Você está na página 1de 17

As pginas seguir devem ser cortadas e grampeadas na lateral, formando um caderno.

ATTCGATTACAGGAATACACTTGC TCCGCTAATGTCCTTATGTGAACG TTAACGCCTCATAGGGCATCTCTA AATTGCGGAGTATCCCGTAGAGAT GCGCGCATTAGATTCTCCGATATG CGCGCGTAATCTAAGAGGCTATAC

Regras do Jogo
Clula Adentro pode ser jogado de dois modos diferentes. No primeiro, chamado de Jogando contra o Relgio, as equipes jogam juntas para tentar resolver o Caso, cooperando e correndo contra o tempo! Neste modo, todos vencem ou perdem juntos. No segundo modo, chamado de Jogando Competindo, os jogadores formam equipes que competem entre si para resolver o Caso proposto. Vence quem apresentar primeiro a soluo correta. Apresentaremos a seguir as regras adequadas para cada uma destas maneiras de jogar. Em todas elas, antes de jogar, vocs devem providenciar lpis ou caneta para anotar as pistas. Boa sorte!

JOGANDO CONTRA O RELGIO


PREPARAO: os jogadores devero formar um grupo de 4 a 12 integrantes. O grupo dever se dividir em equipes de investigadores (duplas ou trios) para pegar o maior nmero de pistas possvel em um curto espao de tempo. OBJETIVO: Encontrar uma soluo para a pergunta apresentada no Carto do Caso. Cada Caso possui 10 Cartes de Pistas. Cada pista s poder ser fornecida equipe que ingressar em cada um dos 10 compartimentos da clula destacados no tabuleiro. Coletando e discutindo as pistas, as equipes devero juntas elaborar a resposta mais completa baseada nas evidncias cientficas contidas nas Pistas. JOGADOR BANQUEIRO: escolhe-se um Jogador Banqueiro - voluntrio, sorteado ou de outro modo proposto pelo grupo - para guardar as Cartas de Pistas e Cartes de Sorte ou Azar. Caber ao Banqueiro entreg-las s duplas e as recolher nos momentos adequados. O jogador Banqueiro dever fazer parte de uma dupla ou trio. INICIANDO O JOGO: O Carto do Caso escolhido lido em voz alta para

todos os participantes. Cada equipe dever posicionar seu peo em um dos quatro locais marcados como Incio no tabuleiro. Todas as equipes lanam os dados uma nica vez: aquela que obtiver o maior nmero de pontos comear o jogo. As demais equipes jogaro no sentido horrio. As equipes devero movimentar seus pees ao longo do tabuleiro para obter as pistas. Cada equipe joga o dado na sua vez e move seu peo por tantas casas quanto forem os pontos sorteados. As trilhas de casas esto marcadas no tabuleiro. PARTIDA: As equipes tm 30 minutos para coletar as Pistas, de modo independente, sem comunicao entre os jogadores de duplas/trios diferentes. Dificilmente uma equipe ter tempo suficiente para ler sozinha todas as 10 pistas. Por isso, as equipes devero se dividir para coletar e anotar as pistas da melhor forma possvel. Ao final da Partida, cada equipe pode relatar s outras duplas/trios o que encontrou em suas Pistas. MOVIMENTANDO-SE NO TABULEIRO: As equipes devero movimentar seus pees ao longo do tabuleiro para obter as pistas. Cada equipe joga o dado na sua vez e move seu peo por tantas casas quanto forem os pontos sorteados. As trilhas de casas esto marcadas no tabuleiro. Compartimentos Celulares contendo Cartas de Pistas (casas coloridas destacadas): Matriz; Mitocndria; Membrana; Golgi; Retculo; Ncleo; Lisossomo; Peroxissomo; Centrolo e Citoesqueleto. Ateno: Se o nmero obtido no lanamento do dado ultrapassar o necessrio para entrar no compartimento contendo pistas, a equipe ter a opo de dispensar os nmeros restantes e consultar sua Carta de Pista. PISTAS: Cada compartimento contm uma pista diferente, que dever ser lida e discutida em voz baixa somente pela equipe que entrou naquele compartimento. As concluses da discusso devero ser registradas no Caderno de Anotaes. Uma vez lida, a Pista tem de ser devolvida ao aluno Banqueiro. No permitido aos jogadores consultarem mais de uma Pista ao mesmo tempo. Uma mesma Pista poder ser consultada por todas as equipes que alcanarem o compartimento que a contm. Para voltar a consultar uma determinada Pista, a equipe dever se deslocar pelo tabuleiro novamente at o compartimento correspondente. GLOSSRIO: Os termos marcados em itlico nas Pistas e Cartes de Caso possuem definies no Glossrio oferecido no final deste caderno, que poder ser consultado a qualquer momento do jogo. CASAS DE SORTE OU AZAR: No tabuleiro encontram-se diversas casas representadas por uma pequena lupa. Ao cair em uma destas casas, a equipe dever retirar um Carto de Sorte ou Azar (com uma lupa no verso). Estes cartes podem de algum modo oferecer ajuda (avanar casas, consultar mais Pistas, etc...) ou atrapalhar (perdendo jogadas, por

exemplo). As instrues contidas no carto devem ser obedecidas e este deve ser devolvido ao fim da pilha de Cartes de Sorte ou Azar. Caso se trate de um carto dando direito a consultar o professor, a mesma poder ser guardada pela equipe at o momento em que decidir us-lo, quando ento ser devolvida pilha de cartes. PROPONDO A SOLUO: terminado o tempo de coleta de Pistas, o banqueiro recolhe e guarda todas as Cartas de Pistas. As equipes de um mesmo tabuleiro devero se juntar formando um nico grupo. Cada equipe apresentar s demais as informaes das Pistas que foram capazes de coletar durante a partida (nesse momento, a consulta ao Caderno de Anotaes livre). O grupo formado por todas as equipes tem 20 minutos para discutir e propor uma soluo nica para o Caso. FINAL DO JOGO: A soluo encontrada no Caderno de Solues deve ser lida em voz alta. Se a resposta do grupo estiver correta, parabns! Todos ganharam! Note que nesse modo de jogar no h um jogador ou grupo vencedor. Todos devero jogar contra o tempo e por isso, este dever ser rigorosamente controlado.
Os Jogadores comeam a partida divididos em equipes

pistas podem coletar pistas, de modo independente, por 30 minutos

pistas

pistas

pistas

depois formam um nico grupo, onde discutem as diferentes pistas e chegam juntos Soluo

SOLUO

JOGANDO COMPETINDO
OBJETIVO: Encontrar uma soluo para a pergunta apresentada no Carto do Caso. Cada Caso possui 10 Cartes de Pistas. Cada pista s poder ser fornecida equipe que ingressar em cada um dos 10 compartimentos da clula destacados no tabuleiro. Juntando e discutindo as pistas, a equipe dever elaborar a resposta mais completa baseada nas evidncias cientficas contidas nas Pistas. Vence a equipe que propuser uma soluo correta do Caso antes dos demais concorrentes.

INICIANDO O JOGO: Os jogadores devem formar duas a quatro equipes (duplas/trios) por tabuleiro. O Carto do Caso escolhido lido em voz alta para todos os participantes. Cada equipe dever posicionar seu peo em um dos 4 locais marcados como Incio no tabuleiro. Todas as equipes lanam os dados uma nica vez: aquela que obtiver o maior nmero de pontos comear o jogo. As demais equipes jogaro no sentido horrio. MOVIMENTANDO-SE NO TABULEIRO: As equipes devero movimentar seus pees ao longo do tabuleiro para obter as pistas. Cada equipe joga o dado na sua vez e move seu peo por tantas casas quanto forem os pontos sorteados. As trilhas de casas esto marcadas no tabuleiro. Compartimentos Celulares contendo Cartas de Pistas (casas coloridas destacadas): Matriz; Mitocndria; Membrana; Golgi; Retculo; Ncleo; Lisossomo; Peroxissomo; Centrolo e Citoesqueleto. Ateno: Se o nmero obtido no lanamento do dado ultrapassar o necessrio para entrar no compartimento contendo pistas, a equipe ter a opo de dispensar os nmeros restantes e consultar sua Carta de Pista. PISTAS: Cada compartimento contm uma pista diferente, que dever ser lida e discutida em voz baixa somente pela equipe que entrou naquele compartimento. As concluses da discusso devero ser registradas no Caderno de Anotaes. Uma vez lida, a Pista tem de ser devolvida ao aluno Banqueiro. No permitido aos jogadores consultarem mais de uma Pista ao mesmo tempo. Uma mesma Pista poder ser consultada por todas as equipes que alcanarem o compartimento que a contm. Para voltar a consultar uma determinada Pista, a equipe dever se deslocar pelo tabuleiro novamente at o compartimento correspondente. GLOSSRIO E CARTAS DE SORTE OU AZAR: Neste modo de jogo, funcionam exatamente como no modo Jogando Contra o Relgio. FINAL DO JOGO: Quando uma equipe achar que solucionou o problema, dever escrever sua soluo no Bloco de Anotaes e retornar a qualquer uma das Instituies de Pesquisa (Incios do tabuleiro). A equipe dever ento ler a soluo do Caso contida no Caderno de Solues sem permitir que as outras tomem conhecimento da resposta. Se a resposta estiver correta, a equipe ter vencido o jogo e a Soluo do Caso poder ser lida em voz alta. Se a resposta estiver errada, a equipe dever retirar-se do jogo. Neste caso, as outras equipes devem continuar jogando at que uma delas obtenha a resposta correta. Alternativamente, as demais equipes podem continuar jogando mesmo aps uma delas encontrar a soluo correta, desde que a soluo no seja lida em voz alta. Desta forma, as equipes podem se classificar como primeiro, segundo e terceiro colocados.

GLOSSRIO
Acetona - composto qumico orgnico tambm conhecido como propanona. Actina - protena globular capaz de formar microfilamentos. um importante componente do citoesqueleto, que d forma clula. Adenovrus - grupo de vrus cujo material gentico o DNA. Causam doenas como a pneumonia e a conjuntivite. Alelos - as diversas formas alternativas de um gene, que podem ser encontradas em diferentes cromossomos. Antibitico - substncia que ataca bactrias, utilizada no combate a microorganismos causadores de infeces no organismo. Anticorpos- ou imunoglobulinas, so protenas responsveis pela defesa do organismo, participando do sistema imunolgico. ATP - trifosfato de adenosina, molcula que armazena energia em suas ligaes fosfato. Quando essas ligaes so desfeitas h liberao de energia, essencial sobrevivncia dos seres vivos. Axnio - parte do neurnio que conduz o impulso eltrico at outros neurnios ou clulas efetoras como as fibras musculares. Bactrias- organismos unicelulares procariontes que se reproduzem assexuadamente. Clula - a unidade estrutural e funcional dos organismos vivos. Clulas nervosas - ou clulas neurais - clulas que compem o sistema nervoso. Celulose - polissacardeo ou carboidrato encontrado na parede celular das clulas vegetais. Centrifugao - tcnica que separa partculas em suspenso de acordo com sua massa ou densidade. Clios - filamentos proticos, curtos e numerosos, que auxiliam na locomoo, captura de alimentos e outras funes. Citoesqueleto - estrutura composta por diferentes protenas, com inmeras funes na clula, como manter sua forma, por exemplo. Citoplasma - parte aquosa da clula, onde encontram-se molculas orgnicas e organelas. Complexo de Golgi - organela presente na maioria das clulas eucariticas, tem a funo de armazenar, transformar, empacotar e liberar protenas na clula. Contrao muscular - encurtamento das fibras musculares como resposta a um estmulo nervoso. Esse encurtamento depende de protenas como a actina e a miosina, e envolve gasto de energia. Corantes - substncias qumicas utilizadas para facilitar a visualizao de clulas ou estruturas celulares, atravs de sua colorao. Cromossomo - estrutura composta por uma longa fita dupla de DNA e protenas associadas, que contm informao gentica. Difuso - fenmeno de transporte onde molculas se movimentam de modo aleatrio em meio qualquer, como a gua, por exemplo.

Diviso celular a diviso de uma clula que gera duas clulas-filhas. DNA - cido desoxirribonuclico, formado por uma longa cadeia de nucleotdeos. Contm a informao gentica de um indivduo. DNA polimerase - enzima responsvel pela formao de novas fitas de DNA a partir de uma fita molde. Drogas - toda e qualquer substncia natural ou sinttica que, quando introduzida no organismo, modifica suas funes. Eletroforese em gel - tcnica de separao de molculas que se encontram de acordo com seu tamanho e carga eltrica. Muito utilizada na separao de misturas de protenas e tambm de fragmentos de DNA. Encfalo - componente do sistema nervoso central formado pelo crebro, cerebelo e tronco enceflico. Endossimbiose - relao harmnica entre diferentes espcies, na qual um organismo capaz de viver no interior de outro, trazendo benefcios para ambos. Enzimas - molculas (quase sempre protenas) que aceleram a velocidade das reaes qumicas nos seres vivos. Esperma - fluido orgnico composto por secrees produzidas por glndulas masculinas, com a funo de transportar os espermatozides. Espermatozide - clula reprodutora masculina, dotada de flagelo. Eucarionte - seres vivos formados por clulas eucariticas, ou seja, que possuem seu DNA rodeado por uma membrana (formando o ncleo), alm de diversas organelas em seu citoplasma. Evoluo - acmulo de mudanas nos seres vivos ao longo do tempo, que resulta no surgimento de novas espcies. Fagocitose - ao de ingerir partculas ou microorganismos para defesa ou alimentao. Para que ocorra, a clula deve emitir pseudpodos ou projees da membrana plasmtica. Fermentao - processo de obteno de energia a partir da quebra da molcula de glicose na ausncia de oxignio. Flagelo - estrutura celular composta por filamentos de protenas com diversas funes como: locomoo de clulas, movimentao de fluidos dentro do organismo, captura de alimentos e excreo. Fosfolipdeos - lipdeos presentes nas membranas da clula, constitudos por uma molcula de glicerol, duas cadeias de cidos graxos e um grupo fosfato ligado a uma molcula polar. Gene - sequncia de nucleotdeos do DNA que contm informao gentica. Genoma humano - o conjunto de 23 pares de cromossomos das clulas somticas humanas, sendo que 1 destes pares (XX ou XY) determina o sexo do indivduo. Hemcias - tambm conhecidas como eritrcitos ou glbulos vermelhos. So as clulas responsveis pelo transporte de oxignio no sangue. Hemoglobina - protena presente nas hemcias que d a cor vemelha a elas e responsvel pela captura e transporte do oxignio no sangue. Herpes - doena causada pelo vrus Herpes simplex que afeta a mucosa da boca e do nariz ou a regio genital, podendo ainda causar graves complicaes neurolgicas.

Heterozigoto - indivduo que possui dois alelos diferentes do mesmo gene. Hidroflica - substncia solvel em gua ou em outros solventes polares. Hidrofbico - qualquer substncia ou molcula incapaz de interagir com a gua. As molculas hidrofbicas normalmente so apolares. Homozigoto - indivduo que possui dois alelos idnticos do mesmo gene. Inflamao - resposta do sistema imune uma agresso ou uma infeco, caracterizada por dor, calor, inchao e rubor (cor vermelha) na rea afetada. Intoxicao - danos causados pela ingesto, aspirao ou introduo no organismo, acidental ou no, de substncias txicas como entorpecentes, medicamentos, produtos qumicos, alimentos deteriorados, venenos, gases txicos e etc. Junes celulares - especializaes da membrana plasmtica que permitem clula ligar-se e interagir com as suas clulas vizinhas ou com o meio que a envolve. Lipdeo - molcula encontrada em seres vivos, caracterizada pela insolubilidade em gua e solubilidade em solventes orgnicos como o lcool, por exemplo. Macrfagos - clulas que fagocitam elementos estranhos ao organismo, tendo assim um importante papel na defesa contra infeces. Membrana celular - estrutura semi-permevel que delimita todas as clulas vivas, separando o meio intracelular do meio extracelular. Meninges - trs membranas delicadas que protegem o encfalo e a medula espinhal. Microscopia - tcnica realizada com auxlio de um microscpio para a visualizao de estruturas muito pequenas ou invisveis aos olhos humanos. Microscopia de fluorescncia - tcnica especial de microscopia que usa molculas fluorescentes para marcar molculas, organelas ou estruturas que se deseja observar. Produz imagens detalhadas de componentes do interior e da superfcie da amostra. Microscopia de luz - tcnica que utiliza o microscpio tico para a observao de estruturas celulares. Microscopia eletrnica - feita atravs do microscpio eletrnico, onde no ocorre a propagao de feixes luz, mas sim de feixes de eltrons. Tem capacidade de aumento muito maior do que a microscopia tica. Microscpio - aparelho utilizado para visualizar estruturas minsculas, como as clulas e at mesmo seu interior. Mitocndria - organela que produz energia na forma de ATP a partir dos nutrientes obtidos na alimentao e do oxignio obtido na respirao. Molcula - a menor parte de uma substncia, formada pela unio de um ou mais tomos. Mutao - alterao permanente no DNA de um organismo, que pode ocorrer de forma espontnea ou induzida por agentes mutagnicos, como a radiao. Mutualismo - ocorre quando h interao entre duas espcies, em que ambas so beneficiadas. Nanmetro - (nm) unidade de comprimento que equivale a 1,010-9 metros. Se voc pegar um milmetro e dividi-lo um milho de vezes, cada pedao ter um nanmetro.

Ncleo - Estrutura celular na qual encontra-se o material gentico das clulas eucariticas. Nucleocapsdeo - parte de um vrus constituda por um cido nuclico e uma cpsula protica que o envolve. Organelas - estruturas celulares delimitadas por uma membrana prpria, que desempenham funes especficas na clula. Oxignio - elemento qumico que existe na natureza na forma de gs oxignio (O2) e gs oznio (O3). Pigmentos - compostos qumicos responsveis pela colorao de estruturas orgnicas e inorgnicas. Plasma - componente lquido do sangue, onde as clulas sanguneas ficam suspensas. Poliovrus - vrus de alta infectividade, causador da poliomielite. Protenas - molculas constitudas por aminocidos que tem funes fundamentais para os seres vivos, como estrutura, defesa, regulao e nutrio , entre outras. Protozorios - organismos eucariontes, unicelulares, heterotrficos, de vida livre ou parasitria. Radical livre -composto qumico instvel que tende a reagir com outras molculas estveis de um organismo (como o DNA), destruindo-as. Replicao - processo de duplicao do material gentico (DNA) que ocorre antes da clula entrar em diviso. Reproduo - fenmeno caracterstico dos seres vivos, onde so gerados descendentes. Pode ser sexuada ou assexuada. Respirao aerbica - processo de obteno de energia (na forma de ATP) a partir da oxidao de molculas na presena do oxignio. Respirao anaerbica - processo de obteno de energia (na forma de ATP) a partir da oxidao de molculas na ausncia do oxignio. Ribossomos - estruturas responsveis pela produo de protenas na clula. Seres fotossintetizantes - seres que realizam a fotossntese, processo no qual so sintetizadas molculas orgnicas a partir de CO2 e gua na presena de luz. Simbiose - a interao entre duas espcies na qual ambas obtm benefcios. Soluo aquosa - soluo em que o solvente a gua. Solventes orgnicos - substncias qumicas orgnicas, apolares, capazes de solubilizar outras substncias tambm apolares. Tecido - conjunto de clulas especializadas que desempenham uma determinada funo e formam os rgos. Tubulina - protena globular que forma os microtbulos. Variabilidade gentica - representa a diferena existente entre indivduos da mesma espcie quanto a caractersticas especficas (ex: cor dos olhos). Vescula - pequena organela esfrica, que transporta substncias no citoplasma de clulas eucariotas. Vrus - seres formados por molculas de DNA ou RNA envoltos por um capsdeo protico. So incapazes de se replicarem sozinhos, necessitando para isso de uma clula hospedeira.

ATTCGATTACAGGAATACACTTGC TCCGCTAATGTCCTTATGTGAACG TTAACGCCTCATAGGGCATCTCTA AATTGCGGAGTATCCCGTAGAGAT GCGCGCATTAGATTCTCCGATATG CGCGCGTAATCTAAGAGGCTATAC

Caderno do Professor
Este material foi desenvolvido especificamente para voc professor Ele complementa e aprofunda questes prticas e pedaggicas relacionadas ao Clula Adentro Sugerimos sua leitura aps travar conhecimento com as regras do jogo, j que faremos referncias a elas.

O jogo Clula Adentro


Clula Adentro um jogo de tabuleiro investigativo no qual os Casos propostos abordam questes que envolvem a Biologia Celular e Molecular. O jogo permite que os alunos entendam, de forma ldica, como os cientistas construram alguns conceitos atuais fundamentais relacionados s clulas. O jogo se baseia na interpretao de Pistas que podem conter esquemas, figuras, experincias ou resultados com os quais a comunidade cientfica se deparou, alm de informaes atuais. Os jogadores agem como investigadores fazendo anotaes, discutindo e chegando as suas prprias concluses para solucionar os Casos Grupos de at 12 alunos divididos em duplas ou trios so desafiados a encontrar a soluo correta para o Caso. O Clula Adentro pode ser jogado de duas maneiras: competitiva ou cooperativa. Nos dois casos o professor tem o papel de coordenador e orientador das discusses Cabe a ele tambm receber e avaliar as diferentes solues apresentadas pelos alunos, assim como guiar uma rica discusso ao final do jogo O Cl ul a Adentro a p res enta op ortuni da des p a ra o desenvolvimento de habilidades de raciocnio, interpretao, sntese e associao de idias, alm de possibilitar a interpretao de figuras e grficos tpicos da linguagem cientfica Este jogo possibilita aos alunos a construo do conhecimento de temas atuais relacionados Biologia Celular e Molecular de forma ldica. Alguns temas podem ser explorados no Ensino Mdio e outros no Ensino Superior, dependendo do contexto de ensino. No caso do Ensino Superior, o jogo contempla reas de interesse de Bioqumica, Evoluo, Microbiologia, Biofsica e Imunologia.

O tempo da atividade, incluindo explicao das regras, o jogo e a discusso final com a turma, dura em mdia 90 minutos (uma hora e meia), o que o torna compatvel com os tempos de aula comuns no ambiente escolar e universitrio De forma resumida, no Clula Adentro os jogadores so desafiados a resolver os Casos por meio da coleta interpretao e discusso de Pistas Para isso eles movimentam seus pees pelo tabuleiro que representa de forma esquemtica uma clula eucaritica Ao resolverem o Caso, os estudantes descobrem algumas das caractersticas e funes da clula, como sugere o nome do Jogo

Objetivos Pedaggicos do jogo


O Clula Adentro foi desenvolvido por um grupo de educadores e pesquisadores das reas de Bioqumica, Biologia Celular e Ensino que, vivenciando o ensino de Biologia em vrios nveis, se uniram para criar uma estratgia que pudesse resgatar o prazer da descoberta e do aprendizado por meio de uma atividade ldica que estimulassem o raciocnio e o trabalho em grupo. Os principais objetivos deste jogo so: 1) convidar os alunos a serem mais ativos no processo de aprendizagem 2) oferecer uma oportunidade interativa e ldica para o aprendizado de Biologia3) estimular a curiosidade e o trabalho em equipe a discusso e troca de idias 4) promover a interpretao de dados cientficos sua linguagem representaes (grficos, tabelas, imagens) e 5) simular, at certo ponto, etapas do processo de pesquisa cientfica, estimulando os alunos a relacionarem diferentes informaes para a resoluo de um problema. Em cada Pista procuramos sempre explorar resultados de experincias introduzindo formas de apresentao de dados comuns na linguagem cientfica, tais como grficos, tabelas, micrografias sempre tendo como objetivo o uso destes recursos em associao com uma linguagem acessvel aos estudantes Nenhuma pista sozinha capaz de fornecer a soluo para o Caso. importante portanto interpretar cada uma delas e relacion las com as demais para chegar soluo do Caso
AF BN DV SH CG Ci Bulbo
1

Lipdeos extrados das hemcias espalhados na gua Hemcias


Tempo gasto para viajar 10cm

bactria livre

B
Reproduzido sob permisso de Julie Theriot & Tim Mitchison
10m m

clula hospedeira fagocitose

rea total ( m m)

Partcula
0,5

Dimetro (nm) 33 90 105

Em H2O (dias) 45 122 169

No citoplasma (dias) 22.265


60.590

bactria escapa bactria mvel formao da cauda de actina

Partcula de Poliovrus Partcula de Adenovrus Partcula de vrus Herpes simplex


bode homem

84.315
bactria segue para clula vizinha

O Clula Adentro pretende trazer para a sala de aula a discusso sobre temas importantes, interessantes e atuais sobre a clula, sua fisiologia, funo, interao com outras clulas e microrganismos, alm de sua homeostase e evoluo. A compreenso das Pistas permite ao aluno desvendar algum mistrio em relao clula e aprender ao mesmo

tempo um pouco mais sobre suas organelas e estruturas. O objetivo maior fazer com que os alunos construam autonomamente os conceitos de forma ldica. O jogo no pretende substituir o professor em sala de aula, e sim servir como um instrumento adicional para estimular os alunos, ao abordar temas complexos de Biologia Celular e Molecular. O clima de descontrao gerado pelo "jogar" em grupo fundamental para o processo de aprendizagem relacionado ao Clula Adentro

O Papel do Professor no Jogo


O professor desempenha um papel fundamental antes, durante e aps a partida. Apresentaremos aqui algumas sugestes para orientao dos alunos que ajudam a tornar o jogo mais eficiente e divertido Como o tempo de aula normalmente curto importante uma rpida separao dos grupos e uma explicao clara das regras do jogo. O ideal que joguem, no mximo, 4 duplas ou trios por tabuleiro. No entanto quando a turma for grande e a disponibilidade de tabuleiros pequena pode se dividir em grupos maiores dos quais um representante dever rolar o dado movimentar o peo e levar a pista para o restante do grupo. Ou seja, ao invs de 4 duplas em torno de um tabuleiro, poder haver grupos de at alunos cada Lembramos que o jogo est disponvel gratuitamente na internet para impresso bastando dispor de dados e objetos que substituam os pees (botes, pees de outros jogos, etc). Sendo assim, aconselhamos a jogar com grupos menores a fim de obter melhor desempenho individual Deve se tambm antes de comear o jogo, salientar a importncia dos alunos coletarem e lerem o maior nmero de Pistas possvel de preferncia todas as 10 Pistas de cada Caso Os alunos devem ser orientados para escreverem no Caderno de Anotaes apenas um resumodapista Elesno devemcopiar a pista poisisso comprometeria o dinamismo do jogo sem aumentar as chances de resoluo do Caso. Alm disso, deve-se frisar a importncia de que ao apresentarem uma proposta de soluo para cada Caso os alunos devem incluir explicitamente as evidncias que os levaram a formular aquela hiptese. Durante a partida: comum os alunos solicitarem ajuda do professor para entender as Pistas No aconselhamos que isto seja feito, a menos que eles tenham uma carta de sorte ajuda do professor A busca autnoma das respostas pelos alunos estimula a discusso nas equipes e, em geral, medida que vo conseguindo outras Pistas suas dvidas so esclarecidas. A idia do jogo que os alunos tenham tempo para ler interpretar discutir e raciocinar para poder elaborar suas prprias concluses Osproblemasdeinterpretao que eventualmente

permanecerem at o fim da partida sero sanados no momento da discusso aps a partida. Ao fim do jogo: Na forma competitiva a regra indica que a partida acaba quando a primeira dupla apresentar uma soluo correta para o Caso Sugerimos porm, que o professor d mais tempo para que outras duplas tentem escrever suas solues mesmo que ainda no tenham coletado todas as Pistas Eventualmente se pode fazer algum tipo de pdio, com diferentes colocaes. Na forma cooperativa, deve-se fazer um controle rgido do tempo, para que ele seja um desafio real. O momento de escrever a soluo tambm de fundamental importncia para que os alunos desenvolvam e pratiquem a interpretao, sntese e articulao de idias. Mesmo que no cheguem soluo totalmente correta, a discusso em grupo sempre uma boa oportunidade para organizar consolidar e estruturar as idias. A discusso final Consideramos a discusso como parte do jogo do ponto de vista pedaggico apesar de ocorrer aps o final da partida nesse momento que o professor desempenha um papel fundamental discutir as dvidas dos alunos acerca dos contedos das Pistas de levantar questes sobre o Caso e/ou temas do programa de ensino a ele relacionados Para isto o professor deve coordenar a discusso, apresentando pista por pista para garantir que as dvidas questionamentos e curiosidades em relao ao vocabulrio, aos grficos, experimentos e o papel de cada pista no Caso, sejam abordados Por favor, entrem em contato conosco atravs de nosso site: www.celulaadentro.com.br para qualquer dvida e/ou sugesto.

Por que jogar de forma cooperativa?


A aprendizagem cooperativa vem sendo amplamente utilizada desde a dcada de 1960 por educadores que acreditam em seu potencial na formao pessoal e profissional dos estudantes. A cooperao pode promover uma aprendizagem mais ativa, estimulando o pensamento crtico, desenvolvendo capacidades de interao, negociao de informaes e resoluo de problemas. Essas caractersticas levam o aluno a assimilar e construir conceitos de modo mais autnomo, permitindo assim um aprendizado mais centrado no aluno do que no professor. A cooperao aumenta ainda a sociabilidade dos indivduos, visto que todos os membros do grupo devem aprender a dialogar organizadamente resolver conflitos democraticamente dividir igualmente as tarefas e levar em considerao outras idias (Johnson & Johnson, 1994). fundamental destacar que o simples trabalho em grupo no caracteriza uma estratgia como cooperativa: extremamente importante que cada membro do

grupo desempenhe uma tarefa reconhecida como importante para o coletivo Nossa equipe acredita que a melhor maneira de jogar o Clula Adentro de forma cooperativa Nessa estratgia, os jogadores dividem-se em equipes que cooperam para coletar e interpretar as Pistas tendo com nico adversrio o tempo que, por esse motivo, dever ser rigorosamente controlado As regras deste modo de jogar encontram se no caderno de Regras do JogoOs resultados das pesquisas e avaliaes do Clula Adentro jogado de forma cooperativa mostram que os alunos no sentem falta da competio Os alunos reconhecem que trabalhar em grupo facilita o aprendizado e citam mais a diverso como um aspecto positivo do jogo do que quando esto competindo. Alm disso, avaliamos que jogar cooperando funciona, pois o desempenho do grupo e de cada aluno igual ou maior do que competindo Melim e cols. Dessa forma alm de trabalhar aspectos relacionados cognio, a cooperao aumenta o dilogo entre os alunos, uma vez que ao final do jogo as duplas devem relatar umas as outras o contedo das Pistas por elas coletadas, a fim de propor a soluo do grupo. Isto estimula a participao de todos os alunos durante a atividade e exercita a capacidade dos alunos lidarem com diferentes pontos de vista sobre um mesmo assunto sem que se perca o carter ldico do jogo.

Quando Jogar Clula Adentro?


O Clula Adentro possui cinco Casos que foram desenvolvidos abordando diferentes temas relacionados ao estudo da clula: 1) a origem evolutiva da mitocndria a apoptose no desenvolvimento embrionrio biologia molecular forense a estrutura da membrana plasmtica e a utilizao do citoesqueleto na infeco viral. Segue um quadro com uma breve descrio dos diferentes Casos com o objetivo a ser alcanado, a pergunta contida em cada um deles e os temas abordados (veja os detalhes no Quadro 1 na prxima pgina

Quadro 1: Contedo dos 5 Casos do Jogo


PROBLEMA PROSPOSTO TEMAS ABORDADOS SUGESTES DE QUANDO JOGAR - Ao abordar a origem da clula eucariota - Quando estiver discutindo o tpico de mitocndria e respirao celular

CASO

OBJETIVO

Hspede do Barulho

Entender como surgiu a mitocndria na clula primitiva, causando mudanas to drsticas na evoluo dos seres complexos.

Voc dever descobrir como a mitocndria surgiu na clula eucariota.

- Evoluo Simbiose - Fagocitose - Estrutura e funo da mitocndria

O Caso da Membrana Plasmtica

Entender como os lipdeos esto organizados na membrana plasmtica, e como isso foi descoberto.

Voc dever, partir das pistas deixadas por Gorter e Grendel, descobrir como os lipdeos esto organizados na membrana plasmtica das clulas.

- Lipdeos e membranas celulares

- Quando estiver abordando as biomolculas da clula - Ao iniciar o tema membrana plasmtica

Surfando na Clula

Atravs do exemplo do caminho utilizado pelo vrus Herpes para chegar no ncleo da clula, abordar a estrutura e funes do citoesqueleto da clula eucariota. Discutir a importncia da apoptose no apenas no desenvolvimento embrionrio (tema do caso), mas tambm ao longo da vida do organismo, sendo necessria ao seu bom funcionamento e sobrevivncia. Exemplificar como os conhecimentos de DNA e da biologia forense so importantes numa investigao criminal.

Descubra o meio atravs do qual o Virus da Herpes consegue chegar rapidamente ao ncleo de uma clula eucaritica.

- Funo e estrutura do citoesqueleto - Infeco viral - Transmisso da Herpes

- Ao abordar os temas de organelas e estruturas celulares - Para introduzir o tema do citoesqueleto

Um por Todos

Como as clulas das membranas entre os dedos de um feto desaparecem para que eles se formem?

- Apoptose

- Ao introduzir o desenvolvimento embrionrio - Ao discutir morte celular - Ao final do ciclo celular

- Necrose

A prola do Nilo

Quem roubou a jia A Prola do Nilo? Como foi possvel, a partir de um nico fio de cabelo, encontrar o criminoso?

- Tcnicas de biologia molecular - DNA - Biologia Forense

- Ao terminar de estudar o tema DNA e replicao

Um pouco de teoria...
Este jogo foi formulado baseando-se na abordagem do aprendizado pela soluo de problemas (PBL - Problem Based Learning) (Pozo, 1998 Stevens e cols Neste tipo de estratgia, os estudantes devem colaborar para resolver situaes-problema. No contexto do jogo, estes problemas relacionam-se a importantes questes do campo da biologia celular e molecular. Diferente de abordagens educacionais mais tradicionais, envolvendo somente aulas expositivas, o ensino baseado na soluo de problemas envolve a discusso entre pequenos grupos de estudantes, discusses essas apoiadas e facilitadas pela figura do tutor ou professor (Aspy e cols., 1993). A formulao didtica das situaes problema apresentadas no jogo levam em conta a preparao e as limitaes inerentes ao nvel educacional dos jogadores Houve a orientao para uma ao investigativa, com carter dinmico e, acima de tudo, com uma soluo que resulte na construo do conhecimento. Ao jogar o Clula Adentro o aluno deve ser capaz de pesquisar, buscar informaes, abaliz las e selecion las em lugar de praticar exerccios de memorizao preciso que sejam realizadas diferentes atividades acompanhadas de situaes problematizadoras, questionadoras e de dilogo, envolvendo resoluo de problemas e levando introduo de conceitos novos, para que os alunos possam construir seu conhecimento. Utilizar atividades investigativas como ponto de partida para desenvolver a compreenso de conceitos uma das maneiras de levar o aluno a sair de uma postura passiva, tornadose mais participativo no processo de aprendizagem e ativo sobre o seu objeto de estudo Carvalho e cols

Resultados da Avaliao do Jogo


Em estudo recente, verificamos a grande aceitao do jogo entre o pblico jovem (Spiegel e cols Neste trabalho envolvendo alunos da rede pblica e privada do Rio de Janeiro, 94% dos jogadores declararam que gostariam de jogar o Clula Adentro novamente, porque consideravam o jogo divertido e bom para seu aprendizado A maioria dos alunos chegou soluo dos Casos propostos construindo conceitos de Biologia de forma dinmica e reforando ainda seus conhecimentos de outros contedos. Alm disso, as observaes realizadas neste trabalho sugeriram um importante papel do trabalho em grupo (em pares ou trios) para atingir os principais objetivos educacionais do jogo O Clula Adentro foi avaliado e obteve boa aceitao tanto em universidades quanto em escolas pblicas e privadas do ensino mdio no Rio de Janeiro (Spiegel e cols e na Sua (Cardona e cols ,

Nossos resultados tambm apontam para uma boa aceitao do jogo como estratgia de ensino por parte dos professores entrevistados (Cardona e cols. no apenas por seu carter ldico mas tambm pelo desenvolvimento de importantes habilidades Os resultados indicam portanto que o Clula Adentro motivador estimula o raciocnio, gera o entrosamento e troca de idias entre os alunos e, principalmente, torna ldico o aprendizado em temas de biologia celular e molecular. Dessa forma, este jogo tem grande potencial para uso na difuso de cincias entre jovens de diferentes faixas etrias e nveis de escolaridade.

Para saber mais sobre o Clula Adentro


Cardona TS, Spiegel CN, Alves GG, Ducommun J, Pons AH, Arajo-Jorge TC (2007) Introducing DNA Concepts to Swiss High School Students Based on a Brazilian Educational Game Biochemistry and Molecular Biology Education 35(6), 416421. Melim LMC, Alves GG, Spiegel CN, Arajo-Jorge TC & Luz MRMP (2009) Surfing in the Cell an investigative game for teaching cytoskeleton concepts for undergraduate students Enseanza de las Cincias, volume extra VIII Congreso Internacional sobre Investigacin en Enseanza de las Ciencias Melim LMC, Spiegel CN, Alves GG Luz MRMP Cooperao ou competio? Avaliao de uma estratgia ldica de ensino de Biologia para estudantes do ensino mdio. VII Encontro Nacional de Pesquisa em Educao em Cincias. Spiegel CN, Alves GG, Cardona TS, Melim LMC, Luz MRMP, Arajo-Jorge TC & Henriques-Pons A (2008). Clula Adentro Discovering the Cell an educational game in cell and molecular biology for secondary-level students. Journal of Biology Education, 43(1), 27-35.

Bibliografia
Aspy DN, Aspy CB and Quimby PM (1993). What doctors can teach teachers about problem-based learning. Educational Leadership, 50 (7), 22-24. Carvalho AMP, Azevedo MCPS, Nascimento VB, Cappechi MCM, Vannuchi AI, Castro R S, Pietrocola M, Vianna DM & Arajo RS (2004). Ensino de Cincias: unindo a pesquisa e a prtica. Ed. Thomson. Johnson T & Johnson DW An Overview of Cooperative Learning. http://www.co-operation.org/pages/overviewpaper.html Originalmente publicado em: J. Thousand, A. Villa and A Nevin Eds Creativity and Collaborative Learning Brookes Press Baltimore Pozo JI, Echeverra MPP & Castill JD (Eds.) A Soluo de Problemas. Artmed, RS, Brasil Stevens R, Johnson DF Soller A Probabilities and Predictions: Modeling the Development of Scientific Problem-Solving Skills. Cell Biology Education, 4, 42 57.