EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007 1.

(Unicamp 2005) Em 25 de abril de 1953, um estudo de uma única página na revista inglesa Nature intitulado "A estrutura molecular dos ácidos nucléicos", quase ignorado de início, revolucionou para sempre todas as ciências da vida sejam elas do homem, rato, planta ou bactéria. James Watson e Francis Crick descobriram a estrutura do DNA, que permitiu posteriormente decifrar o código genético determinante para a síntese protéica. a) Watson e Crick demonstraram que a estrutura do DNA se assemelha a uma escada retorcida. Explique a que correspondem os "corrimãos" e os "degraus" dessa escada. b) Que relação existe entre DNA, RNA e síntese protéica? c) Como podemos diferenciar duas proteínas? 2. (Fuvest 96) Uma doença genética de herança dominante é causada por mutações em um gene localizado em um autossomo. Os indivíduos A, B e C têm mutações em um segmento de DNA desse gene, cuja seqüência normal está representada a seguir. Usando a tabela que relaciona alguns codons aos respectivos aminoácidos e considerando que a fita molde a ser transcrita é aquela assinalada com a letra m, responda: a) Quais serão os segmentos de proteínas produzidos, respectivamente, pelos indivíduos A, B e C? b) Como será o fenótipo (normal ou afetado dos indivíduos A, B e C? Por quê? Seqüência normal CAA AAC TGA GGA ATG CAT TTC (m) GTT TTG ACT CCT TAC GTA AAG Indivíduo A CAA AAC TGA GGA ATT CAT TTC (m) GTT TTG ACT CCT TAA GTA AAG Indivíduo B CAT AAC TGA GGA ATG CAT TTC (m) GTA TTG ACT CCT TAC GTA AAG Indivíduo C CAA TAC TGA GGA ATG CAT TTC (m) GTT ATG ACT CCT TAC GTA AAG

b) Utilize um exemplo de alteração estrutural da globina humana (cadeia beta) para explicar como uma mutação pontual. Explique por quê. cuja seqüência de nucleotídeos é 5' . Um gene é constituído por um número N de nucleotídeos que codifica uma proteína constituída por P aminoácidos. (Ufrj 97) O ADN é um polímero constituído por vários nucleotídeos e as proteínas são polímeros constituídos por vários aminoácidos.3. . utilizando-se da tabela do código genético apresentada a seguir. a partir da seqüência de aminoácidos de uma proteína. não se pode deduzir a seqüência de nucleotídeos do gene.AAG .CTG . pode afetar a saúde e a qualidade de vida do portador dessa mutação. é sempre possível deduzir-se a seqüência de aminoácidos de uma proteína a partir da seqüência de nucleotídeos do seu gene.ACT . (Ufrj 99) Com o auxílio da tabela do código genético representada a seguir. Por que sempre encontramos N > P ? 5. Entretanto. a) Considere o segmento de DNA.GAG . o oposto não é verdadeiro. isto é.CAC .CCT . 4. ou do RNA-m correspondentes.3' e. (Ufg 2005) As globinas constituem um bom exemplo da importância da informação genética na estrutura primária e na função das proteínas.GTG . do tipo substituição. forneça o produto da síntese protéica (polipeptídio parte da cadeia beta prevista para a globina humana).GAG .

faça uma comparação entre a diversidade dos organismos encontrados nesses dois planetas. qual seria o aminoácido da tabela a ser incorporado? c) Qual é anticódon correspondente ao novo aminoácido incorporado? . (Ufrn 2002) O DNA dos organismos do planeta Zbohrnya é constituído pelos mesmos 4 tipos de bases dos seres vivos terrestres. na 3 base do código correspondente ao 6Ž aminoácido do polipeptídeo. (Ufv 2000) Considere a tabela abaixo.6. b) Se ocorresse uma substituição. a proteína produzida pela expressão desse gene será idêntica à da espécie zbohrniana? Justifique sua resposta. Já o código genético desses organismos é determinado por códons de 2 bases. para resolver os itens seguintes: a) Determine a seqüência de bases do RNAm que foi utilizado para sintetizar o polipeptídeo esquematizado abaixo da tabela.5 bilhões de anos. Explique a possibilidade da ocorrência dessas três proteínas nos seres de Zbohrnya. 16 e 19 tipos diferentes de aminoácidos. 13. b) Sabendo que a vida em Zbohrnya e na Terra existe há 3. contendo códigos de trincas de bases do DNA com os aminoácidos correspondentes. respectivamente. a) As proteínas A. 7. encontradas nos organismos da Terra. apresentam. por uma purina. B e C. c) Se o gene de uma proteína respiratória de um organismo zbohrniano for introduzido numa bactéria terrestre.

após uma deleção do TERCEIRO nucleotídeo? 9. e ACU do RNA mensageiro codificam. Explique como essa única mutação pontual pode fazer com que a síntese da proteína seja interrompida prematuramente. ainda hoje. Analise a tabela e faça o que se pede: a) Cite o nome da enzima que catalisa a síntese de RNA mensageiro. sabemos que outros povos." . através dos vestígios materiais encontrados nas pesquisas arqueológicas. 10. (Unifesp 2006) Uma fita de DNA tem a seguinte seqüência de bases 5'ATGCGT3'. qual será a seqüência de bases da fita complementar? b) Se a fita complementar for usada durante a transcrição. CUG. italianos e de outros povos. A. alemães. Santa Cruz do Sul: EDUNISC. as três raças se mesclam em nossos descendentes. esse código segue o padrão do código genético universal. no qual três bases codificam um aminoácido. deixaram-nos um legado que. L. organizador. Ainda hoje. respectivamente os aminoácidos arginina. brancos e negros. qual será a seqüência de bases do RNA resultante e que nome recebe esse RNA se ele traduzir para síntese de proteínas? 11. b) Cite a seqüência do anticódon correspondente ao códon de iniciação. No entanto. Entretanto. (Ufv 2004) A tabela adiante representa uma versão fictícia do código genético. Diante da relevância do contexto e da vontade de valorizar o nosso povo nativo.TCT . como os Kaingáng.8. Escreva esses aminoácidos na ordem correspondente à seqüência TGA .GAC de um segmento de DNA. "Nossos ancestrais. diferencia-nos.. anteriores aos citados. uma mistura de índios. "o índio". protagonizaram a nossa história. 2004). foi selecionada a área temática CULTURA e as questões foram construídas com base na obra "Os Primeiros Habitantes do Rio Grande do Sul" (Custódio. d) Qual a seqüência de aminoácidos que resultará da tradução da mesma molécula de mRNA. (Ufrj 2004) Após tratar culturas de bactérias com doses de um agente mutagênico capaz de induzir uma única mutação pontual (que afeta apenas um nucleotídeo por célula). analisou-se a seqüência de aminoácidos de uma determinada proteína em diversos mutantes gerados. leucina e treonina. muitas vezes. c) Qual a seqüência de aminoácidos que resultará da tradução da molécula de RNA mensageiro? Ver figura anterior. B. (G2) Os códons AGA. Nosso chimarrão nos identifica em qualquer parte do mundo. Verificou-se que um desses mutantes produzia uma dada proteína que diferia da original pela ausência de 35 aminoácidos em uma das extremidades da cadeia peptídica. convivemos com grupos indígenas. a) Considerando que tenha ocorrido a ação da DNA-polimerase. TEXTO PARA A PRÓXIMA QUESTÃO (Ufsm 2006) A história da maioria dos municípios gaúchos coincide com a chegada dos primeiros portugueses. IPHAN.

moléculas sintetizam enzimas catalisadoras das reações metabólicas. d) apenas I e II. b) Uma das moléculas representadas no desenho não é normalmente encontrada no citoplasma celular. b) o núcleo produz moléculas que. 13.12. c) apenas III. nucleotídeos que são compostos por uma base nitrogenada. reflita sobre esse assunto e assinale a afirmativa INCORRETA. (Pucmg 2006) A figura mostra cinco tipos de moléculas de grande importância para uma célula animal. no citoplasma. formando ligações fosfo-diéster. O DNA presente nas mitocôndrias tem composição e estrutura típicas desse tipo de ácido nucléico. III. a) Uma das moléculas apresentadas pode fornecer informações para a produção de uma outra representada. para todas as partes da célula. e) o conteúdo do núcleo passa para o citoplasma e atua diretamente nas funções celulares. d) Uma das moléculas representadas pode favorecer a captação do carboidrato indicado no esquema. uma pentose e um radical "fosfato". promovem a síntese de enzimas catalisadoras das reações metabólicas. b) apenas II. duas cadeias polinucleotídicas paralelas e complementares entre si. d) dentro do núcleo. portanto é formado por I. Está(ão) correta(s) a) apenas I. catalisando as reações metabólicas. . c) o núcleo produz e envia. (Fuvest 2005) Quando afirmamos que o metabolismo da célula é controlado pelo núcleo celular. 14. moléculas que catalisam as reações metabólicas. Analise o esquema. c) Apenas duas das moléculas indicadas na figura podem ser quebradas e fornecer energia para as células. isso significa que a) todas as reações metabólicas são catalisadas por moléculas e componentes nucleares. uma cadeia de nucleotídeos em que as bases nitrogenadas interagem. através dos pareamentos de aminoácidos. II. e) apenas II e III.

não as proteínas que eles codificam. proposta por Richard Dawkins no livro "O gene egoísta". (. . e) ATGCACCT. existem regiões cromossômicas com alta taxa de mutação. d) errada.15. d) 38 cromossomos simples e 19 moléculas de DNA. cada página de cada volume contém um texto formado por uma seqüência de: a) fenótipos b) aminoácidos c) cromossomos d) bases nitrogenadas 19. que determinam a seqüência de bases do RNA mensageiro. nem no metabolismo celular. a) O DNA é constituído por códons.) No homem.. c) errada. b) correta. na produção das proteínas. porque não é possível decifrar todo o código genético. porque o código genético diz respeito à correspondência entre os códons do DNA e os aminoácidos nas proteínas. provocando a desnaturação dessas moléculas e. responsáveis pela produção das proteínas. c) 38 cromossomos simples e 38 moléculas de DNA. (Uerj 2004) É como se em cada quarto de um imenso prédio existisse uma estante contendo os planos do arquiteto para todo o prédio. Nessa analogia. b) No caso de uma mutação acarretar a transformação de um códon em outro relacionado ao mesmo aminoácido. e) 19 cromossomos duplicados e 19 moléculas de DNA. a finalização do Projeto Genoma Humano foi noticiada por vários meios de comunicação como sendo a "decifração do código genético humano". c) TACGTGGA. No núcleo do óvulo normal de uma gata são esperados: a) 19 cromossomos simples e 19 moléculas de DNA. d) As mutações atuam diretamente sobre as proteínas. não haverá alteração na molécula protéica formada. os planos do arquiteto montam 46 volumes. da maneira como foi veiculada. isto é. está a) correta. conseqüentemente. A informação. (Pucsp 2006) O gato doméstico ('Felis domestica') apresenta 38 cromossomos em suas células somáticas. e) Quando algumas proteínas são alteradas por mutações. suas funções no metabolismo celular passam a ser realizadas pelos aminoácidos. porque o Projeto decifrou os genes dos cromossomos humanos. proteínas que atuam como catalisadores e que podem sofrer mutações genéticas sendo modificadas ou eliminadas. b) 19 cromossomos duplicados e 38 moléculas de DNA. a ocorrência de mutações e as conseqüentes mudanças do ciclo de vida da célula. 18. c) A mutação altera a seqüência de aminoácidos do DNA. Assinale a alternativa correta. levando em conta os ácidos nucléicos. porque agora se sabe toda a seqüência de nucleotídeos dos cromossomos humanos. d) TCCACGTA. (Unifesp 2004) Em abril de 2003. porque agora se sabe toda a seqüência de genes dos cromossomos humanos. b) UACGUGGA. conseqüentemente. necessária à formação dos anticódons. 17. 16. e) errada. (Fatec 2006) O metabolismo celular depende de uma série de reações químicas controladas por enzimas.. a inativação delas. (Pucrs 2005) A seqüência de nucleotídeos ATGCACCT forma um segmento de DNA dupla hélice ao se ligar à fita complementar a) AUGCACCU. acarretando alterações na seqüência de bases do RNA mensageiro e.

Arg . b) GAA .AAA .GLI .GGU .Val .Arg .CUC. c) CTT . (Fatec 95) A tabela a seguir relaciona trincas de bases do DNA aos aminoácidos correspondentes.AAC.Ile . a seqüência de aminoácidos no polipeptídeo correspondente será.Arg .GGC . (Fuvest 94) Um gene de bactéria com 600 pares de bases nitrogenadas produzirá uma cadeia polipeptídica com número de aminoácidos aproximadamente igual a a) 200 b) 300 c) 600 d) 1200 e) 1800 .Ile c) Arg .Leu 21.Cis .GGA .UUG.UUU .Leu .UUU . d) GAA .LEU a) GUU .Cis d) Ile .Ile .Ile b) Leu .Cis . e) GUU .Val .Arg .CUC.Cis .UUU . de acordo com a tabela anterior: a) Cis . 22.FEN .CCG .Val .GGC .Leu e) Val . (Cesgranrio 92) A tabela a seguir mostra alguns aminoácidos e as trincas de bases no DNA que os identificam: Se um RNA mensageiro apresenta a seqüência de bases AUU AGA UGU GUU UUA.20.CTC.Leu .Val .TTT . Assinale a alternativa que apresenta a possível seqüência de códons para a formação do seguinte tetrapeptídeo: GLU .

(Puc-rio 2000) Com relação ao código genético e à síntese de proteínas. timina e uracil. e a tradução. que compreende a passagem do código genético do DNA para o RNA. pode corrigir defeitos no código . a) O aminoácido tirosina será substituído por outro aminoácido. UAU. cuja seqüência de bases é AAGTTTGGT.tirosina . compondo os cromossomos e ribossomos na forma de moléculas complexas de nucleoproteínas. c) A mutação é uma alteração do código genético de um organismo e pode ser provocada por radiações ou substâncias químicas. b) Todas as células do corpo têm a mesma coleção de genes. citosina. (Fuvest 95) Considere a seguinte tabela que indica seqüências de bases do RNA mensageiro e os aminoácidos por elas codificados. c) Duas grandes etapas estão envolvidas na síntese das proteínas: a transcrição. ou mesmo por exposição aos raios ultravioleta do sol. prolina. o códon UAG é terminal. lisina. por raios cósmicos. 24. respectivamente os aminoácidos cisteína. (Puc-rio 2001) Em 1987. b) Aspargina. foi oficialmente fundado o Projeto Genoma. d) A mutação constitui uma alteração na seqüência de bases nitrogenadas de um segmento de DNA e pode ser provocada por radiações. Este processo chama-se diferenciação celular. lisina. b) Os ácidos nucléicos podem aparecer livres na célula ou podem estar associados a proteínas. pois qualquer modificação na fita de DNA é imediatamente corrigida. que codifica a seqüência serina . apesar disso. Indique a alternativa ERRADA relativa ao código genético e à síntese de proteínas: a) Os genes são formados por ácido desoxirribonucleico e controlam a produção de proteínas da célula. c) A seqüência não será traduzida. encontramos células com formas e funções diferentes. alanina e serina. assinale a afirmativa FALSA. leucina. c) Fenilalanina. e) A Engenharia Genética. GCC e AGC codificam. apesar disto. e) Todas as células do corpo têm a mesma coleção de genes. indica a interrupção da tradução. pois essa molécula de DNA alterada não é capaz de comandar esse processo.cisteína . e) Valina. valina. lisina.23. tirosina. sofreu a perda da 9 base nitrogenada. lisina. resultando numa molécula com 3 aminoácidos. 25. Assinale a alternativa que descreve o que acontecerá com a seqüência de aminoácidos. e) A seqüência não sofrerá prejuízo. nem as suas características. que visa decifrar e mapear o código genético humano. que é uma técnica de manipulação dos genes. Um fragmento de DNA. valina. d) As mudanças na programação genética de um organismo não alteram a produção de proteínas. mas. qual seria a seqüência de aminoácidos codificada? a) Aspargina. por raios-X. encontramos células com formas e funções diferentes. prolina. d) Fenilalanina. prolina. d) A tradução será interrompida no 2Ž aminoácido. encontramos sempre desoxirribose e cinco tipos de bases: adenina. guanina. que compreende o trabalho do RNA de organização dos aminoácidos na seqüência determinada pelo código genético. mas.alanina. a) Na molécula de DNA. 26. Com base na tabela fornecida e considerando um segmento hipotético de DNA. determinando as características de um ser vivo. b) O aminoácido tirosina não será traduzido. (Mackenzie 99) Os códons UGC. ou seja.

o codon da metionina é também o do início da tradução. respectivamente: a) lisina e cisteína b) treonina e triptofano c) alanina e ácido glutâmico d) fenil alanina e ácido aspártico . UAG e UGA.genético de um organismo. 27. (Uerj 2005) A mutação em um gene. Observe que: . 28. por conseqüência da substituição de uma única base na estrutura do DNA. (Uel 98) Considere os seguintes códons do RNA mensageiro e os aminoácidos por eles especificados: ACA = treonina GUU = valina Assinale a alternativa da tabela a seguir que indica corretamente os anticódons do RNAt e os códons do DNA relacionados com esses aminoácidos. pode acarretar modificações importantes na atividade biológica da proteína codificada por esse gene. . Considere que a estrutura normal de um RNA mensageiro de um peptídio e sua estrutura alterada em virtude da troca de uma única base no gene correspondente são: 5' AUGUGGUUUGCACACAAAUGAUAA 3' (normal) 5' AUGUGGUUUGAACACAAAUGAUAA 3' (alterada) A tabela a seguir identifica alguns codons.os codons de término da tradução são UAA. O aminoácido encontrado no peptídio normal e aquele que o substituiu no peptídio mutante são.

respectivamente.ribossômico 33. b) arginina. GCA e UGA. e) Se a ação desse ácido for bloqueada. leucina. treonina. unindo-se aos aminoácidos. que especificam esses aminoácidos. (G2) A seqüência de aminoácidos de uma proteína é determinada pela seqüência de a) pentoses da molécula de DNA. c) leucina. d) Os anticódons do 1ª do 2ª códon dessa seqüência são. d) treonina. d) bases da molécula de RNA . . c) Esse ácido nucléico é produzido no núcleo e se dirige ao citoplasma. que representa um fragmento de ácido nucléico. representada em II. 31. (Mackenzie 2001) Considerando o esquema acima. leucina e treonina. e) leucina. os aminoácidos arginina. o processo de transcrição não ocorrerá. b) Cada trinca de bases. assinale a alternativa INCORRETA.29. devem estar presentes no seu mRNA? a) 100 b) 33 c) 99 d) 300 e) 500 30. quantos códons. CUG e ACU do RNA mensageiro codificam. a) treonina.mensageiro. e) bases da molécula de RNA . A seqüência desses aminoácidos na proteína correspondente ao segmento do DNA que apresenta a seqüência de nucleotídeos GAC TGA TCT será. (Ufpi 2000) Se uma proteína possui 100 aminoácidos. 32. leucina. é denominada anticódon. arginina. (Ufrn 2000) Observe as seqüências de nucleotídeos de um vírus de RNA: 5' GCA UCA CAC CUC AUU GCG UAG 3' Considerando que esse segmento de RNA codifica um determinado peptídeo. é correto afirmar: a) Os códons dessa seqüência sinalizam os mesmos aminoácidos em seres humanos. arginina. leucina. respectivamente. b) A inserção de um nucleotídeo entre a 4 e a 5 base não altera o código genético. arginina. respectivamente. arginina. a) A substância representada em I é obrigatoriamente ribose. treonina. cuja função é transportar aminoácidos. d) II pode apresentar moléculas de adenina. c) bases da molécula de DNA.transportador. c) Os códons GCA e GCG são degenerados porque codificam aminoácidos diferentes. treonina. b) pentoses da molécula de RNA . (Unifesp 2007) Os códons AGA.

EXCETO: a) macromoléculas de reserva energética.ACG . c) o transporte de aminoácido para o local da síntese é feito pelo mRNA.34.CUA .GAU . 35.GAC e) GCA .ACG . d) moléculas utilizadas nos processos de cicatrização. Nesse processo ocorre produção de. Uma delas é a síntese de proteína. (Pucmg 99) O DNA apresenta importantes funções celulares. por exemplo.GUA .CGA . b) a posição dos aminoácidos na cadeia polipeptídica depende da seqüência de bases do tRNA. A função celular drasticamente afetada por essa mutação será a) a replicação do DNA.CUT .CTA . 37. e) o transporte de RNA.ACT . (Pucmg 2007) O esquema a seguir é um processo celular vital.TAC c) TUG . (Ufc 99) Sobre os diferentes papéis dos ácidos nucléicos na síntese de proteínas podemos afirmar corretamente que: a) a seqüência de bases no DNA determina a seqüência de aminoácidos na cadeia polipeptídica. .UAC b) ATG .TCG . d) o transporte de proteínas. c) moléculas de defesa do corpo. no processo digestivo.CGU 38. que ocorre também em você. e) a extremidade livre dos diversos tRNA tem seqüências de bases diferentes. (Ufal 99) Considere os seguintes códons: UAC .UCG .UTC d) AGT .AUG Os anti-códons correspondentes são: a) AUG . b) a síntese de RNA mensageiros. o filamento de DNA que proporcionou essa síntese deverá ter o seguinte número total de nucleotídeos: a) 62 b) 93 c) 186 d) 279 e) 558 36. b) enzimas usadas. Numa síntese de proteína com 185 ligações peptídicas. (Puccamp 2002) Um mutante perdeu um segmento de DNA contendo todas as cópias dos genes que codificam RNA transportador. c) a síntese de proteínas.UGC . d) a seqüência de bases do rRNA é transcrita a partir do código do mRNA.

apresentando suas hipóteses sobre a estrutura teórica da biologia molecular. Entre as hipóteses apresentadas naquele texto. que podem ser de quatro tipos diferentes. publicou um manifesto sobre a síntese de proteínas. Segundo esse dogma. lançando. as bases para a descoberta do código genético. d) cada molécula de DNA é formada pela reunião de nucleotídeos. e) uma molécula de DNA difere de outra pela seqüência de seus nucleotídeos.39. a) o código genético é degenerado. um dos descobridores da estrutura da molécula de DNA. destaca-se o dogma central da Biologia. c) cada polipeptídeo tem uma seqüência específica de nucleotídeos determinada pelo gene. b) a transferência de informações genéticas ocorre do DNA para o RNA. pois um aminoácido pode ser codificado por mais de uma trinca. assim. Em 1958. quantos nucleotídeos em média estão presentes em uma seqüência codificadora de ARN-m. (Unirio 2003) Supondo que o peso molecular médio de um aminoácido é de 100 daltons. 40. será lembrado como um dos mais influentes cientistas de todos os tempos. (Ufrs 2005) O cientista britânico Francis Crick. morto em julho de 2004. responsável pelo sequenciamento dos aminoácidos em um peptídeo com peso molecular de 27000 daltons? a) 810 b) 300 c) 270 d) 81000 e) 2700 . e deste para a proteína.

porque o código genético é degenerado. C é afetado porque possui um aminoácido diferente em sua proteína.Leu . 4. 3. 6. a) Proteína normal: Val .Tre . c) As proteínas podem ser diferenciadas pelo número. produz o RNA mensageiro. códons de finalização. o gene que codifica uma proteína tem sempre maior número de nucleotídeos que de aminoácidos. tipos e seqüências de seus aminoácidos. a) Produto da síntese protéica (polipeptídio): val .lys b) Exemplo de mutação pontual no gene que codifica a cadeia da globina humana: substituição do nucleotídeo A por T no códon correspondente ao ácido glutâmico. c) A proteína produzida pela bactéria terrestre "transgênica" não será idêntica ao polipeptídeo alienígena. 5. isto é.Tir . B é normal. Seu código genético. a) RNAm: UCC GUU AAU UCC GGC AAG b) O códon mutado.Tre . Porque o código genético é degenerado.redução da capacidade de transporte de oxigênio.Val .manifestação dos sintomas da anemia falciforme. Com a descoberta do código genético sabe-se que um aminoácido é sempre codificado por três nucleotídeos.leu . obviamente. que conduz os códons para a síntese da proteína nos ribossomos.pro .thr .Tre . isto é. maior. . Neste caso.Lis Indivíduo A: Val . Os 'degraus' são constituídos por pares de bases nitrogenadas. .Tir .Pro . b) O DNA realiza a transcrição. uma vez que o equipamento ribossômico da bactéria que incorporou o gene. Conseqüência: anemia falciforme . 2. Assim o número de tipos distintos de aminoácidos presentes nos polipeptídeos seria.Lis b) A é afetado porque produz uma proteína menor. e citosina com guanina. pois o código genético dos terráqueos é formado por 64 códons. no máximo. permite a formação de apenas 16 códons diferentes.Tre .Val . TTA.his . unidas por pontes de hidrogênio. b) A diversidade no planeta Terra seria maior.Lis Indivíduo C: Val .alteração estrutural do polipeptídio (substituição do ácido glutâmico pela valina).glu .Leu .Leu .Pro Indivíduo B: Val . especificaria o terceiro aminoácido da tabela. Sabe-se ainda que existem vários nucleotídeos do gene que servem para a função de regulação e não são transcritos. para um mesmo aminoácido existem vários códons diferentes. respectivamente.GABARITO 1. ou mais.alteração da função da proteína (globina). está capacitado para traduzir códons constituídos por 3 bases nitrogenadas consecutivas. a) As proteínas produzidas pelos extraterrestres em questão. onde adenina pareia com timina. .Pro . poderiam ter. a) Os 'corrimãos' correspondem a uma sucessão alternada de fosfato e desoxirribose (açúcar). formado por pares de bases. sendo 3 códons de finalização. Isso sem considerar a possibilidade da existência de um. 16 tipos diferentes de aminoácidos.Val . .Met .Pro .Tir . 7. 16 e 19 aminoácidos. apesar da substituição de uma base nitrogenada no seu DNA.glu . Logo. não seria possível a produção das proteínas B e C com.

[A] 18.C . c) W . b) UAC. [D] 25. [E] 36.I . [B] 14.E . [C] 20. [C] 24.S . [C] 15. [D] 22.A . [C] 35. [D] 21.Leucina 10. [C] 29. 11. [C] 33.R . [C] 17. [A] 38. O RNA que será utilizado na tradução é o RNAm (RNA mensageiro). d) A proteína não será formada. [A] 39.K. [A] 23. [A] .C . [E] 32. [B] 40. [C] 28.N . que interrompe a leitura do ARNm pelo ribossoma. [A] 37.O . b) 5'AUGCGU3'. a) RNA-polimerase.c) UUA 8. [D] 19. Treonina . A mutação deve ter alterado um códon que codificava um aminoácido transformando-o em um códon de parada.Arginina . [A] 31. [E] 34. [C] 13. [A] 26. 12. [A] 30. a) 3'TACGCA5'. [D] 27.T . 9. pois foi alterado o códon de iniciação. [B] 16.

Sign up to vote on this title
UsefulNot useful