Você está na página 1de 24

Gentica e

Embriologia
PROFA. RAPHAELA L. TRAVASSOS
BACHAREL EM ODONTOLOGIA
PS-GRADUANDA EM CIRURGIA BUCOMAXILOFACIAL ABO-AM
Conceitos Fundamentais
Gentica a cincia que estuda a hereditariedade

Hereditariedade: Fenmeno atravs do qual os seres
vivos transmitem suas caractersticas para as
prximas geraes.
Conceitos Fundamentais
GENTIPO
FENTIPO
Conceitos Fundamentais
Gametas : Clulas sexuais . Homens : Espermatozide.
Mulheres : vulos
O que um Gene?
Onde est armazenado?
Conceitos Bsicos
GENE : A UNIDADE FUNDAMENTAL DA HEREDITARIEDADE , SO SEQUENCIAS DE DNA
DNA : a estrutura
Def: uma macromolcula polimrica de cidos nucleicos
composta de trs tipos de unidades:
Um acar de 5 carbonos, a dexoxirribose
Uma base nitrogenada
Um grupo fosfato



Bioquimicamente falando...
O que so polmeros?
Monmeros so pequenas molculas
capazes de fazer ligaes.
Conforme a quantidade de ligaes altera a
nomenclatura.
P. Ex.: Dmero, Trmero, Tetrmero e por fim
POLMERO.
NUCLEOTDEO : UNIDADE
ESTRUTURAL DO AC. NUCLEICO
De seus trs componentes (acar, radical fosfato e
base orgnica nitrogenada) apenas o radical fosfato
no varia no nucleotdeo. Os aucares e as bases
nitrogenadas so variveis.
Quanto aos aucares, dois tipos de pentoses podem
fazer parte de um nucleotdeo: ribose e
desoxirribose(assim chamada por ter um tomo de
oxignio a menos em relao ribose.
J as bases nitrogenadas pertencem a dois grupos:
as pricas: adenina (A) e guanina (G);
as pirimdicas: timina (T), citosina (C) e uracila (U).


Conceitos Fundamentais
Conceitos Fundamentais
da associao dos diferentes
nucleotdeos que se formam as
macromolculas dos dois tipos
de cidos nuclicos:
o cido ribonuclico (RNA) e
o cido desoxirribonuclico
(DNA).

Eles foram assim chamados
em funo dos acar
presente em suas molculas:
O RNA contm o acar
ribose e o DNA contm o
acar desoxirribose.
Outra diferena
importante entre as
molculas de DNA
e a de RNA diz
respeito s bases
nitrogenadas: no
DNA, as bases so
citosina, guanina,
adenina e timina;
no RNA, no lugar
da timina,
encontra-se a
uracila.
IMPORTNCIA ?????
CONHECER A SEQUNCIA DE UM NUCLEOTDEO EM UM
FILAMENTO
PERMITE A RPLICA IDNTICA DA SEQUNCIA DE UM
NUCLEOTDEO EM FILAMENTO AUTOMATICAMENTE EM
CASO DE MOLCULAS DANIFICADAS COM PERDA DE
PARTE DESSA INFORMAO.
QUANDO NECESSRIO COMPLEMENTAR A SEQUNCIA.
AUTO-REPARO.
DIFERENAS: DNA X RNA
RNA similar ao DNA difere acar RIBOSE
Uracila (U) substitui a Timina (T)
Na maioria dos organismos RNA uma estrutura
unifilamentar.
DNA dupla-hlice
Questo :
Qual a relao do vrus HIV com RNA? Como
ocorre esse processo? (2 pontos)
Ligaes de Pareamento
As bases se mantm pareadas por pontes de hidrognio, 2 entre "A"
e "T" e 3 entre "C" e "G". As fitas do DNA podem ser separadas sob
certas condies experimentais, sem rompimento das ligaes
fosfodister, e a dupla hlice pode ser desnaturada em um processo
controlado e dependente de temperatura.
Pareamento
RPLICA DE DNA
ETAPAS:
A transcrio a etapa em que ocorre a cpia da
sequncia de bases do ADN para uma cadeia
complementar de RNAm.
Esta etapa decorre no ncleo, onde apenas uma cadeia de
ADN usada como molde para sntese de RNAm.
Esta sntese comandada pela enzima RNA-polimerase, que
desliga um troo de ADN, abrindo a cadeia e iniciando a
sntese, sempre no sentido 5 -> 3. Aps a passagem daRNA-
polimerase a cadeia de ADN volta fechar, formando-se
novamente pontes de hidrognio entre as bases azotadas
das 2 cadeias.
RPLICA DE DNA
Nos seres eucariontes o RNA sintetizado sofre um processamento ou maturao, antes de
abandonar o ncleo. Durante este processo, diversas pores do RNA inicialmente transcritas,
so removidas os ntrons.
Estes so sequncias no codificadoras, que so eliminadas atravs de enzimas. Entretanto as
sequncias codificadoras restantes - os exons so unidos entre si, formando
o RNAm funcional ou maturado.

RPLICA DE DNA
O processo de transcrio permite no s a sntese de mRNA, mas tambm de outros tipos
de RNA, nomeadamente, RNA ribossomico(rRNA) e RNA transferncia (tRNA), como est
esquematizado na figura.
RPLICA DE DNA

A migrao ocorre no final do processo de transcrio, pois d-se
quando o mRNA migra do ncleo para o citoplasma, no qual vai
ocorrer a traduo da mensagem. O mRNA passa para o
citoplasma atravs dos poros nucleares do ncleo.
Na traduo d-se a produo das protenas, segundo a
sequncia de codes do mRNA, com a ajuda
dos RNAt, RNAr (referidos no postESTRUTURA DO RNA) e
dos ribossomas.
Essa informao retorna para o ncleo para novo armazenamento

RPLICA DE DNA
Resumindo
DNA
(funo
ptn)
RNAm
RNAm
Citoplasma
RNAt+
RNAR+
RNAm+
RIBOSSOMO
TRANSCRIO
M
I
G
R
A

O
TRADUO
EXERCCIO:
Exerccio de Fixao:
Conhecendo os conceitos de rplica de DNA, faa uma
transcrio e uma traduo da seguinte sequencia:
AAACGGGTCCCAAAATGC
Uma sequencia de DNA foi encontrada danificada, com base na
sequencia transcrita, qual a sequencia complementar (COMPLETAR
AS DUAS SEQUENCIAS DE DNA)?
DNA=CCCCGGGGTTTTTTTAAA------GCTAATTAGC
RNA= GGGGCCCCAAAAAAAUUUCCGAAUCGAUUAAUCG
DVIDAS???
= rapha.lth@gmail.com