EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007 1.

(Unicamp 2005) Em 25 de abril de 1953, um estudo de uma única página na revista inglesa Nature intitulado "A estrutura molecular dos ácidos nucléicos", quase ignorado de início, revolucionou para sempre todas as ciências da vida sejam elas do homem, rato, planta ou bactéria. James Watson e Francis Crick descobriram a estrutura do DNA, que permitiu posteriormente decifrar o código genético determinante para a síntese protéica. a) Watson e Crick demonstraram que a estrutura do DNA se assemelha a uma escada retorcida. Explique a que correspondem os "corrimãos" e os "degraus" dessa escada. b) Que relação existe entre DNA, RNA e síntese protéica? c) Como podemos diferenciar duas proteínas? 2. (Fuvest 96) Uma doença genética de herança dominante é causada por mutações em um gene localizado em um autossomo. Os indivíduos A, B e C têm mutações em um segmento de DNA desse gene, cuja seqüência normal está representada a seguir. Usando a tabela que relaciona alguns codons aos respectivos aminoácidos e considerando que a fita molde a ser transcrita é aquela assinalada com a letra m, responda: a) Quais serão os segmentos de proteínas produzidos, respectivamente, pelos indivíduos A, B e C? b) Como será o fenótipo (normal ou afetado dos indivíduos A, B e C? Por quê? Seqüência normal CAA AAC TGA GGA ATG CAT TTC (m) GTT TTG ACT CCT TAC GTA AAG Indivíduo A CAA AAC TGA GGA ATT CAT TTC (m) GTT TTG ACT CCT TAA GTA AAG Indivíduo B CAT AAC TGA GGA ATG CAT TTC (m) GTA TTG ACT CCT TAC GTA AAG Indivíduo C CAA TAC TGA GGA ATG CAT TTC (m) GTT ATG ACT CCT TAC GTA AAG

ACT . é sempre possível deduzir-se a seqüência de aminoácidos de uma proteína a partir da seqüência de nucleotídeos do seu gene. (Ufrj 97) O ADN é um polímero constituído por vários nucleotídeos e as proteínas são polímeros constituídos por vários aminoácidos.GAG . utilizando-se da tabela do código genético apresentada a seguir. não se pode deduzir a seqüência de nucleotídeos do gene. Por que sempre encontramos N > P ? 5.3' e. b) Utilize um exemplo de alteração estrutural da globina humana (cadeia beta) para explicar como uma mutação pontual.GAG . do tipo substituição.GTG . (Ufg 2005) As globinas constituem um bom exemplo da importância da informação genética na estrutura primária e na função das proteínas. cuja seqüência de nucleotídeos é 5' . Um gene é constituído por um número N de nucleotídeos que codifica uma proteína constituída por P aminoácidos.CAC . a) Considere o segmento de DNA. ou do RNA-m correspondentes.CCT . forneça o produto da síntese protéica (polipeptídio parte da cadeia beta prevista para a globina humana). o oposto não é verdadeiro.CTG .AAG . a partir da seqüência de aminoácidos de uma proteína. isto é. 4.3. (Ufrj 99) Com o auxílio da tabela do código genético representada a seguir. Entretanto. Explique por quê. pode afetar a saúde e a qualidade de vida do portador dessa mutação. .

na 3 base do código correspondente ao 6Ž aminoácido do polipeptídeo. b) Se ocorresse uma substituição. Explique a possibilidade da ocorrência dessas três proteínas nos seres de Zbohrnya. 16 e 19 tipos diferentes de aminoácidos. a proteína produzida pela expressão desse gene será idêntica à da espécie zbohrniana? Justifique sua resposta. Já o código genético desses organismos é determinado por códons de 2 bases. c) Se o gene de uma proteína respiratória de um organismo zbohrniano for introduzido numa bactéria terrestre. encontradas nos organismos da Terra. respectivamente.5 bilhões de anos. contendo códigos de trincas de bases do DNA com os aminoácidos correspondentes.6. 13. 7. B e C. b) Sabendo que a vida em Zbohrnya e na Terra existe há 3. faça uma comparação entre a diversidade dos organismos encontrados nesses dois planetas. para resolver os itens seguintes: a) Determine a seqüência de bases do RNAm que foi utilizado para sintetizar o polipeptídeo esquematizado abaixo da tabela. (Ufv 2000) Considere a tabela abaixo. a) As proteínas A. (Ufrn 2002) O DNA dos organismos do planeta Zbohrnya é constituído pelos mesmos 4 tipos de bases dos seres vivos terrestres. apresentam. qual seria o aminoácido da tabela a ser incorporado? c) Qual é anticódon correspondente ao novo aminoácido incorporado? . por uma purina.

uma mistura de índios. italianos e de outros povos.GAC de um segmento de DNA. (G2) Os códons AGA." . 10. Diante da relevância do contexto e da vontade de valorizar o nosso povo nativo. (Ufv 2004) A tabela adiante representa uma versão fictícia do código genético. deixaram-nos um legado que. esse código segue o padrão do código genético universal. após uma deleção do TERCEIRO nucleotídeo? 9. diferencia-nos. respectivamente os aminoácidos arginina. anteriores aos citados. foi selecionada a área temática CULTURA e as questões foram construídas com base na obra "Os Primeiros Habitantes do Rio Grande do Sul" (Custódio.. organizador. através dos vestígios materiais encontrados nas pesquisas arqueológicas. CUG. Explique como essa única mutação pontual pode fazer com que a síntese da proteína seja interrompida prematuramente. b) Cite a seqüência do anticódon correspondente ao códon de iniciação. sabemos que outros povos. analisou-se a seqüência de aminoácidos de uma determinada proteína em diversos mutantes gerados. d) Qual a seqüência de aminoácidos que resultará da tradução da mesma molécula de mRNA. ainda hoje. 2004). no qual três bases codificam um aminoácido. leucina e treonina. Ainda hoje. a) Considerando que tenha ocorrido a ação da DNA-polimerase. IPHAN. Entretanto. TEXTO PARA A PRÓXIMA QUESTÃO (Ufsm 2006) A história da maioria dos municípios gaúchos coincide com a chegada dos primeiros portugueses. qual será a seqüência de bases do RNA resultante e que nome recebe esse RNA se ele traduzir para síntese de proteínas? 11. Analise a tabela e faça o que se pede: a) Cite o nome da enzima que catalisa a síntese de RNA mensageiro. L. protagonizaram a nossa história. c) Qual a seqüência de aminoácidos que resultará da tradução da molécula de RNA mensageiro? Ver figura anterior.8. convivemos com grupos indígenas. muitas vezes. como os Kaingáng. e ACU do RNA mensageiro codificam. brancos e negros. "o índio". qual será a seqüência de bases da fita complementar? b) Se a fita complementar for usada durante a transcrição. B. (Unifesp 2006) Uma fita de DNA tem a seguinte seqüência de bases 5'ATGCGT3'. Santa Cruz do Sul: EDUNISC. "Nossos ancestrais. (Ufrj 2004) Após tratar culturas de bactérias com doses de um agente mutagênico capaz de induzir uma única mutação pontual (que afeta apenas um nucleotídeo por célula). No entanto. as três raças se mesclam em nossos descendentes. alemães. Verificou-se que um desses mutantes produzia uma dada proteína que diferia da original pela ausência de 35 aminoácidos em uma das extremidades da cadeia peptídica.TCT . A. Escreva esses aminoácidos na ordem correspondente à seqüência TGA . Nosso chimarrão nos identifica em qualquer parte do mundo.

c) apenas III. a) Uma das moléculas apresentadas pode fornecer informações para a produção de uma outra representada. 14. e) o conteúdo do núcleo passa para o citoplasma e atua diretamente nas funções celulares. isso significa que a) todas as reações metabólicas são catalisadas por moléculas e componentes nucleares. catalisando as reações metabólicas. b) apenas II. portanto é formado por I. (Fuvest 2005) Quando afirmamos que o metabolismo da célula é controlado pelo núcleo celular. c) o núcleo produz e envia. formando ligações fosfo-diéster. para todas as partes da célula. reflita sobre esse assunto e assinale a afirmativa INCORRETA. uma pentose e um radical "fosfato". no citoplasma. moléculas que catalisam as reações metabólicas. nucleotídeos que são compostos por uma base nitrogenada. . moléculas sintetizam enzimas catalisadoras das reações metabólicas. Analise o esquema. duas cadeias polinucleotídicas paralelas e complementares entre si. III.12. O DNA presente nas mitocôndrias tem composição e estrutura típicas desse tipo de ácido nucléico. promovem a síntese de enzimas catalisadoras das reações metabólicas. e) apenas II e III. uma cadeia de nucleotídeos em que as bases nitrogenadas interagem. c) Apenas duas das moléculas indicadas na figura podem ser quebradas e fornecer energia para as células. d) Uma das moléculas representadas pode favorecer a captação do carboidrato indicado no esquema. d) apenas I e II. b) o núcleo produz moléculas que. através dos pareamentos de aminoácidos. II. (Pucmg 2006) A figura mostra cinco tipos de moléculas de grande importância para uma célula animal. 13. d) dentro do núcleo. Está(ão) correta(s) a) apenas I. b) Uma das moléculas representadas no desenho não é normalmente encontrada no citoplasma celular.

d) TCCACGTA. No núcleo do óvulo normal de uma gata são esperados: a) 19 cromossomos simples e 19 moléculas de DNA. (Uerj 2004) É como se em cada quarto de um imenso prédio existisse uma estante contendo os planos do arquiteto para todo o prédio. 17. conseqüentemente. na produção das proteínas. Assinale a alternativa correta. A informação. Nessa analogia. existem regiões cromossômicas com alta taxa de mutação. (Pucsp 2006) O gato doméstico ('Felis domestica') apresenta 38 cromossomos em suas células somáticas. a) O DNA é constituído por códons. a ocorrência de mutações e as conseqüentes mudanças do ciclo de vida da célula. e) Quando algumas proteínas são alteradas por mutações. (Unifesp 2004) Em abril de 2003. necessária à formação dos anticódons. que determinam a seqüência de bases do RNA mensageiro. proposta por Richard Dawkins no livro "O gene egoísta".15.. da maneira como foi veiculada. e) ATGCACCT. b) UACGUGGA.. provocando a desnaturação dessas moléculas e. (Pucrs 2005) A seqüência de nucleotídeos ATGCACCT forma um segmento de DNA dupla hélice ao se ligar à fita complementar a) AUGCACCU. não haverá alteração na molécula protéica formada. (. cada página de cada volume contém um texto formado por uma seqüência de: a) fenótipos b) aminoácidos c) cromossomos d) bases nitrogenadas 19. b) 19 cromossomos duplicados e 38 moléculas de DNA. c) A mutação altera a seqüência de aminoácidos do DNA. d) 38 cromossomos simples e 19 moléculas de DNA. c) errada. e) 19 cromossomos duplicados e 19 moléculas de DNA. porque agora se sabe toda a seqüência de genes dos cromossomos humanos. c) 38 cromossomos simples e 38 moléculas de DNA. c) TACGTGGA. conseqüentemente. os planos do arquiteto montam 46 volumes. e) errada. isto é.) No homem. 18. suas funções no metabolismo celular passam a ser realizadas pelos aminoácidos. nem no metabolismo celular. porque o Projeto decifrou os genes dos cromossomos humanos. . a inativação delas. proteínas que atuam como catalisadores e que podem sofrer mutações genéticas sendo modificadas ou eliminadas. porque o código genético diz respeito à correspondência entre os códons do DNA e os aminoácidos nas proteínas. está a) correta. levando em conta os ácidos nucléicos. b) No caso de uma mutação acarretar a transformação de um códon em outro relacionado ao mesmo aminoácido. (Fatec 2006) O metabolismo celular depende de uma série de reações químicas controladas por enzimas. porque agora se sabe toda a seqüência de nucleotídeos dos cromossomos humanos. d) errada. acarretando alterações na seqüência de bases do RNA mensageiro e. b) correta. não as proteínas que eles codificam. a finalização do Projeto Genoma Humano foi noticiada por vários meios de comunicação como sendo a "decifração do código genético humano". responsáveis pela produção das proteínas. porque não é possível decifrar todo o código genético. d) As mutações atuam diretamente sobre as proteínas. 16.

Ile . b) GAA . 22.GGC .CUC.20.UUU .Cis d) Ile . (Fatec 95) A tabela a seguir relaciona trincas de bases do DNA aos aminoácidos correspondentes. de acordo com a tabela anterior: a) Cis . (Cesgranrio 92) A tabela a seguir mostra alguns aminoácidos e as trincas de bases no DNA que os identificam: Se um RNA mensageiro apresenta a seqüência de bases AUU AGA UGU GUU UUA.UUG.Leu .Val .Leu . a seqüência de aminoácidos no polipeptídeo correspondente será.GGC .Val .AAA .LEU a) GUU .Cis .CTC.UUU .UUU .CCG .Cis .Val .Arg .Ile b) Leu . d) GAA .FEN . Assinale a alternativa que apresenta a possível seqüência de códons para a formação do seguinte tetrapeptídeo: GLU .TTT .Leu e) Val .Ile c) Arg .Ile .Arg .Arg .AAC.Cis .GLI .GGU .Leu 21. c) CTT .GGA .Val .Arg . (Fuvest 94) Um gene de bactéria com 600 pares de bases nitrogenadas produzirá uma cadeia polipeptídica com número de aminoácidos aproximadamente igual a a) 200 b) 300 c) 600 d) 1200 e) 1800 . e) GUU .CUC.

GCC e AGC codificam. que é uma técnica de manipulação dos genes. encontramos células com formas e funções diferentes. valina.alanina. Indique a alternativa ERRADA relativa ao código genético e à síntese de proteínas: a) Os genes são formados por ácido desoxirribonucleico e controlam a produção de proteínas da célula. e a tradução. apesar disso. lisina. que codifica a seqüência serina . d) As mudanças na programação genética de um organismo não alteram a produção de proteínas. qual seria a seqüência de aminoácidos codificada? a) Aspargina. que compreende o trabalho do RNA de organização dos aminoácidos na seqüência determinada pelo código genético. c) A mutação é uma alteração do código genético de um organismo e pode ser provocada por radiações ou substâncias químicas.cisteína . d) A tradução será interrompida no 2Ž aminoácido. respectivamente os aminoácidos cisteína. d) A mutação constitui uma alteração na seqüência de bases nitrogenadas de um segmento de DNA e pode ser provocada por radiações. valina. nem as suas características. (Fuvest 95) Considere a seguinte tabela que indica seqüências de bases do RNA mensageiro e os aminoácidos por elas codificados. resultando numa molécula com 3 aminoácidos. foi oficialmente fundado o Projeto Genoma. 24. b) Os ácidos nucléicos podem aparecer livres na célula ou podem estar associados a proteínas. 25. que compreende a passagem do código genético do DNA para o RNA. leucina. b) O aminoácido tirosina não será traduzido. cuja seqüência de bases é AAGTTTGGT. e) A seqüência não sofrerá prejuízo. b) Aspargina. d) Fenilalanina. lisina. Este processo chama-se diferenciação celular. prolina. que visa decifrar e mapear o código genético humano. pois qualquer modificação na fita de DNA é imediatamente corrigida. prolina. mas. UAU. pois essa molécula de DNA alterada não é capaz de comandar esse processo. sofreu a perda da 9 base nitrogenada. Com base na tabela fornecida e considerando um segmento hipotético de DNA. por raios cósmicos. e) Todas as células do corpo têm a mesma coleção de genes. guanina. encontramos sempre desoxirribose e cinco tipos de bases: adenina. o códon UAG é terminal. (Puc-rio 2001) Em 1987. c) A seqüência não será traduzida. a) Na molécula de DNA. determinando as características de um ser vivo. e) Valina. c) Duas grandes etapas estão envolvidas na síntese das proteínas: a transcrição. (Mackenzie 99) Os códons UGC. indica a interrupção da tradução.23. pode corrigir defeitos no código . c) Fenilalanina. encontramos células com formas e funções diferentes. mas. Assinale a alternativa que descreve o que acontecerá com a seqüência de aminoácidos. apesar disto. 26. alanina e serina. a) O aminoácido tirosina será substituído por outro aminoácido. ou seja.tirosina . lisina. assinale a afirmativa FALSA. b) Todas as células do corpo têm a mesma coleção de genes. timina e uracil. citosina. (Puc-rio 2000) Com relação ao código genético e à síntese de proteínas. Um fragmento de DNA. ou mesmo por exposição aos raios ultravioleta do sol. compondo os cromossomos e ribossomos na forma de moléculas complexas de nucleoproteínas. lisina. prolina. por raios-X. e) A Engenharia Genética. tirosina.

UAG e UGA. por conseqüência da substituição de uma única base na estrutura do DNA.os codons de término da tradução são UAA.genético de um organismo. 28. (Uel 98) Considere os seguintes códons do RNA mensageiro e os aminoácidos por eles especificados: ACA = treonina GUU = valina Assinale a alternativa da tabela a seguir que indica corretamente os anticódons do RNAt e os códons do DNA relacionados com esses aminoácidos.o codon da metionina é também o do início da tradução. respectivamente: a) lisina e cisteína b) treonina e triptofano c) alanina e ácido glutâmico d) fenil alanina e ácido aspártico . pode acarretar modificações importantes na atividade biológica da proteína codificada por esse gene. . (Uerj 2005) A mutação em um gene. Observe que: . O aminoácido encontrado no peptídio normal e aquele que o substituiu no peptídio mutante são. Considere que a estrutura normal de um RNA mensageiro de um peptídio e sua estrutura alterada em virtude da troca de uma única base no gene correspondente são: 5' AUGUGGUUUGCACACAAAUGAUAA 3' (normal) 5' AUGUGGUUUGAACACAAAUGAUAA 3' (alterada) A tabela a seguir identifica alguns codons. 27.

que especificam esses aminoácidos. o processo de transcrição não ocorrerá. (G2) A seqüência de aminoácidos de uma proteína é determinada pela seqüência de a) pentoses da molécula de DNA. b) arginina. respectivamente. respectivamente. (Ufrn 2000) Observe as seqüências de nucleotídeos de um vírus de RNA: 5' GCA UCA CAC CUC AUU GCG UAG 3' Considerando que esse segmento de RNA codifica um determinado peptídeo. a) A substância representada em I é obrigatoriamente ribose. A seqüência desses aminoácidos na proteína correspondente ao segmento do DNA que apresenta a seqüência de nucleotídeos GAC TGA TCT será. os aminoácidos arginina. d) II pode apresentar moléculas de adenina. leucina e treonina. quantos códons. leucina. d) treonina. leucina. c) Esse ácido nucléico é produzido no núcleo e se dirige ao citoplasma.ribossômico 33. arginina. c) Os códons GCA e GCG são degenerados porque codificam aminoácidos diferentes. arginina. assinale a alternativa INCORRETA. treonina. que representa um fragmento de ácido nucléico.mensageiro. d) Os anticódons do 1ª do 2ª códon dessa seqüência são. 31. arginina. e) bases da molécula de RNA . (Unifesp 2007) Os códons AGA. GCA e UGA. devem estar presentes no seu mRNA? a) 100 b) 33 c) 99 d) 300 e) 500 30. 32.transportador. b) pentoses da molécula de RNA . arginina. CUG e ACU do RNA mensageiro codificam. leucina. (Ufpi 2000) Se uma proteína possui 100 aminoácidos. b) A inserção de um nucleotídeo entre a 4 e a 5 base não altera o código genético.29. a) treonina. . c) leucina. d) bases da molécula de RNA . cuja função é transportar aminoácidos. treonina. é denominada anticódon. e) leucina. e) Se a ação desse ácido for bloqueada. c) bases da molécula de DNA. treonina. unindo-se aos aminoácidos. é correto afirmar: a) Os códons dessa seqüência sinalizam os mesmos aminoácidos em seres humanos. b) Cada trinca de bases. (Mackenzie 2001) Considerando o esquema acima. representada em II. respectivamente.

34. e) o transporte de RNA. d) moléculas utilizadas nos processos de cicatrização.ACG . e) a extremidade livre dos diversos tRNA tem seqüências de bases diferentes. 35. (Pucmg 2007) O esquema a seguir é um processo celular vital. EXCETO: a) macromoléculas de reserva energética.ACG .UAC b) ATG . (Pucmg 99) O DNA apresenta importantes funções celulares. Numa síntese de proteína com 185 ligações peptídicas. . c) moléculas de defesa do corpo. b) enzimas usadas.UGC .ACT . o filamento de DNA que proporcionou essa síntese deverá ter o seguinte número total de nucleotídeos: a) 62 b) 93 c) 186 d) 279 e) 558 36. b) a síntese de RNA mensageiros. Uma delas é a síntese de proteína.CGU 38. c) a síntese de proteínas. que ocorre também em você.CTA .UCG . 37.CGA . no processo digestivo.UTC d) AGT . (Ufal 99) Considere os seguintes códons: UAC . por exemplo.GUA . (Puccamp 2002) Um mutante perdeu um segmento de DNA contendo todas as cópias dos genes que codificam RNA transportador. A função celular drasticamente afetada por essa mutação será a) a replicação do DNA.AUG Os anti-códons correspondentes são: a) AUG . d) o transporte de proteínas. Nesse processo ocorre produção de.GAU .TCG .TAC c) TUG . (Ufc 99) Sobre os diferentes papéis dos ácidos nucléicos na síntese de proteínas podemos afirmar corretamente que: a) a seqüência de bases no DNA determina a seqüência de aminoácidos na cadeia polipeptídica.CUA .CUT . d) a seqüência de bases do rRNA é transcrita a partir do código do mRNA.GAC e) GCA . c) o transporte de aminoácido para o local da síntese é feito pelo mRNA. b) a posição dos aminoácidos na cadeia polipeptídica depende da seqüência de bases do tRNA.

Segundo esse dogma. c) cada polipeptídeo tem uma seqüência específica de nucleotídeos determinada pelo gene. (Unirio 2003) Supondo que o peso molecular médio de um aminoácido é de 100 daltons. destaca-se o dogma central da Biologia. Entre as hipóteses apresentadas naquele texto. será lembrado como um dos mais influentes cientistas de todos os tempos. lançando. as bases para a descoberta do código genético. 40. que podem ser de quatro tipos diferentes.39. a) o código genético é degenerado. pois um aminoácido pode ser codificado por mais de uma trinca. (Ufrs 2005) O cientista britânico Francis Crick. d) cada molécula de DNA é formada pela reunião de nucleotídeos. publicou um manifesto sobre a síntese de proteínas. b) a transferência de informações genéticas ocorre do DNA para o RNA. e) uma molécula de DNA difere de outra pela seqüência de seus nucleotídeos. Em 1958. e deste para a proteína. apresentando suas hipóteses sobre a estrutura teórica da biologia molecular. quantos nucleotídeos em média estão presentes em uma seqüência codificadora de ARN-m. assim. um dos descobridores da estrutura da molécula de DNA. morto em julho de 2004. responsável pelo sequenciamento dos aminoácidos em um peptídeo com peso molecular de 27000 daltons? a) 810 b) 300 c) 270 d) 81000 e) 2700 .

Tir . Isso sem considerar a possibilidade da existência de um.pro . 5. especificaria o terceiro aminoácido da tabela. que conduz os códons para a síntese da proteína nos ribossomos. não seria possível a produção das proteínas B e C com. 16 e 19 aminoácidos. TTA. formado por pares de bases.lys b) Exemplo de mutação pontual no gene que codifica a cadeia da globina humana: substituição do nucleotídeo A por T no códon correspondente ao ácido glutâmico. 2.Leu .Lis b) A é afetado porque produz uma proteína menor.Pro .manifestação dos sintomas da anemia falciforme. isto é.Pro . 7.Tir . onde adenina pareia com timina. Sabe-se ainda que existem vários nucleotídeos do gene que servem para a função de regulação e não são transcritos.Pro Indivíduo B: Val . tipos e seqüências de seus aminoácidos. Conseqüência: anemia falciforme .Leu .Tre . 4. isto é. sendo 3 códons de finalização. códons de finalização. Com a descoberta do código genético sabe-se que um aminoácido é sempre codificado por três nucleotídeos. 3.Val . porque o código genético é degenerado. no máximo. b) A diversidade no planeta Terra seria maior. a) Os 'corrimãos' correspondem a uma sucessão alternada de fosfato e desoxirribose (açúcar).alteração da função da proteína (globina). unidas por pontes de hidrogênio.Lis Indivíduo C: Val .Val .Leu . apesar da substituição de uma base nitrogenada no seu DNA. Os 'degraus' são constituídos por pares de bases nitrogenadas. .Pro . respectivamente. está capacitado para traduzir códons constituídos por 3 bases nitrogenadas consecutivas. a) Produto da síntese protéica (polipeptídio): val . C é afetado porque possui um aminoácido diferente em sua proteína.GABARITO 1. e citosina com guanina. c) As proteínas podem ser diferenciadas pelo número. ou mais. a) Proteína normal: Val . .leu .glu . 6.Tre . para um mesmo aminoácido existem vários códons diferentes. uma vez que o equipamento ribossômico da bactéria que incorporou o gene. Assim o número de tipos distintos de aminoácidos presentes nos polipeptídeos seria. maior.alteração estrutural do polipeptídio (substituição do ácido glutâmico pela valina). Porque o código genético é degenerado.Met . 16 tipos diferentes de aminoácidos. o gene que codifica uma proteína tem sempre maior número de nucleotídeos que de aminoácidos. permite a formação de apenas 16 códons diferentes.Val .Tre . Seu código genético. Neste caso. Logo.Lis Indivíduo A: Val .Tir .thr . poderiam ter. B é normal. . b) O DNA realiza a transcrição. obviamente. a) As proteínas produzidas pelos extraterrestres em questão. produz o RNA mensageiro. pois o código genético dos terráqueos é formado por 64 códons.Tre . .his . c) A proteína produzida pela bactéria terrestre "transgênica" não será idêntica ao polipeptídeo alienígena.glu .redução da capacidade de transporte de oxigênio. a) RNAm: UCC GUU AAU UCC GGC AAG b) O códon mutado.

[C] 24. 9.S . [A] 26. que interrompe a leitura do ARNm pelo ribossoma. 11. [D] 27. 12. [C] 17.A . [C] 20. b) UAC.T . a) 3'TACGCA5'. [A] 18.E . [D] 21. [A] 37. [B] 40.I .K. [A] 30. [C] 15.N . [D] 19. d) A proteína não será formada. [A] 31.C . [C] 29. [D] 25. A mutação deve ter alterado um códon que codificava um aminoácido transformando-o em um códon de parada. [B] 16. [A] 38. c) W .c) UUA 8.Arginina . [A] . O RNA que será utilizado na tradução é o RNAm (RNA mensageiro). [E] 32. [B] 14. b) 5'AUGCGU3'. [C] 35. [C] 13. [A] 39. Treonina .C . [D] 22. [C] 28. a) RNA-polimerase. [E] 34. [E] 36. [C] 33.R . [A] 23. pois foi alterado o códon de iniciação.O .Leucina 10.