Você está na página 1de 81

Ramon Oliveira Vidal

Email: ramon.vidal@gmail.com
Doutorando em Gentica e Biologia Molecular
Sub rea: Bioinformtica
Orientador: Gonalo A.G. Pereira
L
G
E

-

L
a
b
o
r
a
t

r
i
o

d
e

G
e
n

m
i
c
a

e

E
x
p
r
e
s
s

o

@ramonvidal
Marcadores Moleculares
Marcadores por Hibridao
Marcadores por Amplificao
Polimorfismos X mutaes
SNPs
Origem
Aplicaes
Hapltipos
Genotipagem
Identificando os SNPs (em genomas e transcriptomas)
Sanger
454
Solexa
Taxa de evoluo
Identificao de SNPs em Coffea arabica


Fentipo
Propriedades observveis de um indivduo, que se
desenvolveram sob a influncia de:
gentipo do indivduo
fatores ambientais
Gentipo
Constituio gentica de um organismo
como revelada pela anlise gentica e
molecular, ou seja, o conjunto completo de
genes, tanto dominantes e recessivos.
Qualquer caracterstica morfolgica ou
molecular que diferencia indivduos, e que
seja facilmente detectvel

um fentipo de fcil identificao, normalmente
determinado por um nico alelo.

Caractersticas fenotpicas de fcil identificao visual
so utilizadas como marcadores morfolgicos desde
os tempos de Mendel

Polimorfismo detectado na seqncia de DNA
Vantagens:
- No objeto de influncias ambientais;
- Praticamente ilimitado em nmero;
Maior desvantagem a necessidade de tcnicas e
equipamentos mais complexos.
Reprodutibilidade;
Amplamente distribudo atravs do
genoma;
Poder de discriminao;
Ausncia de influncias ambientais;
Barato;
Fcil de mensurar
Diplide: Constitudo por duas cpias (homlogos)
de cada cromossomo.
Alelo: As formas alternativas de um carter
gentico encontrado em um determinado locus de
um cromossomo.
Homozigotos: Um organismo diplide com alelos
idnticos de um determinado gene em ambos os
cromossomos homlogos.
Heterozigotos :Um organismo diplide com alelos
diferentes de um determinado gene em ambos os
cromossomos homlogos.
Diplide
Haplide
Alelos
homozigoze
heterozigoze
Hibridao
RFLP (Restriction Fragment Length Polymorphism)
Minissatlites VNTR (Variable Number of Tandem
Repeats)

Amplificao de DNA
RAPD (Random Amplified Polymorphic DNA)
SCAR (Sequence Characterized Amplified Regions)
ou ASA (Amplified Specific Amplicon)
Microssatlites SSR (Simple Sequence Repeats)
AFLP (Amplified Fragment Length Polymorphism)
RFLP Restriction Fragment Length Polymorphism
RFLP Restriction Fragment Length Polymorphism
Polimorfismo de DNA
entre indivduos pode ser
devido a:
Ausncia do stio do
primer.
Surgimento de um novo
stio.
Ao comprimento da
regio amplificada entre
stios de primer
Significa Seqncias Simples Repetidas, a
qual consiste de pequenas seqncias de
nucleotdeos (1 a 4) repetidas em tandem.

Essas seqncias so distribudas ao acaso
no genoma e um dos marcadores mais
utilizados atualmente
Primers especficos (20 a 30 pb).
Diferentes nmeros de elementos simples
repetidos.
Cada segmento amplificado de tamanho
diferente representa um alelo diferente do
mesmo loco
Mutaes genticas
Alterao na seqncia de nucleotdeos de uma
molcula de DNA.
O termo "mutao geralmente usado para referir-se a
alteraes na seqncia de DNA que no esto presentes
na maioria dos indivduos de uma espcie
Polimorfismos genticos
Diferena na seqncia de DNA entre indivduos, grupos
ou populaes.
Incluem SNPs, seqncias repetitivas, inseres,
delees e recombinaes.
Podem dar origem a olhos ou olhos castanhos, cabelo liso
ou cabelos crespo
Resultado de processos naturais ou induzidos por
agentes externos (como vrus ou radiao).
Polimorfismos so alteraes no DNA que se
mantm nas geraes futuras
Polimorfismo: variao >1%
Mutao: variao <1%
C T T A G C T T
C T T A G T T T
Polimorfismo
C T T A G C T T
C T T A G T T T
Mutao
94%
6%
99.9%
0.1%
TAAAAAT
TAACAAT
TAAAAAT TAAAAAT TAACAAT TAACAAT TAACAAT
TAAAAAT TAACAAT
TAAAAAT
Polimorfismos foram
mutaes que se propagaram
ao longo de geraes
Polimorfismos genticos X Mutaes
genticas
Single Nucleotide
Polymorphism, ou SNP
("snip"):

pequena mudana, ou variao,
que pode ocorrer em um nico
nucleotdeo numa sequncia de
DNA em uma poro significativa
(mais de 1%) de uma populao.
SNPs so as mais frequntes formas de
variaes genticas
90% das variaes genticas humanas
vm dos SNPs
SNPs tem se tornado marcadores de preferncia
pela sua grande abundncia e pelo
desenvolvimento de tecnologias de
genotipagem em larga escala.
SNPs em menor quantidade em genes do que em regies no-
codificantes
Menor quantidade de SNPs nos cromossomos sexuais (humano).
Dentro de um nico cromossomo, SNPs podem se concentrar em
uma regio especfica, geralmente implicando uma regio de
interesse ou de pesquisa.
Em mdia, ocorrem a cada 300~600 nucleotdeos (humano).
Genes com maior presso para modificao tem maior frequncia de
SNP (resistncia, adaptao, interao parasita-hospedeiro, etc)
Intra espcie
Diversidade entre os indivduos de uma
mesma espcie
Reflete os SNPs entre os alelos (espcies
diplides)
Inter espcies
Diversidade entre espcies diferentes
No-codificantes Codificantes
Sinnimas No-sinnimas
conservativas No-conservativas
Transies
Purina<->Purina
Pirimidina<->Pirimidina
Transverses
Purina<->Pirimidina
Genotipagem
Deteco de gentipos de individuos.
Pode ser realizada observando os SNPs.
Hapltipo (gentipo haplide)
Alelo encontrado em um nico cromossomo que
apresenta o mesmo padro de SNPs.
Blocos hapltipos e tendem a ser herdados
juntos.
Podem servir como marcadores de doena
gentica.
A anlise de hapltipos til na identificao de
eventos de recombinao.
Dentro de um bloco hapltipo, acontece pouca
ou nenhuma recombinao
Os SNPs dentro de um bloco hapltipo so
passados juntos nas geraes futuras
Um hapltipo um conjunto de SNP no mesmo
cromossomo

SNP
1
SNP
2
SNP
3
-A C T T A G C T T-
-A A T T T G C T C-
-A C T T T G C T C-
Haplotype 2

Haplotype 3

C A T
A T C
C T C
Haplotype 1

SNP
1
SNP
2
SNP
3
Recombination
hotspots
Chromosome
Haplotype
blocks
C1

C2

C1

S
1
S
2
S
3
S
4
S
5
S
1
S
2
S
3
S
4
S
5
SNP
loci
Haplotype patterns
: Major allele
: Minor allele
SNP
loci
C2

I1

I2

SNPs esto relacionados com a diversidade
de gentipos de humanos
podem ser mapeados relacionando-os a
diversidade de fentipos.
Um SNP individual ou um bloco hapltipo
pode servir de indicao para
caractersticas agronmicas
doenas
etc
Essa relao constitui a base e a motivao
para a identificao e genotipagem de SNPs.
O genoma de cada indivduo contm
distintos padres de SNPs

Pessoas podem ser agrupadas de acordo
com esse perfil

Perfil de SNPs so importantes na
identificao de respostas a terapias
Existe uma correlao entre certos perfis de SNPs
e respostas especficas a tratamentos

Genoma/transcriptoma
Sanger
454
Solexa/Solid/...
Alinhamento de sequncias
Identificao de Discrepncias
Encontrando SNPs:
Minerao de SNPs baseados no sequenciamento
(Sanger tradicional)
Sequenciamento
De DNA
mRNA
cDNA
Library
EST
Overlap
Genomic
BAC
Library
RRS
Library
BAC
Overlap
Shotgun
Overlap
Fragment DNA
DNA from multiple individuals
Sequence and Reassemble
(known sequence)
Assembly with other overlapping
GTTACGCCAATACAGGATCCAGGAGATTACC
GTTACGCCAATACAGCATCCAGGAGATTACC
mismatches = SNPs
Encontrando SNPs:
Minerao de SNPs baseados no sequenciamento
Base-calling Contig assembly
Sequence viewing
Polymorphism tagging
Relatrio de polimorfismos
Genotipagem individual
Polymorphism detection
PolyPhred
Consed
Analysis
Sequenciamento
Phred Phrap
Amplificao do DNA
5 3
Lecture 7.0
Vrios indivduos
SNP Discovery - Sanger sequencing (EST)
SNP Discovery - Diploids (heterozygous loci)
Mtodo Sanger foi o nico utilizado por 30
anos
Sanger processa em paralelo 96 sequencias
enquanto NGS processa milhes de
sequencias a um custo 6X menor.
Problemas:
Fidelidade dos dados
Tamanho dos reads
Custo da infraestrutura
Manipular grandes volumes de dados
Sequencias curtas no mapeiam unicamente
em um lugar no genoma.
Soluo #1: Reads longos.
Soluo #2: Reads pareados.
ACTTAAGGCTGACTAGC
TCGTACCGATATGCTG
Necessrio ter uma montagem de referncia
Mapeamento dos reads na referencia
Coberturas mdias necessrias:
Solexa - 100X, 454 - 10X
Anlise estatstica para validar discrepncias com base na
redundncia dos dados
Muitos Softwares disponveis
Desenvolvimento de algortmos para aumentar velocidade de
processamento

http://seqanswers.com/wiki/Special:BrowseData
sequencing errors
SNP


AACGTTAGCATA
AACGTTAGCATA
AACGTTAGCATA
strain 1
strain 2
strain 3
haploid
individual 1
individual 3
individual 2
diploid
AACGTTCGCATA
AACGTTCGCATA
AACGTTAGCATA
AACGTTAGCATA
AACGTTAGCATA
AACGTTAGCATA
AACGTTAGCATA
AACGTTCGCATA
AACGTTCGCATA
AACGTTCGCATA
AACGTTCGCATA
AACGTTCGCATA
AACGTTCGCATA
AACGTTAGCATA
AACGTTAGCATA

Para inferir uma taxa de evoluo a um gene
so estimados o KA e o KS

KA - a relao entre substituies no
sinnimas e todos os possveis sitios no
sinnimos

KS a relao entre substituies
sinnimas e todos os possveis stios
sinnimos
Exemplo:

Prolina:
CCT
CCA
CCG
CCC
Um stio sinnimo e dois no sinnimos
A taxa KA/KS uma medida clssica da evoluo de
maneira global num gene

KA/KS << 1 indica que uma substancial proporo de
mudanas de aminocidos devem ter sido eliminadas
por seleo de purificao.

KA/KS > 1 indica seleo adaptativa ou positiva
NG: Nei, M. and Gojobori, T. (1986) - Faster
LWL: Li, W.H., et al. (1985)
LPB: Li, W.H. (1993) and Pamilo, P. and
Bianchi, N.O. (1993)
MLWL (Modified LWL), MLPB (Modified LPB):
Tzeng, Y.H., et al. (2004)
YN: Yang, Z. and Nielsen, R. (2000)
MYN (Modified YN): Zhang, Z., et al. (2006)
GY: Goldman, N. and Yang, Z. (1994)
MS (Model Selection), MA (Model Averaging)



A taxa de KAKS em humanos e chimpanzes de
0,23.


Assumindo que mutaes sinnimas so neutras,
esse resultado implica que 77% das alteraes de
aminocidos em genes hominideos so
suficientemente deletrias e so eliminadas por
seleo natural. Como mutaes sinnimas no so
totalmente neutras, a proporo de alteraes de
aminocido neutras com consequncias deletrias
deve ser maior
Identificar e caracterizar SNPs em sequncias
de EST
Identificar os hapltipos com base nos
padres de SNPs
Identificar kaks

Foram utilizados dados de duas espcies de
caf:
Coffea arabica,
Coffea canephora
Espcie diplide
Polinizao cruzada: Algama.
Alta variabilidade
C. canephora melhor adaptada ao clima
equatorial mido e quente
Cultivada em baixas e mdias altitudes
Qualidade de bebida inferior
Mais resistente a diversas condies do que
Coffea arabica, em particular a doenas e
pragas.

Allopoliploide (tetraplide)
Autgama
Baixa variabilidade
Originada de um cruzamento recente
(1mya) entre Coffea eugenoides e Coffea
canephora
Espcie mais cultivada. Ocupa 75% das
plantaes mundiais de caf.
Qualidade da bebida excelente.
CAP3 para montagem dos EST
QualitySNP
KaKs_calculator
Scripts PERL
95% similaridade por 100bp
Previnir agrupamento de parlogos
Remover clusters com menos de 4
ESTs
Remover clusters com mais de 500
ESTs
Evitar contigs mal formados
Analisar informaes do CAP3 (Arquivo ACE)
Deteco de SNPs
Filtros
Reconstruo de hapltipos
Deteco de polimorfismos sinnimos e no
sinnimos com o FASTY
Construir Banco de dados com os dados
gerados.
Detecta todos os SNPs bi, tri e tetra allicos
Cada alelo representado com mais de uma
sequencia.
Excluindo SNPs singlets
Classificao dos SNPs como intra ou inter
espcies
Agrupa sequncias que representam um
mesmo alelo
Tem os mesmos nucleotdeos nos stios
polimorficos.
Utiliza mtodos matemticos para minimizar
falsas reconstrues de hapltipos
Exclui hapltipos formados por apenas uma
sequencia
calculado de acordo com a ocorrencia do
SNP em cada alelo com relao s regies de
alta e baixa qualidade
O score de confiabilidade o menor valor
Descartados valores abaixo de 2
Fasty
Produz menores alinhamentos em sequencias de
baixa qualidade
Deteco da ORF
Correo de frameshifts
Deteco de sSNP/nsSNP e SNPs ou INDELs
em regies UTR
Kaks Calculator
Identificao dos ancestrais hapltipos
Padres diferentes de expresso dos
homeologos
Contribuio de cada ancestral de arabica no
transcriptoma relacionando ao fentipo
Genes com maior presso seletiva para
mudana
Genes com maior presso seletiva para
estabilizao
Artigo submetido e em reviso

Genmica, Transcriptmica, Biologia Sinttica,
Biologia de Sistemas
http://www.lge.ibi.unicamp.br