P. 1
Biologia - Exercicio de genética

Biologia - Exercicio de genética

|Views: 5.988|Likes:
Publicado porGuilherme Costa

More info:

Published by: Guilherme Costa on Mar 10, 2011
Direitos Autorais:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

05/14/2013

pdf

text

original

EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007 1.

(Unicamp 2005) Em 25 de abril de 1953, um estudo de uma única página na revista inglesa Nature intitulado "A estrutura molecular dos ácidos nucléicos", quase ignorado de início, revolucionou para sempre todas as ciências da vida sejam elas do homem, rato, planta ou bactéria. James Watson e Francis Crick descobriram a estrutura do DNA, que permitiu posteriormente decifrar o código genético determinante para a síntese protéica. a) Watson e Crick demonstraram que a estrutura do DNA se assemelha a uma escada retorcida. Explique a que correspondem os "corrimãos" e os "degraus" dessa escada. b) Que relação existe entre DNA, RNA e síntese protéica? c) Como podemos diferenciar duas proteínas? 2. (Fuvest 96) Uma doença genética de herança dominante é causada por mutações em um gene localizado em um autossomo. Os indivíduos A, B e C têm mutações em um segmento de DNA desse gene, cuja seqüência normal está representada a seguir. Usando a tabela que relaciona alguns codons aos respectivos aminoácidos e considerando que a fita molde a ser transcrita é aquela assinalada com a letra m, responda: a) Quais serão os segmentos de proteínas produzidos, respectivamente, pelos indivíduos A, B e C? b) Como será o fenótipo (normal ou afetado dos indivíduos A, B e C? Por quê? Seqüência normal CAA AAC TGA GGA ATG CAT TTC (m) GTT TTG ACT CCT TAC GTA AAG Indivíduo A CAA AAC TGA GGA ATT CAT TTC (m) GTT TTG ACT CCT TAA GTA AAG Indivíduo B CAT AAC TGA GGA ATG CAT TTC (m) GTA TTG ACT CCT TAC GTA AAG Indivíduo C CAA TAC TGA GGA ATG CAT TTC (m) GTT ATG ACT CCT TAC GTA AAG

não se pode deduzir a seqüência de nucleotídeos do gene. .3' e. ou do RNA-m correspondentes.AAG .3.GTG . Explique por quê. pode afetar a saúde e a qualidade de vida do portador dessa mutação. o oposto não é verdadeiro.CTG .CAC . Um gene é constituído por um número N de nucleotídeos que codifica uma proteína constituída por P aminoácidos.GAG . a partir da seqüência de aminoácidos de uma proteína.ACT . isto é.GAG . é sempre possível deduzir-se a seqüência de aminoácidos de uma proteína a partir da seqüência de nucleotídeos do seu gene. Por que sempre encontramos N > P ? 5. a) Considere o segmento de DNA.CCT . (Ufrj 97) O ADN é um polímero constituído por vários nucleotídeos e as proteínas são polímeros constituídos por vários aminoácidos. Entretanto. (Ufg 2005) As globinas constituem um bom exemplo da importância da informação genética na estrutura primária e na função das proteínas. (Ufrj 99) Com o auxílio da tabela do código genético representada a seguir. 4. utilizando-se da tabela do código genético apresentada a seguir. cuja seqüência de nucleotídeos é 5' . b) Utilize um exemplo de alteração estrutural da globina humana (cadeia beta) para explicar como uma mutação pontual. forneça o produto da síntese protéica (polipeptídio parte da cadeia beta prevista para a globina humana). do tipo substituição.

na 3 base do código correspondente ao 6Ž aminoácido do polipeptídeo. contendo códigos de trincas de bases do DNA com os aminoácidos correspondentes. (Ufrn 2002) O DNA dos organismos do planeta Zbohrnya é constituído pelos mesmos 4 tipos de bases dos seres vivos terrestres. apresentam. 13. Explique a possibilidade da ocorrência dessas três proteínas nos seres de Zbohrnya. por uma purina. (Ufv 2000) Considere a tabela abaixo. Já o código genético desses organismos é determinado por códons de 2 bases. qual seria o aminoácido da tabela a ser incorporado? c) Qual é anticódon correspondente ao novo aminoácido incorporado? . faça uma comparação entre a diversidade dos organismos encontrados nesses dois planetas. b) Se ocorresse uma substituição. a) As proteínas A.5 bilhões de anos. respectivamente.6. b) Sabendo que a vida em Zbohrnya e na Terra existe há 3. c) Se o gene de uma proteína respiratória de um organismo zbohrniano for introduzido numa bactéria terrestre. 16 e 19 tipos diferentes de aminoácidos. para resolver os itens seguintes: a) Determine a seqüência de bases do RNAm que foi utilizado para sintetizar o polipeptídeo esquematizado abaixo da tabela. 7. a proteína produzida pela expressão desse gene será idêntica à da espécie zbohrniana? Justifique sua resposta. B e C. encontradas nos organismos da Terra.

A. através dos vestígios materiais encontrados nas pesquisas arqueológicas. No entanto. e ACU do RNA mensageiro codificam. anteriores aos citados. esse código segue o padrão do código genético universal. Verificou-se que um desses mutantes produzia uma dada proteína que diferia da original pela ausência de 35 aminoácidos em uma das extremidades da cadeia peptídica." . b) Cite a seqüência do anticódon correspondente ao códon de iniciação. B. (Ufrj 2004) Após tratar culturas de bactérias com doses de um agente mutagênico capaz de induzir uma única mutação pontual (que afeta apenas um nucleotídeo por célula). muitas vezes. 2004). d) Qual a seqüência de aminoácidos que resultará da tradução da mesma molécula de mRNA. Santa Cruz do Sul: EDUNISC. qual será a seqüência de bases da fita complementar? b) Se a fita complementar for usada durante a transcrição. Explique como essa única mutação pontual pode fazer com que a síntese da proteína seja interrompida prematuramente. protagonizaram a nossa história. sabemos que outros povos. Entretanto. analisou-se a seqüência de aminoácidos de uma determinada proteína em diversos mutantes gerados. IPHAN. qual será a seqüência de bases do RNA resultante e que nome recebe esse RNA se ele traduzir para síntese de proteínas? 11. (Ufv 2004) A tabela adiante representa uma versão fictícia do código genético. c) Qual a seqüência de aminoácidos que resultará da tradução da molécula de RNA mensageiro? Ver figura anterior.8. TEXTO PARA A PRÓXIMA QUESTÃO (Ufsm 2006) A história da maioria dos municípios gaúchos coincide com a chegada dos primeiros portugueses. como os Kaingáng. foi selecionada a área temática CULTURA e as questões foram construídas com base na obra "Os Primeiros Habitantes do Rio Grande do Sul" (Custódio. 10.GAC de um segmento de DNA. após uma deleção do TERCEIRO nucleotídeo? 9. diferencia-nos. as três raças se mesclam em nossos descendentes. (G2) Os códons AGA. convivemos com grupos indígenas.. uma mistura de índios. leucina e treonina. no qual três bases codificam um aminoácido. brancos e negros. Nosso chimarrão nos identifica em qualquer parte do mundo. Analise a tabela e faça o que se pede: a) Cite o nome da enzima que catalisa a síntese de RNA mensageiro. (Unifesp 2006) Uma fita de DNA tem a seguinte seqüência de bases 5'ATGCGT3'. organizador. deixaram-nos um legado que. italianos e de outros povos. respectivamente os aminoácidos arginina. CUG. ainda hoje. Diante da relevância do contexto e da vontade de valorizar o nosso povo nativo. Escreva esses aminoácidos na ordem correspondente à seqüência TGA . Ainda hoje.TCT . a) Considerando que tenha ocorrido a ação da DNA-polimerase. "Nossos ancestrais. L. alemães. "o índio".

promovem a síntese de enzimas catalisadoras das reações metabólicas.12. nucleotídeos que são compostos por uma base nitrogenada. . b) Uma das moléculas representadas no desenho não é normalmente encontrada no citoplasma celular. através dos pareamentos de aminoácidos. uma pentose e um radical "fosfato". (Pucmg 2006) A figura mostra cinco tipos de moléculas de grande importância para uma célula animal. (Fuvest 2005) Quando afirmamos que o metabolismo da célula é controlado pelo núcleo celular. 14. Analise o esquema. II. e) apenas II e III. d) apenas I e II. catalisando as reações metabólicas. duas cadeias polinucleotídicas paralelas e complementares entre si. a) Uma das moléculas apresentadas pode fornecer informações para a produção de uma outra representada. b) apenas II. para todas as partes da célula. reflita sobre esse assunto e assinale a afirmativa INCORRETA. III. c) Apenas duas das moléculas indicadas na figura podem ser quebradas e fornecer energia para as células. d) dentro do núcleo. 13. formando ligações fosfo-diéster. e) o conteúdo do núcleo passa para o citoplasma e atua diretamente nas funções celulares. no citoplasma. portanto é formado por I. b) o núcleo produz moléculas que. d) Uma das moléculas representadas pode favorecer a captação do carboidrato indicado no esquema. isso significa que a) todas as reações metabólicas são catalisadas por moléculas e componentes nucleares. O DNA presente nas mitocôndrias tem composição e estrutura típicas desse tipo de ácido nucléico. moléculas que catalisam as reações metabólicas. uma cadeia de nucleotídeos em que as bases nitrogenadas interagem. Está(ão) correta(s) a) apenas I. moléculas sintetizam enzimas catalisadoras das reações metabólicas. c) apenas III. c) o núcleo produz e envia.

nem no metabolismo celular. c) TACGTGGA. está a) correta. Nessa analogia. porque agora se sabe toda a seqüência de nucleotídeos dos cromossomos humanos. da maneira como foi veiculada. d) As mutações atuam diretamente sobre as proteínas. e) errada. que determinam a seqüência de bases do RNA mensageiro. c) A mutação altera a seqüência de aminoácidos do DNA. d) errada. acarretando alterações na seqüência de bases do RNA mensageiro e. cada página de cada volume contém um texto formado por uma seqüência de: a) fenótipos b) aminoácidos c) cromossomos d) bases nitrogenadas 19.. suas funções no metabolismo celular passam a ser realizadas pelos aminoácidos. proposta por Richard Dawkins no livro "O gene egoísta". não as proteínas que eles codificam. (Unifesp 2004) Em abril de 2003. proteínas que atuam como catalisadores e que podem sofrer mutações genéticas sendo modificadas ou eliminadas. e) ATGCACCT. levando em conta os ácidos nucléicos. a inativação delas. os planos do arquiteto montam 46 volumes. (Pucrs 2005) A seqüência de nucleotídeos ATGCACCT forma um segmento de DNA dupla hélice ao se ligar à fita complementar a) AUGCACCU. 17. na produção das proteínas.) No homem. existem regiões cromossômicas com alta taxa de mutação. e) Quando algumas proteínas são alteradas por mutações. não haverá alteração na molécula protéica formada. c) 38 cromossomos simples e 38 moléculas de DNA. porque o Projeto decifrou os genes dos cromossomos humanos. a) O DNA é constituído por códons. responsáveis pela produção das proteínas. (.. porque não é possível decifrar todo o código genético. a finalização do Projeto Genoma Humano foi noticiada por vários meios de comunicação como sendo a "decifração do código genético humano". (Fatec 2006) O metabolismo celular depende de uma série de reações químicas controladas por enzimas. b) No caso de uma mutação acarretar a transformação de um códon em outro relacionado ao mesmo aminoácido. e) 19 cromossomos duplicados e 19 moléculas de DNA. . Assinale a alternativa correta. necessária à formação dos anticódons. porque agora se sabe toda a seqüência de genes dos cromossomos humanos. conseqüentemente. d) 38 cromossomos simples e 19 moléculas de DNA. (Uerj 2004) É como se em cada quarto de um imenso prédio existisse uma estante contendo os planos do arquiteto para todo o prédio. porque o código genético diz respeito à correspondência entre os códons do DNA e os aminoácidos nas proteínas. 18. b) correta. c) errada. b) UACGUGGA.15. (Pucsp 2006) O gato doméstico ('Felis domestica') apresenta 38 cromossomos em suas células somáticas. A informação. b) 19 cromossomos duplicados e 38 moléculas de DNA. provocando a desnaturação dessas moléculas e. d) TCCACGTA. a ocorrência de mutações e as conseqüentes mudanças do ciclo de vida da célula. No núcleo do óvulo normal de uma gata são esperados: a) 19 cromossomos simples e 19 moléculas de DNA. isto é. 16. conseqüentemente.

Leu .Arg .Cis d) Ile .UUU .UUU .Arg .Ile .Leu .GGA .Arg .Leu e) Val .Val .CCG . d) GAA .GGC .CTC.Cis .Arg .Ile .UUU .Val . de acordo com a tabela anterior: a) Cis . (Cesgranrio 92) A tabela a seguir mostra alguns aminoácidos e as trincas de bases no DNA que os identificam: Se um RNA mensageiro apresenta a seqüência de bases AUU AGA UGU GUU UUA.Cis .CUC. b) GAA .Ile c) Arg .CUC.GGC . (Fuvest 94) Um gene de bactéria com 600 pares de bases nitrogenadas produzirá uma cadeia polipeptídica com número de aminoácidos aproximadamente igual a a) 200 b) 300 c) 600 d) 1200 e) 1800 .UUG.Leu 21. e) GUU . 22.TTT .20. Assinale a alternativa que apresenta a possível seqüência de códons para a formação do seguinte tetrapeptídeo: GLU .Val .FEN . a seqüência de aminoácidos no polipeptídeo correspondente será.GLI .LEU a) GUU . (Fatec 95) A tabela a seguir relaciona trincas de bases do DNA aos aminoácidos correspondentes.Cis .Val . c) CTT .AAA .AAC.GGU .Ile b) Leu .

lisina. e a tradução. que é uma técnica de manipulação dos genes. (Mackenzie 99) Os códons UGC. b) Todas as células do corpo têm a mesma coleção de genes. 26. ou mesmo por exposição aos raios ultravioleta do sol. prolina. pois qualquer modificação na fita de DNA é imediatamente corrigida. c) A seqüência não será traduzida. guanina. Este processo chama-se diferenciação celular. apesar disso. nem as suas características. Assinale a alternativa que descreve o que acontecerá com a seqüência de aminoácidos. Indique a alternativa ERRADA relativa ao código genético e à síntese de proteínas: a) Os genes são formados por ácido desoxirribonucleico e controlam a produção de proteínas da célula. d) Fenilalanina. lisina. Com base na tabela fornecida e considerando um segmento hipotético de DNA. foi oficialmente fundado o Projeto Genoma. determinando as características de um ser vivo. GCC e AGC codificam. resultando numa molécula com 3 aminoácidos. (Fuvest 95) Considere a seguinte tabela que indica seqüências de bases do RNA mensageiro e os aminoácidos por elas codificados. b) Aspargina. encontramos sempre desoxirribose e cinco tipos de bases: adenina. valina. que codifica a seqüência serina . respectivamente os aminoácidos cisteína. mas. ou seja. indica a interrupção da tradução. citosina. e) A seqüência não sofrerá prejuízo. encontramos células com formas e funções diferentes. c) Duas grandes etapas estão envolvidas na síntese das proteínas: a transcrição. leucina. qual seria a seqüência de aminoácidos codificada? a) Aspargina. por raios-X. lisina.cisteína . sofreu a perda da 9 base nitrogenada. pode corrigir defeitos no código . 24. por raios cósmicos. e) A Engenharia Genética. c) A mutação é uma alteração do código genético de um organismo e pode ser provocada por radiações ou substâncias químicas. compondo os cromossomos e ribossomos na forma de moléculas complexas de nucleoproteínas. alanina e serina. que visa decifrar e mapear o código genético humano. d) A tradução será interrompida no 2Ž aminoácido. a) Na molécula de DNA. c) Fenilalanina.23. encontramos células com formas e funções diferentes. d) A mutação constitui uma alteração na seqüência de bases nitrogenadas de um segmento de DNA e pode ser provocada por radiações. (Puc-rio 2000) Com relação ao código genético e à síntese de proteínas. prolina. a) O aminoácido tirosina será substituído por outro aminoácido. 25. UAU. tirosina. mas. valina. prolina. Um fragmento de DNA. apesar disto. que compreende a passagem do código genético do DNA para o RNA. (Puc-rio 2001) Em 1987. b) O aminoácido tirosina não será traduzido.alanina. lisina. e) Todas as células do corpo têm a mesma coleção de genes. que compreende o trabalho do RNA de organização dos aminoácidos na seqüência determinada pelo código genético. pois essa molécula de DNA alterada não é capaz de comandar esse processo.tirosina . d) As mudanças na programação genética de um organismo não alteram a produção de proteínas. b) Os ácidos nucléicos podem aparecer livres na célula ou podem estar associados a proteínas. o códon UAG é terminal. e) Valina. timina e uracil. cuja seqüência de bases é AAGTTTGGT. assinale a afirmativa FALSA.

27.os codons de término da tradução são UAA. Considere que a estrutura normal de um RNA mensageiro de um peptídio e sua estrutura alterada em virtude da troca de uma única base no gene correspondente são: 5' AUGUGGUUUGCACACAAAUGAUAA 3' (normal) 5' AUGUGGUUUGAACACAAAUGAUAA 3' (alterada) A tabela a seguir identifica alguns codons. Observe que: . UAG e UGA. 28. respectivamente: a) lisina e cisteína b) treonina e triptofano c) alanina e ácido glutâmico d) fenil alanina e ácido aspártico . (Uerj 2005) A mutação em um gene.genético de um organismo. pode acarretar modificações importantes na atividade biológica da proteína codificada por esse gene. (Uel 98) Considere os seguintes códons do RNA mensageiro e os aminoácidos por eles especificados: ACA = treonina GUU = valina Assinale a alternativa da tabela a seguir que indica corretamente os anticódons do RNAt e os códons do DNA relacionados com esses aminoácidos. O aminoácido encontrado no peptídio normal e aquele que o substituiu no peptídio mutante são.o codon da metionina é também o do início da tradução. . por conseqüência da substituição de uma única base na estrutura do DNA.

treonina. d) bases da molécula de RNA . leucina. respectivamente. treonina. o processo de transcrição não ocorrerá. (G2) A seqüência de aminoácidos de uma proteína é determinada pela seqüência de a) pentoses da molécula de DNA. arginina. a) A substância representada em I é obrigatoriamente ribose. e) Se a ação desse ácido for bloqueada. arginina.transportador. c) Os códons GCA e GCG são degenerados porque codificam aminoácidos diferentes. treonina. b) arginina. 31. (Ufrn 2000) Observe as seqüências de nucleotídeos de um vírus de RNA: 5' GCA UCA CAC CUC AUU GCG UAG 3' Considerando que esse segmento de RNA codifica um determinado peptídeo. CUG e ACU do RNA mensageiro codificam. respectivamente. 32. leucina. c) bases da molécula de DNA. d) Os anticódons do 1ª do 2ª códon dessa seqüência são. os aminoácidos arginina. d) II pode apresentar moléculas de adenina. (Mackenzie 2001) Considerando o esquema acima. . c) leucina. devem estar presentes no seu mRNA? a) 100 b) 33 c) 99 d) 300 e) 500 30.29. a) treonina.ribossômico 33.mensageiro. assinale a alternativa INCORRETA. b) A inserção de um nucleotídeo entre a 4 e a 5 base não altera o código genético. b) pentoses da molécula de RNA . GCA e UGA. que especificam esses aminoácidos. cuja função é transportar aminoácidos. c) Esse ácido nucléico é produzido no núcleo e se dirige ao citoplasma. leucina e treonina. e) leucina. leucina. respectivamente. que representa um fragmento de ácido nucléico. é correto afirmar: a) Os códons dessa seqüência sinalizam os mesmos aminoácidos em seres humanos. b) Cada trinca de bases. e) bases da molécula de RNA . arginina. (Unifesp 2007) Os códons AGA. A seqüência desses aminoácidos na proteína correspondente ao segmento do DNA que apresenta a seqüência de nucleotídeos GAC TGA TCT será. (Ufpi 2000) Se uma proteína possui 100 aminoácidos. é denominada anticódon. quantos códons. unindo-se aos aminoácidos. representada em II. arginina. d) treonina.

AUG Os anti-códons correspondentes são: a) AUG .TAC c) TUG .UGC .CGU 38. 37.UTC d) AGT . EXCETO: a) macromoléculas de reserva energética. b) enzimas usadas.CUA .GUA . (Puccamp 2002) Um mutante perdeu um segmento de DNA contendo todas as cópias dos genes que codificam RNA transportador. o filamento de DNA que proporcionou essa síntese deverá ter o seguinte número total de nucleotídeos: a) 62 b) 93 c) 186 d) 279 e) 558 36.CUT . c) moléculas de defesa do corpo.CGA . b) a posição dos aminoácidos na cadeia polipeptídica depende da seqüência de bases do tRNA. A função celular drasticamente afetada por essa mutação será a) a replicação do DNA. e) a extremidade livre dos diversos tRNA tem seqüências de bases diferentes.UAC b) ATG . b) a síntese de RNA mensageiros.UCG .ACG . Nesse processo ocorre produção de.TCG . c) a síntese de proteínas. (Ufal 99) Considere os seguintes códons: UAC . no processo digestivo.GAU . Numa síntese de proteína com 185 ligações peptídicas. que ocorre também em você. (Ufc 99) Sobre os diferentes papéis dos ácidos nucléicos na síntese de proteínas podemos afirmar corretamente que: a) a seqüência de bases no DNA determina a seqüência de aminoácidos na cadeia polipeptídica. d) o transporte de proteínas.34. . Uma delas é a síntese de proteína.ACT . (Pucmg 99) O DNA apresenta importantes funções celulares.CTA . d) moléculas utilizadas nos processos de cicatrização. c) o transporte de aminoácido para o local da síntese é feito pelo mRNA. (Pucmg 2007) O esquema a seguir é um processo celular vital. por exemplo. e) o transporte de RNA. d) a seqüência de bases do rRNA é transcrita a partir do código do mRNA.ACG . 35.GAC e) GCA .

lançando. 40. será lembrado como um dos mais influentes cientistas de todos os tempos. assim. que podem ser de quatro tipos diferentes. Em 1958. apresentando suas hipóteses sobre a estrutura teórica da biologia molecular. (Ufrs 2005) O cientista britânico Francis Crick. b) a transferência de informações genéticas ocorre do DNA para o RNA. (Unirio 2003) Supondo que o peso molecular médio de um aminoácido é de 100 daltons. a) o código genético é degenerado.39. pois um aminoácido pode ser codificado por mais de uma trinca. quantos nucleotídeos em média estão presentes em uma seqüência codificadora de ARN-m. responsável pelo sequenciamento dos aminoácidos em um peptídeo com peso molecular de 27000 daltons? a) 810 b) 300 c) 270 d) 81000 e) 2700 . d) cada molécula de DNA é formada pela reunião de nucleotídeos. morto em julho de 2004. Entre as hipóteses apresentadas naquele texto. um dos descobridores da estrutura da molécula de DNA. c) cada polipeptídeo tem uma seqüência específica de nucleotídeos determinada pelo gene. e deste para a proteína. publicou um manifesto sobre a síntese de proteínas. Segundo esse dogma. e) uma molécula de DNA difere de outra pela seqüência de seus nucleotídeos. destaca-se o dogma central da Biologia. as bases para a descoberta do código genético.

e citosina com guanina. especificaria o terceiro aminoácido da tabela.Val .Lis b) A é afetado porque produz uma proteína menor. unidas por pontes de hidrogênio. obviamente.GABARITO 1. Logo. Neste caso.his .glu . C é afetado porque possui um aminoácido diferente em sua proteína. c) A proteína produzida pela bactéria terrestre "transgênica" não será idêntica ao polipeptídeo alienígena. . isto é. onde adenina pareia com timina. Os 'degraus' são constituídos por pares de bases nitrogenadas.Tir . está capacitado para traduzir códons constituídos por 3 bases nitrogenadas consecutivas. tipos e seqüências de seus aminoácidos. maior. isto é. b) A diversidade no planeta Terra seria maior. não seria possível a produção das proteínas B e C com. . B é normal.Met .pro . 16 e 19 aminoácidos. a) Produto da síntese protéica (polipeptídio): val . a) Os 'corrimãos' correspondem a uma sucessão alternada de fosfato e desoxirribose (açúcar). TTA.Lis Indivíduo A: Val . apesar da substituição de uma base nitrogenada no seu DNA.Tre .redução da capacidade de transporte de oxigênio. . . Seu código genético. pois o código genético dos terráqueos é formado por 64 códons. a) RNAm: UCC GUU AAU UCC GGC AAG b) O códon mutado.Tre .Tre . c) As proteínas podem ser diferenciadas pelo número.Lis Indivíduo C: Val . que conduz os códons para a síntese da proteína nos ribossomos. 2. 16 tipos diferentes de aminoácidos.glu .thr . Com a descoberta do código genético sabe-se que um aminoácido é sempre codificado por três nucleotídeos.Val . poderiam ter. Assim o número de tipos distintos de aminoácidos presentes nos polipeptídeos seria. códons de finalização. b) O DNA realiza a transcrição. 4. Porque o código genético é degenerado. para um mesmo aminoácido existem vários códons diferentes.Leu .Pro .Pro .Leu .leu . ou mais. o gene que codifica uma proteína tem sempre maior número de nucleotídeos que de aminoácidos.Pro Indivíduo B: Val . respectivamente.Leu . 6. Sabe-se ainda que existem vários nucleotídeos do gene que servem para a função de regulação e não são transcritos.lys b) Exemplo de mutação pontual no gene que codifica a cadeia da globina humana: substituição do nucleotídeo A por T no códon correspondente ao ácido glutâmico. 3. a) As proteínas produzidas pelos extraterrestres em questão.alteração estrutural do polipeptídio (substituição do ácido glutâmico pela valina).Tre . porque o código genético é degenerado.alteração da função da proteína (globina).Tir .Tir . sendo 3 códons de finalização. Isso sem considerar a possibilidade da existência de um. no máximo. produz o RNA mensageiro. 5. 7.Val .manifestação dos sintomas da anemia falciforme. Conseqüência: anemia falciforme . permite a formação de apenas 16 códons diferentes. uma vez que o equipamento ribossômico da bactéria que incorporou o gene. a) Proteína normal: Val . formado por pares de bases.Pro .

O . [C] 29. [A] .C . [D] 27. [A] 23. [D] 19. d) A proteína não será formada. [E] 32. [D] 25. a) RNA-polimerase. O RNA que será utilizado na tradução é o RNAm (RNA mensageiro). [C] 33. [E] 36. 12.R .c) UUA 8. [B] 14. 9.E . [A] 38. [C] 20. [C] 35.T . [B] 16. [A] 26.A . [B] 40. [C] 28.S . Treonina .Arginina . [E] 34. [C] 13. [A] 37. b) 5'AUGCGU3'. [D] 21. pois foi alterado o códon de iniciação. [C] 15. A mutação deve ter alterado um códon que codificava um aminoácido transformando-o em um códon de parada. [A] 39. [A] 18. a) 3'TACGCA5'. 11.N . [A] 31. que interrompe a leitura do ARNm pelo ribossoma. [D] 22. b) UAC. [C] 17.K.Leucina 10. c) W .C . [C] 24. [A] 30.I .

You're Reading a Free Preview

Descarregar
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->