EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007 1.

(Unicamp 2005) Em 25 de abril de 1953, um estudo de uma única página na revista inglesa Nature intitulado "A estrutura molecular dos ácidos nucléicos", quase ignorado de início, revolucionou para sempre todas as ciências da vida sejam elas do homem, rato, planta ou bactéria. James Watson e Francis Crick descobriram a estrutura do DNA, que permitiu posteriormente decifrar o código genético determinante para a síntese protéica. a) Watson e Crick demonstraram que a estrutura do DNA se assemelha a uma escada retorcida. Explique a que correspondem os "corrimãos" e os "degraus" dessa escada. b) Que relação existe entre DNA, RNA e síntese protéica? c) Como podemos diferenciar duas proteínas? 2. (Fuvest 96) Uma doença genética de herança dominante é causada por mutações em um gene localizado em um autossomo. Os indivíduos A, B e C têm mutações em um segmento de DNA desse gene, cuja seqüência normal está representada a seguir. Usando a tabela que relaciona alguns codons aos respectivos aminoácidos e considerando que a fita molde a ser transcrita é aquela assinalada com a letra m, responda: a) Quais serão os segmentos de proteínas produzidos, respectivamente, pelos indivíduos A, B e C? b) Como será o fenótipo (normal ou afetado dos indivíduos A, B e C? Por quê? Seqüência normal CAA AAC TGA GGA ATG CAT TTC (m) GTT TTG ACT CCT TAC GTA AAG Indivíduo A CAA AAC TGA GGA ATT CAT TTC (m) GTT TTG ACT CCT TAA GTA AAG Indivíduo B CAT AAC TGA GGA ATG CAT TTC (m) GTA TTG ACT CCT TAC GTA AAG Indivíduo C CAA TAC TGA GGA ATG CAT TTC (m) GTT ATG ACT CCT TAC GTA AAG

3' e. a partir da seqüência de aminoácidos de uma proteína. Um gene é constituído por um número N de nucleotídeos que codifica uma proteína constituída por P aminoácidos. ou do RNA-m correspondentes. (Ufrj 99) Com o auxílio da tabela do código genético representada a seguir. o oposto não é verdadeiro. não se pode deduzir a seqüência de nucleotídeos do gene. do tipo substituição.GAG .GTG . .AAG .GAG . a) Considere o segmento de DNA. é sempre possível deduzir-se a seqüência de aminoácidos de uma proteína a partir da seqüência de nucleotídeos do seu gene. (Ufg 2005) As globinas constituem um bom exemplo da importância da informação genética na estrutura primária e na função das proteínas. Explique por quê.CCT .CTG . isto é. (Ufrj 97) O ADN é um polímero constituído por vários nucleotídeos e as proteínas são polímeros constituídos por vários aminoácidos. b) Utilize um exemplo de alteração estrutural da globina humana (cadeia beta) para explicar como uma mutação pontual. pode afetar a saúde e a qualidade de vida do portador dessa mutação. 4.CAC . Entretanto. Por que sempre encontramos N > P ? 5. cuja seqüência de nucleotídeos é 5' . forneça o produto da síntese protéica (polipeptídio parte da cadeia beta prevista para a globina humana).ACT . utilizando-se da tabela do código genético apresentada a seguir.3.

(Ufv 2000) Considere a tabela abaixo. por uma purina.6. 16 e 19 tipos diferentes de aminoácidos. Já o código genético desses organismos é determinado por códons de 2 bases. encontradas nos organismos da Terra. faça uma comparação entre a diversidade dos organismos encontrados nesses dois planetas. contendo códigos de trincas de bases do DNA com os aminoácidos correspondentes. para resolver os itens seguintes: a) Determine a seqüência de bases do RNAm que foi utilizado para sintetizar o polipeptídeo esquematizado abaixo da tabela. B e C. Explique a possibilidade da ocorrência dessas três proteínas nos seres de Zbohrnya. na 3 base do código correspondente ao 6Ž aminoácido do polipeptídeo.5 bilhões de anos. a proteína produzida pela expressão desse gene será idêntica à da espécie zbohrniana? Justifique sua resposta. b) Sabendo que a vida em Zbohrnya e na Terra existe há 3. qual seria o aminoácido da tabela a ser incorporado? c) Qual é anticódon correspondente ao novo aminoácido incorporado? . a) As proteínas A. b) Se ocorresse uma substituição. 13. 7. apresentam. respectivamente. c) Se o gene de uma proteína respiratória de um organismo zbohrniano for introduzido numa bactéria terrestre. (Ufrn 2002) O DNA dos organismos do planeta Zbohrnya é constituído pelos mesmos 4 tipos de bases dos seres vivos terrestres.

brancos e negros. ainda hoje. deixaram-nos um legado que. A. Verificou-se que um desses mutantes produzia uma dada proteína que diferia da original pela ausência de 35 aminoácidos em uma das extremidades da cadeia peptídica. através dos vestígios materiais encontrados nas pesquisas arqueológicas.8. B." . analisou-se a seqüência de aminoácidos de uma determinada proteína em diversos mutantes gerados.TCT . 2004). qual será a seqüência de bases do RNA resultante e que nome recebe esse RNA se ele traduzir para síntese de proteínas? 11. b) Cite a seqüência do anticódon correspondente ao códon de iniciação. "Nossos ancestrais. protagonizaram a nossa história. as três raças se mesclam em nossos descendentes. alemães. como os Kaingáng. "o índio".. L. Escreva esses aminoácidos na ordem correspondente à seqüência TGA . (Unifesp 2006) Uma fita de DNA tem a seguinte seqüência de bases 5'ATGCGT3'. e ACU do RNA mensageiro codificam. italianos e de outros povos. qual será a seqüência de bases da fita complementar? b) Se a fita complementar for usada durante a transcrição. leucina e treonina. Diante da relevância do contexto e da vontade de valorizar o nosso povo nativo. foi selecionada a área temática CULTURA e as questões foram construídas com base na obra "Os Primeiros Habitantes do Rio Grande do Sul" (Custódio. CUG. Nosso chimarrão nos identifica em qualquer parte do mundo. (Ufv 2004) A tabela adiante representa uma versão fictícia do código genético. no qual três bases codificam um aminoácido. esse código segue o padrão do código genético universal. 10.GAC de um segmento de DNA. c) Qual a seqüência de aminoácidos que resultará da tradução da molécula de RNA mensageiro? Ver figura anterior. No entanto. Explique como essa única mutação pontual pode fazer com que a síntese da proteína seja interrompida prematuramente. a) Considerando que tenha ocorrido a ação da DNA-polimerase. convivemos com grupos indígenas. anteriores aos citados. após uma deleção do TERCEIRO nucleotídeo? 9. Entretanto. respectivamente os aminoácidos arginina. d) Qual a seqüência de aminoácidos que resultará da tradução da mesma molécula de mRNA. (Ufrj 2004) Após tratar culturas de bactérias com doses de um agente mutagênico capaz de induzir uma única mutação pontual (que afeta apenas um nucleotídeo por célula). diferencia-nos. Analise a tabela e faça o que se pede: a) Cite o nome da enzima que catalisa a síntese de RNA mensageiro. Ainda hoje. Santa Cruz do Sul: EDUNISC. organizador. uma mistura de índios. IPHAN. (G2) Os códons AGA. TEXTO PARA A PRÓXIMA QUESTÃO (Ufsm 2006) A história da maioria dos municípios gaúchos coincide com a chegada dos primeiros portugueses. muitas vezes. sabemos que outros povos.

b) Uma das moléculas representadas no desenho não é normalmente encontrada no citoplasma celular. d) dentro do núcleo. II. c) Apenas duas das moléculas indicadas na figura podem ser quebradas e fornecer energia para as células. catalisando as reações metabólicas. c) o núcleo produz e envia. b) o núcleo produz moléculas que. através dos pareamentos de aminoácidos. d) Uma das moléculas representadas pode favorecer a captação do carboidrato indicado no esquema.12. a) Uma das moléculas apresentadas pode fornecer informações para a produção de uma outra representada. (Fuvest 2005) Quando afirmamos que o metabolismo da célula é controlado pelo núcleo celular. . (Pucmg 2006) A figura mostra cinco tipos de moléculas de grande importância para uma célula animal. III. b) apenas II. Analise o esquema. reflita sobre esse assunto e assinale a afirmativa INCORRETA. 14. nucleotídeos que são compostos por uma base nitrogenada. e) o conteúdo do núcleo passa para o citoplasma e atua diretamente nas funções celulares. moléculas que catalisam as reações metabólicas. Está(ão) correta(s) a) apenas I. promovem a síntese de enzimas catalisadoras das reações metabólicas. formando ligações fosfo-diéster. portanto é formado por I. para todas as partes da célula. c) apenas III. uma pentose e um radical "fosfato". e) apenas II e III. uma cadeia de nucleotídeos em que as bases nitrogenadas interagem. moléculas sintetizam enzimas catalisadoras das reações metabólicas. 13. duas cadeias polinucleotídicas paralelas e complementares entre si. no citoplasma. d) apenas I e II. isso significa que a) todas as reações metabólicas são catalisadas por moléculas e componentes nucleares. O DNA presente nas mitocôndrias tem composição e estrutura típicas desse tipo de ácido nucléico.

os planos do arquiteto montam 46 volumes. que determinam a seqüência de bases do RNA mensageiro. 18. necessária à formação dos anticódons. d) errada. (Uerj 2004) É como se em cada quarto de um imenso prédio existisse uma estante contendo os planos do arquiteto para todo o prédio.15. b) No caso de uma mutação acarretar a transformação de um códon em outro relacionado ao mesmo aminoácido. suas funções no metabolismo celular passam a ser realizadas pelos aminoácidos. existem regiões cromossômicas com alta taxa de mutação. está a) correta. e) errada. c) A mutação altera a seqüência de aminoácidos do DNA. 17. porque o Projeto decifrou os genes dos cromossomos humanos. porque agora se sabe toda a seqüência de nucleotídeos dos cromossomos humanos. nem no metabolismo celular. (Pucsp 2006) O gato doméstico ('Felis domestica') apresenta 38 cromossomos em suas células somáticas. d) As mutações atuam diretamente sobre as proteínas. e) Quando algumas proteínas são alteradas por mutações.. (Unifesp 2004) Em abril de 2003. e) 19 cromossomos duplicados e 19 moléculas de DNA. c) errada. porque não é possível decifrar todo o código genético. d) TCCACGTA. c) 38 cromossomos simples e 38 moléculas de DNA. Nessa analogia. provocando a desnaturação dessas moléculas e. conseqüentemente. cada página de cada volume contém um texto formado por uma seqüência de: a) fenótipos b) aminoácidos c) cromossomos d) bases nitrogenadas 19. a finalização do Projeto Genoma Humano foi noticiada por vários meios de comunicação como sendo a "decifração do código genético humano". isto é. proposta por Richard Dawkins no livro "O gene egoísta".. acarretando alterações na seqüência de bases do RNA mensageiro e. e) ATGCACCT. (Fatec 2006) O metabolismo celular depende de uma série de reações químicas controladas por enzimas. a inativação delas. da maneira como foi veiculada. na produção das proteínas. d) 38 cromossomos simples e 19 moléculas de DNA. b) UACGUGGA. responsáveis pela produção das proteínas. (. a) O DNA é constituído por códons. Assinale a alternativa correta. proteínas que atuam como catalisadores e que podem sofrer mutações genéticas sendo modificadas ou eliminadas. a ocorrência de mutações e as conseqüentes mudanças do ciclo de vida da célula. No núcleo do óvulo normal de uma gata são esperados: a) 19 cromossomos simples e 19 moléculas de DNA.) No homem. 16. . não as proteínas que eles codificam. A informação. conseqüentemente. b) 19 cromossomos duplicados e 38 moléculas de DNA. não haverá alteração na molécula protéica formada. c) TACGTGGA. porque agora se sabe toda a seqüência de genes dos cromossomos humanos. b) correta. porque o código genético diz respeito à correspondência entre os códons do DNA e os aminoácidos nas proteínas. (Pucrs 2005) A seqüência de nucleotídeos ATGCACCT forma um segmento de DNA dupla hélice ao se ligar à fita complementar a) AUGCACCU. levando em conta os ácidos nucléicos.

CUC.Val . Assinale a alternativa que apresenta a possível seqüência de códons para a formação do seguinte tetrapeptídeo: GLU .Leu . a seqüência de aminoácidos no polipeptídeo correspondente será.Arg .TTT .Cis .UUU . 22.Leu 21.LEU a) GUU . (Cesgranrio 92) A tabela a seguir mostra alguns aminoácidos e as trincas de bases no DNA que os identificam: Se um RNA mensageiro apresenta a seqüência de bases AUU AGA UGU GUU UUA. de acordo com a tabela anterior: a) Cis .Ile c) Arg .UUG.Cis .Leu e) Val .Cis .Arg .Val .Arg .UUU .Val .20.AAC. c) CTT .AAA .Arg .Cis d) Ile . (Fuvest 94) Um gene de bactéria com 600 pares de bases nitrogenadas produzirá uma cadeia polipeptídica com número de aminoácidos aproximadamente igual a a) 200 b) 300 c) 600 d) 1200 e) 1800 .CUC. b) GAA . (Fatec 95) A tabela a seguir relaciona trincas de bases do DNA aos aminoácidos correspondentes.GGU .Val .Ile . d) GAA .GGA .GGC . e) GUU .GGC .Leu .GLI .Ile .FEN .UUU .Ile b) Leu .CTC.CCG .

e) Valina. b) O aminoácido tirosina não será traduzido. assinale a afirmativa FALSA. (Mackenzie 99) Os códons UGC. prolina. pois qualquer modificação na fita de DNA é imediatamente corrigida. encontramos células com formas e funções diferentes. que visa decifrar e mapear o código genético humano. (Fuvest 95) Considere a seguinte tabela que indica seqüências de bases do RNA mensageiro e os aminoácidos por elas codificados. cuja seqüência de bases é AAGTTTGGT. (Puc-rio 2000) Com relação ao código genético e à síntese de proteínas. lisina. ou seja. e) A seqüência não sofrerá prejuízo. d) A mutação constitui uma alteração na seqüência de bases nitrogenadas de um segmento de DNA e pode ser provocada por radiações. lisina. c) A mutação é uma alteração do código genético de um organismo e pode ser provocada por radiações ou substâncias químicas. prolina. lisina. alanina e serina.alanina. Com base na tabela fornecida e considerando um segmento hipotético de DNA. a) Na molécula de DNA. Indique a alternativa ERRADA relativa ao código genético e à síntese de proteínas: a) Os genes são formados por ácido desoxirribonucleico e controlam a produção de proteínas da célula.tirosina . qual seria a seqüência de aminoácidos codificada? a) Aspargina. timina e uracil. mas. que compreende a passagem do código genético do DNA para o RNA. respectivamente os aminoácidos cisteína. sofreu a perda da 9 base nitrogenada. que compreende o trabalho do RNA de organização dos aminoácidos na seqüência determinada pelo código genético. prolina. lisina. 24. pois essa molécula de DNA alterada não é capaz de comandar esse processo. e) A Engenharia Genética. 25. b) Aspargina. encontramos sempre desoxirribose e cinco tipos de bases: adenina. mas. d) Fenilalanina. compondo os cromossomos e ribossomos na forma de moléculas complexas de nucleoproteínas. por raios-X. Este processo chama-se diferenciação celular. foi oficialmente fundado o Projeto Genoma. GCC e AGC codificam. que é uma técnica de manipulação dos genes. guanina. indica a interrupção da tradução. leucina.cisteína . a) O aminoácido tirosina será substituído por outro aminoácido. ou mesmo por exposição aos raios ultravioleta do sol. pode corrigir defeitos no código . resultando numa molécula com 3 aminoácidos. e a tradução. (Puc-rio 2001) Em 1987. tirosina. apesar disso. o códon UAG é terminal. e) Todas as células do corpo têm a mesma coleção de genes. 26. b) Os ácidos nucléicos podem aparecer livres na célula ou podem estar associados a proteínas.23. que codifica a seqüência serina . c) A seqüência não será traduzida. valina. Assinale a alternativa que descreve o que acontecerá com a seqüência de aminoácidos. por raios cósmicos. determinando as características de um ser vivo. Um fragmento de DNA. b) Todas as células do corpo têm a mesma coleção de genes. UAU. citosina. c) Duas grandes etapas estão envolvidas na síntese das proteínas: a transcrição. encontramos células com formas e funções diferentes. c) Fenilalanina. nem as suas características. apesar disto. valina. d) A tradução será interrompida no 2Ž aminoácido. d) As mudanças na programação genética de um organismo não alteram a produção de proteínas.

por conseqüência da substituição de uma única base na estrutura do DNA. 27. UAG e UGA. 28.o codon da metionina é também o do início da tradução. respectivamente: a) lisina e cisteína b) treonina e triptofano c) alanina e ácido glutâmico d) fenil alanina e ácido aspártico . . Considere que a estrutura normal de um RNA mensageiro de um peptídio e sua estrutura alterada em virtude da troca de uma única base no gene correspondente são: 5' AUGUGGUUUGCACACAAAUGAUAA 3' (normal) 5' AUGUGGUUUGAACACAAAUGAUAA 3' (alterada) A tabela a seguir identifica alguns codons. O aminoácido encontrado no peptídio normal e aquele que o substituiu no peptídio mutante são. pode acarretar modificações importantes na atividade biológica da proteína codificada por esse gene.genético de um organismo. (Uel 98) Considere os seguintes códons do RNA mensageiro e os aminoácidos por eles especificados: ACA = treonina GUU = valina Assinale a alternativa da tabela a seguir que indica corretamente os anticódons do RNAt e os códons do DNA relacionados com esses aminoácidos.os codons de término da tradução são UAA. Observe que: . (Uerj 2005) A mutação em um gene.

32. (Ufrn 2000) Observe as seqüências de nucleotídeos de um vírus de RNA: 5' GCA UCA CAC CUC AUU GCG UAG 3' Considerando que esse segmento de RNA codifica um determinado peptídeo.ribossômico 33. é denominada anticódon. arginina. que especificam esses aminoácidos. c) leucina. (Unifesp 2007) Os códons AGA.transportador. leucina. arginina. treonina. e) bases da molécula de RNA . (G2) A seqüência de aminoácidos de uma proteína é determinada pela seqüência de a) pentoses da molécula de DNA. c) Esse ácido nucléico é produzido no núcleo e se dirige ao citoplasma. leucina. unindo-se aos aminoácidos. e) Se a ação desse ácido for bloqueada. (Mackenzie 2001) Considerando o esquema acima. quantos códons. a) treonina. os aminoácidos arginina. treonina. 31. respectivamente. assinale a alternativa INCORRETA. c) bases da molécula de DNA.29. (Ufpi 2000) Se uma proteína possui 100 aminoácidos. cuja função é transportar aminoácidos. é correto afirmar: a) Os códons dessa seqüência sinalizam os mesmos aminoácidos em seres humanos. e) leucina. b) pentoses da molécula de RNA .mensageiro. b) A inserção de um nucleotídeo entre a 4 e a 5 base não altera o código genético. arginina. a) A substância representada em I é obrigatoriamente ribose. o processo de transcrição não ocorrerá. d) II pode apresentar moléculas de adenina. A seqüência desses aminoácidos na proteína correspondente ao segmento do DNA que apresenta a seqüência de nucleotídeos GAC TGA TCT será. GCA e UGA. b) arginina. d) treonina. leucina e treonina. c) Os códons GCA e GCG são degenerados porque codificam aminoácidos diferentes. arginina. . treonina. d) bases da molécula de RNA . d) Os anticódons do 1ª do 2ª códon dessa seqüência são. CUG e ACU do RNA mensageiro codificam. respectivamente. que representa um fragmento de ácido nucléico. b) Cada trinca de bases. leucina. representada em II. devem estar presentes no seu mRNA? a) 100 b) 33 c) 99 d) 300 e) 500 30. respectivamente.

c) a síntese de proteínas. e) a extremidade livre dos diversos tRNA tem seqüências de bases diferentes.ACT .UAC b) ATG .ACG . EXCETO: a) macromoléculas de reserva energética. (Ufc 99) Sobre os diferentes papéis dos ácidos nucléicos na síntese de proteínas podemos afirmar corretamente que: a) a seqüência de bases no DNA determina a seqüência de aminoácidos na cadeia polipeptídica. c) o transporte de aminoácido para o local da síntese é feito pelo mRNA. c) moléculas de defesa do corpo. d) moléculas utilizadas nos processos de cicatrização. no processo digestivo.AUG Os anti-códons correspondentes são: a) AUG .UTC d) AGT . (Pucmg 2007) O esquema a seguir é um processo celular vital. b) a posição dos aminoácidos na cadeia polipeptídica depende da seqüência de bases do tRNA.GAU .TCG . que ocorre também em você.CUT .CUA . Nesse processo ocorre produção de. por exemplo. e) o transporte de RNA.34. o filamento de DNA que proporcionou essa síntese deverá ter o seguinte número total de nucleotídeos: a) 62 b) 93 c) 186 d) 279 e) 558 36.UCG . (Ufal 99) Considere os seguintes códons: UAC . b) a síntese de RNA mensageiros. d) o transporte de proteínas. Numa síntese de proteína com 185 ligações peptídicas.GAC e) GCA . (Puccamp 2002) Um mutante perdeu um segmento de DNA contendo todas as cópias dos genes que codificam RNA transportador.CGU 38.CTA .UGC .ACG . (Pucmg 99) O DNA apresenta importantes funções celulares. 35. d) a seqüência de bases do rRNA é transcrita a partir do código do mRNA.CGA . 37. b) enzimas usadas. .GUA . Uma delas é a síntese de proteína.TAC c) TUG . A função celular drasticamente afetada por essa mutação será a) a replicação do DNA.

Segundo esse dogma. 40.39. e deste para a proteína. Em 1958. apresentando suas hipóteses sobre a estrutura teórica da biologia molecular. destaca-se o dogma central da Biologia. a) o código genético é degenerado. quantos nucleotídeos em média estão presentes em uma seqüência codificadora de ARN-m. que podem ser de quatro tipos diferentes. assim. morto em julho de 2004. (Unirio 2003) Supondo que o peso molecular médio de um aminoácido é de 100 daltons. as bases para a descoberta do código genético. Entre as hipóteses apresentadas naquele texto. (Ufrs 2005) O cientista britânico Francis Crick. responsável pelo sequenciamento dos aminoácidos em um peptídeo com peso molecular de 27000 daltons? a) 810 b) 300 c) 270 d) 81000 e) 2700 . b) a transferência de informações genéticas ocorre do DNA para o RNA. lançando. pois um aminoácido pode ser codificado por mais de uma trinca. publicou um manifesto sobre a síntese de proteínas. será lembrado como um dos mais influentes cientistas de todos os tempos. c) cada polipeptídeo tem uma seqüência específica de nucleotídeos determinada pelo gene. d) cada molécula de DNA é formada pela reunião de nucleotídeos. e) uma molécula de DNA difere de outra pela seqüência de seus nucleotídeos. um dos descobridores da estrutura da molécula de DNA.

alteração da função da proteína (globina). obviamente.Leu . porque o código genético é degenerado. 5. 6. Os 'degraus' são constituídos por pares de bases nitrogenadas. onde adenina pareia com timina. .Tre . c) A proteína produzida pela bactéria terrestre "transgênica" não será idêntica ao polipeptídeo alienígena. que conduz os códons para a síntese da proteína nos ribossomos. tipos e seqüências de seus aminoácidos.Val . pois o código genético dos terráqueos é formado por 64 códons. 4. 16 tipos diferentes de aminoácidos. códons de finalização. maior. formado por pares de bases.leu . não seria possível a produção das proteínas B e C com. B é normal. isto é. . apesar da substituição de uma base nitrogenada no seu DNA.Tre .GABARITO 1. no máximo. uma vez que o equipamento ribossômico da bactéria que incorporou o gene.his .Lis Indivíduo C: Val .redução da capacidade de transporte de oxigênio. poderiam ter.Leu .Tre . 2.thr . .Tir .Val . 16 e 19 aminoácidos.Tre .lys b) Exemplo de mutação pontual no gene que codifica a cadeia da globina humana: substituição do nucleotídeo A por T no códon correspondente ao ácido glutâmico. produz o RNA mensageiro. b) A diversidade no planeta Terra seria maior. respectivamente. Conseqüência: anemia falciforme .Pro . a) Produto da síntese protéica (polipeptídio): val . e citosina com guanina. ou mais. a) Os 'corrimãos' correspondem a uma sucessão alternada de fosfato e desoxirribose (açúcar).Lis Indivíduo A: Val .Pro . C é afetado porque possui um aminoácido diferente em sua proteína.glu .Leu . a) Proteína normal: Val . a) As proteínas produzidas pelos extraterrestres em questão.Pro Indivíduo B: Val .manifestação dos sintomas da anemia falciforme. especificaria o terceiro aminoácido da tabela.Tir . Logo. Isso sem considerar a possibilidade da existência de um. TTA. 3. 7. b) O DNA realiza a transcrição. a) RNAm: UCC GUU AAU UCC GGC AAG b) O códon mutado. para um mesmo aminoácido existem vários códons diferentes. Assim o número de tipos distintos de aminoácidos presentes nos polipeptídeos seria.Tir .Val . Com a descoberta do código genético sabe-se que um aminoácido é sempre codificado por três nucleotídeos. está capacitado para traduzir códons constituídos por 3 bases nitrogenadas consecutivas. Porque o código genético é degenerado. . sendo 3 códons de finalização.pro . isto é.Pro .glu . Seu código genético. Neste caso.Lis b) A é afetado porque produz uma proteína menor. o gene que codifica uma proteína tem sempre maior número de nucleotídeos que de aminoácidos. Sabe-se ainda que existem vários nucleotídeos do gene que servem para a função de regulação e não são transcritos. c) As proteínas podem ser diferenciadas pelo número. unidas por pontes de hidrogênio. permite a formação de apenas 16 códons diferentes.alteração estrutural do polipeptídio (substituição do ácido glutâmico pela valina).Met .

O .I . [A] 38. [A] 37.c) UUA 8. [C] 28.Arginina . b) 5'AUGCGU3'. [A] 18. que interrompe a leitura do ARNm pelo ribossoma. [E] 32. [C] 13. 12. A mutação deve ter alterado um códon que codificava um aminoácido transformando-o em um códon de parada. [B] 40. [A] 39.S .C .R . a) RNA-polimerase. O RNA que será utilizado na tradução é o RNAm (RNA mensageiro). [C] 20. [E] 34. c) W . [D] 25. [D] 27. [C] 33. [C] 24. b) UAC. Treonina . a) 3'TACGCA5'. [D] 22.K. [D] 21. [C] 15.T .E . [C] 17. [C] 35. [E] 36.Leucina 10. 9. [B] 14. [A] .A . [A] 31.C . [A] 30. [D] 19. [B] 16.N . pois foi alterado o códon de iniciação. [A] 26. [A] 23. d) A proteína não será formada. 11. [C] 29.

Sign up to vote on this title
UsefulNot useful