Você está na página 1de 33

MINISTRIO DA EDUCAO UNIVERSIDADE FEDERAL DE GOIS PR-REITORIA DE GRADUAO CENTRO DE SELEO

UFG

Processo Seletivo UFG 2013-1


Ensino pblico e de qualidade

Tipo 1
1. 2. 3.

13/01/2013
PROVAS LNGUA PORTUGUESA LITERATURA BRASILEIRA MATEMTICA BIOLOGIA FSICA GEOGRAFIA HISTRIA QUMICA LNGUA ESTRANGEIRA MODERNA QUESTES 01 11 21 31 41 51 61 71 81 a a a a a a a a a 10 20 30 40 50 60 70 80 90

S ABRA QUANDO AUTORIZADO


LEIA ATENTAMENTE AS INSTRUES
Quando for permitido abrir o caderno, verifique se ele est completo ou se apresenta imperfeies grficas que possam gerar dvidas. Em seguida, verifique se ele contm 90 questes. Cada questo apresenta cinco alternativas de resposta, das quais apenas uma a correta. Preencha no carto-resposta a letra correspondente resposta julgada correta. O carto-resposta ser distribudo s 16 horas. Ele personalizado e no ser substitudo em caso de erro durante o seu preenchimento. Ao receb-lo, verifique se seus dados esto impressos corretamente; se for constatado algum erro, notifique ao aplicador de prova. As provas tero a durao de cinco horas, j includas nesse tempo a marcao do carto-resposta e a coleta da impresso digital. A tabela peridica dos elementos qumicos est disponvel, para consulta, na segunda-capa deste caderno. Voc s poder se retirar definitivamente da sala e do prdio a partir das 17h30min. AO TERMINAR, DEVOLVA O CARTO-RESPOSTA AO APLICADOR DE PROVA.

4. 5. 6. 7.

CLASSIFICAO PERIDICA DOS ELEMENTOS (com massas atmicas referidas ao istopo 12 do carbono)
18
2

1 13
5 10,8 13 6 12,0 14 28,1 32 33 7 14,0 15 31,0 8 16,0 16 32,1 34 9 19,0 17

1 B Si As
74,9 51 118,7 82

1,008 3

H C P S N O F

14

15

16

17

He
4,00 10

2 5
27,0 23 50,9 41 24 25 26 27 28 29 30 31

Li 6 Cr
52,0 42 54,9 43 55,8 44 58,9 45 106,4 78 58,7 46 107,9 79 63,5 47 65,4 48 114,8 81 69,7 49 72,6 50

6,94 11

Be 7 Mn Tc
98,9 75 101,1 76 102,9 77 112,4 80

9,01 12

Ne
20,2 18

3 8 Fe Ru Os
195,1 197,0 200,6 190,2 108 192,2 109

Na 9 Co Rh Ir Mt
(266)

23,0

Mg 10 Ni Pd Au Hg Tl
204,4

24,3

3 V Mo
95,9 74

4 Cu Ag Cd In Sn Zn Ga Ge

11

12

Al

Cl
35,5 35

Ar
39,9 36

19

20

21

22

4 Nb
92,9 73

39,1 37

Ca

40,1 38

Sc

44,9 39

Ti

47,9 40

Se
78,9 52 121,8 83

Br
79,9 53

Kr
83,8 54

5 Ta
180,9 105 183,8 106 186,2 107

Rb W Sg
(263) (264) (265)

85,5 55

Sr Re Bh Hs Pt

87,6 56

88,9 57 - 71

Zr

91,2 72

Sb Pb
207,2

127,6 84

Te Bi
209,0

126,9 85

I Po
209

131,3 86

Xe At
(210)

6 Db
(262)

Cs

Ba

132,9 87

137,3 88

Srie dos Lantandios

Hf

Rn
(222)

89 - 103

178,5 104

Fr

Ra

(223)

(226)

Srie dos Actindios

Rf

(261)

Srie dos Lantandios


58 140,1 59 140,9 60 61 62 63 64 65 66 67 68 69 70 71

57

Z
Ce
144,2 (145) 150,4 91 (231) 92 238,0 93 94 (244)

138,9

La
90

Pr

Nd

Pm

Sm

Eu

152,0

Gd
157,3 95 96

Tb

158,9

Dy
97

162,5

Ho
164,9 98 99

167,3

Er

Tm
168,9 100 101

Yb
173,0 102

Lu

175,0

Smbolo
Th
232,0

Srie dos Actindios


103

89

A
Pa U

(227)

Ac

Np
(237)

Pu

Am
(243)

Cm
(247)

Bk
(247)

(251)

Cf

(252)

Es

Fm
(257)

Md
(258)

No
(259)

(260)

Lr

UFG/CS

PROCESSO SELETIVO-2013-1

TIPO-1

LNGUA PORTUGUESA Leia o Texto 1 para responder s questes de 01 a 03. Texto 1


PREFCIO So os primeiros cantos de um pobre poeta. Desculpai-os. As primeiras vozes do sabi no tm a doura dos seus cnticos de amor. uma lira, mas sem cordas; uma primavera, mas sem flores; uma coroa de folhas, mas sem vio. Cantos espontneos do corao, vibraes doridas da lira interna que agitava um sonho, notas que o vento levou, como isso dou a lume essas harmonias. So as pginas despedaadas de um livro no lido... E agora que despi a minha musa saudosa dos vus do mistrio do meu amor e da minha solido, agora que ela vai seminua e tmida por entre vs, derramar em vossas almas os ltimos perfumes de seu corao, meus amigos, recebei-a no peito, e amai-a como o consolo que foi de uma alma esperanosa, que depunha f na poesia e no amor esses dois raios luminosos do corao de Deus.
AZEVEDO, lvares de. Lira dos vinte anos. In: Obra completa. Organizao de Alexei Bueno. Rio de Janeiro: Nova Aguilar, 2000. p. 120.

QUESTO 03 Se ao invs de usar perodos compostos como em " uma lira, mas sem cordas; uma primavera, mas sem flores; uma coroa de folhas, mas sem vio.", o autor tivesse escolhido perodos simples: " uma lira sem cordas. uma primavera sem flores. uma coroa de folhas sem vio.", a imagem construda a respeito de sua obra no seria a mesma, porque (A) o pressuposto produzido pelo uso do termo sem indica a impossibilidade de os poemas retratarem a completude das coisas do mundo. (B) a oposio entre os objetos naturais e os produzidos pelo homem autoriza a interpretao de que a natureza seja a musa inspiradora dos poemas. (C) o subentendido produzido pelo uso do mas leva o leitor ao entendimento de que a obra comparada a produes rudimentares. (D) a contradio marcada pelo uso do mas permite a compreenso de que a essncia das coisas se mantm mesmo quando lhes falta o atributo principal. (E) a anttese instaurada na comparao entre realidade e fico produz a ideia de que a poesia deva realar a aparncia das coisas.

QUESTO 01

Os aspectos lingusticos e enunciativos do texto demons RASCUNHO tram que se trata do gnero prefcio, pois o autor (A) apresenta sua viso de mundo, explorando o uso de metforas como recurso persuasivo. (B) comenta a obra, apresentando justificativas e explicaes sobre sua autoria. (C) narra uma histria pessoal, explicitando os conflitos vividos por quem escreve poesia. (D) descreve sua infncia, justificando o carter ingnuo que marca a obra. (E) critica a falta de erudio dos jovens da poca, antecipando as dificuldades de leitura. QUESTO 02 No prefcio, a cena enunciativa coloca o autor e o leitor em um mesmo tempo e espao. Quais elementos lingusticos contribuem para esse efeito no dilogo? (A) As vozes em terceira pessoa e a palavra "primavera". (B) Os enunciados negativos e o termo "lira". (C) As oraes adversativas e o substantivo "poeta". (D) Os argumentos explicativos e o adjetivo "pobre". (E) As frases imperativas e o advrbio "agora".

ps-2013-1_linguaportuguesa-tipo-1

UFG/CS

PROCESSO SELETIVO-2013-1

TIPO-1

Leia o Texto 2 para responder s questes 04 e 05. Texto 2


Alienao poltica de jovens tendncia mundial Embora o nmero de eleitores aptos ao voto facultativo, com 16 e 17 anos de idade, tenha aumentado em relao ltima eleio, em 2010, a percepo que h um desinteresse dos jovens nessa faixa etria em relao eleio deste ano. A avaliao do cientista poltico Eurico de Lima Figueiredo, da Universidade Federal Fluminense (UFF). Para ele, essa percepo no s restrita ao Brasil. ''A desmotivao mundial'', disse. ''Parece que ns vivemos uma poca em que os jovens encontram solues que j esto dadas'', completou. Figueiredo acredita, no entanto, que principalmente agora, na Europa, haver um recrudescimento da participao juvenil na tentativa de encontrar solues para os novos problemas colocados pela crise econmica. ''A tradio mostra que so os jovens que mais reagem a situaes de crise, inclusive porque eles trazem dentro de si o futuro e reconhecem nas situaes crticas do presente o que no deve ser feito e o que precisa ser mudado''. No caso do Brasil, analisou que a ltima participao forte da juventude na poltica ocorreu com a gerao dos ''caras pintadas'', que foram s ruas pelo impeachment de Fernando Collor, da Presidncia da Repblica (1992). Por isso, reiterou que a desmotivao uma tendncia geral do mundo, que vive uma situao que, ''para o jovem, relativamente confortvel''. Segundo o professor de ps-graduao em cincia poltica da UFF, h uma ideologia espalhada no ar, que se denomina ps-modernismo, onde se cultiva muito o individualismo, em vez das preocupaes coletivas e sociais. E isso tudo influencia o comportamento juvenil. ''Por isso, no de se estranhar que haja essa desmotivao'', declarou. Vinicius de S Machado foge a essa regra. Morador de So Gonalo, na regio metropolitana do Rio de Janeiro, o estudante de 17 anos lamentou ter perdido o prazo para tirar o ttulo de eleitor para poder votar no prximo domingo (7). Ele se definiu motivado. ''Os candidatos todos despertam o interesse. Mas muitos prometem e no fazem nada'', disse Agncia Brasil. ''Eu queria votar para ajudar a minha cidade'', acrescentou. O presidente da Unio Nacional dos Estudantes (UNE), Daniel Iliescu, chamou a ateno para o fato de que, apesar de o nmero percentual de jovens entre 16 e 18 anos incompletos com inscrio eleitoral no ser to expressivo, ''ano a ano, nas eleies, nunca tantos jovens estiveram aptos a votar''. Por essa razo, definiu como relativo o dado que aponta uma desmotivao dos eleitores de 16 e 17 anos para o pleito deste ano. Destacou que o voto para menores de 18 anos foi um direito conquistado na Constituio de 1988. '' um direito caro para o pas e uma forma importante de os jovens entrarem em contato com a cidadania e com seus deveres enquanto cidados para opinarem sobre a poltica em seu pas''.
GANDRA, A. Disponvel em: <http://www.jb.com.br>. Acesso em: 3 out. 2012. (Adaptado).

QUESTO 04 O artigo de opinio suscita o debate a respeito da alienao poltica dos jovens brasileiros na faixa etria entre 16 e 17 anos. Que trecho do texto traz o argumento que explica a percepo do desinteresse desses eleitores em relao votao do dia 7 de outubro de 2012? (A) A tradio mostra que so os jovens que mais reagem a situaes de crise. (B) eles trazem dentro de si o futuro e reconhecem nas situaes crticas do presente o que no deve ser feito e o que precisa ser mudado. (C) h uma ideologia espalhada no ar, que se denomina ps-modernismo, onde se cultiva muito o individualismo. (D) Os candidatos todos despertam o interesse. Mas muitos prometem e no fazem nada. (E) um direito caro para o pas e uma forma importante de os jovens entrarem em contato com a cidadania e com seus deveres. QUESTO 05 O texto traz a voz de um estudante que fugiria ao padro de comportamento poltico do jovem atual. No entanto, o discurso desse estudante reafirma a tese do desinteresse dessa faixa etria pelas eleies, pois, apesar de (A) dizer que gostaria de votar para ajudar sua cidade, deixou de observar o prazo de inscrio eleitoral. (B) morar em So Gonalo, desconsidera que suas aes polticas tenham consequncias para o Rio de Janeiro. (C) afirmar que as promessas dos polticos carecem de cumprimento, tem vontade de exercer o direito de voto. (D) conhecer a realidade poltica brasileira, diz que os candidatos so interessantes. (E) entender que o voto uma imposio poltica, acredita que eleies sejam benficas ao pas. QUESTO 06 Nos trechos "As primeiras vozes do sabi no tm a doura dos seus cnticos de amor" (Texto 1) e "Parece que ns vivemos uma poca em que os jovens encontram solues que j esto dadas" (Texto 2), a justificativa para a dificuldade do jovem em face de certas tarefas diferente e est centrada, respectivamente, (A) na valorizao da aparncia do jovem e na busca de compreenso de seus conhecimentos. (B) no carter emotivo do jovem e no seu estado de perplexidade diante das questes polticas. (C) na base biolgica do crebro em processo de evoluo e na herana gentica. (D) na capacidade de o jovem imitar a natureza e no pessimismo do jovem ps-moderno. (E) na curta experincia do jovem e na desmotivao para refletir acerca dos problemas de sua poca.

ps-2013-1_linguaportuguesa-tipo-1

UFG/CS

PROCESSO SELETIVO-2013-1

TIPO-1

Leia o Texto 3 para responder s questes 07 e 08. Texto 3

meas. Uns, aps outros, lavavam a cara, incomodamente, debaixo do fio de gua que escorria da altura de uns cinco palmos. O cho inundava-se. As mulheres precisavam j prender as saias entre as coxas para no as molhar; via-selhes a tostada nudez dos braos e do pescoo, que elas despiam, suspendendo o cabelo todo para o alto do casco; os homens, esses no se preocupavam em no molhar o plo, ao contrrio, metiam a cabea bem debaixo da gua e esfregavam com fora as ventas e as barbas, fossando e fungando contra as palmas da mo. As portas das latrinas no descansavam, eram um abrir e fechar de cada instante, um entrar e sair sem trguas. No se demoravam l dentro e vinham ainda amarrando as calas ou as saias; as crianas no se davam ao trabalho de l ir, despachavam-se ali mesmo, no capinzal dos fundos, por detrs da estalagem ou no recanto das hortas.
AZEVEDO, Alusio. O cortio. Rio de Janeiro: Otto Pierre, 1979. p. 4445.

Disponvel em: <www.maisseriedade.blogspot.com.br>. Acesso em: 3 out. 2012.

QUESTO 09

QUESTO 07

No trecho, as escolhas lexicais caracterizam as personaConsiderando-se os sentidos produzidos pelo jogo de ima- gens como gens presente no texto, as frases "Anos rebeldes. Prximo (A) transgressoras, conforme relata o trecho "as crianas captulo. Fora Collor! Impeachment j! contribuem para a no se davam ao trabalho de ir l, despachavam-se construo da ideia de que ali mesmo, no capinzal dos fundos. (A) o povo nostlgico em relao s manifestaes po- (B) seres inquietos, conforme indicam os sentidos produpulares ambientadas no perodo da ditadura. zidos pelos pares de valor semntico opositivo "abrir e fechar" e "entrar e sair". (B) os jovens protagonizam sucessivas cenas de conflitos polticos no pas. (C) contempladoras da natureza, conforme sugere a (C) os polticos tratam os problemas brasileiros como cenas de fico televisiva. meno s aves em grasnar de marrecos e cantar de galos.

(D) a populao brasileira injustiada pelos movimen- (D) animais, conforme demonstra a descrio das aes tos polticos de oposio. em "suspendendo o cabelo para o alto do casco e "esfregam com fora as ventas". (E) o presidente da Repblica deve ser exilado como punio s suas atitudes rebeldes. (E) indiferentes, conforme mostra a avaliao de seu comportamento em uns, aps outros, lavavam a QUESTO 08 cara, incomodamente, debaixo do fio de gua". As frases injuntivas na faixa dos manifestantes representam QUESTO 10 (A) o desejo de provocar uma revoluo poltica no pas. Considerados os papis sociais das personagens do ro(B) o desrespeito ao Estado Democrtico de Direito. mance, a frase "era um zunzum crescente" resume um as(C) a reao a um quadro poltico desfavorvel ordem pecto contextual relevante para a configurao da cena social. retratada, pois (D) a luta pelo direito de voto por meio de eleies dire- (A) demonstra a plasticidade sonora de um ambiente em tas para presidente. que vozes dispersas, sem ressonncia, deixam de ser distintas e so condensadas em rumor. (E) uma crtica averso do presidente Collor s manifestaes populares. (B) descreve uma cena tpica de um grupo social que reconhece seu discurso como arma de resistncia con tra a elite dominante da poca. Leia o Texto 4 para responder s questes 09 e 10. (C) envolve o leitor em uma atmosfera conflituosa, em Texto 4 que homens e mulheres representam opinies diver[] No confuso rumor que se formava, destacavam-se risos, sons de vozes que altercavam, sem se saber onde, grasnar de marrecos, cantar de galos, cacarejar de galinhas. De alguns quartos saam mulheres que vinham pendurar c fora, na parede, a gaiola do papagaio, e os louros, semelhana dos donos, cumprimentavam-se ruidosamente, espanejando-se luz nova do dia. Da a pouco, em volta das bicas era um zunzum crescente; uma aglomerao tumultuosa de machos e f-

gentes diante da realidade imposta. (D) convida o leitor para um passeio panormico a uma sociedade envolta em sons buclicos, de referncia rcade, que do um tom singelo ao ambiente. (E) revela traos fundamentais na caracterizao de uma comunidade centrada em uma atmosfera que inspira suspense e fantasia.
ps-2013-1_linguaportuguesa-tipo-1

UFG/CS

PROCESSO SELETIVO-2013-1

TIPO-1

LITERATURA BRASILEIRA QUESTO 11 As trajetrias das personagens do romance O cortio, de Alusio Azevedo, so representativas da fora com que o meio age sobre seus comportamentos. Afetadas por essa fora, as personagens (A) Albino e Leocdia se tornam promscuas devido s ms influncias dos amigos do cortio. (B) Joo Romo e Bertoleza se anulam em nome da ambio de fazer progredir o cortio. (C) Miranda e Estela se corrompem medida que se aproximam dos moradores do cortio. (D) Jernimo e Pombinha so transformadas pela sensualidade reinante no cortio. (E) Firmo e Rita Baiana tm seu carter modificado pela malandragem prpria dos habitantes do cortio. QUESTO 12 Leia o trecho a seguir.
Inclina, Senhor, o teu ouvido, e ouve-me; porque eu sou desvalido e pobre. (Salmos, LXXXV, 1)
RUBIO, Murilo. O ex-mgico da Taberna Minhota. Obra completa. So Paulo: Companhia das Letras, 2010. p. 21.

QUESTO 13 Leia os poemas apresentados a seguir.


MALVA-MA A P... De teus seios to mimosos Quem gozasse o talism! Quem ali deitasse a fronte Cheia de amoroso af! E quem nele respirasse A tua malva-ma! D-me essa folha cheirosa Que treme no seio teu! D-me a folha hei de beij-la Sedenta no lbio meu! No vs que o calor do seio Tua malva emurcheceu... [...]
AZEVEDO, lvares de. Lira dos vinte anos. In: Obra completa. Organizao de Alexei Bueno. Rio de Janeiro: Nova Aguilar, 2000. p. 269.

Considerando-se a relao de sentido que se estabelece entre a epgrafe transcrita e o conto do qual ela foi extrada, o ex-mgico se julga desvalido e pobre no desfecho dessa narrativa por (A) perceber a incapacidade de resgatar seu poder. (B) duvidar da recepo do pblico em seu espetculo. (C) sentir raiva ao falhar em suas tentativas de suicdio. (D) sofrer rejeio amorosa de uma colega de trabalho. (E) desconhecer sua origem e seu passado. RASCUNHO

H uma flor que est em redor de mim, uma flor que nasce nos cabelos da aurora e desce sobre as guas e os ombros de todos ns. No, no quero amar seno a natureza quando ela se abre como uma flor e suas corolas madrugada; eu no quero amar, seno a mulher que est em redor de mim, a mulher que me acolhe com seus braos e me oferece o que h de mais ntimo, a sua prola e sonho madrugada.
GARCIA, Jos Godoy. Poesia. Braslia: Thesaurus, 1999. p. 153.

Nos poemas transcritos, a representao da figura feminina se assemelha por apresentar (A) a sensualidade da mulher metaforizada pelos elementos da natureza. (B) a idealizao de uma mulher nica enfatizada pela fidelidade do eu lrico. (C) o distanciamento da mulher exemplificado por sua indiferena aos apelos do eu lrico. (D) a simplicidade da mulher evidenciada por suas qualidades morais. (E) o exotismo da mulher emoldurado pela descrio de um cenrio idlico. QUESTO 14 A intertextualidade aparece no romance Eu vos abrao, milhes, de Moacyr Scliar, por meio do recurso das (A) parfrases, como as que so feitas de captulos de Triste fim de Policarpo Quaresma , de Lima Barreto. (B) aluses, como as que so feitas a trechos do Manifesto Futurista divulgados na Semana de Arte Moderna. (C) epgrafes, como as que so extradas do romance Dom Casmurro, de Machado de Assis. (D) pardias, como as que so elaboradas sobre artigos publicados no jornal comunista A classe operria. (E) citaes, como as que so feitas de partes da obra Os sertes, de Euclides da Cunha.
ps-2013-1_literaturabrasileira-tipo-1

UFG/CS

PROCESSO SELETIVO-2013-1

TIPO-1

QUESTO 15

QUESTO 17

O recurso que insere Uma noite em cinco atos, de Alberto Leia o poema apresentado a seguir. Martins, na esttica do teatro contemporneo brasileiro 2 o da (A) interao direta das personagens com o pblico. (B) ruptura da coeso narrativa entre as cenas e os atos. (C) presentificao de diferentes planos temporais via personagens. (D) utilizao de ferramentas miditicas e tecnolgicas. (E) valorizao do espetculo em detrimento da histria representada. QUESTO 16 O contexto scio-histrico do Brasil, no sculo XIX, evidencia-se no enredo do romance O cortio, de Alusio Azevedo, por meio das (A) prticas de trabalho na pedreira de Joo Romo, que se baseiam na explorao de mo de obra excedente do processo de industrializao no Rio de Janeiro. (B) condies de moradia do cortio So Romo, que reproduzem o modo de vida prprio do principal tipo de habitao popular da ento Capital Federal. (C) disputas territoriais, que expressam, no confronto entre os carapicus e os cabeas-de-gato, a violncia caracterstica dos primeiros cortios cariocas. (D) manifestaes folclricas, que representam, na dana, na msica e na culinria dos moradores do cortio, o exotismo inerente ao povo brasileiro.

Se voc acompanhasse um rio, ah, se voc acompanhasse um rio desde as nascentes puras at longe... Se fosse o rio Turvo quando chegasse em Edia viria peixes, peixes e mais peixes e a solido do velho Tefilo cuja filha encantou um padre corado. No Nerpolis, sujos porcos e em barcos viajarias at pelo embrenhado do Corumb. O rio Verde e o rio Corrente escondem muitas mortes. Velho Z Garcia de Santana dizia: tomou-veio-d'gua... Em Formoso tem o rio Escuta, que muita maldade e coisa ruim escutou. Em Cavalcante tem o rio Silncio, que rosrio de sonhos silenciou. E o rio das Garas, se no tem garas, tem diamantes e vidas que a vida amaldioou. O rio do Sono poderia ter sido bom. Tanto como seu prprio filho e tanto como seu prprio corpo, voc amaria um rio, se um dia o acompanhasse das nascentes puras, at longe, at longe.
GARCIA, Jos Godoy. Poesia. Braslia: Thesaurus, 1999. p. 263-264.

(E) correntes migratrias, que configuram o cortio So Romo como uma comunidade formada por comer- Ao tematizar os rios goianos, o poema transcrito alia a obciantes portugueses em busca de ascenso social. jetividade da descrio geogrfica subjetividade das imagens poticas. Nesse processo, o eu lrico RASCUNHO (A) metaforiza a destruio da natureza ao descrever as consequncias da extrao de minrios no rio das Garas. (B) explica os nomes dos rios para reforar uma viso desenvolvimentista dos recursos hdricos do estado. (C) recupera expresses regionais, exemplificadas no verso tomou-veio-d'gua, para evidenciar a relevncia econmica dos rios Verde e Corumb. (D) destaca a importncia dos rios goianos para a constituio do imaginrio das cidades por onde passam. (E) descreve o percurso dos rios pelo estado, a exemplo do verso das nascentes puras, at longe, at longe, para enfatizar sua extenso.

ps-2013-1_literaturabrasileira-tipo-1

UFG/CS

PROCESSO SELETIVO-2013-1

TIPO-1

QUESTO 18

QUESTO 20

A apropriao de eventos histricos um dos recursos uti- Leia o fragmento do poema apresentado a seguir. lizados nos romances para tornar o enredo mais convincente, promovendo o efeito de verossimilhana. A materiaSPLEEN E CHARUTOS lizao desse efeito, no romance Eu vos abrao, milhes, de Moacyr Scliar, evidencia-se na I (A) participao de Hrcules em grupos anarquistas, os quais se originaram nas colnias de imigrantes italianos no comeo do sculo XX. (B) manifestao de apoio de Geninho conspirao dos grupos polticos que motivaram as aes de Carlos Prestes no movimento tenentista. (C) crtica de Jlio s ideias nazistas e aos grupos antissemitas que se propagaram no cenrio brasileiro prSegunda Guerra Mundial. (D) empolgao de Bento por suas aes militares na guerra de Canudos, que se manifesta tambm em sua participao na Revoluo de 1930. (E) dificuldade de Valdo em aproximar-se do lder comunista Astrojildo Pereira, a qual se justifica pela ilegalidade do Partido Comunista Brasileiro, em 1922. QUESTO 19 Leia o trecho apresentado a seguir.
A impassibilidade com que o grupo vencido recebeu a derrota desconcertou o velho: estavam tramando alguma coisa. Mas no o pegariam desprevenido. Conhecia de perto a astcia dos que viviam do outro lado da montanha. [] Aps um ms de ausncia, para desapontamento geral, Roque Diadema regressou. Fazia-se acompanhar de numerosa comitiva, onde predominavam os mecnicos []. [] Enquanto isso, na aldeia, o clima era de mal-estar e desconfiana. [] Pressentiam que chegara a hora de se livrarem dos forasteiros. [] No encontraram resistncia. [] Contudo, exigiram a imediata demolio das construes. O ultimato no perturbou Roque Diadema. Buscou a pasta e dela retirou diversas escrituras. Aproveitei minha viagem para adquirir os terrenos. Sou hoje proprietrio de dois teros da rea urbana do povoado.
RUBIO, Murilo. A dispora. Obra completa. So Paulo: Companhia das Letras, 2010. p. 146; 147; 148.

SOLIDO [] As rvores prateiam-se na praia, Qual de uma fada os mgicos retiros... lua, as doces brisas que sussurram Coam dos lbios teus como suspiros! Falando ao corao que nota area Deste cu, destas guas se desata? Canta assim algum gnio adormecido Das ondas moas no lenol de prata? Minh'alma tenebrosa se entristece, muda como sala morturia... Deito-me s e triste, sem ter fome Vejo na mesa a ceia solitria. lua, lua bela dos amores, Se tu s moa e tens um peito amigo, No me deixes assim dormir solteiro, meia-noite vem cear comigo!
AZEVEDO, lvares de. Lira dos vinte anos. In: Obra completa. Organizao de Alexei Bueno. Rio de Janeiro: Nova Aguilar, 2000. p. 232.

Fenmeno recorrente na esttica romntica, o processo de adjetivao permite ao eu lrico, no poema transcrito, (A) intensificar sua tristeza, ressaltando uma perspectiva pessimista da vida. (B) demarcar sua individualidade, expressando seu estado de esprito. (C) detalhar suas intenes amorosas, nomeando seus sentimentos. (D) descrever as coisas circundantes, apresentando uma viso objetiva da realidade. (E) revelar um sentimento platnico, enumerando as qualidades da amada.

A relao entre o enredo do conto A dispora, de Murilo RASCUNHO Rubio, e o processo brasileiro de modernizao, impulsionado a partir do sculo XIX, se expressa na (A) localizao geogrfica do povoado, que determina um processo de urbanizao calcado na segregao. (B) questo da especulao imobiliria, que visvel na organizao social do povoado antes da chegada de Diadema e seu grupo de construtores. (C) oposio entre novo e antigo, que se reflete no projeto de construo de uma ponte e na consequente instabilidade social na aldeia. (D) estruturao do povoado em bases capitalistas, que refora as ideias modernizadoras dos forasteiros. (E) destituio do lder do povoado, que se assemelha a golpes polticos motivados por reformas urbanas.
ps-2013-1_literaturabrasileira-tipo-1

UFG/CS

PROCESSO SELETIVO-2013-1

TIPO-1

MATEMTICA QUESTO 21

QUESTO 24

Para estimular um estudante a se familiarizar com os nmeros atmicos de alguns elementos qumicos, um proA delegao esportiva de um certo pas participou de fessor cobriu as teclas numricas de uma calculadora com uma festa e, involuntariamente, quatro jogadores do time os smbolos dos elementos qumicos de nmero atmico de basquetebol, cinco do time de voleibol e nove do time correspondente, como mostra a figura a seguir. de futebol ingeriram uma substncia proibida pelo comit antidoping. Um jogador de cada time ser sorteado para passar por um exame desse comit. Considerando-se que o time de basquetebol tem 10 jogadores, o de voleibol, 12 e o de futebol, 22 e ordenando-se os times pela ordem crescente da probabilidade de ser "pego" um jogador que tenha ingerido a substncia proibida, tem-se (A) basquetebol, futebol, voleibol. (B) basquetebol, voleibol, futebol. (C) futebol, voleibol, basquetebol. (D) futebol, basquetebol, voleibol. Nessa calculadora, se o estudante adicionar o elemento de menor nmero atmico com o de maior eletronegativi QUESTO 22 dade, elevar a soma ao elemento cujo nmero atmico seja um nmero primo par e, em seguida, calcular o logaA frmula de um alcano C n H2n+2, onde n um inteiro po- ritmo do resultado, acionando a tecla log, o resultado final sitivo. Neste caso, a massa molecular do alcano, em fun- ser um dgito, cuja tecla corresponde ao smbolo o de n, , aproximadamente: (A) de um gs nobre. (A) 12n (B) do elemento mais eletronegativo. (E) voleibol, futebol, basquetebol. (B) 14n (C) 12n + 2 (D) 14n + 2 (E) 14n + 4 QUESTO 23 QUESTO 25 (C) do elemento de menor nmero atmico. (D) de um halognio. (E) do elemento menos eletronegativo.

N O F Be B C H He Li

Leia a tabela a seguir, impressa em uma embalagem de Alguns agricultores relataram que, inexplicavelmente, suas plantaes apareceram parcialmente queimadas e a leite. regio consumida pelo fogo tinha o padro indicado na fiINFORMAO NUTRICIONAL gura a seguir, correspondendo s regies internas de trs Poro de 200 ml (1 copo) crculos, mutuamente tangentes, cujos centros so os vrtices de um tringulo com lados medindo 30, 40 e 50 meQUANTIDADE POR PORO %VD (*) tros.
Carboidratos Protenas Gorduras Sdio Clcio 8,4 g 6,0 g 6,2 g 150 mg 240 mg
* Porcentual dos valores dirios com base em uma dieta de 2000 kcal ou 8400 kJ.

3 8 11 6 24

Obtendo-se os valores dirios (VD) de clcio e de sdio, com base nas informaes da tabela, conclui-se que o VD Nas condies apresentadas, a rea da regio queimada, de sdio em m, igual a: (A) um quarto do de clcio. (B) duas vezes e meia o de clcio. (C) cinco oitavos do de clcio. (D) dois quintos do de clcio. (E) oito quintos do de clcio. (A) (B) (C) (D) (E) 1100 1200
1300 1400

1550
ps-2013-1_matematica-tipo-1

UFG/CS

PROCESSO SELETIVO-2013-1

TIPO-1

QUESTO 26

QUESTO 28

A lista a seguir apresenta caractersticas relativas a duas Durante um ciclo hidrolgico completo, considera-se que o das partes do livro Lira dos vinte anos, do poeta lvares volume total de gua que passa por uma determinada sede Azevedo, segundo uma determinada edio: o do rio no exutrio de uma bacia hidrogrfica igual ao volume de gua precipitado na bacia menos o volume de Compe-se de 15 poemas. gua que volta para a atmosfera por evapotranspirao. Compe-se de 40 poemas. Em determinado ano, o volume total de gua que passou Uso do lirismo romntico convencional: eu lrico terno; por essa seo do rio foi de 20 milhes de metros cbicos mulher angelical; sentimentos espiritualizados. e a profundidade mdia anual nesse ponto do rio foi de 30 Uso do lirismo romntico grotesco: eu lrico sarcstico; metros. No ano seguinte, nesta mesma seo, o volume de gua e a profundidade mdia foram Q e h, respectivamulher acessvel; sentimentos carnais. mente, como indica o grfico a seguir. Uso de recursos humorsticos: ironia, stira, caricatura.
Profundidade (m)

Aspectos de um intimismo adolescente: desdm pela rotina; nfase no idealismo. Um professor de literatura pretende ordenar a lista apresentada de modo que caractersticas de uma mesma parte do livro fiquem juntas. O nmero de maneiras pelo qual ele poder fazer isso : (A) 24 (B) 48 (C) 72 (D) 90 (E) 96 QUESTO 27

h 30 20000

10 Q

Volume (milhares de m)

Sabendo-se que tanto o volume de gua precipitado quanto a perda por evapotranspirao aumentaram, de um ano para o outro, em 0,49% e que o grfico utiliza a mesma escala para os dois eixos, o valor da profundidade h, em metros, foi de, aproximadamente: Dados: sen 10 0,17 cos 10 0,98

(A) 30,15 Um cone circular reto de madeira, homogneo, com 20 cm de altura e 20 cm de dimetro da base, flutua livremente (B) 31,47 na gua parada em um recipiente, de maneira que o eixo (C) 44,70 do cone fica vertical e o vrtice aponta para baixo, como (D) 47,00 representado na figura a seguir. (E) 98,00

RASCUNHO

Denotando-se por h a profundidade do vrtice do cone, relativa superfcie da gua, por r o raio do crculo formado pelo contato da superfcie da gua com o cone e sabendose que as densidades da gua e da madeira so 1,0 g/cm e 0,6 g/cm, respectivamente, os valores de r e h, em centmetros, so, aproximadamente: (A) 5,8 e 11,6 (B) 8,2 e 18,0 (C) 8,4 e 16,8 (D) 8,9 e 15,0 (E) 9,0 e 18,0
3 Dados: 3 1,44 3 5 1,71

ps-2013-1_matematica-tipo-1

UFG/CS

PROCESSO SELETIVO-2013-1

TIPO-1

QUESTO 29 Analise o grfico a seguir, que representa a populao mundial, em milhes, entre os anos de 1800 e 2010.
8000 7000 6000 5000 4000 3000 2000 1000 0
0 0 0 18 90 0 0 0 18 0 18 3 18 6 19 2 19 5 19 8 20 1 0

RASCUNHO

Disponvel em: <en.wikipedia.org/wiki/World_population>. Acesso em: 1 nov. 2012. (Adaptado).

Denotando por p(t) a populao mundial, em milhes, no ano t, possvel aproximar diferentes trechos do grfico por funes afins. Com relao dinmica histrico-demogrfica, representada no grfico, observa-se, no perodo em que p(t) aproxima-se de (A) 75 t 144000, um aumento da estabilidade poltica mundial, evidenciado pela inexistncia de conflitos internacionais. (B) 75 t 144000, uma reduo das desigualdades socioeconmicas, com a coletivizao dos meios de produo nos pases socialistas. (C) 20 t 11000, um aumento da expectativa de vida da 3 populao, com o desenvolvimento cientfico e tecnolgico decorrente das corridas espacial e armamentista. 20 t 11000, uma reduo da fome nos pases afri3 canos em decorrncia do processo de descolonizao, alm da melhora das condies sanitrias e de sade pblica. 20 t 11000, uma reduo das taxas de mortalidade 3 nos pases onde iniciou-se a Revoluo Industrial, alm da manuteno de elevadas taxas de natalidade.

(D)

(E)

QUESTO 30 Observe a sequncia de bases nitrogenadas de um fragmento de DNA apresentado a seguir. TACAAGGTTCTTTGACTATAATTAGCATTC A sequncia resultante da transcrio deste fragmento composta de (A) 30% de timina. (B) 40% de timina. (C) 60% de timina. (D) 30% de uracila. (E) 40% de uracila.
ps-2013-1_matematica-tipo-1

UFG/CS

PROCESSO SELETIVO-2013-1

TIPO-1

BIOLOGIA QUESTO 31 Analise o cladograma a seguir.


gibo orangotango gorila chimpanz homem

QUESTO 33 Leia o texto a seguir.


Um estudo recente mostrou que ratas alimentadas, durante o perodo gestacional, com dieta pobre em protena obtiveram filhotes que possuam as carboidrases, como exemplo a lactase, mais ativas. Os transportadores presentes nas membranas das clulas intestinais, responsveis pelo transporte ativos de glicose e peptdios tambm aumentaram.
HUTFLESZ, Yuri. Ecos de uma dieta pobre. In: Cincia Hoje, n. 296, v. 50, set. 2012, p. 45. (Adaptado).

Esses resultados permitem concluir que a dieta administrada causa na gerao F1 um aumento na Pelo cladograma, o (A) chimpanz pertence famlia do homem. (B) gorila evoluiu a partir do orangotango. (C) gibo convergiu evolutivamente com o gorila. (D) homem compartilha o mesmo ancestral do gibo. (E) orangotango ancestral do chimpanz. QUESTO 32 Leia as informaes a seguir.
Como chefe da Diretoria de Sade Pblica da cidade do Rio de Janeiro a partir de 1903, o mdico sanitarista Oswaldo Cruz adotou medidas como a formao de um esquadro de 50 homens vacinados, que percorriam a cidade espalhando raticida e mandando recolher o lixo, sendo essas medidas pertencentes Reforma Sanitria, durante o mandato (1902-1906) do Presidente Rodrigues Alves.
Disponvel em: <http://super.abril.com.br/arquivo/1994/conteudo_114370.shtml>. (Adaptado).

(A) absoro de glicdios. (B) digesto de lipdios. (C) produo de suco pancretico. (D) digesto intracelular. (E) emulsificao. QUESTO 34 Em uma colmeia, a abelha rainha frtil originria de um embrio diploide que foi alimentado com geleia real; as operrias estreis tambm so diploides. Os zanges so frteis e originrios de ovcitos no fecundados depositados pela abelha rainha. Nessa sociedade, os machos descritos so (A) clones da abelha rainha. (B) gmeos das operrias. (C) haploides da abelha rainha. (D) euploides das operrias. (E) hbridos euploides da abelha rainha.

Nesse contexto histrico, a medida adotada visava erradi QUESTO 35 car a seguinte doena: Alguns princpios ativos de medicamentos so bases fracas (A) febre amarela e, para serem absorvidos pelo organismo humano, obede(B) peste bubnica cem, como um dos parmetros, a equao de HendersonHasselbach. Essa equao determina a razo molar entre (C) tuberculose forma protonada e no protonada do princpio ativo depen(D) clera dendo do pH do meio. A forma no protonada aquela que tem maior capacidade de atravessar as membranas celula(E) varola res durante o processo de absoro. A equao de Henderson-Hasselbach adaptada para bases fracas representada a seguir.

log 10

[ protonada ] = pka pH [ no protonada ]

Nessa equao, pka a constante de dissociao do princpio ativo. Considerando-se essa equao, um medicamento caracterizado como base fraca, com pka de 4,5, ter maior absoro (A) no estmago, com pH de 1,5. (B) na bexiga, com pH de 2,5. (C) no tbulo coletor do nfron, com pH de 3,5. (D) na pele, com pH de 4,5. (E) no duodeno, com pH de 6,5.
ps-2013-1_biologia-tipo-1

UFG/CS

PROCESSO SELETIVO-2013-1

TIPO-1

QUESTO 36 Considere um ecossistema em que a produtividade primria lquida de 20.000 KJ.m -2ano-1 e os consumidores primrios ingerem 13% dessa produo. Sabendo-se que, do que ingerido, 60% eliminado pelas fezes e pela urina, e 35% em calor pela respirao, qual a produtividade secundria (KJ.m-2ano-1) desse ecossistema? (A) (B) 130 910

QUESTO 38 As voorocas constituem uma das formas mais severas do processo de eroso hdrica, formando profundos e extensos cortes no solo. Esse tipo de eroso pode ser originado e controlado, respectivamente, por (A) assoreamento; plantio de vegetao de grande porte em vertentes com altas inclinaes. (B) desmatamento; plantio de vegetao rasteira de sistema radicular fasciculado profundo. (C) terraceamento; cultivo com arao para revolver a terra. (D) inundao; plantio de vegetao anual de sistema radicular pivotante. (E) poluio de mananciais hdricos; cultivo de monoculturas extensivas de ciclo curto. QUESTO 39 Leia o texto a seguir.
Pombinha, entretanto, nessa manh acordara abatida e nervosa, sem nimo de sair dos lenis. [] havia uma doce expresso dolorosa na limpidez cristalina de seus olhos de moa enferma; [] assim delicada planta murcha, languesce e morre, se carinhosa borboleta no vai sacudir sobre ela as asas prenhes de fecundo e dourado plen. No pouco que dormiu essa noite, que foi a do baralho com a polcia, teve sonhos agitados e passou mal todo o dia seguinte, com as molezas da febre e dores no tero. A moa fechou as plpebras [...] []. Comeou logo a sonhar que em redor tudo ia se fazendo de um cor-de-rosa, a princpio muito leve e transparente, depois mais carregado, e mais, e mais, at formar-se em torno dela uma floresta vermelha, cor de sangue, onde largos tinhores rubros se agitavam lentamente. []. Nisto, Pombinha soltou um ai formidvel e despertou sobressaltada, levando logo ambas as mos ao meio do corpo. E feliz, cheia de susto ao mesmo tempo, a rir e a chorar, sentiu o grito da puberdade sair-lhe afinal das entranhas, em uma onda vermelha e quente.
AZEVEDO, Alusio. O cortio. 3. ed. So Paulo: Ciranda Cultural, 2010.

(C) 1.000 (D) 1.040 (E) 2.600 QUESTO 37 Leia as informaes a seguir.
O cloreto de cobalto (CoCl2) um composto com propriedades higroscpicas, mudando sua colorao, de azul, quando seco, para rosa, quando hidratado.

Papis porosos, com rea de 2 cm 2, impregnados com soluo do composto descrito, foram secos em estufa e ento usados em um experimento para estimar a fotossntese. Esses papis, inicialmente azuis, foram colocados em contato com folhas de feijo, em semelhante estgio de desenvolvimento, mantidas em condies ambientais diferentes. O contato do papel com a mo do experimentador foi evitado. Dez minutos aps o incio do experimento, observou-se os resultados apresentados na tabela a seguir.
Folha I II III IV V % de mudana na colorao do papel, de azul para rosa, quando em contato com a folha 0 30 80 25 90

Pela anlise dos resultados, quais folhas esto realizando p. 85-90. fotossntese em taxa baixa? O enunciado que resume o evento biolgico descrito metaforicamente no trecho e o evento a que se refere so os se(A) I e II guintes: (B) I e IV (A) A moa fechou as plpebras sono. (C) II e IV (B) com as molezas da febre e dores no tero ovula(D) II e V o. (E) III e V (C) se carinhosa borboleta no vai sacudir sobre ela as asas prenhes de fecundo e dourado plen fecundao.

(D) E feliz, cheia de susto ao mesmo tempo, a rir e a chorar orgasmo. (E) sentiu o grito da puberdade sair-lhe afinal das entranhas, em uma onda vermelha e quente menarca.

ps-2013-1_biologia-tipo-1

UFG/CS

PROCESSO SELETIVO-2013-1

TIPO-1

QUESTO 40 Leia o texto a seguir.


A criao de peixes sseos de gua doce para fins comerciais impe aos animais estresses decorrentes do manejo de rotina e doenas ocasionadas por protozorios. Para reduzir o aparecimento dessas doenas utiliza-se banhos com soluo de NaCl, em concentraes entre 2 a 5% com tempo de exposio variando entre 20 segundos a 20 minutos.
KUBITZA, Fernando. A versatilidade do sal na piscicultura. Panorama da aquicultura, set./out. 2007. p. 14-23. (Adaptado).

De acordo com o texto, o controle de protozorios requer a utilizao de soluo salina em concentrao superior fisiolgica. Portanto, para que o banho salino no cause a morte dos animais, ele deve ser breve o suficiente para impedir que os peixes (A) inchem por absoro excessiva de gua. (B) inchem por reteno de urina concentrada. (C) inchem por ingesto de soluo salina. (D) desidratem por perda excessiva de gua. (E) desidratem por excreo de urina concentrada. RASCUNHO

ps-2013-1_biologia-tipo-1

UFG/CS

PROCESSO SELETIVO-2013-1

TIPO-1

FSICA QUESTO 41 Baseado nas propriedades ondulatrias de transmisso e reflexo, as ondas de ultrassom podem ser empregadas para medir a espessura de vasos sanguneos. A figura a seguir representa um exame de ultrassonografia obtido de um homem adulto, onde os pulsos representam os ecos provenientes das reflexes nas paredes anterior e posterior da artria cartida.

QUESTO 43 O transporte ativo de ons por meio de bombas de sdiopotssio presentes nas membranas celulares desempenha uma funo vital para manuteno do potencial de repouso das clulas. Essas bombas tambm esto ativas durante o potencial de ao. Na propagao de um potencial de ao de um neurnio, que possui cerca de 106 dessas bombas e potencial de repouso de -80 mV, cada bomba transporta cerca 190 ons de sdio (Na +) e 140 ons de potssio (K+) a cada 1,0 ms. O grfico a seguir apresenta o potencial eltrico da membrana de uma fibra nervosa, durante um potencial de ao, que parte do potencial de repouso.

Suponha que a velocidade de propagao do ultrassom seja de 1.500 m/s. Nesse sentido, a espessura e a funo dessa artria so, respectivamente: (A) 1,05 cm transportar sangue da aorta para a cabea. (B) 1,05 cm transportar sangue dos pulmes para o corao. (C) 1,20 cm transportar sangue dos pulmes para o co- Considere que a diferena de potencial efetiva mdia atravs da membrana, entre os processos I e II, de 60 mV. rao. Diante do exposto, a potncia eltrica mdia das bombas (D) 2,10 cm transportar sangue da cabea para o pul- em um neurnio e os processos I e II so, respectivamente, mo. (E) 2,10 cm transportar sangue da aorta para a cabea. QUESTO 42 As estaes do ano devem-se basicamente inclinao do eixo de rotao da Terra, a qual possui um perodo de precesso prximo de 26.000 anos. Na poca atual, os solstcios ocorrem prximos ao aflio e ao perilio. Dessa maneira, o perilio ocorre no ms de dezembro, quando a distncia Terra-Sol de 145 106 km, e a velocidade orbital da Terra de 30 km/s. Considere que, no aflio, a distncia Terra-Sol de 150 106 km. Nesse sentido, a velocidade de translao da Terra no aflio e o momento astronmico que caracteriza o incio da respectiva estao do ano devem ser:
Dados: e = 1,6 x 10-19 C

(A) 4,8 10-10 W, despolarizao da membrana com entrada de Na+ e repolarizao com sada de K+. (B) 4,8 10-10 W, despolarizao da membrana com sada de K+ e repolarizao com entrada de Na+. (C) 9,6 10-11 W, repolarizao da membrana com entrada de K+ e despolarizao com sada de Na+. (D) 3,1 10-15 W, ativao do potencial de ao com difuso de Na + e do potencial de repouso pela entrada de K+.

(A) 28 km/s durante o solstcio de vero do hemisfrio (E) 3,1 10-15 W, polarizao da membrana com entrada Norte. de K+ e despolarizao com sada de Na+. (B) 29 km/s durante o solstcio de inverno do hemisfrio Sul. (C) 29 km/s durante o equincio de outono do hemisfrio Sul. (D) 31 km/s durante o equincio de primavera do hemisfrio Sul. (E) 31 km/s durante o solstcio de vero do hemisfrio Norte.
ps-2013-1_fisica-tipo-1

UFG/CS

PROCESSO SELETIVO-2013-1

TIPO-1

QUESTO 44 Uma bomba calorimtrica, usada para determinar o poder calorfico de combustveis, composta de uma cmara de combusto imersa em um tanque de paredes adiabticas contendo 800 litros de gua, conforme ilustrado na figura a seguir.

QUESTO 46 Uma lente convergente de vidro possui distncia focal f quando imersa no ar. Essa lente mergulhada em glicerina, um tipo de lcool com ndice de refrao maior que o do ar. Considerando-se que o ndice de refrao do vidro o mesmo da glicerina (iguais a 1,5), conclui-se que o diagrama que representa o comportamento de um feixe de luz incidindo sobre a lente imersa na glicerina o seguinte:

No experimento de combusto de 4,6 kg de etanol (C2H6O) so produzidos dixido de carbono e gua. Sabendo-se que a entalpia de combusto do etanol de -1376 kJ/mol e que a gua do tanque permanece lquida, a variao de temperatura da gua do tanque em graus Celsius e a massa total dos produtos da combusto em kg QUESTO 47 so, respectivamente, Dados: Umidade o contedo de gua presente em uma subs(A) 6,9 e 19,0. tncia. No caso do ar, a gua na forma de vapor pode forc = 1,0 cal/gC gua (B) 43 e 14,2. mar um gs homogneo e incolor se sua concentrao no 1 cal 4,0 J ar estiver abaixo do limite de absoro de vapor de gua (C) 43 e 4,6. pelo ar. Este limite chamado de ponto de orvalho e ca(D) 172 e 4,6. racteriza a saturao a partir da qual ocorre a precipitao de neblina ou gotculas de gua. O ponto de saturao de (E) 172 e 14,2. vapor de gua no ar aumenta com a temperatura. Um fato interessante ligado umidade do ar que, em um dia QUESTO 45 muito quente, o ser humano sente-se termicamente mais Em 1964, o fsico britnico Peter Higgs props a existn- confortvel em um ambiente de baixa umidade. Esse fato cia de um campo, o qual, ao interagir com uma partcula, se deve ao calor conferia a ela a sua massa. A unidade bsica desse cam- (A) recebido pelo corpo por irradiao. po foi chamada de bson de Higgs. Em julho de 2012, os cientistas do CERN (Centro Europeu de Pesquisas Nucle- (B) cedido para a gua por conveco. ares) anunciaram terem identificado o bson de Higgs, (C) recebido do vapor por conduo. com uma massa de 125 GeV (gigaeltronvolt). O valor (D) cedido para o vapor por conveco. dessa massa, em kg, de: (A) 4,50 10+24 (B) 6,66 10-18 (C) 2,22 10-25 (D) 6,66 10-27 (E) 2,22 10-34
Dados: 1 eV = 1,6 x 10 J c = 3,0 x 108 m/s
-19

(E) cedido pelo corpo por conduo.

ps-2013-1_fisica-tipo-1

UFG/CS

PROCESSO SELETIVO-2013-1

TIPO-1

QUESTO 48 Nos jogos paraolmpicos de Londres, o sul-africano biamputado Oscar Pistorius, aps perder a medalha de ouro para o brasileiro Alan Fonteles, indignado, reclamou do tamanho das prteses de Fonteles. Antes dos jogos, elas foram trocadas por um par 5,0 cm maior que, no entanto, estavam dentro do limite estabelecido pelo regulamento. Porm, mesmo com prteses mais longas, as amplitudes de passada de Fonteles foram menores do que as de Pistorius, conforme o quadro da prova de 200 metros rasos apresentado a seguir.
Dados da corrida Altura Altura mxima permitida Amplitude mdia da passada Nmero de passadas Tempo Fonteles 1,82 m 1,85 m 2,04 m 98 21,45 s Pistorius 1,86 m 1,93 m 2,17 m 92 21,52 s

QUESTO 50 Para a segurana da populao, o lixo radioativo produzido pelo acidente com o csio-137, na cidade de Goinia, foi revestido com paredes de concreto e chumbo. A intensidade da radiao I decai exponencialmente quando atravessa essas paredes, de acordo com a relao x , onde I0 a intensidade que incide sobre I x = I 0e a parede de espessura x e o coeficiente de atenuao, conforme esboado no grfico a seguir.

Considere que Fonteles consiga aumentar a amplitude mdia de sua passada em 1,0 cm, mantendo a mesma frequncia de passadas. Nessas circunstncias, quantos segundos, aproximadamente, ser a nova vantagem de Fonteles? (A) 0,05 (B) 0,07 (C) 0,10 (D) 0,17 (E) 0,35 QUESTO 49 De acordo com estas informaes, o valor do coeficiente de atenuao da parede que reveste o lixo : (A) 0,552 cm-1 (B) 0,825 cm-1 (C) 1,275 cm-1 (D) 1,533 cm-1
Dados: ln e =1 ln 2 = 0,69 ln 3 = 1,10 ln 10 = 2,30

Os caminhes ficam maiores a cada dia devido necessi-1 dade de se transportar cargas cada vez maiores em me- (E) 2,707 cm nor tempo. Por outro lado, o pavimento (estrada de asfalto ou concreto) precisa ser dimensionado para que sua resistncia seja compatvel com a carga suportada repetidamente. Para um pavimento de boa durabilidade, a presso de 2,0 MPa deve ser suportada. Nessa situao, qual a mxima massa, em kg, permitida para um caminho que possui cinco eixos com dois pneus em cada eixo, cuja rea de contato de um pneu de 0,02 m 2? (A) 1,0 106 (B) 2,0 105 (C) 1,2 105 (D) 4,0 104 (E) 4,0 103
Dados: g = 10 m/s2

ps-2013-1_fisica-tipo-1

UFG/CS

PROCESSO SELETIVO-2013-1

TIPO-1

GEOGRAFIA QUESTO 51 Leia o texto a seguir.


O processo de unificao se faz por intermdio do que se chama de redes. Seria, portanto, pela unificao que adviria o fracionamento. As redes so vetores de modernidade e tambm de entropia. Mundiais, veiculam um princpio de ordem, uma regulao a servio de atores hegemnicos na escala planetria.
SANTOS, M. Tcnica, espao e tempo: Meio tcnico-cientfico-informacional. So Paulo: Hucitec, 1994. p. 28.

O texto indica as transformaes que passaram a caracterizar o mundo globalizado. Para que essa mudana se concretizasse era preciso consolidar um sistema mundial, conectado em redes, e capaz de transmitir dados e vozes em velocidades cada vez maiores e com melhores qualidades. Uma nova tecnologia passou a converter os dados digitalizados com a maior velocidade possvel, por meio de um sistema no qual a informao basicamente canalizada. Isso tornou as conexes na internet mais rpidas, diminuindo o tempo para transferncias e cpias de arquivos. As vias utilizadas nesse tipo de transmisso de informao e o fenmeno fsico fundamental para seu funcionamento so, respectivamente, (A) os sinais de satlite e a reflexo interna total. (B) as fibras pticas e a difrao. (C) os sinais de rdio e a reflexo de ondas. (D) as fibras pticas e a reflexo interna total. (E) os sinais de satlite e a difrao. QUESTO 52 O sistema de coordenadas geogrficas, usado na elaborao de mapas, consiste numa rede de paralelos e meridianos, cujos valores, em graus, estabelecem as latitudes e longitudes, respectivamente. Analise o quadrado apresentado a seguir, com 2 cm de lado, formado por paralelos e meridianos.

QUESTO 53 O Tratado de Madri (1750) pretendeu atender disputa de territrios entre Portugal e Espanha, representando tambm uma estratgia para melhor administrar os domnios ibricos na chamada regio das Misses. A tentativa de imp-lo gerou uma guerra que, ao seu final, terminou por definir o controle sobre as colnias que ocupavam a regio dos Pampas. Esse tratado (A) determinou a troca entre os sete povos das misses, no Uruguai, e a colnia de Sacramento, no Brasil. (B) redefiniu as fronteiras territoriais na Amrica do Sul, com base no uti possidetis. (C) permitiu aos jesutas exercer um domnio que se estendeu por toda a regio do Prata. (D) garantiu a consolidao da chamada Repblica dos Guaranis, sob influncia da Igreja Catlica. (E) possibilitou a anexao da regio das Misses ao territrio argentino e do Chaco ao Uruguai. QUESTO 54 A Coreia do Norte tem gerado tenses geopolticas em decorrncia de sua capacidade nuclear, do seu isolamento poltico e das disputas territoriais com sua vizinha Coreia do Sul. Atualmente separadas por uma faixa desmilitarizada, a diviso que criou as duas Coreias se originou (A) no final da Primeira Guerra Mundial, com o controle da Pennsula Coreana pelo Japo. (B) logo em seguida ao fim da revoluo comunista na China, com a expanso de seus domnios territoriais at a Pennsula Coreana. (C) aps a Segunda Guerra Mundial, em um conflito regional que envolveu Estados Unidos da Amrica, Unio Sovitica e China. (D) no decorrer da Guerra Fria, com os Estados Unidos da Amrica procurando ampliar sua influncia no continente asitico. (E) no final dos anos 1980, com o enfraquecimento da Unio Sovitica e a retirada de suas tropas do territrio coreano. QUESTO 55 Nas primeiras dcadas do sculo XX, a economia brasileira foi vtima do contrabando de sementes da espcie vegetal que sintetiza ltex para obteno de borracha, um dos produtos mais cobiados naquele momento. Esse ato, considerado nos dias de hoje como biopirataria, teve como consequncia, para o Brasil, a perda da liderana desse comrcio, com prejuzo para a economia da regio Norte brasileira. O pas favorecido pela biopirataria, ao cultivar essa espcie vegetal em suas colnias, e o tipo de caule, de onde se extrai o ltex, so, respectivamente, (A) Portugal; estipe. (B) Inglaterra; tronco. (C) Portugal; colmo. (D) Inglaterra; estipe. (E) Holanda; tronco.
ps-2013-1_geografia-tipo-1

O ponto A indicado na figura apresenta como coordenadas geogrficas, aproximadamente: (A) latitude 0o 30' Norte e longitude 1o 30' Oeste. (B) latitude 1o 25' Sul e longitude 0o 35' Leste. (C) latitude 0o 15' Sul e longitude 0o 45' Oeste. (D) latitude 1o 45' Norte e longitude 1o 15' Leste. (E) latitude 0o 35' Norte e longitude 0o 25' Oeste.

UFG/CS

PROCESSO SELETIVO-2013-1

TIPO-1

QUESTO 56 Leia o texto a seguir.


Para dar-lhes uma ideia das dimenses da Terra, eu lhes direi que, antes da inveno da eletricidade, era necessrio manter, para o conjunto dos seis continentes, um verdadeiro exrcito de quatrocentos e sessenta e dois mil quinhentos e onze acendedores de lampies. Isto fazia, visto um pouco de longe, um magnfico efeito. Os movimentos desse exrcito eram ritmados como os de um bal de pera. Primeiro vinha a vez dos acendedores de lampies da Nova Zelndia e da Austrlia. Esses, em seguida, acesos os lampies, iam dormir. Entrava por sua vez a dana dos acendedores de lampies da China e da Sibria. E tambm desapareciam nos bastidores. Vinha a vez dos acendedores de lampies da Rssia e das ndias. Depois os da frica e da Europa. Depois os da Amrica do Sul. Os da Amrica do Norte. E jamais se enganavam na ordem de entrada, quando apareciam em cena. Era um espetculo grandioso.
SAINT-EXUPRY, A. O pequeno princpe. Traduo de Dom Marcos Barbosa. Rio de Janeiro: Agir, 2006. p. 30. (Adaptado).

QUESTO 58 Leia o texto a seguir.


Bonfim uma das cidades mais antiga de Gois. Como suas irms mais velhas, Meia Ponte e Vila Boa de Gois, guarda ainda, sob muitos aspectos, o cunho dos ncleos coloniais do sculo XVIII, com sua inconfundvel arquitetura reinol, estilo barroco, de feio pesada, simplria e, ao mesmo tempo que bonachona, hospitaleira aspecto esse que se vai aos poucos apagando dos burgos e vilrios progressistas mais prximos da linha frrea.
RAMOS, H. de C. Tropas e boiadas. Goinia: Cultura Goiana, 1984. p. 168.

O autor se refere atual cidade de Silvnia, cujos estilos coloniais assemelham-se s outras duas citadas que ainda hoje preservam tais caractersticas arquitetnicas. Os nomes atuais dessas cidades e as microrregies em que esto localizadas, so, respectivamente, (A) Pirenpolis, na microrregio Entorno de Braslia; e Cidade de Gois, na microrregio Rio Vermelho. (B) Alexnia, na microrregio Entorno de Braslia; e Cidade de Gois, na microrregio Aragaras. (C) Vianpolis, na microrregio Pires do Rio; e Pirenpolis, na microrregio Anpolis. (D) Luzinia, na microrregio Entorno de Braslia; e Alexnia, na microrregio Anpolis. (E) Vianpolis, na microrregio Goinia; e Luzinia, na microrregio Anpolis. QUESTO 59

O bal dos acendedores de lampies, referido no texto, uma construo metafrica que faz uma (A) meno ao atraso econmico das regies do planeta. (B) crtica diversidade dos habitantes da Terra. (C) aluso variao climtica na superfcie do planeta. (D) referncia aos diversos fusos horrios da Terra. (E) stira ao movimento de translao do planeta. QUESTO 57 A expanso da fronteira agropecuria sobre a Amaznia pode ser considerada preocupante no apenas por causa da consequente perda de biodiversidade, mas tambm pela prpria sustentabilidade dessas atividades econmicas inseridas no bioma amaznico. Tal fato deve-se s caractersticas fisiogrficas da regio que, modificadas, podem resultar em degradao ambiental. Nesse bioma, essas caractersticas esto associadas ao predomnio de solos (A) hidromrficos, ricos em nutrientes, localizados em reentrncias litorneas, em desembocaduras de rios, recobertos por vegetao adaptada alta salinidade. (B) rasos, resultantes de lixiviao incipiente, localizados em depresses interplanlticas, recobertos por vegetao adaptada aridez. (C) salinos, localizados em linhas costeiras, recobertos por vegetao halfita adaptada s condies edficas. (D) cidos, com horizontes bem diferenciados, localizados em terras baixas, recobertos por vegetao adaptada s condies de alta umidade. (E) frteis, localizados em planaltos, originalmente recobertos por vegetao adaptada a temperaturas amenas.

Leia o texto a seguir.


[] A qualidade do ar da cidade no depende somente da quantidade de poluentes lanados pelas fontes emissoras, mas tambm da forma como a atmosfera age no sentido de concentr-los ou dispers-los. [] Assume-se que os fenmenos de disperso e remoo dos poluentes sejam comandados pelas feies regionais da atmosfera [], pelos aspectos locais do clima urbano (ilhas de calor e circulao de ar) em consonncia com as caractersticas da superfcie urbana [].
TORRES, F. T. P.; MARTINS, L. A. Fatores que influenciam na concentrao do material particulado na cidade de Juiz de Fora (MG). In: Caminhos da Geografia, Uberlndia (MG), v. 4, n. 16, p. 23-39, 2005. (Adaptado).

O fenmeno descrito no texto comum nas grandes reas urbanas. Considerando-se essas informaes e levandose em conta a circulao geral da atmosfera em uma cidade situada na Regio Metropolitana de So Paulo, durante a estao do inverno, contribuem para a concentrao de poluentes no ar as condies do (A) tempo, relacionadas a grandes turbulncias do ar. (B) clima, associadas ao encontro entre massas de ar. (C) clima, associadas a instabilidades atmosfricas. (D) tempo, favorveis disperso do material particulado. (E) tempo, caracterizadas por estabilidade atmosfrica.

ps-2013-1_geografia-tipo-1

UFG/CS

PROCESSO SELETIVO-2013-1

TIPO-1

QUESTO 60 Analise os mapas a seguir.

ROSS, J. L. S. (Org.). Geografia do Brasil. So Paulo: Edusp, 1998. p. 53. (Mapa do relevo). (Adaptado). SIMIELLI, M. E. Geoatlas. 4. ed. So Paulo: tica, 1990. (Mapa das bacias hidrogrficas). (Adaptado).

Os mapas apresentados destacam as unidades de relevo e as bacias hidrogrficas do territrio brasileiro. A comparao entre a localizao geogrfica dessas unidades e a rede hidrogrfica revela que a bacia hidrogrfica do Paraguai, no Brasil, possui a maior parte de sua rea associada ao relevo de (A) plancie, com rios navegveis de lento escoamento e pequeno potencial hidreltrico, com ocorrncia de enchen tes frequentes no vero. (B) depresso, com rios intermitentes e perenes, em parte navegveis, com nvel muito baixo na estao seca. (C) plancie, com rios perenes, navegveis em grande parte, com elevado potencial hidreltrico e desembocadura em regio litornea. (D) planalto, com rios em parte navegveis, com grandes desnveis de altitude e elevado aproveitamento hidreltrico. (E) depresso, com rios parcialmente navegveis e de elevado potencial hidreltrico, com desembocadura em regio litornea.

ps-2013-1_geografia-tipo-1

UFG/CS

PROCESSO SELETIVO-2013-1

TIPO-1

HISTRIA QUESTO 61 Leia o fragmento a seguir.


Tinha o desejo de saber por que o Nilo comea a encher no solstcio de Vero. De acordo com a primeira explicao, so os ventos estivais que, desviando com seu sopro as guas do Nilo, impede-as de ir para o mar, ocasionando a cheia. A segunda verso ainda mais absurda, embora encerre qualquer coisa de maravilhoso. Dizem que o oceano envolve toda a terra, e que o Nilo est sujeito a inundaes porque vem do oceano. A terceira explicao mais falsa. Com efeito, pretender que o Nilo provm de fontes de neve equivale a no dizer nada. Como poderia ser formado por fontes de neve se vem de um clima muito quente para um pas igualmente trrido?
HERDOTO. Histria. Rio de Janeiro: Jackson Inc., 1964. p. 119-120. (Adaptado).

QUESTO 63 Analise a imagem.

MONUMENTO AOS DESCOBRIMENTOS. Disponvel em: <http://www.foto.turisplan.pt/mais.php?GALLERY_FORM_VARIABLE_PREFIXitemN=136>. Acesso em: 8 out. 2012.

No fragmento apresentado, escrito por volta de 440 a.C., Herdoto expe diferentes vises para explicar os motivos das cheias do rio Nilo, no Egito. A forma de exposio de Herdoto expressa uma caracterstica da plis grega, associada

Inaugurado em 1960, como parte das celebraes dos 500 anos da morte de Dom Henrique, o Monumento aos Descobrimentos evoca a expanso martima portuguesa dos sculos XV e XVI. Essa evocao associa-se

(A) ao apego a modelos explicativos baseados no empi- (A) idealizao do imprio portugus, identificando-o com as concepes do regime salazarista. rismo. (B) opulncia portuguesa na modernidade, comparando-a (B) crena na interferncia de elementos mticos sobre com a economia do pas na Europa contempornea. os eventos naturais. (C) relevncia do comrcio atlntico, patrocinando uma (C) especulao filosfica como forma de transformar a reinterpretao do trfico de escravos. realidade. (D) colonizao portuguesa na Amrica, reforando a (D) relativizao da verdade como meio para alcanar contribuio dos colonizados para a nao ibrica. o conhecimento. (E) crena sebastianista, enfatizando a expanso territo(E) ao exerccio do dilogo constitudo por distintas opinirial como expresso do imperialismo portugus. es sobre os acontecimentos. QUESTO 64 QUESTO 62 Leia o fragmento a seguir. A segunda lei de Newton, divulgada em 1687, conhecida Que sejam trazidos duzentos carneiros de cargas, daqueles como a equao fundamental da dinmica e sintetiza os que costumam trazer e carregar a prata de Potosi, para fundamentos da mecnica clssica. Nela esto contidas acarrear o ouro e a prata. as ideias que influenciaram a modernidade europeia. De HOLANDA, Srgio Buarque. Viso do paraso. So Paulo: Brasiliense, acordo com essa lei, (A) a acelerao uma constante universal, tal como demonstrado pelos avanos cientficos necessrios O fragmento apresentado, de 1609, destaca uma das medidas tomadas por D. Francisco de Sousa, governador-geral Revoluo Industrial. do Brasil, para intensificar a busca por metais e pedras (B) a massa pode ser considerada permanente, tal como preciosas no interior do territrio. Nesse documento, o anunciado pela concepo do Iluminismo sobre os imaginrio colonial portugus se constitui pela influncia regimes absolutistas. (A) da notcia sobre as riquezas do territrio espanhol, (C) a resultante das foras uma constante, tal como exque circulava na colnia portuguesa. plicado pelos estudos renascentistas sobre a funo (B) do consumo interno de especiarias espanholas, que da musculatura humana. tornava a vida cotidiana na colnia mais aprazvel. (D) o movimento acelerado de um corpo uniformiza as (C) da quantidade de prata extrada em Minas Gerais, percepes sobre o tempo, tal como exposto pela vique aguava o interesse da populao litornea. so apocalptica da Contrarreforma. (D) da carncia dos transportes nas regies aurferas, (E) as foras podem atuar sobre os corpos, tal como inque obrigava os colonos a escravizar indgenas. dicado pelo princpio liberal que trata da atuao do (E) da eficincia administrativa da Coroa Espanhola, que mercado na economia. foi apropriada como modelo pelos portugueses.
ps-2013-1_historia-tipo-1

1994, p. 97. (Adaptado).

UFG/CS

PROCESSO SELETIVO-2013-1

TIPO-1

QUESTO 65 Leia o poema a seguir.


A CANTIGA DO SERTANEJO [...] Pobre amor! o sertanejo Tem apenas seu desejo E as noites belas do val! S o ponche adamascado, O trabuco prateado E o ferro de seu punhal! [...] Se tu viesses, donzela, Verias que a vida bela No deserto do serto! L tm mais aroma as flores E mais amor os amores Que falam no corao!
AZEVEDO, lvares de. Lira dos vinte anos. In: Obra completa. Organizao de Alexei Bueno. Rio de Janeiro: Nova Aguilar, 2000. p. 131.

QUESTO 66 Leia o trecho da composio a seguir.


Mas se voc achar Que eu t derrotado Saiba que ainda esto rolando os dados Porque o tempo, o tempo no para. A tua piscina t cheia de ratos Tuas ideias no correspondem aos fatos O tempo no para Eu vejo o futuro repetir o passado Eu vejo um museu de grandes novidades O tempo no para No para, no, no para.
CAZUZA. O tempo no para. lbum O tempo no para. Gravadora Universal Music Brasil, 1989. Faixa 6. (Adaptado).

Datada de 1989, a composio de Cazuza integra o repertrio do rock nacional. Atingindo um pblico amplo, essa composio exprime uma relao entre a vivncia dos jolvares de Azevedo um importante representante do Rovens e a apreenso de seu tempo, quando mantismo brasileiro oitocentista. No trecho da obra citada, o autor constri uma imagem do serto, decorrente (A) vincula presente e futuro, expressando a incapacidade de mudana na cultura juvenil dominada pelo au(A) do compromisso dos artistas com o projeto de centoritarismo. tralizao do Imprio, que buscava integrar as provncias do interior ao Estado nacional. (B) contraria a vivncia subjetiva do tempo, subordinando a experincia do indivduo ao coletivo em defesa (B) do contato com as artes europeias, que favorecia a do patriotismo. avaliao dos elementos individualizadores da identidade nacional emergente com a Independncia. (C) recusa a memria sobre o passado, tentando se liberar das ocorrncias opressoras da dcada anterior (C) da crtica aos problemas sociais das cidades litorneque afetaram a juventude resistente. as, que reforava o saudosismo diante do declnio da economia cafeeira. (D) identifica o conflito entre geraes, revelando o desejo da juventude do presente em criticar as referncias (D) da elaborao de personagens caricatos, que marcaticas que conduziram a transio democracia. va a gerao de poetas influenciados pelos trabalhos da misso francesa. (E) explora a desacelerao do tempo, aludindo ao sentimento de um presente que se repete porque o ideal (E) da inspirao da literatura descritiva de jesutas, que democrtico parecia distante. relatava o interior do Brasil, destacando o desenvolvimento da economia agropastoril. RASCUNHO RASCUNHO

ps-2013-1_historia-tipo-1

UFG/CS

PROCESSO SELETIVO-2013-1

TIPO-1

QUESTO 67 Leia o fragmento a seguir.


Toda organizao racional se assemelha ao corpo humano ou s suas partes componentes. Ela deve possuir o rgo de direo, como o crebro, capaz de receber as sensaes exteriores, defini-las, conjug-las e resolv-las, determinando a reao adequada.
AZEVEDO, Aldo. Apud LENHARO, Alcir. Sacralizao da poltica. Campinas, SP: Papirus, 1986. p. 149. (Adaptado).

QUESTO 68 Analise a imagem a seguir.

Neste documento de 1932, o corpo humano apropriado como metfora pelo discurso poltico, orientado pela ao das instituies que abrigavam intelectuais varguistas. O fragmento apresentado uma expresso de tal apropriao, que pretende justificar a (A) disseminao de prticas culturais comunitrias, definindo o crebro como modulador de equilbrio para o funcionamento dos sistemas do corpo humano. (B) desigualdade regional que advm do pacto federativo, enfocando o papel do hipotlamo na regulao hormonal. (C) necessidade de politizar a atuao dos sindicatos, destacando os diferentes crtices cerebrais na tomada de deciso. (D) organizao hierrquica da sociedade, indicando o crebro como decodificador dos impulsos nervosos sensoriais em respostas biolgicas. (E) utilizao do sentimento nacionalista, ressaltando o crebro como o centro da expresso emocional do corpo humano. RASCUNHO

Legenda:
reas verdes Sistema virio

PIRES, Jacira Rosa. La ciudad premoderna del Cerrado (Tesis doctoral). Barcelona, Espanha: Universitat Politecnica de Catalunya, 2006. (Adaptado).

A imagem do plano original de Goinia foi desenvolvida por Attlio Corra Lima, a partir de 1935. Para a confeco do desenho, o urbanista recorreu (A) orientao religiosa local, destacando formas que enfatizavam o vnculo da nova capital com o cristianismo, como a cruz e o tringulo. (B) cultura poltica regional, aludindo aos princpios do igualitarismo com a uniformizao das quadras e praas voltadas sociabilidade da populao. (C) ao exame do relevo da regio, aproveitando a topografia para orientar o sistema virio local dirigido para o centro administrativo. (D) hidrografia do stio, organizando o sistema de vias na forma de pistas marginais aos cursos d'gua que cortavam a nova capital. (E) ao clima local, projetando na regio sul da cidade um sistema de reas verdes capaz de atenuar os efeitos trmicos durante a estao seca.

ps-2013-1_historia-tipo-1

UFG/CS

PROCESSO SELETIVO-2013-1

TIPO-1

QUESTO 69 Analise as imagens a seguir.

QUESTO 70 Analise a imagem a seguir.

Jornal Revolucin, 1962.

WARHOL, Andy. Marylin Monroe, 1963. Serigrafia. Disponvel em: <http://temnafotografia.wordpress.com/2011/11/17/artista-da-vez-andywarhol/> Acesso em: 13 out. 2012.

Jornal Granma, 1973.


FRANQUI, Carlos. Retrato de famlia com Fidel. Rio de Janeiro: Record, 1981. s.p. (Adaptado).

Andy Warhol foi um dos representantes da art pop, surgida na Inglaterra e nos Estados Unidos na dcada de 1950. A imagem apresentada traduz a concepo desse movimento artstico, quando

(A) escolhe uma personalidade feminina para tema, asAs imagens apresentadas mostram guerrilheiros na Rdio sociando a arte luta do movimento feminista. Rebelde, que funcionava na Sierra Maestra, durante a Revoluo Cubana. A segunda imagem foi alterada, com o (B) apresenta um nico rosto em sequncia, demonstrando a singularidade dos indivduos celebrados. exlio de Carlos Franqui de Cuba, em 1968. Essa alterao pretendia (C) transforma imagens veiculadas na indstria cultural, ampliando as possibilidades de relao com a arte. (A) distinguir o movimento revolucionrio do regime instaurado, ao centralizar Fidel Castro na fotografia. (D) fortalece o mito do american way of life, utilizando-se de personagens icnicas. (B) relacionar o regime revolucionrio ao povo, ao colocar Fidel Castro junto a um trabalhador. (E) critica o padro de beleza feminina, expondo o elitismo das produes cinematogrficas. (C) fazer propaganda do regime, ao destacar figuras mais conhecidas pelo povo. (D) enfatizar o papel da mdia, ao registrar o ambiente que permitia a comunicao entre os rebeldes. (E) fabricar a memria da luta revolucionria, ao selecionar os personagens que a integram.

ps-2013-1_historia-tipo-1

UFG/CS

PROCESSO SELETIVO-2013-1

TIPO-1

QUMICA QUESTO 71 A substncia 32P uma espcie radioativa utilizada no tratamento radioterpico de alguns tipos de cncer. Essa substncia emite partculas alfa que possuem energia suficiente para combater as clulas infectadas. Ao introduzir 10 g de 32P no organismo, o nmero de tomos e a massa atmica do produto formado aps decaimento radioativo so, respectivamente, (A) 1,9x10 e 36.
23 21 19

QUESTO 74 A tabela a seguir apresenta os valores de raio atmico e raio inico para alguns tomos e ons. Raio atmico (em picmetros) Na Na
+

Raio inico (em picmetros) 90 60

190 160 -

Mg Mg
2+

Dado: Constante de Avogadro = 6x10


23

(B) 1,9x10 e 36. (C) 2,1x10 e 32. (D) 2,1x1017 e 28. (E) 2,1x1015 e 28.

De acordo com os dados apresentados, a porcentagem aproximada de diminuio do dimetro do on Mg2+ bem como a explicao para o fato so, respectivamente, (A) 35% em relao ao dimetro do on Na +, pois h um prton a mais em seu ncleo, aumentando a atrao ncleo-eletrosfera.

QUESTO 72

(B) 65% em relao ao dimetro do on Na +, pois o on Uma soluo foi preparada pela mistura de cido clordriMg2+ tem carga efetiva e raio inico maiores. co (HCl), cido ntrico (HNO 3) e cido sulfrico (H2SO4). Sabendo-se que na soluo final as concentraes mola- (C) 65% em relao ao dimetro do tomo de Mg, pois nem todo ction tem o raio inico maior do que o raio res de HCl, HNO3 e H2SO4 so, respectivamente, iguais a atmico do tomo do qual derivado. 0,010 mol/L, 0,030 mol/L e 0,0050 mol/L, o pH da soluo ser igual a: (D) 35% em relao ao dimetro do tomo de Na, pois o on Mg2+ tem maior carga efetiva e menor raio inico. (A) 5,00 Dado: (B) 3,00 (C) 2,70 (D) 2,00 (E) 1,30
log10 5 = 0,70

(E) 65% em relao ao dimetro do on on Na +, pois este tem maior carga efetiva e menor raio inico. QUESTO 75

Certos alimentos, ao serem cortados, sofrem um processo de escurecimento em sua superfcie, como a ma e o QUESTO 73 palmito. Para retardar esse fenmeno, costuma-se passar suco de limo nas superfcies desses alimentos. A funo Em um determinado momento histrico, o modelo atmico do suco de limo, nesse caso, a de vigente e que explicava parte da constituio da matria considerava que o tomo era composto de um ncleo com (A) coagulante. carga positiva. Ao redor deste, haviam partculas negati- (B) hidratante. vas uniformemente distribudas. A experincia investigativa que levou proposio desse modelo foi aquela na (C) antiumectante. qual (D) antibactericida. (A) realizou-se uma srie de descargas eltricas em tu- (E) antioxidante. bos de gases rarefeitos. (B) determinou-se as leis ponderais das combinaes QUESTO 76 qumicas. Uma reportagem em relao definio do que o leite (C) analisou-se espectros atmicos com emisso de luz de fato foi veiculada na Folha de S. Paulo, edio do dia 16/09/2012 (pgina C7). Segundo essa reportagem: leite com cores caractersticas para cada elemento. um produto natural composto de gua, gordura, vitami(D) caracterizou-se estudos sobre radioatividade e dis- nas, protenas, enzimas e lactose.... Dentre essas subsperso e reflexo de partculas alfa. tncias mencionadas, a classe que um catalisador biol(E) providenciou-se a resoluo de uma equao para gico a determinao dos nveis de energia da camada ele- (A) dos lipdios. trnica. (B) dos minerais. (C) das enzimas. (D) das vitaminas. (E) dos glicdios.

ps-2013-1_quimica-tipo-1

UFG/CS

PROCESSO SELETIVO-2013-1

TIPO-1

QUESTO 77 Analise o esquema a seguir.

QUESTO 79 Leia o texto a seguir.

o o o
o o o
o o
0 0

[] Como a Revoluo Francesa no teve apenas por objeto mudar um governo antigo, mas abolir a forma antiga da sociedade, ela teve de ver-se a braos a um s tempo com todos os poderes estabelecidos, arruinar todas as influncias reconhecidas, apagar as tradies, renovar os costumes e os usos e, de alguma maneira, esvaziar o esprito humano de todas as ideias sobre as quais se tinham fundado at ento o respeito e a obedincia. []
TOCQUEVILLE, A. de. O antigo regime e a revoluo. Braslia: Editora da UnB, 1989.

A ideia expressa, que se coaduna com o texto e os ideais da Revoluo Francesa, a seguinte: (A) Nada to maravilhoso que no possa existir, se admitido pelas leis da natureza. (Michael Faraday)

Entrada de ar

(B) Toda sentena que eu digo deve ser entendida no como afirmao, mas como uma pergunta. (Niels Ao se introduzir uma bolha de gs na base do cilindro, ela Bohr) inicia sua ascenso ao longo da coluna de lquido, temperatura constante. A presso interna da bolha e a pres- (C) Na natureza nada se cria, nada se perde, tudo se transforma. (Antoine Lavoisier) so a que ela est submetida, respectivamente,
Base do Cilindro

(A) aumenta e diminui. (B) diminui e diminui. (C) aumenta e permanece a mesma. (D) permanece a mesma e diminui. (E) diminui e permanece a mesma. QUESTO 78 Os aminocidos so substncias de carter anftero devido presena de grupos -NH 2 e -COOH. Quando dois aminocidos reagem entre si, ocorre a formao de um dipeptdeo com eliminao de gua. Desse modo, o grupo funcional presente na ligao peptdica (A) um fenol. (B) uma amida. (C) um ster. (D) uma amina. (E) um cido carboxlico.

(D) A relao entre a qumica e a msica a criatividade. Assim, ambas so uma arte. (Dimitri Mendeleev) (E) Apenas a prtica frequente faz com que a pessoa realize experimentos complexos. (Joseph Priestley) RASCUNHO

ps-2013-1_quimica-tipo-1

UFG/CS

PROCESSO SELETIVO-2013-1

TIPO-1

QUESTO 80 Os nucleotdeos so constitudos por uma molcula de desoxirribose (D), uma molcula de cido fosfrico (P) e uma base nitrogenada (adenina, guanina, timina ou citosina). A ligao entre os nucleotdeos ocorre pela interao entre as bases nitrogenadas especficas, resultando em uma molcula ordenada e bem definida, o DNA. De acordo com essas informaes, a estrutura plana que representa um fragmento de DNA e o tipo de ligao qumica responsvel pela interao entre as bases nitrogenadas so, respectivamente,

RASCUNHO

(A)

e ligao de hidrognio.

(B)

e ligao covalente.

(C)

e ligao inica.

(D)

e ligao covalente.

(E)

e ligao de hidrognio.

ps-2013-1_quimica-tipo-1

UFG/CS

PROCESSO SELETIVO-2013-1

TIPO-1

ESPANHOL

QUESTO 83

El tercer prrafo es dedicado a destacar las utilidades del Leia o texto que segue e responda s questes de 81 a maz. En l, se dice que en Guinea 83. (A) las panojas maduras se suelen servir en cocidos. LAS PLANTAS DE GUINEA ECUATORIAL: MAZ (B) los corazones de la mazorca se usan en sopas. (C) el grano se pone como aditamento en los platos. (D) lo aprovechable del maz se convierte en pienso. (E) la harina del choclo se transforma en palomitas.
El maz, procedente, como tantas plantas tiles, de la Amrica tropical, se cultiva con mucha frecuencia en los alrededores de los poblados de Guinea. Para prosperar bien, necesita que el suelo est bien trabajado y que no se encharque, es decir, que tenga un buen drenaje. Es una planta muy til, ya que sirve para alimentar, tanto a las personas como al ganado. Durante su cultivo ha de tenerse cuidado de que los pjaros no arruinen la cosecha, pues son muy aficionados al maz. Tambin, una vez recogida sta, deber mantenerse en un lugar seco y bien ventilado. Existen muchas variedades de maz, pero el ms habitual en Guinea es el de granos amarillos; esos granos son bastante grandes y, desde su plantacin hasta su recogida, suelen transcurrir unos tres meses, por lo que se plantan y cosechan dos veces al ao. Las mazorcas, cuando an estn verdes, se consumen asndolas o cocindolas. Una vez completamente maduras se desgranan, es decir, se separan los granos de la panoja, y estos granos se utilizan, cocidos, para sopas, como acompaamiento de platos o, secos y molidos, como harina para preparar una gran variedad de platos. Tambin, saltendolos con un poco de aceite en una sartn, se preparan las conocidas palomitas de maz. Para el ganado se utiliza la planta como forraje, tanto en verde como en seco.
REUS, Erika. Las plantas de Guinea Ecuatorial: maz. Disponvel em: <http://www.lagacetadeguinea.com/179/19.htm>. Acesso em: 18 set. 2012. (Adaptado).

Leia o texto que segue e responda s questes 84 e 85.


EL LESULA, LA NUEVA ESPECIE DE MONO AFRICANO

QUESTO 81 El texto comienza sealando algunas recomendaciones que han de tenerse en cuenta con relacin al maz. Para evitar problemas se indica que (A) la cosecha debe ser guardada en lugares ventilados. (B) las semillas deben ser plantadas en das sin lluvia. (C) los espantapjaros deben ser puestos entre los cultivos. (D) el almacenamiento debe impedir que la luz afecte al grano. (E) lo recogido en mal estado debe ser destinado al ganado. QUESTO 82

Investigadores estadounidenses descubrieron una nueva especie de primates en una regin poco explorada de la Repblica Democrtica del Congo, que se denomin Cercopithecus lomamiensis, localmente conocidos como lesula. Los cientficos vieron en cautiverio, por primera vez, un ejemplar de este mono en la ciudad de Opala, en junio de 2007. A partir de esa fecha, iniciaron una bsqueda sistemtica de ejemplares en su hbitat natural. Durante los siguientes tres aos, los autores del estudio encontraron ms ejemplares de lesula en la naturaleza, determinando su carcter distintivo gentico y anatmico, y realizando las primeras observaciones de su comportamiento y de su ecologa. Entre los detalles de la investigacin que se publican en la revista especializada Plos one se exponen las caractersticas de estos animales. Se destaca que miden entre 47 y 65 centmetros los machos y entre 40 y 42 las hembras, y poseen las extremidades largas y cuerpo delgado. Los lesula se desenvuelven bsicamente por el suelo de la densa selva hmeda tropical, aunque tambin les gustan las ramas bajas de los rboles. Normalmente viven en grupos familiares reducidos, de unos cinco ejemplares, formados por un macho, hembras y cras. El Cercopithecus lomamiensis es tmido y fue el primate que se observ con menos frecuencia entre todos los registrados en las campaas de reconocimiento, sealan los investigadores. Los cientficos los han visto en grupos con otras especies de primates para alimentarse. Esta especie es similar al mono de cara de bho pero tiene rasgos diferentes, sobre todo en la coloracin del pelo, que va del gris rosado al marrn, negro en las patas y rayas distintivas de color mbar.
El lesula, la nueva especie de mono africano. Disponvel em: <http://www.elcomercio.com/sociedad/Identifican-nueva-especier-afr>. Acesso em: 18 set. 2012. (Adaptado).

QUESTO 84

Al referirse a las caractersticas del cultivo del maz, la Al principio del texto se comenta como se localiz el Cercopithecus Iomamiensis. As, es dicho que ese mono autora seala que, en Guinea Ecuatorial, se fue por primera vez visto (A) baten barcas de tamao. (A) fuera de su hbitat natural. (B) dejan en barbecho las tierras. (B) tras tres aos de bsqueda. (C) recogen dos cosechas anuales. (C) en grupos de cinco ejemplares. (D) desechan los granos amarillos. (D) oculto en una regin congolea. (E) siembran los campos cada tres meses. (E) aclimatado a la ciudad de Opala.
ps-2013-1_espanhol-tipo-1

UFG/CS

PROCESSO SELETIVO-2013-1

TIPO-1

QUESTO 85

QUESTO 86

Los resultados de la investigacin sobre el lesula fueron El texto contiene una nota de bito sobre Benot divulgados en un peridico especializado. Segn el Mandelbrot. En el primer prrafo l es calificado como informe publicado, las investigador de las (A) familias de los lesulas huyen del contacto con otros (A) primates. (B) (B) copas de los rboles son el lugar preferido por los (C) lesulas. (D) (C) hembras lesula tienen las extremidades mayores y (E) un cuerpo canijo. sistematizaciones de figuras rectas. transformaciones lineales homogneas. fuerzas irregulares de la naturaleza. clases de excepciones geomtricas. estructuras geomtricas complejas.

(D) campaas de reconocimiento constataron la timidez QUESTO 87 de los lesula. En el segundo prrafo se indica que los estudios (E) tonalidades del pelo del lesula lo emparentan con el trascendentales de Mandelbrot fueron publicados a partir mono cara de bho. de la dcada de 1970. Ellos mostraron que los objetos matemticos irregulares Leia o texto que segue e responda s questes de 86 a (A) contestaban a la simplicidad natural. 88. (B) presentaban rugosidades patolgicas.
MUERE BENOT MANDELBROT

(C) derivaban en la ruptura de las escalas. (D) reflejaban la heterogeneidad de la realidad. (E) mostraban la abstraccin alcanzada por la ciencia. QUESTO 88 El fractal, segn lo indicado en el ltimo prrafo del texto, es un vocablo

El matemtico franco-estadounidense Benot Mandelbrot, pionero en el estudio de los fractales, una clase de formas geomtricas en principio irregulares y difciles de sistematizar, ha muerto a los 85 aos en Cambridge (Massachusetts, Estados Unidos). Los estudios esenciales de Mandelbrot, publicados a partir de los aos 70, sostenan que objetos matemticos irregulares que hasta entonces haban sido descartados como patolgicos por los cientficos eran, en realidad, un reflejo de la naturaleza. Mandelbrot se interes, por ejemplo, por los patrones por los que se rigen la rugosidad o las fracturas. De hecho, como recordaba el investigador, basta con observar la naturaleza para comprobar que la mayora de los objetos ni son homogneos ni son tan simples como el crculo de la Luna o la espiral de un caracol o el panal de unas abejas. Un fractal es, segn el trmino acuado en 1975 por Mandelbrot, un objeto cuya estructura bsica, fragmentada o irregular, se repite a diferentes escalas. Los ejemplos siempre citados son las nubes, las montaas o las costas, objetos demasiado irregulares como para ser descritos en trminos tradicionales. Por ejemplo, el perfil de una costa no es igual si se mide desde un avin, con unas dimensiones aparentemente rectilneas, que si se hace a pie de playa, momento en el que afloran los detalles ms pequeos y se observa un perfil dentado que se reproduce hasta el infinito.
MADRIDEJOS, Antonio. Muere Benot Mandelbrot, Disponvel em: <http://www.elperiodico.com/es/noticias/ciencia-ytecnologia/20101018/muere-benoit-mandelbrot-padre-geometriafractal/542778.shtml>. Acesso em: 18 set. 2012.(Adaptado).

(A) tomado prestado de la orografa. (B) inventado por Benot Mandelbrot. (C) poseedor de demasiados sinnimos. (D) sustituible por trminos tradicionales. (E) carente de proyeccin en el mundo material. RASCUNHO

ps-2013-1_espanhol-tipo-1

UFG/CS

PROCESSO SELETIVO-2013-1

TIPO-1

Leia a tira a seguir e responda s questes 89 e 90.

RASCUNHO

BARTRA. Hernn. Manyute. Disponvel em: <http://hernanbartra.blogspot.com.br/2010/08/manyute-encolores.html>. Acesso em: 26 set. 2012.

QUESTO 89 Dentro del contexto de la historieta, en la expresin figurada y familiar Pedazo de haraganote!, la construccin Pedazo de (A) provoca agobio en el receptor. (B) recalca la necedad del destinatario. (C) atena el efecto despectivo de haraganote. (D) genera un mensaje cifrado para el interlocutor. (E) garantiza las reacciones esperadas por el emisor. QUESTO 90 El ltimo bocadillo de la historieta contiene unas instrucciones para (A) tocar el timbre. (B) salir del cuarto. (C) cerrar la puerta. (D) correr el pestillo. (E) alcanzar el tirador.

ps-2013-1_espanhol-tipo-1

UFG/CS

PROCESSO SELETIVO-2013-1

TIPO-1

INGLS QUESTO 81 Read the text.

The following poem presents a different version of the popular song California Dreamin' by The Mammas and The Papas (1965). Read it and answer questions 83, 84, and 85.
California Steamin' By Clinton VanInman Contributing Poet All the tress are brown And the sky is gray I've been for a walk On a greenhouse day. I should be safe and sound now If I was miles from L.A. California steamin' On such a sweltering day. Stopped into a church I stumbled along the way Got down on my knees And prayed for a rainy day.

Disponvel em: <www.sarkisian.net/sc705/>. Acesso em: 9 out. 2012.

There is an implicit message in the text, according to which (A) statistical tolerancing must be studied more carefully. (B) hypothesis testing involves making a correct decision. (C) training qualified statisticians is frustrating. (D) statistics for calmness of mind is being tested. (E) statistics might be boring sometimes. QUESTO 82

You know the preacher likes it cold Now that all his candles have melted away, California steamin' Please don't take my fan away.
Disponvel em: <http://cafe.cynicmag.com/>. Acesso em: 20 set. 2012.

Glossrio: steamin': fumegante sweltering: abafado stumbled: cambaleei

QUESTO 83 In this adaptation, the poet's main aim is to (A) characterize the climate and biomes found in California.

Information about where to stay while travelling always (B) give a detailed account of his daily life in California. mentions positive aspects of a hotel or a guesthouse, for example. Sometimes, though, it points out something (C) describe the weather conditions he is experiencing in which may not be so positive. The comments presented in California. the alternatives below were taken from the newspaper (D) express how religious he and other Californians are. supplement Travel, in The Sunday Telegraph. (E) tell a story about a church he has visited in California.
THE SUNDAY TELEGRAPH, European Edition, 29 jul. 2012, p. C42-46. (United Kingdom). (Adaptado).

QUESTO 84

There is a couple interested in staying in a small and From this adaptation, the reader concludes that comfortable hotel, with good views and pleasant (A) the current season is Autumn. surroundings. Which of the comments points out something this couple should be aware of? (B) it has been hot in California. (A) 15th century building with a terrace, in a prime (C) rain is expected over the next few days. position on the little harbour of Goedereede and close (D) Los Angeles (L.A.) is a polluted city. to De Kwade Hoek. (E) the preacher likes drinking. (B) Perhaps the most interesting rooms are the bedrooms, with colourful quilts and simple wood QUESTO 85 furniture. I should be safe and sound now (C) The decoration of the staircase, wide landings and If I was miles from L.A. means that the poet corridors to the 22 bedrooms remains painful to look (A) isn't in Los Angeles (L.A.). at. (D) If you want a real taste of Amish life, this charming (B) feels free of danger in L.A. two bedroom guesthouse is on a true-to-life Amish (C) is likely to move to another city. dairy farm. (D) wishes he was somewhere else. (E) This new, small-scale hotel has 10 rooms, and is (E) regrets a past situation. situated on the edge of the village of Ouddorp.
ps-2013-1_ingles-tipo-1

UFG/CS

PROCESSO SELETIVO-2013-1

TIPO-1

QUESTO 86

QUESTO 88 The headlines below are from the online version of the Read the descriptions of tea offered by a coffee and tea company. British newspaper The Guardian.
Red Squirrel population wiped out in northern Italy Why is Labour so quiet on green issues? Obama blocks Chinese firm's purchase of four US wind farms
Disponvel em: <www.theguardian.co.uk/>. Acesso em: 20 set. 2012.

In which of the following sections can such headlines be found? (A) Environment (B) Business (C) Culture (D) Life & Style (E) Travel QUESTO 87 Read the cartoon.
Tea Lattes Made with our deluxe powders, steamed non-fat milk, and foam, our Tea Lattes are often copied by others, but theres nothing like the original.Some might call it tea obsession, we call it innovation. Iced Tea Lattes Enjoy our signature Tea Lattes over ice a great alternative during the warmer months.

Disponvel em: <http://www.coffeebean.com.ph/our-tea>. Acesso em: 8 out. 2012. (Adaptado).

Glossrio: powders: ps steamed: vaporizado foam: espuma

According to both descriptions, the company (A) includes light suplies for tea. (B) prefers refined powders for tea. (C) makes special teas for each season. (D) creates original tea recipes.
Disponvel em: <www.washingtonpost.com/wpsrv/artsandliving/comic/king.html?name=zits&date=20120926>. Acesso em: 1 out. 2012.

(E) is obsessed with perfectionism.

QUESTO 89 According to the girls speech in each part of the cartoon, the list of verbs that represents her discursive intentions is: The following statement When it comes to spending and the five possible answers to it were taken from a money (A) regret suppose accuse advise. personality quiz. Read them and answer the question. (B) apologize emphasize suggest request. (C) excuse declare propose demand. (D) blame insinuate recommend invite. (E) state imply recriminate insist.
When it comes to spending: a. ( ) I hope I have enough money to take care of unexpected expenses. b. ( ) I enjoy spending money, as long as I can keep earning more. c. ( ) I'd rather save my money; spending it makes me nervous. d. ( ) I don't care where my money goes; I have more important things to think about. e. ( ) I love spending money, and I tend to spend more than I earn.
Disponvel em: <http://www.moneyharmony.com/MHQuiz.html>. Acesso em: 24 set. 2012. (Adaptado).

According to what people may choose as answers to the statement When it comes to spending, what can be inferred? (A) People who choose A think about their future. (B) People who choose B save money on a daily basis. (C) People who choose C handle stress easily. (D) People who choose D invest their savings in charity. (E) People who choose E have low salaries.
ps-2013-1_ingles-tipo-1

UFG/CS

PROCESSO SELETIVO-2013-1

TIPO-1

QUESTO 90 Read the advertisement.

THE PORTUGAL NEWS, Portugal's National Newspaper in English, 28 jul. 2012, p.6. (Lisboa). (Adaptado).

Glossrio: BBQ (barbecue): churrasco

The visual and verbal elements of the advertisement have been combined to convey the following most important message: the Bar & Grill is very (A) famous. (B) cheap. (C) comfortable. (D) traditional. (E) enjoyable. RASCUNHO

ps-2013-1_ingles-tipo-1