Você está na página 1de 62
Dogma Central da Biologia Molecular
Dogma Central da Biologia Molecular
Replicação Duplica todo o material genético Objetivo é duplicar para depois haver a divisão celular
Replicação
Duplica todo o
material genético
Objetivo é duplicar
para depois haver a
divisão celular
Transcrição Transcreve para RNA apenas genes específicos Objetivo é transcrever os genes necessários para o funcionamento
Transcrição
Transcreve para RNA
apenas genes
específicos
Objetivo é transcrever
os genes necessários
para o funcionamento
da célula
Quantos genes temos?
30.000 genes Transcrição em momentos específicos Como ocorre a transcrição
30.000 genes
Transcrição em momentos específicos
Como ocorre a transcrição
Transcrição do DNA Genes específicos E. coli Procariotos +1 + 10 DN Gene -35 -10 A
Transcrição do DNA
Genes específicos
E. coli
Procariotos
+1
+ 10
DN
Gene
-35
-10
A
Região promotora
Ocorre antes do gene
Sequência de nucleotídeos reconhecidos pela RNA polimerase
-35
3’-AACTGT-
5’
Sequências de
consenso
-10’
3’-ATATTA-
5’
Transcrição do DNA - Procariotos Iniciação RNA polimerase Subunidades α 2 ββ’ Fator σ RNA polimerase
Transcrição do DNA - Procariotos
Iniciação
RNA polimerase
Subunidades α 2 ββ’
Fator σ
RNA polimerase α 2 ββ'σ
Holoenzima
Versão de uma enzima
Transcrição do DNA - Procariotos Iniciação RNA polimerase Subunidades α 2 ββ’ Fator σ Fator σ
Transcrição do DNA - Procariotos
Iniciação
RNA polimerase
Subunidades α 2 ββ’
Fator σ
Fator σ
Reconhece os promotores
Posiciona a RNA polimerase
3’
5’
+1
Gene
-35 -35
-10
-10
DN
DN
Fator σ reconhece os sítios -35 no DNA
A
A
Transcrição do DNA - Procariotos A transcrição vai ser iniciada em um local aleatório ...
Transcrição do DNA - Procariotos
A transcrição vai ser iniciada em um local aleatório ...
Transcrição do DNA - Procariotos Iniciação RNA polimerase + DNA Complexo promotor fechado Bolha de Complexo
Transcrição do DNA - Procariotos
Iniciação
RNA polimerase + DNA
Complexo promotor fechado
Bolha de
Complexo promotor aberto
transcriçã
o
18 pb
Quebra da dupla fita de DNA na
posição -10
Apenas um filamento de DNA é usado como molde por vez
Transcrição do DNA - Procariotos Iniciação Bolha de Fator σ se solta do sítio - transcriçã
Transcrição do DNA - Procariotos
Iniciação
Bolha de
Fator σ se solta do sítio -
transcriçã
35
o
5’
18 pb
3’
5’
3’
RNA
polimerase
Lê a fita molde de
DNA no sentido 3’- 5’
Por que não precisa de
primer????
Faz inserção dos
primeiros 8
ribonucleotídeos
(A, C, U, G) na nova
molécula de RNA
Transcrição do DNA - Procariotos Iniciação Depois de 8 nucleotídeos inseridos na nova fita de RNA
Transcrição do DNA - Procariotos
Iniciação
Depois de 8 nucleotídeos
inseridos na nova fita de
RNA
5’
3’
3’
Fator σ se solta da RNA
polimerase
5’
Cerne da enzima
Transcrição do DNA - Procariotos Elongamento Cerne da RNA polimerase Migra pela fita molde de DNA
Transcrição do DNA - Procariotos
Elongamento
Cerne da
RNA polimerase
Migra pela fita molde
de DNA (sentido 3’-
Desenrola a dupla hélice
5’)
Insere ribonucleotídeos na
extremidade 3’da nova
molécula de RNA
Ligação fosfodiéster liga os
ribonucleotídeos
Nova molécula de RNA
cresce no sentido 5’- 3’
RNA se solta do DNA
Dupla fita de DNA é
recuperada
Transcrição do DNA - Procariotos Elongamento Rifampina, rifamicina, rifampicina Atuam na RNA polimerase E. coli 50
Transcrição do DNA - Procariotos
Elongamento
Rifampina, rifamicina, rifampicina
Atuam na RNA
polimerase
E. coli
50
nucleotídeos/se
gundo
a 37 o C
Energia
Ribonucleosídeos
Ribonucleosídeos
Energia
trifosfatados
monofosfatados
Leitura: 3´- 5´ Síntese: 5´- 3´
Leitura: 3´- 5´
Síntese: 5´- 3´
Como acaba a transcrição dos genes nos procariotos?
Como acaba a transcrição dos genes nos procariotos?
Como acaba a transcrição do gene nos procariotos? DN Gene -35 A -10 Término Ocorre após
Como acaba a transcrição do gene nos procariotos?
DN
Gene
-35
A
-10
Término
Ocorre após o gene
Finalizadores
independentes de Rô
Finalizadores
dependentes de Rô
Transcrição do DNA - Procariotos Término – Independente de Rô Sequência palindrômica + DNA 3’-5’ (aaaa
Transcrição do DNA - Procariotos
Término – Independente de Rô
Sequência palindrômica +
DNA 3’-5’ (aaaa
5 a 10 As no DNA
)
Região rica em C-G
Estrutura em
grampo
Sequências espelhadas
RNA 5’-3’
Gene
GCCGCCAGUUCCGCUGGCGGCAUU
UU
Haste-alça no RNA
Cauda A tem fraca
ligação com os U do
RNA
Solta o RNA
UUUUU
5
3
G C C G C C A
G
C
G G C G G U
C
Transcrição do DNA - Procariotos Término – Finalizador dependente de rô DNA 3’-5’: Sequência rica em
Transcrição do DNA - Procariotos
Término – Finalizador dependente de rô
DNA 3’-5’: Sequência rica em
3’
5’
G
5’
RNA 5’-3’: Sequência rica em C
GGGG
3’
3’
Proteína rô
5’
Solta o RNA
Proteína
5’-CCCCCCAUUCCCCUCCCCCCC
Propriedades do RNA RNA DNA Transcrito RNA Sequência do RNA Sempre lido no transcrito é quase
Propriedades do RNA
RNA
DNA
Transcrito
RNA
Sequência do RNA
Sempre lido no
transcrito é quase igual à
sentido 3’-5
do filamento de DNA não
molde
Quase igual?
T
U
Propriedades do RNA RNA DNA Transcrito RNA No RNA não existe Timina, existe Uracila O açúcar
Propriedades do RNA
RNA
DNA
Transcrito
RNA
No RNA não existe Timina, existe Uracila
O açúcar do RNA é a Ribose e não a Desoxirribose
O RNA é fita simples (ele se desliga do DNA após a transcrição)
RNA Sempre é fita simples????
RNA
Sempre é fita simples????
Nucleotídeos do RNA podem se parear entre si Pontes de H Arcabouço de açúcar- fosfato Exemplo
Nucleotídeos do RNA podem se parear entre
si
Pontes de
H
Arcabouço de açúcar-
fosfato
Exemplo de RNAt
Exemplo de RNAr
Existe diferença na transcrição dos procariotos e eucariotos?
Existe diferença na transcrição dos procariotos e eucariotos?
Principais diferenças na transcrição dos procariotos e eucariotos No citoplasma No núcleo Tipo de RNA polimerase
Principais diferenças na transcrição dos procariotos e eucariotos
No citoplasma
No núcleo
Tipo de RNA polimerase
Genes transcritos
RNA Polimerase
Transcreve todos os genes
RNA Polimerase I
Genes ribossomais
5,8S; 18S e 28S
RNA Polimerase II
Todos os genes codificados de proteína, genes dos
pequenos RNAs nucleolares, genes dos micro RNAs
RNA Polimerase III
Genes do RNA transportador, DNA ribossomal 5S,
alguns genes dos pequenos RNAs nucleares, todos os
genes para RNA pequenos
Tipos de RNAs em eucariotos Tipo de RNA Função Mensageiro (RNAm) Codifica proteínas Ribossomal (RNAr) Forma
Tipos de RNAs em eucariotos
Tipo de RNA
Função
Mensageiro (RNAm)
Codifica proteínas
Ribossomal (RNAr)
Forma a estrutura básica dos ribossomos , que catalizam a
síntese de proteínas
Transportador
Adaptador entre RNAm e aminoácidos no processo de
(RNAt)
tradução
Pequenos RNAs
Atuam em vários processos nucleares, incluindo o
nucleares (RNAsn)
processamento do RNAm
Pequenos RNAs
Atuam no processamento e modificações químicas dos
nucleolares
RNAr
(RNAsno)
Pequenos RNAs cajal
Usados na modificação dos RNAsno e RNAsn
(RNAsca)
Micro RNA (miRNA)
Regulam a expressão gênica bloqueando seletivamente a
tradução de RNAm
Pequenos RNAs de
Inativa a expressão gênica por degradação seletiva de
interferência (RNAsi)
RNAm e pelo estabelecimento da heterocromatinização
Outros RNAs não
Atuam em diversos processos celulares, incluindo síntese
codificantes
do telômero e inativação do cromossomo X
Mais enzimas e fatores de transcrição envolvidos
Mais enzimas e fatores de
transcrição envolvidos
Transcrição do DNA - Eucariotos Iniciação – RNA polimerase II Início da Tata boxe + 1
Transcrição do DNA - Eucariotos
Iniciação – RNA polimerase II
Início da
Tata boxe
+ 1
transcrição
ATATTTT
Gene
DNA
TATAAA
A
Região promotora
Função:
posicionar
a
maquinaria
para
início
da
transcrição
Elemento cis-atuante
Transcrição do DNA - Eucariotos Iniciação – RNA polimerase II TFIIA TFIID reconhece o TATA box
Transcrição do DNA - Eucariotos
Iniciação – RNA polimerase II
TFIIA
TFIID reconhece o TATA box
Início da
Tata boxe
+ 1
transcrição
ATATTTT
A
Gene
TFIIA ajuda o TF IID
DNA
TATAAA
A
a se ligar ao DNA
TFIID
Transcrição do DNA - Eucariotos Iniciação – RNA polimerase II TFIIA TFIIB TFIIB = posiciona a
Transcrição do DNA - Eucariotos
Iniciação – RNA polimerase II
TFIIA
TFIIB
TFIIB = posiciona a
Início da
Tata boxe
RNA polimerase II no
+ 1
transcrição
ATATTTT
B
sítio de início da
A
Gene
DNA
TATAAA
transcrição
A
TFIID
Transcrição do DNA - Eucariotos Iniciação – RNA polimerase II TFIIA TFIIB Início da Tata boxe
Transcrição do DNA - Eucariotos
Iniciação – RNA polimerase II
TFIIA
TFIIB
Início da
Tata boxe
+ 1
transcrição
ATATTTT
B
TFIIF faz a
A
Gene
E
DNA
TATAAA
deselicoidização
A
TFIID
TFIIF
Regula a TFIIF
TFIIE
Transcrição do DNA - Eucariotos Iniciação – RNA polimerase II TFIIA TFIIB Início da Tata boxe
Transcrição do DNA - Eucariotos
Iniciação – RNA polimerase II
TFIIA
TFIIB
Início da
Tata boxe
+ 1
transcrição
ATATTTT
B
A
Gene
RNA polimerase II
E
DNA
TATAAA
A
TFIID
TFIIF
TFIIE
Só transcreve na
presença do TATA box?
RNA polimerase II
Transcrição do DNA - Eucariotos Iniciação – RNA polimerase II Outros promotores da RNA polimerase II
Transcrição do DNA - Eucariotos
Iniciação – RNA polimerase II
Outros promotores da RNA polimerase II
Transcrição do DNA - Eucariotos Elongamento RNA polimerase Migra pelo DNA Mecanismo similar ao dos procariotos
Transcrição do DNA - Eucariotos
Elongamento
RNA polimerase
Migra pelo DNA
Mecanismo similar ao dos procariotos
Insere ribonucleotídeos na
extremidade 3’da nova
molécula de RNA
Ligação fosfodiéster liga os
ribonucleotídeos
Nova molécula de RNA
cresce no sentido 5’- 3’
Dupla fita de DNA é
recuperada
Transcrição do DNA - Eucariotos Término dos genes transcritos pela RNA polimerase II Após o gene
Transcrição do DNA - Eucariotos
Término dos genes transcritos pela RNA polimerase
II
Após o gene
Sequência
Sequência rica em
conservada
GU
Sequência conservada
AAUAAA
Gene
AAUAAAGUUACACUUUAAGUGUG
UGU
Sequência rica em
GU
Transcrição do DNA - Eucariotos Término dos genes transcritos pela RNA polimerase II Clivagem do RNA
Transcrição do DNA - Eucariotos
Término dos genes transcritos pela RNA polimerase
II
Clivagem do RNA
Solta RNA
Sequência
Sequência rica em
conservada
GU
Gene
AAUAAA
GUUACACUUUAAGUGUGUGU
Clivagem do RNA por
endonuclease
Mas como a RNA polimerase II migra se o DNA pode estar associado a histonas?
Mas como a RNA polimerase II migra se o DNA pode estar associado a
histonas?
Transcrição do DNA - Eucariotos Complexo FACT (Facilitador de transcrição da cromatina) Remove histonas H2A e
Transcrição do DNA - Eucariotos
Complexo FACT
(Facilitador de
transcrição da
cromatina)
Remove histonas H2A e
H2B dos nucleossomos
Recoloca as histonas
após a transcrição do
fragmento
Vídeo
Eucariotos Transcrição Núcleo Processamento RNAm
Eucariotos
Transcrição
Núcleo
Processamento
RNAm
Processamento do RNAm de eucariotos Extremidade 5’ = Extremidade 3’ = Revestimento Cap Cauda poli A
Processamento do RNAm de
eucariotos
Extremidade 5’ =
Extremidade 3’ =
Revestimento Cap
Cauda poli A
Remoção de íntrons
Revestimento Cap Adição de revestimento 3’ de 7-metilguanosina na extremidade 5’ (Cap) 5’ Protege o RNA
Revestimento Cap
Adição de revestimento
3’
de 7-metilguanosina na
extremidade 5’ (Cap)
5’
Protege o RNA da degradação
Cap = “capuz,
boné, boina”
São reconhecidos por fatores
protéicos durante a tradução
Adição da cauda poli A Após clivagem Poli A polimerase Enzima poli A polimerase Gene AAUAAAAAAAAAAAAAAAAA
Adição da cauda poli A
Após clivagem
Poli A polimerase
Enzima poli A
polimerase
Gene
AAUAAAAAAAAAAAAAAAAA
AAA
Adiciona cauda poli A
(poliadenilação)
Estabilidade ao RNA
Auxiliam no transporte do
RNA para o citoplasma
E os outros RNAs????? Tipo de RNA Genes transcritos polimerase I Genes ribossomais 5,8S; 18S e
E os outros RNAs?????
Tipo de RNA
Genes transcritos
polimerase
I
Genes ribossomais
5,8S; 18S e 28S
III
Genes do RNA transportador, DNA ribossomal 5S,
alguns genes dos pequenos RNAs nucleares, todos os
genes para RNA pequenos
Não apresentam capeamento e poliadenilação
Podem necessitar de remoção de íntrons
Sequências não codificadoras (íntrons) RNA RNA com íntrons Precisam ser removidos
Sequências não codificadoras
(íntrons)
RNA
RNA com íntrons
Precisam ser removidos
Remoção de íntrons Só RNAm tem cauda poli Revestimento de 7- A metilguanosina Gene AAUAAAAAAAAAAAAAAAAA Pré-
Remoção de íntrons
Só RNAm tem cauda poli
Revestimento de 7-
A
metilguanosina
Gene
AAUAAAAAAAAAAAAAAAAA
Pré-
AAA
5’
RNAm
3’
Éxon = Sequência Expressa
Éxon
Íntron
Éxon
Íntron = Sequência Intercalar
Remoção dos íntrons
Remoção dos íntrons Depende de sequências sinalizadoras Sequências de consenso nas junções éxon-íntron
Remoção dos íntrons
Depende de sequências sinalizadoras
Sequências de consenso nas junções éxon-íntron
Transcrição do DNA - Eucariotos Processamento do RNA 3 tipos de remoção de íntrons Splicing Nucleases
Transcrição do DNA - Eucariotos
Processamento do RNA
3 tipos de remoção de íntrons
Splicing
Nucleases e ligase
Spliceossomo
s
Autocataliticamente
RNAs nucleares +
enzimas
proteínas
co-fator guanina
Ligações químicas – transferência de ligações
Remoção de íntrons Spliceossomo Pequenos RNAs nucleares + proteínas
Remoção de íntrons
Spliceossomo
Pequenos RNAs nucleares + proteínas
Remoção de íntrons Spliceossomo Primeira transesterificação
Remoção de íntrons
Spliceossomo
Primeira transesterificação
Remoção de íntrons Spliceossomo
Remoção de íntrons
Spliceossomo
Remoção de íntrons Recomposição autocatalítica – co-fator guanina (transferência de ligações)
Remoção de íntrons
Recomposição autocatalítica – co-fator guanina (transferência de ligações)
Remoção de íntrons Nuclease e ligase Éxon Íntron Éxon Endonuclease de recomposição Ligase de recomposição
Remoção de íntrons
Nuclease e ligase
Éxon
Íntron
Éxon
Endonuclease de recomposição
Ligase de
recomposição
Splicing alternativo
Splicing alternativo
Splicing alternativo
Splicing alternativo
Sumarizando Transcrição do DNA - Eucariotos Iniciação com muitos fatores Elongação e adição da 7- de
Sumarizando
Transcrição do DNA - Eucariotos
Iniciação com muitos fatores
Elongação e adição da 7-
de transcrição
metil-guanosina em RNAm
Sumarizando Transcrição do DNA - Eucariotos Remoção dos íntrons Adição da cauda poli A em RNAm
Sumarizando
Transcrição do DNA - Eucariotos
Remoção dos íntrons
Adição da cauda poli A em
RNAm
E a cauda poli A? Permanece ligada ao RNAm final Facilita o transporte para o citoplasma
E a cauda poli A?
Permanece ligada ao RNAm final
Facilita o transporte para o citoplasma
Exercício Complete o quadro seguinte, inclusive o sentido das fitas de DNA. T G T A
Exercício
Complete o quadro seguinte, inclusive o sentido das fitas de DNA.
T
G
T
A
Fita de DNA sentido
T
A
T
G
A
Fita de DNA sentido
U
G
U
U
mRNA transcrito
Referências bibliográficas GRIFFITHS, A.J.F.; WESSLER, S.R.; LEWONTIN, R.C.; CARROLL, S.B. 2008. Introdução à Genética. 9ª Edição.
Referências bibliográficas
GRIFFITHS, A.J.F.; WESSLER, S.R.; LEWONTIN, R.C.; CARROLL, S.B. 2008. Introdução
à Genética. 9ª Edição. Editora Guanabara Koogan S.A. Rio de Janeiro. 712 p.
SNUSTAD, D.P.; SIMMONS, M.J. 2008. Fundamentos da Genética. 4 a Ed. Editora
Guanabara Koogan S.A. Rio de Janeiro. 903p.
KLUG, W.S.; CUMMINGS, M.R.; SPENCER, C.A.; PALLADINO, M.A. 2010. Conceitos de
genética. 9 a Edição. Editorea Artmed, Porto Alegre. 863 p.