other

regions (Seymour et al. 1983a; Seymour et al. 1983b; Medlin et al. 2016) Tesh et al. 1995

The predominance of the Flavivirus genus in Neotropical primates was expected, as they are

known to host several strains of this genus (de Almeida et al. 2012; Batista et al. 2013;

Almeida et al. 2014). However, we expected lower prevalence and circulation in sloths, as
 91

few Flavivirus had been detected in Choloepus hoffmanni and B. variegatus (Medlin et al.

2016). The higher prevalence of sloths and non-human primates with antibodies against

Flavivirus may reflect 1) a silent virus circulation; 2) abundance of vectors; and/or 3) a wide

spectrum of vertebrate host species on which the arthropod vectors feed (Al-Shorbaji et al.

2016) in the Atlantic Forest. The present study supports that arboviruses in sylvatic cycles

may be maintained by more than one host species across taxa, as suggested elsewhere. Indeed,

an arbovirus with a broad host-range might have selective advantages over one capable of

causing productive viremia in only a single host species and single vector (Kading et al. 2013;

Caron et al. 2015; Al-Shorbaji et al. 2016).

In addition, our data suggests viral circulation of Alphavirus and Orthobunyavirus in sylvatic

areas in Bahia. Previous studies in tropical forests (de Thoisy et al. 2004) cited other species

of sloths with high antibodies prevalence against MAYV and VEEV virus, but we show for

the first time B. torquatus exposed to EEEV virus. Sloths are also hosts to some

orthobunyaviruses which are often shared between livestock and other domesticated species

(Seymour et al. 1983b; Figueiredo 1999) and we describe antibodies against CARV virus for

the first time.

The cross-reacting antibody among strains from the same genus (i.e., the heterotypic

reactions) found in this study might be explained by the higher sensitivity than specificity

present in the HI test (Zarnke et al. 1983; Kading et al. 2013; Laroque et al. 2014). However,

the HI test has often been used in serological surveys because it can detect antibodies over a

long period after natural infection, and thus an ideal method for surveys in wild animals

captured in forests (Batista et al. 2012). Also, the HI test allowed one unique sample to be

screened against 26 virus antigens, increasing the chance of finding monotypic responses or

high differences in titers and therefore should be enough to identify antibodies at species level

(Tauro et al. 2012; Casseb et al. 2015).

 92

The monotypic reactions described in our study suggest that the wild animals were exposed

naturally to at least twelve arboviruses. Adding the results from the NT, the animals were

exposed to thirteen arboviruses. Most of these viruses are perpetuated in transmission cycles

independent of human hosts (Figueiredo 2015), highlighting the complexity of arbovirus

transmission and providing further insight into how arboviruses may be maintained and

dispersed sylvatically (Kading et al. 2013). The ILHV, for example, continues to be widely

distributed in Bahia Atlantic Forest, which can lead to outbreaks in livestock and humans.

ILHV was discovered in Ilhéus city in 1947 and causes similar symptoms as dengue in

humans, and presently has been detected during several human surveillance surveys in rural

areas in Brazil. The wild birds are the main reservoirs (Pereira et al. 2001) for ILHV, although

antibodies and viral isolation also occurs in non-human primates (Laroque et al. 2014).

Our study also suggests that the YFV is still circulating in a sylvatic cycle in this part of the

Atlantic Forest, given that two L. chrysomelas were detected with YFV antibodies on the

same farms (Almada and Bonfim) where four sick monkeys (Callithrix kuhlii) had YFV

isolated in the 1940`s (Vaz 2005). Furthermore, we showed elevated prevalence for anti-

SLEV antibodies when compared to the primates Sapajus cay (15.4%; 4/26), S. nigritus

(6.3%; 4/64) and Allouata caraya (2.3%; 1/43) captured in southern Brazil (Svoboda et al.

2014). In the state of Mato Grosso do Sul, the CPCV was found in one free-living primate

with a titer of 1:20 (Batista et al. 2013), which is similar to that found in the present study.

Antibodies against TCMV have been found only in monkeys originally from Amazonian

Forest (Figueiredo 1999) and the UTIV neutraliziting antibodies had not been found in B.

torquatus prior to this study.

Our results also highlight the possibility of viral circulation of dengue virus serotypes 1, 2 and

3 in B. torquatus, B. variegatus and L. chrysomelas. In our study, sampling sites included

animal captures inside of agroforestry and agricultural areas, where the presence of both
 93

workers and wild animals coexist (Cassano et al. 2011; Oliveira et al. 2011; Canale et al.

2013). This proximity could explain the possibility of transmission and circulation of the

DENV to wildlife, although further studies (e.g. viral isolation in wild animals) are necessary

to confirm a sylvatic cycle of dengue in the Southern Bahia Atlantic Forest, Brazil.

Although wild mammals have no confirmed role in the cycle of dengue in South America,

serological studies have suggested a possible secondary amplification cycle involving other

mammals (de Thoisy et al. 2009; Hanley et al. 2013). In French Guiana, DENV-2

seroneutralizing antibodies were found in Dasypus spp., Coendou spp., Metachirus

nudicaudatus, Dasyprocta leporine and Mazama spp. (de Thoisy et al. 2004). A few years

later, de Thoisy and collaborators (2009) identified viral RNA in many species of South

American bats, rodents, and marsupials, and provided the first C/prM sequences of strains of

DENV1-4 circulating in wildlife communities. The exact role of accidentally exposed species

in Southern Bahia Atlantic Forest is unknown. They may act as an epidemic dead end or

maintain the virus during inter-epidemic periods or even in virus amplification, with

transmission by either populations of other vectors, such as Aedes albopictus (Caron et al.

2015). The ecological dynamics of the mammalian species in relation to that of the virus will

need to be explored. Extensive research on vectors is required, as Haemagogus leucocelaenus

infected with DENV-1 has been described in Bahia by RT-Heminested-PCR tests (de

Figueiredo et al. 2010). Finally, in Ilhéus and Una municipalities, all four serotypes (DENV-

1, DENV-2, DENV-3, DENV-4) are present, and the disease is endemic with sporadic

outbreaks (Melo et al. 2007; Barreto et al. 2008; Melo et al. 2010). The continuous

monitoring of arboviruses that could affect wild animals is important, particularly in

surrounding villages and regions that experience continued deforestation.

 94

Implications for Humans and Wildlife Health

The active surveillance of infectious diseases in wild animals has the potential to assist public

health. This type of epidemiological surveillance may permit early detection of an outbreak in

humans, such as ZIKV, CHIKV or YFV, and may enable quick establishment of a

transmission-blocking vaccination or control of vectors in rural communities (Lima et al.

2010; Tranquilin et al. 2013).

Arbovirus infection could cause wildlife population decline and reduce animal survival, as the

ongoing yellow fever outbreaks demonstrate (de Almeida et al. 2012; Tranquilin et al. 2013;

Brasil 2017). The exposure to pathogens and potential vectors, in addition to other threats

(e.g. deforestation, illegal wildlife trade and introduction of exotic species) may compromise

the survival of host populations (Daszak et al. 2000; Engering et al. 2013; Jansen et al. 2015;

Deem 2016; Vorou 2016).

CONCLUSIONS

The present serum survey suggests that arboviruses are circulating in free-living animals in

the Southern Bahia Atlantic Forest, Brazil. The general low titer of antibodies and the

absence of clinical signs in non-human primates and sloths highlight the necessity of further

studies to evaluate the role of these species as accidental hosts, bridge hosts or reservoirs of

arboviruses, and the possibility of isolating the virus. It is possible that some arboviruses

remain silent in the forest, including the dengue virus. The question of whether mammals

maintain dengue in enzootic cycles and can play a role in its reemergence in human

populations remains to be answered. Considering that areas investigated here harbor some of

the few protected populations of threatened wildlife species in Brazil, we recommend long-

term monitoring of small populations of these threatened species living close to human

villages and households. We also suggest improving the long-term entomological studies,
 95

which will add to long-term arbovirus surveillance of human populations in these villages and

to wildlife health.

The recent entry of new arboviruses into Brazil and the ongoing yellow-fever epidemics

challenges physicians, health professionals, biologists, ecologists and veterinarians to

intensify an active and ongoing investigation on the pathogenesis, etiological agents,

laboratory diagnostic capabilities, and the wildlife and environmental and social factors that

may be associated with arbovirus outbreaks in human populations and the risk of endemic and

epidemic disease events.

All applicable institutional and/or national guidelines for the care and use of animals were

followed.

The authors declare that they have no conflict of interest.

REFERENCES

Alger K, Caldas M (1994) The declining cocoa economy and the Atlantic Forest of Southern
Bahia, Brazil: Conservation attitudes of cocoa planters. Environmentalist 14:107–119.
doi: 10.1007/BF01901304

Almeida MAB, Cardoso J da C, dos Santos E, da Fonseca DF, Cruz LL, Faraco FJC, Bercini
MA, Vettorello KC, Porto MA, Mohrdieck R, Ranieri TMS, Schermann MT, Sperb
AF, Paz FZ, Nunes ZMA, Romano APM, Costa ZG, Gomes SL, Flannery B (2014)
Surveillance for Yellow Fever Virus in Non-Human Primates in Southern Brazil,
2001–2011: A Tool for Prioritizing Human Populations for Vaccination. PLoS Negl
Trop Dis. doi: 10.1371/journal.pntd.0002741

Almeida MAB, Santos E, Cardoso JC, Fonseca, Torres MAN, Cardoso LL Vigilância da
febre amarela e outras arboviroses através do monitoramento de primatas não
humanos de vida livre no Rio Grande do Sul. Rev Soc Bras Med Trop 41(supl 1):173.

Al-Shorbaji F, Roche B, Gozlan R, Britton R, Andreou D (2016) The consequences of

reservoir host eradication on disease epidemiology in animal communities. Emerg
Microbes Infect 5:e46. doi: 10.1038/emi.2016.46

Althouse BM, Vasilakis N, Sall AA, Diallo M, Weaver SC, Hanley KA (2016) Potential for
Zika Virus to Establish a Sylvatic Transmission Cycle in the Americas. PLoS Negl
Trop Dis 10:e0005055. doi: 10.1371/journal.pntd.0005055

Barreto FR, Teixeira MG, Costa M da CN, Carvalho MS, Barreto ML (2008) Spread pattern
of the first dengue epidemic in the city of Salvador, Brazil. BMC Public Health 8:51.
doi: 10.1186/1471-2458-8-51
 96

Batista PM, Andreotti R, Almeida PS de, Marques AC, Rodrigues SG, Chiang JO,
Vasconcelos PF da C, Batista PM, Andreotti R, Almeida PS de, Marques AC,
Rodrigues SG, Chiang JO, Vasconcelos PF da C (2013) Detection of arboviruses of
public health interest in free-living New World primates (Sapajus spp.; Alouatta
caraya) captured in Mato Grosso do Sul, Brazil. Rev Soc Bras Med Trop 46:684–690.
doi: 10.1590/0037-8682-0181-2013

Batista PM, Andreotti R, Chiang JO, Ferreira MS, Vasconcelos PF da C (2012)

Seroepidemiological monitoring in sentinel animals and vectors as part of arbovirus
surveillance in the state of Mato Grosso do Sul, Brazil. Rev Soc Bras Med Trop
45:168–173. doi: 10.1590/S0037-86822012000200006

Beaty, BJ, Calisher,CH, Shope, RE (1989) Arboviruses. Diagn Proced Viral Ricketts
Chlamydial Infect 797–855.

Benchimol M, Peres CA (2014) Predicting primate local extinctions within “real-world”

forest fragments: A pan-neotropical analysis. Am J Primatol 76:289–302. doi:
10.1002/ajp.22233

Bueno MG, Martinez N, Abdalla L, Duarte dos Santos CN, Chame M (2016) Animals in the
Zika Virus Life Cycle: What to Expect from Megadiverse Latin American Countries.
PLoS Negl Trop Dis. doi: 10.1371/journal.pntd.0005073

Canale GR, Guidorizzi CE, Kierulff MCM, Gatto CAFR (2009) First record of tool use by
wild populations of the yellow-breasted capuchin monkey (Cebus xanthosternos) and
new records for the bearded capuchin (Cebus libidinosus). Am J Primatol 71:366–372.
doi: 10.1002/ajp.20648

Canale GR, Kierulff MCM, Chivers DJ (2013) A Critically Endangered Capuchin Monkey
(Sapajus xanthosternos) Living in a Highly Fragmented Hotspot. In: Marsh LK,
Chapman CA (eds) Primates in Fragments. Springer New York, pp 299–311

Carneiro Santos HL, Fernandes Martins LA, Saramago Peralta RH, Peralta JM, Werneck de
Macedo H (2014) Frequency of amoebiasis and other intestinal parasitoses in a
settlement in Ilhéus City, State of Bahia, Brazil. Rev Soc Bras Med Trop 47:101–104.
doi: 10.1590/0037-8682-0078-2012

Caron A, Cappelle J, Cumming GS, de Garine-Wichatitsky M, Gaidet N (2015) Bridge hosts,

a missing link for disease ecology in multi-host systems. Vet Res. doi:
10.1186/s13567-015-0217-9

Carrion R, Patterson JL (2012) An animal model that reflects human disease: the common
marmoset (Callithrix jacchus). Curr Opin Virol 2:357–362. doi:
10.1016/j.coviro.2012.02.007

Cassano CR, Kierulff MCM, Chiarello AG (2011) The cacao agroforests of the Brazilian
Atlantic forest as habitat for the endangered maned sloth Bradypus torquatus. Mamm
Biol - Z Für Säugetierkd 76:243–250. doi: 10.1016/j.mambio.2010.06.008

Casseb AR, Silva SP, Casseb LMN, Chiang JO, Martins LC, Vasconcelos PFC (2015)
PREVALÊNCIA DE ANTICORPOS CONTRA ARBOVÍRUS DA FAMÍLIA
 97

<italic>Bunyaviridae</italic> EM BÚFALOS DE ÁGUA. Ciênc Anim Bras 16:428–

436. doi: 10.1590/1089-6891v16i327208

Catenacci LS, Pessoa MS, Nogueira-Filho SLG, Vleeschouwer KMD (2016) Diet and
Feeding Behavior of Leontopithecus chrysomelas (Callitrichidae) in Degraded Areas
of the Atlantic Forest of South-Bahia, Brazil. Int J Primatol 37:136–157. doi:
10.1007/s10764-016-9889-x

Clarke, DH, Casals,J (1958) Techniques for hemagglutination and hemagglutination-

inhibition with arthropod-borne viruses. Am J Trop Med Hyg 561–573.

Crawley (2007) The R Book.

Daszak P, Cunningham AA, Hyatt AD (2000) Emerging Infectious Diseases of Wildlife--

Threats to Biodiversity and Human Health. Science 287:443–449. doi:
10.1126/science.287.5452.443

Daszak P, Tabor GM, Kilpatrick AM, Epstein J, Plowright R (2004) Conservation medicine
and a new agenda for emerging diseases. Ann N Y Acad Sci 1026:1–11. doi:
10.1196/annals.1307.001

de Almeida MAB, Dos Santos E, da Cruz Cardoso J, da Fonseca DF, Noll CA, Silveira VR,
Maeda AY, de Souza RP, Kanamura C, Brasil RA (2012) Yellow fever outbreak
affecting Alouatta populations in southern Brazil (Rio Grande do Sul State), 2008-
2009. Am J Primatol 74:68–76. doi: 10.1002/ajp.21010

de Figueiredo ML, de C Gomes A, Amarilla AA, de S Leandro A, de S Orrico A, de Araujo

RF, do SM Castro J, Durigon EL, Aquino VH, Figueiredo LT (2010) Mosquitoes
infected with dengue viruses in Brazil. Virol J 7:152. doi: 10.1186/1743-422X-7-152

de Thoisy B, Dussart P, Kazanji M (2004) Wild terrestrial rainforest mammals as potential

reservoirs for flaviviruses (yellow fever, dengue 2 and St Louis encephalitis viruses)
in French Guiana. Trans R Soc Trop Med Hyg 98:409–412. doi:
10.1016/j.trstmh.2003.12.003

de Thoisy B, Lacoste V, Germain A, Muñoz-Jordán J, Colón C, Mauffrey J-F, Delaval M,

Catzeflis F, Kazanji M, Matheus S, Dussart P, Morvan J, Setién AA, Deparis X,
Lavergne A (2009) Dengue infection in neotropical forest mammals. Vector Borne
Zoonotic Dis Larchmt N 9:157–170. doi: 10.1089/vbz.2007.0280

Deem SL (2016) Conservation Medicine: A Solution-Based Approach for Saving Nonhuman

Primates. In: Waller MT (ed) Ethnoprimatology. Springer International Publishing, pp
63–76

Deem SL, Karesh WB, Weisman W (2001) Putting Theory into Practice: Wildlife Health in
Conservation. Conserv Biol 15:1224–1233. doi: 10.1111/j.1523-1739.2001.00336.x

Engering A, Hogerwerf L, Slingenbergh J (2013) Pathogen–host–environment interplay and

disease emergence. Emerg Microbes Infect 2:e5. doi: 10.1038/emi.2013.5

Faria NR, Azevedo R do S da S, Kraemer MUG, Souza R, Cunha MS, Hill SC, Thézé J,
Bonsall MB, Bowden TA, Rissanen I, Rocco IM, Nogueira JS, Maeda AY, Vasami
 98

FG da S, Macedo FL de L, Suzuki A, Rodrigues SG, Cruz ACR, Nunes BT, Medeiros

DB de A, Rodrigues DSG, Nunes Queiroz AL, da Silva EVP, Henriques DF,
Travassos da Rosa ES, de Oliveira CS, Martins LC, Vasconcelos HB, Casseb LMN,
Simith D de B, Messina JP, Abade L, Lourenço J, Carlos Junior Alcantara L, de Lima
MM, Giovanetti M, Hay SI, de Oliveira RS, Lemos P da S, de Oliveira LF, de Lima
CPS, da Silva SP, de Vasconcelos JM, Franco L, Cardoso JF, Vianez-Júnior JL da SG,
Mir D, Bello G, Delatorre E, Khan K, Creatore M, Coelho GE, de Oliveira WK, Tesh
R, Pybus OG, Nunes MRT, Vasconcelos PFC (2016) Zika virus in the Americas:
Early epidemiological and genetic findings. Science 352:345–349. doi:
10.1126/science.aaf5036

Ferreira MS, de Castro PHG, Silva GA, Casseb SMM, Dias Júnior AG, Rodrigues SG,
Azevedo R do S da S, Silva MFC e, Zauli DAG, Araújo MSS, Béla SR, Teixeira-
Carvalho A, Martins-Filho OA, Vasconcelos PF da C (2014) Callithrix penicillata: A
feasible experimental model for dengue virus infection. Immunol Lett 158:126–133.
doi: 10.1016/j.imlet.2013.12.008

Figueiredo LTM (1999) Vírus brasileiros da família Bunyaviridae. Med Ribeiräo Preto
32:154–8.

Figueiredo LTM (2015) The recent arbovirus disease epidemic in Brazil. Rev Soc Bras Med
Trop 48:233–234. doi: 10.1590/0037-8682-0179-2015

Gilmore DP, Da Costa CP, Duarte DP (2001) Sloth biology: an update on their physiological
ecology, behavior and role as vectors of arthropods and arboviruses. Braz J Med Biol
Res Rev Bras Pesqui Medicas E Biol 34:9–25.

Gyawali N, Bradbury RS, Taylor-Robinson AW (2016) The global spread of Zika virus: is
public and media concern justified in regions currently unaffected? Infect Dis Poverty
5:37. doi: 10.1186/s40249-016-0132-y

Hanley KA, Monath TP, Weaver SC, Rossi SL, Richman RL, Vasilakis N (2013) Fever
versus Fever: the role of host and vector susceptibility and interspecific competition in
shaping the current and future distributions of the sylvatic cycles of dengue virus and
yellow fever virus. Infect Genet Evol J Mol Epidemiol Evol Genet Infect Dis 0:292–
311. doi: 10.1016/j.meegid.2013.03.008

Hayes EB (2009) Zika Virus Outside Africa. Emerg Infect Dis 15:1347–1350. doi:
10.3201/eid1509.090442

Heymann DL, Hodgson A, Sall AA, Freedman DO, Staples JE, Althabe F, Baruah K,
Mahmud G, Kandun N, Vasconcelos PFC, Bino S, Menon KU (2016) Zika virus and
microcephaly: why is this situation a PHEIC? Lancet Lond Engl 387:719–721. doi:
10.1016/S0140-6736(16)00320-2

Jansen AM, Xavier SCC, Roque ALR (2015) The multiple and complex and changeable
scenarios of the Trypanosoma cruzi transmission cycle in the sylvatic environment.
Acta Trop 151:1–15. doi: 10.1016/j.actatropica.2015.07.018

Kading RC, Borland EM, Cranfield M, Powers AM (2013) Prevalence of antibodies to

alphaviruses and flaviviruses in free-ranging game animals and nonhuman primates in
the greater Congo basin. J Wildl Dis 49:587–599. doi: 10.7589/2012-08-212
 99

Kilbourn AM, Karesh WB, Wolfe ND, Bosi EJ, Cook RA, Andau M (2003) Health
evaluation of free-ranging and semi-captive orangutans (Pongo pygmaeus pygmaeus)
in Sabah, Malaysia. J Wildl Dis 39:73–83. doi: 10.7589/0090-3558-39.1.73

Kobayashi Y, Sugimoto K, Mochizuki N, Segawa T, Itou T, Carvalho AAB, Nociti DP,

Mello RM, Santos AKRA, Ito FH, Sakai T (2013) Isolation of a phylogenetically
distinct rabies virus from a tufted capuchin monkey (Cebus apella) in Brazil. Virus
Res 178:535–538. doi: 10.1016/j.virusres.2013.09.020

Lara-Ruiz P, Chiarello AG (2005) Life-history traits and sexual dimorphism of the Atlantic
forest maned sloth <span class=“italic”>Bradypus torquatus</span> (Xenarthra:
Bradypodidae). J Zool 267:63–73. doi: 10.1017/S0952836905007259

Laroque PO, Valença-Montenegro MM, Ferreira DRA, Chiang JO, Cordeiro MT,
Vasconcelos PFC, Silva JCR (2014) Epidemiologic survey for arbovirus in galician
capuchin monkeys (Cebus flavius) free living in Paraíba and captive capuchin monkey
(Cebus libidinosus) from northeast Brazil. Pesqui Veterinária Bras 34:462–468. doi:
10.1590/S0100-736X2014000500013

Lawrence D, Brown, T, Tony Cai, Anirban DasGupta (2001) Interval Estimation for a
Binomial Proportion. In: Statistical Science ., 2 (may, 2001). pp 101–117

Lima MA, Romano-Lieber NS, Duarte AMR de C (2010) Circulation of antibodies against
yellow fever virus in a simian population in the area of Porto Primavera Hydroelectric
Plant, São Paulo, Brazil. Rev Inst Med Trop São Paulo 52:11–16. doi: 10.1590/S0036-
46652010000100002

Mb P, A R, Rocha TC da, Cg E, Silva MAN da, Ks W, N J, Gr S, Oc J, Fern P, Vasconcelos

o da C (2015) Serosurvey of Arbovirus in Free-Living Non-Human Primates (Sapajus
Spp.) in Brazil. J Environ Anal Chem. doi: 10.4172/2380-2391.1000155

Medlin S, Deardorff ER, Hanley CS, Vergneau-Grosset C, Siudak-Campfield A, Dallwig R,

Travassos da Rosa A, Tesh RB, Pia Martin M, Weaver SC, Vaughan C, Ramirez O,
Sladky KK, Paul-Murphy J (2016) SEROSURVEY OF SELECTED ARBOVIRAL
PATHOGENS IN FREE-RANGING, TWO-TOED SLOTHS (CHOLOEPUS
HOFFMANNI) AND THREE-TOED SLOTHS (BRADYPUS VARIEGATUS) IN
COSTA RICA, 2005–07. J Wildl Dis 52:883–892. doi: 10.7589/2015-02-040

Melo PRS de, Reis EAG, Ciuffo IA, Góes M, Blanton RE, Reis MG dos (2007) The
dynamics of dengue virus serotype 3 introduction and dispersion in the state of Bahia,
Brazil. Mem Inst Oswaldo Cruz 102:905–912. doi: 10.1590/S0074-
02762007000800003

Melo MSS, Barreto FR, Costa M da CN, Morato VC, Teixeira MG (2010) Progression of
dengue virus circulation in the State of Bahia, Brazil, 1994-2000. Rev Soc Bras Med
Trop 43:139–144. doi: 10.1590/S0037-86822010000200007

Miller KE, Dietz JM (2006) Effects of Individual and Group Characteristics on Feeding
Behaviors in Wild Leontopithecus rosalia. Int J Primatol 26:1291–1319. doi:
10.1007/s10764-005-8854-7
 100

Brasil. Ministério da Saúde (2017) Febre Amarela - Informação e orientação. In: Portal Saúde
– Minist. Saúde – Wwwsaudegovbr. http://portalsaude.saude.gov.br/index.php/o-
ministerio/principal/leia-mais-o-ministerio/619-secretaria-svs/l1-svs/27300-febre-
amarela-informacao-e-orientacao. Accessed 3 Mar 2017

Monath TP, Vasconcelos PFC (2015) Yellow fever. J Clin Virol 64:160–173. doi:
10.1016/j.jcv.2014.08.030

Moreira GV, Peixoto CMS, Ziccardi M, Oliveira RL, Castro MG, Dionisio DF, Pissinatti A.
Prevalência de Trypanosoma cruzi,Trypanosoma minasense e de anticorpos contra
arbovírus em primatas não humanos (Callithrichidae) em cativeiro. Rev Bras Med Vet
22:252–254.

Moreno ES, Spinola R, Tengan CH, Brasil RA, Siciliano MM, Coimbra TLM, Silveira VR,
Rocco IM, Bisordi I, Souza RP de, Petrella S, Pereira LE, Maeda AY, Silva FG da,
Suzuki A (2013) Yellow fever epizootics in non-human primates, São Paulo state,
Brazil, 2008-2009. Rev Inst Med Trop São Paulo 55:45–50. doi: 10.1590/S0036-
46652013000100008

Nakgoi K, Nitatpattana N, Wajjwalku W, Pongsopawijit P, Kaewchot S, Yoksan S, Siripolwat

V, Souris M, Gonzalez J-P (2014) Dengue, Japanese encephalitis and Chikungunya
virus antibody prevalence among captive monkey (Macaca nemestrina) colonies of
Northern Thailand. Am J Primatol 76:97–102. doi: 10.1002/ajp.22213

Oliveira LC, Neves LG, Raboy BE, Dietz JM (2011) Abundance of Jackfruit (Artocarpus
heterophyllus) Affects Group Characteristics and Use of Space by Golden-Headed
Lion Tamarins (Leontopithecus chrysomelas) in Cabruca Agroforest. Environ Manage
48:248–262. doi: 10.1007/s00267-010-9582-3

Oliver WLR, Santos IB (1991) Threatened endemic mammals of the Atlantic forest region of
south-east Brazil. Jersey Wildlife Preservation Trust

Omatsu T, Moi ML, Takasaki T, Nakamura S, Katakai Y, Tajima S, Ito M, Yoshida T, Saito
A, Akari H, Kurane I (2012) Changes in hematological and serum biochemical
parameters in common marmosets (Callithrix jacchus) after inoculation with dengue
virus. J Med Primatol 41:289–296. doi: 10.1111/j.1600-0684.2012.00552.x

Pautasso A, Desiato R, Bertolini S, Vitale N, Radaelli M c., Mancini M, Rizzo F, Mosca A,

Calzolari M, Prearo M, Mandola M l., Maurella C, Mignone W, Chiavacci L,
Casalone C (2013) Mosquito Surveillance in Northwestern Italy to Monitor the
Occurrence of Tropical Vector-Borne Diseases. Transbound Emerg Dis 60:154–161.
doi: 10.1111/tbed.12123

Pereira LE, Suzuki A, Coimbra TLM, Souza RP de, Chamelet ELB (2001) Ilheus arbovirus in
wild birds (Sporophila caerulescens and Molothrus bonariensis). Rev Saúde Pública
35:119–123. doi: 10.1590/S0034-89102001000200003

R Core team R: A language and environment for statistical computing. In: R Found. Stat.
Comput. Vienna Austria.

Reed, LJ, Muench, H (1938) A simple method of estimating fifty percent end points. Amer J
Hyg 27:493–497.
 101

Ribeiro MC, Metzger JP, Martensen AC, Ponzoni FJ, Hirota MM (2009) The Brazilian
Atlantic Forest: How much is left, and how is the remaining forest distributed?
Implications for conservation. Biol Conserv 142:1141–1153. doi:
10.1016/j.biocon.2009.02.021

Rocha TC da, Batista PM, Andreotti R, Bona ACD, Silva MAN da, Lange R, Svoboda WK,
Gomes EC, Rocha TC da, Batista PM, Andreotti R, Bona ACD, Silva MAN da, Lange
R, Svoboda WK, Gomes EC (2015) Evaluation of arboviruses of public health interest
in free-living non-human primates (Alouatta spp., Callithrix spp., Sapajus spp.) in
Brazil. Rev Soc Bras Med Trop 48:143–148. doi: 10.1590/0037-8682-0024-2015

Rodrigues SG, Oliva OP, Araujo FAA, Martins LC, Chiang JO, Henriques DF, Silva EVP da,
Rodrigues DSG, Prazeres A do SC dos, Tavares-Neto J, Vasconcelos PF da C (2010)
Epidemiologia do vírus da Encefalite de Saint Louis na Amazônia brasileira e no
Estado do Mato Grosso do Sul, Brasil: elevada prevalência de anticorpos em equinos.
Rev Pan-Amaz Saúde 1:81–86. doi: 10.5123/S2176-62232010000100012

Seymour C, Peralta PH, Montgomery GG (1983a) Serologic evidence of natural togavirus

infections in Panamanian sloths and other vertebrates. Am J Trop Med Hyg 32:854–
861.

Seymour C, Peralta PH, Montgomery GG (1983b) Viruses isolated from Panamanian sloths.
Am J Trop Med Hyg 32:1435–1444.

Sollberg I, Schiavetti A, Moraes MEB (2014) Agricultural management in the una’s wildlife
refuge: a perspective of conservation by agroforestry. Rev Árvore 38:241–250. doi:
10.1590/S0100-67622014000200004

Svoboda WK, Martins LC, Malanski L de S, Shiozawa MM, Spohr KAH, Hilst CLS, Aguiar
LM, Ludwig G, Passos F de C, Silva LR da, Headley SA, Navarro IT, Svoboda WK,
Martins LC, Malanski L de S, Shiozawa MM, Spohr KAH, Hilst CLS, Aguiar LM,
Ludwig G, Passos F de C, Silva LR da, Headley SA, Navarro IT (2014) Serological
evidence for Saint Louis encephalitis virus in free-ranging New World monkeys and
horses within the upper Paraná River basin region, Southern Brazil. Rev Soc Bras
Med Trop 47:280–286. doi: 10.1590/0037-8682-0083-2014

Tauro L, Marino B, Diaz LA, Lucca E, Gallozo D, Spinsanti L, Contigiani M (2012)

Serological detection of St. Louis encephalitis virus and West Nile virus in equines
from Santa Fe, Argentina. Mem Inst Oswaldo Cruz 107:553–556. doi: 10.1590/S0074-
02762012000400019

Tesh RB, Peralta PH, Johnson KM (1969) ECOLOGIC STUDIES OF VESICULAR

STOMATITIS VIRUSI. PREVALENCE OF INFECTION AMONG ANIMALS
AND HUMANS LIVING IN AN AREA OF ENDEMIC VSV ACTIVITY. Am J
Epidemiol 90:255–261. doi: 10.1093/oxfordjournals.aje.a121068

Thompson NN, Auguste AJ, Coombs D, Blitvich BJ, Carrington CVF, da Rosa APT, Wang
E, Chadee DD, Drebot MA, Tesh RB, Weaver SC, Adesiyun AA (2012) Serological
Evidence of Flaviviruses and Alphaviruses in Livestock and Wildlife in Trinidad.
Vector Borne Zoonotic Dis 12:969–978. doi: 10.1089/vbz.2012.0959
 102

Torsten Hothorn, Frank Bretz, Peter Westfall (2008) Simultaneous Inference in General
Parametric Models. Biom J 50:346–363.

Tranquilin MV, Lehmkuhl RC, Maron A, Silva LR da, Ziliotto L, Seki MC, Salomon GR,
Carrasco A de OT, Tranquilin MV, Lehmkuhl RC, Maron A, Silva LR da, Ziliotto L,
Seki MC, Salomon GR, Carrasco A de OT (2013) First report of yellow fever virus in
non-human primates in the State of Parana, Brazil. Rev Soc Bras Med Trop 46:522–
524. doi: 10.1590/0037-8682-0106-2013

Vasconcelos PF da C (2010) Yellow fever in Brazil: thoughts and hypotheses on the

emergence in previously free areas. Rev Saúde Pública 44:1144–1149. doi:
10.1590/S0034-89102010005000046

Vasconcelos PFC, Calisher CH (2016) Emergence of Human Arboviral Diseases in the

Americas, 2000-2016. Vector Borne Zoonotic Dis Larchmt N 16:295–301. doi:
10.1089/vbz.2016.1952

Vasconcelos PFC, Rosa T da, A AP, Rodrigues SG, Rosa T da, S E, Dégallier N, Rosa T da,
S JF (2001) Inadequate management of natural ecosystem in the Brazilian Amazon
region results in the emergence and reemergence of arboviruses. Cad Saúde Pública
17:S155–S164. doi: 10.1590/S0102-311X2001000700025

Vaz Mamíferos colecionados pelo Serviço de Estudos e Pesquisas sobre a Febre Amarela nos
municípios de Ilhéus e Buerarema, estado da Bahia, Brasil. Arq Mus Nac 63:21–28.

Vorou R (2016) Zika virus, vectors, reservoirs, amplifying hosts, and their potential to spread
worldwide: what we know and what we should investigate urgently. Int J Infect Dis
IJID Off Publ Int Soc Infect Dis 48:85–90. doi: 10.1016/j.ijid.2016.05.014

Weaver SC (2013) Urbanization and geographic expansion of zoonotic arboviral diseases:

mechanisms and potential strategies for prevention. Trends Microbiol 21:360–363.
doi: 10.1016/j.tim.2013.03.003

Weaver SC, Reisen WK (2010) Present and future arboviral threats. Antiviral Res 85:328–
345. doi: 10.1016/j.antiviral.2009.10.008

Zarnke RL, Calisher CH, Kerschner J (1983) Serologic evidence of arbovirus infections in
humans and wild animals in Alaska. J Wildl Dis 19:175–179.
 103

Table 1. Antibodies Prevalence against arbovirus in sera from wild animals detected by the hemagglutination inhibition test, with the results
grouped by sex, age and species, during 2006-2014 at the Southern Atlantic Forest of Bahia state, Brazil.

Host Species

Sapajus
Bradypus torquatus Bradypus variegatus Leontopithecus chrysomelas xanthosthernos

Variables N* Prevalence (CI)** N Prevalence (CI) N Prevalence (CI) N Prevalence (CI)

Sex

Male 11 0.455 (0.213-0.72) 5 0.4 (0.118-0.769) 62 0.371 (0.262-0.495) 4 0 (0-0.49)

Female 11 0.545 (0.28-0.787) 2 0.5 (0.095-0.905) 41 0.268 (0.157-0.419) 3 0.333 (0.061-0.79)

Age

non-adult 10 0.4 (0.168-0.687) 1 (0-0.793) 35 0.258(0.141-0.42) 3 (0-0.56)

Adult 12 0.583 (0.319-0.807) 6 0.5 (0.188-0.81) 68 0.367 (0.263-0.486) 4 0.25 (0.045-0.697)

Overall prevalence 22 0.5 (0.307-0.693) 7 0.43 (0.158-0.75) 103 0.33 (0.247-0.426) 7 0.14 (0.026-0.513)

*N= Number of samples; **Confidence intervals

 104

Table 2. Panel with the genera and species of arbovirus tested using the hemagglutination
inhibition and neutralization tests for blood samples collected from wild animals during 2006
to 2014

Genera Species virus Strain virus

Alphavirus Eastern equine encephalitis virus (EEEV) AN 7526
Western equine encephalitis virus (WEEV) AN70100
Mayaro virus (MAYV) AR20290
Mucambo virus (MUCV) AN10967
Chikungunya virus (CHIKV)
Flavivirus Yellow fever virus (YFV) H111
Ilheus virus (ILHV) H7445
West Nile virus (WNV)
Zika virus (ZIKV) SP0143
Saint Louis Encephalitis virus (SLEV) AR23379
Cacicapore virus (CPCV) AR327600
Bussuquara virus (BSQV) AN4116
Dengue Sorotypes 1,2,3 and 4 (DENV 1-
4)
Rocio virus ROCV H34675
Utinga virus (UTIV) AN84785
Orthobunyavirus Belem virus (BELV) AN141106
Caraparu virus (CARV) AN3994
Catu virus (CATUV) H151
Guaroa virus (GROV) H22063
Maguari virus (MGAV) AR7272
Tacaiuma virus (TCMV) AN73
Oropouche virus (OROV) AN19991
Phlebovirus Icoaraci virus (ICOV) AN24262
 105

Table 3. Number of primates and sloths positive samples with antibodies according to the titers
by the hemagglutination inhibition test, 2006-2014 from the Atlantic Forest of Bahia state,
Brazil.

Positive
Virus (N*) Titers (IH)

1:20* 1:40* 1:80* 1:160* 1:320*

TCMV 1 1/0 - - - -

ILHV 22/2 19/1 2/1 1 - -

YFV 4/0 2/0 - - - -

ICOV 6/3 4/1 0/1 1/1 - 0/1

UTIV 0/1 0/1 - - - -

SLEV 7/0 2/0 4/0 1/0 - -

CPCV 4/0 4/0 1/0 1/0 - 0/1

BSQV 5/1 3/0 1/1 1/0 - -

ROCV 8/2 6/0 1/0 0/1 0/1 1/0

BELV 1/1 1/1 - - - -

CARV 0/4 0/2 0/1 - 0/1 -

DENV 1 9/2 6/2 2/0 1/0 - -

DENV 2 17/5 10/2 6/3 1/0 - -

DENV 3 1/5 0/1 1/4 - - -

DENV 4 4/2 - 4/2 - - -

ZIKV 4/0 4/0 2/0 - - -

*The number before “/” correspond to the number of primates positive samples and the number
after “/”correspond to sloths positive samples.
 106

Table 4. Monotypic reactions according to the host species and virus species during an
arbovirus serum survey in Southern Bahia, Brazil 2006-2014.

Virus genera Virus Host species

species
L. chrysomelas S. xanthosthernos B. torquatus

Alphavirus EEEV - - 1

Flavivirus ILHV 6 - -

ROCV 1 1 -

CPCV 1 - -

DENV-1 1 - -

DENV-2 7 - -

DENV-3 - - 2

YFV 2 - -

Orthobunyavirus CARV - - 4

UTIV - - 1

TCMV 1 - -

Phlebovirus ICOV 7 - -

Table 5. Neutralization test results according to the host species, virus genera and virus species
during an arbovirus surveillance during 2006-2014 in Southern Bahia, Brazil.

ID Host Species Virus Genera Virus Species LNI*

GHLT5194 L. chrysomelas Phlebovirus Icoaraci 2,4

GHLT5098 L. chrysomelas Flavivirus Saint Louis 2,9

GHLT35069 L. chrysomelas Flavivirus Bussuquara 1,9

GHLT5120 L. chrysomelas Flavivirus Ilhéus 1,7

GHLT5194 L. chrysomelas Flavivirus Ilhéus 1,7

LNI: logarithmic neutralization index

 107

Figure 1: Study sites where the animals were captured: Ilhéus city (on the top) and Una city
(on the bottom)
 108

Figure 2. Patterns of arbovirus prevalence at genus (A to C) and species (D to F) level for

viruses found in wildlife in Bahia, Brazil. Prevalences are presented for all hosts captures (first
column), but also separately for L. chrysomelas and B. torquatus (middle and last column,
respectively). Lines show 95% intervals estimated using the Wilson method (see Methods for
more details).
 109

Figure 3: Differences in prevalence among host species (BTOR- B. torquatus and LCHR- L.
chrysomelas) and age level for viruses found in wildlife in Bahia, Brazil, during 2006-2014.
 110

Figure 4. Differences in sero-prevalence patterns (virus species composition) among host

species. A) Distribution of host individuals across two axes derived from non-metric
multidimensional scaling ordination. Each axis summarizes variation in the virus species
composition (sero-prevalence) among hosts. Grey circles represent L. chrysomelas; white
circles B. torquatus. Dots in the center of circles mark adult individuals. B) There were
significant differences in values of composition axis 2 between host species, indicating that,
despite some overlap, species of virus found infecting wildlife vary among host species (see
also Figure 2).
 111

APÊNDICE B:

CATENACCI, L. S.; FERREIRA, M. S.; FERNANDES, D. D. C.; TRAVASSOS DA ROSA,

E. S.; DEEM, S. L.; VASCONCELOS, P. F. C. Risk factors associates with arboviruses in rural
population of Bahia, Brazil. (A ser submetido para Emerging Infectious Diseases)
 112

Risk factors associates with arboviruses in rural population of Bahia, Brazil

Lilian Catenacci*, Milene Ferreira, Debora Fernandes, Hannah Padda, Elizabeth

Travassos da Rosa, Sharon Deem, Pedro Vasconcelos and Livia Martins

Author afilliations: Federal University of Piauí State, Bom Jesus, Piauí, Brazil (L. Catenacci);

Evandro Chagas Institute, Anannindeua, Pará, Brazil (L. Catenacci, M. Ferreira, D.

Fernandes, E. Travassos da Rosa, P. Vasconcelos, L. Martins); Washington University in St.

Louis, St. Louis, Missouri, USA (Hannah Padda), Saint Louis Zoo, Saint Louis, Missouri,

USA (Sharon Deem).

*Address for correspondence: Federal University of Piauí State, Bom Jesus, 64900-000/PI,

Brazil, catenacci@ufpi.edu.br, +55(89) 99900-1212.

Article summary line: The high prevalence of Flavivirus antibodies suggest viral circulation

in rural communities. The presence of fragments of forest and the presence of free-living

monkeys close to the areas where people lived had a protective effect for arbovirus infection

in the rural communities studied,

Abstract

Landscape change has been proposed as the foremost driver of the emergence of diseases.

Exploring demographic, household and environmental conditions under which infectious

diseases occur may inform prevention strategies of disease emergence in human populations.

To explore factors facilitating arbovirus emergence in rural and sylvatic areas, we developed a

study investigating arbovirus in rural communities at Southern Bahia, Brazil, in 2014. 523

individuals were sampled and epidemiological formulary applied. The overall

serumprevalence of arboviruses in the rural population was 65.2%, with Flavivirus genus with

the highest value (64.4%). The symptoms most commonly reported were headaches, muscles

pains, epigastric pains, fever and coryza. Taking a count of the monotypic reactions, the

population had contact with five arbovírus: Dengue 3, Ilheus, Oropouche, Caraparu and East
 113

equine encephalitis virus. The best model fit showed that household and environmental

predictors represent more risk of having arbovirus than demographic variables. The presence

of close forest and the presence of free-living monkeys in the areas studied had a protective

effect for the human population. The dilution effect could be one mechanism explaining these

results. These results highlight the important ecological role of wildlife-friendly agriculture.

Further studies in other areas should be done to emphasize these findings.

Key words: arbovirus; immunoglobulin G; seroepidemiologic studies; dilution effect;

Flavivirus; predictors; Atlantic Forest

The transmission of arboviruses is a major risk factor for the introduction of emerging

diseases in different regions around the world (1–3). Brazil has been in the spotlight for

arbovirus transmission, having the higher number of arboviruses identified globally (4).

Arboviruses are maintained in nature due to the biological transmission of an infected

vertebrate host to another through hematophagous arthropods and, with few exceptions, are

etiological agents of zoonoses that depend on animal species other than humans for

maintenance in nature (5). Since 2014, Brazil has experienced Dengue (DENV), Chikungunya

(CHIKV) and Zika virus (ZIKV) outbreaks (6–9). Autochthonous arboviruses are in

circulation there and non-autochthonous arboviruses had entered and spread via mosquitoes,

the movements of infected animals, or infected humans (1,10). Most of the arboviruses have a

sylvatic cycle dominant. However, Oropouche (OROV) and Mayaro virus (MAYV), have

been identified in humans in urban and rural areas of the country (11,12). Additionally, in

2017, the biggest sylvatic yellow fever outbreaks in Latin America have been occurring in all

regions of Brazil, with 792 confirmed human cases and 642 epizootic cases already reported

(13).
 114

Bahia state, located in the northeast of Brazil has an historical role in arboviruses. Both

CHIKV and ZIKV were first detected in Brazil, in May 2014 and March 2015, respectively

(6,14). Dengue control also is a big challenge in this state(15–17). However, few

seroprevalence studies about arbovirus have been conducted in rural areas or communities

that live close to reserves and protected natural areas (16,18,19).

Several risk factors, including age, gender, occupation, country or region of residence,

household educational level, and access to the forest, have been associated with an increased

arbovirus seropositive rate (20,21). The analysis of risk factors for the acquisition of arbovirus

infection would be helpful to identify susceptible populations (21,22). The identification of

susceptible populations is also important because clinical diagnosis is difficult, especially

where co-circulation of other arbovirus such as DENV and ZIKV viruses occurs (7). In

addition, as sequential arboviral infections, and even co-infections could play a role in severe

clinical manifestations, there is a need for a better understanding of multiple arboviruses

transmission dynamics (7).

Vaccination, along with other public health measures, greatly reduced the burden of many

infectious diseases in the modern era (23). However, for arboviruses, there are currently no

vaccines, execpeted for the YFV vaccine and the failure of chemical and biological vector

controls makes observational epidemiological studies fundamental to acquiring knowledge on

the transmission of arbovirus in complex environments (24,25).

With the aim of obtaining data about the circulation of both known and unknown arboviruses,

a multidisciplinary study was conducted across rural and protected natural areas in Southern

Bahia Atlantic Forest. Since 2006, wild mammals and the entomofauna have been monitored

as part of ecological and health studies, within the framework of general arbovirus

transmission. The results found on wildlife and vectors research (26,27) motivated the Federal

and Bahia State Health Department to conducted a human survey in all the rural communities
 115

that lived close where the animals and arthropods were captured. In this article, we present the

results found about the arbovirus seropositive rate in humans. Furthermore, we identified the

associated demographic, the environment and lifestyle risk factors which could increase the

transmission of arbovirus in rural communities in the Bahia State, Brazil.

Material and Methods

Field study

A cross-sectional survey was conducted from September 17 - 28, 2014. Households in the

study area were visited by the field team (nurses, veterinarian, research assistant, and park

guard) during this time. In one of the communities visited, a physician was also present. The

goals were explained to each family prior to survey administration, and written informed

consent obtained, either from the individual or a legal guardian. The following procedures

were also performed: (a) application of an extensive questionnaire to obtain potential risk

factors, as demographic, prior disease and symptoms history data and a detailed description of

the households and the environment (Figure 2), (b) collection of venous blood samples from

the household members, (c) determination of the household’s exact location and the

communities using portable navigation equipment (eTrex®, Garmin International, Olathe,

USA), with an accuracy of 15 meters. The occupation and level of education were used as a

proxy for household income to assess socioeconomic status of the population.

We selected 11 rural communities, in the municipalities of Ilhéus and Una, belonging to the

Southern Bahia Atlantic Forest domain, Brazil (Figure 1). Those communities were grouped

in: Cocoa farms next to Castelo Novo village, Castelo Novo village, Cocoa farms next to

Lagoa Encantada village, Colônia de Una village, Lagoa Encantada village, Ribeira das

Pedras village, Família Brasil village, Una Biological Reserve (REBIO-UNA) and Una

Biological Wildlife Refuge (REVIS) (Figure 2). Rural populations were selected based on the

proximity to areas where wild mammals and the entomofauna have been monitored as part of

ecological and arbovirus studies (26,27). Briefly, across the region, the Native Atlantic Forest
 116

is highly fragmented, and embedded within an agricultural matrix dominated by cacao

agroforestry systems, and plantations of rubber tree, coconut, banana and cassava. The region

also contains the Una Biological Reserve and its Buffer Zone, the REVIS (28,29). REBIO has

the highest level of law protection and was created to be a woodland for protecting the

biodiversity. The REVIS-UNA is a reserve when fragments of forest connect the agroforestry

systems and the households. The Lagoa Encantada village is at the border of a 6,4km2

diameter lake.

A total of 49 taxa of insects were found in and surrounding these rural communities, including

the vectors from the Sabethini tribe and the Haemagogus and Aedes genera. The serum

prevalence of arbovirus in free-living monkeys and sloths of this region raised to 26%, with

Flavivirus genus the most dominant.

Sample Taking

Every household had at least one sample collected and the maximun of three people/

household. The blood was collected in people over two years old. Nurses collected at least 8

ml of blood in ten ml empty tubes without anti-coagulant. If the patient’s answers from the

questionnaire indicated recent symptoms compatible with arbovirus (fever, headache,

exanthema, chill, dizziness, photophobia, nausea, vomit, epigastric pain, muscle pain,

cutaneous congestion, conjunctival congestion, jaundice, coma, coryza), an extra two ml of

blood were collected and stored in liquid nitrogen immediately following collection. The

samples were taken by radioulnar venipuncture after antisepsis of the area with isopropyl

alcohol. The collected blood samples were identified with numbers corresponding to the

questionnaire applied to each subject; those contained in tube without anti-coagulant were

centrifugated at 3,500 rpm for 10 minutes at the field lab in order to obtain the serum for the

serological tests.(23) The serum samples were transported in liquid nitrogen to the State’s

Central Laboratory of Public Health (LACEN-BA) in Salvador, Bahia. In that lab, the
 117

samples were stored in -80oC until shipping in dry ice by airplane to Division of Arbovirology

and Hemorrhagic Fevers at Evandro Chagas Institute (SAARB-IEC) in Belém, Brazil.

Investigation of arbovirus antibodies

All serological assays were performed at the SAARB-IEC. The samples were submitted to

microplate hemagglutination inhibition (HI) against standardized antigens from 19 types of

arbovirus, including five from genus Alphavirus: Eastern Equine Encephalitis virus (EEEV),

Western Equine Encephalitis virus (WEE), Mayaro virus (MAYV), Chikungunya virus

(CHIKV), and Mucambo virus (MUCV); ten from genus Flavivirus: wild Yellow Fever virus

(YFV),vaccinal Yellow Fever virus (17D), Ilheus virus (ILH), Saint Louis virus (SLEV),

Rocio virus (ROCV), West Nile virus (WNV), Dengue virus (DENV- 1, DENV-2, DENV-3,

and DENV-4); and four from genus Orthobunyavirus: Caraparu virus (CARV), Catu virus

(CATUV), Oropouche virus (OROV), and Tacaiuma virus (TCMV). All the procedures were

followed according to Clarke & Casals (1958) and Shope (1963).

Serological response to arboviruses is difficult to differs between the first infection and any

subsequent infection with another serotype belong to the same genus, once they show an

increasingly strong response on subsequent infection and also serological cross-reaction is

frequently observed (16). Thus, the criterion adopted was that defined by World Health

Organization (1997) and used for previous studies: titres by HI of 1:20 or higher, exclusively

to a specific serotype (i.e. monotipic reaction), or titres four times higher for one serotype than

for another (i.e. heterotipic reaction) were considered positive and specific for that serotype

(16,30) .

Viral isolation

All patients that reported any acute symptoms such as fever, headaches, rashes, migraine and

other listed in the questionnaire for up to five days onset of symptoms were blood collected to

investigate viral isolation. A total of 200 microliters of the mixture containing 100 microliters
 118

of the patient’s total blood add to 900 microliters of antibiotics were inoculated into the brains

of six newborn mice for approximately 21 days for signs of encephalitis (31). Diseased mice

were stored at -80oC.

Statistical analysis

The data were analyzed with the SPSS Statistics, version 17.0 (2008 SPSS Inc, Chicago, IL,

USA). Continuous variables were compared by the chi-square analysis, when appropriate.

Categorical variables were given as percentage (n/N) and compared with a Pearson chi-square

test.

The overall seropositve rates were calculated. The difference in the seropositive rate between

groups was analyzed with a chi-square analysis. Univariate logistic regression was initially

performed to explore potential risk factors associated with the seropositive rate (23). A

multivariate logistic regression model was run, adjusting for age and demographic

characteristic, to establish the independent role of risk factors on the arbovirus seropositive

rate (Figure 3). Level 1 deals with factors that are more proximal to the

individual/demographic (age, gender, education level and occupation); the second level

concerns factors related to the household (presence of pet and domestic animals, time of

residency, residence type, the presence of bats close to their places, type of vegetation close to

the house, past history as a farmer, presence of free living monkeys; level 3 was related to

more distal factors concerning the sentinel area/environment (municipalities and type of rural

communities) (Figure 3). The selection of the best model was based mainly on theoretical

reasons related to the construction of the question under investigation and according to the

statistical criteria of the multilevel logistic model (22). The strength of association was

estimated by calculating the odds ratio with the 95% confidence interval. P value < 0.05 was

considered to be significant.
 119

Ethical aspects

The research protocol was analyzed and approved by the Research Ethics Committee for

Experimentation in Human Beings (under number 35073014.3.0000.0019) and the CEUA

(under number 33/2014) at the Evandro Chagas Institute.

Results

Prevalence of arbovirus antibodies

Of the 523 individuals eligible for venous blood sampling in Una (n=221) and Ilhéus (n=302)

rural communities, all were tested for 19 antibodies to the different types of arbovirus using

HI test. In addition to these tests, the viral detection was tested in 34 patients who had acute

symptoms up to five days onset of symptoms. However, no viral detection was found in these

34 samples tested.

The overall arbovirus seroprevalence was 65.2% (n=341) (Figure 4) and no difference was

found between the municipalities (p=0.594) (Figure 5). Considering Ilhéus rural communities,

the seroprevalence reached 66.6% (n=203), while Una had 63.3% of positive samples for

arbovirus (n=138). In both municipalities, the Flavivirus genus showed the highest prevalence

(64.4%, n=337) with titers from 20 to 1280, followed by the Orthobunyavirus (2.7%, n=14)

with titers from 20 to 80 and the Alphavirus (1%, n=5) with titers from 20 to 80 (Figure 4).

Most of the samples had heterotypic reactions (i.e., antibodies for more than one type of virus

from the same genus). Three individuals showed titers four times higher for Dengue virus

serotype 3 (DENV-3) (titers 1:320 and 1:1280), two for Ilheus virus (ILHV) (titer 1:1280) and

one for Eastern equine encephalomyelitis virus (EEEV) (titer 1:160).

Of the total positive samples, 16 (4.7%) presented monotypic reactions (i.e., antibodies to a

single type of virus from this genus), with the antibodies against the Ilheus (titers of 1:20 and

1:80, n=2), Eastern equine encephalomyelitis (titers of 1:20 and 1:80, n=2), Oropouche

(OROV)(titers of 1:20) and Caraparu (CARV) virus (titers of 1:20 and 1:40).
 120

In the DENV-3 cases, all them born on the place, lived close to plantations and have no used

to go to the forest. One of them are fishman and two of them are students. The students

belonged to Castelo Novo village and the fishman in from the Ribeira das Pedras village.

While child has no symptoms, the teenager showed epigastric pain and the adult presented

muscle pains, dizziness and chill. In the Ilheus virus cases, two individuals belonged to the

same family, lived in the Castelo Novo community, were students, and one of them used to go

into the forest following her grandma activities. The other positive is a farmer from the Cocoa

farm close to Castelo Novo communitiy. One female, positive for ILHV was from the REVIS

community and reported to work as a housewife and were note used to get into to the forest.

Three individuals tested positive for the presence of the EEEV antibodies. One of them was a

female student who used to go to the forest and worked on cacao plantations but moved to the

REVIS three years before the sampling. The other person, an adult male, was born and lived

in the Lagoa Encantada community, worked as a fisherman, used to go to the forest and never

presented any arbovirus symptoms. The last one positive for EEV is from the Cocia farm

close to Castelo Novo, housewife and her house it was located close to the agroforestry

plantation and to a river; she also never presented any symptons to arbovirus. The CARV

antibodies were present in six adult individuals, four of which lived inside of the REVIS. Five

of them were farmers, used to go inside to the forest, and had seen bats close to their places.

Two of them were born inside of the REVIS. A total of six individuals showed antibodies for

the OROV. All of them were from Una, three were living in Colônia de Una and three inside

of the REVIS. Five of them reported a history of going into the forest and to plantations. They

also reported bats and monkeys close to their houses.

Risk Factors

The prevalence of arbovirus among demographic characteristics is shown in Table 1.

Bivariate analysis shows a higher risk of arbovirus for adults and farmer, but these predictors

were not significant when added with other covariates. A multivariate logistic regression
 121

model was used to test whether there was a statistically significant model that could predict

the probability of testing positive for Arbovirus. For this model, only cases with complete

answers to the questions of interest were considered, and thus 98 cases were excluded, for a

sample size of 425. A step-wise logistic regression was performed. The first block in the

logistic regression model considered individual characteristics (Figure 3, level 1). There was a

statistically significant linear model that could predict the probability of testing positive for

Arbovirus based off age, gender, level of education, and occupation (p < .05, OR = 2.393).

The next block considered household characteristics (Figure 3, level 2), and after adjusting for

individual characteristics, the overall model was significant (p > .05). In this model, the

presence of free-living monkeys was a statistically significant predictor, and was associated

with decreased odds of testing positive for arbovirus (B = -.521, OR = .594, 95% CI = .354,

.996). Thus, the presence of free-living monkeys in the forest has a protective effect against

arbovirus transmission. The third block included environmental characteristics (Figure 3,

level 3). The overall model was insignificant, however, some of the predictor variables were

significant. Of the environmental risk factors evaluated in this study, the communities were

associated with the increase the risk to have arbovirus arbovirus. After adjusting for

individual and household characteristics, the large community of residence was a significant

predictor (p < .05). Living on a Cocoa Farm next to Castelo Novo and at Lagoa Encantada

were significant predictors and associated with increased odds of testing positive for arbovirus

(ORCocoa Farm next to Castelo Novo=4.294, 95% CI = 1.463, 12.607; OR Lagoa Encantada=3.383, 95% CI =

1.349, 8.485). Whether there were free-living monkeys in the forest was significant predictor,

which was associated with decreased odds of testing positive for arbovirus (B= -.616, OR =

.540, 95% CI = .312, .934). Additionally, having wildlife and other animals as domestic pets

was a significant predictor in this model, and was associated with a decreased odds of testing

positive for arbovirus (OR = .198, 95% CI = .043, .899).

 122

After reviewing these results, another multivariate logistic regression was performed. The

individual characteristics from the previous model were maintained and adjusted for, then

domestic animals adjusted for, and then the large community of residence and whether or not

there were free living monkeys assessed. Overall, there was not found a statistically

significant for this model, but individual predictors had statistical significance. Similar to the

previous model with all the risk factors of interest, there was statistical significance for the

large community of residence and whether or not there were free-living monkeys in the forest.

Significance increased for these variables from the previous model to this new model, and

free living monkeys in the forest maintained their protective effect (B = -.608, OR = 544, 95%

= .321, .925) (Table 2) while living on a Cocoa Farm next to Castelo Novo, living on a Cocoa

Farm next to Lagoa Encantada, and living at Lagoa Encantada were associated with increased

odds ORCocoa Farm next to Castelo Novo=3.893, 95% CI = 1.713, 8.847; ORCocoa Farm next to Lagoa

Encantada=2.921, 95% CI = 1.157, 7.376; OR Lagoa Encantada=2.833, 95% CI =1.217, 6.596) (Table

2). Thus, an individual’s community of residence was a good predictor of having arbovirus,

and the two communities on plantations were significantly associated with an increased risk

of having arbovirus, and while living in a forest had an insignificant association, there was

lower odds of having arbovirus for individuals living in and by forests.

Clinical history and previous diseases

A total of 63% (n=329) of the individuals presented antibodies against the Yellow fever

Vacinal strain 17D, although 37.5% (n= 196) reporting not having or not knowing if they had

received a yellow fever vaccine.

Only 29.8% (n=156) individuals from the total sampled reported having no symptoms

compatible with arbovirus. However, others 18.7% (n=98) reported experiencing more than

four symptoms up to three months sampled, followed by 15.1% (n=79) that presented with

only one symptom, 13.1% (n=69) that experienced three symptoms, 13% (n=68) with two

symptoms and 8% (n=42) with four symptoms. The symptoms most commonly reported were
 123

headaches (44.2% of the cases), muscles pains (36.2%), epigastric pains (28.5%), fever

(27.4%) and coryza (24.2%).

During the interview, 24.4% (n=154) subjects reported having had dengue in the past,

although only 53.9% of cases (n=83) were confirmed at a hospital or health clinic. From the

cases who reported having had dengue, 127 (82.4%) showed antibodies against Flavivirus and

114 (21.8%) reported any symptoms. The other reported diseases were leishmaniosis (n =27,

5.2%) and malaria (n = 1).

Discussion

Prevalence of arbovirus antibodies, virus isolations and risk factors

This surveillance study highlights the large Flavivirus serum prevalence, which indicates the

intense exposure and circulation of this genus among rural communities in Ilhéus and Una

(Figure 4). Previous studies in communities that lived in rural or natural areas in other regions

of Brazil showed lower (26.4%, 3,8%) overall prevalence compared to the present study

(18,32). The differences among the number of arboviruses tested, the characteristics of the

communities, climate and environment, and abundance and richness of mosquitoes and hosts

in those areas could explain the variation in the results (33).

Little research that has described risk factors associated with the arbovirus in sylvatic and

rural areas of Atlantic forest of Northeast of Brazil (15,32). Most information regarding risk

comes from studies performed in big cities (16,21,22,34), such the capital of Bahia state,

Salvador, where the lifestyle and habits are completely different.

We expected to find higher risk for arbovirus in male, adult, farmers with a low level of

education (Table 1). Using only univariate analysis, we found an increased arbovirus risk

depending on the occupation and the age; as previous studies reported (16,34). However, no

significant association was observed after adjusting for other covariates. These differences of

patterns among the studies could be associated with the characteristics of the communities and

difference of statistical analyses performed. Our results emphasize the importance of

 124

household and the environmental characteristics for increase the risk of the transmission of

arbovirus, more than individual/demographic information (Table 2). Nevertheless, this

socioeconomic data should not be ignored. Poor communities typically have environmental

characteristics that facilitate Aedes spp. and other sylvatic and peri-rural vector’s breeding,

including the presence of refuse deposits and containers for water storage (21). In several

settings, low socioeconomic status has been observed to impact dengue transmission and

transmission of other infectious diseases, emphasizing that the disease burden is likely to be

greatest in vulnerable populations, as we found in this study (21,30,35). The two positive

individuals with dengue serotype virus belonged to the largest rural villages, which may

justify this finding, due the poor sanitation conditions and lack of vector control activities.

Living in rural community dominated by agroforestry with only little remaining forest cover

(as Ilhéus) or next to a large lake seems to increase the risk of arbovirus transmission for local

people; when compared to living inside of the forest, or in cocoa landscapes with still a high

proportion of forest remnants (as in Una). After adjusting for demographic and household

characteristics, the odds of having arbovirus was 3.83 times higher for those that lived on a

Cocoa Farm next to Castelo Novo, 2.91 times higher for those that lived on a Cocoa Farm

next to Lagoa Encantada, and 2.83 times higher for those that lived in the Lagoa Encantada

village (Table 2). However, all the human communities that lived and had their agroforestry

systems inside of these two forest reserves, REBIO and REVIS (Una), were not more exposed

to arbovirus infectious. These federally protected areas associated with the agroforestry

mosaics maintain one of the highest biodiversity and the primary and secondary growth

forests fragments left in Southern Bahia (36–38); which could explain the lower odds of

having arbovirus in individuals living in these two sites. There is no doubt that the

combination of forest remnants with a matrix dominated by agroforestry and secondary

forests are fundamental for the maintenance of the rich biological communities (37).
 125

We observed high biodiversity having a protective effect against arbovirus; which could be

explained by the dilution effect. This concept describes how when biodiversity increases in an

area, the pathogens have to become more adapted and competent to infect wide potential hosts

and vectors and thus the probability of pathogens spreading the diseases on an epidemic scale

decreases. The fundamental principle underlying the dilution effect is that increased host

diversity can dilute disease incidence through multiple mechanisms(39–41). Such

mechanisms included in situations of increasing host diversity are: a reduction in the

probability of transmission of the disease from infected hosts to vectors (transmission

reduction), a reduction in the rate of encounters between hosts and infected vectors

(encounter reduction), a reduction in the number of susceptible hosts (susceptible host

regulation), a reduction in infected vector density (vector regulation), and a faster disease

recovery rate among infected hosts (recovery augmentation)(39,42). Thus, the larger number

of species of wild hosts(36–38), abundance and richness of vectors (36) and arbovirus

circulating in REBIO and REVIS communities might be capable to dilute the dispersion of

the arbovirus among wild animals and to decrease the transmission taxa for human

population.

Furthermore, the presence of free-living monkeys near the communities had a protective

effect against arbovirus transmission. These observations support the dilution effect concept,

as more wild hosts were available to be bitten and infected before humans. The dilution effect

concept has been used in models to predict the epidemiological dynamics of many infectious

disease, as the transmission of West Nile virus (40,42) and Oropouche virus (43). The

common challenge among these models is having enough eco-epidemiological data to

associate ecological factors with the incidence of diseases in human population (40,42,43).

We suggest future research using this dilution affect approach in the modelling to investigate

the eco-epidemiology of Yellow Fever and other arbovirus in rural and sylvatic areas. We also
 126

suggest the monitoring of the domestic animals to investigate if those animals could have a

protective effect as well against arbovirus transmission.

Furthermore, the presence of specific environmental characteristics, such as the large lake in

the Lagoa Encantada village (Figure 2), may facilitate both high population density for

humans and provides a breeding ground for mosquito populations. The cocoa farms plantation

close to Lagoa Encantada and close to Castelo Novo presented one of the highest relative

abundance of culicids when compared to the other communities (data no showed). The

increase in both human and mosquito populations in the Lagoa Encantada village may be

responsible for the high predicted levels of arbovirus infection in these three communities.

Clinical history and monotipic reactions

The low vaccination coverage for Yellow Fever in Ilheus and Una may be attributed to the

Brazilian National Program of Immunization’s mandates. Those municipalities were outside

of the risk zone, and thus YFV vacines are not required. In areas recommended for

vaccination, the coverage in rural communities raised 97.7%(9). Since humans are not the

sole reservoir of the YFV, sporadic introduction of the YFV into these human population and

sporadic cases of disease could have occurred. Due the presence of YFV antibodies in free-

living monkeys that live close to these areas (44), we suggest following the WHO’s

recommendations (2017): catch-up campaigns for vaccination in vulnerable populations,

outreach education and be alert to collect biological material from dead or seek free-living

monkeys (45).

A cross-sectional study and the one-time sample was collected for each subject. Combining

the antibody responses of this sampling with a six months later second-time sample, could be

helpful to determine at species level the arbovirus who the individuals were exposure.

However, taking in consideration monotypic reaction and the 4 four times high titer

conversion, we suggest the rural population already had contact for at least five arbovírus:

DENV-3, ILHV, EEEV, CAR and OROV. With exception of the Oropouche, all of them
 127

were found in previous wildlife surveillance studies in these areas (44). The free-living

primates Leontopithecus chrysomelas were found with antibodies against ILHV, while the

free-living sloths from the specie Bradypus torquatus were found with antibodies titers

against the other arbovirus (44). Furthermore, the main vectors responsible to transmit this

species of arbovirus also were captured close to the wildlife surveys (44,46). Thus, our results

suggest viral circulation between the wild animals and the rural communities.

Excepted from DENV-3 and sporadic cases of OROV in urban areas, all the other arbovirus

has a sylvatic and rural cycle as dominant (16); which corroborated our findings. According

to Ilhéus Health Services, DENV-3 was detected in 2002, one year later the introduction of

DENV-3 into Brazil (22). The found of OROV in the rural communities it is a concern, once

more than one half million persons have been infected with OROV, which makes this virus a

public health threat in tropical and subtropical areas of Central and South America. (47–49).

The illness was characterized by headache, fever, pain in the muscles, joints and back,

photophobia, retrobulbar pain, nausea and dizziness (50). And the recurrence of symptoms

was reported in 56% of sick people (51). It is possible that certain species of primates, sloths,

and wild birds can act as vertebrate hosts for the virus (49). Little is known, however, about

the forest vector of ORO virus (52). ILHV was discovered in Ilhéus city in 1944 and causes

similar symptoms as dengue in humans, and presently has been detected during several

human surveillance surveys in areas in Latin America (53,54). The wild birds are the main

reservoirs (55) for ILHV, although antibodies and viral isolation also occurs in non-human

primates (52). The EEEV patients often experience severe symptoms of disease including

high fever, headache, vomiting, general or focal seizures, focal weakness, cranial nerve

palsies, and coma; long-term neurological sequelae may persist in survivors (~25%) and can

include both motor and cognitive impairments. EEEV is also pathogenic for equines and can

produce mortality rates as high as 80–90% in horses (56); the possibility of viral circulation in
 128

the rural communities drivers the animal health concern, once most of the household keep

domestic animals, including equines in their lands. Eastern equine encephalitis virus (EEEV)

is a highly pathogenic mosquito-borne arbovirus, with active transmission foci in freshwater

hardwood swamps in eastern North America, where enzootic transmission is maintain

between the ornithophilic mosquito, Culiseta melanura, and wild passerine and migratory

birds (57). In Brazil, although eastern equine encephalitis virus (EEEV) has been identified in

vectors and antibodies are sometimes detected in horses and humans, there have been no

records of equine encephalitis in horses caused by this virus during the last 24 years (58) .

This study describes eighteen cases of eastern equine encephalomyelitis that occurred in six

Brazilian states between 2005 and 2009 (58). Patients with CARV antibodies presents as a

self-limited, dengue-like illness consisting of fever, headache, myalgia, nausea, vomiting,

weakness, etc., of 2 to 5 days in duration (59).

As dengue, other arboviruses usually present nonspecific clinical manifestations, and the

disease burden may have been underreported during interepidemic periods, especially in areas

with scarce access to health care. Symptoms were more frequently reported by people whose

HI was positive and corroborate with other arboviruses studies: fever, headache, chills,

dizziness, muscle and joint pains (34). In spite of the high incidence of antibodies prevalence,

no hemorrhagic cases were reported. The limited access to health clinic around the sites

studied could explain the low rate of dengue cases with confirmed diagnostic (21).

Landscape perturbation has been proposed previously one of the drivers of arboviruses

outbreaks. While some questions await further study, such as better understanding of hosts

and vectors for sylvatic arboviruses, some lessons clearly emerge from the existing evidence.

The replacement of agroforests by other land uses, the establishment of new plantations in

current forest lands and the decrease of connectivity between agroforestry system and
 129

fragments of forest seems important threats for the health of the rural communities, once they

are losing biodiversity surroundings.

We suggest that the maintenance of patch of forests added to the dilution effect concept might

explain the less probability of transmission arbovirus for people living inside of the protect

areas. This context should be considered by those debating strategies to reconcile agricultural

production, conservation and health.

Furthermore, the high overall prevalence of arbovirus, mainly Flavivivirus genus and the

antibodies circulation of ILHV, DENV-3, OROV, CARV and EEEV in these areas highlights

the importance to more effectively monitor the emergence of this public health and animal

risk and design targeted surveillance and preventive measures.

Acknowledgments
The authors thank the important contributions of the Municipal and Bahia State Health
Department and the colleagues from the Evandro Chagas Institute for assistance with the
laboratory diagnostics and logistical support in the field. Additional thanks go to Project
BioBrasil/Centre for Research and Conservation, ICMBio and the Bicho-da mata NGO for their
logistical support and ICMBio for permits and help with logistics to conduct research in the
Una Biological Reserve. We also thank the sponsoring institutions that made this project
possible: Saint Louis Zoo WildCare Institute (USA), The Wild Animal Fund, from the
American Association of Zoological Veterinarians (USA), CNPq (Brasil), the Center for
Research and Conservation of the Royal Zoological Society of Antwerp (Belgium), Lion
Tamarins of Brazil Fund, National Lottery of Belgium, Primate Action Fund, Zoological
Society of London, Conservação Internacional, Fundação o Boticário de Proteção a Natureza.
The Flemish Ministry of Science (Belgium) provided structural support to the Center for
Research and Conservation of the Royal Zoological Society of Antwerp.

Author Bio
Lilian Silva Catenacci is a Brazilian veterinarian, professor of Clinical and Wildlife
Management at the Federal University of Piaui State in Brazil and also a PhD student in
virology at the Evandro Chagas Institute. Lilian's academic interests are in the fields of
conservation medicine, public health and wildlife veterinary medicine. Her ongoing research
 130

focuses on studying outbreaks of arbovirus infections in wildlife and human populations in

and around protected natural areas of north-eastern Brazil.

References
1. Aranda C, Sánchez-Seco MP, Cáceres F, Escosa R, Gálvez JC, Masià M, et al.
Detection and monitoring of mosquito flaviviruses in Spain between 2001 and 2005.
Vector Borne Zoonotic Dis Larchmt N. 2009 Apr;9(2):171–8.

2. Gould E, Pettersson J, Higgs S, Charrel R, de Lamballerie X. Emerging arboviruses:

Why today? One Health. 2017 Dec;4:1–13.

3. Weaver SC, Reisen WK. Present and future arboviral threats. Antiviral Res. 2010
Feb;85(2):328–45.

4. Figueiredo LTM, Figueiredo LTM. The recent arbovirus disease epidemic in Brazil.
Rev Soc Bras Med Trop. 2015 Jun;48(3):233–4.

5. Pauvolid-Corrêa A, Tavares FN, Costa EV da, Burlandy FM, Murta M, Pellegrin AO,
et al. Serologic evidence of the recent circulation of Saint Louis encephalitis virus and
high prevalence of equine encephalitis viruses in horses in the Nhecolândia sub-region
in South Pantanal, Central-West Brazil. Mem Inst Oswaldo Cruz. 2010
Sep;105(6):829–33.

6. Campos GC, Sardi SI, Sarno M, Brites C. Zika virus infection, a new public health
challenge. Braz J Infect Dis. 2016 May;20(3):227–8.

7. Cardoso CW, Kikuti M, Prates APPB, Paploski IAD, Tauro LB, Silva MMO, et al.
Unrecognized Emergence of Chikungunya Virus during a Zika Virus Outbreak in
Salvador, Brazil. PLoS Negl Trop Dis [Internet]. 2017 Jan 23 [cited 2017 Mar
8];11(1). Available from: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC5289630/

8. Monath TP, Vasconcelos PFC. Yellow fever. J Clin Virol. 2015 Mar 1;64:160–73.

9. Machado VW, Vasconcelos PF da C, Silva EVP, Santos JB. Serologic assessment of

yellow fever immunity in the rural population of a yellow fever-endemic area in
Central Brazil. Rev Soc Bras Med Trop. 2013 Apr;46(2):166–71.

10. Weaver SC. Urbanization and geographic expansion of zoonotic arboviral diseases:
mechanisms and potential strategies for prevention. Trends Microbiol. 2013
Aug;21(8):360–3.

11. Figueiredo MLG de, Figueiredo LTM, Figueiredo MLG de, Figueiredo LTM.
Emerging alphaviruses in the Americas: Chikungunya and Mayaro. Rev Soc Bras Med
Trop. 2014 Dec;47(6):677–83.
 131

12. Culquichicón C, Cardona-Ospina JA, Patiño-Barbosa AM, Rodriguez-Morales AJ.

Bibliometric analysis of Oropouche research: impact on the surveillance of emerging
arboviruses in Latin America. F1000Research. 2017;6:194.

13. Brasil. Boletim Informativo de Febre Amarela. Brasília,DF: Minstério da Saúde; 2017
p. 1–7.

14. Campos GS, Bandeira AC, Sardi SI. Zika Virus Outbreak, Bahia, Brazil. Emerg Infect
Dis. 2015 Oct;21(10):1885–6.

15. Saba H, Vale VC, Moret MA, Miranda JGV. Spatio-temporal correlation networks of
dengue in the state of Bahia. BMC Public Health [Internet]. 2014 Oct 18 [cited 2017
Mar 8];14. Available from: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4210607/

16. Vasconcelos PF da C, Mota K, Straatmann A, Torres S de MS, Rosa APAT da,

Tavares-Neto J. Epidemia de dengue em Ipupiara e Prado, Bahia. Inquérito soro-
epidemiológico. Revista da Sociedade Brasileira de Medicina Tropical [Internet]. 2000
[cited 2017 Jun 30]; Available from: http://repositorio.ufba.br/ri/handle/ri/2962

17. Campos GS, Pinho ACO, Brandão CJ de F, Bandeira AC, Sardi SI. Dengue virus 4
(DENV-4) re-emerges after 30 years in Brazil: cocirculation of DENV-2, DENV-3,
and DENV-4 in Bahia. Jpn J Infect Dis. 2015;68(1):45–9.

18. Romano-Lieber NS, Iversson LB. Serological survey on arbovirus infection in

residents of ecological reserve. Rev Saúde Pública. 2000 Jun;34(3):236–42.

19. Ferreira IB, Pereira LE, Rocco IM, Marti AT, Souza LTM de, Iversson LB.
Surveillance of arbovirus infections in the atlantic forest region, State of São Paulo,
Brazil: I. detection of hemagglutination-inhibition antibodies in wild birds between
1978 and 1990. Rev Inst Med Trop São Paulo. 1994 Jun;36(3):265–74.

20. Díaz LA, del Pilar Díaz M, Almirón WR, Contigiani MS. Infection by UNA virus
(Alphavirus; Togaviridae) and risk factor analysis in black howler monkeys (Alouatta
caraya) from Paraguay and Argentina. Trans R Soc Trop Med Hyg. 2007 Oct
1;101(10):1039–41.

21. Kikuti M, Cunha GM, Paploski IAD, Kasper AM, Silva MMO, Tavares AS, et al.
Spatial Distribution of Dengue in a Brazilian Urban Slum Setting: Role of
Socioeconomic Gradient in Disease Risk. PLoS Negl Trop Dis [Internet]. 2015 Jul 21
[cited 2017 Mar 8];9(7). Available from:
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4510880/

22. Teixeira MG, Morato V, Barreto FR, Mendes CMC, Barreto ML, Costa M da CN.
Risk factors for the incidence of dengue virus infection in preschool children. Trop
Med Int Health TM IH. 2012 Nov;17(11):1391–5.

23. Chen C-Y, Huang K-YA, Shen J-H, Tsao K-C, Huang Y-C. A Large-Scale
Seroprevalence of Epstein-Barr Virus in Taiwan. PLOS ONE. 2015 Jan
23;10(1):e0115836.

24. Silva-Nunes M da, Malafronte R dos S, Luz B de A, Souza EA de, Martins LC,
Rodrigues SG, et al. The Acre Project: the epidemiology of malaria and arthropod-
 132

borne virus infections in a rural Amazonian population. Cad Saúde Pública. 2006
Jun;22(6):1325–34.

25. Barreto FR, Teixeira MG, Costa M da CN, Carvalho MS, Barreto ML. Spread pattern
of the first dengue epidemic in the city of Salvador, Brazil. BMC Public Health. 2008
Feb 7;8:51.

26. Oliveira LC, Neves LG, Raboy BE, Dietz JM. Abundance of Jackfruit (Artocarpus
heterophyllus) Affects Group Characteristics and Use of Space by Golden-Headed
Lion Tamarins (Leontopithecus chrysomelas) in Cabruca Agroforest. Environ
Manage. 2011 Aug 1;48(2):248–62.

27. Catenacci LS, Pessoa MS, Nogueira-Filho SLG, Vleeschouwer KMD. Diet and
Feeding Behavior of Leontopithecus chrysomelas (Callitrichidae) in Degraded Areas
of the Atlantic Forest of South-Bahia, Brazil. Int J Primatol. 2016 Apr 1;37(2):136–57.

28. Alger K, Caldas M. The declining cocoa economy and the Atlantic Forest of Southern
Bahia, Brazil: Conservation attitudes of cocoa planters. Environmentalist. 1994 Jun
1;14(2):107–19.

29. Sollberg I, Schiavetti A, Moraes MEB. Agricultural management in the una’s wildlife
refuge: a perspective of conservation by agroforestry. Rev Árvore. 2014
Apr;38(2):241–50.

30. Teixeira MG, Costa MC, Barreto ML, Barreto FR. [Epidemiology of dengue in
Salvador-Bahia, 1995-1999]. Rev Soc Bras Med Trop. 2001 Jun;34(3):269–74.

31. Beaty, BJ, Calisher,CH, Shope, RE. Arboviruses. Diagn Proced Viral Ricketts
Chlamydial Infect. 1989;797–855.

32. Tavares-Neto J, Travassos da Rosa AP, Vasconcelos PF, Costa JM, Travassos da Rosa
JF, Marsden PD. [Research on antibodies to arbovirus in the serum of residents of the
village of Corte de Pedra, Valencia, Bahia]. Mem Inst Oswaldo Cruz. 1986
Dec;81(4):351–8.

33. Vasconcelos PFC, Rosa T da, A AP, Rodrigues SG, Rosa T da, S E, et al. Inadequate
management of natural ecosystem in the Brazilian Amazon region results in the
emergence and reemergence of arboviruses. Cad Saúde Pública. 2001;17:S155–64.

34. Vasconcelos PF da C, Lima JWO, Raposo ML, Rodrigues SG, Rosa JFST da, Amorim
SMC, et al. Inquérito soro-epidemiológico na Ilha de São Luis durante epidemia de
dengue no Maranhão. Rev Soc Bras Med Trop. 1999 Apr;32(2):171–9.

35. Santos JB, Lauand L, Souza GS de, Macêdo V de O. Socioeconomic factors and
attitudes towards household prevention of American cutaneous leishmaniasis in an
endemic area in southern Bahia, Brazil. Cad Saúde Pública. 2000 Sep;16(3):701–8.

36. Cassano CR, Silva RM, Mariano-Neto E, Schroth G, Faria D. Bat and bird exclusion
but not shade cover influence arthropod abundance and cocoa leaf consumption in
agroforestry landscape in northeast Brazil. Agric Ecosyst Environ. 2016 Sep
16;232:247–53.
 133

37. Cassano CR, Barlow J, Pardini R. Forest loss or management intensification?

Identifying causes of mammal decline in cacao agroforests. Biol Conserv. 2014
Jan;169:14–22.

38. Cassano CR, Kierulff MCM, Chiarello AG. The cacao agroforests of the Brazilian
Atlantic forest as habitat for the endangered maned sloth Bradypus torquatus. Mamm
Biol - Z Für Säugetierkd. 2011 May;76(3):243–50.

39. Keesing F, Holt RD, Ostfeld RS. Effects of species diversity on disease risk. Ecol
Lett. 2006 Apr;9(4):485–98.

40. Swaddle JP, Calos SE. Increased Avian Diversity Is Associated with Lower Incidence
of Human West Nile Infection: Observation of the Dilution Effect. PLOS ONE. 2008
Jun 25;3(6):e2488.

41. Johnson PTJ, Ostfeld RS, Keesing F. Frontiers in research on biodiversity and disease.
Ecol Lett. 2015 Oct;18(10):1119–33.

42. Tran A, L’Ambert G, Balança G, Pradier S, Grosbois V, Balenghien T, et al. An

Integrative Eco-Epidemiological Analysis of West Nile Virus Transmission.
EcoHealth. 2017 Jun 5;

43. Romero-Alvarez D, Escobar LE. Vegetation loss and the 2016 Oropouche fever
outbreak in Peru. Mem Inst Oswaldo Cruz. 2017 Apr;112(4):292–8.

44. Catenacci, Ferreira MS, Martins LC, De Vleeschouwer KM, Cassano CR, Oliveira
LC, et al. Primates and sloths as sentinels for arboviruses in the Atlantic Forest, Bahia,
Brazil. In 2017.

45. Brasil. Ministério da Saúde. Guia de vigilância de epizootias em primatas não

humanos e entomologia aplicada à vigilância da febre amarela. MS; 2014. 100 p.

46. Lilian Catenacci, Joaquim Nunes-neto, Francisco Corrêa Castro, Poliana Lemos,
Eduardo Oyama, Sharon L Deem, et al. New records of mosquito species (Diptera:
Culicidae) for Bahia (Brazil). Int J Mosq Res. 2017;4(4):12–6.

47. Nunes MRT, Martins LC, Rodrigues SG, Chiang JO, Azevedo R do S da S, Travassos
da Rosa APA, et al. Oropouche Virus Isolation, Southeast Brazil. Emerg Infect Dis.
2005 Oct;11(10):1610–3.

48. Tilston-Lunel NL, Hughes J, Acrani GO, da Silva DEA, Azevedo RSS, Rodrigues SG,
et al. Genetic analysis of members of the species Oropouche virus and identification of
a novel M segment sequence. J Gen Virol. 2015 Jul;96(Pt 7):1636–50.

49. Gibrail MM, Fiaccadori FS, Souza M, Almeida TNV, Chiang JO, Martins LC, et al.
Detection of antibodies to Oropouche virus in non-human primates in Goiânia City,
Goiás. Rev Soc Bras Med Trop. 2016 Jun;49(3):357–60.

50. Travassos da Rosa JF, de Souza WM, Pinheiro F de P, Figueiredo ML, Cardoso JF,
Acrani GO, et al. Oropouche Virus: Clinical, Epidemiological, and Molecular Aspects
of a Neglected Orthobunyavirus. Am J Trop Med Hyg. 2017 May;96(5):1019–30.
 134

51. Vasconcelos PF, Travassos Da Rosa JF, Guerreiro SC, Dégallier N, Travassos Da
Rosa ES, Travassos Da Rosa AP. [1st register of an epidemic caused by Oropouche
virus in the states of Maranhão and Goiás, Brazil]. Rev Inst Med Trop Sao Paulo.
1989 Aug;31(4):271–8.

52. Laroque PO, Valença-Montenegro MM, Ferreira DRA, Chiang JO, Cordeiro MT,
Vasconcelos PFC, et al. Epidemiologic survey for arbovirus in galician capuchin
monkeys (Cebus flavius) free living in Paraíba and captive capuchin monkey (Cebus
libidinosus) from northeast Brazil. Pesqui Veterinária Bras. 2014 May;34(5):462–8.

53. Azevedo R do S da S, Barros VLR de S, Martins LC, Cruz ACR, Rodrigues SG,
Vasconcelos PF da C. Estudo experimental sobre a patogenicidade do Vírus Ilhéus em
hamsters dourados (Mesocricetus auratus). Rev Pan-Amaz Saúde. 2010 Mar;1(1):73–
80.

54. Karabatsos N. Supplement to International Catalogue of Arboviruses including certain

other viruses of vertebrates. Am J Trop Med Hyg. 1978 Mar;27(2 Pt 2 Suppl):372–
440.

55. Pereira LE, Suzuki A, Coimbra TLM, Souza RP de, Chamelet ELB. Ilheus arbovirus
in wild birds (Sporophila caerulescens and Molothrus bonariensis). Rev Saúde
Pública. 2001 Apr;35(2):119–23.

56. Adams AP, Aronson JF, Tardif SD, Patterson JL, Brasky KM, Geiger R, et al.
Common Marmosets (Callithrix jacchus) as a Nonhuman Primate Model To Assess
the Virulence of Eastern Equine Encephalitis Virus Strains. J Virol. 2008
Sep;82(18):9035–42.

57. Shepard JJ, Andreadis TG, Thomas MC, Molaei G. Host associations of mosquitoes at
eastern equine encephalitis virus foci in Connecticut, USA. Parasit Vectors [Internet].
2016 Aug 30;9(1). Available from:
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC5006286/

58. de Novaes Oliveira R, Iamamoto K, Silva MLCR, Achkar SM, Castilho JG, Ono ED,
et al. Eastern equine encephalitis cases among horses in Brazil between 2005 and
2009. Arch Virol. 2014 Oct;159(10):2615–20.

59. Nunes MRT, Travassos da Rosa APA, Weaver SC, Tesh RB, Vasconcelos PFC.
Molecular epidemiology of group C viruses (Bunyaviridae, Orthobunyavirus) isolated
in the Americas. J Virol. 2005 Aug;79(16):10561–70.
 135

Table 1. Demographic characteristics and serumprevalence of antibodies against arbovirus

detected by IH test in rural population, 2014, Bahia, Brazil
Characteristics Negative Positive Total Prevalence (%) P value

Sex

Male 57 119 176 67,6 0.222

Female 95 159 254 62,6

Age 0.002

Child 24 15 39 38,5

Teenager 21 30 51 58,8

Adult 88 180 268 67,2

Elderly 9 48 57 84,2

Level of education 0.95

No schooling 15 35 50 70,0

Pre-kindergarten or kindergarten 5 2 7 28,6

Unfinished elementary school or middle school 64 126 190 66,3

Unfinished high school 36 44 80 55,0

High school 21 33 54 61,1

Elementary school or middle school 6 22 28 78,6

Postsecondary education 5 11 16 68,8

Job

Farmer 26 73 99 73,7 0.07

Student 56 59 115 51,3

Housewife 35 54 89 60,7
Maid 6 10 16 62,5
Unemployed 1 5 6 83,3

Retired 2 18 20 90,0

Fishing man 8 11 19 57,9

Marisqueira” 1 2 3 66,7
Child 2 1 3 33,3
*marisqueira: women that collect shellfish

Table 2. Associations between risk factors within a year and seroprevalence of antibodies

against arbovirus detected by IH test in multivariable analysis

Characteristics B S.E. Wald df P OR (95% CI)

Domestic animals and wildlife -1.540 0.770 3.998 1 0.046 0.214 (0.047 - 0.970)

Presence of free living monkeys -0.608 0.270 5.064 1 0.024 0.544 (0.321 - 0.925)
Community- Cocoa farms next to
1.359 0.419 10.533 1 0.001 3.893 (1.713 - 8.847)
Castelo Novo
Community- Cocoa farms next to
1.072 0.473 5.147 1 0.023 2.921 (1.157 - 7.376)
Lagoa Encantada
Community- Lagoa Encantada 1.041 0.431 5.830 1 0.016 2.833 (1.217 - 6.596)
 136

Figure 1. Study site with the rural communities visited in Ilhéus (on the top) and Una (on the
bottom) municipalities, Bahia, Brazil
 137

Figure 2. Rural big communities visited during the survey in populations living in Una and
Ilhéus municipalities, Brazil. (A) REVIS; (B) REBIO-UMA; (C) Lagoa Encantada village;
(D) Cocoa farms next to Lagoa Encantada village; (E); Família Brasil village (F) Cocoa farms
next to Castelo Novo village, (G) Castelo novo; (H) Ribeira das Pedras village.
 138

Figure 3. Predictor Model

1st Level 2nd Level 3td Level

Individual/ Household Sentinel area/
Demographic Animals (PET; production Environment
Age (child, teenager, animals; bird; PET and Municipalities (Ilhéus,
adult, elderly) production animals; Una)
Gender (male, female) wildlife; PET, production Rural communities
Education level (no animals and birds; PET and (Colônia de Una, Lagoa
schooling, pre- birds; wildlife and others) Encantada, Ribeiro das
kindergarten or Time of residency (1-3 Pedras, Vila Brasil,
kindergarten, Castelo Novo,
years, 3-5 years, 5-10
unfinished elementary REBIO,REVIS, Cocoa
years, >10 years)
school or middle farms next to Castelo
Residence type (concrete, Novo, Cocoa farms next
school, unfinished high wood, clay, canvas) to Lagoa Encantada)
school, elementary Presence of bats close to
school or middle the house (Y/N)
school, high school, Type of vegetation close
postsecondary to the house (forest, open
education) areas, plantation, next to
Occupation (farmer, the river, forest and open
student, housewife, areas, forest, open areas
maid, unemployed, and plantation, forest,
retired, fishing man, open areas, plantation and
“marisqueira*”,
*marisqueira:
child) next to the river, open
women that areas, plantation and next
collect
shellfish to the river, forest and
plantation)
Presence of free living
monkeys (Y/N)

Arbovirus Infection
(serology +/-)

Figure 4. Overall arbovirus serumprevalence, including the Flavivirus, Alphavirus and

Orthobunyavirus genera in the rural population from Una and Ilhéus, Bahia, Brazil, 2014
 139

0,9

0,8

0,7

0,6

0,5 Ilheus
Una
0,4

0,3

0,2

0,1

0
Flavivirus Alphavirus Orthogunyavirus
 140

Figure 5. Overall arbovirus serumprevalence among the big the rural communities from Una
and Ilhéus, Bahia, Brazil, 2014
 141

APÊNDICE C:

CATENACCI, L. S.; NUNES NETO, J. P.; DE VLEESCHOUWER, K. M.; OLIVEIRA, L.

C.; DEEM, S. L.; PALMER, J. L.; MONTEIRO, H. A. O.; OYAMA, E.; TRAVASSOS DA
ROSA, E. S.; VASCONCELOS, P. F. C.; TELLO, J. S. Patterns of Hematophagus insect
Diversity in Atlantic Forest Fragments and Agroforestry Systems in Southern Bahia, Brazil. (A
ser submetido para o Journal of Vector Ecology)
 142

Patterns of the diversity of insects hematophagous in Atlantic Forest Fragments and Human-
modified areas in Southern Bahia, Brazil

Lilian S. Catenacci1,2,3*, Joaquim Nunes-Neto2, Kristel M. De Vleeschouwer3,4, Leonardo de

Oliveira4,5, Sharon E. Deem6, Jamie L. Palmer6, Hamilton A.O. Monteiro2, Oyama, E.7,
Elizabeth S. Travassos da Rosa2, Pedro F.C. Vasconcelos2, J. Sebastian Tello8
1*
Federal University of Piauí State, Professora Cinobelina Elvas, Bom Jesus, 64900-000/PI,
Brazil, catenacci@ufpi.edu.br, +55(89) 99900-1212.
2
Section of Arbovirology and Hemorrhagic Fevers, Evandro Chagas Institute- Ministry of
Health, Anannindeua, Brazil
3
Centre for Research and Conservation, Royal Zoological Society of Antwerp, Antwerp
4
Bicho do Mato Instituto de Pesquisa, Belo Horizonte, MG, Brazil
5
State University of Rio de Janeiro, Faculdade de Formação de Professores, Rio de Janeiro,
RJ, Brazil
6
Saint Louis Zoo Institute for Conservation Medicine, St. Louis, USA
7
DIVEP, Health Department of Bahia State- Ministry of Health, BA, Brazil
8
Missouri Botanical Garden, St. Louis, USA

ABSTRACT
Mosquitoes, as well as other hematophagous insects, are often important vectors of emerging
and re-emerging diseases worldwide. In recent years, there have been a number of important
outbreaks of mosquito-borne diseases in the Neotropics, particularly in Brazil. Moreover,
some taxa are also considered indicators of environmental health. Despite the importance of
understanding mosquito abundance and distribution to understand disease dynamics and
design strategies to manage them, we still know relatively little about mosquitoes in many
tropical regions. Here we study the abundance and diversity of mosquitoes in the Bahia State
of Brazil, a point of origin for recent arbovirus outbreaks, including Zika and Chikungunya
fever. In particular, we describe the most common hematophagous insects, and study patterns
of variation in diversity among forest strata, climatic seasons and sites of varying
characteristics. During 2009-2014, were identified 51 mosquito taxa belonging to three
dipteran families: Ceratopogonidae, Culicidae, Psychodidae. The family Cullicidae, including
the Sabethini tribe, were the most abundant (81.5%) and most taxa-rich (n=45). While season
(winter or dryer) was a strong factor determinant of the occurrence of the most abundant taxa,
the stratification level on the forest (ground or tree level) had a strong effect and dominant
taxa at ground level was completely different from the dominant species collected at tree
level. We suggest that sites with a mix of forest and cocoa agroforestry systems support the
higher biodiversity of hematophagous insects than highly disturbed landscapes.
 143

Key words: arbovirus, mosquito, Culicidae, abundance, richness, Brazil

INTRODUCTION
Arthropods belong to the largest phylum of the animal kingdom and many species, especially
hematophagous insects in the families Ceratopogonidae, Culicidae, Psychodidae and
Simuliidae, are vectors for important tropical diseases (Vasconcelos and Calisher 2016;
Harbach RE. 2017; Cardoso et al. 2017). Considering the emerging arbovirus outbreaks in
recent years (e.g. in Brazil) (Figueiredo et al. 2014; Figueiredo and Figueiredo 2015;
Vasconcelos and Calisher 2016), knowledge on mosquito distribution and biodiversity is
essential to determine areas of potential risk of pathogen transmission and to conduct
assessments of environmental health in protected and anthropogenically disturbed areas
(Navarro et al. 2015).
Culicid mosquitoes (Diptera: Culicidae) have been extensively studied, mainly in neotropical
regions (Pinto et al. 2009). Around 3,500 species of Culicidae have been described worldwide
and Brazil is home to about 450 culicid species (Paula et al. 2015; Harbach RE. 2017; WRBU
2017). The hematophagous Culicidae are divided in two subfamilies, Anophelinae and
Culicinae. The Anophelinae are vectors for many arboviruses and Plasmodium spp. (Brazil
2016). The subfamily Culicinae are vectors for a high variety of arboviruses, such as Yellow
fever virus (YFV), Dengue virus (DENV) serotypes, Saint Louis Encephalitis virus (SLEV),
Ilheus virus (ILHV), Rocio virus (ROCV), Bussuquara virus (BSQV), Cacipacore virus
(CPCV), and recently, West Nile virus (WNV), Chikungunya virus (CHIK) and Zika virus
(ZIKV) (de Figueiredo et al. 2010; Serra et al. 2016). In sylvatic areas, culicid mosquitoes
also bite and transmit pathogens to wild animals (Medeiros-Sousa et al. 2013). Thus, rural
communities where people, mosquitoes and wild animals co-exists in close proximity are at
an increased risk for the emergence of infectious diseases, particularly those that are vector-
borne including arboviruses. Understanding the vertical stratification of culicid mosquitoes,
which may act as vectors of arboviral diseases in the tropical forest and the role of climate
factors in this process, is important for an assessment of disease risks in the natural
environment (Pinto et al. 2009). Furthermore, the condition of culicid populations can be used
as a bioindicator for environmental health assessment (Montes 2005; Paula et al. 2015).
Unfortunately, the ecology of mosquitoes in many parts of the tropics is poorly understood.
Even though recent outbreaks of Zika and Chikungunya in Brazil can be traced back to rural
areas of Southern Bahia State (Brazil 2016), few information exists about mosquito diversity,
demography or abundance. Moreover, this region contains remnants of the Atlantic Forest,
 144

which are home to a large number of mammals, birds and arthropods (Ribeiro et al. 2009;
Cassano et al. 2011), some of which may be important for the circulation dynamics of many
arboviruses (Souza et al. 2015). The goal of this study was to investigate the entomofauna in
sylvatic (i.e. natural) and rural areas of Southern Bahia, Brazil, and to evaluate the effect of
seasonality and the stratification level of the forest on arthropod taxa diversity. We also
discuss in more detail the Culicidae that are potential bioindicators and vectors of human and
wildlife diseases.

MATERIAL AND METHODS

Study Area
We conducted this study in the municipalities of Ilhéus and Una, located in the Southern
Bahia Atlantic Forests of Brazil to 2006 from 2014 (Figure 1). Across this region,
anthropogenic activities have resulted in a mosaic of land use strategies. Native Atlantic
Forest is highly fragmented, and embedded within an agricultural matrix dominated by cacao
agroforestry systems, and plantations of rubber tree, coconut, banana and cassava. The region
also contains the Una Biological Reserve and its Buffer Zone, the Una Biological Wildlife
Refuge (Alger and Caldas 1994; Sollberg et al. 2014). The area is surrounded by small
villages where the majority of the people are living by subsistence agriculture on small
family-based farms. Here, people have limited access to basic infrastructure, such as
electricity, potable water, sanitation and health care (Carneiro Santos et al. 2014; Sollberg et
al. 2014). With regards to climate, the mean annual temperature is 24°C, and annual rainfall
averages 1500 mm (Karger, Dirk Nikolaus et al. 2016; Karger, D.N. et al. 2016). Based on the
average temperature over the last three decades(Karger, Dirk Nikolaus et al. 2016; Karger,
D.N. et al. 2016), we defined summer as the warmer and wetter part of the year, from
November to April. We define winter as the colder, drier part of the year from May to
October (Figure 2).
We worked at seven collection sites in sylvatic and rural environments (Table 1). These sites
were selected based on type of vegetation and proximity to areas where wild mammals have
been monitored as part of other ecological and health studies (Oliveira et al. 2011; Catenacci
et al. 2016). The sites with higher amounts of primary or second-growth forests were REBIO-
Una, Ecoparque de Una and Lagoa Encantada, respectively. We sampled at six sites during
the “summer season” and four during the “winter season” (Table 1 and Figure 2).
 145

Mosquito sampling
The Brazilian Federal and State Entomological Services conducted the mosquito collections
as part of their surveillance programs from 2009 to 2014. At each site, sampling period was
between 3 to 10 days at three points each day: two during daylight (8am -12 pm and 4-6 pm)
and one at night (6 pm-6am). During daylight sampling, three or more team members
collected mosquitoes referred to as ground level sampling using hand nets (polyester net bag
with 30 cm in diameter and is attached to 30 cm aluminum handle). Adult mosquitoes were
transferred immediately to Eppendorf tubes using a manual suction tube (Castro catcher, glass
material with 50 Length per 25 mm diameter) and taken under adequate humidity and
environmental temperature conditions to the field laboratory (Serra et al. 2016). Furthermore,
we collected samples at two different stratification levels in the forest: ground level (1.5m
high), and tree level (15m high). Thus, at some sites (Table 2), we used climbing equipment
or a platform and a trained person to collect mosquitoes at tree level. In those situations, one
team member collected mosquitoes at tree level, and two or more members collected at
ground level. During nocturnal sampling, two unbaited automatic CDC light traps (BioQuip
Products®, CA, USA) were used and mosquitoes were collected the following morning.
These CDC light traps were set only at ground level (about 1.5m above the ground).
At the field laboratory, mosquito samples were transferred to Eppendorf cryotubes and frozen
in liquid nitrogen. Samples were kept at -70oC in the Bahia State’s Central Laboratory of
Public Health until shipped by air on dry ice to the Division of Arbovirology and Hemorragic
Fevers at Evandro Chagas Institute (SAARB-IEC) in Belém, PA, Brazil. At the SAARB-IEC
Laboratory, mosquitoes were identified using dichotomous keys (Consoli and Oliveira 1994).
Then, they were grouped into pools of 1- 91 specimens by date, collection site, gender and
taxonomic identification. All pools were frozen and stored at -70°C in the SAARB-IEC for
future arbovirus studies.
Data analysis
During taxonomic work, we made an effort to assign each individual to the lowest possible
identification level. Not all individuals, however, could be identified to species, and some were
identified to sub-genus, genus or family level. To describe the taxonomic resolution of the
dataset used, we calculated the frequency of the lowest taxonomic rank available for each insect
collected. It is important to note that for the analyses in this manuscript we use the term
"taxonomic unit" or "taxa" rather than "species", and "taxonomic diversity" rather than "species
diversity" because not all individuals in our samples could be identified to species level. Thus,
 146

each taxonomic name was used as a unit of analysis, but sometimes these taxonomic units
correspond to species, genera or families.
First, we describe the structure of arthropod assemblages using the relative abundances of each
family: Culicidae, Ceratopogonidae and Psychodidae (Schmidt and Barcellos 2007). We did
this for all data combined, as well as for each site, strata (ground-level or tree level) and season
(summer and winter), separately. For the family Culicidae, we also calculated the relative
abundances of each taxonomic unit. These data were then used to construct abundance
distribution curves, which describe how common is each taxonomic units relative to rare ones
(Melo 2008).
Second, we compared levels of taxonomic diversity in Culicidae among sites, habitats and
seasons. Because diversity within a site (or habitat or season) can be high solely owing to a
larger sampling effort, we used rarefaction curves to make our measures of taxonomic richness
comparable. Rarefaction curves are produced by repeatedly re-sampling N number of
individuals from the full pool of samples. Then, the average diversity is calculated for the all
samples of N individuals. Finally, average expected diversity is plotted against an increasing
value of N (Melo 2008; Distler et al. 2009). We calculated rarefaction curves to describe the
observed taxonomic richness for all Culicidae in our dataset, as well as separately for each site,
and each habitat by season combination. We used R (R Core team) to build the rarefaction
curves.

Results
In total, 7699 individuals comprised of 49 taxa were collected, all within the families
Culicidae, Psychodidae and Ceratopogonidae (Figure 3a). These three insect families
occurred simultaneously only in the most pristine site, REBIO-Una (Site 6; Figure 3d).
Culicidae was the dominant family, being the most abundant at all sites, strata (ground level
and tree level) (Figure 3b) and seasons (winter and summer) (Figure 3c and d). Within the
Culicidae family, five tribes (Aedini, Cullicini, Mansoniini, Sabethini and Uranotaeniini),
distributed over 14 genera were collected (Coquillettidia, Culex, Mansonia, Psorophora,
Aedes, Haemagogus, Limatus, Sabethes, Johnbelkinia, Runchomyia, Trichoprosopon,
Anopheles, Uranotaenia and Wyeomyia). In total, 46 taxonomic units were identified from the
7534 culicids collected (Table 2).
Sabethini was the dominant tribe, corresponding to 81.5% of individuals collected, followed
by Aedini (6.8%), Mansoniini (2.9%), and Uranotaeniini (0.13%). Anophelinae, represented
7.7% of samples collected. When considering all sites together, three taxonomic units showed
 147

the highest abundance: one species, the Limatus pseudomethysticus (39.8%), one genera
Wyeomyia spp. (20.1%) and one subgenera Wyeomyia (Phoniomyia) spp. (6.7%) (Figure 4a).
Table 2 shows the three most dominant taxa in each combination of season and habitat, as
well as each site.
These results show no major difference in the most abundant genera identified during the winter
and dry season (Table 2). However, considering the stratification level of the forest, the
dominant taxa at ground level was completely different from the dominant species collected at
tree level, independent of the season (Table 2). Hg. (Hag.) janthinomys, Sa. (Sbo.)
chloropterus, Wyeomyia (Phoniomyia) spp. were the dominant culicids at tree level, while
Wyeomyia spp., Anopheles (Ano.) spp., Li. pseudomethysticus and Limatus spp. were dominant
at ground level (Table 2). For all sites, seasons and habitat types, the abundance distribution
curves (Figure 4) show the classical ecological patterns where few taxa are very common, while
most of taxa in a natural assemblages are rare (Melo 2008).
The genus Aedes represented 0.2% of individuals in all sites together. Aedes serratus was the
only Aedes species present at all sites, except at Santa Rita farm, while Ae. albopictus and Ae.
fluviatilis were collected only at the Bonfim and the Colonia de Una farms, respectively. The
Ae. scapularis was captured on Almada, Santa Rita Farm and Lagoa Encantada and the Ae.
fulvus were captured only at Almada and Santa Rita Farms. The taxa Anopheles spp. was
present at all sites, while Hg. (Hag.) janthinomys occurred at six sites (except Santa Rita Farm)
and the genus Sabethes spp. and Culex spp. were present at five sites (Table 3). During the
summer at ground level, the Hg. (Hag.) janthinomys was one of the most abundant species
collected in Lagoa Encantada and REBIO-UNA (Table 2).
A total of ten taxa were exclusive to one of the more pristine areas; REBIO-Una, Ecoparque
and Lagoa Encantada. Cq. (Rhy.) nigricans, Cq (Rhy.) spp. and Sa. (Sab.) cyaneus were
common for all three sites. An. (Nys.) triannulatus, Ma. (Man) spp., Sa (Sab.) spp. were unique
to REBIO and the Ur. (Ura) calosamata, Ur (Ura) spp., Sa (Sab.) belisariori and Ur. (Ura)
geometrica were only found at Ecoparque (Table 3).
When using rarefaction curves to compare taxonomic richness, we found that the ground level
assemblages during the summer had higher richness than any other habitat/season combination
(Figure 5b; Table 2). This was followed in diversity by the winter ground level group, the
summer tree level group and the winter tree level group (Figure 5b).
Across site comparisons, Santa Rita Farm had clearly the lowest taxonomic richness (Figure
5c and Table 2), while Almada Farm had the highest number of taxonomic units during the
summer. These differences among sites almost completely disappear during the winter
 148

(Figure 5d). However, richness in winter was lower when compared with the same sites
during the summer (Figure c and d).

DISCUSSION
Abundance of hematophagous insects and the importance of culicids for public health
As expected, the three families of insects (Psychodidae, Ceratopogonidae and Culicidae) were
present in the most pristine study site (Figure 3b and c) given that better conserved areas will
support increased insect richness due to the variety of resources, hosts, breeding sites and
microhabitats (Taipe-Lagos and Natal 2003; Pinto et al. 2009; Nnko et al. 2017; Sawalha et
al. 2017). Psychodidae, the sandflies family, are vectors for Leishmaniasis (Dias-Lima et al.
2003; Sawalha et al. 2017) and more than 21 species of arboviruses, including Phlebovirus
(Weidmann et al. 2008; Ventura-Villarroel et al. 2015). Ceratopogonidae is similarly known
to transmit some arboviruses, including the Oropouche virus (Mellor et al. 2000). One of the
reasons that could explain the lower abundance of the Ceratopogonidae in cacao agroforestry
systems is their inability to breed in cacaos peels, the main substrate left for the farmers in the
soil after extracting seeds from the cacao fruit (Soria et al, 1980). The Psychodidae family,
although prefers breeding in more humid habitats and resting in dense vegetation cover, are
adapted for areas with less humidity and vegetations cover (Müller et al. 2011; Sawalha et al.
2017). Given that individuals from the Psychodidae family are present in four of the seven
surveyed sites (Figure 3b and c), further studies should investigate the occurrence of
leishmaniasis and arboviruses in insects and humans that live near those sites to evaluate
disease transmission and exposure risks. However, due to the high abundance of Culicidae
and ongoing arbovirus outbreaks in humans and wild animals (Vasconcelos and Calisher
2016), culicids should be considered one of the most important emerging and re-emerging
disease vectors (Navarro et al. 2015) to be investigated.
Our results demonstrated that almost 10% of the Brazilian culicid taxa are distributed in
Southern Bahia, with Sabethini as the most dominant tribe. This tribe is almost entirely
Neotropical (Gomes et al. 2010; Cardoso et al. 2010; Navarro et al. 2015) and most taxa seem
to be zoophilic, but will opportunistically sting humans, both in the forest and in surrounding
areas. Frequently these mosquitoes are found in areas of old-growth or secondary-growth
forest with no or little human alteration, and may be considered environmental health
bioindicators (Paula et al. 2015).
 149

Evidence of forest stratification in the composition of the most common culicidae

mosquitos
Vertical stratification, a marked preference for different heights within the vegetation, was
expected for the Sabethini tribe. This is so because most taxa in this tribe breed in tree holes,
bromeliads and palm axils (Forattini 1995). However, as found in other studies, some
sabethines, such as Li. pseudomethysticus and Wyeomyia spp., prefer to use the ground level
of the forest, depositing eggs in natural substrates (e.g. bamboo, bromeliads and fruit peel) or
in artificial receptacles left by humans on the ground (Guimarães et al. 1985). This breeding
behaviour could explain their higher abundance at the ground level at the sites studied.
Arbovirus have been isolated for these two taxa, including Eastern Equine Encephalitis virus;
however, little information about their role as arboviruses vectors has been reported.
The high occurrence of Hg. (Hag.) janthinomys, Sa. (Sbo.) chloropterus, and Wyeomyia
(Pho.) spp. at tree level was expected (Table 2) given they show affinity for forest canopies
(species termed “acrodendrophilic”) and lay eggs almost exclusively in bromeliads
(Guimarães et al. 1985; Forattini 1995; Pinto et al. 2009; Gomes et al. 2010), which are more
frequently on the trees (Guimarães et al. 1984; Gomes et al. 2010). Furthermore, Hg. (Hag.)
janthinomys, Sa. (Sbo.) chloropterus are primatophilic (i.e. most often obtain blood meals
from monkeys), which typically live at tree level (Guimarães et al. 1985). Previous studies
showed that the circadian activity of mosquito vectors may be related to the resting periods of
their hosts (Galindo 1958). Chadee (1990), Pinto et al. (2009) and Guimarães et al. (1986)
observed a more aggressive behaviour of Hg. (Hag.) janthinomys and Sa. (Sbo.) chloropterus
females towards their hosts between the late morning hours and the early afternoon, a period
of the day that corresponds to the resting time of monkeys, the preferred hosts for these
species. However, as found in other studies, these mosquitoes are also capable of using the
forest floor (Table 2), which was observed at the REBIO-Una and Lagoa Encantada sites
(Guimarães et al. 1985; Gomes et al. 2007, 2010; Pinto et al. 2009). Hg. (Hag.) janthinomys
are an important vector of yellow-fever and Mayaro virus in sylvatic environments (Davis
1930; de Thoisy et al. 2003; Almeida et al. 2014), while the Sabethes spp. are considered
potential secondary vectors of yellow fever in Central and South America, along with other
arbovirus such as SLEV and ILHV (Forattini 1995b; Gomes et al. 2010b). And as described
by Gomes et al. (2010a), species from the genus Sabethes were present in almost all of the
same sites as Haemagogus and Sabethes chloropterus.
 150

Culicidae diversity in natural and anthropogenically modified habitats

Culicids are of interest not only from an epidemiological perspective, an aspect that has been
amply discussed in the literature, but also because some taxa may be used as bioindicators of
environmental health. The usefulness of mosquitoes as bioindicators is readily apparent if one
assesses the extent of change that has occurred in a particular region and, at the same time,
observes the increase or decrease or disappearance of a particular taxon (Paula et al. 2015).
Although we did not study the demographic aspects of the mosquitoes across time, we
compared the richness and abundance of taxa across sites with different management
types/landscapes. The richness of culicids and the high abundance of the Sabethini tribe
suggest that fragments of Atlantic Forest, as well cacao agroforestry systems (capable of
maintaining characteristics of sylvatic environments) support biodiversity better than highly
disturbed environments. Sabethini mosquitoes are found in areas of old-growth or secondary-
growth forest with no or little human alteration, and may be considered as environmental
health bioindicators for the forests (Paula et al. 2015). However, some Sabethini, as Li.
durhami are associated with humans areas because its immature forms are frequently found in
artificial breeding sites provided by human activity, such as plastic bottles (Guimarães et al.
1984). Our study corroborates both the finding by Guimarães et al. (1987), which report
Limatus species present in sylvatic environments, and by Guimaraes et al (1984), which found
Limatus species in human modified environments (Table 2).
Furthermore, the exclusivity of some culicids species in the most pristine forest fragments, the
lower relative abundance of the genus Aedes among these sites and the presence of
anophelines in all sites corroborate that the idea that fragments of Bahia Atlantic Forest close
to managed agroforestry systems support biodiversity better than highly disturbed
environments. For example, Ae. serratus, found in almost every study site, has been
preferentially captured in sylvatic environments in other studies (Forattini 1995) (Table 3). In
natural conditions, this species is known to be infected with STLV, Oropouche, Aura and
Trocara virus in Amazon forests. It is also considered the vector responsible for the sylvatic
cycle of ILHV in others regions of Brazil (Cardoso et al. 2010). Additionally, the Ae.
scapularis is commonly captured in environments modified by humans, while reports on Ae.
fulvus incidence referred to them being collected in forested areas where human activity is
poorly mentioned (Forattini 1995; Forattini et al. 1995), as we found in the present study
(Table 3). In Brazil, anophelines are generally common in rural or wild environments and
rare in urban areas because their habitats require special environmental conditions, such as the
bromeliads as the preferred breeding sites (Pittendrigh 1950; Guimarães et al. 1985; Cardoso
 151

et al. 2012; Paula et al. 2015). The relationship between anophelines and the presence of
favorable man-made habitats or habitats that keep the bromeliads and water storage container
may contribute to the maintenance of the population of these species in all study sites (Table
3).
The high abundance of large bromeliads in the region (Catenacci et al. 2009; Fontoura et al.
2010), which serve as breeding sites, the tall trees that make up the canopies, the abundance
of wild fauna that still populate these areas (Cassano et al. 2009) likely contribute to the
biodiversity of vectors in the study sites. According to (Nnko et al. 2017) the distribution and
abundance of vectors is determined by the interplay of three factors: suitable climatic
conditions, habitat for development, and the availability of hosts for food.
Even though forest fragments and agroforestry systems in Southern Bahia are able to maintain
high diversity of mosquitoes and the complex interactions among vectors-pathogens-wild
hosts in nature, the continuing deforestation rates and the extent of cattle ranching has resulted
in drastic changes in the local landscape matrix. These changes can directly impact vector
populations, which can lead to a high prevalence of certain species with a higher capacity for
arbovirus transmission resulting in outbreaks of arboviruses both in people and wild animals,
as has been reported in other regions of Brazil (Lima et al. 2010; Pauvolid-Corrêa et al. 2010).
Because of this, carrying out an entomological investigation on the species composition of
Culicidae assemblages in sylvatic and rural areas can help highlight the importance of keeping
natural areas in an anthropic environment matrix by showing the biological richness of these
arthropods (Paula et al. 2015).

Seasonality affects mosquito diversity

Previous studies have suggested that the structural complexity of an environment has an
important effect on the insects diversity and composition (Pittendrigh 1950; Pinto et al. 2009;
Braga et al. 2010). The high abundance of large bromeliads in the study region (Catenacci et
al. 2009; Fontoura et al. 2010), which serve as breeding sites, the tall trees that make up the
canopies, the abundance of wild fauna that still populate these areas (Cassano et al. 2009)
likely also contribute to the observed biodiversity of vectors.
However, even for sites that contain the same key characteristics, such as cacao agroforestry
systems, small variations in environmental conditions can affect the diversity of insects
(Pittendrigh 1950; Pinto et al. 2009). As described in other studies, the summer season, with
higher humidity and temperature tends to increase the relative abundance of insects when
compared to the winter season, as these conditions benefit the occurrence of breeding sites
 152

(Fig 5) (Pittendrigh 1950; Paterno and Marcondes 2004; Pinto et al. 2009; Sawalha et al.
2017). Usually, in the wet tropics, epizootics and epidemics of mosquito-borne diseases are
associated with the onset of the rainy season, when the population densities of vectors are
higher. Pinto et al. (2009) also observed in a tropical forest that the number of culicid
mosquitoes was higher during the rainy season and lower at the start of the dry season, both at
canopy and ground level. Additionally, a wide range of mosquitoes have the capacity to
maintain their eggs in a quiescent stage under poor conditions until the environmental
situation improves, which usually coincides with the summer/rainy season. The complexity
of habitat and season to explain the diversity of entomofauna might increase if we consider
microscale modifications that could influence the development of immature insect stages,
such as water salinity, water movement in a small area, water pollutants, etc. (Pittendrigh
1950). These complexities could explain the difference in richness between seasons, habitat
and sites in the present study; even for sites with similar vegetation.
Our study suggests that fragmented forest areas, followed by agroforestry systems in Southern
Bahia host high sylvatic mosquito diversity and low abundance of the main genus of culicid
that is important for public health, Aedes spp. However, the importance of native fauna that is
established in forested and managed areas should not be underestimated, because various taxa
in these areas already have both the competency and capacity to transmit important pathogens
to wild animals, and many of them have not been studied. Haemagogus janthynomys and
others have shown a capacity for living in rural and sylvatic environments, as has the
Sabethini tribe, increasing contact with humans and the risk of emerging arbovirus infections.
The limited literature on entomofauna in the State of Bahia, the fact that some of the
hematophagous arthropods taxa identified in this study are considered significant etiological
vectors and the considerable human and wildlife interactions justifies similar studies in other
areas of the state.

Acknowledgments
We are much indebted to the technical staff of the Department of the Health of Bahia State (6a
DIRES) who has helped the authors to collect the material in the field and the Evandro
Chagas Institute team, especially Bruna Laís Sena do Nascimento, Hélio Augusto Cardoso
Saraiva, José Wilson Rosa Junior, Francisco Correa de Castro, Durval Bertran Rodrigues
Vieira for assistance with the identification of the arthropods. Additional thanks go to Project
BioBrasil/Centre for Research and Conservation Antwerpia Zoo, ICMBIO, Kathleen
Apakupakul at the Saint Louis Zoo Institute for Conservation Medicine and the Bicho-da
 153

mata NGO for their logistical support. We sincerely acknowledge the owner of the areas. This
study was funded by Saint Louis Zoo WildCare Institute (USA), The Wild Animal Fund,
from the American Association of Zoological Veterinarians (AAZV, USA), CNPq (Brasil),
the Centre for Research and Conservation of the Royal Zoological Society of Antwerp
(Belgium), Lion Tamarins of Brazil Fund, National Lottery of Belgium, Primate Action Fund,
Zoological Society of London, Fundação o Boticário de Proteção a Natureza. The Flemish
Ministry of Science (Belgium) provided structural support to the Centre for Research and
Conservation of the Royal Zoological Society of Antwerp.

REFERENCES
Alger K, Caldas M (1994) The declining cocoa economy and the Atlantic Forest of Southern
Bahia, Brazil: Conservation attitudes of cocoa planters. Environmentalist 14:107–119.
doi: 10.1007/BF01901304

Almeida MAB, Cardoso J da C, dos Santos E, et al (2014) Surveillance for Yellow Fever
Virus in Non-Human Primates in Southern Brazil, 2001–2011: A Tool for Prioritizing
Human Populations for Vaccination. PLoS Negl Trop Dis. doi:
10.1371/journal.pntd.0002741

Braga DL, Louzada JNC, Zanetti R, Delabie J (2010) Rapid evaluation of ant diversity in land
use systems in southern Bahia, Brazil. Neotrop Entomol 39:464–469. doi:
10.1590/S1519-566X2010000400002

Brazil (2016) Carta anofélica da Bahia, Brasil (Diptera: Culicidae). Bol Entomológico Secr
Saúde Estado Bahia 3:1–2.

Cardoso CW, Kikuti M, Prates APPB, et al (2017) Unrecognized Emergence of Chikungunya

Virus during a Zika Virus Outbreak in Salvador, Brazil. PLoS Negl Trop Dis. doi:
10.1371/journal.pntd.0005334

Cardoso J da C, Paula MB de, Fernandes A, et al (2010) New records and epidemiological

potential of certain species of mosquito (Diptera, Culicidae) in the State of Rio Grande
do Sul, Brazil. Rev Soc Bras Med Trop 43:552–556. doi: 10.1590/S0037-
86822010000500016

Cardoso JDC, Bergo ES, Oliveira TMP, et al (2012) New Records of Anopheles homunculus
in Central and Serra Do Mar Biodiversity Corridors of the Atlantic Forest, Brazil. J
Am Mosq Control Assoc 28:1–5. doi: 10.2987/11-6205.1

Carneiro Santos HL, Fernandes Martins LA, Saramago Peralta RH, et al (2014) Frequency of
amoebiasis and other intestinal parasitoses in a settlement in Ilhéus City, State of
Bahia, Brazil. Rev Soc Bras Med Trop 47:101–104. doi: 10.1590/0037-8682-0078-
2012
 154

Cassano CR, Kierulff MCM, Chiarello AG (2011) The cacao agroforests of the Brazilian
Atlantic forest as habitat for the endangered maned sloth Bradypus torquatus. Mamm
Biol - Z Für Säugetierkd 76:243–250. doi: 10.1016/j.mambio.2010.06.008

Cassano CR, Schroth G, Faria D, et al (2009) Landscape and farm scale management to
enhance biodiversity conservation in the cocoa producing region of southern Bahia,
Brazil. Biodivers Conserv 18:577–603. doi: 10.1007/s10531-008-9526-x

Catenacci LS, De Vleeschouwer KM, Nogueira-Filho SLG (2009) Seed Dispersal by Golden-
headed Lion Tamarins Leontopithecus chrysomelas in Southern Bahian Atlantic
Forest, Brazil. Biotropica 41:744–750. doi: 10.1111/j.1744-7429.2009.00530.x

Catenacci LS, Pessoa MS, Nogueira-Filho SLG, Vleeschouwer KMD (2016) Diet and
Feeding Behavior of Leontopithecus chrysomelas (Callitrichidae) in Degraded Areas
of the Atlantic Forest of South-Bahia, Brazil. Int J Primatol 37:136–157. doi:
10.1007/s10764-016-9889-x

Consoli RAGB, Oliveira RL de (1994) Principais mosquitos de importância sanitária no

Brasil. Editora Fiocruz

Davis NC (1930) THE SUSCEPTIBILITY OF MARMOSETS TO YELLOW FEVER

VIRUS. J Exp Med 52:405–416.

de Figueiredo ML, de C Gomes A, Amarilla AA, et al (2010) Mosquitoes infected with

dengue viruses in Brazil. Virol J 7:152. doi: 10.1186/1743-422X-7-152

de Thoisy B, Gardon J, Salas RA, et al (2003) Mayaro Virus in Wild Mammals, French
Guiana. Emerg Infect Dis 9:1326–1329. doi: 10.3201/eid0910.030161

Dias-Lima AG, Guedes MLS, Sherlock IA (2003) Horizontal stratification of the sand fly
fauna (Diptera: Psychodidae) in a transitional vegetation between caatinga and tropical
rain forest, state of Bahia, Brazil. Mem Inst Oswaldo Cruz 98:733–737. doi:
10.1590/S0074-02762003000600004

Distler T, Jørgensen PM, Graham A, et al (2009) Determinants and prediction of broad-scale

plant richness across the western neotropics. Ann Mo Bot Gard 96:470–491. doi:
10.3417/2008034

Figueiredo MLG de, Figueiredo LTM, Figueiredo MLG de, Figueiredo LTM (2014)
Emerging alphaviruses in the Americas: Chikungunya and Mayaro. Rev Soc Bras Med
Trop 47:677–683. doi: 10.1590/0037-8682-0246-2014

Figueiredo LTM, Figueiredo LTM (2015) The recent arbovirus disease epidemic in Brazil.
Rev Soc Bras Med Trop 48:233–234. doi: 10.1590/0037-8682-0179-2015

Fontoura T, Cazetta E, Nascimento W do, et al (2010) Diurnal frugivores on the Bromeliaceae

Aechmea depressa L.B. Sm. from Northeastern Brazil: the prominent role taken by a
small forest primate. Biota Neotropica 10:351–354. doi: 10.1590/S1676-
06032010000400041

Forattini OP (1995) Principais mosquitos de importância sanitária no Brasil. Cad Saúde

Pública 11:157–158. doi: 10.1590/S0102-311X1995000100027
 155

Forattini OP, Kakitani I, Massad E, Marucci D (1995) Studies on mosquitoes (Diptera:

Culicidae) and anthropic environment: 9- Synanthropy and epidemiological vector
role of Aedes scapularis in South-Eastern Brazil. Rev Saúde Pública 29:199–207. doi:
10.1590/S0034-89101995000300007

Galindo P (1958) Bionomics of Sabethes chloropterus Humboldt, a vector of sylvan yellow

fever in Middle America. Am J Trop Med Hyg 7:429–440.

Gomes A de C, Torres MAN, Ferri L, et al (2007) Finding of Haemagogus (Conopostegus)

leucocelaenus (Diptera: Culicidae), in the municipality of Porto Alegre, State of Rio
Grande do Sul. Rev Soc Bras Med Trop 40:487–488. doi: 10.1590/S0037-
86822007000400025

Gomes A de C, Torres MAN, Paula MB de, et al (2010) Ecologia de Haemagogus e Sabethes

(Diptera: Culicidae) em áreas epizoóticas do vírus da febre amarela, Rio Grande do
Sul, Brasil. Epidemiol E Serviços Saúde 19:101–113. doi: 10.5123/S1679-
49742010000200003

Guimarães AÉ, Arlé M, Guimarães AÉ, Arlé M (1984) Mosquitos no Parque Nacional da
Serra dos Órgãos, estado do Rio de Janeiro, Brasil: I- distribuição estacional. Mem
Inst Oswaldo Cruz 79:309–323. doi: 10.1590/S0074-02761984000300004

Guimarães AE, Arlé M, Machado RNM, et al (1985) Mosquitoes in the National Park of
Serra dos Orgãos, State of Rio de Janeiro, Brazil: II. Vertical distribution. Mem Inst
Oswaldo Cruz 80:171–185. doi: 10.1590/S0074-02761985000200008

Guimarães AÉ, Victório VMN, Guimarães AÉ, Victório VMN (1986) Mosquitoes in the
Parque Nacional da Serra dos Orgãos, State of Rio de Janeiro, Brazil: III. Hour
preference for blood sucking. Mem Inst Oswaldo Cruz 81:93–103. doi:
10.1590/S0074-02761986000100013

Harbach RE. (2017) Mosquito Taxonomic Inventory. Valid Species List.

Karger, Dirk Nikolaus, Conrad, Olaf, Böhner, Jürgen, et al (2016) CHELSA climatologies at
high resolution for the earth’s land surface areas (Version 1.1). World Data Cent Clim.
doi: 10.1594/WDCC/CHELSA_v1_1

Karger, D.N., Conrad, O., Böhner, J., et al (2016) Climatologies at high resolution for the
Earth land surface areas.

Lima MA, Romano-Lieber NS, Duarte AMR de C (2010) Circulation of antibodies against
yellow fever virus in a simian population in the area of Porto Primavera Hydroelectric
Plant, São Paulo, Brazil. Rev Inst Med Trop São Paulo 52:11–16. doi: 10.1590/S0036-
46652010000100002

Medeiros-Sousa AR, Ceretti-Junior W, Urbinatti PR, et al (2013) Mosquito (Diptera:

Culicidae) survey in parks of São Paulo City I. Biota Neotropica 13:317–321. doi:
10.1590/S1676-06032013000100030

Mellor PS, Boorman J, Baylis M (2000) Culicoides biting midges: their role as arbovirus
vectors. Annu Rev Entomol 45:307–340. doi: 10.1146/annurev.ento.45.1.307
 156

Melo AS (2008) O que ganhamos “confundindo” riqueza de espécies e equabilidade em um

índice de diversidade?

Montes J (2005) Culicidae fauna of Serra da Cantareira, Sao Paulo, Brazil. Rev Saúde Pública
39:578–584. doi: 10.1590/S0034-89102005000400010

Müller GC, Kravchenko VD, Rybalov L, Schlein Y (2011) Characteristics of resting and
breeding habitats of adult sand flies in the Judean Desert. J Vector Ecol 36:S195–
S205. doi: 10.1111/j.1948-7134.2011.00131.x

Navarro, S Enríquez, P Duque, et al (2015) New Sabethes (Diptera: Culicidae) species

records for Ecuador, from Colonso-Chalupas biological reserve, province of Napo
(Amazon). J Entomol Zool Stud 3:169–172.

Nnko HJ, Ngonyoka A, Salekwa L, et al (2017) Seasonal variation of tsetse fly species
abundance and prevalence of trypanosomes in the Maasai Steppe, Tanzania. J Vector
Ecol 42:24–33. doi: 10.1111/jvec.12236

Oliveira LC, Neves LG, Raboy BE, Dietz JM (2011) Abundance of Jackfruit (Artocarpus
heterophyllus) Affects Group Characteristics and Use of Space by Golden-Headed
Lion Tamarins (Leontopithecus chrysomelas) in Cabruca Agroforest. Environ Manage
48:248–262. doi: 10.1007/s00267-010-9582-3

Paterno U, Marcondes CB (2004) Mosquitoes with morning biting activity in the Atlantic
forest, Brazil (Diptera, Culicidae). Rev Saúde Pública 38:133–135. doi:
10.1590/S0034-89102004000100019

Paula MB de, Fernandes A, Medeiros-Sousa AR, et al (2015) Mosquito (Diptera: Culicidae)

fauna in parks in greater São Paulo, Brazil. Biota Neotropica. doi: 10.1590/1676-
0611-BN-2014-0026

Pauvolid-Corrêa A, Tavares FN, Alencar J, et al (2010) Preliminary investigation of Culicidae

species in South Pantanal, Brazil and their potential importance in arbovirus
transmission. Rev Inst Med Trop São Paulo 52:17–24. doi: 10.1590/S0036-
46652010000100003

Pinto CS, Confalonieri UE, Mascarenhas BM (2009) Ecology of Haemagogus sp. and
Sabethes sp. (Diptera: Culicidae) in relation to the microclimates of the Caxiuanã
National Forest, Pará, Brazil. Mem Inst Oswaldo Cruz 104:592–598. doi:
10.1590/S0074-02762009000400010

Pittendrigh CS (1950) The Ecoclimatic Divergence of Anopheles bellator and A. homunculus.

Evolution 4:43–63. doi: 10.2307/2405533

Ribeiro MC, Metzger JP, Martensen AC, et al (2009) The Brazilian Atlantic Forest: How
much is left, and how is the remaining forest distributed? Implications for
conservation. Biol Conserv 142:1141–1153. doi: 10.1016/j.biocon.2009.02.021

Sawalha SS, Ramlawi A, Sansur RM, et al (2017) Diversity, ecology, and seasonality of sand
flies (Diptera: Psychodidae) of the Jenin District (Palestinian Territories). J Vector
Ecol 42:120–129. doi: 10.1111/jvec.12246
 157

Schmidt LS, Barcellos A (2007) Abundance and species richness of Heteroptera (Hemiptera)
from Parque Estadual do Turvo, southern Brazil: Pentatomoidea. Iheringia Sér Zool
97:73–79. doi: 10.1590/S0073-47212007000100011

Serra OP, Cardoso BF, Ribeiro ALM, et al (2016) Mayaro virus and dengue virus 1 and 4
natural infection in culicids from Cuiabá, state of Mato Grosso, Brazil. Mem Inst
Oswaldo Cruz 111:20–29. doi: 10.1590/0074-02760150270

Sollberg I, Schiavetti A, Moraes MEB (2014) Agricultural management in the una’s wildlife
refuge: a perspective of conservation by agroforestry. Rev Árvore 38:241–250. doi:
10.1590/S0100-67622014000200004

Souza RL, Santos RF, Nunes Neto J, et al (2015) MONITORAMENTO ENTOMOLÓGICO

EM ÁREA DE OCORRÊNCIA DE FEBRE AMARELA SILVESTRE NO OESTE
DA BAHIA. 39:136.

Taipe-Lagos CB, Natal D (2003) Culicidae mosquito abundance in a preserved metropolitan

area and its epidemiological implications. Rev Saúde Pública 37:275–279. doi:
10.1590/S0034-89102003000300002

Vasconcelos PFC, Calisher CH (2016) Emergence of Human Arboviral Diseases in the

Americas, 2000-2016. Vector Borne Zoonotic Dis Larchmt N 16:295–301. doi:
10.1089/vbz.2016.1952

Ventura-Villarroel FD, Ruiz S, Herrero L, et al (2015) Identification of flaviviruses and

phleboviruses from insects in southwest of Spain. J Clin Virol 70:S6. doi:
10.1016/j.jcv.2015.07.022

Weidmann M, Sanchez-Seco MP, Sall AA, et al (2008) Rapid detection of important human
pathogenic Phleboviruses. J Clin Virol Off Publ Pan Am Soc Clin Virol 41:138–142.
doi: 10.1016/j.jcv.2007.10.001

WRBU (2017) Walter Reed Biosystematics Unit.

Figure 1. Study sites where the arthropods were captured: Ilhéus city (on the top) and Una city
(on the bottom)
158
 159

Figure 2. Annual variation in mean temperature and total precipitation by month for each
sample site. White circles represent values that were higher than the mean for each site. Grey
circles represent values that were at least one standard deviation higher than the mean for each
site. Season specification determined by this data. We define summer as November to April.
Winter is defined as May to October.
 160

Figure 3. Relative abundances of mosquito families. (A) all data combined, (B) each
combination of habitat and season, (C) ground-level and summer data for each site, and (D)
ground-level and winter data for each site.
 161

Figure 4. Abundance distributions for Culicidae taxa. (A) all Culicidae data combined, (B)
each combination of habitat and season, (C) ground-level data for each site.
 162

Figure 5. Rarefaction curves comparing Culicidae richness across varying sample sizes. (A)
all Culicidae data combined, (B) each combination of habitat and season, (C) ground-level
and summer data for each site, and (D) ground-level and winter data for each site. Lines
around each point represent one standard error away from the mean estimate of richness.
 163

Table 1. Study sites, including the dominant landscape, the municipality and the geographic coordinates.
Study site Predominant type of vegetation* Cities Coordinates
Almada Farm (Site 1)- cacao farm - Agroforestry with second-growth forest b,c
Ilhéus 14039'49.4''S
- Neighbor of Bonfin and Santa Rita Farm 39011'36.8''W
Bonfim Farm- rural settlement with cacao -Agroforestry with second-growth forest b,c Ilhéus 14039'31.24''S
farm (site 2)
- Neighbor of Almada and Santa Rita Farm 39011'37.6''W
Santa Rita Farm (site 3)- cacao farm - Agroforestry with second-growth forest b,c Ilhéus 14040'35.6''S
- Neighbor of Bonfim and Almada Farm 39011'10.8''W
Colônia de Una Farm- - Agriculture with second-growth forest b,d Una 15017'11.1''S
Familiar agriculture farm (site 4)
- Close to REBIO-UNA 39008'25.0''W
Lagoa Encantada (site 5) – conservation -Second-growth forest b with few agroforestry c, close to a big lake Ilhéus 14037'10.5''S
area
- Close to Bonfim, Santa Rita and Almada Farm 39008'14.6''W
Una Biological Reserve (Rebio-Una) (site 6) Mostly old-growth foresta in the East side and Second-growth b Una 15010'55.3''S
– conservation area forest with old-growth foresta in the West side 39004'20.7''W
-Neighbor of Ecoparque de Una
Ecoparque de Una (site 7) – conservation Second-growth forest b Una 15010'11.7''S
área
Neighbor of Ecoparque de Una 39003'16.4''W
a
*Vegetation types: old-growth forest: forest with little or no sign of past human disturbance, a closed canopy, trees in general at least 20 m high
with large diameters, bromeliads in a wide range of sizes and an extensive layer of vines; b Second-growth forest: forest with visible signs of
previous human disturbance, which has been subjected to either ‘general’ (recovering from complete deforestation) or ‘selective’ logging
(recovering from the cutting of selected species). Bromeliads were present, but not often as we found in the primary forest; c Agroforestry: forest
in which the undergrowth has been cut and replaced by cacao trees and other agroforestry systems, such as banana, cupuaçu and rubber trees; d
Agriculture: plantation areas, including coconut, cassava tree, passiflora and rubber trees
Table 2. Most abundant culicids among study sites, habitat and season.
 164

Total Culicidae Count of Richnes Richness Three Most Abundant Culicidae

Site Season Habitat
(N) (N) Taxa (n=47) (n=200) Taxa
Li. pseudomethysticus (39.8%),
All All All 7534 5734 45 11.84 20.73 Wyeomyia sp. (20.1%), Wyeomyia
(Pho.) sp. (6.7%)
Wyeomyia sp. (28.4%), An. (Ano.)
Summer Ground 3308 1907 33 13.01 21.04 sp. (15.8%), Li. pseudomethysticus
(15.8%)
Li. pseudomethysticus (55.5%),
Winter Ground 3910 3561 30 8.06 14.07 Wyeomyia sp. (16.5%), Limatus sp.
(9.8%)
All
Hg. (Hag.) janthinomys (33.3%),
Summer Tree 65 60 6 5.77 NA Sa. (Sbo.) chloropterus (31.7%),
Wyeomyia (Pho.) sp. (16.7%)
Wyeomyia (Pho.) sp. (41.7%), Hg.
Winter Tree 251 206 17 9.97 16.85 (Hag.) janthinomys (20.4%), Sa.
(Sbo.) chloropterus (13.6%)
Wyeomyia sp. (42.5%), Li.
Summer Ground 1155 1145 25 10.52 17.31 pseudomethysticus (23.4%),
Fazenda Almada Wyeomyia (Pho.) sp. (6%)
(Site 1) Hg. (Hag.) janthinomys (33.3%),
Summer Tree 65 60 6 5.77 NA Sa. (Sbo.) chloropterus (31.7%),
Wyeomyia (Pho.) sp. (16.7%)
Wyeomyia sp. (29.5%), Li.
Fazenda Bomfim
Summer Ground 139 139 13 8.97 NA pseudomethysticus (22.3%), Li.
(Site 2)
durhamii (21.6%)
An. (Ano.) sp. (72.9%), An. (Ano.)
Fazenda Santa
Summer Ground 454 406 10 4.72 7.83 mediopunctatus (16.5%), Li.
Rita (Site 3)
durhamii (5.9%)
Wyeomyia sp. (46.7%), Limatus sp.
Summer Ground 15 15 4 NA NA
Colônia de Una (40%), Ps. (Gra.) cingulata (6.7%)
(Site 4) Wyeomyia sp. (36.6%), Limatus sp.
Winter Ground 1152 1072 16 7.26 10.53
(32.6%), Li. durhamii (9.8%)
 165

Wyeomyia (Pho.) sp. (31.8%),

Winter Tree 22 22 7 NA NA Wyeomyia sp. (22.7%), Sa. (Sbo.)
chloropterus (18.2%)
Cq. (Rhy.) nigricans (28.8%), Ps.
Summer Ground 163 163 14 9.35 NA (Jan.) ferox (25.2%), Hg. (Hag.)
Lagoa Encantada janthinomys (23.3%)
(Site 5) Li. pseudomethysticus (34.4%),
Winter Ground 128 128 11 7.33 NA Wyeomyia sp. (32%), Wyeomyia
(Pho.) sp. (17.2%)
Hg. (Hag.) janthinomys (61.5%),
Summer Ground 1382 39 4 NA NA An. (Nys.) triannulatus (20.5%),
An. (Ano.) mediopunctatus (10.3%)
Li. pseudomethysticus (61.9%),
REBIO-Una (Site
Winter Ground 562 417 14 7.22 12.09 Wyeomyia (Pho.) sp. (12.7%),
6)
Wyeomyia sp. (10.8%)
Wyeomyia (Pho.) sp. (58.8%), Hg.
Winter Tree 142 97 7 5.32 NA (Hag.) janthinomys (20.6%), Sa.
(Sbo.) chloropterus (14.4%)
Li. pseudomethysticus (86.2%),
Winter Ground 2068 1944 19 5.01 9.57 Wyeomyia sp. (5.6%), Wyeomyia
Ecoparque de (Pho.) sp. (1.7%)
Una (Site 7) Wyeomyia (Pho.) sp. (25.3%), Hg.
Winter Tree 87 87 15 12.11 NA (Hag.) janthinomys (23%), Sa.
(Sbo.) chloropterus (11.5%)
 166

Table 3. Mosquitoes of the Cullicidae family collected during 2009-2014 in Bahia, Brazil
Tribe Genus SubGenus Species
Aedini Aedes Ochlerotatus
fluviatilis
fulvus
scapularis
serratus
Stegomyia albopictus
Haemagogus Haemagogus janthinomys
Psorophora Grabhamia cingulata
Janthinosoma albipes
ferox
Culicini Culex Carrollia sp.
Culex sp.
Melanoconion sp.
Mansoniini Coquillettidia Rhynchotaenia nigricans
sp.
venezuelensis
Mansonia Mansonia sp.
titillans
Sabethini Johnbelkinia longipes
sp.
Limatus durhamii
pseudomethysticus
sp.
Runchomyia Runchomyia sp.
Sabethes Sabethes albiprivus
belisarioi
cyaneus
quasicyaneus
sp.
tarsopus
Sabethinus sp.
Sabethoides chloropterus
Peytonulus soperi
Trichoprosopon digitatum
Wyeomyia Phoniomyia sp.
sp.
Uranotaeniini Uranotaenia Uranotaenia calosomata
geometrica
sp.
Anopheles intermedius
 167

Anopheles mediopunctatus
sp.
Kerteszia sp.
Nyssorhynchus albitarsis
sp.
triannulatus
Stethomyia nimbus
 168

APÊNDICE D:

CATENACCI, L. S.; NUNES NETO, J.; CASTRO, F. C.; LEMOS, P.; OYAMA, E.; DEEM,
S.L.; TRAVASSOS DA ROSA, E.S. New Records of Mosquito Species (Diptera: Culicidae)
for Bahia (Brazil). Int. J. Mosq. Res., v. 4, n. 4, p. 12-16, 2017.

ISSN: 2348-5906
CODEN: IJMRK2
IJMR 2017; 4(4): 12-16
© 2017 IJMR
Received: 03-05-2017
Accepted: 04-06-2017
Lilian Catenacci
(A) Federal University of Piauí
State, Professora Cinobelina Elvas,
Bom Jesus, 64900-000/PI, Brazil
(B) Virology Graduate Program,
Evandro Chagas Institute-
Ministry of Health, Ananindeua,
67030-000/ PA, Brazil
Joaquim Nunes-neto
Section of Arbovirology and
Hemorrhagic Fevers, Evandro
Chagas Institute- Ministry of
Health, Ananindeua, 67030-000/
PA, Brazil
Francisco Corrêa Castro
Section of Arbovirology and
Hemorrhagic Fevers, Evandro
Chagas Institute- Ministry of
Health, Ananindeua, 67030-000/
PA, Brazil
Poliana Lemos
Section of Arbovirology and
Hemorrhagic Fevers, Evandro
Chagas Institute- Ministry of
Health, Ananindeua, 67030-000/
PA, Brazil
Eduardo Oyama
Center for Technological
Innovation, Evandro Chagas
Institute- Ministry of Health,
Ananindeua, 67030-000/ PA, Brazil
Sharon L Deem
Institute for Conservation
Medicine, Saint Louis Zoo, Saint
Louis, 63110/MO USA
Elizabeth Travassos-da-Rosa
Virology Graduate Program,
Evandro Chagas Institute-
Ministry of Health, Ananindeua,
67030-000/ PA, Brazil
Correspondence
Lilian Catenacci
(A) Federal University of Piauí
State, Professora Cinobelina Elvas,
Bom Jesus, 64900-000/PI, Brazil
(B) Virology Graduate Program,
Evandro Chagas Institute-
Ministry of Health, Ananindeua,
67030-000/ PA, Brazil
169
International Journal of Mosquito Research 2017; 4(4): 12-16
New records of mosquito species (Diptera:
Culicidae) for Bahia (Brazil)
Lilian Catenacci, Joaquim Nunes-neto, Francisco Corrêa Castro, Poliana
Lemos, Eduardo Oyama, Sharon L Deem and Elizabeth Travassos-da-
Rosa
Abstract
We provide seven new identified mosquitoes in the Bahia State, Brazil: Coquillettidia nigricans,
Johnbelkinia longipes, Limatus pseudomethysticus, Psorophora albipes, Sabethes belisarioi, Sabethes
cyaneus and Sabethes quasicyaneus. This new finding which expands the known distribution of these
seven species of mosquitoes, is of great importance as we work for the development of preventive
measures for arboviruses in Brazil and globally. In other regions of the world, the culicids we report are
known vectors of important arboviruses of human and non-human animal concern, including yellow
fever, Saint Louis encephalitis, equine encephalitis, Guama, Una, Mayaro, wyeomyia and Kairi viruses,
and may play a role in the epidemiology of these diseases in Bahia as well. Our work also highlights the
paucity of data on the insect diversity in different environments in Brazil.
Keywords: Culicidae, Insects, Arbovirus, Atlantic Forest, Agroforestry system, Brazil
1. Introduction
The Diptera, family Culicidae, includes several epidemiologically important species, mostly
related to their role in the transmission of arboviruses and malaria parasites, but also due to the
physical annoyance caused by their bites [1, 2, 3]. The Brazilian northeast state of Bahia is
included in the geographical distribution of several arboviruses [4, 5], with the first case of Zika
virus in humans in Brazil occurring in this state in 2015 [6]. However, few studies have
described the mosquito fauna in Bahia state and the information available is mostly restricted
to those species associated with dengue and malaria transmission, such as Aedes and
Anopheles genus, respectively [7-14]. Knowledge of the distribution of mosquito species is
essential for understanding the risks to human and animal health and for development of future
control measures [1, 3]. The objective of the present paper is to present new records of seven
mosquito species belonging to five genera in the State of Bahia, Brazil and to discuss the role
of these species in the transmission of arboviruses [1-3].
2. Materials and methods
2.1 Collection sites
We collected mosquitoes in six different localities of Ilhéus and Una municipalities, belonging
to the Bahia Atlantic Forest domain, in Northeast Brazil (Fig. 1 and Table 1). The Atlantic
Forest biome is characterized by dense ombrophiles forest and a tropical climate [15]. The mean
annual temperature of this region is 24°C and rainfall average is 1500 mm/yr [16, 17]. The
collection sites were selected in sylvatic (Lagoa Encantada, Una Biological Reserve and
Ecoparque de Una) and rural environments (Almada, Santa Rita and Colônia de Una Farms)
(Table 1). Except for the forest fragments, all other study sites were areas of high human
activities, and were classified as either agriculture or agroforestry systems. Agriculture sites
were those that had been clear-cut into open area agricultural plantations. The agroforestry
system in Bahia is called cabruca, where cacao is grown in the shade of native canopy trees
[18]
. Mosquitoes were captured opportunistically by State and Health Entomological Services
during their surveillance programs between 2009 to 2014.
~ 12 ~ 
 170
International Journal of Mosquito Research 
 

Fig 1: Study sites where the mosquitoes were captured: Ilhéus city (on the top) and Una city (on the bottom), Bahia State, Brazil.

Table 1: Study sites where the culicids where captured, including the dominant type of vegetation, the municipalities and the geographic
coordinates.
Study site Predominant type of vegetation Cities, State Coordinates
Almada Farm Agroforestry (cacao) with second-growth forest 14039'49.4''S
Ilhéus, Bahia
Neighbor of Santa Rita Farm 39011'36.8''W
Santa Rita Farm Agroforestry (cacao) with second-growth forest Ilhéus, Bahia
Second-growth forest close to a big lake 14037'10.5''S
Lagoa Encantada Ilhéus, Bahia
Close to Almada Farm 39008'14.6''W
Clear cut agricultural plantation surrounded by forest 15017'11.1''S
Colônia de Una Farm Una, Bahia
Close to REBIO 39008'25.0''W
Primary-growth and Second-growth forest
Una Biological Reserve (REBIO)
Neighbor of Ecoparque de Una
15010'11.7''S
Ecoparque de Una Second-growth forest close to a big river Una, Bahia State
39003'16.4''W

2.2 Capturing mosquitoes 3. Results & Discussion

During daylight sampling, the team members collected
mosquitoes using a hand net. The adult specimens were
transferred immediately to entomological receptacles using
manual suction tube (Castro catcher) and transported with
adequate humidity and temperature conditions to the field
laboratory, following Serra et al. (2016). For nocturnal
sampling, the automatic CDC light trap, without bait, was
used. All captured mosquitoes in the trap were collected the
following morning. Mosquitoes were maintained in -80 C and
shipped in dry ice to the Entomology Laboratory of the
Section of Arbovirology and Hemorrhagic Fevers at the
Evandro Chagas Institute (SAARB-IEC), in the Evandro
Chagas Institute (Pará, Brazil). Mosquito identification was
determined using the descriptions and keys of Consoli (1994).
All specimens were incorporated in the SAARB-IEC, for
future studies.
13 
We recorded seven mosquito species, from five genera, for
the first time in Bahia State, Brazil: Coquillettidia nigricans,
Johnbelkinia longipes, Limatus pseudomethysticus,
Psorophora albipes, Sabethes belisarioi, Sabethes cyaneus
and Sabethes quasicyaneus. (Table 2). Most of the new
records were in the Sabethini tribe, followed by Aedini and
Mansoniini. The species An. (Ste.) nimbus had already been
registered in Bahia state [13], but not in Ilhéus or Una
municipalities (Table 2).
The species in the Sabethini tribe were from the genus
Sabethes and included Sa. (Sabethes) belisarioi, Sa.
(Sabethes) cyaneus and Sa. (Sabethes) quasicyaneus.
Mosquitoes of the Sabethes genera grow in tree holes,
bromeliads, bamboos and palm axils, and are frequently found
in wild places, having a secondary role in the enzootic cycle
of arboviruses [19, 20, 21]. The high presence of bromeliads in
the Bahia Atlantic Forest and the cacao agroforestry systems
could explain the presence of these species [22, 23]. They were

 

International Journal of Mosquito Research 
collected in the canopy and on the forest floor in forest
fragments and the ground in agroforestry systems, but not in
the agriculture site (Table 1 and 2). The Sa. belisarioi is an
exclusively sylvatic mosquito with adults often present on the
ground, but also with acrodendrophilous habitat [24].
Mosquitoes of this species have previously been detected with
Saint Louis virus in Belém city (Para State, Brazil), and its
geographic distribution includes Argentina, Bolivia,
Colombia, French Guiana, Guyana, Panama, Peru, Suriname,
Trinidad and Tobago, Venezuela [24, 25, 26]. Corroborating with
other studies, adults of Sa. cyaneus rarely are found at ground
level and thus are thought unlikely to directly transmit yellow
fever virus (YFV) to humans [27, 28]. However, few studies
have addressed the role of this species as a secondary vector
in the enzootic cycle of YFV, [25, 26]. It has a distribution in all
South American countries and Antilles, Belize, Costa Rica,
Honduras, Mexico, Nicaragua, Panama, Trinidad and Tobago.
Although we registered the Sa. quasicyaneus on the forest
floor, previous researchers [29] described this culicid dominant
in canopies during an entomological surveillance at the Serra
dos Órgãos National Park, Rio de Janeiro. Brazil. The species
has also been collected in other countries, including Colombia
and Peru [24, 25] but no arboviruses were isolated from this
species of mosquitoes.
Limatus pseudomethysticus mosquitoes were collected
primarily from the ground level in rural and sylvatic
environments, corroborating with Guimarães et al (1985),
who found the Limatus genus mostly on the ground (Table 2).
The sylvatic environments are the dominant habitat reported
for this species, once bromeliads, axilla of trees their main
breeding sites [2]. Li. pseudomethysticus occurs only in Brazil,
French Guiana and Suriname [25, 26]. Based on previous
studies, the finding of Johnbelkinia longipes inside of an
exclusive agriculture site was not expected, once this species
prefers preserved areas to lay eggs [2, 5]. It is known in Bolivia,
171
Colombia, Costa Rica, Ecuador, French Guiana, Guatemala,
Guyana, Nicaragua, Panama, Paraguay, Peru, Suriname and
Venezuela, while No findings are available about medical
importance for Li. Pseudomethysticus and J. longipes,
although other Limatus species already were infected with
Maguari and Guama virus in Brazil.
The only new record of the Aedini tribe in Bahia State, Ps.
albipes, were collected in a agriculture area in Una City,
Bahia (Table 1 and 2). This finding corroborated with
previous studies, in which adults were found in open natural
areas, such as savannas, or in rural areas close to plantations
[2])
. Individuals have been registred in Argentina, Belize,
Bolivia, Colombia, Costa Rica, Ecuador, French Guiana,
Guatemala, Guyana, Honduras, Mexico, Nicaragua, Panama,
Paraguay, Peru, Suriname, Trinidad and Tobago and
Venezuela [25, 26]. This species is important in the
epidemiology of many arboviruses including yellow-fever,
Venezuelan equine encephalitis, Guama, Una, Mayaro,
wyeomyia and Kairi virus [25].
The representative of the Mansonini tribe, Coquillettidia
(Rhynchotaenia) nigricans, were collected in all forest
fragments (Table 2) mostly at ground level. Its geographic
distribution includes Argentina, Belize, Bolivia, Colombia,
Costa Rica, Cuba, Ecuador, El Salvador, French Guiana,
Guatemala, Honduras, Jamaica, Mexico, Nicaragua, Panama,
Paraguay, Peru, Trinidad and Tobago and Venezuela (24)(25).
Coquillettidia spp. mosquitoes are considered aggressive, avid
blood feeders of humans and/ or other animals [2]). Previous
studies described other species for the same genera hosting
forest and areas close to residence, because of these feeding
behaviors or because of their attraction to artificial light [5,
30]
.Although the C.(Rhy.) nigricans is not known to be
naturally infected with arboviruses, other Coquillettidia spp.
have been detected with Una, Oriboca, bussuquara,
Oropouche and wyeomyia virus [24, 25].

Table 2: Identification of the new records of culicids in Bahia State, Brazil, including the habitat, the numbers of individuals captured.
Individuals collected
Tribe Genus Sub genus Species Habitat collected Site name City
(N)
Anopheles Stethomyia nimbus floor 2 Ecoparque Una
Aedini Psorophora Janthinosoma albipes floor 3 Almada Farm Ilhéus
Mansoniini Coquillettidia Rhynchotaenia nigricans floor 57 Lagoa Encantada Ilhéus
floor 1 Ecoparque Uma
floor 5 REBIO Uma
canopy 1 REBIO Uma
Johnbelkinia longipes floor 5 Colônia de Una Uma
Limatus pseudomethysticus floor 264 Almada Farm Ilhéus
floor 2 Santa Rita Farm Ilhéus
floor 1700 Ecoparque Una
canopy 6 Ecoparque Una
Sabethini floor 258 REBIO Una
Sabethes Sabethes belisarioi canopy 1 Ecoparque Una
Sabethes Sabethes cyaneus canopy 1 Ecoparque Una
floor 1 Ecoparque Una
canopy 3 REBIO Una
Sabethes Sabethes quasicyaneus floor 1 Almada Farm Ilhéus

4. Conclusions human animal health concerns, although their full capacity is

To the authors’ knowledge, this is the first time any of these
seven culicids species have been identified in Bahia, State,
Brazil.
Many of the mosquito species found in this study have vector
competence for pathogens and parasites of human and non-
14 
poorly understood. The ongoing studies addressing ecological
aspects and geographical distribution of mosquitoes may
provide information on the potential risks for animal and
human populations living in rural areas in Bahia state,
including the Una and Ilhéus municipalities. Currently these

 

International Journal of Mosquito Research 
cities have no recommendations for yellow-fever vaccine,
although based on our findings we know that secondary
vectors of this arbovirus are present in the region.
Furthermore, the new reports of insect fauna in different
environments; forest, agroforestry systems and traditional
agriculture, emphasizes the need for entomological studies
focusing on different landscapes across Brazil.
Acknowledgments
The authors thank the important contributions of the
Municipal and Bahia State Health Department for logistical
support in the field and colleagues from the Evandro Chagas
Institute, especially Hamilton A. Monteiro and Bruna
Nascimento for assistance with the identification of the
specimens. Additional thanks goes to Project BioBrasil/Centre
for Research and Conservation, ICMBio, the Saint Louis Zoo
Institute for Conservation Medicine team and the Bicho-da
mata NGO for their logistical support. We also thank the
sponsoring institutions that made this project possible: Saint
Louis Zoo WildCare Institute (USA), The Wild Animal Fund,
from the American Association of Zoological Veterinarians
(USA), CNPq (Brasil), the Center for Research and
Conservation of the Royal Zoological Society of Antwerp
(Belgium), Lion Tamarins of Brazil Fund, National Lottery of
Belgium, Primate Action Fund, Zoological Society of
London, Fundação o Boticário de Proteção a Natureza. The
Flemish Ministry of Science (Belgium) provided structural
support to the Center for Research and Conservation of the
Royal Zoological Society of Antwerp.
References
1. Dégallier N, Travassos da Rosa APA, Vasconcelos PFC,
Travassos da Rosa ES, Rodrigues SG, Sá Filho GS. New
entomological and virological data on the vectors of
sylvatic yellow fever in Brazil. Journal of the Brazilian
Association for lhe Advancement of Science, 1992;
44:136-42.
2. Consoli RAGB, Oliveira RL de. Principais mosquitos de
importância sanitária no Brasil. Editora Fiocruz, Rio de
Janeiro, Brazil, 1994, 228.
3. Müller GA, Kuwabara EF, Duque JE, Navarro-Silva MA,
Marcondes CB. New records of mosquito species
(Diptera: Culicidae) for Santa Catarina and Paraná
(Brazil). Biota Neotropica, 2008; 8(4):211-218.
4. Pauvolid-Corrêa A, Tavares FN, Alencar J, Silva J dos S,
Murta M, Serra-Freire NM et al. Preliminary
investigation of Culicidae species in South Pantanal,
Brazil and their potential importance in arbovirus
transmission. Revista do Instituto de Medicina Tropical
de São Paulo. 2010; 52(1):17-24.
5. Forattini OP. Culicidologia médica: identificação,
biologia, epidemiologia. EDUSP, São Paulo, Brazil,
2002; 2:864.
6. Campos GS, Bandeira AC, Sardi SI. Zika Virus
Outbreak, Bahia, Brazil. Emerging Infectious Diseases,
2015; 21(10):1885-6.
7. Carvalho-Pinto CJ de, Lourenço-de-Oliveira R.
Isoenzimatic analysis of four Anopheles (Kerteszia) cruzii
(Diptera: Culicidae) populations of Brazil. Memórias do
Instituto Oswaldo Cruz. 2004; 99(5):471-5.
8. Hutchings RSG, Sallum MAM, Ferreira RLM, Hutchings
RW, The Nelson L. Cerqueira Mosquito Collection
15 
172
(Diptera, Culicidae) in the Invertebrate Collection of the
Instituto Nacional de Pesquisas da Amazônia, Manaus,
Brazil. Revista Brasileira de Entomologia, 2005;
49(1):15-28.
9. Santos IM dos, Calado D. Capture of anthropophilic
mosquitoes (Diptera, Culicidae) in an urban area of the
western Bahia, Brazil. Iheringia Série Zoologica. 2014;
104(1):32-8.
10. Santos DA, Thibes R. Simulações numéricas de um
modelo de transmissão de dengue em microrregiões do
sudoeste da Bahia (Brasil). Tendências em Matemática
Aplicada e Computacional. 2014; 15(3):249-59.
11. Souza RL, Santos RF, Nunes Neto J, Monteiro HA,
Vasconcelos PF. Monitoramento entomológico em área
de ocorrência de febre amarela silvestre no oeste da
Bahia. 2015; 39:136-149.
12. Secretaria de Saúde do Estado da Bahia. Atualização da
distribuição de Aedes aegypti e Aedes albopictus na
Bahia. Boletim Entomológico, 2016, 1-2.
13. Secretaria de Saúde do Estado da Bahia. Carta anofélica
da Bahia, Brasil (Diptera: Culicidae). Boletim
Entomológico. 2016; 3:1-2.
14. Costa IMP, Calado DC, Costa IMP, Calado DC.
Incidence of dengue cases (2007-2013) and seasonal
distribution of mosquitoes (Diptera: Culicidae) (2012-
2013) in Barreiras, Bahia, Brazil. Epidemiologia e
Serviços de Saúde. 2016; 25(4):735-44.
15. Alger K, Caldas M. The declining cocoa economy and
the Atlantic Forest of Southern Bahia, Brazil:
Conservation attitudes of cocoa planters.
Environmentalist. 1994; 14(2):107-19.
16. Karger DN, Conrad O, Böhner J, Kawohl T, Holger K,
Soria-Auza RW et al. climatologies at high resolution for
the earth’s land surface areas (Version 1.1), 2016; World
Data Cent Clim, 2016.
17. Karger DN, Conrad O, Böhner J, Kawohl T, Kreft H,
Soria-Auza RW et al. Climatologies at high resolution for
the Earth land surface areas, 2016; ArXiv160700217
Phys.
18. Sambuichi RHR, Vidal DB, Piasentin FB, Jardim JG,
Viana TG, Menezes AA et al. Cabruca agroforests in
southern Bahia, Brazil: tree component, management
practices and tree species conservation. Biodiversity and
Conservation Journal. 2012; 21(4):1055-77.
19. Guimarães AE, Arlé M, Machado RNM, Guimarães AE,
Arlé M, Machado RNM. Mosquitoes in the National Park
of Serra dos Orgãos, State of Rio de Janeiro, Brazil: II.
Vertical distribution. Memórias do Instituto Oswaldo
Cruz, 1985; 80(2):171-85.
20. Gomes A de C, Torres MAN, Paula MB de, Fernandes A,
Marassá AM, Consales CA et al. Ecologia de
Haemagogus e Sabethes (Diptera: Culicidae) em áreas
epizoóticas do vírus da febre amarela, Rio Grande do Sul,
Brasil. Epidemiologia e Serviços de Saúde. 2010;
19(2):101-13.
21. Paula MB de, Fernandes A, Medeiros-Sousa AR, Ceretti-
Júnior W, Christe R, Stroebel RC et al. Mosquito
(Diptera: Culicidae) fauna in parks in greater São Paulo,
Brazil. Biota Neotropica. 2015; 15(3).
22. Catenacci LS, De Vleeschouwer KM, Nogueira-Filho
SLG. Seed Dispersal by Golden-headed Lion Tamarins
Leontopithecus chrysomelas in Southern Bahian Atlantic
 173
International Journal of Mosquito Research 
 
Forest, Brazil. Biotropica. 2009; 41(6):744-50.
23. Fontoura T, Cazetta E, Nascimento W do, Catenacci L,
De Vleeschouwer K, Raboy B. Diurnal frugivores on the
Bromeliaceae Aechmea depressa L.B. Sm. from
Northeastern Brazil: the prominent role taken by a small
forest primate. Biota Neotropica, 2010; 10(4):351-4.
24. Alan Martins da Silva. Sabethes (Sabethes) belisarioi
Neiva, 1908 (Diptera Culicidae) em ambiente antrópico
no Estado do Paraná, Brasil. Entomología y Vectores,
2003; 10(3):353-60.
25. Segura MNO, Castro FCC. Atlas de Culicídeos na
Amazônia Brasileira, Instituto Evandro Chagas Press,
Belém Pará, Brazil, 2007, 167.
26. WRBU. Walter Reed Biosystematics Unit
http://www.wrbu.org/. 31st may, 2017.
27. Pinto CS, Confalonieri UE, Mascarenhas BM. Ecology of
Haemagogus sp. and Sabethes sp. (Diptera: Culicidae) in
relation to the microclimates of the Caxiuanã National
Forest, Pará, Brazil. Memórias do Instituto Oswaldo
Cruz. 2009; 104(4):592-8.
28. Santos-Mallet J, Sarmento JS, Alencar J, Müller GA,
Oliveira EM, Foster WA et al. Scanning Electron
Microscopy of Eggs of Sabethes cyaneus. Journal of the
American Mosquito Control Association. 2013; 29(1):64-
8.
29. Guimarães AE, Arlé M, Machado RNM, Guimarães AE,
Arlé M, Machado RNM. Mosquitoes in the National Park
of Serra dos Orgãos, State of Rio de Janeiro, Brazil: I.
Stational distribution. Memórias do Instituto Oswaldo
Cruz, 1985; 80(2):171-85.
30. Guimarães AÉ, Victório VMN, Guimarães AÉ, Victório
VMN. Mosquitoes in the Parque Nacional da Serra dos
Orgãos, State of Rio de Janeiro, Brazil: III. Hour
preference for blood sucking. Memórias do Instituto
Oswaldo Cruz. 1986; 81(1):93-103.

16 

 
 174

APÊNDICE E:

CATENACCI, L. S.; PAZ, T.; HERNANDEZ, L. H. A.; CARVALHO, V. L.; CASSEB, S. M.

M.; NUNES NETO, J. P.; DEEM, S. L.; APAKUPAKUL, K.; MASSAFRA, J. M. V.; VIANEZ
JUNIOR, J. L. S. G.; TRAVASSOS DA ROSA, E. S.; CRUZ, A. C. R. Rapid molecular
monitoring of arbovirus in field-caught arthropods using universal primers. (A ser submetido
para The American Journal of Tropical Medicine and Hygiene)
 175

Detection of arbovirus in potential vectors by RT-PCR

Rapid molecular monitoring of arbovirus in field-caught arthropods using universal

primers
Lilian Silva Catenacci1,2*, Thito da Paz2,3, Leonardo Henrique Almeida Hernández2,3, Valeria
Lima Carvalho2, Samir Mansour Moraes Casseb2, Joaquim Pinto Nunes Neto2, Sharon L.
Deem4, Kathleen Apakupakul4, Janaína Mota de Vasconcelos Massafra2,5, João Lídio da Silva
Gonçalves Vianez Junior2, Elizabeth Salbe Travassos da Rosa2 and Ana Cecília Ribeiro Cruz2

1
Federal University of Piauí State, Professora Cinobelina Elvas, Bom Jesus, PI, Brazil;
2
Evandro Chagas Institute- Ministry of Health, Ananindeua, PA, Brazil; 3 Para State
University, Belém, PA, Brazil; 4Institute for Conservation Medicine, Saint Louis Zoo, Saint
Louis, MO, USA; Federal University of Pará State, Belém, PA, Brazil5

Key words: Arbovirus, molecular biology, vectors, RT-PCR

Words count (abstract): 157

Words count (text): 3.364
Number of figures: 1
Number of tables: 3

* Federal University of Piauí State, Professora Cinobelina Elvas, Bom Jesus, Rodovia Bom
Jesus Viana, 64900-000/PI, Brazil, catenacci@ufpi.edu.br, +55 (89) 999001212
 176

Abstract
The surveillance of arboviruses in field-collected mosquitoes is an important tool for detecting
emerging viruses, especially given the recent public health concerns with Chikungunya, West
Nile virus, Zika, dengue and yellow-fever viruses. The purpose of this study was to investigate
the detection of arboviruses using genera-specific primers in the hopes of using this approach
to earlier diagnoses than currently used surveillance techniques. A total of 23 virus purified
viral strains belonging to Alphavirus, Flavivirus and Orthobunyavirus were tested by
conventional reverse transcriptase PCR reaction using genera-specific primers. All were
readily detected by gel electrophoresis of amplified products. The same technique was then
performed to detect the viruses in macerated arthropods and in infected cells from infected
arthropods. From 304 pools of arthropods, 41 showed bands corresponding to Alphavirus
(n=22), Flavivirus (n=17) and Orthobunyavirus (n=2). Our data suggest that our approach to
detection RNA viruses in arthropods is rapid, sensitive, specific, and low cost for entomological
arbovirus surveillance.

Introduction
Mosquito-borne arboviruses are widely distributed throughout the world, causing important
human and animals illnesses.1 The ongoing emergence of these viruses poses major public
health concerns worldwide.2,3 Flavivirus, Alphavirus, and Orthobunyavirus are some of the
most important arbovirus genera for the purposes of surveillance.4,5 Additional arboviruses of
unknown pathogenicity have also been described in hematophagous arthropods without a
vertebrate host6, including cell fusing agent virus (CFA), Kamiti River virus (KRV) and Culex
flavivirus (CxF). 5,7,8
Mosquitoes (Diptera: Culicidae) in the tribe Sabethini and in the genera Aedes spp., Anopheles
spp., Culex spp., and Haemagogus spp. are some of the main insects recognized as potential
vectors of arboviruses.7,9–11 These viruses have been introduced into new areas as a consequence
of the rapid expansion of human international travel and the expansion of the population of
potential vectors in urban and peri-urban areas. The ecological disturbances caused by humans
have resulted in an imbalance of sylvatic cycles, bringing vectors and the arboviruses they carry
closer to urban areas.1,6,9,12 Furthermore, the lack of effective antiviral treatments and vaccines
for human and non-human animals for most arboviruses and the difficulty of vector control has
enabled viruses and insects to become a threat that may result in explosive epidemics, as
recently described for chikungunya (CHIKV) and Zika (ZIKV) virus in humans or enzootics,
as yellow-fever virus (YFV) in the Americas.1,4 Generally, mosquitoes infected by arboviruses
 177

are detected for up to six weeks prior to the beginning of an outbreak13. Moreover, infected
mosquitoes carry the virus for their entire life, presenting as an epidemiological indicator of
arboviruses circulation in a given area.14
In this context, the development of methods to enable early detection of arboviruses in their
mosquito vectors is essential for advanced surveillance and to estimate the risk of exposure to
humans and animals.1,15 Currently, diagnosis of arbovirus infection has been performed mainly
by either virus isolation, serological assays, or by reverse transcription-polymerase chain
reaction (RT-PCR) using highly species-specific primers to some arboviruses.1,16–1817 But virus
isolation in cell culture is sometimes unwise due to the characteristics of the viruses, and implies
the use of facilities which provide a high level of biosafety.19,20 However, in entomology
surveillance we believe there is a real need to develop genus-specific PCR based assays as a
low cost screening approach to screening PCR based assays with viral specific
primers.7,9,14,17,21,22 Furthermore, using genus specific primer, there is a opportunity to detect
novel virus that may be circulating in the area sampled,
In the current study, we evaluate a RT-PCR protocol using three pairs of genus-specific primers
for the detection of the most common American mosquito-borne alphaviruses, flaviviruses, and
orthobunyaviruses in hematophagous arthropods. Furthermore, we present the applicability of
this feasible and inexpensive diagnostic method for arthropods collected in natural and rural
areas in Bahia State, Brazil.

Material and methods

Prototype virus strains and RNA extraction

The viral strains used in this study were obtained from the Section of Arbovirology and
Hemorrhagic Fevers at the Instituto Evandro Chagas (SAARB-IEC), (Table 1). The strains were
propagated by intracerebral inoculation of 1-2-day-old suckling mice (Mus musculus) or into
C6/36 cell cultures. 23 Infected tissue brains were triturated with 5mm stainless steel beads and
diluted into 20% heat-inactivated fetal bovine serum, 77% D-PBS, 1% of
gentamicin/streptomycin using a TissueLyser (Qiagen, Valencia, CA). After centrifugation
10.000 rpm for 10 minutes, the supernatant was aliquoted as viral stock and stored at -70oC.
Infected C6/36 cells were lyophilized and stored at -70oC. Uninfected cell culture supernatant,
uninfected mice brain tissue extract, pure water, and an uninfected mosquito were used as
negative controls. 24–26
 178

Viral RNAs were extracted with a Trizol Plus RNA purification kit (Thermofisher®, USA),
yielding a 50µl final volume. The total RNA and DNA were quantified by Qubit® Fluorometer,
using the ssDNA BR Assay Kit (Thermofisher®, USA) and Qubit® RNA BR (Broad-Range)
Kit (Thermofisher®, USA). The RNA BR kit is designed to be accurate for RNA initial sample
concentration from 1 ng/µL to 1 µg/µL and ssDNA kit for DNA initial sample concentration
from 50 pg/µl–200 ng/µl.

Primers

We used three pairs of primers for rapid detection of Orthobunyavirus, Flavivirus, and
25,27–30
Alphavirus genera, as previously described. These primers were selected because they
were designed to amplify conserved regions of genomes, producing specific PCR products of
easily distinguishable sizes. The forward M2W (YAGAGCDTTTTCGCAYSTRGCHW) and
reverse cM3W (ACATRAANKGNGTNGTRTCRAANCCDAYCC) primer set is specific for
the nonstructural protein 1 gene of Alphavirus, producing amplicons of approximately 434 bp.
24,25,30,31
The forward cFD2 (GTGTCCCAGCCGGCGGTGTCATCAGC) and reverse MA
(CATGATGGGRAARAGRGARRAG) primer set target to the NS5 gene of Flavivirus,
producing amplicons of approximately 220 bp. 18,29 For Orthobunyavirus, the forward BUN-S
(AGT AGTGTGCTCCAC) and reverse BUN-C (AGTAGTATACTCCAC) produced 700 to
1,100 bp amplicons after targeting to the segment S. 27,28

RT-PCR

We conducted RT-PCR as described by Santos (2013) with modifications in the enzymes and
primers. Briefly, total RNA was reverse transcribed with 12,5ng/µl random hexamers
(Invitrogen®, USA), 0,5mM dNTPs, ultrapure water and denatured at 65°C for 5 minutes. Five
times buffer, 5mMDTT, 40U RNAse inhibitor (RNAse OUT, Invitrogen®, USA) and 200U
reverse transcriptase (SuperScript III, Invitrogen®, USA or M-MLv Invitrogen®, USA) were
then added to the mix, which was then incubated at 25°C for 5 minutes. The cDNA synthesis
was carried out at 55°C for one hour, followed by 70°C for 15 minutes and kept at 4°C until the
PCR step. PCR amplification using primers described above was performed with 5 μL of cDNA
mixed with 10x buffer, 1.5mM MgCl2, 0,2mM dNTP, 0.2 µM forward primer, 0.2 µM reverse
primer, 2U Taq DNA polymerase (Invitrogen®, Brazil) and ultrapure water to 50 μL reaction
volume. Thermocycling conditions were used as described on Table 2. Sixteen microliters of
 179

each PCR product were analyzed by electrophoresis in 2% agarose gels (Ultra-pure gel-
Invitrogen®) diluted in 1X TAE (Tris 10mM; Acetato 0,1 M; EDTA 1mM pH 7,2) and
visualized with UV light after staining with SYBR® Safe DNA gel stain (Invitrogen®, USA),
as described by Kuno and Chang (2005) and Figueiredo et al. (1998). The total cDNA were
quantified by Qubit Assay Kits (Thermofisher®, USA) using the manufacture’s descriptions.

Limit of detection and specificity of RT-PCR

To estimate the limit of detection of RT-PCR for Flavivirus, we used known 10-fold serial
dilutions of ZIKV, DENV, YFV and vaccinal YFV (17D) stock that already had been quantified
using real time RT- PCR at SAARB-IEC. 1,32 Serial dilutions of these viruses were prepared in
30
phosphate-buffered saline (PBS). The initial RNA concentration previously quantified by
real time RT-PCR for ZIKV, DENV (all serotypes), YFV, and 17D were 108, 109, 1011, and
1012 million of copies respectively. For the limit of detection of Alphavirus, 108 million copies
were the initial concentration of CHIKV virus RNA.
The specificity of the universal primers was tested using three negative controls and at least
three virus strains that did not belong to the genus-specific primer tested. For example, the
Flavivirus genus primers were tested with known samples of CHIKV, MAYV, EEEV as well
as with ultrapure water, uninfected brain tissue and uninfected mosquitoes.

Arthropod samples

To evaluate the applicability of our assay for RNA extracted from arthropods, we took two
different approaches. In the first, we extracted total RNA directly from triturated mosquitoes.
In the second, RNA was extracted from either C6/36 cells or Vero cells inoculated with those
pools of arthropods that had been previously confirmed infected by cytopathic effect (CPE).
For this study, we took advantage of arthropods previously captured and pooled from 2009 to
2014 in natural and rural areas of the Southern Atlantic Forest, at Una and Ilhéus municipalities,
in Bahia State, Brazil, as part of an arbovirus surveillance program. A total of 7699 insects
grouped in 304 pools with 1-91 insects per cryotube were evaluated by date, collection site,
11
traps and taxonomic identification. Vectors were identified and found to be distributed
amongst the families Culicidae and Psychodidae. The mosquitoes were triturated with 3mm
tungsten beads and diluted into 20% heat-inactivated fetal bovine serum, 77% D-PBS, 1% of
gentamicin/streptomycin using a TissueLyser (Qiagen, Valencia, CA). After centrifugation
 180

10.000 rpm for 10 minutes, the supernatant was aliquoted as viral stock and stored at -70oC. In
addition to performing the RNA extractions (Iprep Pure Link Virus kit, Invitrogen®) and RT-
PCR directly from the supernatant of macerated mosquitoes, the 304 pools were also inoculated
in C636 and Vero cell cultures. Of these, 64 demonstrated CPE and were submitted for the
RNA extraction (Trizol Plus RNA purification kit, Thermofisher®, USA). RT-PCR using the
genus-specific primers was the same as described for the prototype strain virus. Amplicons
visualized in the transilluminator were recovered from an agarose gel and purified using the
QIAquick PCR Purification Kit (Qiagen®) according to the manufacturer’s instructions and
resuspended in 50 ml of sterile, ultrapure water. The purified amplicons were stored at -20o until
sequencing.
Minimum infection rate (MIR) for each species of artropods by virus genera was calculated
using the formula [(number of positive pools/total specimens of the species tested) x 1,000]
(Table 3). 14

Sequence and data analyses

Amplified cDNA was sequenced bidirectionally on the ABI PRISM 3130 (Applied
Biosystems®, USA) using the Big Dye Terminator v3.1 Cycle Sequencing Kit (Applied
Biosystems®, USA).6 The results were analyzed using Unipro UGENE v1.26 and compared
through BLAST with reference sequences available in GenBank National Center for
Biotechnology Information (NCBI). In the BLAST program the E-Value and the cover of the
alignments were evaluated. The sequence of virus that showed the highest E-values was
considered the probable virus presented in mosquitoes samples.
Results
Detecting virus strains using the genus-specific primers
The genus-specific primers and RT-PCR protocol used in the present study could detect virus
strains using the designed primers (Figure 1E).
The positive results visualized by gel electrophoresis were repeated, and in all cases, only the
amplicon with expected size was visualized on the agarose gel.
 181

Limit of detection and specificity of RT-PCR

The sensitivity of the RT-PCR for both propagated ZIK and DENV (all serotypes) was about
106 million RNA copies (Figure 1D),109 million copies of YFV and 17D and 108 million of
CHIKV RNA.
Cross-reactivity between genera-specific primers was not observed, and no amplicons were
obtained from negative controls, indicating that these assays were virus genus specific.

Arthropod samples

Of the 304 arthropod pools, 40 amplified target RNA for some viral genera. Twenty two pools
(12 mosquitoes and one sand flie taxa) were positive for the Alphavirus RNA, 17 pools (12
mosquitoes and one sand flie taxa) were positive for the Flavivirus and 2 (one genus species of
mosquitoes) were positive for Orthobunyavirus RNA (Table 3; Figure 1A,B,C). No pools were
co-infected with more than one targeted virus. The lower minimum infection rate for both
Flavivirus and Alphavirus genera were for the Flebotominae family (MIR=0.55; 1.1) and the
higher MIR were found for Ma. (Man) species and Sa. (Sab.) species (MIR=200; 1000),
respectively. The Orthobunyavirus positive belongs to the same culicids species, Wyeomyia
species.
From the 304 pools quantified for total RNA, 40% showed concentrations bellow to the initial
concentration designed for the kit; but even with the lower concentration, the RT-PCR was
efficient to amplify and detect the viral (Table 3). Among the total cDNA quantified, 24.2%
showed concentrations lower than designed for the kit. In both quantifications (RNA or cDNA),
the macerated crude mosquitoes presented the highest number of pools with lower
concentrations (Table 3).

Sequence and data analyses

Five arboviruses were identified from 16 pools of arthropods: Mosquito Flavivirus, Kamiti
River virus, Mayaro virus (MAYV), Mucambo virus (MUCV) and Rocio virus (ROCV).
Another seven pools sequenced showed no significant similarity with the NCBI data base. The
alphaviruses detected in a pool of Wyeomyia spp. were identified by it sequence as MAYV
 182

(GenBank accession number KY985361.1). The flaviviruses were identified as ROCV

(Flebotominae, Aedes fulvus, Limatus pseudomethysticus, Hg. (Hag.) janthinomys, Weyomia
phoniomyia spp.) (Genbank accession numbers AY632542.4, KY985361.1); MUCV (Limatus
pseudomethysticus) (Genbank accession number AF075253.1); Kamiti river virus (An. (Ano.)
species, Limatus pseudomethysticus) (Genbank accession numbers AY149905.1,
EU074051.1); Mosquito flavivirus (An. (Nys.) triannulatus, An. (Ano.) spp., Runchomya spp.)
(Genbank accession numbers GQ477005.1, KM088041.1, HQ441862.1). ROCV was the most
commonly detected arbovirus.

Discussion

Testing of mosquito pools for the presence of human pathogenic viruses is one of the primary
sources of arbovirus surveillance data. Such information is important for determining when
control measures are necessary, and what these measures should include for greatest
effectiveness. Consequently, it is essential that the method employed exhibits great sensitivity
and specificity. Because of the large number of arthropods samples to be tested, it is also
desirable that the methods employed be simplified as much as possible33. The present study
demonstrated that the use of genera-specific primers in this simplified RT-PCR assay is suitable
as a rapid screening test for infected mosquitoes that may carry the most important American
arboviruses (Table 3, Figure 1A,B,C). Furthermore, the use of genera-specific primers might
allow the discovery of novel virus which belongs to some of the genera tested. Although RT-
PCR protocols using universal primers for Alphavirus and Flavivirus detection have been
developed previously in infected mouse brain tissue, human blood, and cell culture1,7,17–
20,24,25,30,34
, a sensitive genera-specific RT-PCR protocol that detects the presence of viruses
directly from naturally infected sylvatic arthropods had barely been performed in South
America.9,14 Some studies with crude mosquitoes have been made in Europe and USA, but
using different primers. Our study besides to confirm the efficiency of the primers for natural
mosquitoes infected, was capable to detect virus belonged to Orthobunyavirus genus, that have
not been tested before with this protocol: GAMV, GMAV, CATUV, CARV and TCMV (Figure
1E). As described by Figueiredo et al. (1998), this single RT-PCR assay requires less work, has
a shorter turnaround time, a reduced risk of contamination, and uses smaller amounts of
reagents compared to other reported assays, providing a more economical option for virus
testing; a significant benefit for developing countries. Viruses for which animal or cell culture
infectivity assays exist can take upwards of two weeks to perform; hence a more rapid method
 183

such as PCR35 from crude arthropod samples would be appropriate. We have adapted a rapid
RT-PCR assay for typing three arbovirus genera in the arthropods themselves for use under
difficult conditions often prevailing in countries where several sylvatic and urban arboviruses
such as Dengue, Zika, Yellow Fever, Oropouche, and Chikungunya are endemic.4,34,36,37
Furthermore, the concern to improve the entomofauna surveillance becomes apparent taking in
consideration the huge neotropical diversity of insects, including culicids, known vectors of
arboviruses spread globally. 6,7,9,10,15,38–40
The specificity of the primers for each genus was confirmed once no cross-reaction among them
was observed and all negative controls were maintained without visualization of bands in the
agarose gel. The same specificity results were already found in previous studies that used the
MAY-1, MAY-2, cfD2, MA, BUN-C and BUN-S for detection of arbovirus in tissue and blood
samples.1,7,24–26
35
Sellner et al. found a limit of detection of 109 million copies using RT-PCR with specific
primers for the alphavirus Ross River virus in crude mosquitoes collected in Australia. Our
study showed a higher limit of detection, that may be associated the primers tested (Figure 1D).
Sanchez et al (2005) described that the amplification of internal control can also be measured
and used to quantify the viral load.
The success of the conventional RT-PCR does not depend on the viability of the virus or its
intact antigenic structure, but depends on the integrity of the genetic material and the RNA
concentration of the samples.25,41 The low RNA titer often found in crude sylvatic mosquitoes,
quantified indirectly by the total RNA, may compromise the amplification of cDNA, the
visualization of bands in the agarose gel and further sequence analysis.18,35 Our results showed
that even low concentrations of total RNA generated amplification of cDNA (Table 3).
However, other studies suggest using hybridization or nested RT-PCR techniques to improve
sensitivity of RT-PCR, in cases when light bands were displayed after
electrophoresis.19,20,24,25,35 The positive pools which showed lightly bands also could be
inoculated via cell culture before sequencing, but this takes longer the diagnostic.22 And it is
important to take into consideration that the viral propagation in cell culture will be influenced
by the ability of the virus to infect cells.42 Inactive virus (i.e., due to failure during
transportation) are unable to infect and propagate into cell culture. 41 Alternatively, active virus
inoculated into cells tends to replicate and raise the possibility of viral detection on RT-PCR8,
even if mosquitoes carry a low initial viral load. The infectivity of the virus and the increase of
RNA viral load after inoculation in cells could explain our findings of positive virus detection
only in RNA extracted from the cell supernatant. Low virus concentration could explain the
 184

differences observed between the method of virus detection using the RNA extracted directly
from the arthropods and the method using RNA extracted from infected cell culture.
A number of studies describe RT-PCR assays for insects to pose the problem of inhibitory
components which compromise the enzyme activities and may lead to false negative
results.21,43,44 These authors consider the presence of chitin from the mosquitoes as inhibitors
of the RNA detection;44 but this issue could can be averted if only the supernatant from the
mosquito-virus lysate is harvested for RNA extraction.8 And according of Ibrahin (1997), the
use of a pool with ten or less mosquitoes should avoid these RT-PCR inhibitors. We believe for
our study that the low virus titers for the crude mosquito samples was the most limiting factor
for virus detection.
Surveillance for vector-borne pathogens and the identification of arthropod vectors that transmit
these agents are both critical components for estimating risk of virus exposure to wildlife,
domestic animals, and humans6. Some of the arthropods in which we detected the presence of
arboviruses in the present study are known to transmit important emerging and reemerging
arboviruses, such as Hg. (Hag.) janthinomys, Ae. (Och.) serratus and Sa. (Sbo.) chloropterus.
10,45,46
However, most of these arthropod-virus relationships remain poorly known. The
probable viral detection of the ROCV, MUCV and MAY in the arthropods suggest the viral
circulation of these viruses in the areas studied. These findings corroborated with previous
seroprevalence study in the region, in which at least MAYV and ROCV antibodies were
described in two species of free-living monkeys (Leontopithecus chrysomelas and Sapajus
xanthosthernos). 47 The lower MIR for the Flebotominae family was expected in those genera
studied, since another arbovirus genus, the Pheblovirus, is known for the most virus isolation
and detection in the sandflies. The viruses exclusive of insects (i.e. they do not seem to grow
on vertebrate cell lines) were already defined as mosquito-only flaviviruses or insect-specific
7,8
flaviviruses. At least eleven of these viruses were isolated worldwide in several mosquito
species. Therefore, our findings suggested that the Flavivirus genus specific primers might to
be able to detect at least the circulation of three mosquito-only flaviviruses. Moreover, in recent
years, numerous novel and related arboviruses without known pathogenic capacity have been
isolated worldwide in the natural mosquito and sandfly populations8. The possibility of novel
virus would explain the lack of similarity in some samples sequenced in this study; although
the quality of the amplicons recovered also might explicate absence of similarity.
 185

Conclusion

Techniques used for diagnostic and surveillance programs must be rapid and simple and should
detect and identify a wide range of pathogens with high sensitivity.19 Thus, in-country access
to simplified and cost-effective PCR-based techniques is useful for immediate public health
purposes as well as for long-term epidemiological studies.42 Our results suggest that the speed
(maximum 2 days test), facility, and low cost of conventional RT- PCR (compared with other
methods) associated with the genus-specific primers tested should be an important tool for
detection of arboviruses in arthropods. Furthermore, extraction of RNA directly from crude
naturally infected mosquitoes might be used for rapid and earlier detection of the presence of a
virus; however, low viral load may be a limiting factor. These advantages are important in both
outbreak and surveillance programs of a wide variety of viruses. Furthermore, the rapid
detection at the genus level would enable informed policy measures to address local priorities
for vector control and inform disease management.

Ethical considerations- Animal Use

This study was approved by the Animal Welfare Committee of Evandro Chagas Institute, Pará,
Brazil, under n°26/2014 and 27/2014 and the Brazilian Environmental Services SISBIO permits
n° 45513-1.

Disclosure of conflict of interest

The manuscript represents an original work, and is not under consideration for publication
elsewhere. All the authors meet criteria for authorship, and have read and approved the
submission of manuscript. No conflict interest exists in connection with the submitted article.

Acknowledgments

The authors thank the important contributions of the Municipal and Bahia State Health
Department for logistical support in the field and colleagues from the Evandro Chagas Institute,
especially Francisco Correia Castro, and Bruna Nascimento for assistance with the
identification of the specimens. Additional thanks goes to Project BioBrasil/Centre for
 186

Research and Conservation, ICMBio, Jamie Palmer at the Saint Louis Zoo Institute for
Conservation Medicine and the Bicho-da mata NGO for their logistical support. We also thank
the sponsoring institutions that made this project possible: Saint Louis Zoo WildCare Institute
(USA), The Wild Animal Fund, from the American Association of Zoological Veterinarians
(USA), CNPq (Brasil), the Center for Research and Conservation of the Royal Zoological
Society of Antwerp (Belgium), Lion Tamarins of Brazil Fund, National Lottery of Belgium,
Primate Action Fund, Zoological Society of London, Fundação o Boticário de Proteção a
Natureza. The Flemish Ministry of Science (Belgium) provided structural support to the Center
for Research and Conservation of the Royal Zoological Society of Antwerp.

References
1. Romeiro MF, de Souza WM, Tolardo AL, Vieira LC, Henriques DA, de Araujo J, Siqueira
CEH, Colombo TE, Aquino VH, da Fonseca BAL, de Morais Bronzoni RV, Nogueira ML,
Durigon EL, Figueiredo LTM. A real-time RT-PCR for rapid detection and
quantification of mosquito-borne alphaviruses. Arch Virol. 2016;161(11):3171-3177.
doi:10.1007/s00705-016-3019-0.

2. Cardoso CW, Kikuti M, Prates APPB, Paploski IAD, Tauro LB, Silva MMO, Santana P,
Rego MFS, Reis MG, Kitron U, Ribeiro GS. Unrecognized Emergence of Chikungunya
Virus during a Zika Virus Outbreak in Salvador, Brazil. PLoS Negl Trop Dis. 2017;11(1).
doi:10.1371/journal.pntd.0005334.

3. Weaver SC, Reisen WK. Present and future arboviral threats. Antiviral Res.
2010;85(2):328-345. doi:10.1016/j.antiviral.2009.10.008.

4. Figueiredo LTM, Figueiredo LTM. The recent arbovirus disease epidemic in Brazil. Rev
Soc Bras Med Trop. 2015;48(3):233-234. doi:10.1590/0037-8682-0179-2015.

5. Aranda C, Sánchez-Seco MP, Cáceres F, Escosa R, Gálvez JC, Masià M, Marqués E, Ruíz
S, Alba A, Busquets N, Vázquez A, Castellà J, Tenorio A. Detection and monitoring of
mosquito flaviviruses in Spain between 2001 and 2005. Vector Borne Zoonotic Dis
Larchmt N. 2009;9(2):171-178. doi:10.1089/vbz.2008.0073.

6. Roiz D, Vázquez A, Rosso F, Arnoldi D, Girardi M, Cuevas L, Perez-Pastrana E, Sánchez-

Seco MP, Tenorio A, Rizzoli A. Detection of a new insect flavivirus and isolation of
Aedes flavivirus in Northern Italy. Parasit Vectors. 2012;5:223. doi:10.1186/1756-
3305-5-223.

7. Kim DY, Guzman H, Bueno Jr. R, Dennett JA, Auguste AJ, Carrington CVF, Popov VL,
Weaver SC, Beasley DWC, Tesh RB. Characterization of Culex Flavivirus (Flaviviridae)
strains isolated from mosquitoes in the United States and Trinidad. Virology.
2009;386(1):154-159. doi:10.1016/j.virol.2008.12.034.
 187

8. Cook S, Bennett SN, Holmes EC, De Chesse R, Moureau G, de Lamballerie X. Isolation

of a new strain of the flavivirus cell fusing agent virus in a natural mosquito
population from Puerto Rico. J Gen Virol. 2006;87(Pt 4):735-748.
doi:10.1099/vir.0.81475-0.

9. Hoyos-López R, Suaza-Vasco J, Rúa-Uribe G, Uribe S, Gallego-Gómez JC. Molecular

detection of flaviviruses and alphaviruses in mosquitoes (Diptera: Culicidae) from
coastal ecosystems in the Colombian Caribbean. Mem Inst Oswaldo Cruz.
2016;111(10):625-634. doi:10.1590/0074-02760160096.

10. Cardoso J da C, Paula MB de, Fernandes A, Santos E dos, Almeida MAB de, Fonseca
DF da, Sallum MAM. New records and epidemiological potential of certain species of
mosquito (Diptera, Culicidae) in the State of Rio Grande do Sul, Brazil. Rev Soc Bras
Med Trop. 2010;43(5):552-556. doi:10.1590/S0037-86822010000500016.

11. Consoli RAGB, Oliveira RL de. Principais mosquitos de importância sanitária no Brasil.
Editora Fiocruz; 1994. http://www.arca.fiocruz.br/handle/icict/2708. Accessed May
16, 2017.

12. Weaver SC. Urbanization and geographic expansion of zoonotic arboviral diseases:
mechanisms and potential strategies for prevention. Trends Microbiol.
2013;21(8):360-363. doi:10.1016/j.tim.2013.03.003.

13. Chow VT, Chan YC, Yong R, Lee KM, Lim LK, Chung YK, Lam-Phua SG, Tan BT.
Monitoring of dengue viruses in field-caught Aedes aegypti and Aedes albopictus
mosquitoes by a type-specific polymerase chain reaction and cycle sequencing. Am J
Trop Med Hyg. 1998;58(5):578-586.

14. Serra OP, Cardoso BF, Ribeiro ALM, Santos FAL dos, Slhessarenko RD. Mayaro virus
and dengue virus 1 and 4 natural infection in culicids from Cuiabá, state of Mato
Grosso, Brazil. Mem Inst Oswaldo Cruz. 2016;111(1):20-29. doi:10.1590/0074-
02760150270.

15. Ngo KA, Maffei JG, Dupuis AP, Kauffman EB, Backenson PB, Kramer LD. Isolation of
Bunyamwera Serogroup Viruses (Bunyaviridae, Orthobunyavirus) in New York State. J
Med Entomol. 2006;43(5):1004-1009. doi:10.1603/0022-
2585(2006)43[1004:IOBSVB]2.0.CO;2.

16. Batista WC, Tavares G da SB, Vieira DS, Honda ER, Pereira SS, Tada MS. Notification of
the first isolation of Cacipacore virus in a human in the State of Rondônia, Brazil. Rev
Soc Bras Med Trop. 2011;44(4):528-530.

17. Maher-Sturgess SL, Forrester NL, Wayper PJ, Gould EA, Hall RA, Barnard RT, Gibbs MJ.
Universal primers that amplify RNA from all three flavivirus subgroups. Virol J.
2008;5:16. doi:10.1186/1743-422X-5-16.

18. Kuno G. Universal diagnostic RT-PCR protocol for arboviruses. J Virol Methods.
1998;72(1):27-41.
 188

19. Sánchez-Seco MP, Rosario D, Domingo C, Hernández L, Valdés K, Guzmán MG,

Tenorio A. Generic RT-nested-PCR for detection of flaviviruses using degenerated
primers and internal control followed by sequencing for specific identification. J Virol
Methods. 2005;126(1-2):101-109. doi:10.1016/j.jviromet.2005.01.025.

20. Sánchez-Seco MP, Rosario D, Quiroz E, Guzmán G, Tenorio A. A generic nested-RT-

PCR followed by sequencing for detection and identification of members of the
alphavirus genus. J Virol Methods. 2001;95(1-2):153-161.

21. Campbell WP, Huang C. Detection of California serogroup Bunyaviruses in tissue

culture and mosquito pools by PCR. J Virol Methods. 1996;57(2):175-179.
doi:10.1016/0166-0934(95)01982-0.

22. Kuno G, Mitchell CJ, Chang GJ, Smith GC. Detecting bunyaviruses of the Bunyamwera
and California serogroups by a PCR technique. J Clin Microbiol. 1996;34(5):1184-
1188.

23. Travassos da Rosa, APA, Travassos da Rosa, ES, Travassos da Rosa, JFS, Degallier,N,
Vasconcelos, PFC, Rodrigues, SG, Cruz, ACR. Os Arbovírus No Brasil: Generalidades,
Métodos E Técnicas de Estudo. Belém: Instituto Evandro Chagas; 1998:46.

24. Bronzoni RV de M, Baleotti FG, Nogueira RMR, Nunes M, Figueiredo LTM. Duplex
Reverse Transcription-PCR Followed by Nested PCR Assays for Detection and
Identification of Brazilian Alphaviruses and Flaviviruses. J Clin Microbiol.
2005;43(2):696-702. doi:10.1128/JCM.43.2.696-702.2005.

25. Pfeffer M, Proebster B, Kinney RM, Kaaden OR. Genus-specific detection of

alphaviruses by a semi-nested reverse transcription-polymerase chain reaction. Am J
Trop Med Hyg. 1997;57(6):709-718.

26. Weidmann M, Sanchez-Seco MP, Sall AA, Ly PO, Thiongane Y, Lô MM, Schley H,
Hufert FT. Rapid detection of important human pathogenic Phleboviruses. J Clin Virol
Off Publ Pan Am Soc Clin Virol. 2008;41(2):138-142. doi:10.1016/j.jcv.2007.10.001.

27. Moreli ML, Aquino VH, Cruz ACR, Figueiredo LTM. Diagnosis of Oropouche virus
infection by RT-nested-PCR. J Med Virol. 2002;66(1):139-142. doi:10.1002/jmv.2122.

28. Dunn EF, Pritlove DC, Elliott RM. The S RNA genome segments of Batai, Cache Valley,
Guaroa, Kairi, Lumbo, Main Drain and Northway bunyaviruses: sequence
determination and analysis. J Gen Virol. 1994;75(3):597-608. doi:10.1099/0022-1317-
75-3-597.

29. Kuno G, Chang G-JJ, Tsuchiya KR, Karabatsos N, Cropp CB. Phylogeny of the Genus
Flavivirus. J Virol. 1998;72(1):73-83.

30. Bronzoni RVM, Moreli ML, Cruz ACR, Figueiredo LTM. Multiplex nested PCR for
Brazilian Alphavirus diagnosis. Trans R Soc Trop Med Hyg. 2004;98(8):456-461.
doi:10.1016/j.trstmh.2003.09.002.
 189

31. Alessandra da Conceição Miranda Santos. Análise da expressão dos genes das
citocinas IL-2 e TNF-α em modeo experimental de animal infectado com o virus
Mayaro (Togaviridae; Alphavirus). 2013.

32. Patel P, Landt O, Kaiser M, Faye O, Koppe T, Lass U, Sall AA, Niedrig M. Development
of one-step quantitative reverse transcription PCR for the rapid detection of
flaviviruses. Virol J. 2013;10:58. doi:10.1186/1743-422X-10-58.

33. Huang C, Slater B, Campbell W, Howard J, White D. Detection of arboviral RNA

directly from mosquito homogenates by reverse-transcription-polymerase chain
reaction. J Virol Methods. 2001;94(1-2):121-128.

34. Figueiredo LT, Batista WC, Kashima S, Nassar ES. Identification of Brazilian flaviviruses
by a simplified reverse transcription-polymerase chain reaction method using
Flavivirus universal primers. Am J Trop Med Hyg. 1998;59(3):357-362.

35. Seilner LN, Coelen RJ, Mackenzie JS. Sensitive detection of Ross River virus — a one-
tube nested RT-PCR. J Virol Methods. 1994;49(1):47-58. doi:10.1016/0166-
0934(94)90054-X.

36. Althouse BM, Vasilakis N, Sall AA, Diallo M, Weaver SC, Hanley KA. Potential for Zika
Virus to Establish a Sylvatic Transmission Cycle in the Americas. PLoS Negl Trop Dis.
2016;10(12):e0005055. doi:10.1371/journal.pntd.0005055.

37. Figueiredo MLG de, Figueiredo LTM, Figueiredo MLG de, Figueiredo LTM. Emerging
alphaviruses in the Americas: Chikungunya and Mayaro. Rev Soc Bras Med Trop.
2014;47(6):677-683. doi:10.1590/0037-8682-0246-2014.

38. Mellor PS, Boorman J, Baylis M. Culicoides biting midges: their role as arbovirus
vectors. Annu Rev Entomol. 2000;45:307-340. doi:10.1146/annurev.ento.45.1.307.

39. Lilian Catenacci, Joaquim Nunes-neto, Francisco Corrêa Castro, Poliana Lemos,
Eduardo Oyama, Sharon L Deem, Elizabeth Travassos da Rosa. New records of
mosquito species (Diptera: Culicidae) for Bahia (Brazil). Int J Mosq Res. 2017;4(4):12-
16.

40. Aranda C, Sánchez-Seco MP, Cáceres F, Escosa R, Gálvez JC, Masià M, Marqués E, Ruíz
S, Alba A, Busquets N, Vázquez A, Castellà J, Tenorio A. Detection and monitoring of
mosquito flaviviruses in Spain between 2001 and 2005. Vector Borne Zoonotic Dis
Larchmt N. 2009;9(2):171-178. doi:10.1089/vbz.2008.0073.

41. Farfan-Ale JA, Loroño-Pino MA, Garcia-Rejon JE, Hovav E, Powers AM, Lin M, Dorman
KS, Platt KB, Bartholomay LC, Soto V, Beaty BJ, Lanciotti RS, Blitvich BJ. Detection of
RNA from a novel West Nile-like virus and high prevalence of an insect-specific
flavivirus in mosquitoes in the Yucatan Peninsula of Mexico. Am J Trop Med Hyg.
2009;80(1):85-95.

42. E H, Tg R, L S, J S, Ld K, S V, E S, A B. Typing of dengue viruses in clinical specimens and

mosquitoes by single-tube multiplex reverse transcriptase PCR., Typing of Dengue
 190

Viruses in Clinical Specimens and Mosquitoes by Single-Tube Multiplex Reverse

Transcriptase PCR. J Clin Microbiol J Clin Microbiol. 1998;36, 36(9, 9):2634, 2634-
2639.

43. E C, C R, Mf L, P B, S C. Ultra-rapid, simple, sensitive, and economical silica method

for extraction of dengue viral RNA from clinical specimens and mosquitoes by reverse
transcriptase-polymerase chain reaction. J Med Virol. 1993;40(2):142-145.
doi:10.1002/jmv.1890400211.

44. Ms I, Mj T, Fk K, Rs L. Detection of Rift Valley fever virus in mosquitoes by RT-PCR.

Mol Cell Probes. 1997;11(1):49-53. doi:10.1006/mcpr.1996.0075.

45. Gomes A de C, Torres MAN, Paula MB de, Fernandes A, Marassá AM, Consales CA,
Fonseca DF. Ecologia de Haemagogus e Sabethes (Diptera: Culicidae) em áreas
epizoóticas do vírus da febre amarela, Rio Grande do Sul, Brasil. Epidemiol E Serviços
Saúde. 2010;19(2):101-113. doi:10.5123/S1679-49742010000200003.

46. Aragão NC, Müller GA, Balbino VQ, Junior C, Lima CR, Júnior F, Santiago C, Alencar J,
Marcondes CB. A list of mosquito species of the Brazilian State of Pernambuco,
including the first report of Haemagogus janthinomys (Diptera: Culicidae), yellow
fever vector and 14 other species (Diptera: Culicidae). Rev Soc Bras Med Trop.
2010;43(4):458-459. doi:10.1590/S0037-86822010000400024.

47. Catenacci, Ferreira MS, Martins LC, De Vleeschouwer KM, Cassano CR, Oliveira LC,
Canale G, Deem SL, Tello JS, Parker P, Vasconcelos PFC, Travassos da Rosa ES.
Primates and sloths as sentinels for arboviruses in the Atlantic Forest, Bahia, Brazil.
In: ; 2017.
 191

Figure 1. Virus strains tested with the genera- specific primers in arthropods samples captured
in Bahia, Brazil. (A) Samples tested using Flavivirus primers (220pb); (B) Samples tested using
Orthobunyavirus primers (900 pb); (C) Samples tested using Alphavirus primers; (D) Dilution
used to test the sensitivity of the universal primers; (E) Specificity of the Orthobunyavirus
primers (900 pb).
 192

Table 1. Virus strains tested with the genera- specific primers in arthropods samples captured
in Bahia, Brazil
Genera Species Virus strain
Alphavirus Eastern equine encephalitis virus AN 7526
(EEEV)
Western equine encephalitis virus AN70100
(WEEV)
Mayaro virus (MAYV) AR20290
Mucambo virus (MUCV) AN10967
Chikungunya virus (CHIKV) USA S27
Aura virus BE AR 10315
Pixuna virus (PIXV) BE AR 35645
Flavivirus Yellow-fever virus (YFV) H111
Ilheus virus (ILHV) H7445
West Nile virus (WNV) B956
Saint Louis Encephalitis virus (SLEV) AR23379
Cacipacore virus (CPCV) BeAn 327600
Bussuquara virus (BSQV) AN4116
Dengue virus Sorotype I (DENV-1) H 403696
Dengue virus Sorotype II (DENV-2) H 485442
Dengue virus Sorotype III (DENV-3) H 649532
Dengue virus Sorotype IV (DENV-4) H 402276
Yellow-fever virus vaccine (17D) 17D
Rocio virus (ROCV) SPH 34675
Orthobunyavirus Caraparu virus (CARV) BeAn3994
Catu virus (CATUV) H151
Guaroa virus (GROV) H22063
Guama virus (GMAV) BeAn 277
Maguari virus (MAGV) AR7272
Tacaiuma virus (TCMV) BeAn 73
Utinga virus (UTIV) BeAn 84785
Morumbi virus (MRBV) H 47236
Oropouche virus (OROV) AN19991
 193

Table 2: Thermocycling programs used for each pair of genera universal primers
Genera No of Denaturation Hybridization/ Elongation Final
cycles Increment elongation
Flavivirus 35 94°C por 2’ 94°C por 30” 72°C por 72°C por
55°C por 30” 2,5’ 5’
Alphavirus 45 95°C por 5’ 95°C por 30” 68°C por 68°C por
55°C por 30” 1’ 5’
Orthobunyavirus 35 94°C por 5’ 94°C por 1’ 72°C por 72°C por
55°C por 1’ 2’ 7’
 194

Table 3. Identification of positive pools, the total RNA concentration after extraction, the total cDNA concentration after RT-PCR and the virus
detected in arthropods collected in Southern Atlantic Forest Bahia, Brazil, between 2009 and 2014
N MIR Virus
Positive Source sample Mosquitoes/sand flies mosquitoes/ Qbit RNA Qbit cDNA
PCR Taxa pool ng/µl ng/µl (E-value)
Alphavirus crude mosquitoes Ae. (Och.) serratus 1 16.95 - 0.588 -
C636 culture cells Cx. (cx) species 1 90.9 - - No similarity
crude mosquitoes Cx. (cx) species 2 - <1 ng/µl - No similarity
crude mosquitoes Flebotominae 11 0.55 <1 ng/µl <50 pg/µl -
crude mosquitoes Hg. (Hag.) janthinomys 3 12.1 <1 ng/µl - -
crude mosquitoes Hg. (Hag.) janthinomys 14 - 40,4 18 -
crude mosquitoes Li. Durhamii 7 7.72 <1 ng/µl <50 pg/µl No similarity
crude mosquitoes Li. Durhamii 30 - <1 ng/µl 0.13 No similarity
crude mosquitoes Li. pseudomethysticus 36 1.32 <1 ng/µl <50 pg/µl -
crude mosquitoes Li. pseudomethysticus 4 - - - No similarity
Mucambo virus (1E-
crude mosquitoes Li. pseudomethysticus 6 - - -
98)
crude mosquitoes Ma. (Man) species 1 200 21,8 4.82 -
crude mosquitoes Ps.(Jan.) Ferox 1 14.08 <1 ng/µl <50 pg/µl -
crude mosquitoes Sa. (Sab.) albiprivus 1 142.85 <1 ng/µl 0.116 -
crude mosquitoes Sa. (Sbo.) chloropterus 4 27.4 - <50 pg/µl -
crude mosquitoes Sa. (Sbo.) chloropterus 1 - 10,8 <50 pg/µl -
crude mosquitoes Runchomya species 1 40.0 <1 ng/µl - -
Wyeomyia (Pho.)
crude mosquitoes 37 2.24 <1 ng/µl 0.27 Rocio virus (2E-83)
species
crude mosquitoes Wyeomyia species 2 3.47 <1 ng/µl <50 pg/µl -
crude mosquitoes Wyeomyia species 36 - 13.0 3.84 -
 195

crude mosquitoes Wyeomyia species 5 - - 0.112 Mayaro virus (9E-82)

crude mosquitoes Wyeomyia species 35 - - <50 pg/µl -

Flavivirus C636 culture cells Ae. (Och.) fulvus 2 76.9 82.2 25.6 Rocio virus (4E-51)
Kamiti river virus (3E-
C636 culture cells An. (Ano.) species 20 9.96 23.4 1.24
20)
Mosquito Flavivirus
C636 culture cells An. (Ano.) species 20 - 1.24 16.9
(4E-7)
Kamiti river virus (1E-
C636 culture cells An. (Ano.) species 20 - 0.973 5.08
20)
Mosquito Flavivirus
C636 culture cells An. (Nys.) triannulatus 5 125 >600 ng/ml 23.4
(2E-5)
C636 culture cells Cq. (Rhy.) venezuelensis 1 18.18 2.6 1.47 -
C636 culture cells Flebotominae 4 1.1 >600 ng/ml >600 ng/ml Rocio virus (3E-70)
C636 culture cells Flebotominae 91 - 0.711 3.62 Rocio virus (1E-74)
C636 culture cells Hg. (Hag.) janthinomys 1 15.6 - 2.34 Rocio virus (1E-06)
Mosquito Flavivirus
C636 culture cells Li. durhamii 30 3.86 144 33.4
(2E-17)
Kamiti River virus (4E-
C636 culture cells Li. pseudomethysticus 50 1.32 - <600ng/ml
22)
Kamiti River virus (4E-
C636 culture cells Li. pseudomethysticus 50 - - 4.24
22)
C636 culture cells Li. pseudomethysticus 2 - - 108 Rocio virus (9E-36)
Mosquito Flavivirus
C636 culture cells Runchomya species 4 40 0.876 3
(5E-24)
crude mosquitoes Sa. (Sab.) species 1 1,000 0,348 5,96 No similarity
crude mosquitoes Sa. (Sbo) chloropterus 1 13.7 - 4,56 No similarity
C636 culture cells Tr. (Trc.) digitatum 9 25.3 72,2 27,4 -
 196

Orthobunyavirus crude mosquitoes Wyeomyia species 34 1.73 -

crude mosquitoes Wyeomyia species 10 - - -
 197

APÊNDICE F:

CATENACCI, L. S.; ALCÂNTARA, B. N. Zika Virus: a Real Threat for Wildlife? In:
MILLER, E; LAMBERSKI, N.; CALLE, P. (Ed.). Fowler's Zoo and Wild Animal Medicine.
9th Ed. New York: Elsevier Press. Chapter 51, (June 2018).
 198

Zika Virus: a Real Threat for Wildlife?

Introduction: Arboviruses and Epidemiology

Arthropod-borne viruses (also known as arboviruses) normally circulate in nature

through biological cycles of transmission between susceptible vertebrate hosts and blood-

feeding arthropods, such as mosquitoes (Culicidae, Psychodidae), biting midges

(Ceratopogonidae), black flies (Simuliidae), and ticks (Ixodidae and Argasidae).1 Arboviruses

have RNA genomes and are classified within the families Flaviviridae, Togaviridae,

Bunyaviridae, Reoviridae and Rhabdoviridae. With few exceptions, they are zoonotic and

depend on vectors and wild and/or domestic animal interactions for maintenance in nature.1,2

Birds, non-human primates (NHP) and rodents are the main reservoir hosts and

mosquitoes and ticks the most common vectors for the significant arboviruses1,2. ‘Spill-over’ of

arboviruses from enzootic cycles to humans by enzootic, or ‘bridge vectors’, can also occur,

under appropriate ecological conditions3. For most arboviruses, humans are dead-end or

incidental hosts; however, there are several viruses such as Dengue, Zika, and Chikungunya,

that may use humans as its amplification host during outbreaks2,3,4,5,6,7,8.

Zika virus

Molecular

Zika virus (ZIKV) is a member of the Flavivirus genus, which belongs to the

Flaviviridae family. This family includes other agents of clinical significance, such as Dengue

virus (DENV), Yellow Fever virus (YFV), West Nile virus (WNV), and Japanese Encephalitis

virus (JEV)6,7,9. Flaviviruses are small, spherical in shape and contain a positive single stranded

non-segmented RNA of approximately 11 kb10. The genome is flanked by two noncoding

regions (NCR; a 5’ NCR~100bP and a 3’ NCR~450bP base)11.

 199

Zika virus is phylogenetically divided into three lineages: two African (Eastern or

Western African) and one Asian genotype. Only the Asian lineage is directly related to

congenital changes in the CNS, causing microcephaly and other congenital alterations including

Guillain-Barre syndrome12. Recent bioinformatics and phylogenetic analyses suggest that

ZIKV isolates currently circulating in the Americas constitute a new clade of the Asian

genotype6.

Epidemiological studies indicate a widespread distribution of ZIKV in many countries

in Southeast Asia, the Americas and Africa13, reaching approximately 76 countries with reports

of human illness (WHO, Situation Report Zika Virus, 20 Jan 2017).

Epidemiology and wild hosts

The ZIKV prototype was obtained from a febrile sentinel rhesus monkey and Aedes

africanus mosquitoes in the Zika Forest near Entebbe, Uganda in 194714,15. The virus was

subsequently detected in tropical Africa in monkeys during serosurveys and human surveillance

of febrile disease, followed 60 years later by its emergence in the Pacific Islands and in the

Americas, including the Caribbean region6,16,17. In February 2016, the World Health

Organization (WHO) declared it a Public Health Emergency of International Concern18,19.

In the sylvatic environment, ZIKV is maintained between mosquitoes and wild

hosts4,7,8,9,20,21,22 (Table 1). The main route of ZIKV infection is through bites by an infected

female hematophagous mosquito, after a 10-day incubation period. Many known mosquito

species have been detected with ZIKV, but A. africanus and Aedes aegypti were the most
7,9,14,20
competent vectors . Moreover, the virus may also be sexually and vertically

transmitted16,23.

Few studies have focused on the role of animals as hosts for ZIKV12,20. In 1956, for the

first time, Boorman and Porterfield were able to confirm the transmission of ZIKV from Aedes

ageypti to animals, especially mice and monkeys, during experimental studies. Multiple
 200

monkey species in the Zika forest were found to be seropositive for ZIKV, suggesting they may

become infected and support viral replication21. However, other mammals in the Zika forest

(including squirrels, tree rats, giant pouched rats, and civets) did not show serological evidence

of ZIKV infection15, although a subsequent study in Kenya detected ZIKV antibodies in small

mammals including rats and shrews24. A study by Bueno and collaborators (2016) presented the

wildlife species that were antibody-positive to ZIKV, both in situ as well as experimentally.

Most primates identified as ZIKV-positive in the wild or in sentinel studies are Old World

species20. To date, there has not been solid evidence of an Asian or American sylvatic cycle of

ZIKV, but such a sylvatic cycle could be widespread and still go undetected due to the lack of

surveillance for sylvatic arboviruses8,20. The presence of animals seropositive for ZIKV does

not necessarily mean they are viremic or may be able to transmit the virus to a mosquito (as

reservoir). Further studies are required to properly understand the role of vertebrates in the

ZIKV dynamic transmission8,13,20.

Recently, Zika virus has been of significant concern for conservationists, and there is a

lack of studies in wildlife species1,9,25. Free-living and semi-captive orangutans were evaluated

during translocations from forest fragments or degraded habitat in Eastern Sabah (Malaysia) in

2003 and had anti-ZIKV antibodies25. However, how this virus could be pathogenic for wildlife

that already suffer anthropic and natural pressure remains unknown. Is the Zika virus capable

of leading to NHP population declines, as has occurred for Allouata sp. due to yellow fever

outbreaks 8,13,20? Another question that the role of neotropical primates in the maintenance cycle

of ZIKV is still unclear26. Could other vectors, such as Haemagogus sp. or Sabethes sp., serve

as a bridge to facilitate the reverse spillback and establishment of an enzootic ZIKV

transmission cycle in the Americas26,8,20? Based on the huge biodiversity in the Americas, the

proximity of wild vertebrate species to urban and rural areas, and the wide distribution of A.

aegypti and other mosquito genera, ZIKV spillover to wild primates or another wildlife
 201

vertebrate is a potentially real scenario 8,13,20. In Northeast Brazil, Favoretto et al. (2015) showed

that 29% (7/24) of New World primates, Callithrix jacchus and Sapajus libidinosus, were

infected with ZIKV. They also showed that the ZIKV genome sequence from monkeys was

100% similar to the ZIKV circulating in humans in South America (Favoretto et. al. 2015).

In response to the ongoing epidemic, new studies on ZIKV have been carried out in

model animals, mainly to address research and development needs for novel means of

diagnostic, vaccine, and therapeutic approaches targeted to human populations. Nevertheless,

research is still greatly needed to better understand the risk of ZIKV for wildlife.

Pathogenesis of ZIKV

Mosquito-borne flaviviruses are thought to replicate initially in dendritic cells near the

site of the infectious bite then quickly spread to lymph nodes where they replicate and thereafter

reach the bloodstream21. In vitro, ZIKV has been shown to infect fibroblasts and keratinocytes21

Despite recent progress in our understanding, the pathogenesis of ZIKV in vivo remains largely

unknown21. Similarly, ZIKV distribution in anatomic tissues, the duration of infectious

shedding and the immune response to primary ZIKV in humans and other animals remain

unclear17.

Several species of immunocompromised mice24 and NHPs, such as rhesus, pigmail and

cynomolgus, were used for studies of the natural behavior and pathogenesis of ZIKV

infection4,17,14,21. In Brazil, three studies have been conducted to better understand the

serological behavior and pathogenesis caused by the Asian lineage in neotropical primates

(Callimico goeldi and Saimiri collinsi). These studies evaluated the experimental infection by

ZIKV, the inoculation routes and the viral load in the viremic period, trying to evaluate these

NHPs as ZIKV study models27,28,29.

All assays of rhesus monkeys and cynomolgus have shown to be permissive for

infection by the Asian strain of ZIKV. Virus RNA was detected in several body fluids, and it
 202

was possible to detect different concentrations of this nucleic acid in different body fluids such

as plasma, urine, saliva, cerebrospinal fluid, semen, seminal fluids and vaginal fluids) 1-10 days

post-infection (DPI)4,14,17,21,22. Cynomolgus monkeys presented higher viral loads of ZIKV in

testis 8 DPI. After 2-3 weeks of infection, neutralizing antibodies to ZIKV were detected in

most animals4,14,22. Cynomolgus monkeys were also challenged with the African lineage, but

they were not permissive4. Dudley et al 2016 and Osuna et al (2016) reinfected rhesus monkeys

and have not observed viral replication, which could mean that the monkeys may acquire

immune protection after the first ZIKV exposition.

Clinical Manifestations

As occurrence of ZIKV infections in wildlife were mainly found accidentally during

serosurveys searching for other pathogens, there is almost no information about clinical signs

in wild animals. In a sentinel study in Uganda in 1947, one primate showed mild pyrexia 14.

Typically, ZIKV infection in humans has been associated with a self-limiting febrile illness

often including rash, arthralgia, and conjunctivitis, though most infections are

asymptomatic9,24.Wild mammals with ZIKV infection apparently have few clinical signs20.

A study by Dudley et al. (2016) in rhesus macaques infected with ZIKV showed mild-

to-moderate inappetence, which resulted in mild weight loss in four animals. Two animals also

developed a very mild rash around the inoculation site at 1 DPI that persisted for 4–5 days. No

other abnormal clinical signs were noted. Other two studies with rhesus macaques showed that

within 8-10 DPI animals displayed fever (axillary temperature 38.9 °C) with peak temperature

of 40.1 °C22 and 39.5 °C17. All experiments had almost the same quantity of ZIKV infectious

dose (approximately 105 PFU), but from different strains, which may explain the difference.

One of the six Cynomolgus monkeys that were challenged with the ZIKV African

lineage developed a slight erythema around the injection site (Draize dermal score of 1) on

study days 8 and 10 after infection. The erythema had resolved by day 14. No clinical signs
 203

were observed in any of the other animals during the course of the study4. As this individual did

not present viremia of the ZIKV African lineage, the erythema was probably not related with

the virus.

No evidence of neurological complications, such as Guillain-Barré syndrome observed

in human adults, was found in experiments with monkeys. However, congenital birth defects

were demonstrated in one experiment29. Ten days after inoculation with a ZIKV Asian lineage

strain in a pregnant pigtail macaque at 119 days of gestation, the fetal brain developed a

periventricular lesion and evolved asymmetrically in the occipital–parietal lobes. However, in

this experiment, five subcutaneous infections in the pregnant animal were conducted, using 107

PFU each29. This amount of ZIKV inoculated is higher than the other experiments and may not

represent natural infections.

Complete blood count and blood chemistry panels

Blood chemistry was monitored in three ZIKV infection assays17,21,22. According to

observations made by the investigators, aspartate aminotransferase, alanine aminotransferase,

alkaline phosphatase and creatinine phosphatase increased and peaked by day 317,21,22 and day

21. Creatine kinase increases may be due to viral myositis or repeated sedation hemolysis and

endocrine abnormalities22.

The pattern of white blood cell counts remained within normal variation ranges21,22,

although had increased for Osuna et al (2016). However, the counts returned to baseline in most

animals within 2 days of infection17.

ZIKV Targets Various Organs and Causes Pathological Damage

Necropsy data from rhesus and Cynomolgus macaques demonstrate that ZIKV strains

can invade and replicate within the central nervous system (CNS; including cerebrum,

cerebellum, brain stem, and spinal cord) of macaques following s.c. infection, despite no

observed neurological signs17,21. ZIKV RNA was also detected in visceral fragments (e.g., liver,
 204

kidney, spleen, parotid glands, large intestine, small intestine, cecum, bladder, testes, lymph

node, heart, and stomach) in rhesus macaque. Male genital tracts were identified with persistent

foci of ZIKV infected cells localized in the testes, prostate and seminal vesicles in the two

species studied17. This may have negative implications for conservation programs if

demonstrated that ZIKV may be transmitted sexually.

A fetal necropsy in the pigtail macaque revealed ZIKV in the brain and significant

cerebral white matter hypoplasia, periventricular white matter gliosis, and axonal and

ependymal injury29. In the neotropical primate Saimiri collinsi, a fetal necropsy revealed

congestion and hemorrhagic areas (Figure 1). Microscopically, the cortex had significant

gliosis, congestion and hemorrhagic injury with inflammatory cells (Figure 1).

How to collect biological materials to investigate ZIKV in wildlife?

Once collected, blood samples may be divided into two aliquots, one stored immediately

in liquid nitrogen or dry ice and the other maintained at 4 °C for 3 hours until centrifugation for

collection of serum, which will then be placed in liquid nitrogen. Samples should be sent on

dry ice to the diagnostic reference center. A minimum of 0.5 ml of whole blood is required to

perform molecular assays for detection and 0.5 ml of serum is the minimum necessary to

conduct antibody screening. For detection and isolation of ZIKV, whole blood should be

collected in the viremic period (1 to 5 DPI), and may be detected by RT-qPCR up to 14 DPI,

depending on the inoculated viral load. After 7 days, antibody testing will be prioritized.

Molecular detection in other fluids such as urine, saliva and tears and also tissues such as CNS

and placenta occurs well during the viremic period and should be stored in liquid nitrogen and

sent on dry ice. Tissues for histopathological processing should be stored in 10% formaldehyde

and sent at room temperature32.

 205

Diagnosis

Demonstration of ZIKV infections in wildlife may be difficult because of the cross-

reactivity of diagnostic flavivirus antibody assays. One of the current tests most frequently

performed is the hemagglutination-inhibition (HI) test, that shows high sensitivity, but low

specificity between arboviruses belonging to the same genus (CITATION). This test detects

both IgM and IgG and total antibodies. All studies should be repeated after six months in the

same animal to evaluate the variation of antibody titers. Another test to detect specific

antibodies against ZIKV in samples is ELISA, that detects IgM antibodies. If IgM-positive, it

suggests that the animal was exposed with the virus in the last 3 months9. The plaque reduction

neutralization test (PRNT) generally has improved specificity over immunoassays, but may still

yield cross-reactive results in secondary flavivirus infections. All serologic tests can be

conducted on samples obtained after 7-10 days of clinical signs9. Rapid tests, although available

for humans, are not yet available for NHP or other animals. More studies in this area may

discover alternative diagnostic tests in the field or in settings of poor laboratory conditions.

Molecular tests for ZIKV detection is the best option for detecting ZIKV RNA. This

includes real-time PCR (qRT-PCR) tests on acute-phase serum samples, tissues or whole blood.

PCR tests can be conducted on samples obtained less than 7 days after disease onset9.

The inoculation of acute-phase serum samples, tissues or whole blood in Vero or C636

cells have been shown efficient at ZIKV isolation. This technique can be conducted on samples

obtained less than 7 days after disease onset 9.

Necropsy

Histopathological processing allows for the observation of hepatic and CNS lesions as

long as 23 weeks after infection, and immunohistochemistry detects viral antigens in several

tissues17.
 206

Treatment, Prevention and Control

Currently, no vaccines or specific antiviral drugs are available to prevent or treat ZIKV

infection in humans or other animals, including wildlife. Public health policy efforts have

mainly focused on vector control and personal protection measures. Due to the high number of

wild species with the potential to establish a sylvatic cycle, it would be extremely difficult, even

impossible, to control if ZIKV were to spillback into the wild8,20.

For monkeys living in Zoo collections or other captive / semi-captive settings, vector

and virus exposure may be prevented by fitting screens to doors and windows, removing debris

that provide breeding sites for mosquitoes (i.e., free standing water in disposed tires, broken

bowls, flower vases), and avoiding vegetation or yards around enclosures18.

Final considerations - Wildlife as sentinels and Public Health: a conservation medicine

approach

Infectious diseases have important implications for animal and human health and

biodiversity. Monkeys can be considered sentinels for pathogens of human health concern and

seem to be the major wildlife potential reservoir for ZIKV12,20,25,26.

Given its recent history of rapid spread in human populations, it is anticipated that ZIKV

will continue to spread for the foreseeable future in the Americas and globally in regions where

competent Aedes mosquito vectors are present16. Added to this, the risk of ZIKV introduction

in a new sylvatic environment – such as tropical rainforests – may establish permanent virus

reservoirs in an enzootic cycle increasing the risk for constant outbreaks in the newly-affected

areas, similar to the sylvatic cycle of yellow fever in South America8,20,30.

Finally, the following research priorities are recommended8,20 to better understand the

dynamics of ZIKV in wildlife: 1) laboratory studies of host competence of wild species,

especially NHP and vector competence for ZIKV; 2) Serosurveys to detect spillover and

spillback of ZIKV into captive populations of Old World primate species; 3) Ecological long-
 207

term monitoring to detect a potential sylvatic circulation of ZIKV in Asia and the Americas; 4)

development of rapid diagnostic tests for screening ZIKV and other arboviruses; 5)

Incorporation of species presence records and environmental changes into distribution maps to

assess the overlap of host and vector species with potential for sylvatic ZIKV maintenance; and

6) Active surveillance of human populations living close to natural ecosystem environment.

Acknowledgements: The authors would like to thank Carlos Carvalho, Pedro F.C Vasconcelos,

and Sharon L. Deem for their helpful review on the text.

References

1.Vasconcelos PFC, Rosa AAPT, Rodrigues SG, et al. Inadequate management of natural
ecosystem in the Brazilian Amazon region results in the emergence and reemergence of
arboviruses. Cadernos de Saúde Pública 2001;17:155–164.
2.Iranpour M, Moghadam AR, Yazdi M, et al. (2016). Apoptosis, autophagy and unfolded
protein response pathways in Arbovirus replication and pathogenesis. Expert Reviews
in Molecular Medicine 2016; 18:1-21.
3.Weaver SC. Urbanization and geographic expansion of zoonotic arboviral diseases:
mechanisms and potential strategies for prevention. Trends in Microbiology 2013;
21:360–363.
4.Koide F, Goebel S, Snyder B, et al. Development of a Zika Virus Infection Model in
Cynomolgus Macaques. Frontiers in Microbiology 2016; 7:1-8.
5.McGough SF, Brownstein JS, Hawkins JB, et al. Forecasting Zika Incidence in the 2016 Latin
America Outbreak Combining Traditional Disease Surveillance with Search, Social
Media, and News Report Data. PLoS Negl Trop Dis 2017; 11:
6.Faria NR, Azevedo RSS, Kraemer MUG, et al. Zika virus in the Americas: Early
epidemiological and genetic findings. Science 2016;352:45–349.
7.Mota MTO, Terzian AC, Silva MLCR, et al. Mosquito-transmitted viruses - the great
Brazilian challenge. Brazilian Journal of Microbiology 2016; 47: 38–50.
8.Althouse BM, Vasilakis N, Sall AA, et al. (2016). Potential for Zika Virus to Establish a
Sylvatic Transmission Cycle in the Americas. PLoS Negl Trop Dis 2016; 10:1-11.
9.Hayes EB. Zika Virus Outside Africa. Emerg Inf Dis 2009;15:1347–1350.
10.Beckham JD, Pastula DM, Massey A, et al. Zika Virus as an Emerging Global Pathogen:
Neurological Complications of Zika Virus. JAMA Neurology 2016; 73: 875–879.
 208

11.Aman MJ, Kashanchi F. Zika Virus: A New Animal Model for an Arbovirus. PLoS Negl
Trop Dis 2016; 10:1-3.
12.Haddow AD, Schuh AJ, Yasuda CY, et al. Genetic Characterization of Zika Virus Strains:
Geographic Expansion of the Asian Lineage. PLoS Negl Trop Dis 2012;6:1-7.
13.Vorou R. Zika virus, vectors, reservoirs, amplifying hosts, and their potential to spread
worldwide: what we know and what we should investigate urgently. International
Journal of Infectious Diseases 2016;48: 85–90.
14. Dick Gw, Kitchen Sf, Haddow Aj. Zika virus. I. Isolations and serological specificity. Trans
R SocTropMedHyg. 1952; 46:509–20.DOI: 10.1016/0035-9203(52)90042-4.
15.Haddow AJ, Williams MC, Woodall JP, et al. Twelve isolations of Zika virus from Aedes
(Stegomyia) africanus (Theobald) taken in and above a Uganda forest. in proccedings.
Bulletin of the World Health Organization 1964; 31:57–69.
16.Paul LM, Carlin ER, Jenkins MM, et al. Dengue Virus Antibodies Enhance Zika Virus
Infection. bioRxiv, 2016
17.Osuna CE, Lim SY, Deleage C, et al. Zika viral dynamics and shedding in rhesus and
cynomolgus macaques. Nature Medicine 2016; 22:1448–1455.
18.Gyawali N, Bradbury RS, Taylor-Robinson AW. The global spread of Zika virus: is public
and media concern justified in regions currently unaffected? Infectious Diseases of
Poverty 2016;5:1-6.
19.Heymann DL, Hodgson A, Sall AA, et al. Zika virus and microcephaly: why is this situation
a PHEIC? Lancet 2016;387: 719–721.
20.Bueno MG, Martinez N, Abdalla L, et al. Animals in the Zika Virus Life Cycle: What to
Expect from Megadiverse Latin American Countries. PLoS Negl Trop Dis 2016; 10:1-
13.
21.Li XF, Dong HL, Huang XY, et al. Characterization of a 2016 Clinical Isolate of Zika Virus
in Non-human Primates. EBioMedicine 2016; 12:170–177.
22.Dudley DM, Aliota MT, Mohr EL, et al. A rhesus macaque model of Asian-lineage Zika
virus infection. Nat Commun 2016;7:1-9.
23.Huang WC, Abraham R, Shim B.S, et al. Zika virus infection during the period of maximal
brain growth causes microcephaly and corticospinal neuron apoptosis in wild type mice.
Sci Rep 2016:6, 34793
24.Lazear HM, Govero J, Smith AM, et al. A Mouse Model of Zika Virus Pathogenesis. Cell
Host & Microbe 2016;19:720–730.
 209

25.Kilbourn AM, Karesh WB, Wolfe ND, et al. Health evaluation of free-ranging and semi-
captive orangutans (Pongo pygmaeus pygmaeus) in Sabah, Malaysia. Journal of
Wildlife Diseases 2003; 39:73–83.
26. Favoretto S., Araújo Dd., et al. First detection of Zika virus in neotropical primates in Brazil:
a possible new reservoir. bioRxiv 2016;
27.Alcantara BN, Simith DB, Araújo MTF, et al. Standardization of Zika Virus Antigen
Detection by Immunohystochemistry in Neotropical Primate Tissues, in Proceedings.
First International Conference on Zika Virus 2017.
28. Alcantara BN, Rodrigues DSG, et al. Neotropical Callimico Goeldii is Susceptible to Zika
Virus Intradermal Infection. in Proceedings. First International Confe rence on Zika
Virus 2017.
29.Simith DB, Alcantara BN, Carvalho CAM, et al. Detection of IgM Antibodies by Elisa in
the non-human primate Saimiri Collinsi Experimentally Infected by Zika Virus, in
proccedings. First International Conference on Zika Virus 2017
30.Waldorf KMA, Stencel-Baerenwald JE, Kapur RP, et al. Fetal brain lesions after
subcutaneous inoculation of Zika virus in a pregnant nonhuman primate. Nature
Medicine 2016;22:1256–1259.
31.Carvalho CAM, Casseb SMM, Gonçalves RB, et al. Bovine Lactoferrin Activity Against
Chikungunya and Zika Viruses. bioRxiv 2016.
32.CDC. CDC’s Response to Zika ZIKA VIRUS: Collection and submission of fetal tisuues for
zika virus testing, in proceedings 2016; august:1-3.
 210

Figure 1: Fetal necropsy in Saimiri collinsi brain infected with ZIKV. (A) congestion and

hemorrhagic areas in the brain. (B) Microscopically, the cortex had significant gliosis,

congestion and hemorrhagic injury with inflammatory cells.

 211

Table 1: Wildlife species that have tested positive for Zika virus antibody or antigen by

serologic, molecular, or viral isolation testing.

Order Family Common names Scientific name

Artiodactyla Bovidae Hartebeest Alcelaphus buselaphus2
Wildebeest Connochaetes taurinus2
African buffalo Syncerus caffer2
Impala Aepyceros melampus2
Hippopotamidae Hippo Not mentioned2
Carnivora Felidae Lion Panthera leo2
Charadriformes Scolopacidae Ruff Philomachus pugnax2
Chiroptera Vespertilionidae Little Brown Bat Myotis lucifugus1
Lagomorpha Leporidae Rabbit Not mentioned1
Pelecaniformes Ardeidae Cattle Egret Bubulcus ibis2
Threskiornithidae African Sacred Ibis Threskiornis aethiopicus2
Perissodactyla Equidae Zebra not mentioned2
Primates Callitrichidae Marmoset Callithrix jacchus2
Callimico Callimico goeldi1
Cebidae Capuchin monkey Sapajus libidinosus2
Squirrel monkey Saimiri collinsi1
Cercopithecidae Rhesus monkey Macaca mulatta1,2
Red-tailed monkey Cercopithecus ascanius1,2
Grivet monkey Chlorocebus aethiops1,2
Mangabey Lophocebus albigena2
Mona Monkey Cercopithecus mona2
Putty-nosed Monkey Cercopithecus nictitans2
Olive Baboon Papio anubis choras2
Patas Erythrocebus patas2
Cynomolgus macaques Macaca fascicularis 1
Hominidae Bornean Orangutan Pongo pygmaeus2
Proboscidea Elephantidae Elephant not mentioned2
Rodentia Caviidae Guinea pigs Cavia sp.1
Cricetidae Cotton-rat Sigmodon hispidus1
Muridae Swiss albino mice Mus musculus1
Abyssinian grass rat Arvicanthis abyssinicus2
African Grass Rat Arvicanthis niloticus2
Kaiser’s Rock Rat Aethomys kaiseri2
Indian gerbil Tatera indica2
Indian desert jird Meriones hurrianae2
Sind rice rat Bandicota bengalensis2
Soricidae African giant shrew Crocidura occidentalis2
Squamata Lamprophiidae Brown House Snake Boaedon fuliginosus2
Varanidae Water Monitor Varanus niloticus2
1- assay experiment; 2-natural infection
 212

APÊNDICE G:

CATENACCI, L. S.; RABOY, B. E.; OLIVEIRA, L. C.; NEVES, L. G.; SUSCKE, P.; DE
VLEESCHOUWER, K. M. Leontopithecus chrysomelas: 25 anos de experiência em métodos
para captura e coleta de material biológico. Boletim da Sociedade Brasileira de Mastozoologia.
(Submetido)
 213

Short title: Captura e coleta de materiais biológicos em micos-leões.

Leontopithecus chrysomelas: 25 anos de experiência em métodos para captura e coleta de material biológico

Leontopithecus chrysomelas: 25 years of experience in methods to capture and to collect biological material

Lilian Silva Catenacci1, Beck E. Raboy2, Leonardo Oliveira3,4, Leonardo Gomes Neves5, Priscila Suscke6 and Kristel

Myriam De Vleeschouwer7

1*
Federal University of Piaui State, Campus Professora Cinobelina Elvas, Bom Jesus, PI 64900-000 Brasil; Virology

Graduate Program, Evandro Chagas Institute, Ananindeua, PA 67030-000, Brasil

2
University of Toronto, Department of Ecology and Evolutionary Biology, 25 Harbord Street, Toronto, Ontario,

M5S 3G5, Canada

3
Bicho do Mato Instituto de Pesquisa, Belo Horizonte, MG 30360-082, Brasil

4
State University of Rio de Janeiro, Faculdade de Formação de Professores, Rio de Janeiro, RJ 24435-005, Brasil

5
Instituto de Estudos Socio-ambientais do Sul da Bahia- IESB, Ilhéus, BA, Brasil

6
University of São Paulo, Department of Experimental Psychology, Institute of Psychology, Av. Prof. Mello

Moraes

1721, São Paulo, SP CEP 05508-020, Brasil

7
Antwerp Zoo Centre for Research and Conservation, Koningin Astridplein 26, B-2018 Antwerp, Belgium

Autor correspondente: Lilian Catenacci (catenacci@ufpi.edu.br)

ABSTRACT

The capture of wild animals allows the collection of important data on composition of groups, reproductive

status, biometric data and health status of the individuals. In addition, permits to collecting biological materials,

individual marking and placement of radiotelemetry equipment to facilitate monitoring and subsequent

ecological studies. On the other hand, restraint is the moment of greatest stress promoted by the researcher to

the animal due to the natural resistance to the moment of capture, handling, containment and transportation.

Because of it detailed planning of a capture is essential to ensure both the safety of the animals and the safety

of the team. The objective of this study was to report an experience to capture, collect biological materials and

release free-ranging gold-tamarin moths that have been used in field projects for more than two decades in
 214

southern Bahia, Brazil. This report describes the main activities that might be carried out prior to the capture

(planning), during and after a capture (release) of these primates. It is included in detailed information of cevas

for animal trapping through traps, chemical immobilization, collection of biological materials, biometrics, risk

marking and collar radio placement. It is expected that this manual will guide other projects that work with small

neotropical primates, considering as characteristics of the species to be involved, the goal of the capture, the

environment where these animals are inserted and a team experience.

Key words: neotropical primates, immobilization, trapping, Callithichidae, lion-tamarins, protocol

RESUMO

A captura de animais silvestres permite coletar dados importantes sobre a composição de grupos, estado

reprodutivo, dados biométricos e estado de saúde de indivíduos. Além disso, permite a coleta de materiais

biológicos, marcação individual e colocação de equipamentos de radiotelemetria para facilitar monitoramento

e estudos ecológicos posterior a soltura. Por outro lado, a contenção é o momento de maior estresse promovido

pelo pesquisador ao animal, devido à resistência natural ao momento da captura, ao manuseio, à contenção e

ao transporte. Por isso o planejamento detalhado de uma captura é fundamental para garantir tanto a segurança

dos animais como a segurança da equipe. Este trabalho tem como objetivo relatar a experiência de métodos

de captura, coleta de material biológico e soltura de grupos de mico-leão-da-cara-dourada em vida livre que

vem sendo empregado em projetos de campo há mais de duas décadas anos no sul da Bahia, Brasil. Este relato

aponta as principais atividades que devem ser realizadas antes da captura (planejamento), durante e após a

captura (soltura) destes primatas. Estão incluídas ainda informações detalhadas sobre montagem de girais para

captura de animais através de armadilhas, contenção química e monitoramento anestésico, coleta de materiais

biológicos, biométricos, marcação de indivíduos e colocação de radio colar. Espera-se que este manual possa

orientar outros projetos que trabalham com primatas neotropicais, levando em consideração as características

das espécies a serem trabalhadas, o objetivo da captura, o ambiente onde estes animais estão inseridos e a

experiência da equipe.

Palavras-chave: primatas neotropicais, contenção química, armadilhas, Callitrichidae, micos-leões, protocolo

 215

INTRODUÇÃO

A pesquisa de fauna silvestre in situ pode ser executada sob diferentes metodologias com objetivos variados. Em

muitos trabalhos de campo e estudos com saúde pública, é necessário que alguns indivíduos de uma população

sejam capturados ou manipulados (Brasil, 2014). A obtenção de dados biométricos e amostras biológicas, por

exemplo, requer na maioria das vezes contenção física e/ou química dos animais (Brasil, 2012). A capacidade da

equipe de campo em capturar e manipular animais silvestres com eficiência e segurança pode representar o

sucesso ou o fracasso de um projeto (Brasil, 2014; Fedigan, 2010). Isso porque as capturas inevitavelmente geram

estresse aos animais e este pode ser potencializado e gerar respostas negativas nas observações de campo se

capturas não forem bem conduzidas (Bianchi et al., 2016). A publicação de protocolos, manuais e/ou relatos de

experiências de captura e coleta de material biológico tende a diminuir a repetição de erros (Watsa et al., 2015),

que pode gerar até morte de animais (Fedigan, 2010). Infelizmente, a maioria dos protocolos de captura para

primatas neotropicais de pequeno porte permanecem sem serem publicados ou são publicados com pouco

detalhes (Dietz et al., 1996; Dietz et al., 1997; Franklin et al., 2007; Monteiro et al., 2007; Catenacci et al.,2009;

Tavela et al., 2013; Tivosec et al., 2014), com exceção de trabalhos realizados com Saguinus sp. (Watsa et al.,

2015) e Saimiri sp. (Savage et al., 1993; Stone et al., 2015) na Amazônia.

O Gênero Leontopithecus, endêmico da Mata Atlântica, possui quatro espécies, L. caissara, L. rosalia, L.

chrysomelas e L. chrysopygus; todas consideradas “Em Perigo (EN)” de acordo com a lista nacional vigente de

espécies ameaçadas (MMA 2014). Esta classificação segue os critérios adotados pela União Internacional para a

Conservação da Natureza, com exceção do L. caissara, considerado criticamente ameaçada (IUCN 2008). A

espécie Leontopithecus chrysomelas possui distribuição geográfica restrita no estado da Bahia, Brasil, com a área

de ocorrência de 19.462 km² (Pinto et al., 1997). Apenas uma pequena área de sua ocorrência engloba unidades

de conservação, como a Reserva Biológica de Una (Una, Bahia), estando o restante em áreas particulares (Pinto

et al., 1997), constituídas principalmente de fragmentos desconectados.

Os estudos de campo existentes com esta espécie deram início em 1980 na Estação Ecológica Lemos Maia

(Rylands 1982, 1989), no município de Una, Bahia e desde então coletas de dados sobre os aspectos ecológicos,

demográficos e sanitários vem sendo realizados em diferentes grupos que habitam áreas com diferentes

características (Dietz et al., 1996; Guidorizzi, 2008; Oliveira et al., 2011; Raboy et al., 2004; Raboy & Dietz, 2004;

Catenacci et al., 2016; De Vleeschouwer & Oliveira, 2017). Atualmente, é conhecido que grupos de micos-leões-

da-cara-dourada são formados de 3-15 indivíduos com área de uso que varia entre 22 a 197 hectares (Oliveira et
 216

al., 2011). São extremamente territorialistas e defendem com agressividade a ampla área de uso do grupo. A

distância média percorrida pelos grupos diariamente é de 1342 a 2175 metros e este comportamento de

deslocamento consome cerca de um terço do tempo de suas atividades diárias (Raboy & Dietz, 2004). Se

alimentam de frutos, sementes, insetos e pequenos vertebrados e são importantes dispersores de sementes da

mata atlântica do Sul da Bahia (Rylands, 1989; Catenacci et al., 2009). Além de florestas maduras, Catenacci et

al. (2016), Oliveira et al. (2011) e Oliveira & De Vleeschouwer (2017) observaram grupos com territórios em

florestas secundárias, agroflorestas de cacao e seringais. Um recurso limitante para esta espécie de primata são

árvores de largo diâmetro com ocos, usados por eles como abrigo (Rylands, 1989, Raboy et al., 2004). Do ponto

de vista sanitário, são hospedeiros de diversos patógenos, entre eles endoparasitas intestinais (Monteiro et al.,

2007,2010; Catenacci et al., 2016), além de protozoários (Monteiro et al., 2007, 2010), bactérias (Catenacci et

al., pers. comm.), microfilárias e arbovírus (Catenacci et al. 2017).

A maioria dos estudos acima descritos com esta espécie de primata tem utilizado a radiotelemetria como

ferramenta de auxílio para o monitoramento dos grupos, a fim de garantir acesso a melhores observações de

campo. Para a colocação do rádio de maneira segura e eficiente tem-se realizado a contenção química do animal

que receberá este equipamento de monitoramento. A anestesia destes animais tem permitido identificação

individual dos componentes do grupo e no caso dos micos-leões, esta individualização é facilitada por diferentes

métodos de marcação, como tatuagem e pintura dos pêlos em regiões previamente determinadas (Dietz et al.,

1996). Além da necessidade de troca/colocação dos rádios e remarcação dos animais, coordenadores de campo

aproveitam a manipulação dos animais capturados para a realização de biometria e coleta de pêlos para estudos

genéticos. E diante da possibilidade de um maior aproveitamento da presença do espécime anestesiado, cada

vez mais biólogos e veterinários têm se unidos para coleta de diversos materiais biológicos (como sangue, fezes

e etc) que possam inferir sobre o estado sanitário das populações de L. chrysomelas. Desde então, mais de mil

capturas foram realizadas com o protocolo aqui descrito.

Diante deste contexto, o objetivo deste trabalho foi elencar, da maneira mais minuciosa possível, as técnicas de

captura que vem sendo utilizadas nos projetos de campo com populações in situ de L. chrysomelas no Sul da

Bahia, a fim de que esta experiência possa servir de guia para outros projetos de conservação que trabalhem

com primatas neotropicais de pequeno porte. Parte dos procedimentos de montagem de ceva, uso de

armadilhas e marcação dos animais foram adaptados dos métodos já utilizados com L. rosalia, no Rio de Janeiro

(Kleiman et al., 1986). Salientamos que as técnicas descritas aqui são relatos das nossas experiências e que,
 217

seguramente, outras técnicas poderão ser utilizadas, conforme a realidade e objetivo de cada projeto de campo

e a espécie animal a ser trabalhada.

METODOLOGIA

1. Atividades prévias ao campo-planejamento

- Equipe preparada?

Para cumprir os requisitos básicos na contenção de qualquer espécie selvagem, in situ ou ex situ, é necessária

uma equipe multidisciplinar bem treinada e perfeitamente entrosada (Mangini et al., 2006). A realização de

reunião prévia e após a captura é o ponto fundamental para o procedimento. O planejamento de uma captura

envolve a capacitação e organização das pessoas que integrarão a equipe (Brasil, 2005). É fundamental que cada

um deles saiba o porque da realização da captura, qual a função a ser empregada durante a captura, levando em

consideração questões éticas, o bem-estar dos animais (Fedigan, 2010) e a segurança para equipe (Brasil, 2014).

De maneira geral, uma equipe para captura envolve o coordenador geral do projeto, biólogos de campo,

veterinários e assistentes de campo (Brasil, 2014). Deve-se nomear um coordenador geral pela captura e um

coordenador veterinário (se a equipe tiver mais do que um) para a anestesia e monitoramento. O responsável

pela equipe deve discutir a proposta de contenção e programar as atividades, levando em consideração todas as

possibilidades de falha, a fim de minimizar os riscos. Durante a contenção química o menor número de pessoas

deve estar presente, a fim de minimizar o estresse do animal.

Com relação a questões de biossegurança, toda a equipe de campo deverá estar com as vacinas atualizadas (o

que inclui febre amarela, tétano, hepatites, poliomielite, influenza), realizar o esquema de pré-exposição de raiva

humana e verificar a titulação periodicamente. Também se sugere que todos os membros da equipe de campo

façam o teste de tuberculina para investigação de tuberculose. Atenta-se ainda a necessidade da aquisição prévia

do uso de equipamentos de proteção individual, como óculos de proteção, luvas e máscaras com filtro PFF3,

luvas raspas de couro, sapatos fechados e jalecos ou roupas reservadas somente para o processamento dos

animais no laboratório de campo (Brasil, 2014). Estas medidas de biossegurança visam minimizar o risco de

acidentes para as pessoas durante a execução da pesquisa e a exposição de patógenos para os micos-leões

(Fedigan, 2010).
 218

-Material organizado: check list?

Para dar início às atividades de campo, deve-se estar ciente se todos os materiais foram adquiridos e os

equipamentos testados e aptos para serem usados (Brasil, 2014). Uma estratégia para ter certeza de que nada

foi esquecido é fazer uma lista com tudo que será utilizado na captura, colocando inclusive o nome da pessoa

responsável por adquirir o material e a quantidade de cada item a ser utilizado (Brasil, 2005). Além disso, a equipe

de campo poderá fazer um um diagrama que resume todas as atividades que serão feitas no campo.

Consideramos importante ter em mãos listas prévias para checar os:

A. Materiais necessários para monitoramento dos animais nas armadilhas: binóculos, receptores e antenas

de radiotelemetria, alicates de tamanhos diferentes, arames, iscas, capas das armadilhas, caderno de

campo, lápis, cantil de água, arame, capa de chuva, lanche, luvas raspas de couro, lanterna, relógio,

B. Materiais e equipamentos veterinários para contenção e coleta de materiais biológicos: cloridrato de

quetamina (100mg/ml), cloridrato de midazolam (5mg/ml), estetoscópio, seringas de 1 e 3 ml, agulhas

de calibres 25x7 e 14x7, algodão, gaze, esparadrapo, luvas descartáveis de vários tamanhos, luva raspa

de couro, calculadora, máscara descartável PFF3, relógio, tubos de coleta de sangue com e sem EDTA,

álcool iodado, tricótomo, lâmina de barbear, lâmina de bisturi, lâminas de microscópio, papel filtro,

prancheta, caneta de marcação permanente, lápis, ficha clínica e de monitoramento anestésico,

criotubos com capacidade de 2ml, coletor de fezes, potes estéreis, formol 10%, álcool 70%, corante

panótico, corante de giensa, doppler, manguitos, oxímetro, termômetro, centrífuga, pipetas e ponteiras

de 10, 20, 200 e 1000µl, botijão de nitrogênio líquido, caixa com isopor, gelo reciclável, pilhas pequenas,

pinça hemostática, balança, puçá e gaiola de prensa, avental, óculos de proteção, lanterna, vela,

isqueiro.

C. Materiais, equipamentos e fármacos de emergência veterinária: umbu, sonda, soro fisiológico, cateter

tamanho 24, equipo, scalp tamanho 21, estojo cirúrgico, fios cirúrgicos, bolsa térmica, laringoscópio,

adrenalina (dose de 1ampola/5kg a cada 5 minutos), aminofilina (dose de 0,04ml/100g , IV,IM ou SC),

atropina (dose de 0,05mg/kg, IV ou 0,02-0,04mg/kg, IM), cetoprofeno (dose de 5mg/kg, IM),

dexametasona (dose de 0,25-1mg/kg, SC,IM), doxapram (dose de 2mg/kg, IV), epinefrina (0,1ml/animal,

IV, IM, SC), penicilina G. benzatina (20.000-60.000 UI/kg, IM).

D. Materiais e equipamentos para biometria, colocação de rádio colar e marcação dos indivíduos: régua, alicate,

fita métrica, sacos plásticos, jornal, máquina fotográfica, relógio, prancheta, ficha de biometria, rádio-colar,
 219

aparelho de tatuagem, tinta Nyanzol, escova de dentes para aplicar a mistura de Nyanzol e agua oxigenada,

papel toalha, caneta de marcação permanente, água oxigenada, álcool 70%.

- Valores de referência para a espécie

Ao trabalhar com uma espécie silvestre, principalmente in situ, é essencial termos o maior conhecimento

comportamental e fisiológico da espécie que queremos capturar (Mangini et al, 2006; Brasil, 2014). A busca por

dados em literatura e o contato com pessoas que já lidam com a espécie auxilia bastante no aumento do

conhecimento e na segurança do trabalho a ser executado. A tabela 1 apresenta os dados de referência para o

gênero Leontopithecus.

-Local de escolha dos girais, também conhecidos como plataformas de alimentação ou cevas

Para montar os girais, deve-se conhecer a área onde os micos estão utilizando, no caso de grupos habituados,

ou conhecer a área em que foi avistado um grupo de micos-leões (Tivosec et al., 2014). É importante verificar se

o local onde será montada a ceva não é área de sobreposição das áreas de vida de outros grupos de micos-leões,

para não correr o risco de capturar indivíduos, pertencentes a grupos diferentes em um mesmo giral (Brasil,

2014). Por isso, devemos percorrer o local da ceva em momentos distintos para ter a máxima segurança possível

que apenas um grupo está utilizando aquela área.

-Montagem dos girais

Os girais devem ser montados cerca de 1,5 m do chão, com uma base central de madeira larga e resistente o

suficiente para serem colocados até 3 cachos de banana e estacas de madeiras também fortes que saem desta

base e ficam amarradas em árvores adjacentes ao giral (Kierulff et al., 2004; Tivosec et al., 2014). A base central

também poderá ser montada de troncos de árvores, entrelaçados por cipós, lembrando uma mesa (Figura 1A).

O local onde será montada esta base necessita ser arborizado e tanto as árvores como as estacas que se

conectam à base necessitam ser fortes o suficiente para que os micos desçam por ela, e, após utilizar as estacas

como trilhas, tenham acesso aos cachos de banana. Além disso, posteriormente, as estacas e as árvores serão os

locais de escolha para a colocação das armadilhas.

 220

-Preparo das iscas

Após a montagem dos girais, devemos colocar as iscas (no caso, cachos de bananas) na base do giral, amarrando-

as com cipós para que nenhum animal as retire do local. É importante verificar constantemente os girais com

iscas, de forma que os mesmos estejam sempre com quantidade de bananas suficiente para atrair os micos-

leões. As iscas deverão ser colocadas a cada 2 ou 3 dias, lembrando que as mesmas deverão conter cachos verdes

e maduros. As bananas são as iscas escolhidas por serem atrativas (no visual e no cheiro), durarem um bom

tempo, serem baratas, além dos micos deixarem marcas evidentes de mordida que permitam identificação de

que o grupo visitou o giral. Armadilhas fotográficas podem ser colocadas para verificar a frequência de visitação

(Tivosec et al., 2014). Se os animais não se acostumam com banana, outras frutas podem ser usadas para

acostumá-los aos girais. No município de Itororó, BA, um dos grupos foi atraído por uva (talvez por serem

parecidas com as frutas da mata) até ficarem acostumados com bananas (C.E. Guidorizzi, pers. comm.).

-Tempo de ceva e colocação de armadilhas

O tempo de ceva irá variar conforme o grupo com o qual se está trabalhando. Grupos habituados necessitam de

um tempo de ceva de cerca de 3 semanas, dependendo do ambiente trabalhado: na 1° semana monta-se o giral

com bananas apenas na sua base central, sem armadilhas montadas; na 2° semana coloca-se um pequeno

número de armadilhas (ex, grupo de 8, colocar até 6 armadilhas) abertas e travadas, com iscas tanto na base do

giral como em cima e dentro das armadilhas. Caso o grupo esteja habituado, pode-se colocar todas as armadilhas

de uma vez (Figura 1A). As armadilhas são do tipo Tomahawk, com 49 cm de comprimento, 17cm de largura e

17cm de altura e deverão ser previamente pesadas e identificadas para auxiliar no peso estimado prévio à

anestesia. As armadilhas deverão ser colocadas sobre as estacas que formam a trilha até a base do giral e estar

encostadas nas árvores adjacentes onde estas estacas foram presas, de forma que os micos possam descer com

facilidade e segurança até a armadilha. Elas devem ser presas com arame resistente, tanto na sua base (junto às

estacas), como na sua porção final (junto ao tronco da árvore). Enquanto não iniciar a campanha de captura, as

mesmas deverão permanecer abertas, mas travadas com um arame, de forma que não possam ser acionadas

desnecessariamente. Deve-se tomar cuidado para não deixar as pontas dos arames utilizados para prender as

armadilhas soltos de forma a apresentar perigo aos animais (furando-os, por exemplo); na 3° semana coloca-se

o restante das armadilhas abertas e travadas. Se na área existirem outras espécies de primatas, como Callithrix

kuhlii, aconselha-se a colocar o dobro do número de armadilhas do tamanho do grupo de micos que se planeja
 221

capturar. É conhecido que o mico-leão-da-cara-dourada faz associação com C. kuhlii (Rylands 1989; Raboy et al.,

2008; Tivosec et al., 2014) e, portanto, esta espécie pode cair nas armadilhas por engano. Também é importante

colocar armadilhas extras para oferecer a opção de escolha aos micos. No final da terceira semana, colocar iscas

apenas dentro das armadilhas.

No caso de grupos não habituados as armadilhas e aos pesquisadores de campo, os processos de cevar e colocar

armadilhas deverão ser realizados de maneira mais gradual para não afugentar os animais. O tempo de ceva vai

depender do sucesso de visitação da espécie em questão. Se, após duas semanas os animais estiverem visitando

pouco o local, deve-se pensar em montar um giral em outro local. Para grupos onde a área de vida é

desconhecida aconselha-se montar dois girais e abandonar um assim que o grupo começa a visitar a outra ceva.

- Monitoramento de visitas dos animais no giral

Assim que forem colocadas as iscas, os girais deverão ser monitorados a cada 2 ou 3 dias para verificar se houve

visita dos micos-leões, além da necessidade de reposição das bananas. Tendo certeza da ausência do grupo no

giral, deve-se aproximar e procurar indícios da visitação do grupo no local. Um método para confirmar se o grupo

visitou o giral, à exceção da própria visualização do grupo, são as marcas de dentes e unhas deixadas pelos

mesmos nas bananas. É necessária prática para poder afirmar que as mordidas são dos micos-leões, uma vez que

outros calitriquídeos costumam frequentar também estes girais. Pode ser usado armadilhas fotográficas no início

de uma pesquisa de campo para ter certeza do animal que está visitando o giral e com que frequência (Kierulff

et al., 2004; Kierulff et al., 2005; Tivosec et al., 2014). Importante recolher os restos de bananas comidas ou

mesmo marcadas, para que não haja dúvida do pesquisador durante os monitoramentos seguintes.

-Limpeza prévia do laboratório de campo

O laboratório e “quarentenário”, locais onde os animais serão anestesiados e posteriormente alojados por uma

noite, respectivamente, devem ser previamente desinfetados. O protocolo mais utilizado na limpeza destes

locais é a varredura, seguida lavagem com água e sabão e desinfecção com hipoclorito de sódio no piso e nas

bancadas. Assim que o local estiver enxuto, deve-se utilizar a vassoura de fogo nos locais onde as armadilhas

serão alojadas e na bancada onde será feita a contenção física e anestesia. O laboratório deve possuir um local

para guardar jornais, além de lixos específicos para cada procedimento (lixo comum, hospitalar e perfuro-
 222

cortante). Todo este procedimento de limpeza deverá ser seguido criteriosamente quando estivermos na

campanha de captura de vários grupos, no qual, entre cada grupo, o protocolo de limpeza deverá ser repetido.

-Limpeza prévia dos equipamentos no laboratório

Todo material ou equipamento que entrará em contato com os animais deverá ser previamente desinfetado com

álcool 70%. Este procedimento deverá ser realizado também entre os grupos.

2. Atividades durante a captura

-Campanha de Captura

Denominou-se campanha de captura os dias em que a equipe estará apta a abrir as armadilhas para contenção

dos micos-leões.

- Abertura das armadilhas para campanha de captura

A campanha de captura apenas começa quando o grupo de micos está visitando com regularidade o giral já

montado com todas as armadilhas e com bananas dispostas apenas dentro da armadilha. Deve-se deixar apenas

uma banana no fundo de cada armadilha presa por uma vara fina de madeira que fará com que a banana fique

parcialmente fixa no local (Figura 1B). Em seguida, retirar o arame da trava da armadilha e acionar o dispositivo

que a arme. Importante testar diversas vezes este dispositivo para minimizar erros, calculando que o animal pode

descer pela árvore onde a armadilha está apoiada e, portanto, este dispositivo deverá ser colocado de maneira

a não ser ativado com o pulo e o peso do animal por cima da armadilha. Além disso, deve-se verificar se as travas

das portas da armadilha estão descendo até o final, para evitar fuga dos animais após captura. Todas as bananas

que estavam no giral deverão ser retiradas da mata e todas as armadilhas deverão ser checadas antes que a

equipe deixe o local.

- Monitoramento das armadilhas durante a campanha de captura

O monitoramento deverá ser feito com um intervalo médio de duas horas, a depender das condições climáticas

do dia (chuvoso; calor intenso) e da composição do grupo (fêmeas amamentando, filhotes ou subadultos). No

caso de grupos não-habituados, o intervalo poderá ser maior, mas não ultrapassar de 3 horas, desde que

tenhamos certeza de que o giral foi montado em local onde não há sobreposição de grupos. Em dias chuvosos,
 223

o tempo de visita às armadilhas deve ser menor, pelo risco dos animais terem hipotermia ao ficarem molhados

por muito tempo. E em caso de chuvas intensas, a armadilha deve ser fechada e a captura interrompida até

melhores condições climáticas. De qualquer maneira, devemos sempre visitar o giral com o menor número de

pessoas possível e em silêncio, pois os animais podem estar próximos do giral e a presença do pesquisador

poderá afastá-los. Se em uma das visitas houver micos presos nas armadilhas deve-se anotar o horário na ficha

de campo para saber o tempo de jejum e o momento de iniciar a anestesia (Figura 1C). Se o número de animais

capturados não for o desejado, mantemos os animais nas armadilhas no campo, mas colocamos folhas de árvores

no topo das armadilhas que tem animais capturados para gerar sombra/cobertura e melhor conforto térmico.

Também se diminui o tempo de intervalo entre as visitas para garantir que os animais presos nas armadilhas não

sejam predados. Se na composição do grupo estiverem presente filhotes ou fêmeas lactantes, deve-se evitar

que filhotes de menos de um mês fiquem separados da fêmea por mais de quatro horas. Se for necessário,

devemos soltar a fêmea lactante e o adulto que está com o filhote para garantir que o filhote não fique sem ser

amamentado. Outra opção é levar todos ao laboratório de campo e anestesiar a fêmea lactante primeiro, seguida

do animal com o filhote. Assim que o animal com filhote for sedado, transfere-se o infante para a armadilha onde

está a fêmea progenitora. Caso a fêmea com o filhote fique fora da armadilha, recomenda-se soltar outro adulto

para que ele possa dar suporte à fêmea no restante do dia e para que a progenitora não passe a noite sozinha

com o filhote. Se caírem outras espécies nas armadilhas, devemos soltá-las imediatamente; devemos estar

atentos de que filhotes de C. kulhi estejam no dorso do adulto antes de soltá-los, diminuindo a chance que de

abandono do filhote, por estresse.

Cada situação de captura é única e deverá estar a cargo da equipe qual o melhor momento para intervir. Após

ter certeza de que todos os animais desejados foram capturados e estão em condições de serem levados ao

laboratório, os pesquisadores devem se aproximar do giral, colocar um arame reforçando a trava que mantém a

porta da armadilha fechada, soltar a armadilha do giral e em seguida, colocar uma capa de tecido por cima de

cada armadilha, de forma a tentar minimizar o estresse (Figura 1D). As armadilhas com os animais deverão ser

conduzidas, com cuidado até o laboratório de campo onde serão realizados os demais procedimentos.

- Chegada dos animais no quarentenário e sequência de atividades a ser conduzida no laboratório

Assim que os animais chegam da mata, suas capas devem ser retiradas e os mesmos alojados no quarentenário.

Cobrem-se as armadilhas com folhas de jornal para melhor aclimatação. É importante observar a ordem em que
 224

os animais serão alojados, começando por aqueles que aparentam tamanho (e suposto peso) maiores. Caso

algum animal com tamanho intermediário já tenha rádio colar, sugere-se retirar o colar deste animal e incluir

um rádio colar nos animais maiores. Deve-se iniciar a contenção com os micos-leões que irão receber o rádio

colar, pois caso este animal tenha algum problema que inviabilize a colocação do rádio, outros animais poderão

ser escolhidos antes de terem sido anestesiados. Em animais juvenis, os mesmos devem ser colocados perto da

fêmea, na tentativa de mantê-los mais calmos. Obviamente, no caso de imprevistos, como micos que necessitam

de exame clínico imediato ou em transferências de filhotes junto à fêmea, deve-se mudar a ordem de

processamento. Os micos-leões deverão ficar em jejum sólido e líquido entre 3 e 4 horas, sendo o tempo

cronometrado a partir do momento em que os indivíduos param de comer a banana utilizada como isca na

armadilha. Após recuperação anestésica, os indivíduos retornam para o quarentenário, onde permanecem até o

dia seguinte para soltura.

Atualmente a ordem dos procedimentos no laboratório são:

1°: Pesar a armadilha com o animal dentro para poder estimar o seu peso (lembrar que a armadilha sem o animal

já deve ter sido previamente pesada). Esta é a maneira mais precisa de estimar o peso do animal para cálculo da

dose do anestésico. No entanto, não tem sido a técnica mais empregada por questões de logística (maior

manipulação e estresse do animal, além de muitas vezes a gaiola estava molhada, o que impedia de ter o peso

real do animal). Por isso atualmente estimamos o peso do animal somente por visualização e caso houvesse

dúvida, estimamos um peso inferior para ser realizado uma dose de reforço quando o animal já estiver sedado;

2°: Contenção física utilizando a gaiola de prensa;

3°: Contenção química e monitoramento inicial da anestesia;

4°: Pesagem do animal para ajuste de dose do anestésico, se necessário;

5°: Coleta de sangue;

6°: Marcação do indivíduo, através de tatuagem;

7°: Coleta de pelos;

8°: Retirada do rádio colar;

9°: Coleta de dados biométricos;

10°: Colocação de rádio colar (normalmente um ou dois indivíduos por grupo);

11°: Coleta de demais materiais biológicos;

12°: Marcação dos indivíduos através de tingimento; e,

 225

13°: Monitoramento da recuperação anestésica.

- Contenção física

Em uma bancada, o mico-leão é transferido da armadilha para a gaiola de contenção e prensado com uma

“porta” móvel o suficiente para imobilizá-lo e permitir a aplicação da anestesia (Figura 1E).

No caso de captura de filhotes ou jovens com menos de 3 meses de idade, aconselha-se não realizar a contenção

química. Neste caso, utiliza-se luvas de raspa de couro e o animal é rapidamente pesado utilizando-se um saco

de pano e uma pesola. Além desse procedimento, é feito sexagem e o animal é marcado com tinta para então

retornar à armadilha. Este procedimento de contenção física deverá ser realizado por profissionais experientes

em contenção.

-Contenção química e monitoramento anestésico

Assim que o animal é prensado na gaiola de contenção, aplica-se, via intramuscular e na região coxo-femoral, a

anestesia (Figura 1E). O protocolo anestésico adotado desde 2006 é cloridrato cetamina (dose 10mg/kg) e

midazolam (dose 0,3mg/kg) (Savage et al., 1993; Catenacci et al., 2016). Anota-se o horário de indução e decúbito

do indivíduo após a administração do fármaco. O animal é então retirado da gaiola de contenção iniciando o

monitoramento anestésico, no qual são aferidos: freqüência cardíaca e respiratória, temperatura retal, salivação,

tônus musculares e reflexos caudal, anal, auricular, intra-auricular, dérmico e interdigital em três momentos

(assim que o animal entra em decúbito, 15 e 30 minutos após). Os reflexos são medidos com uma pinça

hemostática envolta por uma borracha, de modo a não machucar o animal e deve ir até o primeiro ponto de

travamento da pinça; de forma a padronizar a intensidade do estímulo. A qualidade e o período de latência,

duração e recuperação anestésica deve ser anotado na ficha de monitoramento anestésico. Após recuperação

anestésica, o animal deve retornar ao quarentenário. Além do monitoramento anestésico, são realizados exames

clínicos do animal, como avaliação corporal, coloração de mucosas, tempo de perfusão capilar, tamanho de

linfonodos, existências de fraturas antigas, lesões de pele e etc (Figura S1).

- Pesagem do animal

O animal deve ser pesado com uma balança de precisão digital de um grama logo após o primeiro monitoramento

anestésico para conferir o peso estimado com o peso real e a necessidade de dose de reforço da anestesia. Deve-

se lembrar de retirar o rádio colar antigo do pescoço do animal antes de pesar, caso possua. Para o reforço, leva-
 226

se em consideração não somente o peso, mas também as condições clínicas do animal e o estágio de sedação.

Se necessário complementar a anestesia, utilizar apenas cloridrato de cetamina, na dose 5mg/kg, IM.

-Coleta de sangue

Como este procedimento é mais doloroso que a coleta dos demais materiais biológicos, preconiza-se realizá-lo

o quanto antes (devido a duração da anestesia). É importante que o responsável pela coleta de sangue tenha

experiência prévia para realizar esta atividade; sendo sugerido treinamento prévio em animais de cativeiro, de

preferência da mesma espécie ou gênero da espécie focal. A coleta de sangue pode ser realizada através da

punção da veia inguinal medial no volume máximo de coleta de três ml, utilizando uma agulha calibre 25x7 e

uma seringa de 3ml (Brasil, 2014; Monteiro et al., 2010). Antes da coleta de sangue, faz-se a tricotomia do local

e limpeza com antisséptico. O sangue deverá ser aliquotado e armazenado conforme os exames e testes

diagnósticos a serem realizados. Para hemograma, o sangue deverá ser armazenado em tubos com EDTA e

imediatamente refrigerados, devendo ser realizado com a maior brevidade possível (até 24 horas). Para

bioquímico e provas sorológicas e, alíquotas de sangue devem ser armazenadas em tubos sem anticoagulante, e

se, possível, no laboratório de campo, centrifugados a 2500rpm por 15 minutos para obtenção dos soros, sendo

em seguida congelados. Na ausência da centrífuga de campo, este sangue poderá ser armazenado sob

refrigeração até a centrifugação no laboratório (Brasil, 2012). Para provas moleculares, uma alíquota de sangue

deverá ser armazenada in natura em tubos criogênicos e depositados em botijão de nitrogênio líquido (Brasil,

2014). Ainda para fins moleculares, com o que sobrou de sangue no êmbolo da seringa e agulha, deposite em

papel filtro e deixe secar a temperatura ambiente. Para pesquisa de hemoparasitas, também aconselhamos a

realização de no mínimo um esfregaço sanguíneo no campo, seguido de coloração do tipo guiensa (Brasil, 2012).

Estas lâminas deverão ser armazenadas a temperatura ambiente. Todas as técnicas utilizadas devem ser

adaptadas para trabalhar com a mínima alíquota sanguínea suficiente para a obtenção dos resultados. É

fundamental atentar-se na identificação correta dos tubos e lâminas com lápis. O sangue coletado pode ser

utilizado para realização de hemograma, bioquímico, pesquisa de hematozoários e perfis sorológicos para

diversos agentes infecciosos, a depender da espécie de primata e área estudada (Brasil, 2005). Aconselha-se que

o veterinários responsável da equipe conheça quais são as zoonoses da região de estudo para que a coleta de

dados também possa gerar resultados a saúde pública.

 227

- Tatuagem

Os animais são tatuados utilizando-se aparelho específico de seres humanos. Faz-se a tricotomia do local e

limpeza com antisséptico antes de tatuar (Brasil, 2014). A marcação é em números e é realizada na região medial

da coxa como método de identificação definitiva de cada indivíduo. Esta tatuagem auxilia na identificação futura

dos animais, caso haja recaptura. Este procedimento, em geral, só precisa ser realizado na primeira captura do

animal, mas em todas as recapturas deve-se conferir a marcação e, se necessário, repetir. Entre um animal e

outro a agulha da tatuagem deve ser desinfetada com álcool.

- Coleta de pêlos

No final do primeiro monitoramento anestésico (quando está sendo aferida a temperatura retal), pode-se iniciar

a coleta de pêlos. Cerca de 50 pêlos são necessários para as análises genéticas; o essencial é a retirada do pêlo

com o seu bulbo (raiz). Entre um animal e outro, a pinça utilizada para coleta deve ser flambada afim de evitar

resquícios de material genético de outros indivíduos. Os pêlos deverão ser guardados em envelopes de papel ou

sacos plásticos lacrados e armazenados a temperatura ambiente (Brasil, 2012).

- Colocação do rádio colar

O rádio colar utilizado é adaptado para o gênero Leontopithecus e devem pesar no máximo 5% do peso vivo do

animal. Constitui-se de um colar com esferas para diminuir a possibilidade de ferimentos na pele decorrente de

fricção (Hollohil, modelo RI-2D) (Figura 1F). Para a escolha das frequências, opta-se por escolher frequências dos

rádios distantes no mínimo em 20 unidades tanto quando se trabalha com grupos diferentes, como para rádios

colocados em indivíduos do mesmo grupo. Este cuidado é essencial para que não haja interferência das

frequências durante o monitoramento de campo e possível falha na coleta dos dados. Deve-se escolher as

frequências e testar os rádios-colares antes que o mesmo seja colocado no animal.

Para a colocação do rádio colar, deixa-se uma folga de aproximadamente 1,0-1,5cm entre o colar de esferas e o

pescoço do animal, de forma que o rádio circule livremente pelo pescoço, não permitindo, porém, que a pata

dianteira do animal passe por dentro do colar. Importante fazer este movimento de rotacionar o rádio no

pescoço do animal várias vezes, a fim de verificar o melhor ajuste antes de fechar o colar. O fechamento do colar

deverá ser feito de maneira firme, mas sem deixar pontas na gargantilha que poderiam lesionar o pescoço do

animal. Escolhe-se de preferência animais adultos e dominantes, pois o crescimento do animal já está
 228

estabilizado, além da tentativa de assegurar o monitoramento do grupo, uma vez que é menor a probabilidade

de migração de dominantes para outros grupos. Caso desconheça a idade do indivíduo, usa-se o peso de 510 g

como limite mínimo para um indivíduo estar apto a receber um colar, levando em conta sempre a condição física

do animal no momento do processamento. Pela nossa experiência, a duração de um rádio colar é de cerca de 6

meses, e isto deve estar previsto no planejamento e cronograma da equipe; podendo ser flexível conforme as

informações do sinal do rádio no campo.

-Coleta de dados biométricos

Os dados de biometria fornecem informações importantes sobre a composição do grupo e o estado reprodutivo

dos indivíduos, além de permitir um acompanhamento individual durante as recapturas.

Os métodos de biometria foram adaptados do método previamente desenvolvido pelos pesquisadores que

monitoram o mico-leão-dourado (Leontopithecus rosalia) (Figura S2). De um modo geral, afere-se medida de

todo o corpo do animal, incluindo cauda, cabeça e membros (Figura 1G), além de medidas específicas só de

corpo, crânio, dentição, glândulas de marcação no esterno e circungenitais. Maiores detalhes podem ser

encontrados no material suplementar (Figura S2).

Como são realizadas diversas manipulações do animal durante a biometria, aconselha-se manter a cabeça do

animal erguida sempre que possível para diminuir a chance de falsa via, no caso de refluxo alimentar. Sugerimos

também que as medidas biométricas sejam sempre tomadas pelo mesmo pesquisador, a fim de evitar efeito de

diferenças de pessoas. Além disso, a utilização de material de precisão, como paquímetro digital, tem efeito

positivo na acurácia dos dados.

- Coleta de demais materiais biológicos

A. FEZES: Para pesquisa de endoparasitas, as fezes devem ser coletadas com luva, por via retal, sendo então

armazenadas sob refrigeração, em potes previamente identificados e encaminhados ao Laboratório de

Parasitologia de preferência do pesquisador. Na ausência de refrigeração, as fezes devem ser armazenadas em

potes estéreis contendo formol 10% (Brasil, 2012; Monteiro et al, 2007). Para provas moleculares, uma alíquota

fecal deve ser armazenada in natura em criotubo e congelada imediatamente. Na ausência de energia elétrica,

as amostras podem ser mantidas refrigeradas numa caixa de isopor com gelo reciclado por 24 horas.
 229

B. ECTOPARASITAS: Os carrapatos e outros ectoparasitas (como pulgas, piolhos e ácaros) devem ser retirados

manualmente, armazenados em solução de álcool a 70% e mantidos a temperatura ambiente. As fêmeas

ingurgitadas devem ser armazenadas vivas em potes com furos e com substrato de grama.

C. PÊLOS COM ESCARIFICAÇÃO DA PELE: deve-se avaliar ainda os possíveis parasitas (ácaros) presentes no pêlo

e pele destes animais. Para tanto, devem ser realizados raspados de pele, com utilização de lâmina de bisturi,

mantendo-se a inclinação de 45o, de forma que haja a escarificação da pele, sem que ocorra o corte desta. Além

da identificação parasitológica da pele, os pêlos devem ser coletados para isolamento e identificação de

dermatófitos (fungos pertencentes principalmente aos gêneros Trichophyton, Microsporum e Epidermophyton),

mediante cultura dos fungos. Assim que os pêlos forem coletados, embrulha-se os mesmos entre duas lâminas

de microscopia para envio do material ao laboratório especializado.

D. CITOLOGIA VAGINAL: para identificar as estruturas celulares vaginais da espécie no momento da coleta e

inferir sobre o estado reprodutivo do indivíduo, deve-se realizar um esfregaço vaginal. No esfregaço, os lábios

vulvares devem ser gentilmente separados com uma mão. A outra mão deve conduzir um swab plástico de

algodão estéril, o qual será passado através da comissura dorsal da vulva. O swab deve ser inserido até a distância

necessária para atingir o canal pélvico. Nesse momento deve-se rotacionar o swab em todas as direções. Todo

esse procedimento dura apenas alguns segundos e é indolor (Snoeck et al., 2011). Em seguida, o swab deve ser

rolado gentilmente sobre uma lâmina, fazendo-se em geral três impressões lineares. Esse esfregaço será corado

imediatamente após a coleta pelo método panótico e então encaminhado ao laboratório especializado.

-Marcação dos indivíduos utilizando tingimento

Para auxiliar na identificação dos indivíduos no campo e facilitar dados de comportamento individual, os pêlos

dos animais capturados podem ser tingidos em diferentes partes do corpo. Esta marcação não é definitiva e

geralmente é refeita a cada recaptura. A tinta utilizada para tingir os pêlos dos animais é um corante natural

(Nyanzol® (Dietz et al., 1996). O pó de tinta deve ser misturado com água e água oxigenada 30 volumes até se

formar uma pasta, que tenda ao líquido, na proporção aproximada de 1:1:1, respectivamente). Com o auxílio de

uma escova de dente, esta mistura será passada no mico na região pré-estabelecida pelo pesquisador. Em geral,
 230

a marcação ocorre nas caudas, cabeças ou membros, embora a coloração da cabeça deva ser evitada para não

interferir em possíveis processos de reconhecimento individual entre os micos.

-Monitoramento da recuperação anestésica

Antes do animal retornar a armadilha, dever ser realizado uma última aferição dos parâmetros fisiológicos

descritos anteriormente. São anotados dois momentos de recuperação do animal: quando o mesmo consegue

levantar a cabeça e quando fica em estação.

2. Atividades pós captura (soltura)

No dia seguinte da captura, cerca de duas horas antes de retirar os animais do quarentenário, deve ser oferecido

meio pedaço de banana para que os animais voltem ao campo sem estarem em jejum. Observa-se também a

condição dos animais e se o colar se mantém no local adequado. De maneira geral, os animais aceitam bem esta

oferta de alimento. Antes de voltar ao campo, as armadilhas são novamente cobertas com a capa de tecido.

Os animais devem ser liberados no mesmo local onde foram capturados logo ao nascer do sol, para que possam

retornar as atividades regulares na mata (forrageamento, defesa de território e etc) e encontrem com o restante

do grupo o quanto antes, caso algum animal não tenha sido capturado no dia anterior. Durante a soltura, as

armadilhas devem ser colocadas no solo uma ao lado da outra e abertura das mesmas devem estar voltadas para

uma direção onde o animal possa sair e encontrar uma árvore próxima para subir (Figura 1H). Os animais mais

jovens devem ser liberados primeiro para que tenham tempo de seguir os adultos assim que os mesmos forem

liberados. Uma outra alternativa é soltar primeiro um animal adulto, seguidos dos juvenis e por último, o restante

dos adultos. Dessa maneira, os juvenis poderão seguir o primeiro adulto que foi solto, enquanto os outros adultos

são liberados. Costuma-se não monitorar o grupo no dia em que há a soltura, a não ser que haja algum motivo

especial para este monitoramento emergencial. Porém é essencial procurar o grupo dentro de 2-3 dias depois

da captura para conferir se todos os animais estão juntos e em boa condição.

CONCLUSÃO

O presente estudo relata a experiência de mais de 1000 eventos de captura nas últimas duas décadas com a

espécie Leontopithecus chrysomelas.

 231

A contenção de animais silvestres é uma prática comum no manejo de animais silvestres e um importante

componente de pesquisa (Pitt et al. 2006). Infelizmente são poucos os relatos de experiências detalhados sobre

métodos de captura em primatas neotropicais in situ de pequeno porte (Savage et al., 1993; Stone et al., 2015;

Wasa et al., 2015). Tais dados são essenciais devido ao crescente número de pesquisas para programas de

monitoramento de populações, seja para investigações ecológicas, genéticas ou sanitárias. Espera-se que este

estudo possa auxiliar futuros trabalhos de campo e que sejam sempre levados em consideração o objetivo da

captura, o ambiente e a espécie a ser capturada, além de um planejamento criterioso das atividades a serem

realizadas antes, durante e pós-captura, priorizando o bem-estar do animal capturado e a segurança dos

profissionais envolvidos nesta atividade.

AGRADECIMENTOS

Os autores agradecem a Dra Elizabeth Salbé Travassos da Rosa pela revisão do texto, além da importante

colaboração do ICMBIO, da Ong Instituto de Estudos Socio-ambientais do Sul da Bahia, além do geógrafo Gabriel

Dos Santos e a veterinária Mariângela Cruz pelo auxílio das capturas. Também agradecemos os assistentes de

campo envolvidos nos projetos com mico-leão-da-cara-dourada. Por fim, agradecemos aos financiadores: Saint

Louis Zoo WildCare Institute (USA), The Wild Animal Fund, da American Association of Zoological Veterinarians

(USA), CNPq (Brasil), o Center for Research and Conservation of the Royal Zoological Society of Antwerp

(Belgium), Lion Tamarins of Brazil Fund, National Lottery of Belgium, Primate Action Fund, Zoological Society of

London, Conservação Internacional.

REFERÊNCIAS

Bianchi MAF, Mello RH, Bianchi H, Bermond Júnior JL, Ibrahim PAF. 2016. Restrain of birds with bottles of

polyethylene terephthalate, tested in red-browed from the Atlantic Forest. Arquivo Brasileiro de Medicina

Veterinária e Zootecnia, 68 (1): 136-140.

Brasil. Ministério da Saúde. Secretaria de Vigilância em Saúde. 2005. Manual de vigilância de epizootias em

primatas não-humanos / Ministério da Saúde, Secretaria de Vigilância em Saúde. – Brasília : Ministério da Saúde

56 p.
 232

Brasil. Ministério do Meio Ambiente. Instituto Chico Mendes de Proteção a Biodiversidade. 2012. Protocolo para

coleta de dados sobre primatas em Unidades de Conservação da Amazônia / Marcelo Derzi Vidal (organizador).

– Brasília:

ICMBio, 38 p.

Brasil. Ministério da Saúde. Secretaria de Vigilância em Saúde. Departamento de Vigilância das Doenças

Transmissíveis. 2014. Guia de vigilância de epizootias em primatas não humanos e entomologia aplicada à

vigilância da febre amarela / Ministério da Saúde, Secretaria de Vigilância em Saúde, Departamento de Vigilância

das Doenças Transmissíveis. – 2. ed. – Brasília: Ministério da Saúde. 100 p.

Branson KR. 2003. Anestésicos injetáveis Pp:179-223, in Adams HR (Ed.). Farmacologia e Terapêutica em

Veterinária. Editora Guanabara Koogan, Rio de Janeiro.

Catenacci LS, Nogueira-Filho SLG, De Vleeschouwer KM. 2009. Seed Dispersal by Golden-headed Lion Tamarins

Leontopithecus chrysomelas in Southern Bahian Atlantic Forest, Brazil Biotropica 41(6): 744–750.

Catenacci LS, De Vleeschouwer KM, Pessoa M. Nogueira-Filho SLG. 2016. Diet and feeding behavior of

Leontopithecus chrysomelas (Callitrichidae) in degraded areas of the Atlantic Forest of South-Bahia, Brazil.

International Journal of Primatology 37(2): 136–157.

Catenacci LS, Colosio AC, Oliveira LC, De Vleeschouwer KM, Munhoz AD, Deem SL, Pinto JM. 2016. Occurrence of

Prosthenorchis elegans in Free-living Primates from the Atlantic Forest of Southern Bahia, Brazil. Journal of

Wildlife Diseases. 52(2):364-368.

De Vleeschouwer KM, Oliveira LC. 2017. Report on the presence of a group of golden-headed lion tamarins

(Leontopithecus chrysomelas), an endangered primate species in a rubber plantation in southern Bahia, Brazil.

Primate Biology 4(1):61-67.

Dietz JM, de Sousa SN, Billerbeck R. 1996. Population dynamics of golden-headed-lion-tamarins Leontopithecus

chrysomelas in Una Reserve, Brazil Dodo 32:115-122.

Dietz JM, Peres CA, Pinder L. 1997. Foraging Ecology and Use of Space in Wild Golden Lion Tamarins

(Leontopithecus rosalia) American Journal of Primatology 41:289–305.

Franklin SP. Miller KE. Baker AJ, Dietz JM. 2007. Do Cavity-Nesting Primates Reduce Scent Marking Before

Retirement to Avoid Attracting Predators to Sleeping Sites? American Journal of Primatology 69:255–266.

Fedigan LM. 2010. Ethical Issues Faced by Field Primatologists: Asking the Relevant Questions. American Journal

of Primatology 71:1–18.
 233

Guidorizzi CE. 2008. Ecologia e comportamento do mico-leão-da-cara dourada, Leontopithecus

chrysomelas (Kuhl, 1820) (Primates, callitrichidae), em um fragmento de floresta semidecidual em

Itororó, Bahia, Brasil. Tese de mestrado em Zoologia. Programa de Zoologia da Universidade Estadual

de Santa Cruz – UESC, Ilhéus, Bahia, Brazil.

IUCN 2008. IUCN Red List of Threatened Species. Disponível em: www.redlist.org Acessado em 4 de junho de

2017.

Kierulff MCM, Santos GR, Canale GR, Guidorizzi CE, Cassano CR. 2004. The use of camera-traps in a survey of the

buff-headed capuchin monkey, Cebus xanthosternos Neotropical Primates 12(2): 56-59.

Kierulff MCM, Canale GR, Suscke PG. 2005. Monitoring the Yellow-Breasted Capuchin Monkey (Cebus

xanthosternos) with radiotelemetry: Choosing the best radiocollar. Neotropical Primates 13 (1):32-33.

Kleiman DG, Beck BB, Dietz JM, Dietz LA, Ballou J, Coimbra-Filho AF. 1986. Conservation program for the golden

lion

tamarin: captive research and management, ecological studies, educational strategies, and reintroduction. Pp.

959–979, in Benirschke K (Ed). Primates: the road to self-sustaining populations. Editora Springer-Verlag, New

York.

Mangini PR, JCR Silva. 2006. Medicina da Conservação. Pp: 1258-1267, in Cubas ZC, Silva JCR, Catão-Dias JL (eds).

Tratado de Animais Selvagens. Editora Rocca, São Paulo.

Ministério do Meio Ambiente MMA. 2014. Portaria MMA n. 444/2014, de 17 de dezembro de 2014. Diário Oficial

da União, Brasília, DF, v.126, n.245, p.121, 18 dez. 2014. Seção 1.

Monteiro RV, Dietz JM, Raboy B, Beck B, De Vleeschouwer KM, Baker A, Martins A, Jansen AM. 2007. Parasite

community interactions: Trypanosoma cruzi and intestinal helminths infecting wild golden lion tamarins

Leontopithecus rosalia and golden-headed lion tamarins L. chrysomelas (Callitrichidae, L., 1766) Parasitology

Research 101:1689–1698.

Monteiro RV, Dietz JM, Jansen AM. 2010. The impact of concomitant infections by Trypanosoma cruzi and

intestinal helminths on the health of wild golden and golden-headed lion tamarins. Research in Veterinary

Science 89:27–35.
 234

Oliveira LC, Neves LG, Raboy BE, Dietz JM. 2011. Abundance of jackfruit (Artocarpus heterophyllus) affects group

characteristics and use of space by golden-headed lion tamarins (Leontopithecus chrysomelas) in cabruca

agroforest Environmental Management 48:248-262.

Pinto LPS, Rylands AB. 1997. Geografic, distribuition of the golden-headed lion tamarin, Leontophitecus

chrysomelas: Implications for its management and conservation. Folia Primatologia 68:161-168.

Raboy BE, Dietz JM. 2004. Diet, foraging, and use of space in wild golden-headed lion tamarins. American Journal

of Primatology 63:1-15.

Raboy BE, Christman MC, Dietz JM. 2004. The use of degraded and shade cocoa forests by endangered golden-

headed lion tamarins Leontopithecus chrysomelas Oryx 38:75-83.

Raboy BE, Canale GR, Dietz JM. 2008. Ecology of Callithrix kuhlii and a Review of Eastern Brazilian Marmosets

International Journal of Primatology 29:449–467.

Rylands AB. 1982. The Behaviour and Ecology of Three Species of Marmosets and Tamarins (Callitrichidae,

Primates) in Brazil. Unpublished Ph.D. thesis, University of Cambridge, Cambridge.

Rylands AB. 1989. Sympatric callithrichids: the black tuffed ear marmoset, Callithrix kuhli, and the golden-headed

lion tamarins, Leontopithecus chrysomelas Journal of Human Evolution 18:679-695.

Savage A, Girald LH, Blumer ES, Sot LH, Burger W, Snowdon CT. 1993. Field Techniques for Monitoring Cotton-

Top Tamarins (Saguinus oedipus oedipus) in Colombia American Journal of Primatology 31:189-196.

Snoeck PPN, Cruz ACB, Catenacci LS, Cassano CR. 2011. Citologia vaginal de preguiça-de-coleira (Bradypus

torquatus) Pesquisa Veterinária Brasileira 31(3):271-275.

Stone AI, Castro PHG, Monteiro FOB, Ruivo LP, Silva Junior JS. 2015. A Novel Method for Capturing and

Monitoring a Small Neotropical Primate, the Squirrel Monkey (Saimiri collinsi). American Journal of Primatology

77(3):239-45.

Tavela AO, Fuzessy LF, Silva VHD, Silva FFR, Carretta Junior M, Silva IO, Souza VB. 2013. Helminths of wild hybrid

marmosets (Callithrix sp.) living in an environment with high human activity Revista Brasileira de Parasitologia

Veterinária 22(3): 391-397.

Tisovec KC, Cassano CR, Boubli JP, Pardini R. 2014. Mixed-species groups of marmosets and tamarins across a

gradient of agroforestry intensification Biotropica 46:248–255.

 235

Watsa M, Erkenswick G, Halloran D, Kane EE, Poirier A, Klonoski K, Cassalett S, Maciag E, Mangalea MR, Dinsmore

MP, McCready H, Boughan BK, Parker C, Hickmott A, Bazan IEN, Zuñiga A. 2015. A field protocol for the capture

and release of callitrichids. Neotropical Primates. 22(2): 59-68.

Tabela 1. Valores de referência para o gênero Leontopithecus sp. (Fonte: Cubas et al., 2006)

Parâmetros Valor

Peso macho/fêmea adultos (em gramas) 600-800 gramas

Freqüência cardíaca (batimentos por minuto) 180-260 bpm

Frequência respiratória (movimentos respiratórios por minuto) 20-50 mrpm

Temperatura Retal (°C) 37,2-39,6 °C

 236

Figura 1. Imagens dos procedimentos de captura de Leontopithecus chrysomelas. A: Giral para habituação dos

animais as armadilhas (fonte: B.E.Raboy); B: Armadilha aberta para início de campanha de captura (fonte:

B.E.Raboy); C: Mico-leão capturado (fonte: Projeto BioBrasil); D: Armadilhas com capas para o trajeto campo-

laboratório (fonte: Projeto BioBrasil); E: Contenção físico-química (fonte: Projeto BioBrasil); F:Rádio colar de

contas de esferas (fonte: Projeto BioBrasil); G: Biometria; H: Soltura dos animais no campo.
 237

INFORMAÇÃO SUPLEMENTAR ON-LINE

As informações suplementares a seguir estão disponíveis on-line para este artigo.

Figura S1. Ficha de avaliação clínica e monitoramento anestésico utilizado para as capturas da espécie

Leontopithecus chrysomelas
 238

Figura S2. Ficha de biometria utilizado para as capturas da espécie Leontopithecus chrysomelas
 239

Figura S2. (cont.) Ficha de biometria utilizado para as capturas da espécie Leontopithecus chrysomelas
 240

Figura S2. (cont.) Ficha de biometria utilizado para as capturas da espécie Leontopithecus chrysomelas
 241

APÊNDICE H:

CATENACCI, L. S.; NASCIMENTO, A.; MUNIZ-NETA, E. S.; CASSANO, C. R.; DEEM,

S. L.; TRAVASSOS-DA-ROSA, E. S.; PARKER, P.; MUNHOZ, A. D. First record of
hematological values in free-living and captive maned sloths (Bradypus torquatus,
Bradypodidae). J. Zoo Wild. Med., v. 48, n. 2, p. 312-318, 2017.
 242

FIRST RECORD OF HEMATOLOGIC VALUES IN FREE-

LIVING AND CAPTIVE MANED SLOTHS (BRADYPUS
TORQUATUS; XENARTHA, BRADYPODIDAE)
Author(s): Lilian S. Catenacci, D.V.M., Aisla Nascimento, D.V.M., Elza S.
Muniz-Neta, D.V.M., Camila R. Cassano, Ph.D., Sharon L. Deem, D.V.M.,
Ph.D., Dipl. A.C.Z.M., Elizabeth S. Travassos da Rosa, Ph.D., Patricia Parker,
Ph.D., and Alexandre D. Munhoz, D.V.M., Ph.D.
Source: Journal of Zoo and Wildlife Medicine, 48(2):312-318.
Published By: American Association of Zoo Veterinarians
https://doi.org/10.1638/2016-0025R1.1
URL: http://www.bioone.org/doi/full/10.1638/2016-0025R1.1

BioOne (www.bioone.org) is a nonprofit, online aggregation of core research in the

biological, ecological, and environmental sciences. BioOne provides a sustainable online
platform for over 170 journals and books published by nonprofit societies, associations,
museums, institutions, and presses.
Your use of this PDF, the BioOne Web site, and all posted and associated content
indicates your acceptance of BioOne’s Terms of Use, available at www.bioone.org/page/
terms_of_use.
Usage of BioOne content is strictly limited to personal, educational, and non-commercial
use. Commercial inquiries or rights and permissions requests should be directed to the
individual publisher as copyright holder.

BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit
publishers, academic institutions, research libraries, and research funders in the common goal of maximizing access to
critical research.
 243
Journal of Zoo and Wildlife Medicine 48(2): 312–318, 2017
Copyright 2017 by American Association of Zoo Veterinarians

FIRST RECORD OF HEMATOLOGIC VALUES IN FREE-LIVING

AND CAPTIVE MANED SLOTHS (BRADYPUS TORQUATUS;
XENARTHA, BRADYPODIDAE)

Lilian S. Catenacci, D.V.M., Aisla Nascimento, D.V.M., Elza S. Muniz-Neta, D.V.M., Camila R.
Cassano, Ph.D., Sharon L. Deem, D.V.M., Ph.D., Dipl. A.C.Z.M., Elizabeth S. Travassos da Rosa,
Ph.D., Patricia Parker, Ph.D., and Alexandre D. Munhoz, D.V.M., Ph.D.

Abstract: Bradypus torquatus is a rare and endemic sloth species from the Atlantic Forest, Brazil. Due to a lack
of medical information including hematologic reference parameters for the species, hematologic baseline values
were determined using samples from 14 clinically healthy B. torquatus, under captive (n ¼ 7) and free-living (n ¼ 7)
conditions in Bahia State, Brazil. Additionally, the morphology of the blood cells is presented, with a
demonstration that the Barr body chromosome may assist with sex determination of the species. The Barr body
chromosome was present in all seven females and absent in all males. Many erythrocytes were approximately the
size of small lymphocytes, with red blood cells exhibiting anisocystosis, normochromia, and apparent
macrocytosis, compared with domestic animals. This study provides the first published hematologic values and
cell morphology for B. torquatus. However, further studies are suggested using an automated hematology analyzer
with larger sample sizes so that reference intervals may be established and hematologic values better understood
for sex, habitat type, and age cohorts.
Key words: Baseline data, Bradypus torquatus, Clinical pathology, Hematology, Sloth.

INTRODUCTION a large number of plant species.5 Research on the

Hematologic values are commonly used in both
human and veterinary medicine. Although refer-
ence intervals should not be calculated with small
sample sizes (e.g., ,20 individuals), baseline
blood values are instrumental for monitoring the
health of populations, allowing comparisons of
captive and free-living individuals, and determin-
ing changes in population health over time.6,11,21,30,31
An increasing number of studies have reported
unique trends in the ecology, anatomy, physiology,
and behavior of sloths.5,8,12,13,31 Three-toed sloths
(Bradypus spp.) are heterothermic14,20 and are
considered one of the most lethargic mammals,9
with activity dependent on ambient temperature.13
Species within this group have a specialized
gastrointestinal tract to fit their strictly folivorous
diet20; however, unlike most folivores, they feed on
Federal University of Piaui State, Rod municipal Bom
Jesus Viana, BR135, km 1, Bom Jesus, PI, 64900-000,
Brazil; Virology Graduate Program, Evandro Chagas
Institute, Rod BR-316 km 7 S/N, Ananindeua, PA,
67030-000, Brazil; State University of Santa Cruz, Rod
Jorge Amado, km 16, Salobrinho, Ilhèus, BA, 45662-900,
Brazil; Saint Louis Zoo Institute for Conservation
Medicine. One Government Dr, St. Louis, MO 63110,
EUA; and University of Missouri-St Louis, St. Louis,
One University Blvd, St. Louis, MO 63121, EUA.
Correspondence should be directed to Dr. Catenacci
(catenacci@ufpi.edu.br).
health status and diseases of this genus are only
available for Bradypus variegatus,2,23,27,33 whereas
hematologic values have been published for
Choelopus spp. and B. variegatus.23,25,27,31,33
The maned sloth (Bradypus torquatus) is one of
six extant species of sloths and one of four species
within the genus Bradypus. It is endemic to the
Brazilian Atlantic Forest and listed as ‘‘Vulnera-
ble’’ by the International Union for Conservation
of Nature.15 Primarily due to habitat loss and its
small geographic range, it is the second most
threatened sloth species in the world.15 Maned
sloths are found in old growth forests and may be
found in disturbed environments if tall trees,
necessary in the sloth’s diet, are still present and
include shaded cacao agroforest and small forest
fragments or those that maintain a high percent-
age of vegetation cover.4,28 To date, the species has
not been found in any highly modified environ-
ments, whereas its congeneric B. variegatus is
found in urban areas and simplified agroforestry
systems such as living fences and pasture with
isolated trees.25 Furthermore, the only captive
center known to have kept the species and
conducted research, the ‘‘Reserva Zoobotânica
da Comissão Executiva da Lavoura Cacaueira–
CEPLAC’’, no longer houses any individuals of
the species.10,22
The primary objective of this study was to
describe baseline hematologic values of maned

312

CATENACCI ET AL.—HEMATOLOGIC VALUES IN BRADYPUS TORQUATUS
Figure 1. Study sites of (A) the Zoobotanical Reserve Rehabilitation Center (circle) and (B) free-living sloths
capture sites in the surrounding of Una Biological Reserve.
sloths. The paucity of data on the health status of
B. torquatus justifies the need for such informa-
tion.
MATERIALS AND METHODS
Study area
Free-living maned sloths were captured from
2006 to 2008 in forest remnants and a cacao shade
plantation near the Una Biological Reserve
(158109S, 398039W) and the Private Reserve Eco-
parque de Una (158119S, 39829W) in the lowlands
of southern Bahia, Brazil (Fig. 1). The presence of
large forest remnants within and outside Una
Biological Reserve makes this region of special
conservation value. Shaded cacao and rubber tree
plantations account for 60% of the cultivated land
and represent the main crops in the Una Biolog-
ical Reserve buffer zone.1
The captive animals were located at the Zoobo-
tanical Reserve Rehabilitation Center, Comissão
Executiva do Plano da Lavoura Cacaueira-CE-
PLAC, in Ilhéus, Bahia, Brazil (1484691S, 398139W)
(Fig. 1). Five of the animals were captured in 2007,
whereas two animals were captured in 2013.
Study animals
A total of 24 blood samples were collected from
14 animals (Table 1). Seven free-living sloths were
examined (five females and two males); of these,
five individuals were sampled multiple times (one
male and four females). These animals were
manually captured after location using previously
244
313
placed radio-collars (model TW-3, Biotrack Ltd.;
Telonics TR-4 receiver and a three-element Yagi
antenna, Wildlife Material, Wareham, BH20 4P,
England).13 Each sloth was hand caught in the tree
canopy by a trained climber, placed in a burlap
sack, and lowered to the forest floor using a long
rope. No anesthesia was administered to any of
the sloths. Adults were sexed based on genitalia
and pelage, and all sloths were aged based on
body mass following previous studies.18 Sloths
were weighed using a scale (Pesola AG, CH-8834
Schindellegi, Switzerland), and morphometrics
were collected (head-body length). We recorded
heart rate (beats per minute), respiratory rate
(respirations per minute), and temperature (8C)
every 5 min to ensure animals tolerated handling.
Animals were handled immediately and re-
leased after 15–30 min at the base of the tree
where captured. For those sloths that were
captured two or more times, intervals between
captures were 6 mo. Official permission to carry
out captures and procedures was issued by the
Brazilian environmental agency, Sistema de
Autorizac ão e Informac ão em Biodiversidade
SISBIO, under the authorization of the Instituto
Brasileiro do Meio Ambiente e dos Recursos
Naturais Renováveis, number 02001.007588/
2002 (L. S. Catenacci), and approved by The
Animal Welfare Committee of Universidade Es-
tadual de Santa Cruz, under number 004/2008.
The seven captive individuals (five males and
two females) were housed in a single enclosure
(approximately 20 3 50 feet) with B. variegatus
individuals at the Zoobotanical Reserve Rehabil-
 245
314 JOURNAL OF ZOO AND WILDLIFE MEDICINE

Table 1. Habitat, age, body mass, sex and number of times captured for free-living and captive Bradypus
torquatus in the Southern Bahia, Brazil.

Identification Habitat Agea Body massa (kg) Sex Number of captures

BT033 Free-living Adult 5.8 Female 1

BT123 Free-living Adult 4.5 Male 1
BT464 Free-living Adult 5.7 Female 3
BT142 Free-living Adult 4.5 Female 2
BT040 Free-living Immature-Adult 2.2–4.8 Male 4 (2 Im;2 Ad)b
BT162 Free-living Immature 1.5–2.6 Female 2
BT065 Free-living Immature 1.6–2.1 Female 4
BT 212 Captive Immature 3.5 Male 1
BT 200 Captive Adult 4.8 Male 1
BT 224 Captive Adult 4.9 Male 1
BT 228 Captive Adult 4.8 Male 1
BT 232 Captive Immature 1.2 Female 1
BT 240 Captive Immature 3.5 Female 1
BT 136 Captive Adult 4.1 Male 1
a
Values indicated for BT040, BT065, and BT162 correspond to age and weight range during the study.
b
Im, immature; Ad, adult.

itation Center in Ilhéus, Bahia, Brazil (Fig. 1).
Food was provided once a day, with local and
fresh leaves collected in a forest remnant around
the Rehabilitation Center. Animals were manually
captured using the same protocol used for free-
living sloths.
Blood collection and analysis
Three to 5 ml blood was collected from the
cephalic vein, using a 22-gauge, 0.7- 3 30-mm
needle and 5-ml syringe, and immediately placed
into EDTA tubes (BD Vacutainert Blood Collec-
tion Tube, BD Brasil, São Paulo, SP, 04717-004,
Brazil). Blood tubes were kept on ice in a cooler
during the remaining time researchers were in the
field collecting samples (3–6 hr). Initial process-
ing of blood samples took place at Santa Cruz
State University, within 8 hr of collection. Thin
blood smears were fixed and stained with Diff
Quick (Hematocor, Biologt, Biológica Comercial
Ltda., São Paulo, 04810-030 Brazil) for differen-
tial leukocyte counts. Erythrocytes and leukocytes
were manually counted in a Neubauer type
chamber. The white blood cells were diluted in
Turk’s liquid (dilution 1:21).16 Hemoglobin con-
centration was determined by the cyanmethemo-
globin method and packed cell volumes (PCVs)
by the microhematocrit technique.16,17 Total solids
were measured by a handheld Salinity Refractom-
eter with Automatic Temperature Compensation
refractometer (Extech RF20t, Extech Instru-
ments Corporation, Waltham, California 94143,
USA) calibrated at the site. The samples were
analyzed using the OlympusTM BX 40 optical
microscope, with a zoom rate of 4003. Finally,
the authors measured 55 blood cells from each
type except for immature neutrophils and baso-
phils using the software image pro Express 6.0. At
least five red blood cells and five differential
leukocytes were photographed (OlympusTM Mod.
DP-72.X2, BX60 OlympusTM).
While screening the blood smears, the authors
looked for Barr bodies in neutrophils. Sex identi-
fication based on the presence (i.e., female) or
absence (i.e., male) of these bodies was compared
with the phenotypic characteristics of each animal
as has been previously described.19
Statistical analysis
The statistical analyses followed reference in-
terval guidelines from the American Society for
Veterinary Clinical Pathology for data sets con-
taining ,20 samples.11 Outliers were deleted from
the data, and then multiple measures from a single
individual were averaged, so that each individual
contributed a single value into the analysis. The
authors then calculated the mean, median, and
SDs of each hematology parameter for the 14
animals. Statistical analyses were performed using
the program R.26
RESULTS
All animals were clinically healthy based on
physical examinations. The overall hematologic
values including mean, median, and SD of each
hematology parameter from the 14 animals are
presented in Table 2. Only one individual had an
outlier in the band cell count, and therefore this
 246
CATENACCI ET AL.—HEMATOLOGIC VALUES IN BRADYPUS TORQUATUS 315

Table 2. Minimum, maximum, mean, and SD for hematologic parameters for the species B. torquatus.

Sloths (N ¼ 14)

Parameters Minimum Mean 6 SD Median Maximum

Erythrocytes (310 /ll)

6
1,758 2,951 6 541 3,085 3,668
Hematocrit (%) 23 32.9 6 4.2 33.7 38.3
Hemoglobin (g/dl) 7.66 10.9 6 1.4 11.25 12.77
MCV (fl)a 96.87 115.2 6 15.3 111.45 150.73
MCHC (g/dl) 33.25 33.3 6 0.02 33.32 33.33
MCH (pg) 31.7 37.7 6 4.8 36.7 48.3
Total solids (g/dl) 7.8 8.9 6 0.7 8.9 10.2
Fibrinogen (mg/dl) 0 184.7 6 143.3 200 400
Leukocytes (/ll) 4,550 10,541.9 6 3863 10,393 16,225
Segmented neutrophils (/ll) 918.5 3,430.8 6 2502 2,586 8,967
Segmented neutrophils (%) 11.5 31.8 6 16 32.5 61
Band cells (/ll) 0 8.23 6 21.8 0 399
Band cells (%) 0 0.08 6 0.17 0 3
Eosinophil (/ll) 0 463.2 6 546 293.4 1,918
Eosinophil (%) 0 4.6 6 5 2.25 17
Lymphocyte (/ll) 2,646 6,072 6 2908 5,394 12,930
Lymphocyte (%) 27 58.2 6 16.4 60.62 78
Monocyte (/ll) 73 448.7 6 287 362.5 1,029
Monocyte (%) 0 4.4 6 2.6 4.5 10
Basophil (/ll) 0 64.8 6 110.2 0 399
Basophil (%) 0 0.7 6 1 0 3
a
MCV, mean corpuscular volume; MCHC, mean corpuscular hemoglobin concentration; MCH, mean corpuscular
hemoglobin.

value was excluded from the analysis. The mature
red blood cells are flexible, oval biconcave disks
without nucleus, with central pallor not evident
(Fig. 2). The lymphocytes had a high nucleus–
cytoplasm ratio, and the nucleus was spherical
with dense chromatin and basophilic staining.
The cytoplasm was slightly basophilic (Fig. 2D).
Neutrophils had a lobed nucleus with dense
chromatin and basophilic staining. Microscopi-
cally, the cytoplasm was devoid of granules (Fig.
2C). Eosinophils had a bi-lobed nucleus and pink
cytoplasm with spherical granules. Basophils had
purple cytoplasmic granules (Fig. 2A). The nu-
cleus of monocytes was irregular and sporadically
lobed with loose chromatin (Fig. 2B). Monocytes
were bigger than neutrophils and lymphocytes
and had abundant slightly basophilic cytoplasm
that was occasionally vacuolated. The nucleus
was irregular, with uncompressed chromatin and
sporadically lobed (Table 3).
All phenotypic females (n ¼ 7) had Barr body
chromosomes within the mature neutrophils,
whereas none were present in the males (n ¼ 7;
Fig. 2).

Figure 2. Leukocytes of the species Bradypus tor-
quatus: (A) eosinophil; (B) monocyte; (C) neutrophil
with Barr body ( ); and (D) lymphocyte. Diff-Quick
coloration.
DISCUSSION
This study provides the first description of
baseline hematologic values for both free-living
and captive maned sloths. This species is notori-
ously difficult to maintain in captivity and highly
cryptic in nature, which hinders data collection.7
The authors were able to collect blood samples
for the evaluation of the health status of animals
in the zoo collection and free-living individuals
due to collaborations between institutions across

316 JOURNAL OF ZOO AND WILDLIFE MEDICINE
Table 3. Mean and SD of 14 maned sloth blood cell
sizes.
Mean 6 SD
Type of cells (number
of cells counted) MD a
Erythrocytes (n ¼ 121) 8.45 6 0.65
Lymphocyte (n ¼ 121) 13.19 6 2.02
Eosinophil (n ¼ 96) 18.9 6 2.38
Monocyte (n ¼ 114) 20.52 6 2.93
Segmented neutrophils 17.49 6 1.84
(n ¼ 121)
Band cells (n ¼ 4) 17.21 6 1.15
Basophil (n ¼ 2) 16.17 6 2.63
a
MD, mean of the cells largest diameter; Md, mean of the
cells smallest diameter. Values are expressed in micrometers.
an ex situ–in situ continuum. The hematologic
values are important as baseline data for the
health care of individual animals and to better
interpret changes of health over time and between
populations.6
According to Friedrichs et al.,11 a small number
of samples (10–20) is enough to describe baseline
hematologic values but should not be used to
determine reference intervals because they could
be influenced by sex, age, habitat type, and even
individual characteristics. In this study, the au-
thors describe the baseline hematologic values
but suggest that further studies with increased
sample sizes be conducted so that determination
can be made of values for age, sex, and habitat
type cohorts.
Because no information on blood parameters
has been previously published for maned sloths,
this study may provide useful information to help
with the evaluation of clinical conditions of
maned sloths and to assist with the maintenance
of individuals in captivity. Additionally, in this
study, the authors collected blood samples from
nonanesthetized sloths that were not fasted prior
to handling, which better reflects baseline physi-
ologic values.27,33
The B. torquatus erythrocyte mean count values
(2.95 3 106/ll) were similar to B. variegatus (3 3 106
ll) described by Ramos27 and Choloepus didactylus
(2.6 3 106 ll) described by Vogel et al.31 and Bush
and Gilroy.3 However, values in this study were
lower than B. tridactylus (5.49 3 106/ll) and B.
variegatus (4.6 3 106/ll) in other studies.2,23 The
hemoglobin (10.9 6 1.5 g/dl), mean corpuscular
hemoglobin (MCH; 37.7 6 8.8 pg), and MCH
concentration (MCHC; 33.0 6 1.1 g/dl) values
were similar to values reported for B. variega-
tus.27,34 The results found by Ramos27 and Xavier33
indicated that the mean corpuscular volume
247
(MCV) values tend to be specific for each genus;
Bradypus and Choloepus had higher values than
Choloepus (135.9 6 62.5 fl). As described by
Wallace and Oppenheim32 for C. hoffmanni, the
Mdb authors found the MCV fairly large, and the red
7.99 6 0.60 blood cells closely resembled canine erythrocytes,
12.13 6 1.70 although central pallor was not evident.
16.99 6 1.85 According to Ramos,27 the difference of values
18.11 6 2.71 in the same species could be related to the
16.02 6 1.95 diversity of laboratory techniques used in differ-
ent studies, beside the number of individuals
16.23 6 0.86 evaluated. Further studies using the Giemsa stain
16.06 6 3.07
in preference to the Diff Quick is also recom-
mended to provide higher quality of the blood
slides.
One limitation of this study was conducting a
manual cell count method instead of using an
automated hematology analyzer even though the
automated technique is considered the ‘‘gold
standard’’ for mammals. It is possible that the
manual cell count method could have generated
lower diagnostic accuracy, sensitivity, and higher
variability.24 However, the acquisition of the
automatic blood cell counter (ABX Vet, HORI-
BA Instruments Brasil Ltda Jundiai, São Paulo,
13.212-181 Brazil) by the local university oc-
curred in the last year of this study. Therefore, at
that time, most of the samples had already been
collected and processed by the manual method. A
less specific cell or particle counter such as the
Coulter Counter could be an alternative method
to avoid the manual cell count technique. How-
ever, this equipment also was not available in the
laboratory when the samples were processed. In
this study, the manual counting was performed by
a single expert, and counts were averaged over
three repetitions to minimize errors.
The examination of leukocytes and red blood
cell morphology is a useful method to assist in
disease diagnoses in animals. For example, im-
mature cells, toxic neutrophils, and Dohle bodies
have been used as indicators of infection diseas-
es.29 In the sloths of this study, many erythrocytes
were approximately the size of small lymphocytes.
The authors observed that the red blood cells
exhibited anisocystosis (slight), normochromia,
and apparent macrocytosis compared with do-
mestic animals. This slight variation could be
physiologic and concurs with findings in other
species of sloths.27,32
The Barr body (sexual chromatin) is a lobule in
the form of a drumstick found in mammals.19 In
mammals, males rarely have Barr bodies, whereas
it may be present in females, although usually at a
low prevalence.20 It is located on the nucleus of

CATENACCI ET AL.—HEMATOLOGIC VALUES IN BRADYPUS TORQUATUS
neutrophil cells, representing one of the inactive
X chromosomes that remain in the leukocyte
cell.19
These findings of Barr bodies present in all
adult females but not in any of the males suggests
this may be a useful mechanism for the identifi-
cation of sex in immature individuals of B.
torquatus. Determining the sex of juveniles
through external morphology (genitalia and pel-
age) requires experience and is difficult in imma-
ture individuals, unlike in adults in which males
have a well-developed penis and larger and
conspicuous mane.18 The authors recommend
future studies check for Barr bodies and compare
to phenotypic findings in sloth species for sex
identification.
Hematologic values may assist in the evaluation
of the health and physiologic status of B torquatus
and therefore may contribute to the management
and conservation actions for this threatened
species in both free-living and captive conditions.
Hematologic and biochemical reference parame-
ters for the maned-sloth remain largely unde-
scribed, and further studies are needed, especially
using an automated hematology analyzer with
larger sample sizes. Last, the use of Barr bodies
may serve as an important mechanism for the
determination of sex in sloth species.
Acknowledgments: The authors thank Rebeca
M.F. Barreto, Vera L. de Oliveira, Rubens V.
Lopes, Letı́cia Soares, Juan S. Tello, Jamie Palmer
and Kathleen Apakupakul. We also thanks the
Instituto de estudos socio ambientais do Sul da
Bahia, the Instituto Chico Mendes de Con-
servac ão da Biodiversidade and the sponsoring
instituitions: St Louis Zoo WildCare Institute,
American Association of Zoo and Veterinarians
(Wild Animal Health Fund Grant), Fundac ão O
Boticário de Protec ão à Natureza and Conserva-
tion International.
LITERATURE CITED
1. Araújo M, Alger K, Rocha R, Mesquita CAB. A
Mata Atlântica do sul da Bahia: situac ão atual, ac ões e
perspectivas. In: Costa JPO, Lino CF, Albuquerque
JLR (eds.). Série Cadernos da Reserva da Biosfera da
Mata Atlântica. São Paulo, Brazil: Instituto Florestal
do Estado de São Paulo; 1998. p. 8–35.
2. Bozzini CE, Henriques JAP, Ladosky W. Charac-
terization of the blood volume and iron kinetics in the
three-toed sloth, Bradypus tridactylus. Comp Biochem
Physiol. 1978;61A:417–418.
3. Bush M, Gilroy BA. A bleeding technique from
nonpalpable vessels anesthetized two-toed sloths
248
317
(Choloepus didactylus)—plus hematologic data. J Zoo
Wildl Med. 1979;10:26–27.
4. Cassano CR, Kierulff MCM, Chiarello AG. The
agroforests of the Brazilian Atlantic forest as habitat
for the endangered maned sloth Bradypus torquatus.
Mammal Biol. 2011;76:243–250.
5. Chiarello AG. Sloth ecology: an overview of field
studies. In: Vizcaı́no SF, Loughry WJ (eds.). The
Biology of Xenarthra. Gainesville (FL): University
Press of Florida; 2008. p. 269–280.
6. Deem SL, Karesh WB, Weisman W. Putting
theory into practice: wildlife health in conservation.
Conserv Biol. 2001;15:1224–1233.
7. Dias BB, Santos LAD, Lara-Ruiz P, Cassano CR,
Pinder L, Chiarello AG. First observation on mating
and reproductive seasonality in maned sloths Bradypus
torquatus (Pilosa: Bradypodidae). J Ethol. 2009;27:97–
103.
8. Duarte DPF, Jaguaribe AM, Pedrosa MAC,
Clementino ACCR, Barbosa AA, Silva AFV, Gilmore
DP, Costa CP. Cardiovascular responses to locomotor
activity and feeding in unrestrained three-toed sloths,
Bradypus variegatus. Rev Bras Pesqui Med Biol. 2004;
37:1557–1561.
9. Eisenberg JF. The evolution of arboreal herbi-
vores in the class mammalian. In: Montgomery GG
(ed.). The Ecology of Arboreal Folivores. Washington
(DC): Smithsonian Institution Press; 1978. p. 135–152.
10. Ferreira JR, Oliveira VL. Oliveira KM, Sousa-
Junior NB. Contribuic ões ao estudo da anatomia
macroscópica do encéfalo do Bradypus torquatus (Lin-
naeus, 1758) e Bradypus variegatus (Schinz, 1825) Braz J
Vet Res Anim Sci. 2005;42:397–404.
11. Friedrichs KR, Harr KE, Freeman KP, Szlado-
vits B, Walton RM, Barnhart KF, Blanco-Chavez J.
ASVCP reference interval guidelines: determination of
de novo reference intervals in veterinary species and
other related topics. Vet Clin Pathol. 2012;41:441–453.
12. Gilmore DP, Da-Costa CP, Duarte DPF. An
update on the physiology of two- and three-toed sloths.
Rev Bras Pesqui Med Biol. 2000;33:129–146.
13. Giné GAF, Cassano CR, Almeida SS, Faria D.
Activity budget, pattern and rhythm of maned sloths
(Bradypus torquatus): responses to variations in ambient
temperature. Mamm Biol. 2015;6:459–467.
14. Goffart M. Function and Form in the Sloth. 1st
ed., (Oxford, CA): Pergamon Press; 1971.
15. International Union for Conservation of Nature.
The IUCN Red List of Threatened Species 2014
[Internet]. [cited 2016 November 18]. Available from
http://www.iucnredlist.org/details/summary/3036/0.
16. Jain NC. Essentials of Veterinary Hematology.
Philadelphia (PA): Lea and Febiger; 1993.
17. Lasser ED, Weiser G. Laboratory technology for
veterinary medicine. In: Thrall MA (ed.), Veterinary
Hematology and Clinical Chemistry. 2nd ed., (Ames,
IA): Blackwell Publishing; 2006. p. 3–88.

318 JOURNAL OF ZOO AND WILDLIFE MEDICINE
18. Lara-Ruiz P, Chiarello AG. Life-history traits
and sexual dimorphism of the Atlantic forest maned
sloth Bradypus torquatus (Xenarthra: Bradypodidae). J
Zool. 2005;267:63–73.
19. Long S. The sex chromosomes and sex differen-
tiation. In: Long S (ed.). Veterinary Genetics and
Reproductive Physiology: A Textbook for Veterinary
Nurses and Technicians. New York (NY): Elsevier;
2006. p. 31–38.
20. McNab BK. Energetics of Arboreal folivores:
physiological problems and ecological consequences of
feeding on a ubiquitous food supply. In: Montgomery
GG (ed.). The Ecology of Arboreal Folivores. Wash-
ington (DC): Smithsonian Institution Press; 1978. p.
153–162.
21. Medici EP, Mangini PR, Fernandes-Santos RC.
Health Assement of wild lowland tapir (Tapirus
terrestris) populations in the Atalntic Forest and
Pantanal biomes, Brazil (1996-2012). J Wild Dis.
2014;50(4):817–828.
22. Moraes-Barros N, Silva JAB, Miyaki CY, Mor-
gantel JS. Comparative phylogeography of the Atlantic
forest endemic sloth (Bradypus torquatus) and the
widespread three-toed sloth (Bradypus variegatus) (Bra-
dypodidae, Xenarthra). Genetica. 2006;126:189–198.
23. Neves Junior JM, Lauriggio AJ, Consentino LN,
Ribeiro LF, Villar TD, Monteiro AO. Hematological
evaluation of three-maned sloths (Bradypus variegatus)
living at the November 15td plaza- Valenc a, RJ. J Rural
Univ. 2006;26:33–35.
24. Pierre RV. Peripheral blood film review. The
demise of the eyecount leukocyte differential. Clin Lab
Med. 2002;22(1):279–297.
25. Queiroz CS, Rodrigues JL, Bomfeti CA,
Gonc alves AMPM. Hematologia de preguic as de três
dedos Bradypus variegatus (Bradypodidae, Xenarthra)
da prac a tiradentes em Teófilo Otoni–MG. Revista
Cientı́fica Vozes Vale. 2015;8:1–11.
249
26. R Development Core Team [Internet]. R: A
Language and Environment for Statistical Computing.
R Foundation for Statistical Computing, Viena. [cited 11
August 2009]. Available from http://www.Rproject.org.
27. Ramos FF. Hematological values and identifica-
tion of the hemoglobin of the three-maned sloth
(Bradypus variegatus). MS Thesis, 2006. Federal Uni-
versity of Pernambuco State, Recife, Brazil.
28. Santos PM, Chiarello AG, Ribeiro MC, Ribeiro
JW, Paglia AP. Local and landscape influences on the
habitat occupancy of the endangered Maned Sloth
Bradypus torquatus within fragmented landscapes.
Mamm Biol. 2016;81(5):447–454.
29. Thrall MA. Hematologia e Bioquı́mica Veter-
inária. 1st ed. São Paulo, Brazil: Roca; 2006.
30. Veiga APM, Lopes STA, Franciscato C, Oliveira
LSS, Merini LP. Hematological values, plasma protein
and fibrinogen of criollo horse- their variation with sex,
age and management. Acta Sci Vet. 2006;34:275–279.
31. Vogel I, Vie JC, Thoisy B, Moreau B. Hemato-
logical and serum chemistry profiles of free-ranging
southern two-toed sloths in French Guiana. J Wildl
Dis. 1999;35:531–535.
32. Wallace C, Oppenheim YC. Hematology and
serum chemistry profiles of captive Hoffmann’s two-
toed sloths (Choloepus hoffmanni). Zoo Wildl Med.
1996;27:339–345.
33. Xavier GAA. Clinical aspects and management
of the free-living three-maned sloth (Bradypus variega-
tus) (Schinz, 1825) at the Recife city, Pernambuco,
Brasil. PhD Dissertation, 2006. Federal University of
Pernambuco State, Recife, Brazil.
34. Xie L, Xu F, Liu S, Ji Y, Zhou Q, Wu Q. Age- and
sex-based hematological and biochemical parameters
for Macaca fascicularis. PLoS One. 2013;61:8.
Accepted for publication 6 February 2017
 250

APÊNDICE I:

CATENACCI, L. S.; COLOSIO, A. C.; OLIVEIRA, L. C.; DE VLEESCHOUWER, K. M.;

MUNHOZ, A. D.; DEEM, S. L.; PINTO, J. M. S. Occurrence of Prosthenorchis elegans in
Free-living Primates from the Atlantic Forest of Southern Bahia, Brazil. J. Wild. Dis., v. 52, n.
2, p. 364-368, 2016.
 251
SHORT COMMUNICATIONS
DOI: 10.7589/2015-06-163 Journal of Wildlife Diseases, 52(2), 2016, pp. 364–368
Ó Wildlife Disease Association 2016

Occurrence of Prosthenorchis elegans in Free-living Primates from

the Atlantic Forest of Southern Bahia, Brazil
Lilian S. Catenacci,1,2,3,4,9 Adriana C. Colosio,5 Leonardo C. Oliveira,6,7,8 Kristel M. De Vleeschouwer,3
Alexandre D. Munhoz,5 Sharon L. Deem,4 and Jaqueline M. S. Pinto5 1Universidade Federal do Piauı́/Campus
Professora Cinobelina Elvas, km 01 BR135 Road, Bom Jesus, Piauı́ 64900-000, Brazil; 2Virology Graduate Program,
Instituto Evandro Chagas, km 07 BR 316 Road, Ananindeua, Pará 67030-000, Brazil; 3Centre for Research and
Conservation, Royal Zoological Society of Antwerp, Koningin Astridplein 20-26, 2018 Antwerp, Belgium; 4Institute for
Conservation Medicine, Saint Louis Zoo, 1 Government Dr., St. Louis, Missouri 63110, USA; 5Programa de Pós-
graduação em Ciência Animal, Universidade Estadual de Santa Cruz, Km 16 Jorge Amado Road, Ilhéus, Bahia 45662-
900, Brazil; 6Programa de Pós-graduação em Ecologia e Conservação da Biodiversidade, Universidade Estadual de
Santa Cruz, Km 16 Jorge Amado Road, Ilhéus, Bahia 45662-900, Brazil; 7Bicho do Mato Instituto de Pesquisa, 222
Perdigão Malheiros Street, Belo Horizonte, Minas Gerais 30380-234, Brazil; 8Departamento de Ciências, Faculdade de
Formação de Professores, Universidade do Estado do Rio de Janeiro, 1470 Francisco Portela Dr., Rio de Janeiro 24435-
005, Brazil; 9Corresponding author (email: catenacci@ufpi.edu.br)

ABSTRACT: Parasite prevalence and abundance
are important factors affecting species’ conserva-
tion. During necropsies on a free-living golden-
headed lion tamarin (Leontopithecus chrysome-
las) and two Wied’s marmosets (Callithrix kuhlii)
in the Atlantic Forest of southern Bahia, Brazil,
we collected a large number of adult intestinal
parasites that we identified as Prosthenorchis
elegans. This parasite is pathogenic for neotropical
primates. Prosthenorchis spp. infestation is influ-
enced by diet with increased risk of exposure from
ingesting invertebrate intermediate hosts. The
biological similarities and sympatric nature of
these two nonhuman primates support that they
may harbor similar infectious and parasitic agents.
Key words: Acanthocephala, Callithrix kuhlii,
Leontopithecus chrysomelas, neotropical pri-
mates, parasitology, thorny-headed worm.
The accelerated process of habitat frag-
mentation may increase exposure and suscep-
tibility of wildlife to parasites. Characteristics
of hosts, such as ranging patterns, population
density, intraspecific and interspecific associ-
ations, and diet, may influence prevalence and
parasite load (Bowman et al. 2006). Habitat
fragmentation may alter these characteristics
and parasite ecology in many wildlife species
(Nunn et al. 2003). Parasites that may infect
hosts across taxa are of high conservation
concern, particularly when endangered spe-
cies are infected (Püttker et al. 2008).
The endangered golden-headed lion tama-
rin (Leontopithecus chrysomelas) and the
near-threatened Wied’s marmoset (Callithrix
kuhlii; International Union for Conservation
of Nature 2015) are endemic to the Brazilian
364
Atlantic Forest. With only 8–13% of its
original cover, the Brazilian Atlantic Forest
is one of 34 hotspots of biodiversity (Ribeiro et
al. 2009). Wied’s marmosets are present in
almost all forest fragments and agroforestry
systems containing golden-headed lion tama-
rins, and both species associate frequently
(Oliveira et al. 2011; Tisovec et al. 2014). The
biologic similarities and sympatric nature of
these nonhuman primates suggest they may
harbor similar infectious and parasitic agents.
We report the presence of the adult
acanthocephalan endoparasite Prosthenorchis
elegans in free-living C. kuhlii and L. chrys-
omelas and discuss potential consequences of
these infestations for the conservation of these
species. Acanthocephalans share the same
fundamental life cycle and developmental
stages: a free-living egg (acanthor) requires
an arthropod intermediate host for the larval
acanthella and cystacanth stages, and the adult
utilizes a vertebrate definite host (Machado-
Filho 1950).
One dead golden-headed lion tamarin and
two dead Wied’s marmosets were brought to
the Veterinary Hospital, Universidade Esta-
dual de Santa Cruz, in Ilhéus, Bahia, Brazil.
The adult male tamarin was collected in the
Una Biological Reserve (15809 0 S, 39810 0 W),
an area of lowland Atlantic rainforest charac-
terized by a forest mosaic in different
successional stages including patches of old
growth. The animal belonged to a group of
golden-headed lion tamarins continuously

monitored since 2002 for behavioral and
ecologic studies (De Vleeschouwer et al.
2011). As part of these studies, this individual
was captured on 19 June 2008 to replace its
radio collar. During capture, biometric mea-
sures were taken and clinical evaluations
performed. The animal weighed 646 g and
was deemed in good health. We last observed
the animal alive on 1 July 2008. We noted it
missing from the group on 16 July 2008 and
found it dead the following day.
The two marmosets were found dead in a
Tomahawk trap (48.3315.2315.2 cm) on
private land in Camacan, Bahia (15821 0 S,
39833 0 W), on 11 July 2008. The matrix
dominating this landscape consists of an
agroforestry system (known locally as cabruca)
of cacao shaded by native trees (Oliveira et al.
2011). The trap had been set for a separate
study to capture lion tamarins, and unfortu-
nately these two individuals were accidentally
captured in one trap and died of lesions from
conspecific fighting. These deaths were the
first in 10 yr of study, and since 2008 we have
changed our protocols and have had no
further deaths. The animals were collected
and submitted for necropsy.
The tamarin was necropsied within 24 h of
collection; the marmosets were immediately
frozen and thawed 7 d later for postmortem
examination. All procedures were authorized
by the Instituto Chico Mendes de Conserva-
ção da Biodiversidade and the Brazilian
Institute for the Environment and Renewable
Natural Resources permits 02001, 006792/05-
64, and 113/2007 (L.S.C.), IN 169/2008, and
approved by the Animal Welfare Committee
of Universidade Estadual de Santa Cruz
under permit 004/2008.
During the necropsies, the abdominal and
thoracic cavities were incised and viscera
removed. The digestive tract (stomach and
small and large intestines) was examined
carefully, separated and opened along its
entire length, and frequently rinsed with
distilled water to collect all contents. Contents
were subsequently screened using a 0.212-
mm mesh screen and the remnants sieved and
transferred to Petri dishes. All helminths were
recorded and fixed with 10% buffered forma-
252
SHORT COMMUNICATIONS 365
lin, subsequently cleared in lactophenol, and
studied in temporary mounts by light micro-
scope and a magnifying glass. The helminths
were identified to species by examining
physical structures according to Machado-
Filho (1950), Stunkard (1965), and Urquhart
et al. (1998). Fecal content removed directly
from the intestine was conserved in 10%
formalin as preservative and formal-ether
sedimentation preparation technique as de-
scribed by Monteiro et al. (2007).
We discovered worms embedded in the
intestinal walls (Fig. 1A) of all three primates,
often in nodular lesions. We collected 12
helminths from the golden-headed lion tam-
arin and six from each of the Wied’s
marmosets. Ulcers in the intestinal walls, 1–2
mm in diameter, were caused by the embed-
ded worms and extensive tissue reaction
around the worms was observed. Based on
external morphologic characteristics, includ-
ing globular proboscides (Fig. 1B) armed with
36 hooks (12 rows of three hooks), we
identified three morphologies varying from
robust hooks at the top to short hooks at the
bottom. The parasites were identified as P.
elegans based on the taxonomic characteristics
of the shape and armature of the proboscis
and the size and shape of the body (Machado-
Filho 1950).
The temporary mounts treated with lacto-
phenol allowed for visualization of internal
morphology of the parasites. The male repro-
ductive system occupied 75% of the total body
and was composed of two testicles and the
prostatic glands (Fig. 1C). We identified 10
female worms, varying from 1.8 to 3.3 cm, and
14 males of 1.8–2.7 cm long. The method of
concentration for the formalin-ether revealed
Prosthenorchis spp. eggs in the feces (Fig.
1D). We observed parts of other inverte-
brates, including Coleoptera, in the fecal
samples.
There is little information available on the
endoparasites of neotropical primates (Mon-
teiro et al. 2007; Sales et al. 2010). However, it
is known that most parasites are capable of
infecting more than one host species (Free-
man et al. 2004). Infestations in New World
primates have been reported in zoologic parks
 253
366 JOURNAL OF WILDLIFE DISEASES, VOL. 52, NO. 2, APRIL 2016

FIGURE 1. Morphologic characteristics of the acanthocephalan endoparasite Prosthenorchis elegans from the
small intestines of a golden-headed lion tamarin (Leontopithecus chrysomelas) and two Wied’s marmosets
(Callithrix kuhlii), in Brazil, 2008. (A) Worms deeply embedded in the intestinal walls; (B) light microscope
detail of the proboscis, armed with spines (1003); (C) light microscope detail of male reproductive system,
showing cement glands, behind the testes, and the vesiculae seminales (1003); (D) P. elegans egg.

intermittently since 1953 (Weber and Junge
2000). Stunkard (1965) described heavy in-
festations with Prosthenorchis spp. in mon-
keys that died in the London Zoo and 72% of
captive lion tamarins dead in Rio de Janeiro
Primate Center (Pissinatti et al. 2007). The
affected tamarins had diarrhea, loss of appe-
tite, and progressive weakness before dying.
In contrast, the animals necropsied in our
study were in good overall body condition.
According to Grundman et al. (1976), the
degree of injury associated with gastrointesti-
nal parasite infestations is related to the
number of worms present. Acanthocephalans
are not common in the digestive tract.
However, when present, they attach to the
digestive tract of a vertebrate host with their
proboscis, and the absorption of nutritive
liquids occurs by osmosis, exchanging nutri-
ents, gases, and wastes through the host’s
body wall. They have no mouth or digestive
tract. Adult Prosthenorchis individuals live
embedded and often in nodular lesions,
within the lumen of the terminal portion of
the ileum, cecum, and colon (Dunn 1963). We
believe that the perforations and the nodular
lesions observed in the intestinal wall do not
represent a paratenic parasitism, because all
of the helminths found were adults. We
confirmed the mature stage of the parasites
by identifying the reproductive tract and by
finding parasitic eggs in the hosts’ feces.
During its life cycle, the helminth deposits
embryonic eggs in the intestine of the final
vertebrate host, which are eliminated along
with the feces and ingested by the inverte-
brate, intermediate host. The primates are
then (re)infected by eating the intermediate

host (e.g., Blattodea and Coleoptera), which
contains the larval stages of the parasite
(Stunkard 1965; Rey 2001). As both primate
species have similar diets, have overlapping
territories (Raboy et al. 2004), and share a
degraded landscape (Tisovec et al. 2014),
infestation by Prosthenorchis spp. in the two
species may be facilitated.
According to Freeman et al. (2004), an-
thropogenic habitat destruction may result in
important changes in microhabitats, changing
both parasite presence and the ecology of
Coleoptera. Habitat decline can result in
increased contact between groups belonging
to the same or different primate species and
facilitate transmission of parasites indirectly
through contaminated vegetation and soil. An
increased population density of Coleoptera
within the environment may help maintain the
life cycle of the P. elegans. Additionally, it has
been suggested that stressful conditions (e.g.,
habitat loss and resource scarcity) may lead to
immunosuppression and allow parasite infes-
tations to cause illness and decrease repro-
ductive success, thus impacting the survival of
free-living populations (Sales et al. 2010).
Studying parasites provides a valuable
resource for investigating ecologic relation-
ships between primates and their environ-
ment. Cross-species parasite transmission may
be possible in nonhuman primates in the
Atlantic forest because of shared habitats and
food sources. The loss of habitats may further
result in these sympatric species coming into
closer proximity or contact. Parasites such as
P. elegans, which can infect more than one
species, may be responsible for clinical disease
in endangered species. This study demon-
strates the importance of performing necrop-
sies on free-living animals that die so that we
may learn about baseline health parameters
and possible diseases within populations
across the globe (Deem et al. 2005).
We thank Maı́ra R. dos Santos for contrib-
uting to the necropsies, and Project BioBrasil,
the Centre for Research and Conservation of
the Royal Zoological Society of Antwerp
(Belgium), Instituto de Estudos Socioambien-
tais do Sul da Bahia, and Bicho do Mato for
their logistic support. We also thank the
254
SHORT COMMUNICATIONS 367
Brazilian Institute for the Environment and
Renewable Natural Resources and Instituto
Chico Mendes de Conservação da Biodiversi-
dade for permits and logistic help in conduct-
ing research in the Una Biological Reserve.
Further thanks to the sponsoring institutions
that made this project possible: Brazilian
Higher Education Authority (Coordenação
de Aperfeiçoamento de Pessoal de Nı́vel
Superior), Scott Neotropical Fund of the
Cleveland Metroparks Zoo, Center for Re-
search and Conservation of the Royal Zoolog-
ical Society of Antwerp, Lion Tamarins of
Brazil Fund, National Lottery of Belgium,
Conservation International’s Primate Action
Fund, and Zoological Society of London.
LITERATURE CITED
Bowman DD, Lynn RC, Eberhard ML, Alcaraz A. 2006.
Parasitologia veterinária de Georgis, 8th Ed. Manole,
Barueri, São Paulo, Brazil, 422 pp.
De Vleeschouwer KM, Oliveira LC, Raboy BE, Raghu-
nathan N. 2011. Golden-headed lion tamarin re-
search in the 21st century: Recent advances and
potential areas of future research. Neotrop Primates
18:72–76.
Deem SL, Maisels F, Robbins RG. 2005. Necropsy and
parasitic findings from an adult forest buffalo
(Sycerus caffer nanus) found dead in the Republic
of Congo. Eur J Wildl Res 51:60–62.
Dunn FL. 1963. Acantocephalans and cestodes of South
American monkeys and marmosets. J Parasitol 49:
717–722.
Freeman AS, Kinsella JM, Cipolletta C, Deem SL, Karesh
WB. 2004. Endoparasites of western lowland gorillas
(Gorilla gorilla gorilla) at Bai Hokou, Central African
Republic. J Wildl Dis 40:775–781.
Grundman AW, Warnock RG, Wasson DL. 1976. Some
mechanisms of natural regulation of parasitic hel-
minth populations. Am Midl Nat 95:347–360.
International Union for Conservation of Nature. 2015.
IUCN Red List of threatened species. Version 2015.4.
http://www.iucnredlist.org. Accessed January 2016.
Machado-Filho DA. 1950. Revisão do gênero Proste-
norchis Travassos 1915 (Acantocephala). Mem Inst
Oswaldo Cruz 48:495–544.
Monteiro RV, Dietz JM, Raboy BE, Beck B, De
Vleeschouwer KM, Baker A, Martins A, Jansen AM.
2007. Parasite community interactions: Trypanosoma
cruzi and intestinal helminths infecting wild golden
lion tamarins Leontopithecus rosalia and golden-
headed lion tamarins L. chrysomelas (Callitrichidae,
L., 1766). Parasitol Res 101:1689–1698.
Nunn CL, Altizer S, Jones KE, Sechrest W. 2003.
Compare tests of parasite species richness in
primates. Am Nat 162:597–614.

368 JOURNAL OF WILDLIFE DISEASES, VOL. 52, NO. 2, APRIL 2016
Oliveira LC, Neves LG, Raboy BE, Dietz JM. 2011.
Abundance of jackfruit (Artocarpus heterophyllus)
affects group characteristics and use of space by
golden-headed lion tamarins (Leontopithecus chryso-
melas) in cabruca agroforest. Environ Manag 48:248–
262.
Pissinatti L, Pissinatti A, Burity CHF, Mattos DG Jr,
Tortelly R. 2007. Ocorrência de acantocephala em
Leontopithecus (Lesson, 1840) cativos: Aspectos
clı́nico-patológicos. Callitrichidae—Primates. Arq
Bras Med Vet Zootec 59:1473–1477.
Püttker T, Meyer-Lucht Y, Sommer S. 2008. Effects of
fragmentation on parasite burden (nematodes) of
generalist and specialist small mammal species in
secondary forest fragments of the coastal Atlantic
Forest, Brazil. Ecol Res 23:207–215.
Raboy BE, Christman MC, Dietz JM. 2004. The use of
degraded and shade cocoa forests by endangered
golden-headed lion tamarins Leontopithecus chryso-
melas. Oryx 38:75–83.
Rey L. 2001. Parasitologia, 3rd Ed. Guanabara Koogan,
Rio de Janeiro, Brazil, 856 pp.
Ribeiro MC, Metzger JP, Martensen AC, Ponzoni FJ,
Hirota MM. 2009. The Brazilian Atlantic Forest:
How much is left, and how is the remaining forest
255
distributed? Implications for conservation. Biol Con-
serv 142:1141–1153.
Sales IS, Ruiz-Miranda CR, Santosa CP. 2010. Helminths
found in marmosets (Callithrix penicillata and
Callithrix jacchus) introduced to the region of
occurrence of golden lion tamarins (Leontopithecus
rosalia) in Brazil. Vet Parasitol 171:123–129.
Stunkard HW. 1965. New intermediate hosts in the life
cycle of Prostenorchis elegans (Diesing, 1851), an
acanthocephalan parasite of primates. J Parasitol 51:
645–649.
Tisovec KC, Cassano CR, Boubli JP, Pardini R. 2014.
Mixed-species groups of marmosets and tamarins
across a gradient of agroforestry intensification.
Biotropica 46:248–255.
Urquhart GM, Armour J, Duncan JL, Dunn AM, Jennings
FW. 1998. Parasitologia veterinária, 2nd Ed. Gua-
nabara Koogan, Rio de Janeiro, Brazil, 273 pp.
Weber M, Junge R. 2000. Identification and treatment of
Moniliformis clarki (Acantocephala) in cotton-topped
tamarins (Saguinus oedipus). J Zoo Wildl Med 31:
503–507.
Submitted for publication 23 June 2015.
Accepted 15 October 2015.
 256

APÊNDICE J:

CATENACCI, L. S.; OLIVEIRA, J. B. S.; SANTOS, K. R.; OLIVEIRA, L. C.; DEEM, S. L.;
TRAVASSOS-DA-ROSA, E. S.; DE VLEESCHOUWER, K. M. Intestinal parasites of
Leontopithecus chrysomelas in the Atlantic Forest of southern Bahia: Implications for Primate
Conservation. (Submetido American Journal of Primatology)
 257

Intestinal parasites in lion tamarins: implications for conservation

Intestinal parasites of Leontopithecus chrysomelas in the Atlantic Forest of southern

Bahia: Implications for Primate Conservation

Ecological and anthropogenic pressures influence parasite transmission. The ecological and

demographic data of free-living GHLT groups in Southern Bahia, combined with

parasitological studies may be useful in conservation programs for this species.

Lilian S. Catenacci 1,2,3*, Janilda B. S. Oliveira 1, Karina R. dos Santos 4, Leonardo de C.

5
Oliveira , Sharon L. Deem 6,7, Elizabeth S. Travassos da Rosa 2 , Kristel Myriam De

Vleeschouwer 3
1
Federal University of Piaui State, Campus Professora C. Elvas, Bom Jesus, PI, Brazil
2
Virology Graduate Program, Evandro Chagas Institute, Ananindeua, PA, Brazil
3
Centre for Research and Conservation, Royal Zoological Society of Antwerp, Antwerp,

Belgium
4
Federal University of Piaui State, Campus Ministro Reis Velloso, Parnaíba, PI, Brazil
5
Science Department, State University of Rio de Janeiro, RJ. Brazil.
6
Saint Louis Zoo Institute for Conservation Medicine, Saint Louis, MO, USA
7
University of Missouri-St Louis, St. Louis, MO, USA

Correspondence author:

Lilian Silva Catenacci, Federal University of Piaui State , Rod municipal Bom Jesus Viana,

BR135, km 1, Bom Jesus, Brazil, PI 64900-000, (+55) 89 99900-1212 catenacci@ufpi.edu.br

Abstract

In this study, coproparasitological testing of free-living golden-headed lion tamarins (GHLT)

Leontopithecus chrysomelas was performed using the Hoffman, Willis-Mollay and Ritchie
 258

methods, with comparison of parasite prevalence in tamarins living in different

environments. Feces were collected twice per year for two years. In total, 128 samples were

collected from ten groups over three Atlantic forest environments: national forest, agroforesty

farms (also known as cabruca) and forest mosaics. Eggs in the Acanthocephalidae, Spiruridae,

Ancilostomidae, Ascaridae, Oxiuridae families were identified. The highest prevalence (44%,

n = 56) was for Acanthocephalidae, followed by Spiruridae (9.3%, n = 12). There was no

difference in parasite loads between males and females or between juvenile, sub-adult and

adult animals. However, there was a difference based on site with the highest prevalence

found for animals living in a national forest. These results suggest that intestinal parasites of

GHLT may be related to environmental factors, including difference in feeding behavior of

the primate based on habitat and the life cycle of the parasites. The high Acanthocephala

prevalence we found in tamarins in sites with probable anthropogenic stresses (e.g.,

deforestation and decreased resources) may compromise animal health. The combination of

ecological and demographic data of the GHLT, combined with the parasitological studies

demonstrate that eco-epidemiologic information in Southern Bahia may be useful in

conservation programs for this species.

Key words: golden-headed-lion-tamarin; new world monkeys; cabruca; coproparasitological;

Atlantic forest

Introduction

Environmental changes and ecological disturbances caused by both anthropogenic and natural

causes have been shown to influence parasitic diseases in a number of species (Bonger &

Ferris, 1999; Patz, Graczyk, Gellera & Vittor, 2000; Cleaveland, Laurenson & Taylor, 2001).

These disturbances can alter the ecological balance between the vector, host, and parasite;
 259

which may impact the epidemiology of parasitic diseases (Daszak, Cunningham &Yatt, 2000;

Patza, Graczyk, Gellera & Vittor, 2000).

Parasitic infections have been identified as a critical component to be considered in

conservation biology (Daszak, Cunningham &Yatt, 2000; Eckert, Hahn, Genz et al, 2006)

because the impact of parasitic infections in free-living populations may affect the density and

distribution of host species and the health and survival as well (Cleaveland, Laurenson &

Taylor, 2001; Nunn, Altizer, Jones & Sechrest, 2003; Nunn, Altizer, Sechrest et al, 2004).

Primates are particularly vulnerable to the effects of parasites due to their social behavior,

such as cohesive social group living, which facilitates parasite transmission (Stoner, 1996). In

addition, several species of primates are omnivorous and eat invertebrates, which increases

the likelihood of indirect transmission (Nunn, Altizer, Jones & Sechrest, 2003; Pedersen,

Altizer, Poss, Cunningham & Nunn; 2005). There is a wide diversity of agents that parasitize

non-human primates (NHP), many are adapted to their hosts and thus cause few pathological

issues. However, others have been blamed for significant and even fatal damage, such as

helminths of the Acanthocephala order (Chandler,1953; Weber, Junge, 2000; Pissinatti ,

Pissinatti , Burity, Mattos Jr. & Tortelly, 2007; Catenacci, Colosio, Oliveira et al, 2016).

And, there remains a paucity of data of intestinal parasite prevalence and diversity for most

endangered species, including the GHLT (Stoner, 1996; Monteiro, Dietz, Raboy et al 2007;

Pissinatti , Pissinatti , Burity, Mattos Jr. & Tortelly, 2007; De Vleeschouwer, Oliveira, Raboy

& Raghunathan, 2011).

Tamarins (Callitrichidae: Leontopithecus) are small arboreal primates (weighing between

586 g and 653 g) (Oliveira, Neves, Raboy & Dietz, 2011) which live in small family groups

(Rylands, 1993; Raboy & Dietz, 2004). Habitat destruction and degradation of forests are the

main threat to the genus (Kierulff, Raboy, Oliveira et al, 2002; Monteiro, Jansen &Pinto,

2003; Sales, Ruiz-Miranda & Santos, 2010). One tamarin species, the GHLT (Leontopithecus
 260

chrysomelas) is endemic to the southern Atlantic Forest of Bahia, Brazil (Rylands, 1993;

Kierulff, Raboy, Oliveira et al, 2002; De Vleeschouwer, Oliveira, Raboy & Raghunathan,

2011). As fragmentation continues largely unabated in the region (Guy C, Cassano CR,

Cazarre L, Vleeschouwer KM, Kierulff MCM et al, 2016), available resources for GHLT, and

other wildlife species, are increasingly depleted and may lead to host immunocompromise and

increased parasitic infections for populations in this region of Brazi (Daszak, Cunningham

&Yatt, 2000; Patz, Graczyk, Gellera & Vittor, 2000; McCallum & Dobson, 2002; Raboy,

Christman &Dietz, 2004; Monteiro, Dietz, Raboy et al 2007; Sales, Ruiz-Miranda & Santos,

2010).

Parasites are defined as any agent that is dependent, for some part on its lifecycle, to live in or

on another organism (Urquhart, Armour , Duncan, Dunn & Jennings, 1998). This includes

microparasites (e.g., viruses, bacteria, fungi, and protozoa) and macroparasites that include

endoparasites and ectoparasites (Nunn, Altizer, Sechrest et al, 2004; Pedersen, Altizer, Poss,

Cunningham & Nunn, 2005). Throughout a long evolutionary period, most parasites have

established a dynamic state in which pathologies that compromise the survival of the hosts

occur in low frequencies and are often self-limiting conditions (Grundmann, Warnock &

Wassom, 1976; Nunn, Altizer, Jones & Sechrest, 2003). However, in cases where the host is

under extreme environmental pressure or does not have the immune capacity, disease may

occur (Grundmann, Warnock & Wassom, 1976).

Understanding the factors that may affect the prevalence of intestinal parasites (Stoner, 1996)

in free-living L. chrysomelas groups inhabiting different areas with disturbance gradient or

human influence in southern Bahia is important for the long-term conservation efforts for this

species. For this reason, we conducted a field survey in order to describe and compare

intestinal parasites found in L. chrysomelas groups.

 261

Materials and Methods

Area and study groups

The study was conducted in areas belonging to the Bahia Atlantic Forest domain, Brazil.

Across this region, there are differences in anthropogenic pressures and land use strategies.

We collected data from seven groups of GHLT that were divided into categories according to

the vegetation types in which they were found: three groups that lived exclusively in a

agroforest system called cabruca (municipality of Ilhéus: Almada, Bomfim and Santa Rita);

four groups that used a mosaic between cabruca and fragments of forest remains in cocoa

farms (municipalities of Una, Arataca, Camacan and Jussari); and three groups that lived

exclusively in a National Forest (Una Biological Reserve) (Figure 1).

Cabruca is an agroforest system defined as a dynamic and ecologically-based natural resource

management practice where growing trees of coca are shaded by native trees (Oliveira, Neves,

Raboy & Dietz, 2011). In this system there is selective logging of native trees for cocoa

shading. The Una Biological Reserve (REBIO-Una) in Una-BA is a 18,515 hectares area, and

that is the only fully protected Federal unit in the region. Therefore, this reserve has a high

degree of conservation management (Moura, 2003; Brasil, 2011; ). Based on previous studies

we know that the three REBIO groups have an average size of 4.67 individuals per group,

average density of 0.059 individuals per hectare, and average living area of 84.9 hectares (De

Vleeschouwer, Oliveira, Raboy & Raghunathan, 2011; Catenacci, Pessoa, Nogueira-Filho &

De Vleeschouwer, 2016). For the seven groups inhabiting farms outside the conservation unit,

the average size of the groups was 7.2 individuals per group, average density of 0.15

individuals per hectare, and average living area of 54.6 hectares (Oliveira, Neves, Raboy &

Dietz, 2011).
 262

Capture and chemical restraint

Primates were captured individually using Tomahawk live traps (48.3 x 15.2 x 15.2 cm)

baited with banana and placed on platforms 1.5m above ground in areas used by tamarin

groups (Dietz et al., 1996). Once captured, the animals were taken to a field laboratory for

processing, and then released the following day at the same location where they were

captured. In the field laboratory, they were provided water and food up to 4 hr prior to

anesthesia. They were anesthetized by hand injection of ketamine hydrochloride (10 mg/kg;

i.m.) and midazolam hydrochloride (0.3 mg/kg; i.m.) in a single syringe using a 22 g needle.

During anesthesia, animals were given a full physical exam and biomaterials were collected.

The following data was collected for each animal: sex, age group, animal identification, body

weight and biometric measurements. All procedures were performed by veterinarians and

biologists, using personal protective equipment. All handling complied with the protocols

approved b the Ethics Committee on Animal Experimentation at the Universidade Estadual de

Santa Cruz (number13/07). The captures were also authorized by the Brazilian Environmental

Agency (IBAMA/ICMBio) permit numbers 12334-1, 18444-1, 113/2007 and 15025/2009.

This research adhered to the procedures recommended by the International Committee for the

Conservation and Management of Lion Tamarins and the American Society of Primatologists

principles for the ethical treatment of primates (http://www.asp.org/society/

resolutions/EthicalTreatmentOfNonHumanPrimates.html).

Parasitological testing

Fecal samples from each animal were collected directly from the rectum using a rectal probe

or indirectly from newspaper on the bottom of the trap. Samples were stored in glass vials

containing 10% formalin solution. Sedimentation methods were performed by Hoffman

methods, along with the Willis-Mollay and Ritchie methods for identification of endoparasites

(Santos, 1993; Sloss, Zajac & Kemp, 1999; Urquhart, Armour , Duncan, Dunn & Jennings,
 263

1998). The identification of the eggs was carried out by morphometric comparison with those

from species previously described in the literature (Monteiro, Jansen & Pinto RM. 2003;

Monteiro, Dietz, Raboy et al, 2007; Pissinatti, Pissinatti , Burity, Mattos Jr &, Tortelly, 2007;

Sales, Ruiz-Miranda & Santos, 2010; Catenacci, Colosio, Oliveira et al, 2016).

Unfortunately, some nematodes have egg morphologies that prevent identification to the

species or even genus level. For these eggs, we characterized to higher taxa (Brandão,

Chame, Cordeiro & Chaves, 2009; Sales, Ruiz-Miranda & Santos, 2010).

Statistical analyses

To determine whether there was a difference in parasitic infections (diversity and prevalence)

based on sex, age group and habitat of each animal, we used a chi-square test with confidence

level of <0.05. All the tests were performed using the Bioestat Program version 5.3 (Ayres,

Ayres & Santos, 2007).

Results

Parasites identified

In a period of two years, ten groups of tamarins were captured from the study areas (Figure 1).

A total of 128 fecal samples were collected, belonging to 118 individuals (Table 1). Of the

128 samples, 43.7% ± 8.6(N=56) had eggs of parasites belonging to a morphotype of the

Acanthocephala phylum, four morphotypes of the Ancylostomatidae, Ascarididae,

Oxyurididae and Spiruridae families, and one unknown egg (Table 2). Most of the positive

samples showed only one parasite (78.8%± 9.8, N=52), with the Acanthocephala morphotype

most common.
 264

Parasite richness, sex and age group

Most of the samples were from males (64.3±8.64, N=76) and adult animals (66.3±8.53,

N=77) (Tables 3 and 4). However, there was no sex (X2=0.43, df= 1, P>0.05, N=118) or age

(X2=4.45, df= 2, p>0.05, N=118) effect on parasite diversity.

Parasite richness and study areas

All animals were clinically healthy based on physical examinations. However, the groups

living within the conservation area were more parasitized, with 44 positive samples, while in

non-federal protected areas (cabruca and forest mosaics), only 22 infected samples were

found (X2=8.92, df= 1, P<0.05, N=128). The Ascarididae family and the unknown egg were

present only within the protected area (Table 2).

Discussion

In this study we evaluated gastrointestinal helminth infection under natural conditions with

fecal samples collected within hours of capture. The parasites detected from the GHLT in this

study were Acanthocephala and other nematodes. The parasites in our study have been

reported in a number of NHP species previously (Stunkard ,1965; Stoner, 1996; Pissinatti,

Pissinatti, Burity, Mattos Jr. & Tortelly, 2007; Sales, Ruiz-Miranda & Santos, 2010;

Catenacci, Colosio, Oliveira et al, 2016). Our findings are similar to findings by Sales et al.

2010 and Monteiro et al. 2003 from Leontopithecus rosalia and Callithrix sp. groups in Rio

de Janeiro, Brazil. Monteiro et al (2007) also found a low prevalence of Ascarididae,

Oxyuridae and Ancylostomatidae in three free-living groups of L. chrysomelas.

Acanthocephala had the highest prevalence among parasites found in our study. It is believed

that this is related to this parasite’s indirect transmission strategy (Chandler, 1953; Urquhart,

Armour, Duncan, Dunn & Jennings, 1998; Pedersen, Altizer, Poss, Cunningham & Nunn,
 265

2005). According to the life cycle, Acanthocephala deposite fertilized eggs in the intestine of

the definitive host (vertebrate), which are eliminated with the feces and ingested by

intermediate hosts (cockroaches and other arthropods). The definitive host is infected by

ingesting the intermediate host containing the larval forms (Urquhart, Armour, Duncan, Dunn

& Jennings, 1998; Weber & Junge, 2000). When the intermediate hosts are part of the primate

food chain, the increased infection coincides with the feeding selectivity by the host

(Grundmann, Warnock & Wassom, 1976; Weber & Junge, 2000). As tamarins are

frugivorous-insectivorous (Kierulff, Raboy & Oliveira, 2002), their feeding behavior itself

could explain the higher prevalence of these parasites. In this case, the vegetation

characteristics would be less directly related to the survival of the helminth; arthropod intake

arthropod abundance and immunity of each infected primate is, thus, the important factor.

From the point of view of conservation, the finding of Acanthocephala may represent a risk

for the populations of GHLT in the wild. The Acanthocephala morphotype is pathogenic, and

the degree of injury produced is related to the number of parasites present in the host’s

intestinal mucosa, in addition to their degree of immunity (Pissinatti, Pissinatti, Burity, Mattos

Jr.& Tortelly, 2007). The parasite attaches itself to the intestinal wall due to a thorny

retractable proboscis, and may cause serious injury to the mucosa of the host (Chandler, 1953;

Stunkard,1965) and death in these animals (Weber & Junge, 2000; Pissinatti , Pissinatti,

Burity, Mattos Jr.& Tortelly, 2007; Catenacci, Colosio, Oliveira et al, 2016). Acanthocephala

infection is described in the literature as one of the most severe helminthiasis, characterized

by bleeding and convulsions, with infected animals often having anorexia, weight loss,

anemia, septicemia and death. However, it is known that some hosts can keep healthy even

parasitized or tolerate severe infection without obvious clinical signs (Kindlovits, &

Kindlovits, 2009).
 266

The same vector transmission strategy is used by the nematode Spiruridae (Vicente, Pinto &

Faria, 1992), which had the second highest prevalence (Table 2). However, based on

literature, this parasite has a lower pathogenicity and causes less impairment on the health of

tamarins when compared to Acanthocephala (Vicente, Pinto & Faria, 1992; Monteiro, Jansen

& Pinto, 2003). In other mammals, the prevalence of Spiruridae varied between populations,

due to the feeding variation of these animals: those who consumed more insects had higher

infection rates (Grundmann, Warnock & Wassom,1976).

With respect to other parasites found, transmission occurs via fomites or contaminated water

and soil (Bongers &Ferris, 1999). Since these primates are predominantly arboreal (Rylands,

1993; Raboy & Dietz, 2004), a lower incidence was expected.

Parasite richness, sex and age group

Adult females tend to have a higher parasite prevalence than males due to an overload of the

body during the stages of pregnancy and birth, but Stoner (1996) also found no differences

related to age in a study of free-living groups of Allouata palliata. One explanation for this

lack of correlation can be the good clinical and body status of captured animals (Bales KL,

French JA, McWilliams J, Lake RA & Dietz J., 2006). In fact, the animals were above the

average weight previously described for this species (Oliveira, Neves, Raboy & Dietz, 2011).

Another explanation for the presence of parasites in all age and sex groups is probably

because invertebrates serve as intermediate hosts for the Acanthocephala, and that all age

groups eat invertebrates, particularly insects (Catenacci, Pessoa, Nogueira-Filho &

De Vleeschouwer, 2016).

Parasite richness and study areas

The higher diversity and prevalence of parasites infecting the GHLT was expected outside of

conservation units, due to the greater possibility of the GHLT sharing the environment within
 267

human and domestic animals (Daszak P, Cunningham &Yatt, 2000; Taylor, Latham,

Woolhouse & 2001; Patz, Graczyk , Gellera & Vittor, 2000; Cleaveland, Laurenson

&Taylor, 2001; McCallum & Dobson, 2002;). However, our findings suggest that the high

biodiversity in conserved tropical forests may extend to parasite diversity as well (Monteiro,

Dietz , Raboy et al, 2007). The Southern Bahia Atlantic Forest is a hot spot for biodiversity,

and includes seven species of primates, which five are threatened of extinction and three are

endemics of this area (Moura, 2003; Brasil, 2011). This could explain the presence of the

Ascarididae family and an unknown egg found in monkeys only in the national forest.

Moreover, the diversity of parasites can also be related to the bigger home range for the

groups inside of the conservation unit (85.9 hectares) when compared to primate groups that

were living in the agroforest farms or mosaic environments (54.6 hectares) (Oliveira, Neves,

Raboy & Dietz, 2011). The larger the area of use by the groups and the greater the distance

traveled per day, the greater the probability of animals finding parasite species and being

infected (Nunn, Altizer, Jones & Sechrest W, 2003; Woolhouse, Taylor & Haydson, 2010).

Despite the existence of pathogens that have more than one host as an ecological strategy

(Cleaveland, Laurenson & Taylor, 2001; Nunn, Altizer, Jones & Sechrest W, 2003; Nunn,

Altizer, Sechrest et al, 2004), about 50% of helminths which affect NHP are species-, genus-

or family-specific (Pedersen, Altizer, Poss, Cunningham & Nunn CL. 2005). This means that,

even with the presence of eggs and larvae that had infected other mammals in areas outside

the conservation unit, part of these helminths will not be able to develop in tamarins.

However, the proximity between domestic and wild animals through the presence of rural

workers and their dogs in forest environments may facilitate the spread of parasitic agents to

new environments, which may provide, through adaptation and evolution, new relationships

between hosts and parasites and new ecological niches for disease transmission (Bongers &

Ferris, 1999; Patz, Graczyk, Gellera &Vittor, 2000; Cleaveland, Laurenson &Taylor, 2001;
 268

Hatcher, Dick & Dunn, 2006). Therefore, more detailed studies on inventories of

parasitological fauna in wild and domestic species of the study areas are needed. Over time,

the accumulation of these data will enable greater use of helminths for monitoring the health

of ecosystems in the face of environmental changes (Bongers & Ferris, 1999; Cleaveland,

Laurenson & Taylor, 2001).

A higher prevalence of parasites was also expected in groups of tamarins living outside the

conservation unit, because of the high population density of these groups (0.15 ind/ha)

compared to animals at REBIO (0.06 ind/ha) (Oliveira, Neves, Raboy & Dietz, 2011). Several

studies show that the population density of the host is directly associated with a greater

likelihood of infection, and of recontamination of the environment (McCallum & Dobson,

2002; Nunn, Altizer, Sechrest et al, 2004). We suggest, however, that the higher diversity of

endoparasites in the REBIO groups is related to four factors: 1) transmission strategy of the

parasites found; 2) diversity of the intermediate hosts; 3) successful foraging and ingestion of

prey animals; and 4) forest management differences inside and outside the reserve.

The most prevalent eggs described were Acanthocephala and Spiruridae sp. helminths, which

are transmitted through the ingestion of parasite-infected arthropods, regardless of the primate

density (Urquhart, Armour, Duncan, Dunn &Jennings, 1998; Weber & Junge, 2000). In these

cases, it is the presence of the arthropod, an environment conducive to the growth and

maintenance of these insects, and the behaviors of foraging and eating prey by NHP that are

important for parasite infection. The finding of these parasites in areas both outside and inside

the conservation units demonstrates the presence of arthropods in both locations; however it is

unknown the abundance and diversity of arthrpods and the equally of the arthropods

preference in the diet among the tamarins groups. Future studies should evaluate the diversity

(abundancy and richness) of the invertebrates that could be used as intermediate hosts besides

of the research focusing on the prevalence of parasites in different areas along with
 269

invertebrate population. Regarding the feeding behavior of the tamarins, it was observed that

the animals that live within the conservation units spend more time foraging and eating prey

(23%) (Catenacci, Pessoa, Nogueira-Filho & De Vleeschouwer, 2016), when compared to

animals outside the conservation units (14%) (Oliveira, Neves, Raboy& Dietz, 2011). A

longer foraging time could lead to ingestion of a greater number of infected arthropods and,

thus, the maintenance of the parasite life cycle in a larger number of primates in the

conservation units.

The macro-environment, which houses both the parasitic agent and the host, is essential to

determine the establishment and reproduction of the parasites (Bongers & Ferris, 1999;

Grundmann, Warnock & Wassom, 1976; Nunn, Altizer, Jones & Sechrest,2003). Several

environmental factors, such as climate variability in microhabitats, may also be vital for the

development and survival of helminthes (Patz, Graczyk, Gellera &Vittor, 2000). Moderate

temperatures and high humidity, for example, favor the development of most parasites which

have transmission through fomites, soil or water (Bongers & Ferris, 1999; Urquhart, Armour,

Duncan, Dunn &Jennings, 1998). This may explain the higher diversity of helminths in the

conservation unit, where the amount of litter tends to be higher, forming a microclimate

which favors the maintenance of high humidity and more constant temperature in the soil

(Bongers & Ferris, 1999). Due to the high capacity of survival by the eggs and larvae of

parasites in shady and humid environments, as seen in the conservation units, the maintenance

and transmission of helminths is possible for long periods (Urquhart, Armour, Duncan, Dunn

&Jennings, 1998; Patz, Graczyk, Gellera &Vittor, 2000). However, in unprotected areas

management of soil and litter, due to agricultural or other practices, and selective cutting of

understory, may eliminate shade from trees (Oliveira, Neves, Raboy & Dietz, 2011). Thus,

there will probably be a decrease in humidity and temperature changes on the ground (i.e., in
 270

micro-environments) in these areas, which could affect the maintenance of parasites and lead

to lower diversity of helminths.

Conclusion

Ecological and anthropogenic pressures influence parasite transmission.

Endoparasite studies of NHP is valuable to better understand how the health of

these animals is associated with environmental health. The prevalence of helminth

populations in different host locations is the result of a complex array of factors that

operate in different combinations in each location. Community structure (e.g.,

biodiversity presence), parasite lifecycles, vector distribution, and host density,

immunity and behavior along with environmental management, all may influence

parasite density and prevalence of NHP. The high prevalence of Acanthocephala,

in stressful situations, such as deforestation and decreased resources, may

compromise GHLT health due to parasitic disease. The combination of ecological

and demographic knowledge about this species with parasitological testing will

reveal eco-epidemiologic information of parasitosis in Southern Bahia, Brazil and

may be an important part of primate conservation programs (Deem, 2016).

ACKNOWLEDGMENTS

We thank Project BioBrasil, the Royal Zoological Society ofAntwerp (Belgium), and IESB

for their investment in this study and the Brazilian Institute of the Environment and

Renewable Natural Resources (Instituto Brasileiro do Meio Ambiente e dos Recursos

Naturais Renováveis - IBAMA) and Instituto Chico Mendes de Biodiversidade (ICMBio) for

the permits to capture the study groups. We are grateful to the owners and their employees of
 271

the Fazenda Almada, Santa Rita, Bonfim and the private reserves (RPPNs) Ararauna and

Serra do Teimoso for allowing us to conduct our study on their properties and for the support

provided for the field team and ICMBio and the reserve directors Saturnino N. F. de Sousa

and Paulo C. D. Cruz for support and permission to work inside the Una Biological Reserve.

We are grateful to Antonio Ribeiro Santos Junior, José Alves das Neves Filho, Josinei da

Silva Santos, Jiomário dos Santos Souza, and Edimalvan da Purificação for help with data

collection. We thank the following funding agencies: CNPq, Scott Neotropical Fund of the

Cleveland Metroparks Zoo, the Center for Research and Conservation of the Royal Zoological

Society of Antwerp, Lion Tamarins of Brazil Fund, National Lottery of Belgium, Primate

Action Fund, the Wildlife Conservation Society, International Foundation of Science, The

Rufford Small Grants Foundation and IdeaWild and Zoological Society of London. The

Flemish Ministry of Science (Belgium) provided structural support to the Center for Research

and Conservation of the Royal Zoological Society of Antwerp. LSC received doctoral

fellowship from CAPES (Coordenação de Aperfeiçoamento de Pessoal de Nível Superior).

REFERENCES

Ayres M, Ayres DL, Santos AS. 2007. BioEstat: aplicações estatísticas nas áreas das ciências

biológicas e médicas. Sociedade Civil Mamirauá, MCT-CNPq, Belém.

Bales KL, French JA, McWilliams J, Lake RA, Dietz J. Effects of social status, age, and season

on androgen and cortisol levels in wild male golden lion tamarins (Leontopithecus rosalia).

Hormones and Behavior. 2006; 49: 88 – 95.

Bongers T, Ferris H. 1999. Nematode community structure as a bioindicator in environmental

monitoring. Tree 14:224-28.

 272

Brandão ML, Chame M, Cordeiro JL, Chaves SAM. 2009. Diversidade de helmintos intestinais

em mamíferos silvestres e domésticos na Caatinga do Parque Nacional Serra da Capivara,

Sudeste do Piauí, Brasil. Revista Brasileira de Parasitologia Veterinaria 18:19-28.

Brasil. Ministério do Meio Ambiente. 2011. Sumário Executivo do Plano de Ação Nacional

para a conservação dos Primatas do Nordeste.. Brasília, 8p.

Catenacci LS, Pessoa MS, Nogueira-Filho SLG, De Vleeschouwer, KM. 2016.Diet and

Feeding Behavior of Leontopithecus chrysomelas (Callitrichidae) in Degraded Areas of the

Atlantic Forest of South-Bahia, Brazil. International Journal of Primatology 37:136-157.

Catenacci LS, Colosio AC, Oliveira LC, De Vleeschouwer KM, Munhoz AD, Deem SL, Pinto

JM. 2016. Occurrence of Prosthenorchis elegans in Free-living Primates from the Atlantic

Forest of Southern Bahia, Brazil. Journal of Wldlife Diseases 52:364-368.

Chandler AC. 1953. An Outbreak of Prosthenorchis (Acanthocephala) Infection in Primates in

the Houston Zoological Garden, and a Report of This Parasite in Nasua narica in Mexico. J

Parasitology 39: 226.

Cleaveland S, Laurenson MK, Taylor LH. 2001. Diseases of humans and their domestic

mammals: pathogen characteristics, host range and the risk of emergence. Philosophical

transactions of the Royal Society of London 356: 991-99.

Daszak P, Cunningham AA, Yatt AD. 2000. Emerging infectious diseases of wildlife – threats

to biodiversity and human health. Science 27:443-49.

Deem SL. 2016. Conservation Medicine: A Solution Based Approach for Saving Nonhuman

Primates. In: Waller, M. (ed.), Ethnoprimatology: People and Primates. Saunders, Saint Louis,

Missouri p 63-76.

De Vleeschouwer KM, Oliveira LC, Raboy B, Raghunathan N. 2011. Golden-Headed Lion

Tamarin Research in the 21ST Century: Recent Advances and Potential Areas of Future

Research. Neotropical Primates 18:72-76.

 273

Dietz J, de Sousa S, Billerbeck R. 1996. Population dynamics of golden-headed lion tamarins

in Una Reserve, Brazil. Journal of Wildlife Preservation Trusts 32:115–122.

Eckert K, Hahn NE, Genz A, Kitchen DM, Stuart MD, Averbeck GA, Stromberg BE,

Markowitz H. 2006. Coprological Surveys of Alouatta pigra at Two Sites in Belize.

International Journal of Primatology. 27: 227-38.

Guy C, Cassano CR, Cazarre L, Vleeschouwer KM, Kierulff MCM, Neves LG, Oliveira LC,

Tardio BMR, Zeigler SL, Raboy BE. 2016. Evaluating landscape suitability for golden-headed

lion tamarins (Leontopithecus chrysomelas) and Wied’s black tufted-ear marmosets (Callithrix

kuhlii) in the Bahian Atlantic Forest. Tropical Conservation Science 9:735-757.

Grundmann AW, Warnock RG, Wassom DL. 1976. Some Mechanisms of Natural Regulation

of Parasitic Helminth Populations. The American Naturalist 95: 347-360.

Hatcher MJ, Dick JT, Dunn AM. 2006. How parasites affect interactions between competitors

and predators. Ecology Letters. 9:1253–71.

Kierulff MCM, Raboy B, Oliveira PP, Miller K, Passos FC, Prado F. 2002 Behavioral ecology

of Leontopithecus. In: Kleiman DG, Rylands AB, editors. Lion Tamarins - Biology and

Conservation. Washington: Smithsonian Institution Press. p.157-87.

Kindlovits A, Kindlovits LM. 2009. Clínica e Terapêutica em Primatas Neotropicais. LF

Livros, 2ed. 535 p.

McCallum H, Dobson A. 2002. Disease, habitat fragmentation and conservation. Proceedings

of the Royal Society of London B 269: 2041–2049.

MMA. (2007). Ministério do Meio Ambiente. http://mma.gov.br.

Moura RT. 2003. Distribuição e ocorrência de mamíferos na Mata Atlântica do sul da Bahia In:

Prado P.I., Landau E.C., Moura R.T., Pinto L.P.S., Fonseca G.A.B., Alger K.N. (orgs.)

Corredor de Biodiversidade da Mata Atlântica do Sul da Bahia. Publicação em CD-ROM,

Ilhéus, IESB / CI / CABS / UFMG / UNICAMP.

 274

Monteiro RV, Dietz JM, Raboy B, Beck B, De VLeschouwer KM, Baker A, Martins A, Jansen

AM. 2007. Parasite community interactions: Trypanosoma cruzi and intestinal helminths

infecting wild golden lion tamarins Leontopithecus rosalia and golden-headed lion tamarins L.

chrysomelas (Callitrichidae, L., 1766). Parasitology Research 101:1689–1698.

Monteiro RV, Jansen AM, Pinto RM. 2003. Coprological helminth screening in brazilian free

ranging Golden lion tamarins, Leontopithecus rosalia (L., 1766) (PRIMATES,

CALLITHRICHIDAE). Brazilian Journal of Biology 63: 727-729.

Nunn CL, Altizer S, Jones KE, Sechrest W. 2003. Comparative Tests of Parasite Species

Richness in Primates. The American Naturalist 162: 597-14.

Nunn CL, Altizer S, Sechrest W, Jones KE, Barton RA, Gittleman JL. 2004. Parasites and the

Evolutionary Diversification of Primate Clades. The American Naturalist 164: 90-103.

Oliveira LC, Neves LG, Raboy B, Dietz J. 2011. Abundance of Jackfruit (Artocarpus

heterophyllus) Affects Group Characteristics and Use of Space by Golden-Headed Lion

Tamarins (Leontopithecus chrysomelas) in Cabruca Agroforest. Environmental Management.

48: 248-262.

Patz JA, Graczyk TK, Gellera N, Vittor AY. 2000. Effects of environmental change on

emerging parasitic diseases. International Journal of Parasitology 30:1395-05.

Pedersen AB, Altizer S, Poss M, Cunningham AA, Nunn CL. 2005. Patterns of host specificity

and transmission among parasites of wild primates. International Journal of Parasitology 35:

647–657.

Pissinatti L, Pissinatti A, Burity CHF, Mattos Jr. DG, Tortelly R. 2007. Ocorrência de

Acanthocephala em Leontopithecus (Lesson, 1840), cativos: aspectos clínicopatológicos.

Arquivo Brasileiro de Medicina Veterinaria e Zootecnia 59: 1473-1477.

Raboy BE, Christman MC, Dietz J. 2004. The use of degraded and shade cocoa forests by

Endangered golden-headed lion tamarins Leontopithecus chrysomelas. Oryx 38:75–83.

 275

Raboy BE, Dietz J. 2004. Diet, Foraging, and Use of Space in Wild Golden-Headed Lion

Tamarins. American Journal of Primatology 63:1-15.

Rylands AB. 1993. The ecology of the lions tamarins, Leontopithecus: some intrageneric

differences and comparisions with other callitrichids. In: Rylands AB, editor. Marmosets and

Tamarins: Systematics, Behaviour and Ecology. Oxford: Oxford University Press. p 296-313.

Sales IS, Ruiz-Miranda CR, Santos CP. 2010. Helminths found in marmosets (Callithrix

penicillata and Callithrix jacchus) introduced to the region of occurrence of golden lion

tamarins (Leontopithecus rosalia) in Brazil. Veterinary Parasitology 171: 123–129.

Santos LC. Coleta e Conservação de Amostras Biológicas. Laboratório Ambiental, editora

Edunioeste. 1999.341p.

Sloss MW, Zajac AM, Kemp RL. 1999. Parasitologia clínica veterinária, 6 ed, Editora Manole

198p.

Stoner, KE. 1996. Prevalence and Intensity of Intestinal Parasites in Mantled Howling Monkeys

(Alouatta palliata) in Northeastern Costa Rica: Implications for Conservation Biology.

Conservation Biology 10:539-546.

Stunkard HW. 1965. New Intermediate Hosts in the Life Cycle of Prosthenorchis elegans

(Diesing, 1851), an Acanthocephalan Parasite of Primates. Journal of Parasitology 51: 645-649.

Taylor LH, Latham SM, Woolhouse MEJ. 2001. Risk factors for human disease emergence.

Proceedings of the Royal Society of London B 356: 983-989.

Urquhart GM, Armour J, Duncan JL, Dunn AM, Jennings FW. 1998. Parasitologia Veterinária,

Tópicos de revisão, 2nd. Guanabara Koogan 273p.

Vicente JJ, Pinto RM, Faria Z. 1992. Spirura delicata sp. n. (Spiruridae, Spirurinae) from

Leontocebus mystax (Calltrichidae) and a check list of other nematodes of some Brazilian

primates. Memórias do Instituto Oswaldo Cruz 87:305-308.

 276

Weber M, Junge R. 2000. Identification and treatment of Moniliformis Clarki (Acantocephala)

in cotton-topped tamarins (Saguinus Oedipus). Journal of Zoo and Wildlife Medicine 31:503–

507.

Woolhouse MEJ, Taylor LH, Haydson DT. 2010. Population Biology of Multihost Pathogens.

Science. 292:1109- 112.

 277

Figure 1: Geographical distribution of golden-headed lion tamarin the southeast of Bahia,

Brazil and location of the study sites. Image extracted from Oliveira et al 2011
 278

Table 1: Characterization of golden-headed lion tamarin groups, according to sex, age and

number of fecal samples collected in southern Bahia, Brazil.

Area Number Sex Age* Number of

of groups samples
collected†
Federal REBIO- 4 22 F 14 J 69
Protected UNA 42 M 16 SA
Area 34 A
Mosaic 3 8F 2J 22
12 M 3 SA
Non- 15 A
federal
Protected Cabrucas 3 12 F 2J 37
Area 22M 4 SA
28 A
* related to the first capture. F: Female; M: Male; J: Juvenile; SA: subadult; A: adult.
†including multiples captures

Table 2. Prevalence of helminth eggs in stool of Golden-headed lion tamarins in a

conservation unit (REBIO-Una) and farms outside the conservation unit in Southern Bahia,

Brazil.

Area Helminth eggs P(N)* Positive Negative

Acan Anc Asc Oxy Spi Unk samples samples
P±CI(N)** P±CI (N)**
Reserve 55.1(38) 2.9(2) 7.2(5) 1.4(1) 13 (9) 1.4(1) 63.8 ± 36.2 ±
8.33(44) 8.33 (25)

Mosaic/ 30.5 1.69(1) 0 3.3(2) 5.1(3) 0 37.2± 8.37 62.8± 8.37

Cabrucas (18) (22) (37)
 279

*Acantocephala (Acan); Ancylostomatidae (Anc), Ascarididae (Asc), Oxyuridae (Oxy),

Spiruridae (Spi), Unknown (Unk). Values are percentages related to each area (nominal data

are in brackets). ** P= prevalence; CI: confidence interval; N=number of samples

Table 3. Prevalence of helminth eggs according to the sex of specimens from golden-headed-

lion tamarins captured in the wild in southern Bahia, Brazil.

Sex
Prevalence Male Female Total
P±CI(N)* P±CI(N) P±CI(N)
Absent of parasite 34.7±8.59 (41) 16.9±6.76 (20) 51.6±9.02 (61)
Only 1 parasite 22±7.47 (26) 16.1±6.63 (19) 38.1± 8.76(45)
2 or more parasites 7.6±4.78 (9) 2.5±2.82 (3) 10.1±5.44(12)
Total 64.3±8.64(76) 35.5±8.63(42) 100 (118)
 280

Table 4. Prevalence of helminth eggs according to age groups of specimens from Golden-

headed tamarins captured in the wild in southern Bahia, Brazil.

Prevalence Age Group P±CI(N)*

juvenile subadult Adult Total
Absent of parasite 5.1±3.97 (6) 8.5±5.03 (10) 38.1±8.76 (45) 51.7±9.02 (61)
only 1 parasite 9.3±5.24 (11) 7.6±4.78 (9) 21.2±7.37 (25) 38.1±8.76 (45)
only 2 parasites 0.8±1.8 (1) 3.4±3.27 (4) 7±4.25 (5.9) 11.2±5.6 (12)
Total 15.2±6.48(18) 19.5±7.15(23) 66.3±8.53 (77) 100 (118)

* P= prevalence; CI: confidence interval; N=number of samples

 281

APÊNDICE K:

CATENACCI, L. C.; DEEM, S. L.; LAMMERING, K.; FERREIRA, M. S.; TRAVASSOS DA

ROSA, E. S.; VASCONCELOS, P. F. C.; VLEESCHOUWER, K. M. Building network for a
sustainable health: an One Health Initiative in Bahia, Brazil. (A ser submetido para o Journal
of Public Health)
 282

Building networks for Sustainable Health: an One Health Initiative in Bahia, Brazil
L.S. Catenaccia,c,d, S.L. Deemb, K. Lammeringb, M.S. Ferreirac, E.S. Travassos da Rosac,
P.F.C. Vasconcelosc, K.M. De Vleeschouwerd
a
* Federal University of Piauí State, Professora Cinobelina Elvas, Bom Jesus, 64900-000/PI,
Brazil, catenacci@ufpi.edu.br, +55(89) 99900-1212.
b
Saint Louis Zoo Institute for Conservation Medicine, St. Louis, USA
c
Section of Arbovirology and Hemorrhagic Fevers, Evandro Chagas Institute- Ministry of
Health, Anannindeua, Brazil
d
Centre for Research and Conservation, Royal Zoological Society of Antwerp, Antwerp

Abstract:
Objective: To present an experience of a One Health Initiative developed in rural
communities that live in or near natural protected areas of the Atlantic Forest, Brazil, focusing
on the impact of vector-borne diseases for wildlife and humans and the environment.
Study Design: Assessment survey of wildlife, vectors and humans. We also used
collaboration with a community and other stakeholders based organization, interviews, focus
group discussions and a community forum.
Methods: We conducted key elements to developed the One Health Initiative, which was (1)
develop trust, strengthen collaborations and partnerships among the stakeholders; (2) organize
meetings to empower local groups to assume leadership and sustain programs in the longer
term; (3) promote assessment survey of wildlife, vectors and humans; and (4) organize
educational material (worksheets) for and with the stakeholders.
Results: We measured our results assessing the impact of our activities by simultaneously
investigating the medical, ecological, socioeconomic, and policy issues driving the system
(Table 1).
Conclusions: The stakeholders, including the rural communities perceived the One Health
Initiative project as beneficial to evaluate, discuss and communicate about the importance of
the interface people-environment-animals for prevent diseases and for the conservation of
biodiversity.
Key words: Conservation Medicine, Public Health, Capacity building; policy makers; health
outcomes
 283

Introduction

While education, prevention and early control of outbreaks could be the key to reducing the
impact of epidemics and potential pandemics, especially in less developed countries, the
world still remains positioned to respond, not to prevent.1 The health of humans, animals, and
ecosystems are interconnected and the One Health approach presents important opportunities
to reduce the impact of emergence events and also to prevent future emergence through
improved knowledge and coordination. Early detection and response to emerging pathogens
requires a coordinated, interdisciplinary, collaborative, cross-sectoral approach at global,
regional and local levels.1
Although our world becomes increasingly connected through trade and travel 2, emerging
infectious diseases pose a greater threat in developing nations, particularly in rural and small
communities.3 Rural communities are at special risk because of their location nearby or into
natural areas, and hence the larger interface human-animal-environment; which can facilitate
the transmission of diseases in both directions (people to animals and animals to people).
Additionally, these communities continue to struggle with problems related to basic
sanitation, clean and potable water supply as well as access to quality health care. 4,5 Many of
the deficiencies they experience in access to and the quality of health care transcend
individual-level resources and abilities and are related to the nature of the services offered in
the community, such as the availability of treatments, appropriateness of care, coordination of
care, cultural competency, and barriers to health care. Additionally, these people experience
inequities in other aspects of life such as education, employment and incomes. 4–6
Thus, now more than ever, transdisciplinary approaches are needed to solve these complex
health problems at the human–animal–environmental interface. Facilitating the involvement
of the global community, including universities, zoos, industry, governments, non-
governmental organizations (NGOs) and citizens, is the most efficient approach that holds
promise to improve a sustainable One health. 5
Unfortunately, structural separation between jurisdictions, as well as a historical lack of
collaboration between human health and veterinary medicine disciplines, has severely limited
the identification of solutions to global health problems and the implementation of appropriate
interventions.8 Furthermore, the limited awareness of the role that wildlife and the
environment play in the transmission and emergence of infectious diseases of all animals,
including people, has just begun to be remedied with the One Health Approach, but
 284

stakeholders in these under-represented areas have only recently been included in the
discussions. 8
In this commentary/article, we present an example of a One Health Initiative developed in
rural communities that live in or near natural protected areas of the Atlantic Forest, Brazil.
Focusing on the impact of vector-borne diseases for wildlife and humans (such as Zika,
Chikungunya, Dengue and Yellow-fever) and conservation of biodiversity, we present a
working model for building networks among local and international health, conservation and
educational professionals, involving the local population.

Overview of arboviruses outbreaks in Brazil

At least nine pathogenic arboviruses were found circulating in human populations in Brazil
over the last years, including those responsible for the epidemics caused by Zika (ZIKV),
chikungunya (CHIKV), dengue (DENV) and yellow-fever (YFV) viruses. 9 Brazil has been a
hotspot for these viruses and became a Public Health Emergency of International Concern
(PHEIC) in 2016, according to the World Health Organization.10 The most recent outbreak of
Yellow-fever, in 2017, already had 642 confirmed cases in humans and more than 792
epizootic cases involving neotropical monkeys.11 We hypothesize that this hotspot category is
likely due to a combination of factors. First, Brazil has the greatest number of vertebrates that
may serve as potential hosts, invertebrates that function as disease vectors 12,13, and the
highest diversity of arboviruses in the world. 14,15 Second, Brazil has the second highest level
of deforestation in the world 16 and a high level of illegal wild animal trafficking 17, both of
which increase contact between wildlife, humans, and vectors, resulting in the potential to
trigger disease spillover and outbreaks. 18,19 Thirty, Brazil has hosted a large number of
tourists in the past few years and particularly during the major sport events of 2014 and 2016,
which has facilitated the arrival of exotic viruses such as chikungunya and Zika and promoted
the co-circulation of these with others arboviruses such as dengue. 9,10 In addition, the country
is located in a tropical zone and suffers with the climate change; allowing the growth
populational and expansion of areas of the mosquitoes.20 And the last, but not less important,
although being the 7th richest economy in the word, Brazil presents 2nd highest social
inequality, with less than 9% of our GNP going to Health, Environmental and Education
programs. All these factors create a challenge and demand considerable efforts, strategies and
initiatives to minimize or prevent arbovirus outbreaks. 21
 285

One Health Initiative in Bahia, Brazil

One Health Initiatives promote integrated research, surveillance, and control programs and
policy frameworks. Given the transboundary nature of people, pathogens, and ecosystems,
One Health collaborative partnerships have been set up around the world. 7
The One Health Initiative presented in this study started in 2005, in the South of Bahia State,
Brazil, in the municipalities of Una and Ilhéus , within the area of the Atlantic Forest, a
tropical lowland forest. 22 The Southern Bahia Atlantic Forest has high levels of species
richness and endemism, particularly in the Una Biological Reserve and its Buffer Zone, the
Una Biological Wildlife Refuge (Faria et al, 2007). The remaining forest is highly
fragmented, and embedded within an agricultural matrix of cacao plantations, mainly grown
in agroforests 13,22,23, and other agricultural activities in rural communities. The main form of
subsistence of the human population is small family-based agriculture, and particularly people
in rural communities have poor access to basic infrastructure, such as electricity, potable
water, sanitation and health care. 24
Ecological studies with the flora and fauna and environmental education strategies have been
done by local universities, zoos, enviromental services and non-profit organizations.24–26 In
partnership with these ecological studies, a research project was created to evaluate the health
conditions and the circulation of pathogens in free-living monkeys (Sapajus xanthosthernos
and Leontopithecus chrysomelas) and sloths (Bradypus torquatus). The pathogens selected for
studies on wildlife were based on the main zoonotic diseases found in domestic animals and
the human population present in the region: arboviruses, leptospirosis, leishmaniosis and
trypanosomiasis. As we found a high overall serum prevalence of arbovirus and
trypanosomiasis in the wild animals 26 living close to the rural communities, we began to
incorporate outreach activities with the stakeholders focusing on environmental and health
education. We measured our results assessing the impact of our activities by simultaneously
investigating the medical, ecological, socioeconomic, and policy issues driving the system.
The summary of the “One Health Initiative” activities are showed in the Table 1.

Key elements to build successful networks

The key elements for enhancing the networks during the One Health Initiative included (1)
develop trust, strengthen collaborations and partnerships among local and international
organizations, universities, and government agencies, including the health and environmental
 286

services; (2) organize meetings, workshops and training to empower local groups to assume
leadership and sustain programs in the longer term 27; (3) promote entomological survey,
interview and blood collection in individuals from the rural communities that lived closed to
the place where the wild animals were sampled (Figure 1a); and (4) organize educational
material for and with the stakeholders, including activities in the schools of the rural
communities (Figure 1 b,c,d and Figure 2).

Developing trust, strengthening collaborations and partnerships to get health

Culture reflects a group's values, beliefs, norms, practices, patterns of communication,
familial roles, and other social regularities 28. It has an influence on how people seek and
respond to healthcare information, their perception of the cause and nature of disease, what
they regard as a health problem, and their attitude toward healthcare providers and treatment.
It is needed to understand and appreciate the cultural differences between different
populations and integrate this knowledge into the expectation of the
program/research/initiative being created 28. In our experience, the respect of local customs,
establishment of community partnerships, and involvement of local partners for all decision-
making helped us to develop trust and good communication. The decisions we took to build
trust varied from simple initiatives, as choice of local venues as the place for meetings,
selection of the leaders that will be part of specific training activities to the choice of the
people that would be best fit to make contact during the visit of the communities. The local
partners, such as the health e environmental services, also helped us with the logistic to arrive
to the rural communities, offering cars, drivers and people from their team (nurses, field
assistants, field researchers and forest rangers) to follow us. By respecting local customs and
knowledge, we are more likely to become part of the community context.
Long-term partnerships have been established among the “One health Initiative”project and
Santa Cruz State University, Piauí State Federal University, Paulista State University
(Unesp/Botucatu), Project BioBrasil from Centre for Research and Conservation/Antwerp
Zoo (Belgium), Institute for Conservation Medicine at Saint Louis Zoo (ICM-USA), Bicho do
Mato Instituto de Pesquisa, Instituto de Estudos Socioambientais do Sul da Bahia (IESB),
Ilheus and Una Health Services, Salvador Central State Laboratory, Evandro Chagas Institute,
Una Biological Reserve, Wildlife Refuge and all the rural communities involved. The
universities performed part of the lab tests, organized meeting and received training about
zoonotic diseases and arboviruses. The Evandro Chagas Institute performed the arboviruses
diagnostic in wildlife, human population and arthropods. The other partners got involved on
 287

the trainings, round table meetings and help us with the logistic of the activities in the rural
communities (Table 1).

Organizing meeting, workshops and training activities

The meetings always combined health and conservation discussions (Table 1). We provided
updated information from the research on arbovirus and entomology, about preventive
measures against arboviruses and the other diseases studied, the risk factors associated with
these diseases and explained about the importance of maintaining forest fragments and protect
the fauna as means of preventing transmission of zoonotic diseases in rural populations. We
also provided information from ecological studies, highlighting the importance of wildlife for
the health of the environment where the communities lived, given that animals provide
services as pollinators, seed dispersers, predators of insects, etc. At the end of the meetings we
discussed the challenges to improve the specific health and conservation issue that was
discussed that day and who, how and when the next activities would happen to mitigate the
problem. For example, the Ilhéus Health Services recognized during one of the meetings that
the low dengue viral detection in patients could be associated with the low number of nurses
available to collect the samples at the health clinic, and not because of the absence of cases.
Since then, the Health Services have trained more nurses to improve the dengue surveillance.
Specific trainings were also performed before and during the Brazilian yellow-fever outbreak
to improve the regional and local Epizootic Surveillance. Workshops have been developed to
provide advanced training to healthcare providers. The local health institutions responsible for
receiving dead monkeys and collecting biological samples for diagnostics of arboviruses
received specific training about biosecurity and material, including protective clothing, to
improve the quality of the sample processing and guaranteeing health security. Park guards
and MSc and PhD candidate students that used to be more often in the field were also trained
to collect and storage adequately dead monkeys. A campaign into the rural communities
using round table in public centers were also organized to alert the population about the
importance of the monkeys as sentinels of the yellow-fever disease and not to kill the animals.
Through these efforts these meetings have helped build a larger community awareness of the
abilities and potential contribution of each individual. They have learned from each other,
valuing each other’s expertise. This professional interaction established local professionals as
valued partners, reinforcing their ability to carry out community initiatives 4.
 288

Entomological survey and blood sampling

After starting the meetings with all partnerships, one of the first decision was to include into
the regular schedule of the local entomological services, an entomofauna survey in all areas
where the wild animals were sampled. The main goal was identifying the hematophagous
insects that could transmit diseases, besides studies in abundance and richness of vectors and
evaluate if these vectors were infected with some arbovirus. The mosquitoes sampled were
stored at -70o C at the local university and then, air-shipped for state and federal health
diagnostics laboratory.
The local and federal health service also decided to lead a campaign in the rural communities
to blood collection, evaluating the circulation of arbovirus (Figure 1a). To survey the human
population, a large network was formed, involving government, NGOs, local leaders, guard
parks, field assistants from the ecological studies, universities, besides of the health and
environmental services. In 13 days a total of 11 communities were visited and 523 samples
were collected. This massive campaign in the rural communities was only possible because of
the trust of the population in our initiative and because of the strong network created earlier.

Organizing educational material and open-ended exploration activities

This project not only addresses response but also prevention of arbovirus viruses. We
incorporated distribution of educational materials and school visits to help spread awareness
of arboviruses, their transmission, and methods of vector control. In order to accomplish this
task, we had to consider the culture of the community to determine the best means to
communicate these messages so the information could be received clearly and effectively.

Rural communities and Health and Environmental services public

Educational materials about One Health approach were prepared and distributed for the rural
communities, park guards and employees working at environmental services, and local health
agents and employees of the health services. The first material was entitled “The Forest that
protects you”; contained information about the present project addition and provide children’s
worksheet (Figure 1a,b and Figure S1) and were distributed during the blood sampling
campaign. The text emphasized preventive measures for rural communities that live or work
near the forest or plantations and how to avoid the transmission foci of peri-urban and rural
mosquitos. Using the holistic view of One Health, the main message integrated elements
about the importance of maintaining of fragments of forest and biodiversity close to their
houses as a protective barrier against arbovirus, following the dilution effect concept.29.Blood
 289

was collected from people of various ages so the material we distributed targeted different age
groups. The material included a text for adults, and a series of colourful card of lion tamarins
an endemic specie of the region- for children and crosswords about the theme for teenagers
(Figure 1a,b and Figure S1b). This material intended to inform the population about sylvatic
arboviruses, besides of the urban dengue, zika and chikungunya viruses.
The following educational flyer was prepared to talk about sylvatic and rural species of
mosquitoes (Figure S2). It emphasized the huge diversity of arthropods in the world and their
potential to transmit diseases. The flyer also reported about preventive measures to avoid
mosquito bites and reduce potential breeding grounds of arthropods. The material was
delivered while the blood tests results were returned to the communities. Furthermore,
information about dengue, yellow fever, Mayaro and Oropouche fever designed by the
Brazilian National Reference Laboratory for Arboviruses, the Evandro Chagas Institute, were
carried out for the rural communities and health and environmental services during the round
tables and meetings in 2017. The continuing education strategies aimed at developing
mechanisms that appeal to and sensitize every household and community to adopt effective
habits and practices 30 to reduce the risk of transmission of arboviruses.

Schools
A total of seven schools were visited at least one time, totaling over 500 hundred students.
The schools were from the rural communities Colônia de Una, Lagoa Encantada,
Assentamento Dilma Roussef, Castelo Novo and Ribeira das Pedras. Most of the schools had
multi-age classes with students ranging from ages 5 -15. All the schools were located inside
the villages where agriculture and the cocoa agroforestry system are the main subsistence
(Figure 2c). Due to the great variation of age range among the students, the approach used
varied a little, but all the planned activities were performed.
In the schools we organized a “Science Station Day” (Figure 1 c,d). In this visit, younger
students could learn about the concept of science and epidemiology through story-telling.
Furthermore, a DVM researcher, that worked on both the field surveys and in the laboratory
visited the schools and showed the traps and strategies to collect insects in the field. Older
students gained a laboratory perspective by using a magnifying glass, vectors that transmit the
main arboviruses in that region, and sandflies that transmit leishmaniosis. The researcher also
provided an open discussion about preventive measures and the importance of fauna for the
 290

health of the human population, animals and environment. Taking the holistic approach of
One Health, a PhD researcher, biologist, working on evaluating the biodiversity of mammals
in that region talked about the importance of the biodiversity for the health of the ecosystem
(i.e. pollinators, seed dispersers, predators, control of insects, food web) and presented
pictures of mammals taken on the field by camera traps. Students were able to investigate a
camera trap and understand how this tool works.
One of the schools from Colônia de Una already had an environmental project organized in
partnership by the Belgium zoo. This school was visited two more times to evaluate the
awareness of our outreach activities. This school had six classrooms and students ranged in
age from 5-15 years of age. After the ‘Science Station Day”, students were asked to write
about what they had learned that day (Figure 2c). Most of the statements emphasized the
main outreach message: preventive measures against arboviruses and other vector borne
diseases, the importance of protecting the nature for the world health, besides of the insertion
of epidemiological concepts (life cicle, vector, transmission of diseases, hosts) and the
responsibility of each one for a better sustainable health life (Box 1). Ten days later students
were invited to play two board games that highlight Yellow-fever, dengue and preventive
measures. One week later, students designed a local newspaper to tell their own community
what they had learned (Figure 2d). The materials created by the students were distributed to
the rural communities and the other stakeholders that made part of this “One Health
Initiative”.

Lessons Learned for Planning One Health Projects and Interventions

Global efforts have focused on improving health and well-being of individuals in developing
countries and often have involved multinational collaborations to meet the needs of all
citizens of the world. 4,27 One Health is strengthened by building partnerships.8 Making One
health communication programs work requires both the active participation of affected
individuals and communities in the creation of health communication interventions and the
consideration of culture in message development.31
The initiative developed in the rural communities of Southern Bahia can be considered an
example of how to provide a dialogical exchange strategy to improve actions, as preventive
measures of emerging infectious diseases and the awareness about the connection of health of
the environment with animals and human population health at regional and local levels. The
actions of education carried out in the school level, demonstrated effectiveness in the
acquisition of knowledge by adolescents, although other schools should be evaluated.
 291

Continuing meeting and training should be organized by the local partners to reinforce the
framework already created. The Biobrasil project maintain a weekly meeting with the local
farmers and the education staff from the Colônia de Una school. We suggest the inclusion of
the health community agents in these meetings to integrate different views and approaches.
The material produced down through this experience offers a rich source of documents that
merit the attention of professionals in such areas as education, communication, information,
public health, history, and scientific educational outreach.
And finally, with this momentum, what can we do to ensure our research finds actionable use
toward a ‘future health’ that we want for our planet? 31 We encourage our community to
collectively stretch the boundaries of what we consider research, exploring non-traditional
research partnerships and mechanisms for policy and other societal application.31

Acknowledgement
All of the procedures complied with legal requirements as set by the Environmental Services
SISBIO permits n° 11885-1, 113/2007, 23069-2, 15025-1, 12787-1, 12787-3, 12787-4,
23457-4, 23457-5, 45513-1 (L.S.C.) and by the Animal Welfare Committee of Evandro
Chagas Institute, under n°26/2014 and 27/2014. The research protocol was analyzed and
approved by the Research Ethics Committee for Experimentation in Human Beings (under
number 35073014.3.0000.0019) and the CEUA (under number 33/2014) at the Evandro
Chagas Institute.
Conflicts of interest: none

References
1. Kelly TR, Karesh WB, Johnson CK, Gilardi KVK, Anthony SJ, Goldstein T, et al. One
Health proof of concept: Bringing a transdisciplinary approach to surveillance for zoonotic
viruses at the human-wild animal interface. Prev Vet Med. 2017 Feb 1;137, Part B:112–8.
2. Salvador FS, Fujita DM. Entry routes for Zika virus in Brazil after 2014 world cup: New
possibilities. Travel Med Infect Dis. 2016 Jan 1;14(1):49–51.
3. Dou X, Lyu Y, Jiang Y, Tian L, Li X, Lin C, et al. Seroprevalence of Lyme disease and
associated risk factors in rural population of Beijing. Int J Clin Exp Med. 2015;8(5):7995–9.
4. Cech DJ, Alvarado ZJ. Collaborating with Communities and Higher Education to
Address the Health-care Needs of Individuals with Disabilities in Ecuador. Front Public
Health. 2017;5:91.
5. Conrad PA, Mazet JA, Clifford D, Scott C, Wilkes M. Evolution of a transdisciplinary
“One Medicine-One Health” approach to global health education at the University of
California, Davis. Prev Vet Med. 2009 Dec 1;92(4):268–74.
6. Albuquerque, da Rocha MM, Oliveira RB. A Comunicação em Áreas de Proteção
Ambiental – o caso da APA da Lagoa Encantada, em Ilhéus. In Santos; p. 15.
 292

7. Baum SE, Machalaba C, Daszak P, Salerno RH, Karesh WB. Evaluating one health: Are
we demonstrating effectiveness? One Health. 2017 Jun 1;3:5–10.
8. Mazet J a. K, Uhart MM, Keyyu JD. Stakeholders in One Health. Rev Sci Tech Int Off
Epizoot. 2014 Aug;33(2):443–52.
9. Figueiredo LTM, Figueiredo LTM. The recent arbovirus disease epidemic in Brazil. Rev
Soc Bras Med Trop. 2015 Jun;48(3):233–4.
10. Faria NR, Azevedo R do S da S, Kraemer MUG, Souza R, Cunha MS, Hill SC, et al. Zika
virus in the Americas: Early epidemiological and genetic findings. Science. 2016 Apr
15;352(6283):345–9.
11. Brasil. Boletim Informativo de Febre Amarela. Brasília,DF: Minstério da Saúde; 2017
p. 1–7.
12. Fragoso-Moura EN, Oporto LT, Maia-Barbosa PM, Barbosa F a. R, Fragoso-Moura EN,
Oporto LT, et al. Loss of biodiversity in a conservation unit of the Brazilian Atlantic Forest:
the effect of introducing non-native fish species. Braz J Biol. 2016 Feb;76(1):18–27.
13. Cassano CR, Schroth G, Faria D, Delabie JHC, Bede L. Landscape and farm scale
management to enhance biodiversity conservation in the cocoa producing region of
southern Bahia, Brazil. Biodivers Conserv. 2009 Mar 1;18(3):577–603.
14. Monath TP, Vasconcelos PFC. Yellow fever. J Clin Virol. 2015 Mar 1;64:160–73.
15. Vasconcelos PFC, Rosa T da, A AP, Rodrigues SG, Rosa T da, S E, et al. Inadequate
management of natural ecosystem in the Brazilian Amazon region results in the emergence
and reemergence of arboviruses. Cad Saúde Pública. 2001;17:S155–64.
16. Food and Agriculture Organization of the United Nations. GLOBAL FOREST
RESOURCES ASSESSMENT 2015 How are the world’s forests changing? 2016.
17. Levacov D. LEVANTAMENTO DOS PRIMATAS RECEBIDOS EM CENTROS DE TRIAGEM E
SUA RELAÇÃO COM O TRÁFICO DE ANIMAIS SILVESTRES NO BRASIL. [cited 2017 Mar 1];
Available from:
http://www.academia.edu/14749194/LEVANTAMENTO_DOS_PRIMATAS_RECEBIDOS_EM_C
ENTROS_DE_TRIAGEM_E_SUA_RELA%C3%87%C3%83O_COM_O_TR%C3%81FICO_DE_ANIM
AIS_SILVESTRES_NO_BRASIL
18. Weaver SC, Reisen WK. Present and future arboviral threats. Antiviral Res. 2010
Feb;85(2):328–45.
19. Zell R, Krumbholz A, Wutzler P. Impact of global warming on viral diseases: what is
the evidence? Curr Opin Biotechnol. 2008 Dec;19(6):652–60.
20. Zell R. Global climate change and the emergence/re-emergence of infectious
diseases. Int J Med Microbiol IJMM. 2004 Apr;293 Suppl 37:16–26.
21. WHO. Weekly epidemiological record. World Health Organization; 2017 Apr p. 12.
Report No.: Eliminate Yellow fever Epidemics (EYE): a global strategy, 2017–2026.
22. Cassano CR, Silva RM, Mariano-Neto E, Schroth G, Faria D. Bat and bird exclusion but
not shade cover influence arthropod abundance and cocoa leaf consumption in agroforestry
landscape in northeast Brazil. Agric Ecosyst Environ. 2016 Sep 16;232:247–53.
23. Cassano CR, Kierulff MCM, Chiarello AG. The cacao agroforests of the Brazilian
Atlantic forest as habitat for the endangered maned sloth Bradypus torquatus. Mamm Biol -
Z Für Säugetierkd. 2011 May;76(3):243–50.
24. Sollberg I, Schiavetti A, Moraes MEB. Agricultural management in the una’s wildlife
refuge: a perspective of conservation by agroforestry. Rev Árvore. 2014 Apr;38(2):241–50.
 293

25. Cassano CR, Barlow J, Pardini R. Forest loss or management intensification?

Identifying causes of mammal decline in cacao agroforests. Biol Conserv. 2014 Jan;169:14–
22.
26. Catenacci LS, Pessoa MS, Nogueira-Filho SLG, Vleeschouwer KMD. Diet and Feeding
Behavior of Leontopithecus chrysomelas (Callitrichidae) in Degraded Areas of the Atlantic
Forest of South-Bahia, Brazil. Int J Primatol. 2016 Apr 1;37(2):136–57.
27. Hangulu L, Akintola O. Perspectives of policy-makers and stakeholders about health
care waste management in community-based care in South Africa: a qualitative study. BMC
Health Serv Res. 2017 Apr 19;17(1):290.
28. Okoro ON, Odedina FT, Reams RR, Smith WT. Clinical cultural competency and
knowledge of health disparities among pharmacy students. Am J Pharm Educ. 2012 Apr
10;76(3):40.
29. Tran A, L’Ambert G, Balança G, Pradier S, Grosbois V, Balenghien T, et al. An
Integrative Eco-Epidemiological Analysis of West Nile Virus Transmission. EcoHealth. 2017
Jun 5;
30. Thomas SB, Fine MJ, Ibrahim SA. Health Disparities: The Importance of Culture and
Health Communication. Am J Public Health. 2004 Dec;94(12):2050.
31. Machalaba CC, Daszak P, Karesh WB, Shrivastava P. Future Earth and EcoHealth: A
New Paradigm Toward Global Sustainability and Health. EcoHealth. 2015 Dec 1;12(4):553–4.
 294

Box 1: Student’s highlight thoughts wrote as homework one day after the ‘Station Science Day”
in the Colônia de Una school, Bahia, Brazil.
"I thought the monkey was already born with this disease (yellow fever), but no, it is the infected mosquito that
stings the monkey… The class was a lot of fun.” (LSA, 7th grade)

"I learned that mosquito bites can be very bad for humans. And for not be stung we should go to the plantations
dressing long sleeves, pants and shoes." (ANS, 8th grade)

"Una city and Colônia de Una vilage: we will fight for health and nature" (JDN, 8th grade)

"When you find a dead monkey or animal, do not touch it… Call Immediately for the Una Health Service"

"Let's take care of animals, because animals take care of nature. And we will take care of nature because it will
avoid animals from entering the cities, including the Haemagogus (yellow fever mosquito). "

"I think if we all took the (yellow fever) vaccine it would be better for people." (AP)

"I learned in science class on April 12, 2017 that the Aedes aegypti mosquito transmits Dengue, Chikungunya
and Zika ... that if the monkey is stung he may die. And if you found a dead monkey where we use to walk, it's a
sign that the yellow fever virus is around.” (TNS, 8th grade)

"When we cut/deforested the trees, mosquitoes come to our homes."

"If a monkey dies where you usually walk or where you live, it's because they already have this disease (yellow
fever). Because they can’t protect themselves from the mosquito bite, but you have to protect yourself by
wearing long sleeves, paints and protecting your face.” (GS, 7th grade)

"I understood that it can’t deforest the forest, we have to protect ourselves from mosquitoes and the best thing to
prevent yellow fever is taking the vaccine." (BSS, 6th grade)

"The disease (arboviruses) is not transmitted by the monkeys; he and other animals are victims like us." (ISS)

"This disease (yellow fever) has in the rural area and the local people have to be very careful. Avoiding standing
water and also containers with water without lid. This is very important for everyone's health. " (AL)

"Both dengue and yellow fever are arboviruses. But dengue is more common in cities and yellow fever in rural
areas. The best and most effective way to prevent the vaccination (for yellow fever), besides of using repellent
and mosquito netting. "(RSJ)

"People are killing the monkeys but the animals are innocent…. Take care of our life, please. " (AND)

"It's not the monkey's fault but the transmitter's fault." (CHOS, 9th grade)

"Almost everyone does not know, but the monkeys are innocent. We are the guilty. And you know why?
Because we leave standing water in every part of the world and we are not very careful. And the mosquito is
breeding in the water." (ACNA, 7th year)

"Today I learned something different, which was the respect for nature. Is it okay what we have been doing:
deforesting and polluting the rivers? No, and we only think of ourselves. Could the world sustain without rivers
and woods? Without birds and other animals? To begin with, mosquitoes would start to arrive in our homes.
Through a small animal (the mosquitoes), they can transmit Dengue, Chikungunya, Yellow Fever and Zika virus
and we can have the dangerous microencephaly. But we can avoid it. And how? Do not pollute rivers and
preventive measures, such as wearing long sleeves, paints and repellents before goes to the forest. Is there other
way to avoid this transmission? Yes. Do not deforest." (CHOS, 9th grade)
 295

Figure 1- Activities developed during the One Health Initiative in rural communities of Bahia,
Brazil. (a) collecting blood samples for the arbovirus surveillance; (b) Educational activities at
schools during the “Science Station Day”; (c)Building of one of the elementary and middle
school visited; (d) Group of students during the end of the activities of the “Science Station
Day”
 296

Figure 2: Educational material developed in Bahia, Brazil. (a, b) work sheets activities
distributed for the stakeholders; (c) student’s writing after the “Science Station Day”; (d)
brochure elaborated by the students to be distributed for the rural communities.
 297

Figure S1- Educational material distributed for the stakeholders in Bahia Brazil. (A) Cross
words; (B)Colourfull
 298

Figure S2- Educational material about mosquitoes distributed for the stakeholders in Bahia
Brazil.

Table 1. Summary of One Health interventions by simultaneously investigating the medical, ecological, socioeconomic, and policy issues driving
the system in rural communities in Southern Bahia, Brazil (adapted from Mazet et al, 2010)
SYSTEM
OBJECTIVE
DRIVERS
Assess wildlife for zoonotic pathogens and disease including
Lepstospirosis, Leishmaniosis, Tripanossomiasis,
Microfilarias, Toxoplasmosis, Retrovirus, Helminthísases
and Arboviruses.
MEDICAL Assess human for zoonotic pathogens, including arboviruses
Evaluate rural communities’ perceptions about disease
impacts and risk of transmission from animals and vectors.
Introduce new diagnostic techniques for disease detection
Train stakeholders of ALL education levels about One
Health approach
EDUCATION
Introduce new educational material to talke about
conservation of biodiversity, health and vectors
ECOLOGICAL Assess wildlife population health and demography
299
ACTIVITIES
• 250 wildlife samples tested
• 523 blood samples tested
• 523 surveys in the rural communities estimating disease impacts and examining
transmission risk factors
• Validating three rapid molecular detection of arbovirus in wildlife and arthropods
samples using universal primers
• Community outreach to over 800 local people
• Visiting at least one school from each community sampled, raising over 3 students
• Training for 10 park rangers
• Training for 50 medical technicians
• Training for 25 graduate students in animal and biological sciences
• Partnership with at least five extern local projects
• Three PhD dissertations and 4 undergraduate scholarships
• Training for five local vets
• Lectures for over 500 graduate students in two local universities
• Lectures for over 200 people from the federal, regional and local health and
environmental services
• Lectures in two international zoos (Antwerp, Belgium and Saint Louis, USA)
• Created one board game in partnership with local NGOs, Zoos and the Brazilian
National Reference Lab Evandro Chagas Institute (IEC)
• Created two educational flyers in partnership with local NGOs, Zoos and IEC
• Created a colourful card with local NGOs, Zoos and the IEC
• Created an educational flyer in partnership with the students from the communities
visited, the local university and Zoos
• Distributed five educational flyers elaborated by the IEC
• Surveys in association with Zoos, and the local ecologic projects

Assess potential vectors population and ecology patterns
Examine landscape-level risk factors for disease
SOCIO- Evaluate human disease impacts and the presence of
ECONOMIC fragment of forest on livelihoods of local communities
Develop new health and environmental policy interventions
to mitigate the impacts of zoonotic diseases
POLICY
Raise awareness about the links among health, livelihoods,
and natural resources
300
• Reports on hematological values for the endemic sloth Bradypus torquatus
• Reports on methods of capture and collection of biological material in non-human
primates
• Over 7500 arthropods captured
• Integration of spatial and vegetation data on wildlife, vectors and human density and
land use regimes
• 523 surveys examining economic risk factors
• Village stakeholder workshops
• Surveys in association with local projects
• Strong partnerships with local governments, health and environment ministries, and
policy and education NGOs
• Integrative modeling
• Active participation in stakeholder meetings, international conferences, and ministry
presentations
• Public outreach through social media, radio programs, educational flyers
 301

ANEXOS
 302

ANEXO A - Parecer consubstanciado do CEP

PARECER CONSUBSTANCIADO DO CEP

DADOS DO PROJETO DE PESQUISA

Título da Pesquisa: PREVALÊNCIA DE ARBOVIROSES EM HUMANOS NO SUL DA

BAHIA Pesquisador: Lilian Silva Catenacci Área Temática:
Versão: 2
CAAE: 35073014.3.0000.0019
Instituição Proponente: Instituto Evandro Chagas/SVS/MS
Patrocinador Principal: Instituto Evandro Chagas/SVS/MS

DADOS DO PARECER

Número do Parecer:
794.555

Data da Relatoria:
17/09/2014
Situação do Parecer:
Aprovado
Necessita Apreciação
da CONEP: Não
Considerações Finais
a critério do CEP:
Conforme Res. CNS
466/12, a
responsabilidade do
pesquisador é indelegável
e indeclinável e
compreende os aspectos
éticos e legais da
pesquisa. Nesse sentido,
ressaltamos as seguintes
atribuições do
pesquisador:
 303

- Apresentar o protocolo devidamente instruído ao CEP ou à CONEP, aguardando a decisão de

aprovação ética, antes de iniciar a pesquisa;
- Desenvolver o projeto conforme delineado;
- Elaborar e apresentar os relatórios parcial (is) e final;
- Apresentar dados solicitados pelo CEP ou pela CONEP a qualquer momento;
- Manter os dados da pesquisa em arquivo, físico ou digital, sob sua guarda responsabilidade,
por um período de 5 (cinco) anos após o término da pesquisa;
- Encaminhar os resultados da pesquisa para publicação, com os devidos créditos aos
pesquisadores associados e ao pessoal técnico integrante do projeto; e
- Justificar fundamentadamente, perante o CEP ou a CONEP, interrupção do projeto ou a não
publicação dos resultados.

ANANINDEUA, 17 de setembro de 2014.

Edvaldo Carlos Brito Loureiro

 304

ANEXO B – Parecer CEUA- Projeto com coleta de amostras em seres humanos

 305

ANEXO C – Parecer CEUA- Projeto com coleta de amostras em animais

 306

ANEXO D – Termo de consentimento livre e esclarecido (prospectivo)

PROJETO DE PESQUISA: Prevalência Arboviroses em Humanos no Sul Da Bahia

Eu, ______________________________________________ com ______ anos,

filho(a) de ________________________________________________, de ______ anos fui
procurado(a) pela pesquisadora Lilian Silva Catenacci SIAPE no1772562, investigadora
principal do projeto “Prevalência Arboviroses em Humanos no Sul da Bahia”, ou pelo
enfermeiro Carlos Alex Magalhães de Jesus, oportunidade em que fui informado sobre os
objetivos da pesquisa. Compreendi que o objetivo principal desta pesquisa é realizar exames
laboratoriais para pesquisa de arboviroses tanto em pacientes com suspeitas de dengue, que
apresentaram resultados laboratoriais negativos de dengue, quanto para pertencentes ao
grupo familiar sem sintomatologia clínica febril das seguintes comunidades: Fazenda Santa
Rita, Fazenda Almada, Assentamento Bonfim, Bairro Castelo Novo, Ribeirão das Pedras,
Lagoa Encantada (Ilhéus, BA) e Entorno da Reserva Biológica de Una, do Refúgio de Vida
Silvestre e Bairro Colônia de Una (Una, Bahia). O projeto será realizado em um ano e serei
acompanhado por aproximadamente três meses, no caso de ser paciente febril ou por seis
meses, no caso de estudo nas comunidades. Segundo as informações prestadas, a pesquisa
consta de levantamento de meus dados pessoais, bem como de informações acerca de febre
e outros sintomas, seguido da colheita de 5-10 ml (aproximadamente 1 colher de sopa) do
meu sangue. Todo o procedimento de colheita do sangue será realizado com material estéril
e descartável e estará sob responsabilidade do enfermeiro Carlos Alex Magalhães de Jesus
ou de qualquer outro enfermeiro devidamente identificado, que pertença ao quadro de
servidores das Equipes de Vigilância Epidemiológica de Ilhéus ou Una. Informo ainda que
concordo em permitir o uso das alíquotas de soro ou sangue que restarem deste projeto para
futuras pesquisas científicas, desde que tenha sempre aprovação do comitê de ética para
humanos.
Está claro que eu posso não querer participar desta pesquisa, e isso não causará mal,
nem a mim nem a minha família. Também foi dito que não receberei nenhum pagamento
por participar. Se eu participar, também tenho o direito de desistir a qualquer momento, sem
nenhum problema ou prejuízo. Fui esclarecido que caso deseje, terei o direito de saber os
resultados dos exames realizados e que em caso de dano pessoal diretamente causado pelos
procedimentos propostos nesse estudo (nexo causal comprovado), terei direito a atendimento
médico. Foi garantido também que as informações dadas ao projeto são secretas, e que a
ninguém será informado o meu nome, ou de meus familiares, como participantes da
pesquisa. Fiquei ciente que caso tenha alguma reclamação a fazer, deverei procurar a
investigadora principal do projeto ou outro membro da equipe que consta listado no projeto
(91)3214-2290 e fax 3214-2299 em Ananindeua/Pará ou se tiver alguma consideração ou
dúvida sobre a ética da pesquisa, devo entrar em contato como Comitê de Ética em Pesquisa
do IEC (CEP) – Rodovia BR316, Km 7, S/N, Bairro Levilândia Ananindeua/Pará,
Fone/FAX: 3214-2237; E-mail: seac@iec.pa.gov.br. Se necessário mais informação, posso
também entrar em contato com o enfermeiro que me atendeu, pertencente a Equipe de
Vigilância Epidemiológica de Ilhéus ou Una, através do telefone (73)91430734.

Compreendido tudo isso autorizo a colheita e realização de exames em meu sangue

ou sangue do menor sob minha responsabilidade, isto é, aquele (s) maior (es) de vinte e
quatro meses e menor (es) de dezoito anos de idade (incluído o nome abaixo, quando
pertinente). A equipe ainda me informou que os menores de idade acima citados podem não
querer participar do estudo, e que nesse caso vale a vontade deles sobre a minha.
 307

-----------------------------------------------------
Assinatura do paciente/ Representante Legal Data ___/ ___/ ___

------------------------------------------------------
Nome do pacientes menores de 18 anos, analfabetos, Data ___/ ___/___
semi analfabetos ou portadores de deficiência auditiva ou visual.

Analfabetos

Documento em duas vias Rubrica em todas as páginas do TCLE: sujeito de pesquisa ou seu responsável e o
pesquisador responsável
 308

ANEXO E – Termo de assentimento do menor

Você está sendo convidado para participar da pesquisa “Prevalência de arboviroses em

humanos no sul da Bahia”. Seus pais permitiram que você participe.Queremos saber se
podemos investigar quais vírus, como os da família da dengue, podem estar circulando na sua
comunidade. As crianças que irão participar dessa pesquisa têm de entre 2 e 18 anos de idade.
Você não precisa participar da pesquisa se não quiser, é um direito seu e não terá
nenhum problema se desistir.
A pesquisa será feita nas seguintes comunidades: Fazenda Santa Rita, Fazenda Almada,
Assentamento Bonfim, Bairro Castelo Novo, Ribeirão das Pedras, Lagoa Encantada (Ilhéus,
BA) e Entorno da Reserva Biológica de Una, do Refúgio de Vida Silvestre e Bairro Colônia de
Una (Una, Bahia), onde serão coletados das crianças por enfermeiros e técnicos da Vigilância
de Saúde de Ilhéus/Una ou do Instituto Evandro Chagas de 5-10ml de sangue (uma colher de
sopa). Para isso será usado seringa e agulha estéril e descartável e antes da coleta será feita
limpeza do local com algodão embebido no álcool. O uso destes materiais é considerado seguro,
mas é possível ocorrer dor discreta e causar choro durante a coleta de amostras sanguínea. Caso
aconteça algo errado, você pode nos procurar pelos telefones (91)3213-0439 ou (73) 91430734.
Você também poderá ser incluído na pesquisa caso tenha ido procurar o posto de saúde
e passou por atendimento médico por suspeita de dengue. Neste caso, somente os casos
negativos serão incluídos nesta pesquisa e, a depender do resultado anterior, você foi convidado
a realizar uma nova coleta de sangue.
Ninguém saberá que você está participando da pesquisa, não falaremos a outras pessoas, nem
daremos a estranhos as informações que você nos der. Os resultados da pesquisa vão ser
publicados, mas sem identificar os participantes da pesquisa. Antes de terminar a pesquisa você
receberá os resultados a serem entregues pela Secretaria de Vigilância no Posto de Saúde mais
próximo da sua casa.
Se você tiver alguma dúvida, você pode me perguntar ou ao pesquisador/a Carlos Alex
Magalhães de Jesus. Eu escrevi os telefones na parte acima desse texto.
Eu ___________________________________ aceito participar da pesquisa “Prevalência de
arboviroses em humanos no sul da Bahia” que tem como objetivo investigar quais os vírus,
como os da família da dengue, podem estar circulando na minha comunidade. Entendi que
posso dizer “sim” e participar, mas que, a qualquer momento, posso dizer “não” e desistir que
ninguém vai ficar furioso. Os pesquisadores tiraram minhas dúvidas e conversaram com os
 309

meus responsáveis. Recebi uma cópia deste termo de assentimento e li e concordo em participar
da pesquisa.
Ilhéus, ____de _________de __________.
________________________________ _______________________________
Assinatura do menor Lilian S. Catenacci – Coord. Pesquisa