EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007 1.

(Unicamp 2005) Em 25 de abril de 1953, um estudo de uma única página na revista inglesa Nature intitulado "A estrutura molecular dos ácidos nucléicos", quase ignorado de início, revolucionou para sempre todas as ciências da vida sejam elas do homem, rato, planta ou bactéria. James Watson e Francis Crick descobriram a estrutura do DNA, que permitiu posteriormente decifrar o código genético determinante para a síntese protéica. a) Watson e Crick demonstraram que a estrutura do DNA se assemelha a uma escada retorcida. Explique a que correspondem os "corrimãos" e os "degraus" dessa escada. b) Que relação existe entre DNA, RNA e síntese protéica? c) Como podemos diferenciar duas proteínas? 2. (Fuvest 96) Uma doença genética de herança dominante é causada por mutações em um gene localizado em um autossomo. Os indivíduos A, B e C têm mutações em um segmento de DNA desse gene, cuja seqüência normal está representada a seguir. Usando a tabela que relaciona alguns codons aos respectivos aminoácidos e considerando que a fita molde a ser transcrita é aquela assinalada com a letra m, responda: a) Quais serão os segmentos de proteínas produzidos, respectivamente, pelos indivíduos A, B e C? b) Como será o fenótipo (normal ou afetado dos indivíduos A, B e C? Por quê? Seqüência normal CAA AAC TGA GGA ATG CAT TTC (m) GTT TTG ACT CCT TAC GTA AAG Indivíduo A CAA AAC TGA GGA ATT CAT TTC (m) GTT TTG ACT CCT TAA GTA AAG Indivíduo B CAT AAC TGA GGA ATG CAT TTC (m) GTA TTG ACT CCT TAC GTA AAG Indivíduo C CAA TAC TGA GGA ATG CAT TTC (m) GTT ATG ACT CCT TAC GTA AAG

não se pode deduzir a seqüência de nucleotídeos do gene. cuja seqüência de nucleotídeos é 5' . o oposto não é verdadeiro. Por que sempre encontramos N > P ? 5. forneça o produto da síntese protéica (polipeptídio parte da cadeia beta prevista para a globina humana).GAG .CTG .AAG . do tipo substituição. (Ufrj 97) O ADN é um polímero constituído por vários nucleotídeos e as proteínas são polímeros constituídos por vários aminoácidos. 4.3. isto é.GTG .CCT . a) Considere o segmento de DNA. ou do RNA-m correspondentes.3' e. Explique por quê. Um gene é constituído por um número N de nucleotídeos que codifica uma proteína constituída por P aminoácidos. pode afetar a saúde e a qualidade de vida do portador dessa mutação. utilizando-se da tabela do código genético apresentada a seguir. .ACT . a partir da seqüência de aminoácidos de uma proteína. b) Utilize um exemplo de alteração estrutural da globina humana (cadeia beta) para explicar como uma mutação pontual. é sempre possível deduzir-se a seqüência de aminoácidos de uma proteína a partir da seqüência de nucleotídeos do seu gene.GAG .CAC . Entretanto. (Ufrj 99) Com o auxílio da tabela do código genético representada a seguir. (Ufg 2005) As globinas constituem um bom exemplo da importância da informação genética na estrutura primária e na função das proteínas.

b) Se ocorresse uma substituição. 13. 7. (Ufrn 2002) O DNA dos organismos do planeta Zbohrnya é constituído pelos mesmos 4 tipos de bases dos seres vivos terrestres. a) As proteínas A. respectivamente. qual seria o aminoácido da tabela a ser incorporado? c) Qual é anticódon correspondente ao novo aminoácido incorporado? . na 3 base do código correspondente ao 6Ž aminoácido do polipeptídeo. Já o código genético desses organismos é determinado por códons de 2 bases. encontradas nos organismos da Terra. B e C. para resolver os itens seguintes: a) Determine a seqüência de bases do RNAm que foi utilizado para sintetizar o polipeptídeo esquematizado abaixo da tabela.5 bilhões de anos. a proteína produzida pela expressão desse gene será idêntica à da espécie zbohrniana? Justifique sua resposta.6. (Ufv 2000) Considere a tabela abaixo. 16 e 19 tipos diferentes de aminoácidos. b) Sabendo que a vida em Zbohrnya e na Terra existe há 3. Explique a possibilidade da ocorrência dessas três proteínas nos seres de Zbohrnya. por uma purina. faça uma comparação entre a diversidade dos organismos encontrados nesses dois planetas. c) Se o gene de uma proteína respiratória de um organismo zbohrniano for introduzido numa bactéria terrestre. apresentam. contendo códigos de trincas de bases do DNA com os aminoácidos correspondentes.

d) Qual a seqüência de aminoácidos que resultará da tradução da mesma molécula de mRNA. Entretanto. foi selecionada a área temática CULTURA e as questões foram construídas com base na obra "Os Primeiros Habitantes do Rio Grande do Sul" (Custódio.8. no qual três bases codificam um aminoácido. italianos e de outros povos. a) Considerando que tenha ocorrido a ação da DNA-polimerase. (Ufrj 2004) Após tratar culturas de bactérias com doses de um agente mutagênico capaz de induzir uma única mutação pontual (que afeta apenas um nucleotídeo por célula). ainda hoje. B. analisou-se a seqüência de aminoácidos de uma determinada proteína em diversos mutantes gerados.TCT . alemães. Diante da relevância do contexto e da vontade de valorizar o nosso povo nativo. qual será a seqüência de bases da fita complementar? b) Se a fita complementar for usada durante a transcrição. 2004). e ACU do RNA mensageiro codificam. L. Nosso chimarrão nos identifica em qualquer parte do mundo.. protagonizaram a nossa história. as três raças se mesclam em nossos descendentes. leucina e treonina. "Nossos ancestrais. muitas vezes. IPHAN. como os Kaingáng. Analise a tabela e faça o que se pede: a) Cite o nome da enzima que catalisa a síntese de RNA mensageiro. Escreva esses aminoácidos na ordem correspondente à seqüência TGA . esse código segue o padrão do código genético universal. sabemos que outros povos. qual será a seqüência de bases do RNA resultante e que nome recebe esse RNA se ele traduzir para síntese de proteínas? 11. brancos e negros. Ainda hoje." . anteriores aos citados. Santa Cruz do Sul: EDUNISC. "o índio". (Ufv 2004) A tabela adiante representa uma versão fictícia do código genético. No entanto. 10. convivemos com grupos indígenas. (Unifesp 2006) Uma fita de DNA tem a seguinte seqüência de bases 5'ATGCGT3'. diferencia-nos. CUG. organizador. através dos vestígios materiais encontrados nas pesquisas arqueológicas. respectivamente os aminoácidos arginina. após uma deleção do TERCEIRO nucleotídeo? 9. deixaram-nos um legado que. b) Cite a seqüência do anticódon correspondente ao códon de iniciação. A. TEXTO PARA A PRÓXIMA QUESTÃO (Ufsm 2006) A história da maioria dos municípios gaúchos coincide com a chegada dos primeiros portugueses.GAC de um segmento de DNA. uma mistura de índios. Explique como essa única mutação pontual pode fazer com que a síntese da proteína seja interrompida prematuramente. Verificou-se que um desses mutantes produzia uma dada proteína que diferia da original pela ausência de 35 aminoácidos em uma das extremidades da cadeia peptídica. c) Qual a seqüência de aminoácidos que resultará da tradução da molécula de RNA mensageiro? Ver figura anterior. (G2) Os códons AGA.

(Fuvest 2005) Quando afirmamos que o metabolismo da célula é controlado pelo núcleo celular. formando ligações fosfo-diéster. c) o núcleo produz e envia.12. Analise o esquema. Está(ão) correta(s) a) apenas I. portanto é formado por I. . a) Uma das moléculas apresentadas pode fornecer informações para a produção de uma outra representada. c) apenas III. reflita sobre esse assunto e assinale a afirmativa INCORRETA. II. promovem a síntese de enzimas catalisadoras das reações metabólicas. 13. e) apenas II e III. d) apenas I e II. moléculas que catalisam as reações metabólicas. para todas as partes da célula. catalisando as reações metabólicas. b) o núcleo produz moléculas que. duas cadeias polinucleotídicas paralelas e complementares entre si. nucleotídeos que são compostos por uma base nitrogenada. no citoplasma. b) apenas II. O DNA presente nas mitocôndrias tem composição e estrutura típicas desse tipo de ácido nucléico. uma cadeia de nucleotídeos em que as bases nitrogenadas interagem. e) o conteúdo do núcleo passa para o citoplasma e atua diretamente nas funções celulares. III. c) Apenas duas das moléculas indicadas na figura podem ser quebradas e fornecer energia para as células. d) Uma das moléculas representadas pode favorecer a captação do carboidrato indicado no esquema. 14. moléculas sintetizam enzimas catalisadoras das reações metabólicas. b) Uma das moléculas representadas no desenho não é normalmente encontrada no citoplasma celular. através dos pareamentos de aminoácidos. (Pucmg 2006) A figura mostra cinco tipos de moléculas de grande importância para uma célula animal. isso significa que a) todas as reações metabólicas são catalisadas por moléculas e componentes nucleares. uma pentose e um radical "fosfato". d) dentro do núcleo.

proteínas que atuam como catalisadores e que podem sofrer mutações genéticas sendo modificadas ou eliminadas. responsáveis pela produção das proteínas. 18. d) As mutações atuam diretamente sobre as proteínas. não as proteínas que eles codificam. levando em conta os ácidos nucléicos. os planos do arquiteto montam 46 volumes. a finalização do Projeto Genoma Humano foi noticiada por vários meios de comunicação como sendo a "decifração do código genético humano". a inativação delas. e) errada. nem no metabolismo celular. 16. c) TACGTGGA. (. isto é. b) No caso de uma mutação acarretar a transformação de um códon em outro relacionado ao mesmo aminoácido. porque o Projeto decifrou os genes dos cromossomos humanos. Assinale a alternativa correta. (Fatec 2006) O metabolismo celular depende de uma série de reações químicas controladas por enzimas. b) 19 cromossomos duplicados e 38 moléculas de DNA. que determinam a seqüência de bases do RNA mensageiro. d) TCCACGTA. d) errada.. e) Quando algumas proteínas são alteradas por mutações.15. a ocorrência de mutações e as conseqüentes mudanças do ciclo de vida da célula. acarretando alterações na seqüência de bases do RNA mensageiro e. b) correta. está a) correta. Nessa analogia. não haverá alteração na molécula protéica formada. c) 38 cromossomos simples e 38 moléculas de DNA. suas funções no metabolismo celular passam a ser realizadas pelos aminoácidos. e) ATGCACCT. (Unifesp 2004) Em abril de 2003. 17. (Pucsp 2006) O gato doméstico ('Felis domestica') apresenta 38 cromossomos em suas células somáticas. porque agora se sabe toda a seqüência de genes dos cromossomos humanos. da maneira como foi veiculada. cada página de cada volume contém um texto formado por uma seqüência de: a) fenótipos b) aminoácidos c) cromossomos d) bases nitrogenadas 19. c) errada. na produção das proteínas. e) 19 cromossomos duplicados e 19 moléculas de DNA. a) O DNA é constituído por códons. b) UACGUGGA.. A informação. c) A mutação altera a seqüência de aminoácidos do DNA. porque o código genético diz respeito à correspondência entre os códons do DNA e os aminoácidos nas proteínas.) No homem. necessária à formação dos anticódons. (Uerj 2004) É como se em cada quarto de um imenso prédio existisse uma estante contendo os planos do arquiteto para todo o prédio. provocando a desnaturação dessas moléculas e. porque não é possível decifrar todo o código genético. proposta por Richard Dawkins no livro "O gene egoísta". existem regiões cromossômicas com alta taxa de mutação. No núcleo do óvulo normal de uma gata são esperados: a) 19 cromossomos simples e 19 moléculas de DNA. conseqüentemente. conseqüentemente. d) 38 cromossomos simples e 19 moléculas de DNA. porque agora se sabe toda a seqüência de nucleotídeos dos cromossomos humanos. (Pucrs 2005) A seqüência de nucleotídeos ATGCACCT forma um segmento de DNA dupla hélice ao se ligar à fita complementar a) AUGCACCU. .

LEU a) GUU .20. de acordo com a tabela anterior: a) Cis .Cis d) Ile .Leu e) Val .GGU .TTT .Arg .Val .UUU . a seqüência de aminoácidos no polipeptídeo correspondente será.CUC.Val .Val . (Cesgranrio 92) A tabela a seguir mostra alguns aminoácidos e as trincas de bases no DNA que os identificam: Se um RNA mensageiro apresenta a seqüência de bases AUU AGA UGU GUU UUA. e) GUU .Leu .Cis .Val .UUU .GLI .Leu .CCG . (Fuvest 94) Um gene de bactéria com 600 pares de bases nitrogenadas produzirá uma cadeia polipeptídica com número de aminoácidos aproximadamente igual a a) 200 b) 300 c) 600 d) 1200 e) 1800 .Cis . c) CTT .GGC .Ile c) Arg . Assinale a alternativa que apresenta a possível seqüência de códons para a formação do seguinte tetrapeptídeo: GLU .GGA . (Fatec 95) A tabela a seguir relaciona trincas de bases do DNA aos aminoácidos correspondentes.Leu 21.Cis .Ile b) Leu .Arg . b) GAA .CTC.UUU . 22.Ile .AAC.Arg .Arg .FEN .GGC . d) GAA .CUC.UUG.Ile .AAA .

cuja seqüência de bases é AAGTTTGGT. Este processo chama-se diferenciação celular. encontramos células com formas e funções diferentes. e) Valina. guanina. determinando as características de um ser vivo. encontramos células com formas e funções diferentes. pois essa molécula de DNA alterada não é capaz de comandar esse processo. apesar disso. que compreende o trabalho do RNA de organização dos aminoácidos na seqüência determinada pelo código genético. b) Todas as células do corpo têm a mesma coleção de genes. b) O aminoácido tirosina não será traduzido. GCC e AGC codificam. e a tradução. (Puc-rio 2001) Em 1987. leucina. lisina. respectivamente os aminoácidos cisteína. c) Duas grandes etapas estão envolvidas na síntese das proteínas: a transcrição. d) A mutação constitui uma alteração na seqüência de bases nitrogenadas de um segmento de DNA e pode ser provocada por radiações. por raios-X. (Mackenzie 99) Os códons UGC. e) A seqüência não sofrerá prejuízo. pois qualquer modificação na fita de DNA é imediatamente corrigida.alanina. que visa decifrar e mapear o código genético humano. assinale a afirmativa FALSA. b) Os ácidos nucléicos podem aparecer livres na célula ou podem estar associados a proteínas. compondo os cromossomos e ribossomos na forma de moléculas complexas de nucleoproteínas. e) Todas as células do corpo têm a mesma coleção de genes.cisteína . c) A seqüência não será traduzida. b) Aspargina. c) A mutação é uma alteração do código genético de um organismo e pode ser provocada por radiações ou substâncias químicas. lisina. qual seria a seqüência de aminoácidos codificada? a) Aspargina. Com base na tabela fornecida e considerando um segmento hipotético de DNA. resultando numa molécula com 3 aminoácidos. e) A Engenharia Genética. 25. valina. d) A tradução será interrompida no 2Ž aminoácido. a) Na molécula de DNA. ou seja. Indique a alternativa ERRADA relativa ao código genético e à síntese de proteínas: a) Os genes são formados por ácido desoxirribonucleico e controlam a produção de proteínas da célula. prolina. (Puc-rio 2000) Com relação ao código genético e à síntese de proteínas. por raios cósmicos. foi oficialmente fundado o Projeto Genoma. que compreende a passagem do código genético do DNA para o RNA. nem as suas características. que é uma técnica de manipulação dos genes.tirosina . citosina.23. prolina. (Fuvest 95) Considere a seguinte tabela que indica seqüências de bases do RNA mensageiro e os aminoácidos por elas codificados. indica a interrupção da tradução. prolina. mas. UAU. apesar disto. sofreu a perda da 9 base nitrogenada. o códon UAG é terminal. encontramos sempre desoxirribose e cinco tipos de bases: adenina. mas. pode corrigir defeitos no código . lisina. tirosina. que codifica a seqüência serina . alanina e serina. lisina. ou mesmo por exposição aos raios ultravioleta do sol. 26. a) O aminoácido tirosina será substituído por outro aminoácido. c) Fenilalanina. Um fragmento de DNA. Assinale a alternativa que descreve o que acontecerá com a seqüência de aminoácidos. d) Fenilalanina. valina. d) As mudanças na programação genética de um organismo não alteram a produção de proteínas. 24. timina e uracil.

por conseqüência da substituição de uma única base na estrutura do DNA. (Uel 98) Considere os seguintes códons do RNA mensageiro e os aminoácidos por eles especificados: ACA = treonina GUU = valina Assinale a alternativa da tabela a seguir que indica corretamente os anticódons do RNAt e os códons do DNA relacionados com esses aminoácidos. UAG e UGA. 28.genético de um organismo. pode acarretar modificações importantes na atividade biológica da proteína codificada por esse gene. O aminoácido encontrado no peptídio normal e aquele que o substituiu no peptídio mutante são. Observe que: . . (Uerj 2005) A mutação em um gene. 27.os codons de término da tradução são UAA.o codon da metionina é também o do início da tradução. respectivamente: a) lisina e cisteína b) treonina e triptofano c) alanina e ácido glutâmico d) fenil alanina e ácido aspártico . Considere que a estrutura normal de um RNA mensageiro de um peptídio e sua estrutura alterada em virtude da troca de uma única base no gene correspondente são: 5' AUGUGGUUUGCACACAAAUGAUAA 3' (normal) 5' AUGUGGUUUGAACACAAAUGAUAA 3' (alterada) A tabela a seguir identifica alguns codons.

arginina. cuja função é transportar aminoácidos. b) A inserção de um nucleotídeo entre a 4 e a 5 base não altera o código genético. respectivamente. d) bases da molécula de RNA . respectivamente. c) bases da molécula de DNA. treonina. d) Os anticódons do 1ª do 2ª códon dessa seqüência são. . (Mackenzie 2001) Considerando o esquema acima. e) leucina. 31. e) bases da molécula de RNA . d) treonina. e) Se a ação desse ácido for bloqueada. quantos códons. c) Esse ácido nucléico é produzido no núcleo e se dirige ao citoplasma. é correto afirmar: a) Os códons dessa seqüência sinalizam os mesmos aminoácidos em seres humanos. representada em II.transportador. c) Os códons GCA e GCG são degenerados porque codificam aminoácidos diferentes. c) leucina. (Ufpi 2000) Se uma proteína possui 100 aminoácidos. arginina.mensageiro. arginina. CUG e ACU do RNA mensageiro codificam. respectivamente. b) arginina. os aminoácidos arginina. b) pentoses da molécula de RNA . unindo-se aos aminoácidos. que representa um fragmento de ácido nucléico. leucina. treonina. b) Cada trinca de bases. d) II pode apresentar moléculas de adenina. GCA e UGA. é denominada anticódon. arginina. leucina e treonina. treonina. (Unifesp 2007) Os códons AGA. devem estar presentes no seu mRNA? a) 100 b) 33 c) 99 d) 300 e) 500 30. assinale a alternativa INCORRETA. que especificam esses aminoácidos. a) A substância representada em I é obrigatoriamente ribose. 32.ribossômico 33. A seqüência desses aminoácidos na proteína correspondente ao segmento do DNA que apresenta a seqüência de nucleotídeos GAC TGA TCT será. leucina. leucina. (G2) A seqüência de aminoácidos de uma proteína é determinada pela seqüência de a) pentoses da molécula de DNA. a) treonina.29. (Ufrn 2000) Observe as seqüências de nucleotídeos de um vírus de RNA: 5' GCA UCA CAC CUC AUU GCG UAG 3' Considerando que esse segmento de RNA codifica um determinado peptídeo. o processo de transcrição não ocorrerá.

TCG . 37. b) a síntese de RNA mensageiros. por exemplo.AUG Os anti-códons correspondentes são: a) AUG .GAU .CGA . d) a seqüência de bases do rRNA é transcrita a partir do código do mRNA. (Pucmg 99) O DNA apresenta importantes funções celulares.UCG . (Pucmg 2007) O esquema a seguir é um processo celular vital.CUT .ACG .GAC e) GCA . EXCETO: a) macromoléculas de reserva energética. o filamento de DNA que proporcionou essa síntese deverá ter o seguinte número total de nucleotídeos: a) 62 b) 93 c) 186 d) 279 e) 558 36. c) moléculas de defesa do corpo. . (Ufal 99) Considere os seguintes códons: UAC .CUA .UAC b) ATG .GUA . c) a síntese de proteínas.TAC c) TUG . Numa síntese de proteína com 185 ligações peptídicas.CTA .UTC d) AGT . e) o transporte de RNA. 35. que ocorre também em você. no processo digestivo. b) a posição dos aminoácidos na cadeia polipeptídica depende da seqüência de bases do tRNA. (Puccamp 2002) Um mutante perdeu um segmento de DNA contendo todas as cópias dos genes que codificam RNA transportador. A função celular drasticamente afetada por essa mutação será a) a replicação do DNA. d) moléculas utilizadas nos processos de cicatrização.ACT .34.UGC . e) a extremidade livre dos diversos tRNA tem seqüências de bases diferentes. d) o transporte de proteínas. Uma delas é a síntese de proteína. Nesse processo ocorre produção de. (Ufc 99) Sobre os diferentes papéis dos ácidos nucléicos na síntese de proteínas podemos afirmar corretamente que: a) a seqüência de bases no DNA determina a seqüência de aminoácidos na cadeia polipeptídica.ACG . b) enzimas usadas. c) o transporte de aminoácido para o local da síntese é feito pelo mRNA.CGU 38.

(Ufrs 2005) O cientista britânico Francis Crick. b) a transferência de informações genéticas ocorre do DNA para o RNA. e) uma molécula de DNA difere de outra pela seqüência de seus nucleotídeos. pois um aminoácido pode ser codificado por mais de uma trinca. 40. morto em julho de 2004. d) cada molécula de DNA é formada pela reunião de nucleotídeos. (Unirio 2003) Supondo que o peso molecular médio de um aminoácido é de 100 daltons. publicou um manifesto sobre a síntese de proteínas. responsável pelo sequenciamento dos aminoácidos em um peptídeo com peso molecular de 27000 daltons? a) 810 b) 300 c) 270 d) 81000 e) 2700 . quantos nucleotídeos em média estão presentes em uma seqüência codificadora de ARN-m. Em 1958. lançando.39. as bases para a descoberta do código genético. apresentando suas hipóteses sobre a estrutura teórica da biologia molecular. a) o código genético é degenerado. um dos descobridores da estrutura da molécula de DNA. destaca-se o dogma central da Biologia. assim. c) cada polipeptídeo tem uma seqüência específica de nucleotídeos determinada pelo gene. Segundo esse dogma. será lembrado como um dos mais influentes cientistas de todos os tempos. que podem ser de quatro tipos diferentes. Entre as hipóteses apresentadas naquele texto. e deste para a proteína.

Com a descoberta do código genético sabe-se que um aminoácido é sempre codificado por três nucleotídeos. ou mais. a) Proteína normal: Val .GABARITO 1. isto é.manifestação dos sintomas da anemia falciforme. códons de finalização. pois o código genético dos terráqueos é formado por 64 códons. para um mesmo aminoácido existem vários códons diferentes. b) O DNA realiza a transcrição. b) A diversidade no planeta Terra seria maior. formado por pares de bases. .Val .alteração estrutural do polipeptídio (substituição do ácido glutâmico pela valina). permite a formação de apenas 16 códons diferentes. a) Os 'corrimãos' correspondem a uma sucessão alternada de fosfato e desoxirribose (açúcar). não seria possível a produção das proteínas B e C com. a) Produto da síntese protéica (polipeptídio): val . o gene que codifica uma proteína tem sempre maior número de nucleotídeos que de aminoácidos. 6.pro .glu . 5. .Val .Leu . 16 tipos diferentes de aminoácidos. Seu código genético. a) As proteínas produzidas pelos extraterrestres em questão. C é afetado porque possui um aminoácido diferente em sua proteína.Tre . 7. Porque o código genético é degenerado.glu . 2. Neste caso. Sabe-se ainda que existem vários nucleotídeos do gene que servem para a função de regulação e não são transcritos.Pro .Met .Leu .Pro . apesar da substituição de uma base nitrogenada no seu DNA. tipos e seqüências de seus aminoácidos.Tre . sendo 3 códons de finalização.Tir . Os 'degraus' são constituídos por pares de bases nitrogenadas.Tir . isto é.leu . e citosina com guanina. Assim o número de tipos distintos de aminoácidos presentes nos polipeptídeos seria.Pro . porque o código genético é degenerado. B é normal.lys b) Exemplo de mutação pontual no gene que codifica a cadeia da globina humana: substituição do nucleotídeo A por T no códon correspondente ao ácido glutâmico. poderiam ter. TTA. que conduz os códons para a síntese da proteína nos ribossomos. Isso sem considerar a possibilidade da existência de um.Pro Indivíduo B: Val . uma vez que o equipamento ribossômico da bactéria que incorporou o gene. Logo. c) As proteínas podem ser diferenciadas pelo número.Leu . especificaria o terceiro aminoácido da tabela. a) RNAm: UCC GUU AAU UCC GGC AAG b) O códon mutado.Tre . 4.alteração da função da proteína (globina). c) A proteína produzida pela bactéria terrestre "transgênica" não será idêntica ao polipeptídeo alienígena. unidas por pontes de hidrogênio.Tir . produz o RNA mensageiro. . respectivamente.Tre . está capacitado para traduzir códons constituídos por 3 bases nitrogenadas consecutivas. obviamente.redução da capacidade de transporte de oxigênio. no máximo. onde adenina pareia com timina. Conseqüência: anemia falciforme . maior.thr .Lis Indivíduo C: Val . 3.Val .Lis b) A é afetado porque produz uma proteína menor.Lis Indivíduo A: Val .his . 16 e 19 aminoácidos. .

K. [D] 22.R . [C] 29. b) 5'AUGCGU3'. a) RNA-polimerase. [D] 27.T . [A] 39. [A] . [A] 30. [D] 19. [E] 32. [C] 17.I .Leucina 10. A mutação deve ter alterado um códon que codificava um aminoácido transformando-o em um códon de parada. d) A proteína não será formada. [A] 38.E . 11. [A] 37. [B] 14. que interrompe a leitura do ARNm pelo ribossoma. [C] 33. b) UAC.O .N . a) 3'TACGCA5'. [C] 24.C . O RNA que será utilizado na tradução é o RNAm (RNA mensageiro). Treonina . [B] 40. [C] 28. 9.Arginina .C . 12. c) W . [B] 16.S . [A] 26. [C] 20. [A] 23. [C] 13. pois foi alterado o códon de iniciação. [D] 21. [D] 25.A .c) UUA 8. [A] 31. [C] 15. [C] 35. [E] 36. [E] 34. [A] 18.

Sign up to vote on this title
UsefulNot useful