EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007 1.

(Unicamp 2005) Em 25 de abril de 1953, um estudo de uma única página na revista inglesa Nature intitulado "A estrutura molecular dos ácidos nucléicos", quase ignorado de início, revolucionou para sempre todas as ciências da vida sejam elas do homem, rato, planta ou bactéria. James Watson e Francis Crick descobriram a estrutura do DNA, que permitiu posteriormente decifrar o código genético determinante para a síntese protéica. a) Watson e Crick demonstraram que a estrutura do DNA se assemelha a uma escada retorcida. Explique a que correspondem os "corrimãos" e os "degraus" dessa escada. b) Que relação existe entre DNA, RNA e síntese protéica? c) Como podemos diferenciar duas proteínas? 2. (Fuvest 96) Uma doença genética de herança dominante é causada por mutações em um gene localizado em um autossomo. Os indivíduos A, B e C têm mutações em um segmento de DNA desse gene, cuja seqüência normal está representada a seguir. Usando a tabela que relaciona alguns codons aos respectivos aminoácidos e considerando que a fita molde a ser transcrita é aquela assinalada com a letra m, responda: a) Quais serão os segmentos de proteínas produzidos, respectivamente, pelos indivíduos A, B e C? b) Como será o fenótipo (normal ou afetado dos indivíduos A, B e C? Por quê? Seqüência normal CAA AAC TGA GGA ATG CAT TTC (m) GTT TTG ACT CCT TAC GTA AAG Indivíduo A CAA AAC TGA GGA ATT CAT TTC (m) GTT TTG ACT CCT TAA GTA AAG Indivíduo B CAT AAC TGA GGA ATG CAT TTC (m) GTA TTG ACT CCT TAC GTA AAG Indivíduo C CAA TAC TGA GGA ATG CAT TTC (m) GTT ATG ACT CCT TAC GTA AAG

ou do RNA-m correspondentes.GTG .CTG .CCT . pode afetar a saúde e a qualidade de vida do portador dessa mutação. Explique por quê. (Ufrj 99) Com o auxílio da tabela do código genético representada a seguir.GAG .GAG .ACT . a) Considere o segmento de DNA. a partir da seqüência de aminoácidos de uma proteína. Um gene é constituído por um número N de nucleotídeos que codifica uma proteína constituída por P aminoácidos. utilizando-se da tabela do código genético apresentada a seguir. (Ufg 2005) As globinas constituem um bom exemplo da importância da informação genética na estrutura primária e na função das proteínas. b) Utilize um exemplo de alteração estrutural da globina humana (cadeia beta) para explicar como uma mutação pontual. Entretanto. Por que sempre encontramos N > P ? 5. forneça o produto da síntese protéica (polipeptídio parte da cadeia beta prevista para a globina humana). do tipo substituição.3' e. isto é.CAC . o oposto não é verdadeiro.3. cuja seqüência de nucleotídeos é 5' . . 4.AAG . não se pode deduzir a seqüência de nucleotídeos do gene. é sempre possível deduzir-se a seqüência de aminoácidos de uma proteína a partir da seqüência de nucleotídeos do seu gene. (Ufrj 97) O ADN é um polímero constituído por vários nucleotídeos e as proteínas são polímeros constituídos por vários aminoácidos.

Explique a possibilidade da ocorrência dessas três proteínas nos seres de Zbohrnya. c) Se o gene de uma proteína respiratória de um organismo zbohrniano for introduzido numa bactéria terrestre. contendo códigos de trincas de bases do DNA com os aminoácidos correspondentes. 16 e 19 tipos diferentes de aminoácidos. qual seria o aminoácido da tabela a ser incorporado? c) Qual é anticódon correspondente ao novo aminoácido incorporado? . a proteína produzida pela expressão desse gene será idêntica à da espécie zbohrniana? Justifique sua resposta. b) Se ocorresse uma substituição. 7. Já o código genético desses organismos é determinado por códons de 2 bases.6. (Ufrn 2002) O DNA dos organismos do planeta Zbohrnya é constituído pelos mesmos 4 tipos de bases dos seres vivos terrestres. apresentam.5 bilhões de anos. 13. (Ufv 2000) Considere a tabela abaixo. faça uma comparação entre a diversidade dos organismos encontrados nesses dois planetas. para resolver os itens seguintes: a) Determine a seqüência de bases do RNAm que foi utilizado para sintetizar o polipeptídeo esquematizado abaixo da tabela. na 3 base do código correspondente ao 6Ž aminoácido do polipeptídeo. B e C. a) As proteínas A. b) Sabendo que a vida em Zbohrnya e na Terra existe há 3. encontradas nos organismos da Terra. por uma purina. respectivamente.

2004). protagonizaram a nossa história. A. alemães. c) Qual a seqüência de aminoácidos que resultará da tradução da molécula de RNA mensageiro? Ver figura anterior. b) Cite a seqüência do anticódon correspondente ao códon de iniciação. ainda hoje.GAC de um segmento de DNA. (Unifesp 2006) Uma fita de DNA tem a seguinte seqüência de bases 5'ATGCGT3'. Analise a tabela e faça o que se pede: a) Cite o nome da enzima que catalisa a síntese de RNA mensageiro. a) Considerando que tenha ocorrido a ação da DNA-polimerase. foi selecionada a área temática CULTURA e as questões foram construídas com base na obra "Os Primeiros Habitantes do Rio Grande do Sul" (Custódio. IPHAN. (G2) Os códons AGA. Verificou-se que um desses mutantes produzia uma dada proteína que diferia da original pela ausência de 35 aminoácidos em uma das extremidades da cadeia peptídica. respectivamente os aminoácidos arginina. 10. leucina e treonina. d) Qual a seqüência de aminoácidos que resultará da tradução da mesma molécula de mRNA. qual será a seqüência de bases da fita complementar? b) Se a fita complementar for usada durante a transcrição. brancos e negros. Ainda hoje. após uma deleção do TERCEIRO nucleotídeo? 9. (Ufrj 2004) Após tratar culturas de bactérias com doses de um agente mutagênico capaz de induzir uma única mutação pontual (que afeta apenas um nucleotídeo por célula). B." . esse código segue o padrão do código genético universal. CUG. no qual três bases codificam um aminoácido. Santa Cruz do Sul: EDUNISC. como os Kaingáng. muitas vezes. "o índio". (Ufv 2004) A tabela adiante representa uma versão fictícia do código genético. através dos vestígios materiais encontrados nas pesquisas arqueológicas. deixaram-nos um legado que. Escreva esses aminoácidos na ordem correspondente à seqüência TGA .. convivemos com grupos indígenas. uma mistura de índios. TEXTO PARA A PRÓXIMA QUESTÃO (Ufsm 2006) A história da maioria dos municípios gaúchos coincide com a chegada dos primeiros portugueses. No entanto. anteriores aos citados. Nosso chimarrão nos identifica em qualquer parte do mundo. sabemos que outros povos. Diante da relevância do contexto e da vontade de valorizar o nosso povo nativo. diferencia-nos. e ACU do RNA mensageiro codificam. Explique como essa única mutação pontual pode fazer com que a síntese da proteína seja interrompida prematuramente. analisou-se a seqüência de aminoácidos de uma determinada proteína em diversos mutantes gerados. italianos e de outros povos. L. as três raças se mesclam em nossos descendentes. organizador.8. Entretanto.TCT . qual será a seqüência de bases do RNA resultante e que nome recebe esse RNA se ele traduzir para síntese de proteínas? 11. "Nossos ancestrais.

formando ligações fosfo-diéster. Está(ão) correta(s) a) apenas I. reflita sobre esse assunto e assinale a afirmativa INCORRETA. d) dentro do núcleo. d) apenas I e II. no citoplasma. (Pucmg 2006) A figura mostra cinco tipos de moléculas de grande importância para uma célula animal. através dos pareamentos de aminoácidos. III. e) apenas II e III. O DNA presente nas mitocôndrias tem composição e estrutura típicas desse tipo de ácido nucléico. b) apenas II. duas cadeias polinucleotídicas paralelas e complementares entre si. isso significa que a) todas as reações metabólicas são catalisadas por moléculas e componentes nucleares.12. uma cadeia de nucleotídeos em que as bases nitrogenadas interagem. para todas as partes da célula. 14. c) Apenas duas das moléculas indicadas na figura podem ser quebradas e fornecer energia para as células. catalisando as reações metabólicas. moléculas que catalisam as reações metabólicas. b) Uma das moléculas representadas no desenho não é normalmente encontrada no citoplasma celular. a) Uma das moléculas apresentadas pode fornecer informações para a produção de uma outra representada. II. Analise o esquema. c) apenas III. c) o núcleo produz e envia. e) o conteúdo do núcleo passa para o citoplasma e atua diretamente nas funções celulares. portanto é formado por I. moléculas sintetizam enzimas catalisadoras das reações metabólicas. nucleotídeos que são compostos por uma base nitrogenada. uma pentose e um radical "fosfato". . promovem a síntese de enzimas catalisadoras das reações metabólicas. (Fuvest 2005) Quando afirmamos que o metabolismo da célula é controlado pelo núcleo celular. 13. d) Uma das moléculas representadas pode favorecer a captação do carboidrato indicado no esquema. b) o núcleo produz moléculas que.

na produção das proteínas. proposta por Richard Dawkins no livro "O gene egoísta". suas funções no metabolismo celular passam a ser realizadas pelos aminoácidos. e) errada. (Unifesp 2004) Em abril de 2003. responsáveis pela produção das proteínas. provocando a desnaturação dessas moléculas e. da maneira como foi veiculada. b) UACGUGGA. . cada página de cada volume contém um texto formado por uma seqüência de: a) fenótipos b) aminoácidos c) cromossomos d) bases nitrogenadas 19. porque não é possível decifrar todo o código genético. e) ATGCACCT. c) 38 cromossomos simples e 38 moléculas de DNA. conseqüentemente. a) O DNA é constituído por códons. No núcleo do óvulo normal de uma gata são esperados: a) 19 cromossomos simples e 19 moléculas de DNA. nem no metabolismo celular. levando em conta os ácidos nucléicos. não haverá alteração na molécula protéica formada. necessária à formação dos anticódons. c) TACGTGGA. d) 38 cromossomos simples e 19 moléculas de DNA. a finalização do Projeto Genoma Humano foi noticiada por vários meios de comunicação como sendo a "decifração do código genético humano". d) As mutações atuam diretamente sobre as proteínas. 18. (Pucrs 2005) A seqüência de nucleotídeos ATGCACCT forma um segmento de DNA dupla hélice ao se ligar à fita complementar a) AUGCACCU. A informação. conseqüentemente. que determinam a seqüência de bases do RNA mensageiro. isto é. está a) correta. a ocorrência de mutações e as conseqüentes mudanças do ciclo de vida da célula. não as proteínas que eles codificam. proteínas que atuam como catalisadores e que podem sofrer mutações genéticas sendo modificadas ou eliminadas. e) Quando algumas proteínas são alteradas por mutações. b) 19 cromossomos duplicados e 38 moléculas de DNA. e) 19 cromossomos duplicados e 19 moléculas de DNA. d) TCCACGTA.) No homem. porque agora se sabe toda a seqüência de nucleotídeos dos cromossomos humanos. (Uerj 2004) É como se em cada quarto de um imenso prédio existisse uma estante contendo os planos do arquiteto para todo o prédio. 17. porque o código genético diz respeito à correspondência entre os códons do DNA e os aminoácidos nas proteínas. c) errada. Nessa analogia. existem regiões cromossômicas com alta taxa de mutação. c) A mutação altera a seqüência de aminoácidos do DNA. (Fatec 2006) O metabolismo celular depende de uma série de reações químicas controladas por enzimas. porque o Projeto decifrou os genes dos cromossomos humanos. b) No caso de uma mutação acarretar a transformação de um códon em outro relacionado ao mesmo aminoácido. porque agora se sabe toda a seqüência de genes dos cromossomos humanos. os planos do arquiteto montam 46 volumes. acarretando alterações na seqüência de bases do RNA mensageiro e. Assinale a alternativa correta. 16. (Pucsp 2006) O gato doméstico ('Felis domestica') apresenta 38 cromossomos em suas células somáticas.. b) correta.15. a inativação delas. d) errada. (..

22.UUU . (Fuvest 94) Um gene de bactéria com 600 pares de bases nitrogenadas produzirá uma cadeia polipeptídica com número de aminoácidos aproximadamente igual a a) 200 b) 300 c) 600 d) 1200 e) 1800 .Ile .Cis .Val .FEN .Leu e) Val . a seqüência de aminoácidos no polipeptídeo correspondente será.CUC.UUU .Val . de acordo com a tabela anterior: a) Cis .Ile . e) GUU .AAA .Cis .Val .Ile b) Leu .CUC.Arg .AAC.GGA . d) GAA .Leu 21.GGC .Ile c) Arg .Arg .UUU . Assinale a alternativa que apresenta a possível seqüência de códons para a formação do seguinte tetrapeptídeo: GLU . (Cesgranrio 92) A tabela a seguir mostra alguns aminoácidos e as trincas de bases no DNA que os identificam: Se um RNA mensageiro apresenta a seqüência de bases AUU AGA UGU GUU UUA.Cis d) Ile . c) CTT .GLI .CTC.CCG .Arg .GGU .LEU a) GUU .GGC .Cis .Val .Leu .Arg .UUG.20. (Fatec 95) A tabela a seguir relaciona trincas de bases do DNA aos aminoácidos correspondentes. b) GAA .Leu .TTT .

d) A tradução será interrompida no 2Ž aminoácido. prolina. que visa decifrar e mapear o código genético humano. e) Valina.alanina. leucina. cuja seqüência de bases é AAGTTTGGT. a) Na molécula de DNA. a) O aminoácido tirosina será substituído por outro aminoácido. sofreu a perda da 9 base nitrogenada. c) Fenilalanina. (Puc-rio 2001) Em 1987. prolina. lisina.cisteína . assinale a afirmativa FALSA. pode corrigir defeitos no código .23. lisina. b) Todas as células do corpo têm a mesma coleção de genes. encontramos células com formas e funções diferentes. (Mackenzie 99) Os códons UGC. ou seja. pois qualquer modificação na fita de DNA é imediatamente corrigida. guanina. Este processo chama-se diferenciação celular. determinando as características de um ser vivo. encontramos sempre desoxirribose e cinco tipos de bases: adenina. GCC e AGC codificam. encontramos células com formas e funções diferentes. mas. (Fuvest 95) Considere a seguinte tabela que indica seqüências de bases do RNA mensageiro e os aminoácidos por elas codificados. c) A mutação é uma alteração do código genético de um organismo e pode ser provocada por radiações ou substâncias químicas. nem as suas características. UAU. que codifica a seqüência serina . compondo os cromossomos e ribossomos na forma de moléculas complexas de nucleoproteínas. e a tradução. timina e uracil. ou mesmo por exposição aos raios ultravioleta do sol. Indique a alternativa ERRADA relativa ao código genético e à síntese de proteínas: a) Os genes são formados por ácido desoxirribonucleico e controlam a produção de proteínas da célula. pois essa molécula de DNA alterada não é capaz de comandar esse processo. Um fragmento de DNA. c) A seqüência não será traduzida. resultando numa molécula com 3 aminoácidos. por raios-X. foi oficialmente fundado o Projeto Genoma. e) A seqüência não sofrerá prejuízo. 26. que compreende a passagem do código genético do DNA para o RNA. b) Aspargina. 25. que é uma técnica de manipulação dos genes. e) Todas as células do corpo têm a mesma coleção de genes. d) A mutação constitui uma alteração na seqüência de bases nitrogenadas de um segmento de DNA e pode ser provocada por radiações. valina. apesar disto. prolina. b) O aminoácido tirosina não será traduzido.tirosina . alanina e serina. respectivamente os aminoácidos cisteína. lisina. qual seria a seqüência de aminoácidos codificada? a) Aspargina. (Puc-rio 2000) Com relação ao código genético e à síntese de proteínas. o códon UAG é terminal. tirosina. d) Fenilalanina. por raios cósmicos. 24. lisina. indica a interrupção da tradução. Assinale a alternativa que descreve o que acontecerá com a seqüência de aminoácidos. e) A Engenharia Genética. b) Os ácidos nucléicos podem aparecer livres na célula ou podem estar associados a proteínas. citosina. c) Duas grandes etapas estão envolvidas na síntese das proteínas: a transcrição. d) As mudanças na programação genética de um organismo não alteram a produção de proteínas. valina. que compreende o trabalho do RNA de organização dos aminoácidos na seqüência determinada pelo código genético. mas. apesar disso. Com base na tabela fornecida e considerando um segmento hipotético de DNA.

28. Observe que: . por conseqüência da substituição de uma única base na estrutura do DNA.o codon da metionina é também o do início da tradução. UAG e UGA. . (Uel 98) Considere os seguintes códons do RNA mensageiro e os aminoácidos por eles especificados: ACA = treonina GUU = valina Assinale a alternativa da tabela a seguir que indica corretamente os anticódons do RNAt e os códons do DNA relacionados com esses aminoácidos. respectivamente: a) lisina e cisteína b) treonina e triptofano c) alanina e ácido glutâmico d) fenil alanina e ácido aspártico . Considere que a estrutura normal de um RNA mensageiro de um peptídio e sua estrutura alterada em virtude da troca de uma única base no gene correspondente são: 5' AUGUGGUUUGCACACAAAUGAUAA 3' (normal) 5' AUGUGGUUUGAACACAAAUGAUAA 3' (alterada) A tabela a seguir identifica alguns codons.os codons de término da tradução são UAA. pode acarretar modificações importantes na atividade biológica da proteína codificada por esse gene. (Uerj 2005) A mutação em um gene.genético de um organismo. 27. O aminoácido encontrado no peptídio normal e aquele que o substituiu no peptídio mutante são.

unindo-se aos aminoácidos. a) treonina. (Ufrn 2000) Observe as seqüências de nucleotídeos de um vírus de RNA: 5' GCA UCA CAC CUC AUU GCG UAG 3' Considerando que esse segmento de RNA codifica um determinado peptídeo. arginina. quantos códons. b) A inserção de um nucleotídeo entre a 4 e a 5 base não altera o código genético. arginina. 32. e) Se a ação desse ácido for bloqueada. (Unifesp 2007) Os códons AGA. treonina. representada em II. leucina. respectivamente. . b) Cada trinca de bases. A seqüência desses aminoácidos na proteína correspondente ao segmento do DNA que apresenta a seqüência de nucleotídeos GAC TGA TCT será. é denominada anticódon. leucina e treonina. assinale a alternativa INCORRETA. treonina. b) pentoses da molécula de RNA . o processo de transcrição não ocorrerá. arginina. leucina. d) bases da molécula de RNA . treonina. d) Os anticódons do 1ª do 2ª códon dessa seqüência são. d) treonina. c) leucina. arginina. que especificam esses aminoácidos. c) Os códons GCA e GCG são degenerados porque codificam aminoácidos diferentes. c) Esse ácido nucléico é produzido no núcleo e se dirige ao citoplasma. 31. d) II pode apresentar moléculas de adenina. e) leucina. c) bases da molécula de DNA. respectivamente. respectivamente. a) A substância representada em I é obrigatoriamente ribose. b) arginina.ribossômico 33.transportador. e) bases da molécula de RNA .29. os aminoácidos arginina.mensageiro. é correto afirmar: a) Os códons dessa seqüência sinalizam os mesmos aminoácidos em seres humanos. cuja função é transportar aminoácidos. GCA e UGA. (Ufpi 2000) Se uma proteína possui 100 aminoácidos. que representa um fragmento de ácido nucléico. devem estar presentes no seu mRNA? a) 100 b) 33 c) 99 d) 300 e) 500 30. CUG e ACU do RNA mensageiro codificam. (Mackenzie 2001) Considerando o esquema acima. leucina. (G2) A seqüência de aminoácidos de uma proteína é determinada pela seqüência de a) pentoses da molécula de DNA.

d) a seqüência de bases do rRNA é transcrita a partir do código do mRNA.GAU .AUG Os anti-códons correspondentes são: a) AUG . Uma delas é a síntese de proteína. .GUA . A função celular drasticamente afetada por essa mutação será a) a replicação do DNA. Nesse processo ocorre produção de.CGA .ACG .TCG . e) a extremidade livre dos diversos tRNA tem seqüências de bases diferentes.UGC . b) a síntese de RNA mensageiros. 37.ACG . (Pucmg 2007) O esquema a seguir é um processo celular vital. (Puccamp 2002) Um mutante perdeu um segmento de DNA contendo todas as cópias dos genes que codificam RNA transportador. (Ufal 99) Considere os seguintes códons: UAC .CUT .ACT . c) moléculas de defesa do corpo. b) enzimas usadas. 35. (Pucmg 99) O DNA apresenta importantes funções celulares. Numa síntese de proteína com 185 ligações peptídicas. o filamento de DNA que proporcionou essa síntese deverá ter o seguinte número total de nucleotídeos: a) 62 b) 93 c) 186 d) 279 e) 558 36.TAC c) TUG . (Ufc 99) Sobre os diferentes papéis dos ácidos nucléicos na síntese de proteínas podemos afirmar corretamente que: a) a seqüência de bases no DNA determina a seqüência de aminoácidos na cadeia polipeptídica.UTC d) AGT .CGU 38. e) o transporte de RNA.GAC e) GCA . por exemplo. c) a síntese de proteínas.CUA . que ocorre também em você.34. b) a posição dos aminoácidos na cadeia polipeptídica depende da seqüência de bases do tRNA. d) o transporte de proteínas. no processo digestivo.UAC b) ATG . c) o transporte de aminoácido para o local da síntese é feito pelo mRNA. d) moléculas utilizadas nos processos de cicatrização. EXCETO: a) macromoléculas de reserva energética.CTA .UCG .

pois um aminoácido pode ser codificado por mais de uma trinca. as bases para a descoberta do código genético.39. Entre as hipóteses apresentadas naquele texto. quantos nucleotídeos em média estão presentes em uma seqüência codificadora de ARN-m. b) a transferência de informações genéticas ocorre do DNA para o RNA. um dos descobridores da estrutura da molécula de DNA. (Unirio 2003) Supondo que o peso molecular médio de um aminoácido é de 100 daltons. apresentando suas hipóteses sobre a estrutura teórica da biologia molecular. assim. a) o código genético é degenerado. publicou um manifesto sobre a síntese de proteínas. responsável pelo sequenciamento dos aminoácidos em um peptídeo com peso molecular de 27000 daltons? a) 810 b) 300 c) 270 d) 81000 e) 2700 . d) cada molécula de DNA é formada pela reunião de nucleotídeos. e) uma molécula de DNA difere de outra pela seqüência de seus nucleotídeos. Em 1958. morto em julho de 2004. 40. que podem ser de quatro tipos diferentes. Segundo esse dogma. e deste para a proteína. destaca-se o dogma central da Biologia. (Ufrs 2005) O cientista britânico Francis Crick. c) cada polipeptídeo tem uma seqüência específica de nucleotídeos determinada pelo gene. lançando. será lembrado como um dos mais influentes cientistas de todos os tempos.

Tre .Val . c) As proteínas podem ser diferenciadas pelo número. no máximo.alteração estrutural do polipeptídio (substituição do ácido glutâmico pela valina). o gene que codifica uma proteína tem sempre maior número de nucleotídeos que de aminoácidos.alteração da função da proteína (globina). permite a formação de apenas 16 códons diferentes.Tir . poderiam ter. que conduz os códons para a síntese da proteína nos ribossomos. a) Produto da síntese protéica (polipeptídio): val .Lis Indivíduo A: Val . Neste caso. 2.Leu . respectivamente. produz o RNA mensageiro.Leu .his . Logo.glu . 5.Val . tipos e seqüências de seus aminoácidos. a) As proteínas produzidas pelos extraterrestres em questão. a) Proteína normal: Val .Tre .leu . 7. onde adenina pareia com timina. Porque o código genético é degenerado. 4. b) A diversidade no planeta Terra seria maior.Pro .Pro . c) A proteína produzida pela bactéria terrestre "transgênica" não será idêntica ao polipeptídeo alienígena.redução da capacidade de transporte de oxigênio. isto é. Sabe-se ainda que existem vários nucleotídeos do gene que servem para a função de regulação e não são transcritos. não seria possível a produção das proteínas B e C com.Leu .Tre . TTA. porque o código genético é degenerado. C é afetado porque possui um aminoácido diferente em sua proteína. . B é normal.Pro Indivíduo B: Val .Tir . códons de finalização.pro . . isto é. especificaria o terceiro aminoácido da tabela. sendo 3 códons de finalização. a) RNAm: UCC GUU AAU UCC GGC AAG b) O códon mutado. 6.manifestação dos sintomas da anemia falciforme.lys b) Exemplo de mutação pontual no gene que codifica a cadeia da globina humana: substituição do nucleotídeo A por T no códon correspondente ao ácido glutâmico.thr . b) O DNA realiza a transcrição.Lis b) A é afetado porque produz uma proteína menor.Met .Pro . para um mesmo aminoácido existem vários códons diferentes. ou mais. Isso sem considerar a possibilidade da existência de um.Tir . Seu código genético. Conseqüência: anemia falciforme . Com a descoberta do código genético sabe-se que um aminoácido é sempre codificado por três nucleotídeos. Assim o número de tipos distintos de aminoácidos presentes nos polipeptídeos seria. 16 e 19 aminoácidos. uma vez que o equipamento ribossômico da bactéria que incorporou o gene. a) Os 'corrimãos' correspondem a uma sucessão alternada de fosfato e desoxirribose (açúcar). . e citosina com guanina. Os 'degraus' são constituídos por pares de bases nitrogenadas. obviamente. 16 tipos diferentes de aminoácidos. formado por pares de bases. . unidas por pontes de hidrogênio. 3. apesar da substituição de uma base nitrogenada no seu DNA.GABARITO 1.Val . está capacitado para traduzir códons constituídos por 3 bases nitrogenadas consecutivas. pois o código genético dos terráqueos é formado por 64 códons.glu .Tre .Lis Indivíduo C: Val . maior.

[C] 29. 9. [B] 16.Arginina . [C] 28. [A] 23. [A] 18.c) UUA 8. A mutação deve ter alterado um códon que codificava um aminoácido transformando-o em um códon de parada.O .T . Treonina . c) W . [D] 22. b) UAC. [A] 37.Leucina 10.A . d) A proteína não será formada. [E] 34. [D] 25. O RNA que será utilizado na tradução é o RNAm (RNA mensageiro). [C] 24.R .I .S . [C] 13. [B] 14. [A] 38. [D] 19. [A] 31. 11. [A] 30.K. [A] 39.E . [C] 35. a) RNA-polimerase. pois foi alterado o códon de iniciação. [C] 20. [A] 26.C . b) 5'AUGCGU3'. 12. [D] 27. [B] 40. [C] 15. [A] .C . que interrompe a leitura do ARNm pelo ribossoma. a) 3'TACGCA5'.N . [C] 33. [C] 17. [E] 36. [E] 32. [D] 21.

Sign up to vote on this title
UsefulNot useful