Você está na página 1de 718

Pr Vestibular UNIRIO 2010

Exerccios UERJ Exames de Qualificao

Pr-Vestibular UNIRIO 2010 Todos os direitos reservados.

Apostila produzida por alunos da UNIRIO e voluntrios do Pr-Vestibular Comunitrio UNIRIO 2010. Com o apoio da Pr-Reitoria de Extenso da UNIRIO. Agradecemos ao Ilustrssimo Pr-Reitor de Extenso, Luciano Maia e Magnfica Reitora Malvina Tuttman pela oportundiade de concretizar este projeto.
Gabriel Dria Marinho

Conceito, Diagramao e Coleta de Material

Sumrio
2001 1oo Exame.................................................................................................................................. 1 2001 2 Exame.................................................................................................................................. 43 2002 1ooExame.................................................................................................................................. 87 2002 2 Exame................................................................................................................................. 124 2003 1oo Exame................................................................................................................................. 161 2003 2 Exame................................................................................................................................ 198 2004................................................................................................................................................... 235 2005 1ooExame.................................................................................................................................. 272 2005 2 Exame................................................................................................................................. 308 2006 1ooExame.................................................................................................................................. 344 2006 2 Exame................................................................................................................................. 380 2007 1oo Exame................................................................................................................................. 416 2007 2 Exame................................................................................................................................. 451 2008 1oo Exame................................................................................................................................. 487 2008 2 Exame................................................................................................................................. 522 2009 1ooExame................................................................................................................................. 559 2009 2 Exame................................................................................................................................ 593 2010 1oo Exame.................................................................................................................................. 629 2010 2 Exame.................................................................................................................................. 671

Plano de Estudo
Exame 2001 1o 2001 2o 2002 1o 2002 2o 2003 1o 2003 2o 2004 2005 1o 2005 2o 2006 1o 2006 2o 2007 1o 2007 2o 2008 1o 2008 2o 2009 1o 2009 2o 2010 1o 2010 2o Data 01/02 a 07/02 08/02 a 14/02 22/02 a 28/02 01/03 a 07/03 08/03 a 14/03 15/03 a 21/03 22/03 a 28/03 29/03 a 04/04 05/04 a 11/04 12/04 a 18/04 19/04 a 25/04 26/04 a 02/05 03/05 a 09/05 10/05 a 16/05 17/05 a 23/05 24/05 a 30/05 01/06 a 06/06 07/06 a 13/06 14/06 a 20/06 Total de Questes 80 80 64 64 64 64 64 60 60 60 60 60 60 60 60 60 60 60 60 Conceitos da UERJ A - Acima de 70% B - Entre 60% e 70% C - Entre 50% e 60% D - Entre 40% e 50% E - Menos de 40% Acertos Percentagem

1a Fase - 1o Exame de Qualificao

21/05/2000

Neste caderno voc encontrar um conjunto de 48 (quarenta e oito) pginas numeradas seqencialmente, contendo 80 (oitenta) questes das seguintes reas: Linguagens, Cdigos e suas Tecnologias; Cincias da Natureza, Matemtica e suas Tecnologias; Cincias Humanas e suas Tecnologias. A tabela peridica encontra-se na pgina 45.

INSTRUES I.
Verifique se o seu nome, nmero de inscrio, nmero do documento de identidade e lngua estrangeira escolhida esto corretos no carto de respostas. Se houver erro, notifique o fiscal. Assine o carto de respostas com caneta.

No abra o caderno antes de receber autorizao.

6. 4. Leia atentamente cada questo e escolha a alternativa que mais adequadamente responde a cada uma delas. Marque sua resposta no carto de respostas , cobrindo fortemente o espao correspondente letra a ser assinalada; utilize caneta preta, preferencialmente, ou lpis preto n 2, conforme o exemplo abaixo:
1 A B C D

O carto de respostas no pode ser dobrado, amassado, rasurado ou manchado. Exceto sua assinatura, nada deve ser escrito ou registrado fora dos locais destinados s respostas.

7.

Voc dispe de 5 (cinco) horas para fazer esta prova.

2.

Ao receber autorizao para abrir este caderno, verifique se a impresso, a paginao e a numerao das questes esto corretas. Caso ocorra qualquer erro, notifique o fiscal.

8.
A leitora de marcas no registrar as respostas em que houver falta de nitidez e/ou marcao de mais de uma letra.

5.

Ao terminar a prova, entregue ao fiscal o carto de respostas e este caderno.

3.

As questes de nmeros 25 a 28 da rea de Linguagens, Cdigos e suas Tecnologias devero ser respondidas de acordo com a sua opo de Lngua Estrangeira: Espanhol, Francs ou Ingls.

BOA PROVA!

LINGUAGENS, CDIGOS LINGUAGENS, ECDIGOS SUAS TECNOLOGIAS E SUAS TECNOLOGIAS Questo 01 Leia a piada reproduzida a seguir: Vinha o motorista dirigindo o seu carro, quando se deparou com uma placa de sinalizao:

Imediatamente, ele acelerou o seu veculo. Logo depois, voltou a p para o local da placa e nela escreveu, para corrigi-la:

Como muitas piadas, esta se baseia em um equvoco. O comportamento do motorista que explica mais adequadamente o efeito cmico da piada : (A) voltar a p ao local da placa para efetuar uma correo (B) ler a mensagem da placa como uma ordem para acelerar (C) corrigir a mensagem da placa para retificar informao incompleta (D) imprimir maior velocidade ao carro para escapar dos quebra-molas Questo 02 As novas tecnologias de comunicao utilizam o hipertexto, que uma espcie de supertexto: um texto maior que contm vrios nveis textuais lidos em mltiplas direes. Antes mesmo do computador, j podamos encontrar exemplos de hipertexto, como verbetes de enciclopdia, ndices analticos e notas de rodap. Esta prova de mltipla escolha tambm pode ser caracterizada como hipertextual, pela seguinte razo: (A) fornece uma alternativa verdadeira e trs falsas, para a soluo da questo (B) requer conhecimento prvio dos assuntos, para a articulao com outros textos (C) inclui textos, questes e opes em diversas lnguas, para a ampliao da compreenso (D) exige leitura dos enunciados e das alternativas em diferentes ordens, para a identificao da resposta Questo 03 Em 1648, um qumico holands, chamado Jean Baptist von Helmont, argumentando indutivamente, relatou a seguinte experincia, para comprovar a tese da gerao espontnea: Faa um buraco num tijolo, ponha ali erva de manjerico bem triturada. Aplique um segundo tijolo sobre o primeiro e exponha tudo ao sol. Alguns dias mais tarde, tendo o manjerico agido como fermento, voc ver nascer pequenos escorpies. Hoje, sabemos que escorpies no nascem assim. A concluso do qumico pode ser refutada logicamente pelo argumento indicado em: (A) a experincia no resistiu passagem do tempo (B) uma hiptese alternativa para o fenmeno no foi lembrada (C) o qumico no tinha competncia para a realizao da experincia (D) a gerao espontnea no pode ser comprovada com experimentos
10 Exame de Qualificao Vestibular Estadual 2001

3 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 04

(Ziraldo. Jornal do Brasil, 11/11/1999.)

Na tira de Ziraldo, os personagens mudam de atitude do primeiro quadrinho para o segundo. Pelo terceiro quadrinho, pode-se deduzir o que no est escrito: um pensamento teria provocado a mudana. Esse pensamento poder ser traduzido como: E se os caras dentro do espelho... (A) ... estivessem rindo deles? (B) ... fossem reais e eles o reflexo? (C) ... pudessem trocar de lugar com eles? (D) ... duvidassem da realidade do mundo?

TEXT O1 TEXTO

Um salrio-mnimo maior do que o que vo dar desarrumaria as contas pblicas, comprometeria o programa de estabilizao do Governo, quebraria a Previdncia, inviabilizaria o pas e provavelmente desmancharia o penteado do Malan. Quem prega um salrio-mnimo maior o faz por demagogia, oportunismo poltico ou desinformao. Srios, sensatos, adultos e 05 responsveis so os que defendem o reajuste possvel, nas circunstncias, mesmo reconhecendo que pouco. Como boa parte da populao brasileira vive de um mnimo que no d para viver e as circunstncias que o impedem de ser maior no vo mudar to cedo, eis-nos num silogismo brbaro: se o pas s sobrevive com mais da metade da sua populao condenada a uma subvida 10 perptua, estamos todos condenados a uma lgica do absurdo. Aqui o srio temerrio, o sensato insensato, o adulto irreal e o responsvel criminoso. A nossa estabilidade e o nosso prestgio com a comunidade financeira internacional se devem tenacidade com que homens honrados e capazes, resistindo a apelos emocionais, mantm uma poltica econmica solidamente fundeada na misria alheia e uma admirvel coerncia baseada na fome dos outros. O pas s vivel se metade da sua populao no for. (...)
(VERSSIMO, L. F. O Globo , 24/03/2000.)

4
1 0 Exame de Qualificao Vestibular Estadual 2001

4 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 05

(FERREIRA, A. B. de Holanda. Novo Dicionrio Aurlio de Lngua Portuguesa. Rio de Janeiro: Nova Fronteira, 1986.)

Considerando essa definio, pode-se concluir que o silogismo a que se refere o ttulo do texto encontrado em: (A) Boa parte da populao sobrevive com apenas um salrio-mnimo e o salrio-mnimo no d para viver; ento, h circunstncias que impedem o salrio de ser maior. (B) Precisamos manter nosso prestgio com a comunidade financeira internacional; temos homens honrados e capazes; ento, preciso resistir a apelos emocionais da sociedade. (C) Um salrio-mnimo maior prejudicaria o pas; o salrio-mnimo impe misria a grande parte da populao; ento, o pas necessita da misria de grande parte da sua populao. (D) O salrio mnimo no garante vida digna para a maioria da populao; o salrio no aumenta mais por exigncia do mercado internacional; ento, preciso alterar esse modelo econmico.

Questo 06 O texto apresenta um ponto de vista crtico, construdo, dentre outros, pelo recurso da ironia. A qualidade que constitui uma ironia, no texto, : (A) poltico (linha 04) (B) perptua (linha 10) (C) emocionais (linha 13) (D) admirvel (linha 14)

Questo 07 O encadeamento entre pargrafos um dos aspectos a serem observados na construo de textos argumentativos pode se fazer de maneiras diversas. No texto de Luiz Fernando Verssimo, o segundo pargrafo liga-se ao primeiro por meio do seguinte mecanismo: (A) retomada, por oposio, dos argumentos j apresentados (B) seqenciao, pelo emprego de conectivo, das idias discutidas (C) reafirmao, por uma tica diferenciada, das informaes j levantadas (D) extenso, por referncia a novos exemplos, das afirmaes da introduo

5
10 Exame de Qualificao Vestibular Estadual 2001

5 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

TEXT O II TEXTO
TROCA DE E-MAILS

Seguem abaixo trechos das mensagens de e-mail trocadas na tera-feira e ontem entre o VicePresidente Al Gore e o Governador George W. Bush, do Texas: Do: Sr. Gore Para: Sr. Bush Assunto: Campanha eleitoral Congratulaes por sua indicao partidria. Penso que as vitrias mtuas desta noite nos proporcionam uma chance rara para a mudana no modo de se conduzir campanhas eleitorais e de se restabelecer a confiana dos eleitores em nosso processo eleitoral. Assim sendo, eu o desafio a aceitar minha proposta de que ns dois rejeitemos o uso do chamado dinheiro fcil na veiculao de propaganda eleitoral. Eu darei o primeiro passo pedindo ao Comit Nacional Democrtico para no veicular nenhuma propaganda eleitoral no regulamentada atravs do uso de verbas de procedncia ignorada, a menos que o Partido Republicano passe a agir nesse sentido. Portanto, est nas mos do senhor e de seu partido o incio eventual de uma guerra acirrada de propaganda; o senhor tem o poder de unir-se a mim na proibio do "dinheiro fcil". Se o senhor estiver disposto a fazer a coisa certa, ns podemos mudar a poltica para sempre. Do: Sr. Bush Para: Sr. Gore Assunto: RE: Campanha eleitoral Obrigado por seu e-mail e seus cumprimentos. Eu o felicito tambm, e anseio por uma campanha que trate das questes importantes do nosso tempo a reforma educacional, a modernizao de nossas foras armadas e o resgate de padres de qualidade no nosso governo. O senhor e eu fizemos vrias propostas de reforma de financiamento de campanha. Mas antes de debatermos estas mudanas, importante que os americanos saibam se as leis de financiamento de campanha atuais foram obedecidas. Assim sendo, eu o desafio a esclarecer acusaes graves. Eu espero que o senhor interfira junto Casa Branca e ao Departamento de Justia para a liberao de todos os registros e fotos relativos investigao sobre abusos no financiamento da sua prpria campanha. Em seu e-mail, o senhor falou em restabelecer a confiana em nosso processo eleitoral. E isso o ponto central da questo. So necessrias novas leis de financiamento de campanha. O que at mesmo mais importante o dever dos funcionrios pblicos de obedecer s leis existentes, e eu receio que seu prprio histrico no inspire confiana. Agradeo seu e-mail. Esta sua Internet uma inveno maravilhosa.
(Traduzido do New York Times on line, 16/03/2000.)

6
1 0 Exame de Qualificao Vestibular Estadual 2001

6 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 08 O vice-presidente Gore prope em seu e-mail uma rejeio, de parte a parte, do chamado dinheiro fcil, usado de maneira no regulamentada na veiculao de propagandas eleitorais. O tom da mensagem-rplica do governador Bush reflete basicamente as seguintes atitudes: (A) crtica e desconfiana pela indicao do democrata Gore sucesso presidencial (B) animosidade e distanciamento do processo de moralizao da campanha eleitoral (C) ceticismo e ironia no tocante seriedade das palavras e intenes de seu oponente (D) ressentimento e desdm quanto s instrues dadas por Gore ao Comit Democrtico

Questo 09 O discurso poltico marcado por estratgias de distanciamento que ressaltam a autoridade do locutor, e por traos de solidariedade que buscam o envolvimento dos interlocutores. Tais procedimentos retricos so verificados em: (A) Eu espero que o senhor interfira junto Casa Branca... (B) Se o senhor estiver disposto a fazer a coisa certa, ns podemos mudar... (C) Eu darei o primeiro passo, pedindo ao Comit Nacional Democrtico... (D) Eu o felicito tambm, e anseio por uma campanha que trate das questes...

Questo 10 A mensagem-desafio de Al Gore tem como destinatrio o seu adversrio poltico, mas possvel interpretar que ela tenha sido tornada pblica propositalmente. Considerando o contedo da mensagem e o seu contexto, a melhor explicao para que Al Gore tenha desejado torn-la pblica : (A) provocar uma declarao desastrada de George Bush (B) contribuir para a moralizao da poltica atravs da Internet (C) acusar seu adversrio do uso de dinheiro ilcito na campanha (D) convencer o eleitor do carter desonesto do outro candidato

7
10 Exame de Qualificao Vestibular Estadual 2001

7 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

TEXT O III TEXTO


TICA PARA MEU FILHO (...)Veja: algum pode lamentar ter procedido mal mesmo estando razoavelmente certo de que no sofrer represlias por parte de nada nem de ningum. que, ao agirmos mal e nos darmos conta disso, compreendemos que j estamos sendo castigados, que lesamos a ns mesmos pouco ou muito - voluntariamente. No h pior castigo do que perceber que por nossos atos estamos boicotando o que na verdade queremos ser... De onde vm os remorsos? Para mim est muito claro: de nossa liberdade. Se no fssemos livres, no nos poderamos sentir culpados (nem orgulhosos, claro) de nada e evitaramos os remorsos. Por isso, quando sabemos que fizemos algo vergonhoso procuramos afirmar que no tivemos outro remdio seno agir assim, que no pudemos escolher: cumpri ordens de meus superiores, vi que todo o mundo fazia a mesma coisa, perdi a cabea, mais forte do que eu, no percebi o que estava fazendo, etc. Do mesmo modo, quando o pote de gelia que estava em cima do armrio cai e quebra, a criana pequena grita chorosa: No fui eu!. Grita exatamente porque sabe que foi ela ; se no fosse assim, nem se daria ao trabalho de dizer nada, ou talvez at risse e pronto. Em compensao, ao fazer um desenho muito bonito essa mesma criana ir proclamar: Fiz sozinho, ningum me ajudou! Do mesmo modo, ao crescermos, queremos sempre ser livres para nos atribuir o mrito do que realizamos, mas preferimos confessar-nos escravos das circunstncias quando nossos atos no so exatamente gloriosos.
(SAVATER, Fernando. tica para meu filho.Trad. Monica Stahel. So Paulo: Martins Fontes, 1997. Traduo de: tica para Amador.)

Questo 11 O texto acima faz parte de um ensaio filosfico sobre tica, no qual o autor expe seus argumentos em tom de conversa. Essa estratgia tem o seguinte objetivo: (A) provocar a resposta direta do interlocutor (B) ressaltar uma discusso terica entre iguais (C) diminuir a assimetria entre o filsofo e o leitor (D) revelar opinies compartilhadas pelos interlocutores Questo 12 O leitor do texto III construdo por meio de um jogo com os pronomes. Esse jogo reconhecido pelo emprego de: (A) eu, em diferentes momentos do texto, que identifica ora o leitor, ora o autor, ora a ambos (B) ns, que inclui o autor e outras pessoas, combinado a um eu que torna o leitor responsvel pelo enunciado (C) eu e voc, alternadamente, como numa conversa, combinado presena de ele, que o prprio leitor (D) voc, a quem o autor se dirige em especial, e de ns, que inclui o autor, o leitor e outros seres humanos

8
1 0 Exame de Qualificao Vestibular Estadual 2001

8 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 13 Ao trazer para seu texto a citao de outras falas - por meio do emprego das aspas , o autor obtm o seguinte efeito: (A) valoriza o argumento das outras falas (B) delimita o que defendido e o que atacado (C) identifica um embate como reforo do campo da sinceridade (D) destaca a palavra dos outros como argumento de autoridade

TEXT O IV TEXTO

INTERNET EST MERC DE QUALQUER UM !


Em 7 de fevereiro, o portal americano Yahoo! foi a primeira vtima de uma srie de ataques. Damien Bancal, especialista em pirataria e responsvel por um dos melhores sites franceses dedicados a esse assunto, Taz (www.zataz.com), no acredita que os piratas estejam na origem do ataque. Mas ele destaca a extrema vulnerabilidade da Internet. Le N ouv el O bser vateur Os comentrios falam de ciberterrorismo, embora no tenha havido Nouv ouvel Obser bserv saque propriamente dito. O que aconteceu realmente? ancal At o momento, tinha-se assistido principalmente a incidentes isolados (...) Damien B Bancal Esta onda de ataques muito mais impressionante porque os sites foram bombardeados numa extenso indita. como se 50 milhes de pessoas tivessem me telefonado ao mesmo tempo para me desejar Feliz Dia dos Namorados: minha central telefnica teria explodido. N. O. Uma das hipteses atribui os fatos a um pirata isolado. Outras acusam as empresas de segurana de informtica e, at mesmo, o governo americano, que deseja impor uma ciberpolcia... D. B ancal Se isso obra de um pirata isolado, ele um gnio que dispe de meios Bancal impressionantes. No acredito nisso. Para o ano novo, esperava-se a grande peste, um desafio lanado por um russo a todos os outros piratas do planeta. Talvez essa peste tenha chegado com atraso... mas ainda continuo descrente. Pois se os autores so hackers, eles planejaram as aes com muito tempo de antecedncia. O mais desconcertante a ausncia de assinatura. Os piratas geralmente tm sede de reconhecimento. Nesse caso, no h nenhuma reivindicao. Fala-se tambm de uma operao conduzida pelos concorrentes das vtimas. Seria suicdio: abalar a imagem da rede como dar um tiro no prprio p... Eu acho, na verdade, que esses ataques podem ser responsabilidade das empresas especializadas em segurana, pois preciso ter um poder de fogo colossal [NR: as aes dessas empresas deram um salto na Bolsa no dia seguinte]. Entrevistador: Stphane Arteta
(Traduzido de Le Nouvel Observateur, du 17 au 23 fvrier 2000 )

9
10 Exame de Qualificao Vestibular Estadual 2001

9 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 14 A caracterstica do texto IV que mais contribui para causar no leitor a impresso de uma transcrio exata do que foi dito a seguinte: (A) utilizao do discurso direto (B) introduo sobre o assunto (C) incluso de Nota de Redao (D) indicao de marcas temporais

Questo 15 A primeira pergunta de Stphane Arteta solicita a explicao de um fato. Para respond-la de forma clara, Damien Bancal utiliza basicamente o seguinte recurso: (A) deduo (B) suposio (C) comparao (D) quantificao

Questo 16 Damien Bancal rejeita a primeira hiptese indicada pelo entrevistador. Para justificar sua opinio, utiliza uma estratgia argumentativa dividida em trs momentos: 1 - parte do princpio de que a hiptese do entrevistador seria vlida; 2 - deduz uma hiptese improvvel; 3 - manifesta sua opinio discordante. A alternativa que apresenta um exemplo do 2 momento desse raciocnio : (A) ... mas ainda continuo descrente. (B) Para o ano novo esperava-se a grande peste... (C) O mais desconcertante a ausncia de assinatura. (D) ... ele um gnio que dispe de meios impressionantes.

10
1 0 Exame de Qualificao Vestibular Estadual 2001

10 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

TEXT OV TEXTO

05

Na contramo do vento que move as comemoraes dos 500 anos, uma programao alternativa est deixando de lado a caravela para se embrenhar no Brasil de antes de Cabral. E est dando ao ndio lugar de destaque na festa. As atividades incluem encontros com integrantes de tribos variadas, debates e uma exposio com trabalhos do fotgrafo Sebastio Salgado e textos do poeta Thiago de Mello. Desde o incio da semana, no foyer do Centro Cultural Banco do Brasil, crianas de diferentes idades vm aprendendo histria e deixando preconceitos de lado com a ajuda de Thini- um ndio de 29 anos, da tribo fulni-, de Pernambuco, que abandonou a aldeia ainda menino aps uma invaso de terra em que perdeu vrios parentes. Do massacre nasceu o desejo de falar aos pequenos homens brancos os filhos da elite, como dizia e impedir conflitos futuros. H trs anos Thini- percorre escolas do Rio (...). Fala das tribos e da memria de seus ancestrais, apresenta danas e ritos, mostra arcos, flechas e seduz o pblico com a fala mansa e um timo humor. Agora, como centro dos 500 Anos de Resistncia das Populaes Indgenas no Brasil, organizado pela Cineduc: Cinema e Educao, ele fala para mais crianas e adultos.As comemoraes dos 500 anos, de certa forma, at expem a cultura indgena, mas de maneira muito romntica. Essa atividade pretende desmistificar isso e deixar uma semente para que o contato com a cultura indgena continue e se torne corriqueiro, diz Ricardo Paes, coordenador do projeto. (...)
(S, Ftima.Veja, 22/03/2000.)

10

15

Questo 17 O subttulo do texto - Histrias de um Brasil com mais de 500 anos - construdo de modo a anunciar o carter alternativo e mesmo crtico do evento que ser comentado. O emprego da palavra ou expresso com essa finalidade est corretamente justificado em : (A) Histrias, no plural, revela que um discurso oficial, nem sempre verdadeiro, predomina na sociedade (B) um, referindo-se ao nome Brasil, demonstra que a indefinida identidade social do pas formada pelo encontro de trs raas (C) mais de, antecedendo a expresso 500 anos, contesta a prioridade dada chegada do colonizador para a constituio do Brasil (D) 500 anos, expresso ligada ao nome Brasil, indica a necessidade de uma reflexo mais cuidadosa acerca de alguns dos marcos histricos do pas

11
10 Exame de Qualificao Vestibular Estadual 2001

11 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 18 Na construo comemoraes dos 500 anos, a expresso sublinhada mantm com o termo ncleo comemoraes a mesma relao sinttica verificada em: (A) uma invaso de terra (B) Brasil de antes de Cabral (C) crianas de diferentes idades (D) deixando preconceitos de lado Questo 19 O presente do indicativo um tempo verbal que pode ser empregado com valores diversos. Dos trechos transcritos, aquele em que o emprego do presente do indicativo est corretamente explicado : (A) ... do vento que move as comemoraes dos 500 anos... (linha 1) atualiza passado histrico (B) Fala das tribos e da memria de seus ancestrais... (linhas 10 e 11 ) demonstra ao habitual (C) Essa atividade pretende desmistificar isso... (linha 15) marca futuro prximo (D) ... diz Ricardo Paes, coordenador do projeto. (linha 17) expressa ao simultnea Questo 20 A linguagem figurada, conhecida caracterstica de textos literrios, encontra-se tambm em outros tipos de texto. Verifica-se um exemplo de metonmia no seguinte fragmento da reportagem: (A) ... apresenta danas e ritos, mostra arcos, flechas... (B) ... expem a cultura indgena, mas de maneira muito romntica... (C) ... uma programao alternativa est deixando de lado a caravela... (D) ...e deixar uma semente para que o contato com a cultura indgena continue... TEXT O VI TEXTO
Certo milionrio brasileiro foi trado pela esposa. Quis gritar, mas a infiel disse-lhe sem medo: Eu no amo voc, nem voc a mim. No temos nenhum amor a trair. O marido baixou a cabea. Doeu-lhe, porm, o escndalo. Resolveu viajar para a China, certo de que a distncia o esquecimento. Primeiro, andou em Hong Kong. Um dia, apanhou o automvel e correu como um louco. Foi parar quase na fronteira com a China. Desce e percorre, a p, uma aldeia miservel. Viu, por toda a parte, as faces escavadas da fome. At que entra na primeira porta. Tinha sede e queria beber. Olhou aquela misria abjeta. E, sbito, v surgir, como num milagre, uma menina linda, linda. Aquela beleza absurda, no meio de sordidez tamanha, parecia um delrio. O amor comeou ali. Um amor que no tinha fim, nem princpio, que comeara muito antes e continuaria muito depois. No houve uma palavra entre os dois, nunca. Um no conhecia a lngua do outro. Mas, pouco a pouco, o brasileiro foi percebendo esta verdade: - so as palavras que separam. Durou um ano o amor sem palavras. Os dois formavam um maravilhoso ser nico. At que, de repente, o brasileiro teve que voltar para o Brasil. Foi tambm um adeus sem palavras. Quando embarcou, ele a viu num junco que queria seguir o navio eternamente. Ele ficou muito tempo olhando. Depois no viu mais o junco. A menina no voltou. Morreu s, to s. Passou de um silncio a outro silncio mais profundo.

12

(RODRIGUES, Nelson. A cabra vadia: novas confisses. So Paulo: Companhia das Letras, 1995.)

1 0 Exame de Qualificao Vestibular Estadual 2001

12 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 21 H uma contradio aparente entre as passagens um amor que no tinha fim e durou um ano o amor sem palavras. Essa aparente contradio se desfaz se procurarmos interpretar o texto relacionando-o aos seguintes versos da poesia brasileira: (A) quando o amor tem mais perigo quando ele sincero (Cacaso) (B) Que no seja imortal, posto que chama Mas que seja infinito enquanto dure (Vincius de Morais) (C) e se te fujo que te adoro louco s bela eu moo; tens amor eu medo!... (Casimiro de Abreu) (D) no pois todo amor alvo divino, e mais aguda seta que o destino? (Carlos Drummond de Andrade) Questo 22 A esposa do milionrio convenceu o marido. Para apresentar o seu argumento de uma forma completa, ela poderia utilizar a seguinte construo: (A) Toda traio envolve outro amor; ora, eu amo outro; logo, eu no amo voc. (B) S se trai a quem se ama; ora, eu no te amava nem voc me amava; logo, eu no te tra. (C) Na dvida entre o amor e a traio eu escolhi, como mulher, o amor; logo, voc no se deve sentir trado. (D) Como voc no me amava nem eu a voc, ningum tem culpa dessa traio; logo, cada um deve seguir a sua vida. Questo 23 O pequeno conto de Nelson Rodrigues narra o improvvel encontro entre um milionrio brasileiro e uma menina miservel do interior da China. O carter improvvel desse encontro pode ser lido como uma metonmia que tem funo central na constituio do sentido do texto. Essa funo a de: (A) revelar as obsesses do autor (B) marcar as repeties da narrativa (C) negar um amor para afirmar outro (D) ressaltar a dificuldade dos encontros amorosos Questo 24 O narrador de um conto assume determinados pontos de vista para conduzir o seu leitor a observar o mundo sob perspectivas diversificadas. No conto de Nelson Rodrigues, a narrativa busca emocionar o leitor por meio do seguinte recurso: (A) expressa diretamente o ponto de vista do personagem milionrio (B) expressa de maneira indireta o ponto de vista da personagem chinesa (C) alterna o ponto de vista do personagem milionrio com o do narrador (D) alterna o ponto de vista do personagem milionrio com o da personagem chinesa
10 Exame de Qualificao Vestibular Estadual 2001

13

13 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

ESPANHOL LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Vivimos una poca de declinacin de la autoridad parental. Lo que se ha llamado la cada de los ideales, el fin de los grandes relatos de la modernidad, ha tenido consecuencias en la estructura del grupo familiar. La moral victoriana, que se sostena en valores como austeridad, privacin, sacrificio y sobre todo represin para hablar de la sexualidad, se fue derrumbando a lo largo del siglo pasado. Seguramente, ahora se hacen las mismas cosas que en esa poca, la diferencia es que en nuestros tiempos se puede decir todo y se puede ver todo. Esta aparente democratizacin va bien con la lgica del mercado: hablar hasta no hace mucho tiempo tena consecuencias, al extremo que poda costar la vida. Actualmente, hablar no slo no tiene consecuencias sino que alimenta los medios de comunicacin (talk-show, reality-show, etc.), cualquiera puede decir cualquier cosa y, sin embargo, todo sigue igual. Hemos pasado de la ilusin en ideales de progreso, de cambio, que se sostenan en restricciones, privaciones, sacrificios, a una hiperabundancia de palabras y objetos, pero sin ilusin. Esto implica que la supuesta libertad, que se juega en ciertos mbitos familiares, no conlleva un menor padecimiento que en otra poca. Los nios desafiantes, demandantes, saturados de juguetes descartables y hamburgesas, precoces y tenaces consumidores, no por eso son ms felices, ni tienen garantizada la va del deseo. El psicoanlisis tiene muy en cuenta estas nuevas formas de la infancia, como tambin las nuevas modalidades en la adolescencia: anorexia y bulimia, drogas, alcohol, violencia, etc. La creencia en que la liberacin de las restricciones dar un futuro ms promisorio se ha cado como el Muro de Berln.
* PSICOANALISTA (NOTICIAS, 25 de marzo del 2000)

Questo 25 Considerando las caractersticas del texto, se puede identificar su objetivo comunicativo principal como: (A) orientar hacia determinados comportamientos (B) elucidar un punto de vista respecto a cierto tema (C) dar a conocer un testimonio basado en la experiencia (D) narrar los hechos sucedidos en determinado momento Questo 26 ... hablar hasta no hace mucho tiempo tena consecuencias, ... Se puede sustituir el fragmento subrayado, mantenindose su sentido bsico, por: (A) lo que se hablara (B) hace poco hablar (C) hablar para muchos (D) hablar aunque poco

14
1 0 Exame de Qualificao Vestibular Estadual 2001

14 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

ESPANHOL LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS


Questo 27 La accin reflexiva se caracteriza por indicar que hay una coincidencia entre quien la practica y quien la sufre. El fragmento que expone tal sentido es: (A) Lo que se ha llamado... (B) Seguramente, ahora se hacen... (C) ... en nuestros tiempos se puede decir... (D) La moral victoriana, que se sostena en... Questo 28 El ttulo El otro muro de Berln informa al lector que se est estableciendo una relacin metafrica con el hecho histrico de la cada del muro de la ciudad alemana. La alternativa que aclara el sentido de esa metfora es: (A) se perdi la ilusin en los grandes relatos de la modernidad (B) se debilit la creencia en el xito de la liberacin de los jvenes (C) se descart la lgica del mercado pregonera de la liberacin de principios (D) se refut la idea de la preservacin de ciertos valores austeros y represivos

15
10 Exame de Qualificao Vestibular Estadual 2001

15 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

INGLS LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

BUENA VISTA SOCIAL CLUB (G, 101 minutes) In this charming documentary, German director Wim Wenders chronicles his friend Ry Cooders successful attempt to persuade a lost generation of legendary Cuban musicians to make a comeback album called Buena Vista Social Club. It sold more than a million copies. Between the beats of this so-called son music, you can feel a touching camaraderie among the musicians, including 80-year-old pianist Ruben Gonzalez and Ibrahim Ferrer, aka The Nat King Cole of Cuba, whose soft, 70-year-old voice will slay anyone with an appreciation of fine music. When the band makes its final appearance on the Carnegie stage, to the sweetly mournful strains of Quizs, Quizs, Quizs, you realize youre hooked on these musicians for life. In Spanish and English with subtitles. Contains nothing objectionable except mildly risqu lyrics. Arlington Cinema N Drafthouse.
(Washington Post on line www.washingtonpost.com. March 24, 2000)

Questo 25 The film, mentioned above, is now playing at local theaters nationwide. As far as communicative intentions are concerned, the text above is best characterized as: (A) a summary of the virtuosity of legendary Cuban performers (B) an account of the evolution of Cuban finest music and bands (C) a review of the screen performance of old-time Cuban artists (D) a description of the tropical rhythm of famous Cuban composers Questo 26 When the band makes its final appearance on the Carnegie stage, to the sweetly mournful strains of Quizs, Quizs, Quizs, you realize youre hooked on these musicians for life. The best paraphrase for the underlined clause is: (A) youll hardly ever forget them (B) youll never get close to them (C) you'll always be dependent on them (D) you'll be forever in love with them Questo 27 Nouns in English can be preceded by words of various grammatical classes. The construction which does not contain a typical instance of adjectival modification is: (A) ... comeback album ... (B) ... German director ... (C) ... successful attempt ... (D) ... charming documentary ...

18
1 0 Exame de Qualificao Vestibular Estadual 2001

16 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

INGLS LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS


Questo 28 From the excerpts below, those which signal absence of restriction on theater admission are: (A) ... 101 minutes ... ... to persuade a lost generation of legendary Cuban musicians... (B) ... G ... Contains nothing objectionable except mildly risqu lyrics. (C) ... aka The Nat King Cole of Cuba... ... anyone with an appreciation of fine music. (D) In Spanish and English with subtitles. ... N ...

19
10 Exame de Qualificao Vestibular Estadual 2001

17 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS Questo 29

(Galileu Galilei)

Com base neste conhecimento, Galileu, antes mesmo de realizar seu famoso experimento da torre de Pisa, afirmou que uma pedra leve e outra pesada, quando abandonadas livremente de uma mesma altura, deveriam levar o mesmo tempo para chegar ao solo. Tal afirmao um exemplo de: (A) lei (B) teoria (C) modelo (D) hiptese Questo 30 O modelo astronmico heliocntrico de Kepler, de natureza geomtrica, foi construdo a partir dos cinco poliedros de Plato, inscritos em esferas concntricas, conforme ilustra a figura abaixo:

(KEPLER, J. Dissertatio e Narratio. Turim: Bottega d'Erasmo, 1972.)

A razo entre a medida da aresta do cubo e a medida do dimetro da esfera a ele circunscrita, : (A) 3 (B)
3 2

(C) 3
3 3 (D) 4

20
1 0 Exame de Qualificao Vestibular Estadual 2001

18 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 31 O diagrama abaixo mostra a classificao dos seres vivos em cinco reinos, considerando a combinao de trs critrios: nmero de clulas, existncia de ncleo individualizado na clula e forma de nutrio.

(Adaptado de SOARES, J. L. Biologia. So Paulo: Scipione, 1997.)

A proposio que rene adequadamente dois dos critrios de classificao dos seres vivos utilizados no diagrama : (A) existem eucariontes unicelulares (B) existem procariontes pluricelulares (C) no existem procariontes unicelulares (D) no existem eucariontes pluricelulares

Questo 32 Os medicamentos atualmente conhecidos como genricos apresentam, em sua composio, substncias equivalentes s das marcas tradicionais, com preos mais baixos. Para estimular o crescimento das crianas, recomenda-se a ingesto de comprimidos que contm 2,43 x 10-2 g de ZnO, por comprimido. O medicamento genrico utilizado em substituio ao comprimido tradicional apresenta a seguinte composio:
Soluo aquosa de ZnSO4 de concentrao igual a 0,10 mol . L-1

Para a ingesto da mesma massa de Zn+2 contida em um comprimido, o volume necessrio da soluo de ZnSO4, em mL, corresponde a: (A) 1,5 (B) 3,0 (C) 15,0 (D) 30,0

21
10 Exame de Qualificao Vestibular Estadual 2001

19 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 33 Suponha que uma pessoa precise de 2400 kcal/dia para suprir suas necessidades de energia. Num determinado dia, essa pessoa, alm de executar suas atividades regulares, caminhou durante uma hora. A energia gasta nessa caminhada a mesma necessria para produzir um aumento de temperatura de 80 C em 3 kg de gua. Considere o calor especfico da gua igual a 1 cal/gC. A necessidade de energia dessa pessoa, no mesmo dia, em kcal, equivalente a: (A) 2480 (B) 2520 (C) 2600 (D) 2640 Questo 34 O grfico abaixo representa o consumo de oxignio de uma pessoa que se exercita, em condies aerbicas, numa bicicleta ergomtrica. Considere que o organismo libera, em mdia, 4,8 kcal para cada litro de oxignio absorvido.

A energia liberada no perodo entre 5 e 15 minutos, em kcal, : (A) 48,0 (B) 52,4 (C) 67,2 (D) 93,6 Questo 35 Em tneis muito extensos, existem placas orientando os motoristas a desligarem seus carros em caso de engarrafamento, pois a combusto incompleta que ocorre nos motores produz um gs extremamente txico para o organismo humano. Tal medida visa a evitar, principalmente, o aumento da concentrao desse gs. A alternativa que combina corretamente a frmula do gs e dois dos sistemas vitais atingidos pelo aumento de sua concentrao : (A) CO circulatrio e nervoso (B) O2 respiratrio e nervoso (C) CO2 circulatrio e endcrino (D) N2 respiratrio e endcrino

22
1 0 Exame de Qualificao Vestibular Estadual 2001

20 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 36 Considerando a hiptese de que o controle da respirao pelo sistema nervoso teria uma base qumica, o fisiologista J. S. Haldane realizou, em 1905, um experimento para testar qual dos gases presentes no sangue afetava o centro respiratrio. Analise os dados das tabelas abaixo, que representam os resultados de seu experimento.

(BAKER & ALLEN. Estudo da Biologia. So Paulo: Edgar Blcher, 1975.)

A alterao percebida por Haldane est expressa na seguinte afirmativa: (A) O volume do ar inspirado diminui quando a concentrao do oxignio diminui. (B) A freqncia mdia da respirao dobra quando a concentrao de oxignio aumenta. (C) O volume do ar inspirado aumenta quando a concentrao de dixido de carbono aumenta. (D) A freqncia mdia da respirao dobra quando a concentrao de dixido de carbono diminui.

Questo 37 Considere que, no sangue, as molculas de hemoglobina e de gs oxignio dissolvido esto em equilbrio com a oxiemoglobina, de acordo com equao abaixo:

Em grandes altitudes, quando o ar se torna rarefeito, essa posio de equilbrio alterada, causando distrbios orgnicos. A combinao correta entre o fator cuja variao responsvel pelo deslocamento do equilbrio e o sentido desse deslocamento, indicado na equao, : (A) concentrao de oxignio; 1 (B) concentrao de oxignio; 2 (C) temperatura ambiente; 1 (D) temperatura ambiente; 2

23
10 Exame de Qualificao Vestibular Estadual 2001

21 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 38 Os ces conhecem seus donos pelo cheiro. Isso se deve ao fato de os seres humanos apresentarem, junto pele, glndulas que produzem e liberam cidos carboxlicos. A mistura desses cidos varia de pessoa para pessoa, o que permite a animais de faro bem desenvolvido conseguir discrimin-la. Com o objetivo de testar tal discriminao, um pesquisador elaborou uma mistura de substncias semelhantes produzida pelo dono de um co. Para isso, ele usou substncias genericamente representadas por: (A) RCHO (B) RCOOH (C) RCH2OH (D) RCOOCH3

Utilize a definio e o grfico abaixo para responder questo de nmero 39. Meia-vida ou perodo de semidesintegrao de um istopo radioativo o tempo necessrio para que sua massa se reduza metade.

Questo 39 A meia-vida de um istopo radioativo pode ser calculada utilizando-se equaes do tipo A = C . e kt, em que: C a massa inicial; A a massa existente em t anos; k uma constante associada ao istopo radioativo. Em um laboratrio, existem 60 mg de 226Ra, cujo perodo de semidesintegrao de 1600 anos. Daqui a 100 anos restar, da quantidade original desse istopo, o correspondente, em mg, a: (A) 40,2 (B) 42,6 (C) 50,2 (D) 57,6

24
1 0 Exame de Qualificao Vestibular Estadual 2001

22 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 40 Na maioria dos casos, a energia de um ecossistema origina-se da energia solar. A figura abaixo mostra alguns seres componentes do ecossistema de um lago.

(Adaptado de BAKER & ALLEN. Estudo da Biologia. So Paulo: Edgar Blcher, 1975.)

Considere que, no lago, existam quatro diferentes espcies de peixes. Cada uma dessas espcies se alimenta exclusivamente de um dos quatro componentes indicados. O peixe que teria melhores condies de desenvolvimento, em funo da disponibilidade energtica, seria o que se alimentasse de: (A) algas (B) insetos (C) coppodes (D) crustceos

Questo 41 Para a remoo do leo derramado na Baa de Guanabara, um dos processos utilizados consistiu na adio de um produto semelhante serragem que, aps a aplicao, facilmente recolhido, podendo ser despejado em aterros sanitrios. A funo desse produto, em relao ao leo derramado, de favorecer a: (A) solubilizao (B) evaporao (C) disperso (D) absoro

25
10 Exame de Qualificao Vestibular Estadual 2001

23 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 42 Para o tratamento da acidez estomacal, recomenda-se a ingesto de anticidos que contenham hidrxido de alumnio em sua formulao. A funo dessa substncia neutralizar o excesso do cido produzido pelo estmago. Os produtos da reao de neutralizao total entre o hidrxido de alumnio e o cido do estmago so gua e um sal, cuja frmula est contida na seguinte alternativa: (A) A! C! (B) A! C!3 (C) A! SO4 (D) A!2 (SO4)3
Com base no texto abaixo, responda s questes de nmeros 43 e 44. O balano de clcio a diferena entre a quantidade de clcio ingerida e a quantidade excretada na urina e nas fezes. usualmente positivo durante o crescimento e a gravidez e negativo na menopausa, quando pode ocorrer a osteoporose, uma doena caracterizada pela diminuio da absoro de clcio pelo organismo. A baixa concentrao de on clcio (Ca++) no sangue estimula as glndulas paratireides a produzirem hormnio paratireideo (HP). Nesta situao, o hormnio pode promover a remoo de clcio dos ossos, aumentar sua absoro pelo intestino e reduzir sua excreo pelos rins.
(Adaptado de ALBERTS, B. et al., Biologia Molecular da Clula. Porto Alegre: Artes Mdicas, 1997.)

Questo 43 O grfico que melhor pode expressar a relao entre a produo do hormnio pelas paratireides e a concentrao de on clcio no sangue, :

(A)

(B)

(C)

(D)

26
1 0 Exame de Qualificao Vestibular Estadual 2001

24 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 44 Admita que, a partir dos cinqenta anos, a perda da massa ssea ocorra de forma linear, conforme mostra o grfico abaixo.

(Adaptado de Galileu, janeiro de 1999)

Aos 60 e aos 80 anos, as mulheres tm, respectivamente, 90% e 70% da massa ssea que tinham aos 30 anos. O percentual de massa ssea que as mulheres j perderam aos 76 anos, em relao massa aos 30 anos, igual a: (A) 14 (B) 18 (C) 22 (D) 26 Questo 45 O grfico abaixo mostra a relao entre a velocidade de crescimento da clula e seu ciclo de diviso celular, em um organismo de vida livre, como a levedura, em condies favorveis de nutrio.

Foi testada, experimentalmente, a mesma relao em condies desfavorveis de nutrio, obtendo-se o resultado expresso no grfico abaixo:

(Adaptado de ALBERTS, B. et al., Biologia Molecular da Clula. Porto Alegre: Artes Mdicas, 1997.)

Quanto reao dessas leveduras a condies desfavorveis de nutrio, podem-se perceber as seguintes conseqncias, respectivamente, em relao maior massa atingida pela clula e durao do ciclo de diviso celular: (A) diminui diminui (B) diminui no se altera (C) aumenta no se altera (D) no se altera aumenta

27
10 Exame de Qualificao Vestibular Estadual 2001

25 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 46

(Adaptado de LARSON, Gary. The Far Side. New York: Andrews and McMeel Inc., 1984.)

Nessa charge, a estranha sensao do personagem indica o desconhecimento do conceito de: (A) energia cintica (B) momento de fora (C) velocidade angular (D) centro de gravidade Questo 47 A figura abaixo mostra um anteparo parablico que representado pela funo
f(x) = 3 2 x + 2 3x . 3

Uma bolinha de ao lanada da origem e segue uma trajetria retilnea. Ao incidir no vrtice do anteparo refletida e a nova trajetria simtrica inicial, em relao ao eixo da parbola. O valor do ngulo de incidncia corresponde a: (A) 30 (B) 45 (C) 60 (D) 75

28
1 0 Exame de Qualificao Vestibular Estadual 2001

26 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 48 Observe a estrutura genrica representada abaixo.


H H O O

Para que o composto esteja corretamente representado, de acordo com as ligaes qumicas indicadas na estrutura, x dever ser substitudo pelo seguinte elemento: (A) fsforo (B) enxofre (C) carbono (D) nitrognio

Com base no texto abaixo, responda s questes de nmeros 49 e 50.


Observo uma pedra que cai de uma certa altura a partir do repouso e que adquire, pouco a pouco, novos acrscimos de velocidade (...) Concebemos no esprito que um movimento uniforme e, do mesmo modo, continuamente acelerado, quando, em tempos iguais quaisquer, adquire aumentos iguais de velocidade (...) O grau de velocidade adquirido na segunda parte de tempo ser o dobro do grau de velocidade adquirido na primeira parte.
(GALILEI, Galileu. Duas Novas Cincias. So Paulo: Nova Stella Editorial e Ched Editorial, s. d.)

Questo 49 A grandeza fsica que constante e a que varia linearmente com o tempo so, respectivamente: (A) acelerao e velocidade (B) velocidade e acelerao (C) fora e acelerao (D) acelerao e fora

Questo 50 Suponha que, durante o ltimo segundo de queda, a pedra tenha percorrido uma distncia de 45 m. Considerando g = 10 m/s2 e que a pedra partiu do repouso, pode-se concluir que ela caiu de uma altura, em metros, igual a: (A) 105 (B) 115 (C) 125 (D) 135

29
10 Exame de Qualificao Vestibular Estadual 2001

27 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 51 Os 4,5 bilhes de anos de existncia da Terra podem ser reduzidos a apenas 1 ano, adotando-se a seguinte escala:
1 minuto = 9 . 103 anos

Desse modo, se o aparecimento dos primeiros mamferos se deu em 16 de dezembro, os primeiros primatas surgem em 25 de dezembro. Utilizando-se a escala, a ordem de grandeza, em sculos, entre estas duas datas igual a: (A) 108 (B) 106 (C) 104 (D) 102

Com base no grfico abaixo, responda s questes de nmeros 52 e 53.


O grfico abaixo representa a indicao da velocidade de um carro em movimento, em funo do tempo.

Questo 52 Sabendo-se que, em t = 2 s, a velocidade de 6 m/s, a ordenada do ponto A : (A) 3,5 (B) 3,0 (C) 2,5 (D) 2,0 Questo 53 O deslocamento do carro entre os instantes 4 s e 10 s, em metros, igual a: (A) 150 (B) 172 (C) 110 (D) 150
1 0 Exame de Qualificao Vestibular Estadual 2001

30

28 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 54 Um tcnico de laboratrio, suspeitando de uma desigualdade no tamanho dos braos x e y de sua balana, adota o procedimento abaixo para estabelecer com preciso o valor de um peso P: 1 - coloca P no prato esquerdo da balana e o equilibra com um peso conhecido Q

2 - coloca P no prato direito da balana e o equilibra com um peso conhecido R

Dessa forma, o tcnico conclui que o valor preciso de P, em funo de R e Q, determinado pela seguinte relao: (A) (B)
R Q

R Q

(C) RQ (D) RQ Questo 55 Os vrios componentes do petrleo so separados por um processo denominado destilao fracionada. Em sua destilao, alguns hidrocarbonetos so separados na ordem indicada no esquema abaixo.

(Adaptado de SILVA, R. H. & SILVA, E. B. Curso de Qumica. So Paulo: Harbra, 1992.)

A ordem de destilao desses componentes do petrleo est justificada pela seguinte afirmao: (A) Os alcanos so os hidrocarbonetos mais volteis. (B) Os hidrocarbonetos so lquidos de baixo ponto de ebulio. (C) O aumento da massa molar dos hidrocarbonetos provoca uma maior volatilidade. (D) O ponto de ebulio dos hidrocarbonetos aumenta com o aumento da massa molar.
10 Exame de Qualificao Vestibular Estadual 2001

31

29 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 56 Feixes de partculas ou de radiao podem ser utilizados na terapia de cncer. A destruio de um tumor no organismo humano se d pela transferncia de uma certa quantidade de energia do feixe, denominada dose, para as clulas do tecido doente. O grfico abaixo mostra como varia a dose fornecida por diferentes feixes, em funo da profundidade de um tecido penetrado.

(Adaptado de publicao do Loma Linda University Medical Center, Batavia, s. d.)

Considere que, para os valores das doses apresentadas no grfico, a eficincia do tratamento seja tanto maior quanto maior for a intensidade da dose na regio do tumor. Caso o tumor a ser tratado esteja localizado a uma profundidade de 21 cm, a melhor escolha para o tratamento envolve uma fonte de energia de: (A) raios X (B) cobalto (C) eltrons (D) prtons

32
1 0 Exame de Qualificao Vestibular Estadual 2001

30

CINCIAS HUMANAS E SUAS TECNOLOGIAS Questo 57 Observe a charge de Ricardo Goulart, referente poltica econmica empreendida no perodo dos governos militares no Brasil (1964/1985).

(BOCAYUVA, P. C. C. & VEIGA, S. M. (orgs). Afinal, que pas este? Rio de Janeiro: DP&A, 1999.)

A mensagem da charge est fundamentada na seguinte crtica poltica econmica do perodo citado: (A) a poltica financeira no estimulou a desejada acumulao de capitais (B) a ao do Estado no promoveu crescimento acelerado da economia (C) o dficit da balana comercial no permitiu melhor repartio da riqueza (D) o crescimento econmico no garantiu uma distribuio de renda mais justa Questo 58
(...) O consumo nacional de derivados de petrleo acusa uma ascenso regular, que traduz o desenvolvimento das atividades do pas, no s quanto ao transporte mas tambm quanto indstria. No entanto, (...) essa ascenso constante do consumo implica necessariamente um aumento das importaes, com dispndios crescentes de divisas, que podero ser empregadas na compra de outras utilidades estrangeiras, quando o permitir a produo brasileira de leo mineral (...).
(DEL PRIORE, Mary et alli (orgs). Documentos de Histria do Brasil: de Cabral aos anos 90. So Paulo: Scipione, 1997.)

O texto acima parte da mensagem enviada por Getlio Vargas ao Congresso Nacional, em 1951, propondo a criao da Petrobrs. A leitura do texto permite concluir que o principal objetivo da Petrobrs era: (A) ampliar a exportao de petrleo, obtendo mais divisas para a economia nacional (B) aumentar a produo petrolfera, garantindo recursos para o desenvolvimento industrial (C) incentivar a construo de rodovias, objetivando o aumento do consumo de petrleo e derivados (D) desenvolver a pesquisa petroqumica, gerando autonomia para o setor de produo de petrleo

33
10 Exame de Qualificao Vestibular Estadual 2001

31 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 59

(HENDERSON, W. O. A revoluo industrial. So Paulo: Verbo / Edusp, 1979.)

As ilustraes acima representam dois momentos do processo de transformao da indstria nos sculos XVIII e XIX. Duas caractersticas que diferenciam o segundo momento do primeiro esto indicadas em: (A) aumento na escala produtiva / diviso do trabalho na fbrica (B) ampliao do local de trabalho / proibio do trabalho infantil (C) avano da mecanizao / controle estatal dos meios de produo (D) reduo da jornada de trabalho / desconcentrao espacial da indstria

Questo 60 As grandes instituies financeiras internacionais influenciam fortemente as definies das polticas econmicas dos pases perifricos. Na charge abaixo, faz-se uma crtica a essa situao.

(LAERTE. O tamanho da coisa. So Paulo: Circo Editorial / Obor,1985.)

A crtica sugere que, atualmente, nas relaes internacionais, h uma aparncia de: (A) expanso das trocas comerciais reforando a ordem multipolar (B) autonomia poltica convivendo com imposies econmicas centralizadas (C) processo de submisso econmica mantendo o equilbrio de foras do poder militar (D) crescimento dos produtos nacionais brutos gerando uma rearticulao da poltica internacional

34
1 0 Exame de Qualificao Vestibular Estadual 2001

32 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 61

As mulheres de Canudos Guerreiam com gua quente. Os meninos com pedradas Fazem voltar muita gente.
(www.e-net.com.br/historia)

A trova de Sergipe acima citada destaca algumas das particularidades do movimento de Canudos ( 1 893-1897). O conflito que a se verificou pode ser caracterizado por: (A) participao popular desvinculada da organizao de um exrcito de defesa (B) impedimento do uso de armas de fogo como instrumento de defesa (C) reao militar centrada nas mulheres e crianas (D) resistncia baseada na organizao comunitria

Questo 62

(Folha de So Paulo, 02/04/2000)

Dois fatores que dificultam, no Brasil, a soluo do problema retratado na charge so: (A) traado urbanstico antigo das cidades / desqualificao tcnica na engenharia de trfego (B) mentalidade individualista predominante / falta de investimentos em transporte coletivo (C) indstria automobilstica nacional superada / dificuldade de fabricao de veculos geis e versteis (D) desconcentrao espacial das indstrias automotivas / congestionamento nas vias de escoamento do trnsito

35
10 Exame de Qualificao Vestibular Estadual 2001

33 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 63 No texto abaixo, so feitas reflexes sobre aspectos do nacionalismo na atualidade.


Os movimentos nacionalistas caractersticos dos anos finais do sculo XX so essencialmente negativos, ou melhor, separatistas. Da a insistncia colocada nas diferenas tnicas e lingsticas, que aparecem, s vezes, de forma individual ou combinada com a religio (...).
(HOBSBAWM, E. J. Naes e nacionalismos: desde 1870. Rio de Janeiro: Paz e Terra, 1990.)

Dentre os conflitos internacionais descritos, aquele que pode ser corretamente relacionado ao texto : (A) A interveno do governo indonsio no Timor Leste, em 1999, acarretou disputas com massacres da populao muulmana e destruio de cidades. (B) A populao de maioria catlica da Bsnia, em 1989, organizou a luta contra o domnio da Albnia com o apoio das milcias srvias e de tropas croatas. (C) A suspenso da autonomia de Kosovo pelo governo srvio, em 1989, gerou um movimento poltico, com luta armada e formao do Exrcito de Libertao. (D) A divergncia entre os grupos polticos da Tchetchnia, em 1996, desencadeou um levante militar com a participao da minoria da populao eslava e o apoio da Rssia. Questo 64

(Nosso Sculo. Volume 1. So Paulo: Abril Cultural, 1985.)

A caricatura acima, publicada inicialmente em 1904, refere-se vacinao obrigatria, que foi uma importante motivao para a Revolta da Vacina. Este movimento se apresentou como resultado de: (A) imposio de uma poltica sanitarista pelo Estado (B) apelo da populao por melhores condies de vida (C) reao do povo desinformado ao poder civilizatrio das elites (D) valorizao das problemticas da rea de sade pelo Congresso Nacional

36
1 0 Exame de Qualificao Vestibular Estadual 2001

34 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 65

(LAERTE. O tamanho da coisa. So Paulo: Circo Editorial / Obor, 1985.)

A manuteno de massa desempregada, ou ociosa, como indicado na charge, uma tendncia do mercado de trabalho, mesmo em momentos de intensa atividade econmica. O processo responsvel pela manuteno dos ndices de desemprego est expresso na seguinte afirmativa: (A) O estado absorve setores da economia, estimulando o setor privado e falncias. (B) A populao multiplica-se com rapidez, criando excedente demogrfico e subemprego. (C) A migrao provoca o crescimento das cidades, desencadeando marginalidade e retrao da economia. (D) A economia gera uma superpopulao relativa, produzindo reserva de mo-de-obra e reduo de salrios. Questo 66
O relatrio de 1999 do Programa das Naes Unidas para o Desenvolvimento registra que, no Brasil, os 20% mais pobres cerca de 32 milhes de brasileiros dividem entre si 2,5% da renda nacional (cerca de R$ 22,5 bilhes, considerando que o nosso PIB de cerca de R$ 900 bilhes). J os 20% mais ricos abocanham 63,4% da renda nacional, ou seja, R$ 570,6 bilhes! (...)
(Frei Beto. A avareza. In: SADER, Emir (org.). 7 Pecados do Capital. Rio de Janeiro: Record, 1999.)

Considerando o texto acima, a associao correta entre um sintoma tpico do subdesenvolvimento brasileiro e um elemento explicativo de sua manuteno : (A) concentrao de renda com excluso social / fenmeno de polticas econmicas (B) desigualdade social com reduo do PIB nacional / resultado da dinmica empresarial (C) contradio da sociedade capitalista com ampliao da produo de bens suprfluos / manifestao da globalizao (D) injustia social com aumento da participao dos segmentos mais pobres na renda nacional / realidade da conjuntura internacional

37
10 Exame de Qualificao Vestibular Estadual 2001

35 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 67

(Adaptado de BECKER, B. & outros (orgs.). Geografia e meio ambiente no Brasil. So Paulo: Hucitec, 1995.)

No mapa encontram-se indicadas as reas de expanso da fronteira agrcola no Brasil ao longo do tempo. A associao correta entre regio, perodo e relao social de produo predominante : (A) Nordeste sculos XIX e XX trabalho familiar de migrantes sulistas e mineiros (B) Sudeste sculo XIX mo-de-obra cativa africana e trabalho livre de imigrantes europeus (C) Centro-Oeste 1 metade do sculo XX mo-de-obra escrava de origem indgena e mestia (D) Norte 2 metade do sculo XX trabalho assalariado de migrantes dos pases andinos e das Guianas Questo 68
No era a fome absoluta, a da inanio, muito embora ns, os filhos do meu pai, estivssemos crescendo meio nanicos, mal alimentados, meio tristes, meio duros, meio revoltados. Mas era a fome moderna corroendo devagar aqueles nossos anos de infncia de 1967, 1968, na cidade desumana dos desempregados, dos retirantes, dos esmoleres do Recife. Somente duas dcadas depois eu leria uma definio de fome moderna, a fome do capital.
(FELINTO, Marilene. A Fome. In: SADER, Emir (org.). 7 Pecados do Capital. Rio de Janeiro: Record, 1999.)

Considerando o texto, uma causa e uma conseqncia do problema da fome, esto, respectivamente, apresentadas em: (A) modernizao tcnica nos estabelecimentos rurais / poltica de assentamentos rurais dos governos militares (B) incapacidade para investimentos do setor alimentar / sucesso de greves dos trabalhadores rurais (C) elevao dos preos dos alimentos / participao crescente do poder das oligarquias rurais (D) prioridade da agricultura de exportao / mobilidade espacial da populao

38
1 0 Exame de Qualificao Vestibular Estadual 2001

36 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 69
Neste mesmo dia, a horas de vspera, houvemos vista de terra! (...) Esta terra, Senhor, parece-me que, da ponta que mais contra o sul vimos, at outra ponta que contra o norte vem, de que ns deste porto houvemos vista, ser tamanha que haver nela bem vinte ou vinte e cinco lguas de costa.(...) Pelo serto nos pareceu, vista do mar, muito grande;(...) terra que nos parecia muito extensa.
(CAMINHA, Pero Vaz de. Carta a El Rei D. Manuel. In: PEREIRA, Paulo Roberto. Os trs nicos testemunhos do descobrimento do Brasil. Rio de Janeiro: Lacerda Editores, 1999.)

A superfcie do Brasil,(...) de 850 milhes de hectares.(...) Ora, atualmente, apenas 60 milhes desses hectares esto a ser utilizados na cultura regular de gros. O restante, (...) em estado de improdutividade, de abandono, sem fruto. Povoando dramaticamente esta paisagem e esta realidade social e econmica, vagando entre o sonho e o desespero, 4.800.000 famlias de trabalhadores rurais sem terra. A terra est ali, diante dos olhos e dos braos, uma imensa metade de um pas imenso (...)
(SARAMAGO, J. apud ALENCAR,C. Br 500: um guia para a redescoberta do Brasil. Petrpolis:Vozes, 1999.)

Separados por quase 500 anos, dois portugueses refletem a respeito da imensido da terra encontrada por seu pas. Mas a impresso transmitida pelo depoimento de cada um deles diferente, uma vez que a histria da Colnia e do perodo seguinte transformou a terra para o trabalho agrcola em um bem de acesso restrito. Esse longo processo de restrio ao acesso terra poderia ser sintetizado na seguinte afirmao: (A) O sistema de doaes de sesmarias, sucedido pela transformao da terra em mercadoria, instituiu a propriedade da terra em fonte de poder econmico e poltico. (B) As precrias condies naturais das terras no interior, somadas a crises climticas e ao xodo rural, acarretaram um esvaziamento da produo de bens primrios. (C) Os entraves da Coroa para a compra de terras, seguida pelas dificuldades de financiamento da produo, criou um desequilbrio na distribuio das reas agrcolas. (D) A nfase colonial na produo exportadora, acompanhada pela pouca habilitao tcnica dos agricultores, propiciou uma elitizao da populao do campo. Questo 70 Em 1988, quando se comemorou o centenrio da Lei urea, comentava-se em muitas cidades do Brasil, de forma irnica, que existiria uma clusula no texto dessa lei que revogaria a liberdade dos negros depois de cem anos de vigncia. O surgimento de tais comentrios est relacionado seguinte caracterstica social: (A) surgimento do apartheid (B) permanncia do racismo (C) formao da sociedade de classe (D) decadncia do sistema de estamentos

39
10 Exame de Qualificao Vestibular Estadual 2001

37 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Com base na letra do samba de Noel Rosa, que estabelece um contraponto entre o morro e a cidade, responda s questes de nmeros 71 e 72.
NO TEM TRADUO O cinema falado o grande culpado da transformao Dessa gente que pensa que um barraco prende mais que um xadrez L no morro, se eu fizer uma falseta A Risoleta se esquece logo do francs e do ingls A gria que o nosso morro criou Bem cedo a cidade aceitou e usou Mais tarde o malandro deixou de danar dando pinote Na gafieira, danando o foxtrote Essa gente hoje em dia que tem a mania de exibio No se lembra que o samba no tem traduo no idioma francs Tudo aquilo que o malandro pronuncia, com voz macia, brasileiro, j passou de portugus Amor l no morro amor pra chuchu As rimas do samba no so I love you E esse negcio de al, al boy, al Johnny S pode ser conversa de telefone
(Noel Rosa, 1933)

Questo 71 O universo retratado pelo compositor o da cidade do Rio de Janeiro na dcada de 1930, j nesse momento dividida de forma geral entre uma parte baixa, com maior densidade de construes, e as encostas ocupadas pelos segmentos de baixa renda da populao. Tal diferenciao espacial, no momento considerado, tem como causas principais: (A) reformas urbanas nas reas centrais da cidade / ocorrncia do xodo rural / pauperizao da populao (B) urbanizao da Zona Oeste / acelerao da migrao pendular / reduo de empregos no setor de servios (C) processo de industrializao na Zona Sul / deslocamento da populao perifrica para as encostas dos morros / poltica de construo de conjuntos habitacionais (D) incentivo ocupao na Baixada Fluminense / mobilidade espacial de trabalhadores na regio metropolitana / ao dos empreendedores na demarcao de loteamentos Questo 72 As menes ao portugus, ao ingls e ao francs na letra da msica No tem traduo, referem-se influncia estrangeira na vida brasileira, do ponto de vista econmico e cultural. No contexto das discusses nacionalistas da dcada de 1930, possvel considerar o autor como mais uma voz que se pronuncia para reforar a seguinte caracterstica da poca: (A) exaltao da cultura popular, que absorvia de forma criativa a influncia externa (B) crtica presena cultural portuguesa, que reproduzia a dominao do perodo colonial (C) discordncia da valorizao das culturas regionais, que deturpavam o sentimento nacional (D) incentivo destruio da cultura tradicional, que mantinha o conservadorismo da sociedade
1 0 Exame de Qualificao Vestibular Estadual 2001

40

38 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 73 situao 1 situao 2


O novo ministro da Justia, Jos Gregori, fez uma crtica velada s organizaes no-governamentais ao afirmar que melhor conversar com ndio do que com branco amigo de ndio. [continua o ministro:] O ndio no tem posio ideolgica, a posio de quem tem necessidades concretas, no intudas por um europeu que tem ar-condicionado ou (que fica) ao lado da lareira em um pas alpino.
(Adaptado de Folha de So Paulo, 17/04/2000.)

(Vieira Protetor dos ndios - 1746)

As duas situaes acima configuram a relao dos indgenas com os brancos, em tempos histricos diferentes. Em relao s sociedades indgenas, as duas situaes retratadas tm como elemento comum: (A) influncias religiosas ditadas pelos europeus (B) valores culturais impostos por agentes sociais externos (C) atitudes polticas sugeridas por organizaes de defesa do ndio (D) preconceitos raciais assimilados pelas autoridades governamentais Questo 74 Na segunda metade do sculo XIX, devido a problemas de abastecimento de gua na cidade do Rio de Janeiro, promoveu-se o reflorestamento do Macio da Tijuca. Um exemplo da grande repercusso do tema na poca est representado no seguinte texto de 1870:
A utilidade das florestas nas cercanias das cidades de toda evidncia: o benefcio que delas provm inestimvel com relao ao fenmeno meteorolgico das chuvas cuja freqncia e regularidade elas operam (...). Em nossa opinio, o belo exemplo da Floresta Nacional da Tijuca deveria ser seguido e aplicado em outros pontos da montanha, que cercam nossa capital, e que se vo escalvando com a derrubada do arvoredo para fabricar carvo(...)
(Instituto Imperial Fluminense apud HEYNEMANN, C. Floresta da Tijuca: natureza e civilizao. Rio de Janeiro: Prefeitura da Cidade, 1995.)

Hoje, a questo da preservao e da recuperao da cobertura florestal, numa rea urbana como a do Rio de Janeiro, justificada no apenas pelo aspecto meteorolgico, mas tambm pela possibilidade de contribuir para: (A) transformar a fauna e a flora e sua diversidade (B) explorar os produtos florestais economicamente (C) regularizar a infiltrao e o escoamento das guas pluviais (D) impedir a ocupao das encostas pelos segmentos desfavorecidos
10 Exame de Qualificao Vestibular Estadual 2001

41

39 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 75
A bandeira brasileira no exprime a poltica nem a histria. um smbolo da natureza: floresta, ouro, cu, estrela e ordem. o Brasil-jardim, o Brasil-paraso terrestre. O mesmo fenmeno pode ser observado no Hino Nacional, que canta mares mais verdes, cus mais azuis, bosques como as flores e nossa vida de 'mais amores'. (...) O mito do pas-paraso nos persuade de que nossa identidade e grandeza se acham predeterminadas no plano natural: somos sensuais, alegres e no-violentos.
(CHAU, Marilena. Folha de So Paulo, 26/03/2000.)

A construo desse mito tem como pressuposto a seguinte posio ideolgica: (A) sentimentos patriticos estimulam a crtica popular (B) acontecimentos polticos independem das lutas sociais (C) momentos sangrentos impem a afirmao nacionalista (D) fanatismos religiosos determinam a estrutura socioeconmica

Questo 76 Densidade Demogrfica de Grupos Germnicos

(COSGROVE, D. & DANIELS, S. (orgs.). The iconography of landscape. Cambridge: Cambridge University Press, 1994.)

Considere as afirmaes: 1- O mapa uma representao do real e no a prpria realidade. 2- O mapa acima, produzido para um atlas escolar alemo de 1933 na poca do nazismo, distorce a densidade demogrfica de grupos germnicos na Europa Oriental. As afirmaes 1 e 2 so confirmadas pela conjugao dos seguintes fatos: (A) dificuldade de coleta de dados / impossibilidade de percepo da localizao e da movimentao dos povos nmades na Europa (B) manipulao dos instrumentos de sensoriamento remoto / hostilidade do governo alemo e italiano frente aos pases da Europa Ocidental (C) ausncia de neutralidade cartogrfica / necessidade de persuaso do povo alemo para a interveno e proteo de minorias germnicas no leste europeu (D) precariedade nas tcnicas de preparao de mapas / ignorncia das caractersticas de instrumentalizao ideolgica e demogrfica por parte dos gegrafos da Alemanha

42
1 0 Exame de Qualificao Vestibular Estadual 2001

40 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 77 A Regio Metropolitana do Rio de Janeiro ocupa apenas 15% da superfcie total do estado e abriga por volta de 80% de sua populao. Em outros estados como So Paulo e Minas Gerais as regies metropolitanas no abrigam percentagens to elevadas. Comparando as diferenas de percentagens populacionais das regies metropolitanas citadas, a melhor razo para a especificidade no caso do Rio de Janeiro : (A) adensamento populacional e do setor de servios, estimulando a migrao de retorno dos demais municpios (B) concentrao demogrfica e econmica da capital e sua periferia, acarretando poder decisrio reduzido dos municpios do interior (C) presso da imigrao estrangeira e das migraes internas, incentivando a desacelerao populacional das cidades do interior (D) retomada de crescimento econmico e poltico, promovendo maior participao nas trocas de produtos agrcolas com os estados limtrofes

Questo 78

Efetivamente a cidade teve um progresso rpido. Muitos homens adotaram gravatas e profisses desconhecidas. Os carros de bois deixaram de chiar nos caminhos estreitos. O automvel, a eletricidade e o cinema. E impostos.
(RAMOS, Graciliano. So Bernardo. So Paulo: Record, 1988 original de 1934.)

Talvez se possa dizer que esse desencontro entre a sociedade e a economia seja um dos segredos da prosperidade dos negcios. As expanses do capital beneficiam-se das condies adversas sob as quais os trabalhadores so obrigados a produzir, no campo e na cidade. (...) Os setores sociais 'participantes' tm uma base na explorao dos excludos.
(IANNI, Octavio. A Idia do Brasil Moderno. So Paulo: Brasiliense, 1992.)

No texto do romancista apresentam-se aspectos de um processo criticado de modo significativo no texto do socilogo Ianni. O processo e o principal indicador crtico referidos nos textos podem ser identificados em: (A) desenvolvimento industrial experincia de concentrao de poder e de capital pelo Estado nacional (B) urbanizao acelerada desencontro de interesses entre o rural e urbano pela ao da sociedade (C) crescimento econmico permanncia dos problemas sociais e econmicos pela ineficincia da burguesia industrial (D) modernizao econmica produo simultnea de prosperidade e de desigualdade social pelos mesmos agentes

43
10 Exame de Qualificao Vestibular Estadual 2001

41 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 79

(IPEA, 1998.) (OLIVA, J. & GIASANTI, R. Temas de geografia do Brasil. So Paulo: Atual, 1999.)

Observando os dados acima, duas causas que explicam a alterao do PIB per capita , a partir dos anos 80, so: (A) abertura ao mercado internacional / elevado crescimento demogrfico (B) marasmo econmico comum s viradas de sculo / desvalorizao cambial (C) esgotamento do modelo desenvolvimentista adotado / conjuntura internacional desfavorvel (D) retrao nas reformas econmicas / atrao do capital financeiro para setores estratgicos

Questo 80 Compare os dois textos abaixo:


Cinco grupos etnogrficos, ligados pela comunidade ativa da lngua e passiva da religio, moldados pelas condies ambientes de cinco regies dispersas, tendo pelas riquezas naturais da terra um entusiasmo estrepitoso, sentindo pelo portugus averso ou desprezo, no se prezando, porm, uns aos outros de modo particular eis em suma ao que se reduziu a obra de trs sculos.
(ABREU,Capistrano de. Captulos de histria colonial. Rio de Janeiro: Civilizao Brasileira, 1976 original de 1907.) (RIBEIRO,Darcy. O povo brasileiro. So Paulo: Companhia das Letras, 1995.)

de assinalar que, apesar de feitos pela fuso de matrizes to diferenciadas, os brasileiros so, hoje, um dos povos mais homogneos, lingstica e culturalmente e tambm um dos mais integrados socialmente da Terra. Falam uma mesma lngua, sem dialetos. No abrigam nenhum contingente reivindicativo de autonomia, nem se apegam a nenhum passado. Estamos abertos para o futuro.

No que diz respeito formao da nao brasileira, os autores, nas passagens acima, divergem quanto ao significado de aspectos da: (A) herana colonial (B) unificao territorial (C) polarizao regional (D) imigrao estrangeira

44
1 0 Exame de Qualificao Vestibular Estadual 2001

42

GABARITO OFICIAL - 1 EXAME DE QUALIFICAO

01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20

B D B B C D A C B D C D B A C D C A B C

ESPANHOL

25 26 27 28

B B D B

FRANCS

25 26 27 28

B B D A

INGLS

25 26 27 28

C D A B

29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48

D C A B D C A C B B D A D B C D D B A C

55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74

D D D B A B D B C A D A B D A B A A B C

21 - B 22 - B 23 - D 24 - C

49 - A 50 - C 51 - B 52 - D 53 - C 54 - C

75 - B 76 - C 77 - B 78 - D 79 - C 80 - A

43

1a Fase - 2o Exame de Qualificao

20/08/2000

Neste caderno voc encontrar um conjunto de 48 (quarenta e oito) pginas numeradas seqencialmente, contendo 80 (oitenta) questes das seguintes reas: Linguagens, Cdigos e suas Tecnologias; Cincias da Natureza, Matemtica e suas Tecnologias; Cincias Humanas e suas Tecnologias. A tabela peridica encontra-se na pgina 47.

INSTRUES I.
Verifique se o seu nome, nmero de inscrio, nmero do documento de identidade e lngua estrangeira escolhida esto corretos no carto de respostas. Se houver erro, notifique o fiscal. Assine o carto de respostas com caneta.

No abra o caderno antes de receber autorizao.

6.
Leia atentamente cada questo e escolha a alternativa que mais adequadamente responde a cada uma delas. Marque sua resposta no carto de respostas, cobrindo fortemente o espao correspondente letra a ser assinalada; utilize caneta preta, preferencialmente, ou lpis preto n 2, conforme o exemplo abaixo:
1 A B C D

4.

O carto de respostas no pode ser dobrado, amassado, rasurado ou manchado. Exceto sua assinatura, nada deve ser escrito ou registrado fora dos locais destinados s respostas.

7. Voc dispe de 5 (cinco) horas para fazer esta prova.

2.

Ao receber autorizao para abrir este caderno, verifique se a impresso, a paginao e a numerao das questes esto corretas. Caso ocorra qualquer erro, notifique o fiscal.

8. 5. A leitora de marcas no registrar as respostas em que houver falta de nitidez e/ou marcao de mais de uma letra.

Ao terminar a prova, entregue ao fiscal o carto de respostas e este caderno.

3.

As questes de nmeros 25 a 28 da rea de Linguagens, Cdigos e suas Tecnologias devero ser respondidas de acordo com a sua opo de Lngua Estrangeira: Espanhol, Francs ou Ingls.

BOA PROVA!

44

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS


Com base na foto abaixo, responda s questes de nmeros 01 e 02 02.

O fotgrafo brasileiro Sebastio Salgado fez esta foto num campo de refugiados instalados em equipamentos ferrovirios na fronteira da Crocia com a Srvia e a Bsnia, em 1994. Assim como textos, fotografias podem ser lidas: o menino que aparece no primeiro plano funciona como o tema da foto, enquanto o trem no segundo plano comenta este tema.

(SALGADO, Sebastio. xodos. So Paulo: Companhia das Letras, 2000.)

Questo 01 A escolha da figura humana no primeiro plano busca provocar no espectador a seguinte atitude: (A) questionar a opo pelo tema (B) admirar a composio com o fundo (C) surpreender-se com o gesto do menino (D) refletir sobre o desamparo da criana Questo 02 O fotgrafo, ao enquadrar o trem parado ao fundo, onde os refugiados se encontravam instalados, ressalta o contraste entre: (A) o metal e a terra (B) o real e o imaginrio (C) o progresso e a guerra (D) a infncia e o mundo adulto

3
20 Exame de Qualificao Vestibular Estadual 2001

45 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 03
Vestibular UERJ 2001. Construindo o cidado do futuro.

No enunciado acima, extrado de um folheto de divulgao deste Vestibular, o vocbulo futuro classifica-se gramaticalmente como substantivo. Se, entretanto, houvesse alterao para Construindo o cidado futuro, a mesma palavra seria um adjetivo. Casos como esse permitem considerar substantivos e adjetivos como nomes, que se diferenciam, sobretudo, pelas respectivas caractersticas a seguir: (A) invariabilidade mrfica variabilidade em gnero e nmero (B) designao de seres e conceitos expresso de um fenmeno (C) termo gerador de nomes derivados resultado de uma derivao (D) papel sinttico de termo ncleo papel sinttico de modificador de outro nome Questo 04 Flexo o processo de fazer variar um vocbulo, em sua estrutura interna, para nele expressar dadas categorias gramaticais como gnero e nmero. A partir desse conceito, a palavra sublinhada que admite flexo de gnero : (A) Fez-se de triste o que se fez amante (Vincius de Moraes) (B) Paisagens da minha terra,/ Onde o rouxinol no canta. (Manuel Bandeira) (C) Sou um homem comum/ de carne e de memria/ de osso e de esquecimento (Ferreira Gullar) (D) Meu amigo, vamos cantar,/ vamos chorar de mansinho/ e ouvir muita vitrola (Carlos Drummond de Andrade) Questo 05
Os aliados no querem romper o namoro com FHC querem namorar mais.
(Veja,18/08/1999)

A comparao entre as palavras sublinhadas acima demonstra que o significado geral de expressar ao no suficiente para identificar o verbo como classe gramatical, j que namoro consta do dicionrio como ato de namorar. Para diferenciar o verbo do substantivo, por exemplo, seria necessrio considerar, alm do sentido de ao, a seguinte caracterstica que s os verbos possuem: (A) terminao em r (B) flexo de tempo, modo e pessoa (C) presena indispensvel frase (D) anteposio de um substantivo

4
2 0 Exame de Qualificao Vestibular Estadual 2001

46 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 06
A Internet o portal da nova era, mas apenas 3% da populao brasileira tm hoje acesso rede.
(O Globo, 09/07/2000)

Analisando o emprego do conectivo mas na construo acima, possvel concluir que, alm de ligar duas partes da frase, ele desempenha a seguinte funo: (A) reafirmar o significado da primeira parte (B) permitir a compreenso interna das duas partes (C) desfazer a ambigidade de sentido da primeira parte (D) evidenciar uma relao de sentido entre as duas partes

Com base nos textos abaixo, responda s questes de nmeros 07 a 10 10. CARTAS DE LEITORES J conhecemos nossos governantes e polticos, suas ndoles, seus defeitos, suas capacidades limitadas para solues e amplas para confuses. S no conhecamos ainda nossos manifestantes, se que assim se pode dizer. Nada justifica a agresso fsica, seja qual for a manifestao, seja quem for o agredido ou o agressor. Nada justificar, jamais, a agresso sofrida pelo governador Mrio Covas, por mais digna que fosse a manifestao. O que causa espanto que se tratava de uma manifestao de professores. esse o papel de um educador?
(VILA, Marcelo Maciel. O Globo, 03/06/2000.)

O pas est chocado com as agresses que os representantes do povo esto sofrendo. As autoridades e a imprensa nacional tm-se manifestado severamente contra esses atos. Primeiro foi uma paulada no governador de So Paulo, depois um ovo no ministro da Sade e, em 1 de junho, outro ataque ao governador Mrio Covas. O vice-presidente da Repblica disse que o governador merece respeito. Concordo. Mas os demais cidados brasileiros no merecem? O ministro da Justia cobrou punio judicial para os agressores, afirmando que a ltima manifestao transpusera os limites do tolervel. E a situao de extrema violncia que ns, cariocas, estamos vivendo? Quando o ministro vai achar que foram transpostos os limites do tolervel?
(SILVA, Arthur Costa da. O Globo, 03/06/2000.)

Questo 07 As duas cartas acima so de leitores expressando suas opinies sobre o episdio de agresso ao governador de So Paulo em manifestao de professores em greve. O veculo de publicao das cartas o jornal impe um limite de espao para os textos. Em funo desse limite de espao, os dois textos apresentam como trao comum: (A) combate a pontos de vista de outros leitores (B) construo de comprovaes por meio de silogismos (C) expresso de opinio sem fundamentos desenvolvidos (D) escolha de assunto segundo o interesse do editor do jornal

5
20 Exame de Qualificao Vestibular Estadual 2001

47 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 08 Em geral, esse tipo de carta no jornal busca convencer os leitores de um dado ponto de vista. Por causa dessa inteno, possvel verificar que ambas as cartas transcritas se caracterizam por: (A) finalizar com perguntas retricas para expressar sua argumentao (B) iniciar com consideraes gerais para contestar opinies muito difundidas (C) utilizar oraes de estruturao negativa para defender a posio de outros (D) empregar estruturas de repetio para reforar idias centrais da argumentao

Questo 09 O fragmento que expe a tese de cada uma das cartas, respectivamente, pode ser identificado em: (A) J conhecemos nossos governantes / Quando o ministro vai achar que foram transpostos os limites do tolervel? (B) S no conhecamos ainda nossos manifestantes / a ltima manifestao transpusera os limites do tolervel (C) Nada justifica a agresso fsica / Mas os demais cidados brasileiros no merecem? (D) esse o papel de um educador? / Primeiro foi uma paulada no governador de So Paulo

Questo 10 Pela leitura da carta de Arthur Costa da Silva, possvel afirmar que as perguntas nela presentes tm o seguinte significado: (A) questionar as atitudes dos polticos brasileiros (B) apontar falhas no discurso de autoridades brasileiras (C) propor uma reflexo acerca da atitude dos agressores (D) mostrar solidariedade ao comportamento dos manifestantes

6
2 0 Exame de Qualificao Vestibular Estadual 2001

48 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Com base no texto abaixo, responda s questes de nmeros 11 a 14 14. A PTRIA Desde dezoito anos que o tal patriotismo lhe absorvia e por ele fizera a tolice de estudar inutilidades. Que lhe importavam os rios? Eram grandes? Pois que fossem... Em que lhe contribuiria para a felicidade saber o nome dos heris do Brasil? Em nada... O importante que ele tivesse sido feliz. Foi? No. Lembrou-se das suas cousas de tupi, do folklore, das suas tentativas agrcolas... Restava disso tudo em sua alma uma satisfao? Nenhuma! Nenhuma! O tupi encontrou a incredulidade geral, o riso, a mofa, o escrnio; e levou-o loucura. Uma decepo. E a agricultura? Nada. As terras no eram ferazes e ela no era fcil como diziam os livros. Outra decepo. E, quando o seu patriotismo se fizera combatente, o que achara? Decepes. Onde estava a doura de nossa gente? Pois ele no a viu combater como feras? Pois no a via matar prisioneiros, inmeros? Outra decepo. A sua vida era uma decepo, uma srie, melhor, um encadeamento de decepes. A ptria que quisera ter era um mito; era um fantasma criado por ele no silncio do seu gabinete. Nem a fsica, nem a moral, nem a intelectual, nem a poltica que julgava existir, havia. A que existia de fato, era a do Tenente Antonino, a do doutor Campos, a do homem do Itamarati. E, bem pensando, mesmo na sua pureza, o que vinha a ser a Ptria? No teria levado toda a sua vida norteado por uma iluso, por uma idia a menos, sem base, sem apoio, por um Deus ou uma Deusa cujo imprio se esvaa? No sabia que essa idia nascera da amplificao da crendice dos povos greco-romanos de que os ancestrais mortos continuariam a viver como sombras e era preciso aliment-las para que eles no perseguissem os descendentes? Lembrou-se do seu Fustel de Coulanges... Lembrou-se de que essa noo nada para os Menenan, para tantas pessoas... Pareceu-lhe que essa idia como que fora explorada pelos conquistadores por instantes sabedores das nossas subservincias psicolgicas, no intuito de servir s suas prprias ambies... Reviu a histria; viu as mutilaes, os acrscimos em todos os pases histricos e perguntou de si para si: como um homem que vivesse quatro sculos, sendo francs, ingls, italiano, alemo, podia sentir a Ptria? Uma hora, para o francs, o Franco-Condado era terra dos seus avs, outra no era; num dado momento, a Alscia no era, depois era e afinal no vinha a ser. Ns mesmos no tivemos a Cisplatina e no a perdemos; e, porventura, sentimos que haja l manes dos nossos avs e por isso sofremos qualquer mgoa? Certamente era uma noo sem consistncia racional e precisava ser revista.
(BARRETO, Lima.Triste fim de Policarpo Quaresma. So Paulo: Brasiliense, 1986.)

Questo 11 O personagem Policarpo Quaresma, no trecho acima, se encontra preso, prestes a ser executado pelo exrcito de Floriano Peixoto, por ter escrito uma carta ao presidente protestando contra o assassinato de prisioneiros. Antes de ser executado, ele reflete sobre a noo de ptria. Nos dois primeiros pargrafos, ele parte de suas prprias experincias, o que configura o seguinte mtodo de raciocnio: (A) indutivo, pensando do particular para o geral (B) dedutivo, pensando do abstrato para o concreto (C) dialtico, pensando a partir das suas contradies (D) sofismtico, pensando do geral para o particular

7
20 Exame de Qualificao Vestibular Estadual 2001

49 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 12 Reviu a histria; viu as mutilaes, os acrscimos em todos os pases histricos e perguntou de si para si: como um homem que vivesse quatro sculos, sendo francs, ingls, italiano, alemo, podia sentir a Ptria? A pergunta de Policarpo refere-se a determinado territrio na Europa que de fato mudou quatro vezes de nacionalidade em quatro sculos. A pergunta permite subentender a seguinte afirmao: (A) Se a Ptria pode mudar de lugar, ento um homem que seguisse o seu percurso histrico se sentiria eterno imigrante. (B) Se a Ptria uma noo histrica, ento um homem que acompanhasse as mudanas se perceberia mais humano do que patriota. (C) Se a Ptria pode abrigar lnguas diferentes, ento um homem que nela vivesse teria um sentimento muito mais forte de patriotismo. (D) Se a Ptria pode mudar de tamanho, ento um homem que crescesse com ela veria o seu sentimento patritico alterar-se na mesma proporo.

Questo 13 Que lhe importavam os rios? Eram grandes? Pois que fossem... Com essas frases, Policarpo Quaresma critica o sofisma que liga o tamanho dos rios brasileiros grandeza moral da ptria brasileira. Esse tipo de sofisma ocorre quando se estabelece uma relao arbitrria entre dois elementos independentes que so apresentados como: (A) efeito e causa (B) opinio e citao (C) generalizao e fatos (D) interrogao e resposta Questo 14 Certamente era uma noo sem consistncia racional e precisava ser revista. A frase final constitui uma concluso preparada, ao longo do texto, por idias que se contrapem a uma noo de ptria que o personagem-narrador indica ter cultivado durante a sua vida. Um argumento que conduz concluso da falta de consistncia racional da noo de ptria : (A) O importante que ele tivesse sido feliz. Foi? No. (B) As terras no eram ferazes e ela no era fcil como diziam os livros. (C) A ptria que quisera ter era um mito; era um fantasma criado por ele no silncio do seu gabinete. (D) Lembrou-se de que essa noo nada para os Menenan, para tantas pessoas...

8
2 0 Exame de Qualificao Vestibular Estadual 2001

50 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Com base no texto abaixo, responda s questes de nmeros 15 a 17 17.

PALAVRAS Veio me dizer que eu desestruturo a linguagem. Eu desestruturo a linguagem? Vejamos: eu estou bem sentado num lugar. Vem uma palavra e tira o lugar de debaixo de mim. Tira o lugar em que eu estava sentado. Eu no fazia nada para que a palavra me desalojasse daquele lugar. E eu nem atrapalhava a passagem de ningum. Ao retirar de debaixo de mim o lugar, eu desaprumei. Ali s havia um grilo com a sua flauta de couro. O grilo feridava o silncio. Os moradores do lugar se queixavam do grilo. Veio uma palavra e retirou o grilo da flauta. Agora eu pergunto: quem desestruturou a linguagem? Fui eu ou foram as palavras? E o lugar que retiraram de debaixo de mim? No era para terem retirado a mim do lugar? Foram as palavras pois que desestruturaram a linguagem. E no eu.
(BARROS, Manoel de. Ensaios fotogrficos. Rio de Janeiro: Record, 2000.)

Questo 15 O poema, em prosa potica, de Manoel de Barros, questiona a idia de que a lngua seja controlada pelos falantes a lngua, em alguns momentos, que nos controlaria. Para fazer esse questionamento, utiliza-se do seguinte processo de construo: (A) discute teorias e conceitos lingsticos, como se polemizasse (B) religa os versos a sentenas interrogativas, como se dialogasse (C) concretiza idias com elementos da natureza, como se refletisse (D) constri hiprboles sobre o lugar do poeta, como se monologasse

Questo 16 O prefixo des aparece seis vezes no poema: desestruturo, desestruturo, desalojasse, desaprumei, desestruturou, desestruturaram. Refora-se, assim, a noo de que a poesia mais desestabiliza significados cristalizados e cria novos do que comunica alguma mensagem do poeta para o leitor. A frase de Manoel de Barros que melhor exemplifica essa desestabilizao : (A) E eu nem atrapalhava a passagem de ningum. (B) O grilo feridava o silncio. (C) Fui eu ou foram as palavras? (D) No era para terem retirado a mim do lugar?

9
20 Exame de Qualificao Vestibular Estadual 2001

51 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 17 As gramticas em geral registram duas ocorrncias que deixam o sujeito indeterminado: frases como Falaram mal de voc, em que o verbo aparece na terceira pessoa do plural e no h sujeito reconhecvel, e frases como Precisa-se de servente, em que o pronome se, na terceira pessoa do singular, indetermina o sujeito. O poema de Manoel de Barros, no entanto, cria uma outra ocorrncia de sujeito indeterminado, que aparece no seguinte trecho: (A) Veio me dizer que eu desestruturo a linguagem (B) Vejamos: eu estou bem sentado num lugar (C) Ali s havia um grilo com sua flauta de couro (D) E o lugar que retiraram de debaixo de mim?

Com base no texto abaixo, responda s questes de nmeros 18 a 21 21.

RIOS SEM DISCURSO


.

Quando um rio corta, corta-se de vez o discurso-rio de gua que ele fazia; cortado, a gua se quebra em pedaos, em poos de gua, em gua paraltica. Em situao de poo, a gua equivale a uma palavra em situao dicionria: isolada, estanque no poo dela mesma, e porque assim estanque, estancada; e mais: porque assim estancada, muda, e muda porque com nenhuma comunica, porque cortou-se a sintaxe desse rio, o fio de gua por que ele discorria. O curso de um rio, seu discurso-rio, chega raramente a se reatar de vez; um rio precisa de muito fio de gua para refazer o fio antigo que o fez. Salvo a grandiloqncia de uma cheia lhe impondo interina outra linguagem, um rio precisa de muita gua em fios para que todos os poos se enfrasem: se reatando, de um para outro poo, em frases curtas, ento frase e frase, at a sentena-rio do discurso nico em que se tem voz a seca ele combate.
(NETO, Joo Cabral de Melo. Antologia potica. Rio de Janeiro: Jos Olympio, 1973. )

10
2 0 Exame de Qualificao Vestibular Estadual 2001

52 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 18 Em situao de poo, a gua equivale a uma palavra em situao dicionria: Se, no poema, poo equivale a dicionrio, rio equivale ao seguinte elemento lingstico: (A) texto (B) verso (C) regncia (D) vocabulrio

Questo 19 A concluso do poema completa o ttulo: os rios sem discurso so rios secos. Isso significa dizer que a seca dos rios tem relao direta com discursos que apresentam os atributos a seguir: (A) vazios e montonos (B) ridos e combativos (C) fragmentados e estreis (D) grandiloqentes e verborrgicos

Questo 20 Na qualificao progressiva da palavra gua, feita pela primeira estrofe, d-se a alterao de estanque para estancada. Essa alterao expressa uma nova noo a partir do seguinte recurso gramatical: (A) flexo de gnero (B) emprego de estrutura passiva (C) complemento do nome palavra (D) correo da concordncia nominal

Questo 21 O ttulo - Rios sem discurso - j apresenta um tipo de metfora, predominante no texto, que marca um estilo de construo potica. Esse tipo de metfora est corretamente descrito em: (A) compara movimentos da gua, nos rios, contestao da seca (B) ope aspectos naturais, incontrolveis, produo do discurso (C) associa elementos concretos, visuais, a fenmenos da linguagem (D) aproxima a fragmentao da palavra, estanque, do curso de um rio

11
20 Exame de Qualificao Vestibular Estadual 2001

53 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Com base no texto abaixo, responda s questes de nmeros 22 a 24 24.

(...)No resguardei os apontamentos obtidos em largos dias e meses de observao: num momento de aperto fui obrigado a atir-los na gua. Certamente me iro fazer falta, mas ter sido uma perda irreparvel? Quase me inclino a supor que foi bom privar-me desse material. Se ele existisse, ver-me-ia propenso a consult-lo a cada instante, mortificar-me-ia por dizer com rigor a hora exata de uma partida, quantas demoradas tristezas se aqueciam ao sol plido, em manh de bruma, a cor das folhas que tombavam das rvores, num ptio branco, a forma dos montes verdes, tintos de luz, frases autnticas, gestos, gritos, gemidos. Mas que significa isso? Essas coisas verdadeiras podem no ser verossmeis. E se esmoreceram, deix-las no esquecimento: valiam pouco, pelo menos imagino que valiam pouco. Outras, porm, conservaram-se, cresceram, associaram-se, e inevitvel mencion-las. Afirmarei que sejam absolutamente exatas? Leviandade. (...)Nesta reconstituio de fatos velhos, neste esmiuamento, exponho o que notei, o que julgo ter notado. Outros devem possuir lembranas diversas. No as contesto, mas espero que no recusem as minhas: conjugam-se, completam-se e me do hoje impresso de realidade. (...)
(RAMOS, Graciliano. Memrias do crcere. Rio, So Paulo: Record, 1984.)

Questo 22 O fragmento transcrito expressa uma reflexo do autor-narrador quanto escrita de seu livro contando a experincia que viveu como preso poltico, durante o Estado Novo. No que diz respeito s relaes entre escrita literria e realidade, possvel depreender, da leitura do texto, a seguinte caracterstica da literatura: (A) revela ao leitor vivncias humanas concretas e reais (B) representa uma conscientizao do artista sobre a realidade (C) dispensa elementos da realidade social exterior arte literria (D) constitui uma interpretao de dados da realidade conhecida

Questo 23 Por causa da perda das anotaes, relatada pelo narrador, o texto impregnado de dvidas acerca da exatido do que ser levantado no livro. O trecho que melhor representa um exemplo dessas dvidas : (A) Quase me inclino a supor que foi bom privar-me desse material (B) Outras, porm, conservaram-se, cresceram, associaram-se, e inevitvel mencion-las (C) neste esmiuamento, exponho o que notei, o que julgo ter notado (D) No as contesto, mas espero que no recusem as minhas

12
2 0 Exame de Qualificao Vestibular Estadual 2001

54 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 24 A relao entre autor e narrador pode assumir feies diversas na literatura. Pode-se dizer que tal relao tem papel fundamental na caracterizao de textos que, a exemplo do livro de Graciliano Ramos, constituem uma autobiografia gnero literrio definido como relato da vida de um indivduo feito por ele mesmo. A partir dessa definio, possvel afirmar que o carter autobiogrfico de uma obra reconhecido pelo leitor em virtude de: (A) contedo verdico das experincias pessoais e coletivas relatadas (B) identidade de nome entre autor, narrador e personagem principal (C) possibilidade de comprovao histrica de contextos e fatos narrados (D) notoriedade do autor e de sua histria junto ao pblico e sociedade

13
20 Exame de Qualificao Vestibular Estadual 2001

55 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

ESPANHOL LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS


Com base no texto abaixo, responda s questes de nmeros 25 a 27 27. n

EL LIBRO DE PAPEL VS. EL LIBRO DIGITAL: UN DEBATE CON TODAS LAS LETRAS
por J ulin G allo, editor de Clarn D igital Julin Gallo, Digital (...) Manchas de tinta sobre rboles muertos, as llaman a los libros de papel, a los diarios y a las revistas los defensores de los soportes electrnicos. Por otro lado, hay una legin de personas que le atribuye al libro de papel capacidades insustituibles como instrumentos de distribucin de cultura y conocimiento, y en su defensa no se avergenzan en sostener argumentos francamente fetichistas, como el del placer de tocar la cubierta de un buen libro o el agradable olor de sus pginas. Hoy, los libros de papel hacen algunas cosas mejor que su competidor. Son bastante baratos, son transportables y livianos, no necesitan de fuentes de energa, tienen el mejor ndice de contraste posible para la lectura, tienen alta definicin para las imgenes, todo el catlogo de ttulos se encuentra publicado en este formato (...), se puede escribir en sus bordes, redactar en ellos clidas dedicatorias en letra cursiva y regalarlos. Un libro de papel, hoy, puede ser algo tan elemental como una novela de bolsillo en oferta (a poco ms de un peso), o una edicin extraordinaria, como el flamante libro del fotgrafo Helmut Newton, que cuesta en Argentina dos mil pesos. Los libros de papel tienen ms de 500 aos de existencia entre nosotros, desde que Johannes Gutenberg imprimi por primera vez La Biblia en 1455. Eso los convierte en objetos aparentemente indispensables para nuestra cultura (hasta ahora). Mientras tanto, los libros electrnicos parecen una curiosidad. Para leer un libro electrnico hoy disponemos de las computadoras de escritorio o porttiles y de artefactos como el Rocket ebook (una pequea pantalla porttil de unos veinte centmetros de alto, en blanco y negro, que cuesta doscientos dlares en EE.UU.). Son dos formas muy precarias para leer textos de ms de dos carillas de extensin y especialmente arduos para los textos de ficcin. Pero la industria tecnolgica promete grandes soluciones para la exhibicin adecuada de textos: desde el papel electrnico (largamente anunciado y todava nunca visto fuera de los centros de investigacin) hasta el desarrollo de software especializado en la representacin clara de caracteres (Clear Type display technology) como el Microsoft Reader. Por un camino o por otro, los textos llegarn a ser tan eficazmente exhibidos en forma electrnica como en papel, y ese da la polmica terminar. Porque estas tecnologas permitirn distribuir toda clase de informacin, entre ella textos, y los argumentos que defienden al papel se debilitarn inexorablemente. En este libro electrnico futuro cabrn todos los libros, toda la literatura, todas las cartas, todos los diarios, todas las revistas, todos los informes, todos los mapas, todas las reproducciones de cuadros, toda la msica, todas las pelculas, todas las fotografas. A un costo bajsimo, las personas dispondrn de bibliotecas inmensas de acceso instantneo, varias veces superior a su capacidad de lectura. Los libros de papel quedarn relegados a ediciones donde la impresin grfica tenga una relevancia similar al contenido. No falta tanto para que esto pase. Las versiones comerciales de papel electrnico se anuncian como de inminente aparicin y sus aplicaciones superan a la edicin de libros y alcanzan envases, carteles y ropa (ver www.electronic-ink.com). Y segn la lnea de tiempo presentada por Microsoft, para el ao 2008 la venta de libros electrnicos superar a la de los libros de papel. En 20, en 30, en 40 aos o en algn momento dentro de este siglo, los libros de papel comenzarn a ser melanclicos objetos del pasado.
(VIVA, La revista de Clarn, 4 de junio de 2000)

05

45

10

50

15

55

20

60

25

65

30

70

35

75

40

14

2 0 Exame de Qualificao Vestibular Estadual 2001

56 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

ESPANHOL LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS


Questo 25 Segn el texto, la competencia entre libro impreso y libro digital se encamina hacia: (A) finalizacin favorable al digital, aunque en un futuro no muy lejano (B) situacin de equilibrio entre los dos, segn las preferencias personales (C) manutencin del poder del impreso, incluso entre los lectores virtuales (D) creacin de nuevos soportes para ambos, a partir del papel electrnico Questo 26 Se puede identificar la manifestacin de una clara posicin del que enuncia, respecto al debate, en el siguiente fragmento: (A) Manchas de tinta sobre rboles muertos (l. 1) (B) Eso los convierte en objetos aparentemente indispensables para nuestra cultura (hasta ahora) (l. 30 - 32) (C) Para leer un libro electrnico hoy disponemos de las computadoras de escritorio o porttiles (l. 33 - 35) (D) Las versiones comerciales de papel electrnico se anuncian como de inminente aparicin (l. 70 - 71) Questo 27 El fragmento del texto que presenta una idea de contraargumentacin est indicado en: (A) Por otro lado, hay una legin de personas (l. 4 - 5) (B) Pero la industria tecnolgica promete (l. 42 - 43) (C) Por un camino o por otro, los textos llegarn (l. 50 - 51) (D) Porque estas tecnologas permitirn distribuir (l. 54) Questo 28

(QUINO. Mafalda. Buenos Aires: Ediciones de La Flor, 1988.)

Por la escena presentada en la ltima vieta, se puede deducir que Mafalda tira su diccionario a la basura porque: (A) duda del sentido atribuido a la palabra (B) se opone a lo dicho por su amigo (C) no logra razones contra la sopa (D) quiere sorprender a su madre

15
20 Exame de Qualificao Vestibular Estadual 2001

57 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

INGLS LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS


Com base no texto abaixo, responda s questes de nmeros 25 a 27.

STORIED LIBRARY OF ALEXANDRIA TO RE-OPEN AFTER 1,400 YEARS

05

In the days when 500,000 papyrus scrolls could store the entire sum of human knowledge, the Egyptian city of Alexandria - at the crossroads of Europe, Asia and Africa - was a natural site for the worlds greatest library. It was here, under the Ptolemies, that man first calculated the circumference of the earth and discovered the power of steam, only to abandon it because energy from slaves was so much cheaper. But when the Great Library was destroyed, 1,400 or more years ago, hundreds of works of philosophy, science and literature were lost, knowledge which it took the world centuries to rediscover. But later this year the Library of Alexandria will open for business once again - this time in a spectacular 120m (U.S. 180 million) building, with the worlds most advanced cataloguing system, computerised book transport, CD-roms, microfilms, internet connections and a fire prevention system to ensure it doesnt suffer the same fate as its predecessor. The new librarys roof is a tilted disc, 160m in diameter, dipping below ground level and said to symbolise the rising sun. Its circular granite-clad wall is carved with letters from almost every known alphabet. The vast reading room, with 2,000 seats, rises through seven terraces. Though it is billed as a unique research institution, a haven for scholars worldwide, the library has scarcely any money for books. Despite having the capacity to store 8m volumes, there will only be 400,000 when it opens. Its a familiar problem - and one that the ancient Egyptians solved ingeniously:

40

according to legend, they raided passing ships and forced them to hand over any scrolls on board for copying. The modern Egyptians do the same, more politely. They ask visiting businessmen and dignitaries if they happen to have any spare books. Scholars and librarians shudder at the prospect. We have trenchantly argued that this is the wrong approach, says David Wardrop, secretary of the UK Friends of the Alexandria Library. But the Egyptians say theres room for 8m books, so why worry. Short of trying to collect every book in existence, as the ancient library did, experts say that Alexandrias best hope of becoming a world-class librar y is to develop an acquisition strategy with areas of speciality. Acquisitions that fit the strategy include copies of Spains Escorial collection of Arab scholarship of the 10th-14th centuries and of Turkeys Ottoman empire documents. Up to now, the entire project has been run by Dr Mohsen Zahran, an architect, with plenty of input from Suzanne Mubarak, the wife of the Egyptian president. Recruiting a top-calibre librarian would mean paying an international salary (80,000 or more) which the Egyptians claim they cannot afford without risking a strike by librarians in the rest of the country. This may be a ploy to persuade foreign donors to stump up the money, but privately sources say that the Egyptians dont want a librarian running the show and that they already have a political figure in mind for the top job.
- by The Guardian Unlimited (National Geographic online, July 2000) http://www.ngnews.com/news/2000/06/06272000/library 2803.asp

45

10

50

15

55

20

60

25

65

30

70

35

18
2 0 Exame de Qualificao Vestibular Estadual 2001

58

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

INGLS LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS


Questo 25 The text depicts the new library of Alexandria as an extraordinary architectural landmark. The author, however, draws attention to problems characterized as: (A) financial and political (B) scholarly and nationalistic (C) geographical and historical (D) environmental and occupational Questo 26 According to the text, there is a curious parallel between ancient and modern Egyptians with regard to procedures for the compilation of reading material. The excerpt containing the description of a practice of the past is: (A) they raided passing ships and forced them to hand over any scrolls (l. 39 - 41) (B) They ask visiting businessmen and dignitaries (...) any spare books (l. 43- 45) (C) Acquisitions that fit the strategy include copies of Spains Escorial collection (l. 56 - 57) (D) sources say that the Egyptians dont want a librarian running the show (l. 70 - 72) Questo 27 A single conjunction may express multiple meanings. In Short of trying to collect every book in existence, as the ancient library did..., the word as conveys the idea of: (A) cause (B) comparison (C) simultaneity (D) contradiction Questo 28

(GUISEWITE, Cathy) http://www.uexpress.com/usp/comics/ca/pages/ca000518.html

The comic strip offers food for thought about the way men feel and behave. In Electras view, Cathys attitude reflects: (A) absence of true affection and desires (B) carelessness toward pets and loved ones (C) inconsistency between words and actions (D) deceitfulness in relation to intentions and virtues
20 Exame de Qualificao Vestibular Estadual 2001

19

59

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 29 At o sculo XVII, o papel dos espermatozides na fertilizao do vulo no era reconhecido. O cientista italiano Lazaro Spallanzani, em 1785, questionou se seria o prprio smen, ou simplesmente o vapor dele derivado, a causa do desenvolvimento do vulo. Do relatrio que escreveu a partir de seus estudos sobre a fertilizao, foi retirado o seguinte trecho: ... para decidir a questo, importante empregar um meio conveniente que permita separar o vapor da parte figurada do smen e faz-lo de tal modo, que os embries sejam mais ou menos envolvidos pelo vapor. Dentre as etapas que constituem o mtodo cientfico, esse trecho do relatrio um exemplo de: (A) anlise de dados (B) coleta de material (C) elaborao da hiptese (D) planejamento do experimento Questo 30 Para analisar o crescimento de razes, quatro mudas idnticas de violeta foram submetidas a um procedimento experimental. Trs das mudas foram colocadas em solues nutritivas contendo diferentes concentraes de cido naftaleno actico, um inibidor do crescimento de razes. As concentraes de cido utilizadas, em mol.L-1, foram: C1 = 2.10- 4 C2 = 1.10-3 C3 = 2.10-5

A quarta muda, para controle, foi colocada na mesma soluo nutritiva, porm na ausncia do inibidor. Observe o grfico abaixo:

(Adaptado de BAKER & ALLEN. Estudo de Biologia. So Paulo: Edgar Blcher, 1975.)

20

As curvas que representam o crescimento das razes para as concentraes C1, C2, C3 e de controle so, respectivamente, as de nmeros: (A) IV - III - II - I (B) III - IV - II - I (C) II - I - III - IV (D) I - II - III - IV
2 0 Exame de Qualificao Vestibular Estadual 2001

60 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 31 Dalton, em 1803, considerava o peso atmico como o peso de um tomo em relao ao peso do hidrognio. Muitos valores por ele encontrados estavam errados, pela utilizao de propores erradas dos tomos nas molculas. Dalton considerava que a frmula da gua seria HO e no H2O e que seriam necessrios 5,5 gramas de oxignio para cada grama de hidrognio em sua formao. A tabela abaixo mostra, em A, os valores que ele encontrou; em B esto indicados os valores que encontraria se utilizasse as propores corretas.

De acordo com a tabela, pode-se concluir que, para Dalton, as frmulas do anidrido carbnico e da amnia seriam, respectivamente: (A) CO2 e NH (B) CO2 e NH2 (C) CO e NH3 (D) CO e NH4 Questo 32 Segundo a lei da gravitao universal de Newton, a fora gravitacional entre dois corpos diretamente proporcional ao produto de suas massas e inversamente proporcional ao quadrado da distncia entre seus centros de gravidade. Mesmo que no seja obrigatoriamente conhecido pelos artistas, possvel identificar o conceito bsico dessa lei na seguinte citao: (A) Trate a natureza em termos do cilindro, da esfera e do cone, todos em perspectiva. (Paul Czanne) (B) Hoje, a beleza (...) o nico meio que nos manifesta puramente a fora universal que todas as coisas contm. (Piet Mondrian) (C) Na natureza jamais vemos coisa alguma isolada, mas tudo sempre em conexo com algo que lhe est diante, ao lado, abaixo ou acima. (Goethe) (D) Ocorre na natureza alguma coisa semelhante ao que acontece na msica de Wagner, que embora tocada por uma grande orquestra, intimista. (Van Gogh)

21
20 Exame de Qualificao Vestibular Estadual 2001

61 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 33 A tabela abaixo resume alguns processos celulares de oxirreduo realizados pelos organismos para atender a suas necessidades energticas.

A evoluo desses processos est relacionada evoluo das condies ambientais da terra. Assim, dos processos celulares acima, aquele que surgiu primeiro o de nmero: (A) I (B) II (C) III (D) IV

Utilize as informaes abaixo para responder questo de nmero 34.

Trechos complementares de duas cadeias de nucleotdeos de uma molcula de DNA. Observe que uma cadeia se dispe em relao outra de modo invertido.
(Adaptado de LOPES, Snia.BIO 3. So Paulo: Saraiva,1993.)

Questo 34 Considere as seguintes condies para a obteno de fragmentos de molculas de DNA: - todos os fragmentos devem ser formados por 2 pares de bases nitrogenadas; - cada fragmento deve conter as quatro diferentes bases nitrogenadas. O nmero mximo de fragmentos diferentes que podem ser assim obtidos corresponde a: (A) 14 (B) 18 (C) 12 (D) 24

22
2 0 Exame de Qualificao Vestibular Estadual 2001

62 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 35 Uma molcula de RNA m, composta pelas bases adeninaA e citosinaC, foi sintetizada experimentalmente. Sua estrutura est representada no esquema abaixo: C -A - C -A - C -A - C -A - C -A - C -A - C -A - C -A - C -A Suponha que a sntese de um peptdeo possa ser iniciada a partir de qualquer um dos extremos dessa estrutura de RNAm, sem necessidade de cdigo de iniciao ou de terminao. Nestas condies, o nmero de diferentes tipos de aminocidos encontrados nos peptdeos formados ser: (A) 4 (B) 3 (C) 2 (D) 1 Questo 36 Analise a tabela:

(Adaptado de ODUM, E. Ecologia. Rio de Janeiro: Guanabara Koogan, 1988.)

Considerando a variao dos dados apresentados, foi possvel concluir que as seis populaes esto funcionando aproximadamente no mesmo nvel trfico. Dentre as variveis apresentadas na tabela, a que permite comprovar essa concluso : (A) biomassa (B) densidade (C) fluxo de energia (D) dimenso caracterstica do indivduo

23
20 Exame de Qualificao Vestibular Estadual 2001

63 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 37 A doena de Chagas foi descrita em 1909 pelo mdico brasileiro Carlos Chagas, na regio norte de Minas Gerais. L verificou a existncia de um inseto chamado popularmente de barbeiro, que, noite, picava os habitantes da regio. Quando Chagas examinou o barbeiro viu, em seu intestino, microorganismos que ele batizou de Tripanossoma cruzi, em homenagem a Oswaldo Cruz. Chagas pde concluir que este inseto era o responsvel pela doena quando encontrou o tripanossoma em amostras humanas de: (A) fezes (B) urina (C) saliva (D) sangue

Utiliz e a tabela abaixo par ar esponder s questes de nmer os 38 e 39 . tilize para responder nmeros 39.

Questo 38 Considere, sobre os mamferos, que: - tm densidades aproximadamente iguais; - volume e superfcie externa aumentam com taxas diferentes; - geram maior quantidade de calor por unidade de massa e de tempo medida que aumenta o valor da razo entre superfcie externa e massa. O mamfero que apresenta a maior razo entre sua superfcie externa e seu volume aquele representado, na tabela, pelo seguinte nmero: (A) I (B) II (C) III (D) IV

24
2 0 Exame de Qualificao Vestibular Estadual 2001

64 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 39 O grfico que mais se aproxima da relao existente entre log x e log y :

(A)

(B)

(C)

(D)

25
20 Exame de Qualificao Vestibular Estadual 2001

65 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 40 Um estudante recebeu um quebra-cabea que contm peas numeradas de 1 a 6, representando partes de molculas.

Para montar a estrutura de uma unidade fundamental de uma protena, ele dever juntar trs peas do jogo na seguinte seqncia: (A) 1, 5 e 3 (B) 1, 5 e 6 (C) 4, 2 e 3 (D) 4, 2 e 6

Questo 41 A gua oxigenada empregada, freqentemente, como agente microbicida de ao oxidante local. A liberao do oxignio, que ocorre durante a sua decomposio, acelerada por uma enzima presente no sangue. Na limpeza de um ferimento, esse microbicida liberou, ao se decompor, 1,6 g de oxignio por segundo. Nessas condies, a velocidade de decomposio da gua oxigenada, em mol/min, igual a: (A) 6,0 (B) 5,4 (C) 3,4 (D) 1,7

26
2 0 Exame de Qualificao Vestibular Estadual 2001

66 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 42 Observe os esquemas abaixo, que representam experimentos envolvendo raios catdicos.

(Adaptado de HARTWIG, D.R. e outros. Qumica geral e inorgnica. So Paulo: Scipione, 1999.)

Desses experimentos resultou a descoberta de uma partcula subatmica. As propriedades massa e carga eltrica dessa partcula apresentam, respectivamente, a seguinte caracterizao: (A) igual a zero; igual a zero (B) igual a zero; maior que zero (C) diferente de zero; igual a zero (D) diferente de zero; menor que zero

Questo 43 O processo de aquecimento baseado em energia solar consiste na utilizao de um produto denominado sal de Glauber, representado por Na2SO4.10H2O, que se transforma segundo as equaes abaixo: Dia: Na2SO4.10H2O(s) + energia solar Na2SO4(s) + 10H2O(l)

Noite: Na2SO4(s)+ 10H2O(v)

Na2SO4.10H2O(s) + calor liberado

Considere, na equao relativa noite, que o calor liberado seja de 20 kcal/mol de Na 2SO 4.10 H 2O, para um rendimento hipottico de 100 % da reao. Para aquecer uma casa cujo consumo de 10.000 kcal durante uma noite, a massa de sal de Glauber que dever ser utilizada, em kg, corresponde a: (A) 161 (B) 101 (C) 71 (D) 51

27
20 Exame de Qualificao Vestibular Estadual 2001

67 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 44 A figura abaixo representa o tomo de um elemento qumico, de acordo com o modelo de Bohr.

(HARTWIG, D.R. e outros. Qumica geral e inorgnica. So Paulo: Scipione, 1999.)

Para adquirir estabilidade, um tomo do elemento representado pela figura dever efetuar ligao qumica com um nico tomo de outro elemento, cujo smbolo : (A) C (B) F (C) P (D) S Questo 45 Um fertilizante de larga utilizao o nitrato de amnio, de frmula NH4NO3. Para uma determinada cultura, o fabricante recomenda a aplicao de 1 L de soluo de nitrato de amnio de concentrao 0,5 mol.L-1 por m2 de plantao. A figura abaixo indica as dimenses do terreno que o agricultor utilizar para o plantio.

A massa de nitrato de amnio, em quilogramas, que o agricultor dever empregar para fertilizar sua cultura, de acordo com a recomendao do fabricante, igual a: (A) 120 (B) 150 (C) 180 (D) 200
2 0 Exame de Qualificao Vestibular Estadual 2001

28

68 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 46 Divulgou-se, recentemente, que cientistas brasileiros extraram tomos de carbono a partir de lcool etlico obtido da cana-de-acar. Esses tomos foram grupados de modo a formar um cristal de diamante. Em sua fabricao so despendidas 24 horas para que se obtenha uma placa de 1 cm2. Suponha que esses cientistas, nas mesmas condies e mantendo o ritmo de produo constante, quisessem produzir uma placa quadrada, com 1 m de lado e mesma espessura da anterior. A ordem de grandeza do tempo necessrio, em horas, para que o trabalho seja concludo : (A) 105 (B) 104 (C) 103 (D) 102

Utilize os dados abaixo para responder s questes de nmeros 47 e 48.


Durante um experimento, um pesquisador anotou as posies de dois mveis A e B, elaborando a tabela abaixo.

O movimento de A uniforme e o de B uniformemente variado.

Questo 47 A acelerao do mvel B , em m/s2, igual a: (A) 2,5 (B) 5,0 (C) 10,0 (D) 12,5 Questo 48 A distncia, em metros, entre os mveis A e B, no instante t = 6 segundos, corresponde a: (A) 45 (B) 50 (C) 55 (D) 60
20 Exame de Qualificao Vestibular Estadual 2001

29

69 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Utilize as informaes abaixo para responder s questes de nmeros 49 e 50.


Em um parque de diverses h um brinquedo que tem como modelo um avio. Esse brinquedo est ligado, por um brao AC, a um eixo central giratrio CD, como ilustra a figura abaixo:

Enquanto o eixo gira com uma velocidade angular de mdulo constante, o piloto dispe de um comando que pode expandir ou contrair o cilindro hidrulico BD, fazendo o ngulo variar, para que o avio suba ou desa.

Questo 49 A medida do raio r da trajetria descrita pelo ponto A, em funo do ngulo , equivale a: (A) 6 sen (B) 4 sen (C) 3 sen (D) 2 sen Questo 50 Quando o brao AC est perpendicular ao eixo central, o ponto A tem velocidade escalar v1. Se v2 a velocidade escalar do mesmo ponto quando o ngulo corresponde a 60, ento a razo v igual a: 1 (A) 0,75 (B) 0,85 (C) 0,90 (D) 1,00
2 0 Exame de Qualificao Vestibular Estadual 2001

v2

30

70 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 51 Considere um carro de trao dianteira que acelera no sentido indicado na figura abaixo.

O motor capaz de impor s rodas de trao um determinado sentido de rotao. S h movimento quando h atrito esttico, pois, na sua ausncia, as rodas de trao patinam sobre o solo, como acontece em um terreno enlameado. O diagrama que representa corretamente as foras de atrito esttico que o solo exerce sobre as rodas : (A)

(B)

(C)

(D) Questo 52 Um tcnico, utilizando uma fonte trmica de potncia eficaz igual a 100 W, realiza uma experincia para determinar a quantidade de energia necessria para fundir completamente 100 g de chumbo, a partir da temperatura de 27 C. Ele anota os dados da variao da temperatura em funo do tempo, ao longo da experincia, e constri o grfico abaixo.

Se o chumbo tem calor especfico igual a 0,13 J/g C e calor latente de fuso igual a 25 J/g, ento o instante T do grfico, em segundos, e a energia total consumida, em joules, correspondem, respectivamente, a: (A) 25 e 2.500 (B) 39 e 3.900 (C) 25 e 5.200 (D) 39 e 6.400
20 Exame de Qualificao Vestibular Estadual 2001

31

71 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 53 Uma pessoa gira uma bola presa a um fio. Por mais rpido que seja o movimento da bola, as duas extremidades do fio nunca chegam a ficar no mesmo plano horizontal. Considere o sistema de referncia inercial:

As projees das foras T trao no fio e P peso da bola sobre os eixos X e Y , respectivamente, esto melhor representadas em:

(A)

(B)

(C)

(D)

Questo 54 O movimento uniformemente acelerado de um objeto pode ser representado pela seguinte progresso aritmtica:
7 11 15 19 23 27 ...

Esses nmeros representam os deslocamentos, em metros, realizados pelo objeto, a cada segundo. Portanto, a funo horria que descreve a posio desse objeto : (A) 3t + 4t2 (B) 5t + 2t2 (C) 1 + 2t + 4t2 (D) 2 + 3t + 2t2
2 0 Exame de Qualificao Vestibular Estadual 2001

32

72 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 55 As figuras abaixo mostram dois tipos de alavanca: a alavanca interfixa (I) e a alavanca inter-resistente (II). Esto indicadas, em ambas as figuras, a fora no apoio N, a fora de resistncia R e a fora de ao F.

Esses dois tipos de alavanca so, respectivamente, a base para o funcionamento das seguintes mquinas simples: (A) alicate e pina (B) tesoura e quebra-nozes (C) carrinho de mo e pegador de gelo (D) expremedor de alho e cortador de unha Questo 56 Um recipiente cilndrico de 60 cm de altura e base com 20 cm de raio est sobre uma superfcie plana horizontal e contm gua at a altura de 40 cm, conforme indicado na figura.

Imergindo-se totalmente um bloco cbico no recipiente, o nvel da gua sobe 25%. Considerando igual a 3, a medida, em cm, da aresta do cubo colocado na gua igual a: (A) 10 2 (B) 10 3 2 (C) 10 12 (D) 10 3 12

33
20 Exame de Qualificao Vestibular Estadual 2001

73

CINCIAS HUMANAS E SUAS TECNOLOGIAS Com base no texto abaixo, responda s questes de nmeros 57 e 58.

Pela primeira vez na histria da humanidade, tornou-se possvel organizar a produo, e no apenas o comrcio, em escala transnacional. Portanto, enquanto a diviso global do trabalho estava antes confinada troca de produtos entre regies especficas, hoje possvel produzir independentemente das fronteiras nacionais e continentais. (...) Na minha opinio, h certa confuso entre duas coisas bem diferentes. No h dvida de que a globalizao, em alguns aspectos, independe da atuao governamental. O mesmo no se d com a ideologia baseada na globalizao, a ideologia neoliberal do livre mercado. Essa ideologia baseia-se no pressuposto de que a liberalizao do mercado otimiza o crescimento e a riqueza no mundo, e leva melhor distribuio desse incremento. Em minha opinio, ningum nunca conseguiu justificar de maneira satisfatria essa concepo.
(Adaptado de HOBSBAWM, Eric. O novo sculo. So Paulo: Companhia das Letras, 2000.)

Questo 57 O texto expe uma diferena entre a dinmica da globalizao e a ideologia associada a esse processo. A crtica do autor a tal ideologia pode ser expressa, de forma sucinta, pelo argumento de que a: (A) atuao do Estado no resiste globalizao (B) liberdade de mercado no garante a justia social (C) expanso comercial no atravessa as fronteiras nacionais (D) opo neoliberal no defende o crescimento econmico Questo 58 No contexto apresentado por Hobsbawm, a superao de fronteiras nacionais e continentais pode parecer contraditria com as seguintes realidades: - separatismo basco; - conflitos entre catlicos e protestantes na Irlanda do Norte; - tenses autonomistas e separatistas no Canad; - foras de disperso e fragmentao no Leste Europeu; - guerras tnicas africanas. Esta aparente contradio pode ser compreendida a partir da seguinte afirmativa: (A) A revoluo tcnico-cientfica e a mundializao dos mercados acarretam os conflitos nacionalistas. (B) A globalizao e a afirmao do Estado nacional so processos coexistentes nas relaes internacionais. (C) A transformao econmica e os movimentos separatistas incrementam a formao de blocos regionais. (D) A fragmentao territorial dos Estados e as novas estratgias de consumo aceleram a concentrao de capitais.

34
20 Exame de Qualificao Vestibular Estadual 2001

74 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 59

(QUINO. Gente en su sitio. Barcelona: Lmen, 1980.)

Considere a dinmica atual da economia capitalista e o que sugerido na charge quanto ao comportamento das empresas. A partir da, possvel estabelecer uma associao com o processo econmico de: (A) criao das empresas (B) liberalizao do comrcio (C) formao de monoplios (D) acumulao primitiva do capital Questo 60
Existem dois conjuntos sociais para os quais a questo da terra constitui um fator de importncia fundamental. Um deles formado por aqueles que utilizam a posse ou a propriedade como instrumento de diversas formas de explorao e especulao. O outro grupo social formado pelos trabalhadores sem terra, pequenos produtores deslocados pelo latifndio para reas marginais ou pressionados pelo capital comercial e financeiro, e os migrantes frustrados, que sobrevivem nas periferias urbanas. A estes podem vir a agregar-se, em futuro no muito remoto, outras vtimas do processo de ajuste neoliberal, ex-funcionrios pblicos, ex-bancrios e todos os outros ex de menor nvel de qualificao.
(Adaptado de TAVARES, Maria da Conceio. Destruio no criadora. Rio de Janeiro: Record,1999.)

Segundo a viso da autora, problemas sociais no campo e na cidade esto intimamente relacionados. No caso brasileiro, esta relao se estabelece porque em ambos os espaos ocorrem, dentre outras, as seguintes situaes: (A) estagnao da economia e fuga de capitais (B) estatizao das empresas e expanso do setor financeiro (C) atenuao das desigualdades e periferizao do povoamento (D) reduo do emprego e concentrao do poder econmico

35
20 Exame de Qualificao Vestibular Estadual 2001

75 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Utilize o quadro abaixo para responder s questes de nmeros 61 e 62.

Questo 61 Pelas caractersticas dos modelos produtivos do momento da 2 Revoluo Industrial, possvel afirmar que o fordismo absorveu certos aspectos do taylorismo, incorporando novas caractersticas. Essa afirmao se justifica, dentre outras razes, porque os objetivos do fordismo, principalmente, pressupunham: (A) elevada qualificao intelectual do trabalhador ligada ao controle de tarefas sofisticadas (B) altos ganhos de produtividade vinculados a estratgias flexveis de diviso do trabalho na linha de montagem (C) reduo do custo da produo associada s potencialidades de consumo dos prprios operrios das fbricas (D) mxima utilizao do tempo de trabalho do operrio relacionada despreocupao com os contratos trabalhistas

Questo 62 A posio central ocupada pela tcnica fundamental para explicar a atual fase do capitalismo em que se insere o ps-fordismo. Esta nova forma de organizao da produo promove o seguinte conjunto de conseqncias:

. retrao do setor de comrcio e prestao de servios . ampliao de um mercado consumidor seletivo, diversificado e sofisticado (B) . intensificao das estratgias de produo e consumo em nvel internacional . reduo do fluxo de informao e dos veculos de propaganda (C) . reduo da distncia entre os estabelecimentos industriais e comerciais . acelerado ritmo de inovaes do produto com mercados pouco especializados (D) . crescente terceirizao das atividades de apoio produo e distribuio . elevados nveis de concentrao de capitais com formao de conglomerados
(A)

36
2 0 Exame de Qualificao Vestibular Estadual 2001

76 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Utilizando os trechos das composies de Chico Buarque e outros parceiros, que dizem muito sobre o perodo da ditadura militar no Brasil, responda s questes de nmeros 63 a 66.

Questo 63 Os trechos que melhor explicitam uma voz de determinao de luta contra a ditadura militar no Brasil e uma motivao para esta luta so, respectivamente, os de nmero: (A) II e V (B) III e I (C) V e II (D) VI e IV Questo 64 Sobre o chamado Milagre Brasileiro (1967-1973), uma caracterstica salientada pelo compositor no trecho V a ausncia de uma ampla poltica de: (A) reduo da inflao (B) fomento s exportaes (C) distribuio da riqueza (D) liberalizao crescente de crdito

37
20 Exame de Qualificao Vestibular Estadual 2001

77 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 65 O crescente antagonismo entre o regime e parcelas expressivas de estudantes, intelectuais e trabalhadores descontentes gerou medidas governamentais enrgicas e autoritrias. A mais significativa dessas medidas, empreendida pelo governo Costa e Silva, e a cano com a crtica mais direta ao silncio que foi imposto naquele momento, esto indicadas em: (A) edio do Ato Institucional n 5 - Clice (B) formao da Junta Militar - Meu caro amigo (C) criao do Ministrio da Economia - Milagre brasileiro (D) decretao do Ato Institucional n 2 - Apesar de voc Questo 66 Na cano Meu caro amigo, o compositor faz uma ironia que poderia ser motivada no somente pelo desencanto com o regime militar, mas tambm pela situao econmica do pas. Essa situao econmica desfavorvel manifestada pelo: (A) avano das empresas estatais desencadeando a formao dos sindicatos (B) crescimento econmico mantendo parte da populao margem do mercado consumidor (C) arrocho salarial desestimulando o crescimento dos setores mais dinmicos da economia (D) esgotamento do milagre econmico provocando a adoo de medidas contra o desemprego Questo 67

Tu s um grande apstolo do Socialismo, bonde modesto.(...) O bonde pe em contato pessoas que nunca se encontrariam talvez na vida se no existisse esse terreno neutro e ambulante, em que se misturam diariamente todas as classes da sociedade.
(BILAC, Olavo. Vossa insolncia. So Paulo: Companhia das Letras, 1996.)

(SCHWARZ, L.M.(org.). Histria da vida privada no Brasil . So Paulo: Companhia das Letras, 1998. )

O trecho da crnica de Bilac e a charge representam vises diferentes sobre aspectos da vida urbana no Rio de Janeiro, no perodo entre o final do sculo XIX e as primeiras dcadas do sculo XX. Considerando o exposto e a estrutura social brasileira, possvel concluir que a: (A) difuso das ideologias revolucionrias reduzia as barreiras sociais (B) convivncia cotidiana nos transportes coletivos no eliminava a segregao social (C) populao descendente de escravos no sofria um processo de discriminao social (D) expanso dos servios pblicos homogeneizava a organizao social do espao urbano
2 0 Exame de Qualificao Vestibular Estadual 2001

38

78 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 68

(OLIVA, J. & GIANSANTI, R. Espao e modernidade: temas da Geografia do Brasil. So Paulo: Atual, 1999.)

De acordo com a evoluo da percentagem de habitantes de cada regio metropolitana no Brasil, pode-se deduzir que, atualmente, existe a tendncia de: (A) acelerao contnua do xodo rural (B) estagnao no crescimento da populao do pas (C) reverso no crescimento das metrpoles nacionais (D) diminuio da populao absoluta das maiores concentraes urbanas Questo 69
Eu gostaria que a palavra raa no fosse utilizada para dizer que h diversidade humana. Ela acaba servindo para exagerar os efeitos das diferenas aparentes, ou seja, fsicas. No temos o direito de nos basear nas diferenas fsicas a cor da pele, o tamanho, os traos do rosto para dividir a humanidade hierarquicamente, ou seja, considerando que existem homens superiores em relao a outros que seriam postos em uma classe inferior. (...) Proponho no utilizar a palavra raa. Ela foi to explorada por pessoas ms que melhor substitu-la pelas palavras espcie humana.
(JELLOUN, T. B. O racismo explicado minha filha. So Paulo: Lettera, 2000.)

Inquiridos os brasileiros no brancos sobre sua cor, no Censo de 1980, eles responderam que era: Acastanhada, alva, bem-morena, bronzeada, bugrezinha-escura, burro-quando-foge, cabocla, cor-de-canela, encerada, meiobranca, morena-clara, morena-roxa, morenatrigueira, mulata, pretinha, queimada, rosada, ruo, sarar, tostada,...etc, num total de 136 cores declaradas.
(Adaptado de MUNANGA, K. Rediscutindo a mestiagem no Brasil. Petrpolis: Vozes, 1999.)

No primeiro texto, a questo do racismo tratada de forma terica, enquanto no segundo apresenta-se informao sobre este assunto associada realidade brasileira. Com base na posio dos autores, possvel concluir que os conceitos sociais referentes a esta questo so passveis de crtica pela seguinte razo: (A) Tm origem em tenses psicolgicas. (B) Justificam-se por caractersticas biolgicas. (C) Provocam diferentes contextos histricos. (D) Esto carregados de significados ideolgicos.
20 Exame de Qualificao Vestibular Estadual 2001

(Fonte: M. Santos, A urbanizao brasileira.)

39

79 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 70
Eu era garoto ainda quando a Fora Expedicionria Brasileira chegou Itlia. Passaram na minha cidade, porque foram de Salerno para Siena. Fazia parte do batalho um cidado italiano, que veio para c pequenino e depois se naturalizou. O pai deste soldado tinha deixado uma filha pequena na Itlia com um irmo que no conseguia ter filho nenhum. Ento o rapaz sabia que tinha uma irm em Paola, que ele no conhecia e que era criada por um tio. Pediu consentimento para os oficiais e chegou em Paola; chegou l para conhecer a irm. No sabia nem falar italiano, s falava portugus. Ningum entendia nada. A procuraram o meu pai, que falava bem o portugus e meu pai serviu de intrprete para ele poder conhecer a irm. (Depoimento de Vicenzo Figlino)
(In: GOMES, A. C. (org.). Histrias de famlia: entre a Itlia e o Brasil. Niteri: Muiraquit, 1999.)

Uma das formas que o historiador utiliza para estudar uma poca recolher depoimentos de pessoas que viveram experincias no passado. O depoimento acima pode estar identificado por um tipo de memria ligado a um contexto histrico. A alternativa que apresenta, respectivamente, a qualificao para este tipo de memria e uma referncia histrica relacionada ao depoimento, : (A) social - imigrao italiana (B) oficial - Segunda Guerra Mundial (C) oficial - Fora Expedicionria Brasileira (D) social - construo da cidadania italiana Questo 71 Relacione o texto com a mensagem do anncio:
A Amrica Latina produziu mais pobres nas ltimas dcadas do que em toda a sua histria: mais pobres, menos empregos formais, um crescimento da economia informal e um fosso crescente entre os que tm acesso a condies dignas de vida e os que vivem em situao de pobreza. (...) Cresce a excluso atravs de mecanismos autoritrios e da represso policial; aumenta a suspeita e a desconfiana como forma cotidiana de vida; diminuem os lugares de sociabilidade e de encontro coletivo, rebaixando a experincia urbana.
(Adaptado de REGUILLO, R. In: Revista Lugar Comum, n. 8, 1999.)

(Adaptado de O Globo, 01/07/2000.)

A alternativa que caracteriza a segregao social urbana nas metrpoles : (A) polticas de estado atuantes na economia visam desintegrao social nas metrpoles (B) setores da economia alimentados pela insegurana existente reforam as barreiras sociais (C) ideologias defensoras da separao permitem a acelerao do crescimento da cidade (D) segmentos da sociedade ligados marginalidade impossibilitam as polticas de distribuio de renda

40
2 0 Exame de Qualificao Vestibular Estadual 2001

80 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 72 Leia o texto sobre o Contestado (1912-1916), conflito ocorrido no sul do pas e motivado, entre outros fatores, pela disputa de terras.
A revolta teve sobretudo um carter social e religioso. O que manteve os caboclos unidos foi a crena em um profeta conhecido como monge Jos Maria, um guerreiro mstico como Antnio Conselheiro. O Contestado foi um movimento milenarista, ou seja, impregnado de temores apocalpticos e esperanas de salvao para os iniciados. Os caboclos acreditavam no fim deste mundo e no surgimento de outro melhor, sem fome nem misria. At hoje a populao local se refere ao episdio como a guerra dos fanticos, diz o historiador Paulo Pinheiro Machado, da Universidade Federal de Santa Catarina (UFSC).
(Adaptado de Superinteressante, maio de 2000.)

A expresso guerra dos fanticos era usada para definir a participao dos revoltosos e foi criada naquela poca pelas autoridades polticas e pelos latifundirios. Sob um ponto de vista crtico atual, pode-se dizer que a expresso indica a inteno de: (A) desqualificar os participantes da rebelio (B) apoiar as idias monarquistas dos revoltosos (C) enfatizar o carter degenerado dos caboclos revoltosos (D) destacar a indolncia de origem psicoclimtica dos camponeses Questo 73
Um dos documentos mais curiosos para a histria da grande data de 15 de novembro consiste, a nosso ver, no aspecto inaltervel da rua do Ouvidor, nos dias 15, 16 e 17, onde, a no ser a passagem das foras e a maior animao das pessoas, dir-se-ia nada ter acontecido. To preparado estava o nosso pas para a Repblica, to geral foi o consenso do povo a essa reforma, to unnimes as adeses que ela obteve, que a rua do Ouvidor, onde toda a nossa vida, todas as nossas perturbaes se refletem com intensidade, no perdeu absolutamente o seu carter de ponto de reunio da moda.
(Adaptado de THOME, J.Crnica do chic. 1889. Apud PRIORE, M.D. et alli. Documentos de Histria do Brasil: de Cabral aos anos 90. So Paulo: Scipione, 1997.).. .............................................

Em frase que se tornou famosa, Aristides Lobo, o propagandista da Repblica, manifestou seu desapontamento com a maneira pela qual foi proclamado o novo regime. Segundo ele, o povo, que pelo iderio republicano deveria ter sido protagonista dos acontecimentos, assistira a tudo bestializado, sem compreender o que se passava, julgando ver talvez uma parada militar.
(CARVALHO, J. M. Os bestializados: o Rio de Janeiro e a Repblica que no foi . So Paulo: Companhia das Letras, 1987. )................................................

Nos textos apresentados, encontram-se as opinies de dois observadores do fim do sculo XIX - Jos Thome e Aristides Lobo - a respeito da Proclamao da Repblica. A divergncia entre as posies dos autores sobre o evento refere-se ao seguinte aspecto: (A) iderio republicano (B) reao da populao (C) carter elitista do movimento (D) caracterizao poltica do regime

41
20 Exame de Qualificao Vestibular Estadual 2001

81 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 74
O futuro crescimento intelectual vai irradiar de So Paulo (...). O sculo XVI pertenceu a Pernambuco, o XVII Bahia, o XVIII a Minas Gerais, o XIX ao Rio de Janeiro, o sculo XX o sculo de So Paulo.
(LIMA, A.A. In: MARTINS, W. Histr ia da Inteligncia brasileira. So Paulo: Edusp, 1978.)

(CANO, W. In: LORENZO, H.C. e COSTA, W.P. A dcada de 20 e as origens do Brasil moderno. So Paulo: Unesp,1997.)

Os dados sobre o perodo de 1872 - 1920 podem indicar que o aumento da influncia intelectual da cidade de So Paulo, apontada pelo autor do texto, acompanhou a acelerao do seu crescimento demogrfico em relao ao da capital do pas. A explicao para tal acelerao pode ser encontrada no processo de: (A) formao de uma nova elite paulista de origem imigrante (B) afluxo de trabalhadores oriundos da crise da economia aucareira (C) decadncia da capital associada aos interesses das elites comerciais (D) desenvolvimento dos setores urbanos ligados economia cafeeira Questo 75

(Retrato do Brasil. So Paulo: EditoraTrs/Poltica Editora, 1984.)

As gravuras acima ressaltam aspectos da propaganda oficial sobre as prioridades polticas do primeiro perodo Vargas, principalmente do Estado Novo, que simbolizou o coroamento de um ideal de modernizao. A caracterstica econmica do perodo que pode ser identificada como predominante nas duas gravuras a nfase na: (A) indstria de base (B) rede de transportes (C) agricultura de exportao (D) produo de combustveis

42
2 0 Exame de Qualificao Vestibular Estadual 2001

82 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 76
Pode-se dizer que os fluxos migratrios entre Brasil e Japo conheceram dois momentos. No primeiro deles, ocorrido h quase 100 anos, o Brasil recebia imigrantes. Na atualidade, o fluxo se inverteu e o pas envia para o Japo os dekasseguis, descendentes dos imigrantes do primeiro momento. O que caracteriza a situao da maioria da populao migrante, no primeiro e no segundo momento, respectivamente, est apontado na seguinte alternativa:

(A) . eram colonos atrados pelo governo brasileiro . chegam na condio de trabalhadores ilegais (B) . eram grandes proprietrios de terra arruinados . exercem ofcios agrcolas em pequenas propriedades (C) . trabalhavam em atividades agrcolas de exportao . desempenham atividades pouco qualificadas no meio urbano (D) . representavam estrangeiros marginalizados no mercado de trabalho . possuem dupla nacionalidade com igualdade de direitos Questo 77

(Adaptado de Retrato do Brasil. So Paulo: Editora Trs/Poltica Editora, 1984.)

Considerando os dados acima e as alteraes dos textos constitucionais brasileiros, a partir das eleies presidenciais de 1945, podemos identificar uma mudana na participao da sociedade nos destinos da nao. O processo e a causa associados a essa mudana so, respectivamente: (A) aumento da participao popular - fim da restrio ao voto feminino (B) acelerao demogrfica - revoluo urbano-sanitria do ps-guerra (C) permisso do voto dos analfabetos - ampliao numrica dos eleitores (D) crescimento percentual de votantes - maior mobilidade poltico-partidria

43
20 Exame de Qualificao Vestibular Estadual 2001

83 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 78 Leia o quadro e o texto.

(VICENTINO, C. Rssia antes e depois da URSS. So Paulo: Scipione, 1995.)

Um elemento que contribui para a difuso do nacionalismo entre as minorias o colapso das instituies do Estado. O fracasso em preencher necessidades bsicas das pessoas e a inexistncia de estruturas alternativas satisfatrias so fatores-chave para a compreenso da inesperada proliferao de movimentos nacionalistas na antiga Unio Sovitica, onde novas estruturas de Estado esto em processo de estabelecimento, mas ainda no podem prover a segurana e o bem-estar de seus componentes.
(Adaptado de GUIBERNAU, M. Nacionalismos: o estado nacional e o nacionalismo no sculo XX . Rio de Janeiro: Jorge Zahar Editora, 1997.)

Muitos dos problemas polticos vividos hoje nas ex-repblicas soviticas decorrem da poltica de expanso das populaes russas durante o perodo socialista. Analisando-se o problema nacionalista nos pases indicados no quadro e a composio tnica de suas populaes, a conseqncia poltica que pode ser identificada : (A) oposio ao regime socialista russo (B) separatismo frente ao regime de Moscou (C) ressentimento contra as minorias russas (D) conflito entre as etnias majoritrias soviticas

44
2 0 Exame de Qualificao Vestibular Estadual 2001

(Fonte: The Economist, dezembro/ 1994)

84 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 79 Observe o mapa de unidades de conservao ambiental.

(DEAN, Warren. A ferro e fogo. So Paulo: Companhia das Letras, 1997.)

A rea de maior concentrao das unidades de conservao ambiental apresentadas, sua respectiva caracterizao e a razo de sua ocorrncia esto indicadas na seguinte alternativa: (A) sul do pas / clima temperado / tecnologia de conservao mais desenvolvida (B) domnio da caatinga / maior densidade demogrfica / maior vigilncia pelo Estado (C) domnio do cerrado / propenso a incndios naturais / concentrao de esforos de preservao pelo Estado (D) litoral do Sudeste / maior devastao ao longo da histria / presso da populao pela conservao dos recursos

45
20 Exame de Qualificao Vestibular Estadual 2001

85 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 80

(Ferno Vaz Dourado, 1570. In: BERTRAN, P. Histria da terra e do homem no Planalto Central. Braslia: Solo, 1994.)

A crena na existncia de minerais preciosos no Brasil alimentou o imaginrio dos colonizadores e colonos portugueses. Um dos mitos que alimentava o desejo de encontrar ouro nos rios era o da existncia de um suposto Lago Dourado, que originaria as bacias Amaznica, Platina e do So Francisco. Quanto representao cartogrfica, o fator que melhor explica a distoro do mapa est apontado em: (A) expectativas sociais do momento (B) projetos governamentais de poca (C) articulaes econmicas no territrio (D) caractersticas naturais do espao geogrfico
2 0 Exame de Qualificao Vestibular Estadual 2001

46

86

GABARITO OFICIAL - 2 EXAME DE QUALIFICAO

01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20

D C D D B D C A C B A B A D C B A A C B

ESPANHOL

25 26 27 28

A B A C

FRANCS

25 26 27 28

B D C C

INGLS

25 26 27 28

A A B C

29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48

D C A C B B C C D A C D A D A D A A C B

55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74

B D B B C D C D B C A B B C D A B A B D

21 - C 22 - D 23 - C 24 - B

49 - A 50 - B 51 - B 52 - D 53 - C 54 - B

75 - A 76 - C 77 - A 78 - C 79 - D 80 - A

87

1a FASE - 1o EXAME DE QU ALIFIC AO QUALIFIC ALIFICAO

27/05/2001

Neste caderno voc encontrar um conjunto de 40 (quarenta) pginas numeradas seqencialmente, contendo 64 (sessenta e quatro) questes das seguintes reas: Linguagens, Cdigos e suas Tecnologias; Cincias da Natureza, Matemtica e suas Tecnologias; Cincias Humanas e suas Tecnologias. A tabela peridica encontra-se na litima pgina. No abra o caderno antes de receber autorizao.

INSTRUES

I. Verifique se o seu nome, nmero de inscrio, nmero do documento de identidade e


lngua estrangeira escolhida esto corretos no carto de respostas. Se houver erro, notifique o fiscal. Assine o carto de respostas com caneta.

2. Ao receber autorizao para abrir este caderno, verifique se a impresso, a paginao e a numerao das questes esto corretas. Caso ocorra qualquer erro, notifique o fiscal. 3. As
questes de nmeros 17 a 22 da rea de Linguagens, Cdigos e suas Tecnologias devero ser respondidas de acordo com a sua opo de Lngua Estrangeira: Espanhol, Francs ou Ingls.

4. Leia atentamente cada questo e escolha a alternativa que mais adequadamente responde
a cada uma delas. Marque sua resposta no carto de respostas, cobrindo fortemente o espao correspondente letra a ser assinalada; utilize caneta preta, preferencialmente, ou lpis preto n 2, conforme o exemplo abaixo:
1 A B C D

5. A leitora de marcas no registrar as respostas em que houver falta de nitidez


e/ou marcao de mais de uma letra.

6. O carto de respostas no pode ser dobrado, amassado, rasurado ou manchado. Exceto


sua assinatura, nada deve ser escrito ou registrado fora dos locais destinados s respostas.

7. Voc dispe de 4 (quatro) horas para fazer esta prova. 8. Ao terminar a prova, entregue ao fiscal o carto de respostas e este caderno.
BOA PROVA!

88

LINGUAGENS, CDIGOS ECDIGOS SUAS TECNOLOGIAS LINGUAGENS, E SUAS TECNOLOGIAS Questo 01


A CRISE

Perdo, cavalheiro, este osso meu: fui eu quem o viu primeiro.


(RAUL. Revista Fon-Fon, 06/06/1914.)

Na charge de Raul, composta por ttulo, desenho e legenda, h vrios contrastes. O contraste que melhor refora o ttulo da charge : (A) um senhor de fraque e chapu olha um mendigo (B) um homem e um co disputam o mesmo alimento (C) um mendigo com fome faz uma frase polida e formal (D) o co faminto olha para o mendigo e no para o osso

Questo 02
A caricatura no tem por objeto principal fazer rir. Isto to certo que h caricaturas lgubres. Porque encontra o riso em seu caminho, a caricatura afinal no tem nada duma arte do riso, como tm avanado muitos autores, e assim a considera o preconceito corrente. (...) Longe de ser um testemunho da alegria, o prprio exagero caricatural no seno um meio, nas mos do artista, para exprimir seu rancor. No h por que nos surpreendermos com isso. Como, realmente, fora de muito advertidos a respeito daquilo que mascara a mmica social, no cairmos em meditao cheia de desgosto? Como no nos deixarmos possuir por uma espcie de desencantamento, uma como que fadiga da alma, custa de muito vermos e de vermos muito bem?
(GAULTIER, Paul. In: LIMA, Herman. Histria da caricatura no Brasil. Rio de Janeiro: Jos Olympio, 1963.)

Porque encontra o riso em seu caminho, a caricatura afinal no tem nada duma arte do riso... Neste trecho, percebemos que o conectivo porque est sendo empregado com um significado diferente do usual. A substituio do conectivo que preserva o sentido original do trecho : (A) Se encontrar o riso em seu caminho, ... (B) Ainda que encontre o riso em seu caminho, ... (C) J tendo encontrado o riso em seu caminho, ... (D) Em virtude de encontrar o riso em seu caminho, ...

2
10 Exame de Qualificao Vestibular Estadual 2002

89 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 03
Comenta-se, um pouco rpido demais, que a predileo que os leitores sentimos por um ou outro personagem vem da facilidade com que nos identificamos com eles. Esta formulao exige algumas pontuaes: no que nos identifiquemos com o personagem, mas sim que este nos identifica, nos aclara e define frente a ns mesmos; algo em ns se identifica com essa individualidade imaginria, algo contraditrio com outras identificaes semelhantes, algo que de outro modo apenas em sonhos haveria logrado estatuto de natureza. A paixo pela literatura tambm uma maneira de reconhecer que cada um somos muitos, e que dessa raiz, oposta ao senso comum em que vivemos, brota o prazer literrio.
(Traduzido de SAVATER, Fernando. Criaturas del aire. Barcelona: Ediciones Destino, 1989.)

Este texto trata de um conceito importante na teoria da literatura: o conceito de catarse. De acordo com o autor, pode-se definir catarse como o processo que afeta o leitor no sentido de: (A) valorizar o imaginrio (B) superar o senso comum (C) construir a personalidade (D) liberar emoes reprimidas

Questo 04 Observe atentamente os dois trechos transcritos abaixo.


... o objetivo da poesia (e da arte literria em geral) no o real concreto, o verdadeiro, aquilo que de fato aconteceu, mas sim o verossmil, o que pode acontecer, considerado na sua universalidade.
(SILVA, Vtor M. de A. Teoria da Literatura. Coimbra: Almedina, 1982.)

Verossmil. 1. Semelhante verdade; que parece verdadeiro. 2. Que no repugna verdade, provvel.
(FERREIRA, A. B. de Holanda. Novo Dicionrio Aurlio da Lngua Portuguesa. Rio de Janeiro: Nova Fronteira, 1986.)

A partir da leitura de ambos os fragmentos, pode-se deduzir que a obra literria tem o seguinte objetivo: (A) opor-se ao real para afirmar a imaginao criadora (B) anular a realidade concreta para superar contradies aparentes (C) construir uma aparncia de realidade para expressar dado sentido (D) buscar uma parcela representativa do real para contestar sua validade

3
10 Exame de Qualificao Vestibular Estadual 2002

90 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Com base no te xto abaixo ,r esponda s questes de nmer os 05 a 08. . texto abaixo, responda nmeros
EM DEFESA DA RAZO

05

10

Estou chegando aos 70 anos. Minha gerao assistiu a mais revolues cientficas, tecnolgicas e sociais do que todas as geraes anteriores. Com essa experincia de vida, preocupa-me o que estamos deixando para os nossos netos: um mundo onde as pessoas desconfiam dos cientistas e se entregam s crendices. Um mundo de violncia, injustia e desencanto, que abre espao para a explorao do desespero da populao. Durante dcadas, lutei desesperadamente para trazer racionalidade s geraes que me sucederiam, acreditando na cincia e em suas conquistas. A caminhada do homem na Lua, as fotos dos planetas distantes, os computadores, a televiso direta dos satlites, as vacinas que eliminaram da face da Terra a varola e a poliomielite, os remdios desenhados em computadores que curam o cncer quando detectado a tempo, os transplantes de corao e rins, a biotecnologia gerando plantas mais resistentes e mais produtivas, que liquidaram com a profecia de Malthus, afastando o perigo da fome universal. E, apesar disso, o que colhemos? Uma gerao de crdulos sem capacidade crtica. At mesmo as pessoas que seguiram carreira tcnico-cientfica no entendem a racionalidade da cincia. Consomem toneladas de pseudomedicamentos sem nenhum efeito positivo para o organismo. Engolem comprimidos de vitaminas que sero eliminadas na urina. Consomem extratos de plantas com substncias txicas e abandonam o tratamento mdico. Gastam fortunas com diferentes marcas de xampu que contm sempre o mesmo detergente, mas anunciam alimentos para os cabelos, quando estes recebem nutrientes diretamente do sangue que irriga suas razes. H os que untam o rosto com colgeno gelia de mocot e ovos e acham que esto rejuvenescendo. Fui professor de colgio e de faculdade de medicina. Fiz pesquisas, formei uma dzia de discpulos que hoje pesquisam, so professores universitrios e j criaram meia centena de meus netos intelectuais. Na universidade, desenvolvi um novo modelo de ensino mdio.

50

Revolucionei o ensino das cincias nas escolas e improvisei na televiso o primeiro programa de ensino de cincia. Produzimos novos livros substituindo totalmente o contedo do ensino. Por tudo isso, fico pasmado ao ver que, s portas do ano 2000, as pessoas lem horscopos sem jamais comparar as previses da vspera com o que realmente aconteceu. Desconfiam dos cientistas, mas acreditam nas cartomantes, que prevem o bvio. Formamos uma gerao de pseudo-educados, que querem ser enganados nas farmcias, pelos curandeiros que enfiam agulhas em seus ps e manipulam sua coluna, pelos ufologistas, que vem extraterrestres chegar e sair sem ser detectados pelos radares. Uma gerao que se deixa levar por benzedeiras e charlates com suas poes, por anncios desonestos na televiso e por pregadores a quem entregam parte do salrio. Saem as descobertas e as experincias cientficas e entram os duendes, anjos e bruxos. Mas nem tudo est perdido. Ainda h quem encontre motivao para se guiar pelo racionalismo e pela cincia e para mudar. E h muito que fazer. preciso combater o irracionalismo e as mistificaes, onde quer que eles se manifestem: na televiso, nos locais de trabalho, nas faculdades. Podemos comear pela educao. Hoje, as pessoas passam um tero da vida nas salas de aula sem aprender e ningum se importa. Criamos robs que nos permitem ter uma produo cada vez maior de bens, mas ficamos prisioneiros de uma sociedade cada vez menos justa. Numa sociedade em que a cincia expandiu a longevidade do homem, no oferecemos maioria da populao segurana fsica nem acesso ao que a medicina moderna pode oferecer nem mesmo a garantia de teto e comida. Enfim, criamos um campo propcio para a proliferao dos enganadores. Est na hora de quebrar a insensibilidade dos governos e das lideranas para tentar corrigir isso. No ser nos entregando irracionalidade que sairemos desse buraco e construiremos um futuro melhor para os nossos netos.
(RAW, Isaias. Veja, 09/04/1996 .)

55

60

15

65

20

70

25

75

30

80

35

85

40

90

45

1 Exame de Qualificao Vestibular Estadual 2002

91 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 05 Para criticar o comportamento da nova gerao, o autor utiliza, na construo do texto, uma estratgia que demonstra seu distanciamento em relao ao misticismo e ao irracionalismo. Pode-se afirmar que essa estratgia constri-se fundamentalmente a partir do seguinte dado fornecido pelo texto: (A) crtica insensibilidade dos governos (B) constatao da crendice das pessoas (C) vivncia profissional do autor (D) avano do ensino da cincia Questo 06 Observe o enunciado abaixo:
Em suma: toda declarao (ou juzo) que expresse opinio pessoal ou pretenda estabelecer a verdade s ter validade se devidamente demonstrada, isto , se apoiada ou fundamentada na evidncia dos fatos, quer dizer, se acompanhada de prova.
(GARCIA, Othon M. Comunicao em prosa moderna. Rio de Janeiro: FGV, 1999.)

Em sua crtica ao que caracteriza como crendice ou irracionalismo, o autor do texto Em defesa da razo faz diversas declaraes. O exemplo de declarao feita no texto que mais se aproxima do critrio de validade, conforme o enunciado transcrito, : (A) ... um mundo onde as pessoas desconfiam dos cientistas e se entregam s crendices. Um mundo de violncia, injustia e desencanto, que abre espao para a explorao do desespero da populao. (l. 06 - 10) (B) Gastam fortunas com diferentes marcas de xampu que contm sempre o mesmo detergente, mas anunciam alimentos para os cabelos, quando estes recebem nutrientes diretamente do sangue que irriga suas razes. (l. 35 - 40) (C) Uma gerao que se deixa levar por benzedeiras e charlates com suas poes, por anncios desonestos na televiso e por pregadores a quem entregam parte do salrio. (l. 64 - 67) (D) Enfim, criamos um campo propcio para a proliferao dos enganadores. Est na hora de quebrar a insensibilidade dos governos e das lideranas para tentar corrigir isso. (l. 88 - 91) Questo 07 O primeiro pargrafo constitui uma das formas clssicas de fazer a introduo de um texto argumentativo, porque contm resumidamente elementos essenciais ao desenvolvimento das idias do autor. Tais elementos, no caso deste texto, podem ser definidos como: (A) declarao de natureza subjetiva enumerao de subtemas (B) registro de testemunho histrico exemplificao do problema (C) questionamento de conceito preestabelecido delimitao do tema (D) afirmao da autoridade do enunciador apresentao do problema

5
10 Exame de Qualificao Vestibular Estadual 2002

92 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 08 No penltimo pargrafo do texto, a partir da linha - preciso combater... (l. 73) os perodos no se iniciam por conectivos ou palavras de ligao. No entanto, possvel compreender sua unidade como partes de um mesmo pargrafo. Neste caso, a unidade interna do pargrafo dada por uma relao de sentido entre suas partes. Tal relao pode ser identificada porque cada perodo assume a funo de: (A) representar um desenvolvimento da idia E h muito que fazer. (B) constituir uma exemplificao da idia Mas nem tudo est perdido. (C) contestar a generalizao da idia Podemos comear pela educao. (D) apresentar uma negao da idia preciso combater o irracionalismo

Com base no texto abaixo, responda s questes de nmeros 09 a 12 12.


UM BOI V OS HOMENS

To delicados (mais que um arbusto) e correm e correm de um para outro lado, sempre esquecidos de alguma coisa. Certamente, falta-lhes no sei que atributo essencial, posto se apresentem nobres
05

e graves, por vezes. Ah, espantosamente graves, at sinistros. Coitados, dir-se-ia que no escutam nem o canto do ar nem os segredos do feno, como tambm parecem no enxergar o que visvel e comum a cada um de ns, no espao. E ficam tristes

10

e no rasto da tristeza chegam crueldade. Toda a expresso deles mora nos olhos e perde-se a um simples baixar de clios, a uma sombra. Nada nos plos, nos extremos de inconcebvel fragilidade, e como neles h pouca montanha,

15

e que secura e que reentrncias e que impossibilidade de se organizarem em formas calmas, permanentes e necessrias. Tm, talvez, certa graa melanclica (um minuto) e com isto se fazem perdoar a agitao incmoda e o translcido

20

vazio interior que os torna to pobres e carecidos de emitir sons absurdos e agnicos: desejo, amor, cime (que sabemos ns?), sons que se despedaam e tombam no campo como pedras aflitas e queimam a erva e a gua, e difcil, depois disto, ruminarmos nossa verdade.
(ANDRADE, Carlos Drummond de. Reunio: 10 livros de poesia. Rio de Janeiro: Jos Olympio, 1977.)

6
10 Exame de Qualificao Vestibular Estadual 2002

93 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 09 O poema de Drummond procura ver os seres humanos de um ponto de vista no-humano. Se fizermos uma correlao entre a construo deste texto e a prpria literatura, podemos perceber na literatura a capacidade fundamental de: (A) espelhar a realidade do homem (B) deslocar a perspectiva do leitor (C) estabelecer uma negao do cotidiano (D) promover a ratificao do senso comum Questo 10 O boi o eu potico declarado no ttulo apresenta sua viso sobre os homens e a eles se refere como coitados, expressando uma atitude de superioridade que enfatiza, ao longo do texto, a fragilidade humana. O fragmento em que essa fragilidade dos homens est explicitamente demonstrada pelo eu potico : (A) Ah, espantosamente graves, / at sinistros. (v. 05 - 06) (B) E ficam tristes / e no rasto da tristeza chegam crueldade. (v. 09 - 10) (C) Tm, talvez, / certa graa melanclica (v. 17 - 18) (D) o translcido / vazio interior que os torna to pobres (v. 19 - 20) Questo 11 To delicados (mais que um arbusto) e correm / e correm de um para outro lado, ... (v. 01 - 02) Pela leitura dos versos acima, pode-se afirmar que a repetio estilstica do conectivo e assume o seguinte sentido na caracterizao dos homens: (A) revela uma gravidade pessoal (B) enfatiza uma atitude obsessiva (C) aponta uma inquietude interior (D) insinua uma crueldade escondida Questo 12 comum encontrar nos livros escolares a definio de predicado como aquilo que se declara sobre o sujeito de uma orao. Essa definio de predicado, entretanto, no suficiente para identific-lo em todas as suas ocorrncias. O exemplo em que no se poderia identificar o predicado pela definio dada : (A) falta-lhes / no sei que atributo essencial, (v. 3 - 4) (B) Toda a expresso deles mora nos olhos (v. 11) (C) neles h pouca montanha, (v. 14) (D) sons que se despedaam (v. 22)

7
10 Exame de Qualificao Vestibular Estadual 2002

94 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Com base no texto abaixo, responda s questes de nmeros 13 a 15 15.


SONATA (TRECHO)

05

10

A histria que vou contar no tem a rigor um princpio, um meio e um fim. O Tempo um rio sem nascentes a correr incessantemente para a Eternidade, mas bem se pode dar que em inesperados trechos de seu curso o nosso barco se afaste da correnteza, derivando para algum brao morto, feito de antigas guas ficadas, e s Deus sabe o que ento nos poder acontecer. No entanto, para facilitar a narrativa, vamos supor que tudo tenha comeado naquela tarde de abril. Era o primeiro ano da Guerra e eu evitava ler os jornais ou dar ouvidos s pessoas que falavam em combates, bombardeios e movimentos de tropas. Os alemes rompero facilmente a linha Maginot, assegurou-me um dia o desconhecido que se sentara a meu lado num banco de praa. Em poucas semanas estaro senhores de Paris. Sacudi a cabea e repliquei: Impossvel. Paris no uma cidade do espao, mas do tempo. um estado de alma e como tal inacessvel s Panzerdivisionen1. O homem lanou-me um olhar enviesado, misto de estranheza e alarma. Ora, estou habituado a ser olhado desse modo. Um luntico! o que murmuram de mim os inquilinos da casa de cmodos onde tenho um quarto alugado, com direito mesa parca e ao banheiro coletivo. E natural que pensem assim. Sou um sujeito um tanto esquisito, um tmido, um solitrio que s vezes passa horas inteiras a conversar consigo mesmo em voz alta. Bicho-de-concha!- j disseram de mim. Sim, mas a esta apagada ostra no resta nem o consolo de ter produzido em sua

40

solido alguma prola rara, a no ser... Mas no devo antecipar nem julgar. Homem de necessidades modestas, o que ganho, dando lies de piano a domiclio, basta para o meu sustento e ainda me permite comprar discos de gramofone e ir de vez em quando a concertos. Quase todas as noites, depois de vaguear sozinho pelas ruas, recolho-me ao quarto, ponho a eletrola a funcionar e, estendido na cama, cerro os olhos e fico a escutar os ltimos quartetos de Beethoven, tentando descobrir o que teria querido dizer o Velho com esta ou aquela frase. Tenho no quarto um piano no qual costumo tocar as minhas prprias composies, que nunca tive a coragem nem a necessidade de mostrar a ningum. Disse um poeta que Entre a idia e a realidade Entre o movimento E o ato Cai a Sombra. Pois entre essa Sombra e a mal-entrevista claridade duma esperana vivia eu, aparentemente sem outra ambio que a de manter a paz e a solitude. No Inverno, na Primavera e no Vero sinto-me como que exilado, s encontrando o meu clima nativo, o meu reino e o meu nicho no Outono a estao que envolve as pessoas e as coisas numa surdina lils. como se Deus armasse e iluminasse o palco do mundo especialmente para seus mistrios prediletos, de modo que a qualquer minuto um milagre pode acontecer.
(VERSSIMO, rico. Contos. Porto Alegre: Globo, 1980.)

45

50

15

55

20

60

25

65

30

70

35

75

Panzerdivisionen - divises nazistas de ataque

8
10 Exame de Qualificao Vestibular Estadual 2002

95 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 13 Este trecho faz parte do incio de um conto. Seu narrador alerta o leitor para o carter ficcional do relato que passar a ler. Isso se d por meio do seguinte recurso: (A) assumir uma histria sem princpio, meio e fim (B) construir uma frase longa com ritmo fluente de narrativa (C) usar o verbo supor como marca de incio dos acontecimentos (D) sugerir o Tempo e a Eternidade como metforas humanizadas

Questo 14 O incio do conto Sonata estabelece as referncias para categorias importantes da narrativa. As categorias de tempo, espao e o carter do personagem-narrador so delimitados, respectivamente, pelos seguintes elementos do texto: (A) outono, ruas, piano (B) tempo, rio sem nascentes, barco (C) Segunda Guerra, Paris, Beethoven (D) gramofone, cmodos, bicho-de-concha

Questo 15 como se Deus armasse e iluminasse o palco do mundo especialmente para seus mistrios prediletos, de modo que a qualquer minuto um milagre pode acontecer. (l. 72 - 76) O perodo acima, por meio da expresso como se, estabelece relao de sentido com a orao anterior. A reescritura que explicita melhor essa relao, mantendo o sentido do perodo, : (A) como se Deus armasse e iluminasse o palco do mundo especialmente para seus mistrios prediletos, numa surdina lils, ... (B) O Outono como Deus, armando e iluminando o palco do mundo, numa surdina lils, especialmente para seus mistrios prediletos, ... (C) Deus, no Outono, envolve as coisas e as pessoas numa surdina lils, armando e iluminando o palco do mundo especialmente para seus mistrios prediletos, ... (D) O Outono envolve as coisas e as pessoas numa surdina lils, como se Deus armasse e iluminasse o palco do mundo especialmente para seus mistrios prediletos, ...

9
10 Exame de Qualificao Vestibular Estadual 2002

96 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 16 Digamos que um poltico em campanha eleitoral afirme:


se um partido mais organizado, devemos votar nele; ora, o meu partido mais organizado; logo, vocs devem votar nos candidatos do meu partido; como um destes candidatos sou eu mesmo, no lhes parece bastante razovel que vocs votem em mim?

Para apoiar sua tese, ele recorre a um professor de Lgica que, consultado, concorda que o argumento vlido. Entretanto, o argumento do candidato pode ser questionado. Este questionamento, segundo os mesmos princpios de Lgica, deve defender que: (A) quando se admite a validade de um argumento, no se admite ao mesmo tempo a sua verdade (B) uma vez que o professor de Lgica humano, ele pode estar to errado quanto o candidato (C) j que o exerccio da democracia exige compromisso poltico, no se pode pautar o voto apenas pela lgica (D) como o argumento do candidato beneficia todos os candidatos do seu partido, tanto faz votar nele como nos outros

10
10 Exame de Qualificao Vestibular Estadual 2002

97 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS LINGUAGENS, CDIGOS E SUAS ESPANHOL TECNOLOGIAS

Com base no texto abaixo, responda s questes de nmeros 17 a 20.


BRASIL PIDE A LA ONU QUE RECONOZCA EL DERECHO A FABRICAR Y VENDER GENRICOS CONTRA EL SIDA
EL PAS HA LOGRADO, CON SUS PROPIOS FRMACOS, REDUCIR UN 50% LAS MUERTES POR LA EPIDEMIA

05

10

Brasil, el pas con el mayor nmero de enfermos de sida de Iberoamrica, unos 500.000 en una poblacin de 172 millones, y que ha logrado reducir a la mitad las muertes por la epidemia gracias a sus propios frmacos genricos, urgi el pasado lunes a la ONU a reconocer el derecho de los pases a fabricar medicamentos antisida sin pagar patente. Brasil pidi en la reunin preparatoria de la prxima Asamblea General de la ONU de junio que se permita a todos los pases importar a bajo precio genricos contra la enfermedad. La postura brasilea sintetiza dos reivindicaciones que levantan ampollas en la Organizacin Mundial del Comercio (OMC), cuyas normas - apoyadas por Estados Unidos y las multinacionales farmacuticas - exigen que los laboratorios mantengan la propiedad de las patentes 20 aos. Los pases pobres piden libertad para fabricar y comerciar con genricos. La empresa india de genricos Cipla ha ofrecido su propio cctel antisida a unas 180 pesetas al da, y el pasado lunes anunci que dialogar con la Organizacin Mundial de la Salud (OMS) para que sus frmacos se distribuyan en los pases pobres. Dos grandes ONG, Mdicos Sin Fronteras y Oxfam, protagonizan campaas por el acceso a los medicamentos esenciales y su abaratamiento. Brasil se siente respaldado en sus exigencias. Un informe del secretario general de la ONU, Kofi Annan, puso la pasada semana a Brasil como ejemplo en la lucha contra el sida. El nmero de casos, especialmente el de muertes, dice el informe, ha descendido significativamente como resultado de la extensin del acceso a los tratamientos que prolongan la vida. Aade Annan: Aunque esos programas no son accesibles a todas las personas que lo necesitan, aportan un importante modelo.
ERROR DEL BANCO MUNDIAL

45

50

buena parte de los 100.000 medicados trabaja normalmente y el nmero de enfermos internados ha bajado del 80%. En 1996 comenz la distribucin del cctel, compuesto por 10 medicamentos, ocho de los cuales se fabrican en el pas con materias primas de India y China, cuyos Gobiernos sortean las normas sobre patentes. El xito de la lucha contra el sida en Brasil se debe a la poltica gubernamental, pero tambin a la iniciativa de la sociedad civil. La distribucin del cctel en los hospitales es fruto de la presin de ms de 600 ONG, que han calculado que si los pacientes brasileos tuvieran que pagarse esos frmacos que se les ofrecen gratis gastaran cada uno 1,5 millones de pesetas al ao, en un pas donde el salario base es de 14.500 pesetas. Tambin han dado fruto las grandes campaas a favor del preservativo, cuyo uso entre 1993 y 1999 aument de 70 millones a 320 millones de unidades: en esas campaas, el Ministerio de Sanidad ha encontrado a menudo la colaboracin de la Iglesia de base; la jerarqua eclesistica sigue prohibiendo oficialmente el condn, pero prrocos y monjas lo aceptan como arma contra el sida. Antes de la intervencin brasilea en la ONU, Louise Frechette, asistente del secretario general, resalt la importancia de los sistemas pblicos de salud para afrontar la epidemia. El debate pblico ms reciente, dijo, se orienta, acertadamente, en la necesidad de que el tratamiento alcance a millones de personas en pases en desarrollo, sobre todo en frica, que sin ello se enfrentaran a una muerte lenta, sumidas en el dolor y la humillacin. Segn datos de la agencia de Naciones Unidas Onusida, el 95% de los 36,1 millones de personas que sufren esa enfermedad viven en pases pobres.

55

15

60

20

65

25

70

30

75

35

80

40

El Banco Mundial haba pronosticado para Brasil 1,2 millones de infectados. Gracias al cctel de genricos ofrecido gratis en los hospitales, las muertes han descendido un 50%,
10 Exame de Qualificao Vestibular Estadual 2002

JUAN ARIAS http://www.elpais.es Mircoles, 28 de febrero de 2001

11

98 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

ESPANHOL LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS


Questo 17 Se puede reconocer el argumento bsico del texto en la siguiente afirmativa: (A) las exigencias de los fabricantes de frmacos no se alcanzan ni en veinte aos (B) a los infectados por sida no se les garantiza en la ley el acceso a medicamentos (C) los pronsticos del Banco Mundial respecto al descenso de enfermos no se concretaron (D) los derechos de patente de medicamentos no pueden sobreponerse a la salud del pueblo

Questo 18 en esas campaas, el Ministerio de Sanidad ha encontrado a menudo la colaboracin de la Iglesia de base; (l. 65 - 67) Lo subrayado en el fragmento tiene sentido semejante a: (A) La Iglesia de base colabor poco con el Estado. (B) La Iglesia vino colaborando intensamente con el Estado. (C) Estado e Iglesia encontraron dificultades en la colaboracin mutua. (D) El Estado y parte de la Iglesia mantuvieron colaboraciones frecuentes.

Questo 19 Brasil se siente respaldado en sus exigencias. (l. 29) Esta afirmacin se justifica, particularmente, porque viene reforzada por citas de: (A) opiniones de varios expertos y datos estadsticos (B) leyes de patentes distintas y reivindicaciones populares (C) apoyo de otros pases y visin de la ONU sobre el tema (D) error del Banco Mundial e informaciones sobre reduccin de muertes

Questo 20 En el proceso de reduccin de muertes por sida, adems de la solicitud de Brasil, se puede reconocer otra accin igualmente relevante en el siguiente fragmento: (A) la Organizacin Mundial del Comercio (OMC), cuyas normas (...) exigen que los laboratorios mantengan la propiedad de las patentes 20 aos. (l. 14 - 18) (B) Dos grandes ONG (... ) protagonizan campaas por el acceso a los medicamentos esenciales y su abaratamiento. (l. 25 - 28) (C) Un informe del secretario general de la ONU, Kofi Annan, puso la pasada semana a Brasil como ejemplo en la lucha contra el sida. (l. 29 - 32) (D) El Banco Mundial haba pronosticado para Brasil 1,2 millones de infectados. (l. 41 - 42)

12
10 Exame de Qualificao Vestibular Estadual 2002

99 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS ESPANHOL

Com base no texto abaixo, responda s questes de nmeros 21 e 22.


HAY UNA INTERESANTE GENERACIN DE MUJERES PRCTICAMENTE DESCONOCIDAS EN LA ARGENTINA

EL BRASIL QUE NO ESCUCHAMOS


DESPUS DE LA GENERACIN DE ELIS, GAL Y BETHANIA, EL PBLICO ARGENTINO SUPO POCO Y NADA DE LAS DAMAS QUE SIGUIERON ENGALANANDO LA MSICA BRASILEA.

La natural relacin que la Argentina de los aos 70 y 80 tena con las intrpretes de la msica popular brasilea parece, por ahora, perdida. Las melodas de Joo Gilberto, Chico Buarque y Caetano Veloso, interpretadas por las voces de Elis Regina, Maria Bethania o Gal Costa eran prcticamente materia obligada de cualquier discoteca. La vitalidad que mostraba la msica del Brasil a travs de sus grandes transformaciones produjo en la Argentina un gran entusiasmo. A fines de los aos 50 la aparicin de la bossa nova - un nuevo tipo de samba, samba de medio ao, para ser escuchado fuera del momento del Carnaval - dio gran impulso a la figura de la cantante femenina que, sobre una base rtmica menos densa y tempos ms lentos que los del samba tradicional, tena ahora posibilidades de mostrar sus cualidades vocales y expresivas. La voz de Elis Regina fue el instrumento perfecto para esta nueva bossa. Unos aos despus, de la mano de Caetano Veloso y Gilberto Gil, fueron las ideas del Tropicalismo - con su intencin de exponer y jerarquizar todos los aspectos de ese gran mosaico que es la cultura brasilea - y las voces de Maria Bethania y Gal Costa, las que fomentaron en los aficionados a la msica la sensacin de encontrarse ante un cuerpo ms o menos compacto de autores y cantantes, relacionados orgnicamente unos con otros. Haba que escucharlos a todos. La fuerza de ese momento se ha disipado.(...) Sin embargo, entre estas hijas de Elis hay un mundo por descubrir. Todas ellas tienen alrededor de treinta aos, son muy buenas cantantes, algunas tambin compositoras, unidas por la fidelidad a la tradicin ms lejana del choro y el samba de carnaval, pero tambin deudoras de las sonoridades ms modernas del Tropicalismo. Aqu estn, stas son: (...) Marisa Monte, (...) Adriana Calcanhoto, (...) Virgnia Rodrigues, (...) Bebel Gilberto (...).
SANDRA DE LA FUENTE http://www.clarin.com
04/02/2001

Questo 21 En el texto se establece una relacin de causa / consecuencia entre los siguientes elementos: (A) la vitalidad de la msica brasilea y las cualidades vocales de Elis (B) la aparicin de la bossa nova y el gran impulso a la figura de la cantante femenina (C) la idea de un conjunto compacto entre autores y cantantes y las ideas del Tropicalismo (D) los tempos ms lentos del samba tradicional y la preferencia de los argentinos por ese ritmo Questo 22 El enunciador se propone llevar a su lector argentino a interesarse por una generacin an desconocida de cantantes brasileas. Su argumento principal se fundamenta en el hecho de que son jvenes que: (A) componen un conjunto orgnico y armnico (B) tienen voces semejantes a las de Bethania y Gal (C) se toman la libertad de fundir ritmos y melodas (D) guardan relacin con la tradicin y la modernidad
10 Exame de Qualificao Vestibular Estadual 2002

13

100 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS INGLS

Com base no texto abaixo, responda s questes de nmeros 17 a 20.

BRAZIL FLEXES NEW MUSCLE IN ANOTHER TRADE FIGHT

BRASLIA First came a bitter trade dispute with Canada. Now Brazils leaders are standing firm on another trade-related foreign policy issue, this time with the United States.
05

45

government officials were able to treat the event as a triumph and announced plans to file complaints against Canada at the World Trade Organization. This was a win-win situation for Brazil, in that it got the attention of the Canadians and will probably get more attention at the upcoming summit than it would have otherwise, said Kenneth Maxwell, director of the Brazil project at the Council on Foreign Relations, referring to a gathering of Western Hemisphere leaders in April in Quebec. The agenda for that meeting focuses on liberalizing trade, in particular on an American proposal to create a Free Trade Area of the Americas as rapidly as possible, perhaps as early as 2003. Brazil argues that a deadline of 2005 is more adequate and appropriate because of the complex issues involved. Brazil was almost alone in advocating a slower approach at first. But that position has now been endorsed by small Caribbean nations and by Ecuador, which becomes chairman of the trade talks in April. Its not so important when, but rather how we are going to have this common market, Ecuadors foreign minister, Heinz Moeller, said in Washington recently. Are we really talking seriously about free trade? Is free trade a two-way road between North and South? At the same time, though, Brazil is even looking to play a role beyond the hemisphere. It sees itself as the natural Latin American candidate for a seat on an expanded United Nations Security Council, a cause that it has advocated. (...) Brazil belongs to a group of monster countries like Russia, China and India that because of their continental size have an inherent weight in international affairs.

The dispute with Washington has to do with patents on AIDS drugs. The one with Canada is over subsidies to aircraft makers and over mad cow disease. What they have in common is the sight of Brazil as it sheds its image as eternally easygoing and cordial and suddenly flexes the muscles that naturally accrue to a regional power with 170 million people and a booming economy. (...) Brazil is entitled to much greater international recognition and more of a leadership role because of the countrys growing economic importance. In the dispute on AIDS drugs, the United States has filed a complaint with the World Trade Organization. It argues that a law here that would force foreign companies to provide their antiAIDS drugs at lower prices, or license Brazilian companies to do so in the event of a health emergency, violates international trade rules. But Brazil shows no sign of backing down. Indeed, Brazil runs a highly successful program to fight AIDS, in part because it is able to provide drugs at prices below those charged by major pharmaceutical companies. The United Nations singled out the program for praise in early March. In recent years, Brazil has been equally determined to defend Embraer, which builds commuter jets and military planes, against its main rival, Bombardier, the Canadian company. A new front in that conflict emerged in February when Canada suddenly announced a prohibition on imports of Brazilian beef, supposedly because of fears of mad cow disease. Brazilian officials argued that the beef ban was just an excuse to intimidate them in the aircraft dispute and gave Canada until March 1 to rescind the ban. When the Canadians finally gave Brazilian meat a clean bill of health on Feb. 27,

50

10

55

15

60

20

65

25

70

30

75

35

80

40

But Brazil is inherently more pacific than other such countries because it has not been present at the core of conflicts in the international system.
LARRY ROHTER http://www.sanfranciscogate.com March 27, 2001

17
10 Exame de Qualificao Vestibular Estadual 2002

101 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

INGLS LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS


Questo 17 From the idea expressed in the text and the title of the article one may infer that: (A) Brazil will fulfill its economic potential once it opens its borders and embraces free trade. (B) The air industry will go bust when Brazil beats its bitterest rivals, thanks to effective foreign policies. (C) Brazil will soon be in a position to wield decisive influence over the future of the world trading system. (D) The establishment of free trade will be strongly supported by Brazilian leaders due to reasonable tariffs. Questo 18 What they have in common is the sight of Brazil as it sheds its image as eternally easygoing... (l. 09 - 10) The two instances of the word as in the sentence above establish the following semantic relations: (A) causality and addition (B) alternation and purpose (C) concession and contrast (D) temporality and comparison Questo 19 Recognition of the economic and political weight of Brazil in the international arena is implied in the following excerpt: (A) A new front in that conflict emerged in February when Canada suddenly announced a prohibition on imports of Brazilian beef, (l. 33 - 36) (B) Brazilian officials argued that the beef ban was just an excuse to intimidate them in the aircraft dispute and gave Canada until March 1 to rescind the ban. (l. 38 - 41) (C) When the Canadians finally gave Brazilian meat a clean bill of health on Feb. 27, government officials were able to treat the event as a triumph and announced plans to file complaints against Canada (l. 41 - 45) (D) This was a win-win situation for Brazil, in that it got the attention of the Canadians and will probably get more attention at the upcoming summit than it would have otherwise, (l. 47 - 50) Questo 20 South American officials are cautious and not very confident about policy issues concerning the: (A) reciprocity of commercial trade in the Americas (B) adoption of peaceful political strategies by the US (C) agenda of the Foreign Relations Council in Quebec (D) candidacy of Brazil for a seat in the United Nations

18
10 Exame de Qualificao Vestibular Estadual 2002

102 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

INGLS LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS


Com base no texto abaixo, responda s questes de nmeros 21 e 22.

JAZZ AT LINCOLN CENTER TO REACH FROM BRAZIL TO NEW ORLEANS

The longer works of John Coltrane and Charles Mingus, an Abbey Lincoln retrospective and a Brazilian music festival are among more than 400 events worldwide planned by Jazz at Lincoln Center for its 11th season as a year-round producer, starting in September. After a July residency by the Lincoln Center Jazz Orchestra at the Vitoria-Gasteiz Festival in Spain, the organization plans a fall series of performances, educational events and broadcasts centering on the theme Jump In. Jump In signifies the philosophy of Jazz at Lincoln Center, which is welcome and dont hesitate, like when you go to somebodys house and they try to make you comfortable in the shortest period of time, said Wynton Marsalis, the organizations artistic director. We have a season that is inclusive of many styles and forms, with musicians of all persuasions. Since its inception, Jazz at Lincoln Center has been criticized for ignoring music produced since the 1960s. The 2001-2 season suggests a broader focus: two concerts are to explore the later, visionary works of Coltrane and Mingus, and a three-concert retrospective will present not only Ms. Lincolns musical compositions but her poetry as well. A series of events will also reflect the relationship between Brazilian music and jazz, including collaborations between the Lincoln Center Jazz Orchestra and a samba band led by the percussionist Cyro Baptista; three concerts featuring new arrangements of the music of the Brazilian composer Pixinguinha, performed by a small ensemble led by the guitarist Romero Lubambo; an annotated film program that examines the carnival traditions of Brazil and New Orleans; and three Jazz for Young People concerts, one on Mingus, one on Coltrane and a third titled What Is Samba?
http://www.nytimes.com March 26, 2001

Questo 21 The article above was extracted from the city entertainment section of a renowned American newspaper. The upcoming attractions are best described in: (A) high-quality jazz orchestras led by Brazilian musicians will play in New Orleans (B) artistic trends of Brazil and New Orleans will be showcased in New York City (C) carnival traditions and samba music arrangements will be examined in New York City (D) jazz bands and Brazilian samba composers will give joint performances in New Orleans Questo 22 The theme Jump In, chosen by the artistic organizers for the diversified events, is intended to: (A) shake the audience (B) promote cultural exchange (C) make festival-goers feel at ease (D) bring together music traditions

19
10 Exame de Qualificao Vestibular Estadual 2002

103 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS Questo 23

Leia os quadrinhos:

(O Globo, maro 2000)

Suponha que o volume de terra acumulada no carrinho-de-mo do personagem seja igual ao do slido esquematizado na figura abaixo, formado por uma pirmide reta sobreposta a um paraleleppedo retngulo.

Assim, o volume mdio de terra que Hagar acumulou em cada ano de trabalho , em dm3, igual a: (A) 12 (B) 13 (C) 14 (D) 15 Questo 24 Um vendedor, antes de fazer um embrulho, enrola cada uma das extremidades de um pedao de barbante em cada uma das mos e, em seguida, as afasta tentando romper o barbante. Para o mesmo tipo de barbante, mais fcil conseguir o rompimento com um movimento brusco do que com um movimento progressivo. Isto se deve variao, em um intervalo de tempo muito curto, da seguinte grandeza fsica associada s mos: (A) energia (B) velocidade (C) acelerao (D) momento linear

20
10 Exame de Qualificao Vestibular Estadual 2002

104 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 25 Quanto mais rpido for o congelamento da gua, menores e mais numerosos sero os cristais de gelo formados. Para congelar amostras em laboratrios utilizam-se, geralmente, gases liquefeitos, nas temperaturas (T) mostradas na tabela abaixo.

Pretende-se congelar suspenses aquosas de clulas, de modo a preservar suas estruturas e manter suas propriedades vitais aps o congelamento. Sabendo-se que cristais maiores provocam mais leses nas clulas, o gs liquefeito mais adequado para esse congelamento o: (A) He (B) N2 (C) Ar (D) CO2 Questo 26 As variaes das cargas eltricas das molculas das protenas W, X, Y e Z, em funo do pH do meio, esto representadas no grfico abaixo.

A molcula do DNA, em pH fisiolgico, apresenta carga eltrica negativa, devido a sua natureza cida. No ncleo celular, ela est associada a protenas, de carter bsico, denominadas histonas. De acordo com o grfico, a protena que apresenta propriedades compatveis com as de uma histona a representada pela seguinte letra: (A) W (B) X (C) Y (D) Z

21
10 Exame de Qualificao Vestibular Estadual 2002

105 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 27 Em 1911, o cientista Ernest Rutherford realizou um experimento que consistiu em bombardear uma finssima lmina de ouro com partculas , emitidas por um elemento radioativo, e observou que: a grande maioria das partculas atravessava a lmina de ouro sem sofrer desvios ou sofrendo desvios muito pequenos; uma em cada dez mil partculas era desviada para um ngulo maior do que 90. Com base nas observaes acima, Rutherford pde chegar seguinte concluso quanto estrutura do tomo: (A) o tomo macio e eletricamente neutro (B) a carga eltrica do eltron negativa e puntiforme (C) o ouro radioativo e um bom condutor de corrente eltrica (D) o ncleo do tomo pequeno e contm a maior parte da massa Questo 28 Considere a situao abaixo, que ilustra a conhecida experincia dos hemisfrios de Magdeburgo.

(ALVARENGA, Beatriz & MXIMO, Antnio. Curso de Fsica. Rio de Janeiro: Harbra, 1987.)

Na experincia original, foram utilizados 16 cavalos divididos em 2 grupos de 8 , cada qual capaz de exercer uma fora resultante F sobre o hemisfrio. Imagine que o idealizador do experimento s dispusesse de 8 cavalos para tracionar, com a mesma fora F , um dos hemisfrios, e prendesse o outro a um tronco resistente e fixo no cho. Seja T a trao total exercida pelas cordas sobre os hemisfrios nessa nova situao e T0 , a da experincia original. Assim, a razo (A) 1
(B)
1 2 1 4 1 8
10 Exame de Qualificao Vestibular Estadual 2002

igual a:

(C)

(D)

22

106 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 29 Considere a informao abaixo:


Se o papel de escritrio consumido a cada ano no mundo fosse empilhado, corresponderia a cinco vezes a distncia da Terra Lua.
(Adaptado de Veja, 15/12/99)

Admitindo-se que a distncia da Terra Lua de 3,8 x 105 Km e que a espessura mdia de uma folha de papel de 1,3 x 10 1 mm, a ordem de grandeza do nmero de folhas de papel de escritrio consumido a cada ano : (A) 109 (B) 1011 (C) 1013 (D) 1015 Questo 30 Um contraste radiolgico, substncia opaca ao raio X, foi injetado, por via venosa, no brao de um paciente submetido a uma radiografia dos rins. Essa substncia, logo aps a injeo e antes de atingir os rins, passa pela seguinte seqncia de estruturas anatmicas: (A) pulmes trio cardaco direito ventrculo cardaco direito trio cardaco esquerdo ventrculo cardaco esquerdo (B) trio cardaco direito ventrculo cardaco direito pulmes trio cardaco esquerdo ventrculo cardaco esquerdo (C) pulmes trio cardaco esquerdo ventrculo cardaco esquerdo trio cardaco direito ventrculo cardaco direito (D) trio cardaco esquerdo ventrculo cardaco esquerdo pulmes trio cardaco direito ventrculo cardaco direito Questo 31 Durante uma aula prtica de qumica, para demonstrar o deslocamento do estado de equilbrio, um professor utilizou um sistema fechado em equilbrio, conforme a equao:

As duas variveis que provocaram a progressiva diminuio na intensidade da colorao castanha esto indicadas em: (A) adio de catalisador aumento da presso (B) aumento do volume aumento da temperatura (C) adio de catalisador aumento da temperatura (D) imerso em banho de gelo aumento da presso

23
10 Exame de Qualificao Vestibular Estadual 2002

107 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 32 Considere a afirmao abaixo:


No homem, todo gs oxignio que entra no sangue pelos pulmes sai por esse mesmo rgo, porm ligado ao carbono, sob a forma de gs carbnico.

Esta frase no deve ser considerada como correta pela seguinte razo: (A) o CO2 excretado sob a forma de bicarbonato pelos rins (B) os pulmes eliminam pequena parte do CO2 produzido no organismo (C) o O2 , na cadeia respiratria mitocondrial, incorporado na gua formada (D) o O2 encontrado no ar expirado pelos pulmes originrio de reaes metablicas Questo 33 A razo entre a massa e o volume de uma substncia, ou seja, a sua massa especfica, depende da temperatura. A seguir, so apresentadas as curvas aproximadas da massa em funo do volume para o lcool e para o ferro, ambos temperatura de 0 C.

Considere F a massa especfica do ferro e A a massa especfica do lcool. De acordo com o grfico, a razo (A) 4 (B) 8 (C) 10 (D) 20 Questo 34 A hidroponia uma tcnica de cultivo de vegetais fora do solo. Os nutrientes so fornecidos atravs de uma soluo contendo vrios sais de fcil assimilao pelo vegetal. Para o preparo de 100 L de soluo nutritiva, contendo 0,007 mol.L 1 de nitrato de clcio, a massa necessria deste sal, em gramas, aproximadamente de: (A) 72 (B) 102 (C) 115 (D) 164 igual a:

24
10 Exame de Qualificao Vestibular Estadual 2002

108 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 35 A hidrlise da sacarose pode ser realizada atravs de catlise cida ou de catlise enzimtica, como ocorre na digesto intestinal. Em um experimento para medir a variao da concentrao da sacarose em funo do tempo de incubao, trs solues idnticas desse dissacardeo foram submetidas hidrlise cida e enzimtica em trs temperaturas (T) diferentes: 37 C, T1 e T2 . Os resultados esto mostrados nos grficos abaixo.

A partir da anlise do grfico de referncia, as curvas que representam a hidrlise cida e a enzimtica, respectivamente, e o nmero do grfico compatvel com experimentos realizados temperatura de 80 C, so: (A) X e Y ; 1 (B) X e Y ; 2 (C) Y e X ; 1 (D) Y e X ; 2 Questo 36 Leia com ateno a histria em quadrinhos.

(O Globo, 16/03/2001)

Considere que o leo da histria acima tenha repetido o convite por vrias semanas. Na primeira, convidou a Lana para sair 19 vezes; na segunda semana, convidou 23 vezes; na terceira, 27 vezes e assim sucessivamente, sempre aumentando em 4 unidades o nmero de convites feitos na semana anterior. Imediatamente aps ter sido feito o ltimo dos 492 convites, o nmero de semanas j decorridas desde o primeiro convite era igual a: (A) 10 (B) 12 (C) 14 (D) 16
10 Exame de Qualificao Vestibular Estadual 2002

25

109 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 37 Duas chaleiras idnticas, que comeam a apitar no momento em que a gua nelas contida entra em ebulio, so colocadas de duas formas distintas sobre o fogo, como indica a figura:

(Adaptado de EPSTEIN, Lewis C. Thinking Physics. San Francisco: Insight Press, 1995.)

Em um dado momento, em que ambas j estavam apitando, as chamas foram apagadas simultaneamente. Assim, a situao relativa ao tempo de durao dos apitos das chaleiras e a explicao fsica do fenmeno esto descritas na seguinte alternativa: (A) A chaleira I continuar apitando por mais tempo, pois a placa metlica est mais quente do que a gua. (B) Ambas as chaleiras deixam de apitar no mesmo instante, pois as chamas foram apagadas simultaneamente. (C) Ambas as chaleiras deixam de apitar no mesmo instante, pois a temperatura da gua nas duas a mesma. (D) A chaleira II continuar apitando por mais tempo, pois a capacidade trmica do metal menor do que a da gua. Questo 38 Rafael comprou quatro passagens areas para dar uma de presente para cada um de seus quatro netos. Para definir a poca em que iro viajar, Rafael pediu para cada um dizer uma frase. Se a frase fosse verdadeira, o neto viajaria imediatamente; se fosse falsa, o neto s viajaria no final do ano. O quadro abaixo apresenta as frases que cada neto falou:

A partir das frases ditas, Rafael no pde definir a poca da viagem do neto representado pelo seguinte nmero: (A) I (B) II (C) III (D) IV

26
10 Exame de Qualificao Vestibular Estadual 2002

110 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Utilize as informaes abaixo para responder s questes de nmeros 39 e 40. Alm do impacto ambiental agudo advindo do derramamento de grandes quantidades de leo em ambientes aquticos, existem problemas a longo prazo associados presena, no leo, de algumas substncias como os hidrocarbonetos policclicos aromticos, mutagnicos e potencialmente carcinognicos. Essas substncias so muito estveis no ambiente e podem ser encontradas por longo tempo no sedimento do fundo, porque gotculas de leo, aps adsoro por material particulado em suspenso na gua, sofrem processo de decantao.

Questo 39 As substncias mutagnicas mencionadas no texto podem atingir o topo da pirmide alimentar atravs do fenmeno denominado: (A) biognese (B) biossntese (C) biodegradao (D) bioacumulao

Questo 40 Um agente mutagnico, com as caractersticas estruturais citadas no texto, apresenta a seguinte frmula:

(A)

(B)

(C)
N

(D)

27
10 Exame de Qualificao Vestibular Estadual 2002

111 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 41 Em um posto de sade foram atendidas, em determinado dia, 160 pessoas com a mesma doena, apresentando, pelo menos, os sintomas diarria, febre ou dor no corpo, isoladamente ou no. A partir dos dados registrados nas fichas de atendimento dessas pessoas, foi elaborada a tabela abaixo.

Na tabela, X corresponde ao nmero de pessoas que apresentaram, ao mesmo tempo, os trs sintomas. Pode-se concluir que X igual a: (A) 6 (B) 8 (C) 10 (D) 12 Questo 42 Em nosso organismo, parte da energia liberada pela oxidao completa da glicose captada na reao ADP + Fosfato ATP.

. . .

Considere que: em pessoas sadias, parte da energia liberada pela oxidao completa de 1 mol de glicose acumula-se sob a forma de 38 mols de ATP, sendo a energia restante dissipada sob forma de calor; em um determinado paciente com hipertireoidismo, o rendimento de produo de ATP foi 15% abaixo do normal; a reao de hidrlise ATP ADP + Fosfato libera 7.000 cal/mol.

A quantidade de calor que o paciente com hipertireoidismo libera a mais que uma pessoa sadia, nas mesmas condies, quando oxida completamente 1,0 mol de glicose, , em Kcal, aproximadamente igual a: (A) 40 (B) 61 (C) 226 (D) 266

28
10 Exame de Qualificao Vestibular Estadual 2002

112 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 43 Em uma sesso de fisioterapia, a perna de um paciente acidentado submetida a uma fora de trao que depende do ngulo , como indica a figura abaixo.

(KING, A. R. & REGEV, O. Physics with answers. Cambridge: Cambridge University Press, 1997.)

O ngulo varia deslocando-se a roldana R sobre a horizontal. Se, para um mesmo peso P, o fisioterapeuta muda de 60 para 45, o valor da trao na perna fica multiplicado por: (A) (B) (C)
3 2
3 2 2 2

(D)

Questo 44 Os objetos metlicos perdem o brilho quando os tomos da superfcie reagem com outras substncias formando um revestimento embaado. A prata, por exemplo, perde o brilho quando reage com enxofre, formando uma mancha de sulfeto de prata. A mancha pode ser removida colocando-se o objeto em uma panela de alumnio contendo gua quente e um pouco de detergente, por alguns minutos. Nesse processo, a reao qumica que corresponde remoo das manchas : (A) (B) (C) (D)

29
10 Exame de Qualificao Vestibular Estadual 2002

113 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Utilize as informaes abaixo para responder s questes de nmeros 45 e 46. A tabela de Mendeleiev, ao ser apresentada Sociedade Russa de Qumica, possua espaos em branco, reservados para elementos ainda no descobertos. A tabela foi assim organizada a partir da crena de Mendeleiev na existncia de relaes peridicas entre as propriedades fsico-qumicas dos elementos.

Questo 45 Ao analisar a tabela de Mendeleiev, Berlikov, um jovem qumico, criticou-a fazendo a seguinte pergunta: Pode a natureza ter espaos em branco? Do ponto de vista do mtodo cientfico, a pergunta reflete a ausncia de: (A) lei fsica (B) hiptese plausvel (C) modelo matemtico (D) observao experimental Questo 46 Dois dos elementos, ento representados pelos espaos em branco, hoje so conhecidos como glio (Ga) e germnio (Ge). Mendeleiev havia previsto, em seu trabalho original, que tais elementos teriam propriedades qumicas semelhantes, respectivamente, a: (A) estanho (Sn) e ndio (In) (B) alumnio (Al) e silcio (Si) (C) cobre (Cu) e selnio (Se) (D) zinco (Zn) e arsnio (As)

30
10 Exame de Qualificao Vestibular Estadual 2002

114

CINCIAS HUMANAS CINCIAS EHUMANAS SUAS TECNOLOGIAS E SUAS TECNOLOGIAS Questo 47


O debate acerca do mundo e da vida neste fim de sculo organiza-se (...) em torno de pensadores, quase sempre de classe mdia e universitrios, que so uma pequena minoria. Esta minoria enxerga de preferncia os elementos que a preocupam mais. Assim, ao ouvi-la, teramos a impresso de que os debates acerca de coisas como o feminismo(...), ecologismo(...), multiculturalismo(...), descriminalizao e desmedicao do homossexualismo e do uso de drogas em suma, a partir de posies que nos Estados Unidos so conhecidas como politicamente corretas configurariam as discusses mais importantes, mais vitais e urgentes do mundo atual.
(CARDOSO, Ciro F. In: REIS FILHO, D. e outros (org.). O sculo XX: o tempo das dvidas. Rio de Janeiro: Civilizao Brasileira, 2000.)

A posio do autor sobre as discusses tidas como as mais urgentes do mundo atual est melhor traduzida na seguinte alternativa: (A) As temticas mais importantes da virada do sculo so definidas pelas elites econmicas. (B) Os temas que mais preocupam as camadas de baixa renda so priorizados pelos intelectuais da classe mdia. (C) As discusses das classes mdias refletem as preocupaes das camadas sociais desprivilegiadas. (D) Os debates sobre temas do mundo contemporneo so polarizados por grupos socioculturais especficos.

Questo 48
(...) de assustar o nmero de partidos que vm se formando e ganhando apoio popular em diversos pases muulmanos, usando muitas vezes a violncia para alcanar seus objetivos. A Arglia e o Afeganisto so apenas os exemplos mais evidentes desta situao, e a contnua existncia de grupos fundamentalistas entre a populao palestina prova da vitalidade de suas idias. Da mesma forma, Israel, hoje, vive as conseqncias do profundo dissenso ideolgico e cultural entre judeus seculares e fundamentalistas. Acirrando um conflito que teve origem no prprio momento de fundao do Estado, opostos paz com os rabes e pluralidade poltica e religiosa, os judeus fundamentalistas so a maior ameaa consolidao da democracia em Israel. (...) Isto muda completamente a situao com a qual israelenses e rabes estavam acostumados a lidar h quase um sculo, quando o inimigo era o vizinho. Agora, o inimigo est do lado de dentro.
(GRINBERG, Keila. In: REIS FILHO, D. e outros (org.). O sculo XX: o tempo das dvidas. Rio de Janeiro: Civilizao Brasileira, 2000.)

Segundo a idia central deste texto, as dificuldades para a consolidao da paz, neste momento, no Oriente Mdio, esto relacionadas de forma mais geral com: (A) permanncia de divergncias entre rabes e judeus (B) disputas internas no mundo muulmano e em Israel (C) dissoluo do fundamentalismo religioso na Arglia e no Afeganisto (D) enfrentamento entre os partidos da esquerda na Arglia e em Israel

31
10 Exame de Qualificao Vestibular Estadual 2002

115 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 49
O fascismo, como o nacionalismo, perseguia a conexo do passado com o presente, oferecendo aos indivduos a oportunidade de se empenharem num projeto comum para o futuro de sua nao, uma entidade a que eles pertenciam e que os transcendia. Integrando o proletariado comunidade nacional, o fascismo consegue apagar a identificao, efetuada pela democracia, da nao com a burguesia. (...) A nao, como entidade complexa, baseada na ligao com um territrio determinado, passado histrico, valores e culturas comuns, mostrava uma vez mais a fora da conscincia comum de seus habitantes e sua vontade de decidir o destino poltico comum. A nao revela-se o foco primordial da lealdade.
(GUIBERNAU, Montserrat. Nacionalismos: o estado nacional e o nacionalismo no sculo XX. Rio de Janeiro: Jorge Zahar,1997.)

Tomando como ponto de referncia o texto, uma das caractersticas do nacionalismo de tipo fascista pode ser identificada na seguinte alternativa: (A) proposio de uma idia de nao acima dos interesses de classe (B) propaganda de smbolos da nao identificados com os valores de classe (C) organizao do proletariado em uma comunidade nica vinculada nao (D) constituio de uma conscincia antinacional oposta idia de uma cultura comum

Questo 50

(Adaptado de LEOPOLDI, M. A. In: PANDOLFI, Dulce (org.). Repensando o Estado Novo. Rio de Janeiro: FGV,1999.)

A partir da anlise das tabelas, pode-se afirmar que, no perodo de 1930 a 1945, identifica-se uma caracterstica econmica expressa na seguinte afirmativa: (A) O avano da indstria permitiu um desenvolvimento equilibrado entre as regies do pas. (B) A distribuio regional do PIB um indicativo de desenvolvimento capitalista concentrado. (C) O crescimento industrial foi responsvel pela dinamizao do setor primrio nos anos 30. (D) O incremento da agricultura impediu maior concentrao de renda nas regies mais desenvolvidas.

32
10 Exame de Qualificao Vestibular Estadual 2002

116 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 51

(Folha de So Paulo, 29/11/2000)

A charge se refere criticamente aos processos de transformao tecnolgica de servios pblicos tradicionais, tais como o ensino. Essa crtica se baseia no pressuposto de que a eficcia das novas tecnologias depende do seguinte fator: (A) encarecimento de custos do ensino pblico (B) revoluo nas condies de vida locais (C) tendncia privatizao do ensino (D) contexto social de seus usurios Questo 52

(HARVEY, David. A condio ps-moderna. So Paulo: Loyola, 1993.)

O quadro acima aponta mudanas ocorridas no mundo do trabalho durante o sculo XX. Um indicador correto da passagem do modelo fordista para o de acumulao flexvel : (A) os trabalhadores tornaram-se mais conservadores (B) os sindicatos ganharam maior poder de interveno (C) a produo em larga escala declinou em importncia (D) o Estado intensificou sua forma de controle sobre o trabalho

33
10 Exame de Qualificao Vestibular Estadual 2002

117 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 53
Da Revoluo Industrial at o auge do fordismo, que pde ser facilmente atingido com energias fsseis, mas em cujo reverso se abre um abismo, passaram-se mais de 200 anos; um curto perodo de tempo, em que se gastaram recursos naturais fsseis resultantes de milhes de anos terrestres.
(ALTVATER, Elmar. O preo da riqueza. So Paulo: UNESP, 1995.)

O texto acima expressa uma avaliao sobre a relao natureza / sociedade de grande importncia para o planejamento das atividades humanas. A caracterstica da dinmica capitalista que traduz o alerta feito pelo autor est em: (A) A inovao da tecnologia determinou a disponibilidade de bens renovveis. (B) A mudana no padro energtico impediu a adoo de polticas de preservao ambiental. (C) O avano da degradao ambiental conduziu conscincia do fim da sociedade industrial. (D) A utilizao econmica dos recursos naturais superou o ritmo de renovao do meio fsico. Questo 54

(Adaptado de Raul Pederneiras. In: VELLOSO, Monica. Que cara tem o Brasil? Rio de Janeiro: Ediouro, 2000.)

Nestas imagens de 1921, o caricaturista compara os hbitos da elite carioca de outrora com os predominantes em sua poca. As duas colunas representam reunies sociais: na primeira ressaltam-se as danas de origem europia, como a polca e a valsa e, na segunda, os pares danam o maxixe, estilo mais popular derivado das danas dos escravos. Essa absoro de costumes populares pode ser associada ao seguinte fator: (A) sntese cultural num pas de tradio europia (B) segregao de classes sociais numa metrpole nacional (C) influncia estrangeira num contexto de urbanizao acelerada (D) abolio da escravatura numa sociedade predominantemente rural

34
10 Exame de Qualificao Vestibular Estadual 2002

118 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 55

(Adaptado de Folha de So Paulo, 18/03/2001)

Em 18/03/2001, o jornal Folha de So Paulo divulgou que est sendo proposto um aumento das verbas para o Projeto Calha Norte, que se refere fronteira norte-amaznica do pas. A observao do mapa das unidades previstas permite concluir que o projeto tem como uma de suas preocupaes bsicas: (A) a agricultura, em terras destinadas reforma agrria (B) o abastecimento, em espao carente de vias de acesso (C) a proteo militar, em rea marcada por conflitos polticos (D) a industrializao, em regio caracterizada pelo crescimento econmico Questo 56
Bush quer atropelar FFHH e o Brasil.(...) Um de seus antecessores, Richard Nixon, ensaboou a ditadura militar dizendo ao general Mdici que para onde o Brasil for ir o resto da Amrica Latina. Os generais acreditaram nisso. Pois veio o presidente Jimmy Carter e armou incrvel encrenca com as violaes dos direitos humanos praticadas pela mesma ditadura que Nixon besuntara. (...) Perderam o seu tempo. Tanto Nixon quanto Carter defendiam o interesse nacional americano.
(GASPARI, lio . O Globo, 04/04/2001.)

Com base na anlise do texto, a dificuldade dos governos brasileiros nas relaes com os EUA se manifesta, principalmente, pela seguinte razo: (A) Os EUA tm defendido polticas unilaterais para a Amrica Latina. (B) O Brasil no se interessa por acordos com pases da Amrica Latina. (C) Os pases da Amrica Latina necessitam de apoio brasileiro para fazer frente aos EUA. (D) Os pases latino-americanos possuem interesses conflitantes com o mundo desenvolvido.

35
10 Exame de Qualificao Vestibular Estadual 2002

119 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 57
Tendo chegado ao conhecimento desta Delegacia que o indivduo Antonio Rodrigues da Silva, de nacionalidade portugueza, se entregava, nesta Capital, propaganda de idias anarchistas, e, o que ainda mais grave, levando essa propaganda s oficinas do Lloyd Brazileiro, onde trabalhava como carpinteiro, resolvi apurar de forma regular esses factos, por julgar conveniente a sua expulso do territrio nacional, visto se tratar de um elemento nocivo sociedade.(...) Chega-se, assim, concluso de que o indivduo(...) um elemento pernicioso ao nosso meio social, e perigoso tranquilidade pblica, em virtude de sua aco provadamente anarchista. Como tal deve ser expulso do territrio nacional(...).
(Brasil. Arquivo Nacional, SPJ, IJJ7 138, Processo de expulso, s/no - 1919)

Aps oito anos de funcionamento do Transmontano, Manuel Sendas decidiu vender o armazm e voltar a Portugal na companhia da nova famlia. (...) foi curta, entretanto, sua permanncia em Portugal, que continuava a enfrentar os mesmos problemas que haviam pressionado sua sada.(...) No ano de 1935, mais uma vez, (...) ele embarcou (...) para o Brasil, onde veio abrir um novo armazm, desta feita denominado Casa do Povo. Iniciava-se uma trajetria de sucesso que nunca mais sofreria interrupes, culminando, em 1960, com a fundao da organizao que, desde os seus primrdios, sob a liderana de seu filho Arthur, passou a liderar o rank dos supermercados com sede no Rio de Janeiro.
(MENEZES. In: GOMES, Angela de C. (org.). Histria de imigrantes e de imigrao no Rio de Janeiro. Rio de Janeiro: 7 Letras, 2000.)

Os dois textos indicam caminhos para a compreenso da imigrao no Brasil. Comparando-os, deduz-se que a trajetria do imigrante caracterizada por: (A) possibilidade diferenciada de insero social (B) tendncia de valorizao social dos militantes polticos (C) predomnio de trabalhadores portugueses no setor de comrcio (D) chance maior de enriquecimento em relao ao trabalhador nacional Questo 58 Os dados abaixo tratam da populao ocupada no Brasil entre o final do sculo XIX e incio do XX.

(Adaptado de PINHEIRO, P. Srgio. In: FAUSTO, Boris (org.). Histria geral da sociedade brasileira III: o Brasil Republicano. So Paulo: Difel, 1985.)

A anlise dos dados leva seguinte caracterstica econmica desse perodo: (A) crescimento do setor de servios (B) dinamizao da atividade industrial (C) protecionismo da agricultura de subsistncia (D) desenvolvimento acelerado dos trs setores econmicos

36
10 Exame de Qualificao Vestibular Estadual 2002

120 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 59

(Adaptado de SANTOS, Milton e SILVEIRA, Maria Laura. O Brasil: territrio e sociedade no incio do sculo XXI . Rio de Janeiro, So Paulo: Record, 2001.)

Os mapas, de 1975 e 1995, mostram a evoluo do nmero e da distribuio de empresas de aviao agrcola no Brasil, que utilizam equipamentos sofisticados para pulverizar com pesticidas as plantaes. Isso demonstra uma dinamizao do setor associada aos processos de: (A) metropolizao e xodo rural (B) expanso da fronteira agrcola e difuso da agroindstria (C) esvaziamento das reas interiores e concentrao urbana (D) centralizao da poltica agrcola e descentralizao de investimentos produtivos Questo 60
(...) Temos, no governo Collor, a distncia entre duas publicidades: uma publicidade favorvel ao governo, por ele suscitada e mesmo paga, que se expressava na encarnao da fora fsica, melhor dizendo, de uma positividade que no remetia a nenhuma virtude moral ou poltica, mas se reduzia ao mero abuso da animalidade; e outra publicidade, que lhe foi fatal, quando o irmo veio a pblico denunciar o presidente enquanto pessoa pblica, por corrupo, e enquanto pessoa privada, por atos ilegais, quer imorais, nem todos, porm, de relevncia para a sociedade brasileira, como os que se referiam sua vida sexual.
(RIBEIRO, R. Janine. In: DAGNINO, Evelina (org.). Anos 90: Poltica e sociedade no Brasil. So Paulo: Brasiliense, 1994.)

Este texto apresenta algumas reflexes sobre a crise que desencadeou o impedimento do Presidente Fernando Collor de Mello. A crtica poltica que apia as preocupaes do autor acerca daquele perodo pode ser traduzida por: (A) O predomnio da imagem pblica prejudicial democracia. (B) A propaganda positiva fundamental na consolidao dos governos atuais. (C) A nfase na pessoa privada decorre da fragilidade das instituies pblicas. (D) A imagem pblica fica prejudicada com a difuso dos meios de comunicao.

37
10 Exame de Qualificao Vestibular Estadual 2002

121 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 61
FAVELA

Numa vasta extenso onde no h plantao nem ningum morando l. Cada um pobre que passa por ali s pensa em construir seu lar. E quando o primeiro comea

os outros, depressa, procuram marcar seu pedacinho de terra pra morar. E assim a regio sofre modificao, fica sendo chamada de nova aquarela. a que o lugar ento passa a se chamar Favela
(Padeirinho Jorginho)

As primeiras favelas do Rio de Janeiro surgiram, provavelmente, ao final do sculo XIX nos morros Favela atual Providncia e Santo Antnio, numa poca de intenso crescimento populacional e significativas modificaes urbanas. O conhecimento histrico desse processo e as observaes feitas pelos autores da cano permitem afirmar que o surgimento das favelas, no Rio de Janeiro, est ligado conjugao dos seguintes fatores: (A) expanso espacial da cidade e disputa pela ocupao do solo (B) poltica estatal de habitao popular e crescimento da rea metropolitana (C) decadncia agrcola fluminense e competio entre reas de especializao produtiva (D) momento de imigrao estrangeira e atrao de novos trabalhadores para a indstria

Com base nas afirmativas abaixo, responda s questes de nmeros 62 e 63. A frica aqui. E a Europa tambm. Da Lagoa a Acari, abismo de um sculo.
(Retratos do Rio estudo sobre o ndice de Desenvolvimento Humano. O Globo, 24/03/2001.)

Questo 62 As diferenas internas da metrpole carioca esto apoiadas principalmente na disparidade encontrada em: (A) indicadores sociais (B) relaes de trabalho (C) composies tnicas (D) organizaes polticas Questo 63 A comparao entre as duas afirmativas permite concluir que se procurou estabelecer, predominantemente, uma relao entre: (A) crescimento urbano e aspectos naturais (B) nvel cultural e caractersticas administrativas (C) desenvolvimento econmico e tempo histrico (D) localizao geogrfica e concentrao populacional

38
10 Exame de Qualificao Vestibular Estadual 2002

122 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 64

(Adaptado de JANCS, Istvan (coord.). Cronologia da Histria do Brasil Colonial . So Paulo: USP, 1994.)

Do ponto de vista geogrfico, histrico e cartogrfico, e considerando as linhas de fronteira, duas caractersticas deste mapa so: (A) limites da atualidade e representao de dados naturais imaginrios (B) traado da poca e conhecimento disponvel sobre a sociedade colonial (C) contorno da poca e apoio das expedies exploradoras do interior do territrio (D) representao da atualidade e projeo de uma realidade territorial sem demarcao fixa

39
10 Exame de Qualificao Vestibular Estadual 2002

123

GABARITO OFICIAL - 1 EXAME DE QUALIFICAO

01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16

B B C C C B D A B D B C C D D A

ESPANHOL

17 18 19 20 21 22

D D A B B D

FRANCS

17 18 19 20 21 22

A D C B C A

INGLS

17 18 19 20 21 22

C D D A B C

23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43

D D A A D A C B D C C C A B A C D D A A B

44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64

C D B D B A B D C D A C A A B B C A A C D

124

1 a FASE - 2 o EXAME DE QU ALIFIC AO QUALIFIC ALIFICAO

19 /0 8/2001 19/0 /08

Neste caderno voc encontrar um conjunto de 40 (quarenta) pginas numeradas seqencialmente, contendo 64 (sessenta e quatro) questes das seguintes reas: Linguagens, Cdigos e suas Tecnologias; Cincias da Natureza, Matemtica e suas Tecnologias; Cincias Humanas e suas Tecnologias. A tabela peridica encontrase na ltima pgina. No abra o caderno antes de receber autorizao.

INSTRUES

I. Verifique se o seu nome, nmero de inscrio, nmero do documento de identidade e


lngua estrangeira escolhida esto corretos no carto de respostas. Se houver erro, notifique o fiscal. Assine o carto de respostas com caneta.

2. Ao receber autorizao para abrir este caderno, verifique se a impresso, a paginao e a numerao das questes esto corretas. Caso ocorra qualquer erro, notifique o fiscal. 3. As
questes de nmeros 17 a 22 da rea de Linguagens, Cdigos e suas Tecnologias devero ser respondidas de acordo com a sua opo de Lngua Estrangeira: Espanhol, Francs ou Ingls.

4. Leia atentamente cada questo e escolha a alternativa que mais adequadamente responde
a cada uma delas. Marque sua resposta no carto de respostas, cobrindo fortemente o espao correspondente letra a ser assinalada; utilize caneta preta, preferencialmente, ou lpis preto n 2, conforme o exemplo abaixo:
1 A B C D

5. A leitora de marcas no registrar as respostas em que houver falta de nitidez


e/ou marcao de mais de uma letra.

6. O carto de respostas no pode ser dobrado, amassado, rasurado ou manchado. Exceto


sua assinatura, nada deve ser escrito ou registrado fora dos locais destinados s respostas.

7. Voc dispe de 4 (quatro) horas para fazer esta prova. 8. Ao terminar a prova, entregue ao fiscal o carto de respostas e este caderno.
BOA PROVA!

125

LINGUAGENS, CDIGOS ECDIGOS SUAS TECNOLOGIAS LINGUAGENS, E SUAS TECNOLOGIAS Questo 01

(In: Herman Lima. Histria da caricatura no Brasil. Rio de Janeiro: Jos Olympio, 1963.)

K. Lixto um desenhista carioca que viveu no incio do sculo XX. O primeiro desenho sua autocaricatura. O segundo uma caricatura dele feita por seu colega, Romano. A partir delas, podemos definir a caricatura essencialmente como a arte de exagerar para: (A) esconder a identidade do autor (B) indicar o carter de uma pessoa (C) homenagear uma pessoa querida (D) revelar uma caracterstica do outro

Questo 02 A caricatura comumente realizada a partir de pessoas pblicas em evidncia, especialmente polticos, em peridicos de grande circulao. O caricaturista, nesse caso, precisa pressupor que o leitor, para que entenda a mensagem, deve ser capaz de: (A) perceber a ideologia subjacente (B) colocar-se no lugar dos polticos (C) identificar as situaes apontadas (D) questionar os objetivos dos polticos

2
20 Exame de Qualificao Vestibular Estadual 2002

126 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Com base no trecho abaixo, do conto Bolvar, responda s questes de nmeros 03 e 04.

Na ltima srie do curso colegial, antes que eu completasse dezoito anos, o professor de Matemtica, com mais de trinta, invadiu a sala de aula montado num corcel que pertencera a Sir Percival, metido na armadura que roubara do Rei Artur. Ao tirar o elmo, percebi que seus cabelos dourados, numa grandiosa revoluo sobre a testa, quase encobriam o azul das ris. Em seguida, saltou do cavalo e veio at minha carteira, de espada em punho, apontar as duas incgnitas da equao em que eu me transformara: o amolecimento dos membros inferiores e a taquicardia de cento e vinte por minuto. No houve jeito. Fiquei apaixonada e me casei no ano seguinte. Mas o casamento foi um teorema que s serviu para demonstrar a inutilidade da espada: era de papelo e no resistia ao menor embate. Em sete anos praticamente assexuados, sem ao menos um filho para chorar o silncio de nossas noites, meu prncipe encantado se desencantou sob a forma de uma gema arrebentada em cima da clara.
(GIUDICE, Victor. Salvador janta no Lamas. Rio de Janeiro: Jos Olympio, 1989.)

Questo 03 Pelo trecho passam vrias representaes da figura do heri na literatura, atravs do personagem do professor de Matemtica. Para a narradora, ele se transforma de um tipo de heri em outro. Essa transformao pode ser comprovada pela identificao do personagem do professor, respectivamente, com os seguintes tipos de heri: (A) pico e anti-heri (B) medieval e moderno (C) intelectual e provedor (D) verdadeiro e problemtico

Questo 04 No trecho do conto de Giudice, os termos matemticos so usados de maneira irnica. O melhor exemplo dessa ironia ocorre atravs do estabelecimento da seguinte relao: (A) equao e paixo (B) teorema e casamento (C) revoluo e azul das ris (D) incgnitas e espada em punho

3
20 Exame de Qualificao Vestibular Estadual 2002

127 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Com base no trecho abaixo, responda s questes de nmeros 05 a 08.

O Brasil ainda no propriamente uma nao. Pode ser um Estado nacional, no sentido de um aparelho estatal organizado, abrangente e forte, que acomoda, controla ou dinamiza tanto estados e regies como grupos raciais e classes sociais. Mas as desigualdades entre as unidades administrativas e os segmentos sociais, que compem a sociedade, so de tal monta que seria difcil dizer que o todo uma expresso razovel das partes se admitimos que o todo pode ser uma expresso na qual as partes tambm se realizam e desenvolvem. Os estados e as regies, por um lado, e os grupos e as classes, por outro, vistos em conjunto e em suas relaes mtuas reais, apresentam-se como um conglomerado heterogneo, contraditrio, disparatado. O que tem sido um dilema brasileiro fundamental, ao longo do Imprio e da Repblica, continua a ser um dilema do presente: o Brasil se revela uma vasta desarticulao. O todo parece uma expresso diversa, estranha, alheia s partes. E estas permanecem fragmentadas, dissociadas, reiterando-se aqui ou l, ontem ou hoje, como que extraviadas, em busca de seu lugar. verdade que o Brasil est simbolizado na lngua, hino, bandeira, moeda, mercado, Constituio, histria, santos, heris, monumentos, runas. H momentos em que o pas parece uma nao compreendida como um todo em movimento e transformao. Mas so freqentes as conjunturas em que se revelam as disparidades inerentes s diversidades dos estados e regies, dos grupos raciais e classes sociais. Acontece que as foras da disperso freqentemente se impem quelas que atuam no sentido da integrao. As mesmas foras que predominam no mbito do Estado, conferindo-lhe a capacidade de controlar, acomodar e dinamizar, reiteram continuamente as desigualdades e os desencontros que promovem a desarticulao.
(IANNI, Octvio. A idia de Brasil moderno. So Paulo: Brasiliense, 1992.)

Questo 05
O todo parece uma expresso diversa, estranha, alheia s partes.

Esta sentena indica a base do argumento de Octvio Ianni, que dialtica, ao explorar uma relao contraditria entre o todo e as partes. Pode-se reformular a sentena, mantendo o aspecto dialtico, da seguinte maneira: (A) A soma das partes do pas no produz necessariamente um todo coerente. (B) O fato de o Brasil conter vrios pases diferentes no transmite uma idia global de pas. (C) A compreenso das diferenas sociais do pas no significa compreend-lo como um todo. (D) O fato de haver uma lngua nacional no implica a existncia de um todo poltico e social.

4
20 Exame de Qualificao Vestibular Estadual 2002

128 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 06
o Brasil se revela uma vasta desarticulao

A organizao do trecho acima disfara a condio sintaticamente passiva do termo sujeito. Para remover o disfarce e manter o sentido, deve-se reescrever a sentena da seguinte forma: (A) O Brasil percebido de maneira desarticulada. (B) O Brasil indica sua desarticulao aos brasileiros. (C) O Brasil desarticulado em fragmentos dissociados. (D) O Brasil mostrado como uma vasta desarticulao. Questo 07

As mesmas foras que predominam no mbito do Estado, conferindo-lhe a capacidade de controlar, acomodar e dinamizar, reiteram continuamente as desigualdades e os desencontros que promovem a desarticulao.

Este ltimo perodo retoma trs verbos em seqncia que haviam aparecido logo no incio do texto, no segundo perodo. O autor, ao fazer esta retomada, mostra as foras do Estado fundamentalmente como: (A) imparciais (B) paradoxais (C) subversivas (D) conseqentes Questo 08
Acontece que as foras da disperso freqentemente se impem quelas que atuam no sentido da integrao.

A anlise isolada deste perodo, do ltimo pargrafo, mostra o verbo acontece como orao principal, deixando todo o restante como uma orao subordinada com funo de sujeito. A leitura de todo o texto, no entanto, nos permite perceber a expresso acontece que com uma funo adicional. Essa funo seria a de: (A) reafirmar um conceito (B) desenvolver uma afirmao (C) estabelecer um paralelismo (D) enfatizar uma contraposio

5
20 Exame de Qualificao Vestibular Estadual 2002

129 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Com base no texto abaixo, responda s questes de nmeros 09 a 11.

FITA VERDE NO CABELO

Havia uma aldeia em algum lugar, nem maior nem menor, com velhos e velhas que velhavam, homens e mulheres que esperavam, e meninos e meninas que nasciam e cresciam.
05

45

Sou eu e Fita-Verde descansou a voz. Sou sua linda netinha, com cesto e pote, com a fita verde no cabelo, que a mame me mandou. Vai, a av, difcil, disse: Puxa o ferrolho de pau da porta, entra e abre. Deus te abenoe. Fita-Verde assim fez, e entrou e olhou.

Todos com juzo, suficientemente, menos uma meninazinha, a que por enquanto. Aquela, um dia, saiu de l, com uma fita verde inventada no cabelo. Sua me mandara-a, com um cesto e um pote, av, que a amava, a uma outra e quase igualzinha aldeia. Fita-Verde partiu, sobre logo, ela a linda, tudo era uma vez. O pote continha um doce em calda, e o cesto estava vazio, que para buscar framboesas. Da, que, indo, no atravessar o bosque, viu s os lenhadores, que por l lenhavam; mas o lobo nenhum, desconhecido nem peludo. Pois os lenhadores tinham exterminado o lobo.
50

10

55

A av estava na cama, rebuada e s. Devia, para falar agagado e fraco e rouco, assim, de ter apanhado um ruim defluxo. Dizendo: Depe o pote e o cesto na arca, e vem para perto de mim, enquanto tempo. Mas agora Fita-Verde se espantava, alm de entristecer-se de ver que perdera em caminho sua grande fita verde no cabelo atada; e estava suada, com enorme fome de almoo. Ela perguntou: Vovozinha, que braos to magros, os seus, e que mos to trementes! porque no vou poder nunca mais te abraar, minha neta a av murmurou.

15

60

20

Ento, ela, mesma, era quem se dizia: Vou vov, com cesto e pote, e a fita verde no cabelo, o tanto que a mame me mandou. A aldeia e a casa esperando-a acol, depois daquele moinho, que a gente pensa que v, e das horas, que a gente no v que no so. E ela mesma resolveu escolher tomar este caminho de c, louco e longo, e no o outro, encurtoso. Saiu, atrs de suas asas ligeiras, sua sombra tambm vindo-lhe correndo, em ps. Divertia-se com ver as avels do cho no voarem, com inalcanar essas borboletas nunca em buqu nem em boto, e com ignorar se cada uma em seu lugar as plebeinhas flores, princesinhas e incomuns, quando a gente tanto por elas passa. Vinha sobejadamente. Demorou, para dar com a av em casa, que assim lhe respondeu, quando ela, toque, toque, bateu: Quem ?
65

25

Vovozinha, mas que lbios, a, to arroxeados! porque no vou nunca mais poder te beijar, minha neta a av suspirou.

70

Vovozinha, e que olhos to fundos e parados, nesse rosto encovado, plido? porque j no te estou vendo, nunca mais, minha netinha a av ainda gemeu.

30

35

75

Fita-Verde mais se assustou, como se fosse ter juzo pela primeira vez. Gritou: Vovozinha, eu tenho medo do Lobo! Mas a av no estava mais l, sendo que demasiado ausente, a no ser pelo frio, triste e to repentino corpo.

40

(ROSA, Joo Guimares. Fita verde no cabelo. Rio de Janeiro: Nova Fronteira, 1992.)

6
20 Exame de Qualificao Vestibular Estadual 2002

130 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 09 O conto recria a tradicional histria de Chapeuzinho Vermelho, citando suas marcas mais conhecidas e refazendo seu sentido original. Distanciando-se, ainda, da histria conhecida, o narrador faz questo de assinalar o carter ficcional da narrativa. Esse procedimento, de apontar a prpria narrativa como produto da fico, explicita-se na seguinte passagem: (A) Sua me mandara-a, com um cesto e um pote, av, que a amava, a uma outra e quase igualzinha aldeia. (l. 9 - 11) (B) Da, que, indo, no atravessar o bosque, viu s os lenhadores, que por l lenhavam; mas o lobo nenhum, desconhecido nem peludo. (l. 16 - 18) (C) A aldeia e a casa esperando-a acol, depois daquele moinho, que a gente pensa que v, e das horas, que a gente no v que no so. (l. 23 - 25) (D) Demorou, para dar com a av em casa, que assim lhe respondeu, quando ela, toque, toque, bateu: (l. 38 - 40) Questo 10
Mas agora Fita-Verde se espantava, alm de entristecer-se de ver que perdera em caminho sua grande fita verde no cabelo atada; e estava suada, com enorme fome de almoo. ( l. 56 - 60)

Pela leitura global do conto, possvel afirmar que essa passagem implica uma mudana para a personagem. Essa mudana pode ser caracterizada como: (A) encontro com o passado e superao do medo do desconhecido (B) ruptura com um mundo de fantasia e aproximao com a realidade (C) supresso do ponto de vista infantil e afirmao de uma nova perspectiva (D) alterao da antiga ordem familiar e conhecimento do fenmeno da morte Questo 11
Fita-Verde partiu, sobre logo, ela a linda, tudo era uma vez. (l. 12 - 13)

O trecho acima exemplifica uma construo original da linguagem por parte do autor, que seleciona e combina as palavras de um modo distinto do uso corriqueiro a que estamos habituados. Um dos recursos empregados para construir essa originalidade, no exemplo dado, : (A) o isolamento da expresso sobre logo por vrgulas (B) a designao da menina por meio do composto Fita-Verde (C) a equivalncia entre ela e a linda na referncia menina (D) o emprego da expresso era uma vez com o sujeito tudo

7
20 Exame de Qualificao Vestibular Estadual 2002

131 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Com base no texto abaixo, responda s questes de nmeros 12 a 14.


ACALANTO DO SERINGUEIRO

05

10

Seringueiro brasileiro, Na escureza da floresta Seringueiro, dorme. Ponteando o amor eu forcejo Pra cantar uma cantiga Que faa voc dormir. Que dificuldade enorme! Quero cantar e no posso, Quero sentir e no sinto A palavra brasileira Que faa voc dormir... Seringueiro, dorme... Como ser a escureza Desse mato-virgem do Acre? Como sero os aromas A macieza ou a aspereza Desse cho que tambm meu? Que misria! Eu no escuto A nota do uirapuru!... Tenho de ver por tabela, Sentir pelo que me contam, Voc, seringueiro do Acre, Brasileiro que nem eu. Na escureza da floresta Seringueiro, dorme. (...) Mas porm brasileiro, Brasileiro que nem eu... Fomos ns dois que botamos Pra fora Pedro II... Somos ns dois que devemos At os olhos da cara Pra esses banqueiros de Londres... Trabalhar ns trabalhamos Porm pra comprar as prolas Do pescocinho da moa Do deputado Fulano. Companheiro, dorme!

40

Porm nunca nos olhamos Nem ouvimos e nem nunca Nos ouviremos jamais... No sabemos nada um do outro, No nos veremos jamais! (...) Nem voc pode pensar Que algum outro brasileiro Que seja poeta no sul Ande se preocupando Com o seringueiro dormindo, Desejando pro que dorme O bem da felicidade... Essas coisas pra voc Devem ser indiferentes, Duma indiferena enorme... Porm eu sou seu amigo E quero ver si consigo No passar na sua vida Numa indiferena enorme. Meu desejo e pensamento (... numa indiferena enorme...) Ronda sob as seringueiras (... numa indiferena enorme...) Num amor-de-amigo enorme... Seringueiro, dorme! Num amor-de-amigo enorme Brasileiro, dorme! Brasileiro, dorme. Num amor-de-amigo enorme Brasileiro, dorme. Brasileiro, dorme, Brasileiro... dorme... Brasileiro... dorme...

45

15

50

20

55

25

60

65

30

35

(ANDRADE, Mrio de. Poesias completas. So Paulo: Livraria Martins, 1980.)

8
20 Exame de Qualificao Vestibular Estadual 2002

132 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 12
Que dificuldade enorme! Quero cantar e no posso, Quero sentir e no sinto A palavra brasileira (v. 7 - 10)

A dificuldade a que se referem os versos acima resultado das diferenas regionais e culturais que distanciam o seringueiro do eu potico. Dos versos abaixo, aqueles que melhor expressam essa distncia percebida e revelada pelo eu potico so: (A) Seringueiro brasileiro, / Na escureza da floresta / Seringueiro, dorme. (v. 1 - 3) (B) Tenho de ver por tabela, / Sentir pelo que me contam, (v. 20 - 21) (C) Desejando pro que dorme / O bem da felicidade... (v. 48 - 49) (D) Seringueiro, dorme! / Num amor-de-amigo enorme / Brasileiro, dorme! (v. 62 - 64)

Questo 13 Ao longo do poema, reafirma-se aquilo que diferencia o poeta e o seringueiro, o que, entretanto, no impede o reconhecimento de uma relao comum entre eles. Nos versos 28 a 36, esse trao comum se revela por meio de: (A) histria de vida (B) atuao como cidados (C) condio de explorados (D) conhecimento de Histria

Questo 14 O uso do vocativo uma das marcas, no poema, do desejo de comunicao do eu potico. O vocativo inicial Seringueiro brasileiro substitudo, ao longo do texto, por seringueiro, companheiro e, finalmente, por brasileiro, enfaticamente repetido ao final. Esse recurso formal da repetio, no encerramento do texto, empregado para: (A) construir um desfecho inesperado (B) reafirmar uma identidade especfica (C) destacar uma caracterstica implcita (D) assinalar uma contradio crescente

9
20 Exame de Qualificao Vestibular Estadual 2002

133 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 15

A televiso no transmite regularmente cenas de violncia, nos telejornais, nos filmes e at nos desenhos animados? Pois ento: a nossa sociedade muito violenta! Como fica demonstrado, a causa da violncia a televiso. Logo, deve-se simplesmente censurar as cenas de violncia de todos os programas de televiso.

O argumento apresentado no trecho acima um sofisma. Podemos caracterizar este sofisma como: (A) crculo vicioso (B) desvio de assunto (C) silogismo no-vlido (D) confuso entre causas e efeitos

Questo 16 Leia atentamente o fragmento a seguir:


Por exemplo, a frase: Em casual encontro com Jlia, Pedro fez comentrios sobre seus exames. tem um enunciado equvoco; os comentrios de Pedro podem ter sido feitos sobre os exames de Jlia, ou sobre os exames dele, Pedro; ou, ainda, sobre os exames de ambos.
(CUNHA, Celso & CINTRA, Lindley. Nova gramtica do portugus contemporneo . Rio de Janeiro: Nova Fronteira, 1985.)

O fragmento acima aponta o problema da ambigidade resultante do emprego do termo seus. A ocorrncia da ambigidade, no caso, pode ser explicada por uma caracterstica relativa significao geral da palavra em questo. Essa caracterstica do vocbulo seus a de: (A) indicar a pessoa gramatical, sem flexionar-se ou remeter a termos antecedentes (B) referir-se pessoa gramatical, sem nome-la ou indicar-lhe caracterstica prpria (C) substituir o nome prprio, sem individualiz-lo ou permitir a devida concordncia (D) qualificar os nomes presentes, sem hierarquiz-los ou revelar sua verdadeira significao

10
20 Exame de Qualificao Vestibular Estadual 2002

134 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS LINGUAGENS, CDIGOS E SUAS ESPANHOL TECNOLOGIAS

Com base no texto abaixo, responda s questes de nmeros 17 a 20.

LA REAL GANA: TICA DEL VOLUNTARIADO

05

10

Uno de los experimentos ms frustrantes que pueden hacerse en esta vida consiste en preguntar a otros, y preguntarse, por el significado de las palabras ms corrientes. Pregunte usted, y pregntese, qu significan por ejemplo - cosas tan de actualidad y tan relacionadas entre s como tica, voluntariado, felicidad, justicia, y se encontrar con el ms absoluto desconcierto. Las cuestiones de palabras - deca un querido profesor mo - son solemnes cuestiones de cosas, y por eso conviene aclararlas, no sea que nos estemos jugando algo muy serio. En lo que hace a la tica, tiene que ver con el ethos, con el carcter que necesariamente nos forjamos las personas, las organizaciones y los pueblos, ya que no nacemos hechos, sino por hacer. Y, claro est, importa forjarse un buen carcter, uno que nos prepare para vivir bien, y no lo contrario. Que los seres humanos desean ser felices es cosa sabida, pero no lo es menos que las instituciones deben intentar ser justas, si quieren ser legtimas, que una sociedad es perversa si no aspira a la justicia. (...) Ciertamente, no resulta fcil aclarar qu es lo justo ms all de la aeja caracterizacin segn la cual lo justo consiste en dar a cada uno lo que le corresponde. Pero no es menos cierto que a la altura de nuestro tiempo la idea de justicia se ha dotado de contenidos ampliamente aceptados, que se expresan sobre todo a travs del lenguaje de los derechos humanos; derechos a los que sin duda corresponden deberes cuya titularidad es a

40

menudo difcil de determinar. Atentar contra los derechos humanos, privar de la vida, las libertades, el ingreso bsico, la educacin, la sanidad, la vivienda, el trabajo, las prestaciones en tiempos de debilidad, es caer bajo mnimos de justicia, bajo mnimos de humanidad. Sin embargo, sucede que al hilo del tiempo de las utopas de la justicia han entrado en conflicto reiteradamente con las de la felicidad; sucede que, como en las leyendas medievales, topamos los viajeros con encrucijadas en las que es preciso optar por uno de ambos caminos (lo justo, lo felicitante), como si fuera imposible convertirlos en uno solo. Nos hemos hecho muy modestos, en nuestras aspiraciones y ya no soamos con la felicidad (eso son palabras mayores), sino, a lo sumo y en el ms ambicioso de los casos, con la calidad de vida, con un prudente estar bien, al que se le hace muy cuesta arriba preocuparse por la justicia. (...) Proponer proyectos concretos de felicidad que incluyan como innegociable la justicia, recordar a la poltica y la economa las metas por las que cobran legitimidad, sacar a la luz situaciones de marginacin y salirles al paso desde la real gana es - a mi juicio - la gran tarea del voluntariado. Pero tambin lo es satisfacer esas necesidades de esperanza, de consuelo, de ternura, de sentido, que nunca podrn reclamarse como un derecho (para eso pago impuestos), nunca podrn satisfacerse como un deber.
ADELA CORTINA http://www.elpais.es
27/02/2001

45

15

50

20

55

25

60

30

65

35

11
20 Exame de Qualificao Vestibular Estadual 2002

135 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

ESPANHOL LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS


Questo 17 Segn el tema propuesto desde el ttulo, slo se logra el voluntariado a partir de la manifestacin de: (A) afn de imagen (B) deseo de participacin (C) aspiraciones de felicidad (D) ganas de bienestar personal

Questo 18 En el texto, el concepto de justicia se apoya fundamentalmente en: (A) derechos y deberes del hombre (B) estructura y organizacin de los pueblos (C) metas polticas e instituciones del gobierno (D) calidad de vida e ingreso bsico de la humanidad

Questo 19 Entre los fragmentos que contienen estructuras en primera persona, aqul que no corresponde al punto de vista del enunciador es: (A) ya que no nacemos hechos, sino por hacer. (l. 17 - 18) (B) Nos hemos hecho muy modestos, en nuestras aspiraciones (l. 49 - 50) (C) sacar a la luz situaciones de marginacin y salirles al paso desde la real gana es - a mi juicio la gran tarea del voluntariado. (l. 59 - 62) (D) que nunca podrn reclamarse como un derecho (para eso pago impuestos), nunca podrn satisfacerse como un deber. (l. 64 - 67)

Questo 20
y por eso conviene aclararlas, no sea que nos estemos jugando algo muy serio (l. 11 - 13)

Lo subrayado exprime idea de: (A) hiptesis (B) finalidad (C) oposicin (D) excepcin

12
20 Exame de Qualificao Vestibular Estadual 2002

136 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS ESPANHOL

Com base no texto abaixo, responda s questes de nmeros 21 e 22.

MANIFIESTO 2000 PARA UNA CULTURA DE PAZ Y NO VIOLENCIA

Porque el ao 2000 debe ser un nuevo comienzo para todos nosotros. Juntos podemos transformar la cultura de guerra y de violencia en una cultura de paz y no violencia. Porque esta evolucin exige la participacin de cada uno de nosotros y ofrece a los jvenes y a las generaciones futuras valores que les ayuden a forjar un mundo ms justo, ms solidario, ms libre, digno y armonioso, y con mejor prosperidad para todos. Porque la cultura de paz hace posible el desarrollo duradero, la proteccin del medio ambiente y la satisfaccin personal de cada ser humano. Porque soy conciente de mi parte de responsabilidad ante el futuro de la humanidad, especialmente para los nios de hoy y de maana. M e compr ometo en mi vida cotidiana, en mi familia, mi trabajo, mi comunidad, mi pas y mi comprometo regin a: r espetar la vida y la dignidad de cada persona, sin discriminacin ni prejuicios; practicar la no violencia activ a, rechazando la violencia en todas sus formas: fsica, sexual, sicolgica, activa econmica y social, en particular hacia los ms dbiles y vulnerables, como los nios y adolescentes; compar tir mi tiempo y mis r ecursos materiales compartir recursos materiales, cultivando la generosidad a fin de terminar con la exclusin, la injusticia y la opresin poltica y econmica; defender la liber tad de expr esin y la div ersidad cultural libertad expresin diversidad cultural, privilegiando siempre la escucha y el dilogo, sin ceder al fanatismo, ni a la maledicencia y el rechazo del prjimo; pr omo ver un consumo r esponsable y un modo de desarrollo que tenga en cuenta la importancia promo omov responsable de todas las formas de vida y el equilibrio de los recursos naturales del planeta; contribuir al desarr ollo de mi comunidad desarrollo comunidad, propiciando la plena participacin de las mujeres y el respeto de los principios democrticos, con el fin de crear juntos nuevas formas de solidaridad.
http://www3.unesco.org/manifesto2000

Questo 21 En general, un manifiesto se propone a que los firmantes demuestren su posicin respecto al tema en discusin. Por lo tanto, en ese texto, se les solicita la demostracin de la siguiente accin: (A) cambio de actitud (B) captacin de fondos (C) distribucin de tareas (D) definicin de calendario Questo 22 Se observa que la estructuracin argumentativa del texto se basa en una correlacin entre los siguientes elementos: (A) definiciones y conceptualizaciones (B) condicionantes y razonamientos (C) justificaciones y proposiciones (D) explicaciones y solicitudes

13
20 Exame de Qualificao Vestibular Estadual 2002

137 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS INGLS

Com base no texto abaixo, responda s questes de nmeros 17 a 20.

PROPOSAL FOR THE UNITED NATIONS TO DECLARE THE 21ST CENTURY AS THE CENTURY OF RESTORING THE EARTH

05

10

Sustainable development is now recognised as an important goal by politicians, conservationists, aid workers, planners and many other people. However, for sustainable development to be achieved, the world requires, first of all, to have sustainable ecosystems, as all our human well-being and wealth ultimately derives from the ability of our planet to provide abundance - clean air, fresh water, healthy food and natural resources which can be used to make products for peoples benefit. At present, we do not have sustainable ecosystems in the world - everywhere forests, wetlands, savannas etc are being depleted, fragmented and destroyed. To return our planet to a state of health again, the current efforts to prevent further destruction must be matched by a concerted programme of restoration, to help the Earth heal, and to ensure that there is a sustainable future for ourselves, and all our fellow species. Most environmental initiatives are by necessity concentrated on damage limitation - reducing the destructive impact our industrial culture has on the world, but because of this they tend to be adversarial, creating opposition and polarity amongst different people and interest groups. By contrast, restoration is an entirely positive activity which can, and often does, draw together people from different backgrounds behind the common task of doing something positive for their local area and therefore the planet.

40

Because environmental degradation is a global phenomenon which transcends cultural, political and national differences, restoration will provide an opportunity to unite all of humanity behind a shared goal the first in our history - of helping to heal the Earth.
SOME POSSIBLE INITIATIVES TO BEGIN THE CENTURY OF RESTORING THE EARTH

45

15

50

20

Ten percent of each nations military budget to be re-directed to restoration activities, either in cash or in kind. Military personnel, equipment and organisational abilities to be made available for key restoration programmes. This will help to provide a new, meaningful role for the military in the next century, as true global security depends on having a healthy planet to live on! Establishment of an Earth Restoration Service, enrolling people from all over the world as volunteers in essential restoration programmes. Starting the new millennium with an international focus on restoration will provide a positive vision for nations and individuals to rally behind, and will help people everywhere to realise that we need to actively take care of our degraded world for our future well-being.

55

25

60

30

35

http://www.treesforlife.org.uk/tfl.intnl.html

17
20 Exame de Qualificao Vestibular Estadual 2002

138 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS INGLS

Questo 17 The main aim of the proposal for the United Nations is to raise public awareness in relation to the following course of action: (A) healing degraded ecosystems (B) preserving endangered species (C) diminishing human exploitation (D) preventing ecological devastation

Questo 18 According to the text, true global security will only be achieved through initiatives to: (A) refine clean-up techniques (B) promote worldwide peace (C) implement ecological recovery (D) encourage local volunteer work

Questo 19
damage limitation x restoration

These two practices, suggested in the text, produce distinct results. They are best characterized in the opposition conveyed by the following pair of adjectives: (A) topological and climatic (B) permanent and provisional (C) prescriptive and descriptive (D) segregatory and combinatory

Questo 20
as all our human well-being and wealth ultimately derives from the ability of our planet to provide abundance (l. 8 - 10)

In the excerpt above, the adverb ultimately means: (A) lastly (B) recently (C) currently (D) fundamentally

18
20 Exame de Qualificao Vestibular Estadual 2002

139 LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS INGLS

Com base no texto abaixo, responda s questes de nmeros 21 e 22.

International Alert is a non-governmental organisation based in the UK. The organisation was set up in 1985 by human rights advocates including Martin Ennals, former Secretary General of Amnesty International and a committed defender of human rights. Martin Ennals was the founding Secretary General of International Alert. The creation of the organisation was a response to the rise in violent conflict within countries and the subsequent abuse of individual and collective human rights in conflict situations. Today there is an evermore pressing need for conflict resolution and peacebuilding efforts.
ROLE

IA seeks to strengthen the ability of people in conflict situations to make peace by: . facilitating dialogue at different levels and sectors of society in conflict; . helping to develop and enhance local capacities - through, for example, funding or training; . facilitating peace-oriented development work amongst grassroots organisations and local peacebuilding initiatives; . encouraging the international community to address the structural causes of conflict. IA is also engaged in advocacy and policy analysis which enables us to: . generate international awareness for the issues and concerns arising out of our field work; . give voice to critical issues raised by regional and local organisations; . address issues relating to the deep-seated causes of conflict.
http://www.international-alert.org/aboutus.htm

Questo 21 The intention behind a manifesto is that of eliciting some kind of response from readers. Therefore, the most basic reaction to be expected here is: (A) provision of funds (B) change of attitude (C) propaganda of ideas (D) distribution of tasks Questo 22 The argumentation in the text is structured by means of the following combination of strategies: (A) explanation and analogy (B) definition and illustration (C) justification and purpose (D) condition and presupposition

19
20 Exame de Qualificao Vestibular Estadual 2002

140 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS Questo 23

A aguardente uma bebida alcolica obtida da cana-de-acar. A charge abaixo poderia transmitir a idia de que se trata de uma substncia pura.

(HARTWIG, et alli. Qumica: qumica geral e inorgnica. So Paulo: Scipione, 1999.)

Na realidade, ela no uma substncia pura, mas sim uma mistura homognea. Isso pode ser comprovado pelo seguinte processo fsico de separao: (A) filtrao (B) destilao (C) decantao (D) centrifugao Questo 24 A velocidade angular W de um mvel inversamente proporcional ao tempo T e pode ser representada pelo grfico abaixo.

Quando W igual a 0,8 rad/s, T, em segundos, corresponde a: (A) 2,1 (B) 2,3 (C) 2,5 (D) 2,7

20
20 Exame de Qualificao Vestibular Estadual 2002

141 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 25 As falhas da camada de oznio da alta atmosfera provocam uma maior incidncia de radiao solar sobre a Terra, aumentando o nmero de casos de cncer de pele. A pele escura, no entanto, mais resistente doena do que a pele clara. A menor incidncia do cncer nas pessoas de pele escura se deve seguinte associao entre tipo de radiao e sua absoro por substncias encontradas na pele: (A) raios X - melanina (B) raios ultravioleta - melanina (C) raios infravermelhos - queratina (D) raios luminosos na faixa visvel - queratina Questo 26
O acelerador de ons pesados relativsticos de Brookhaven (Estados Unidos) foi inaugurado com a coliso entre dois ncleos de ouro, liberando uma energia de 10 trilhes de eltrons-volt. Os cientistas esperam, em breve, elevar a energia a 40 trilhes de eltrons-volt, para simular as condies do Universo durante os primeiros microssegundos aps o Big Bang.
(Cincia Hoje, setembro de 2000)

Sabendo que 1 eltron-volt igual a 1,6 10-19 joules, a ordem de grandeza da energia, em joules, que se espera atingir em breve, com o acelerador de Brookhaven, : (A) 10-8 (B) 10-7 (C) 10-6 (D) 10-5 Questo 27 Uma panela, contendo um bloco de gelo a - 40 C, colocada sobre a chama de um fogo. A evoluo da temperatura T, em graus Celsius, ao longo do tempo x, em minutos, descrita pela seguinte funo real:

O tempo necessrio para que a temperatura da gua atinja 50 C, em minutos, equivale a: (A) 4,5 (B) 9,0 (C) 15,0 (D) 30,0

21
20 Exame de Qualificao Vestibular Estadual 2002

142 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 28 Um corpo de peso P encontra-se em equilbrio, suspenso por trs cordas inextensveis. Observe, na figura, o esquema das foras T1 e T2 , que atuam sobre o n de juno das cordas, e os respectivos ngulos, e , que elas formam com o plano horizontal.

Fazendo a decomposio dessas foras, um aluno escreveu o seguinte sistema de equaes:

Sabendo que e so ngulos complementares, o aluno pde determinar a seguinte expresso do cos em funo de T1 , T2 e P: (A)

(B)

(C)

(D)

Questo 29 A sndrome conhecida como vaca louca uma doena infecciosa que ataca o sistema nervoso central de animais e at do homem. O agente infeccioso dessa doena um pron - molcula normal de clulas nervosas - alterado em sua estrutura tridimensional. Os prons assim alterados tm a propriedade de transformar prons normais em prons infecciosos. Os prons normais so digeridos por enzimas do tipo da tripsina. Curiosamente, os alterados no o so, o que, entre outras razes, permite a transmisso da doena por via digestiva. Tais dados indicam que a molcula do pron de natureza: (A) glicolipdica (B) polipeptdica (C) polissacardica (D) oligonucleotdica

22
20 Exame de Qualificao Vestibular Estadual 2002

143 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 30 A influncia da concentrao de CO2 (C) e da intensidade luminosa (I) do ambiente sobre a capacidade fotossinttica (T) de um determinado tipo de planta foi testada em laboratrio. Utilizando-se cinco plantas idnticas, mediu-se T em funo de C e I, nas condies definidas na tabela.

Considere que, quanto maior o ndice de cada varivel, maior o seu valor numrico. O resultado da experincia leva concluso de que a capacidade fotossinttica dessa planta atinge a saturao acima de determinados valores de C e I. Dentre as condies testadas, os valores mnimos de C e de I que, isoladamente, provocam a saturao, so: (A) C4 e I4 (B) C3 e I3 (C) C4 e I2 (D) C3 e I1 Questo 31 Em uma determinada etapa metablica importante para gerao de ATP no msculo, durante a realizao de exerccios fsicos, esto envolvidas trs substncias orgnicas cido pirvico, gliceraldedo e glicose identificveis nas estruturas X, Y e Z, a seguir.

Na etapa metablica considerada, tais substncias se apresentam na seguinte seqncia: (A) X - Y - Z (B) Z - Y - X (C) X - Z - Y (D) Z - X - Y
20 Exame de Qualificao Vestibular Estadual 2002

23

144 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 32 Nas panelas de presso atuais, a gua ferve a aproximadamente 130 C, e no a 100 C, no nvel do mar. Para duas panelas de presso idnticas, A1 e A2, considere as seguintes condies: - duas massas de gua, m1 e m2, ambas a 30 C no nvel do mar, so levadas fervura, respectivamente, em A1 e A2; - A1 mantida sem tampa e A2 com tampa; - a quantidade de calor necessria para dar incio fervura, nos dois casos, a mesma. Para satisfazer as condies descritas, a razo entre m2 e m1 dever ser igual a: (A) 1,30 (B) 1,00 (C) 0,90 (D) 0,70
Utilize as informaes abaixo para responder s questes de nmeros 33 e 34.

Em uma pesquisa para produo de organismos transgnicos, isolou-se um fragmento de DNA que continha o gene a ser estudado. O DNA foi cortado com enzimas de restrio e seus fragmentos foram separados por eletroforese. Nesta tcnica, os fragmentos so colocados em um suporte poroso embebido em soluo salina a pH 8,0. Uma corrente eltrica contnua percorre o suporte, fazendo com que os fragmentos de DNA migrem em direo ao plo positivo.

Questo 33 O DNA migra para o plo positivo porque contm, em sua molcula, grande nmero de radicais de: (A) fosfato (B) sulfato (C) nitrato (D) amnio Questo 34 Considere que as cargas negativas de todos os fragmentos sejam iguais e que a velocidade de migrao dos fragmentos sobre o suporte poroso seja uma funo inversa do tamanho do fragmento. Assim, a diferena constatada nas velocidades de migrao conseqncia da ao de foras de diferentes intensidades sobre os fragmentos. Estas foras so da seguinte natureza: (A) eltrica (B) repulsiva (C) dissipativa (D) gravitacional

24
20 Exame de Qualificao Vestibular Estadual 2002

145 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 35 Traras so predadoras naturais dos lambaris. Acompanhou-se, em uma pequena lagoa, a evoluo da densidade populacional dessas duas espcies de peixes. Tais populaes, inicialmente em equilbrio, sofreram notveis alteraes aps o incio da pesca predatria da trara, na mesma lagoa. Esse fato pode ser observado no grfico abaixo, em que a curva 1 representa a variao da densidade populacional da trara.

A curva que representa a variao da densidade populacional de lambaris a de nmero: (A) 2 (B) 3 (C) 4 (D) 5 Questo 36 A amnia empregada como matria-prima na fabricao de fertilizantes nitrogenados. obtida industrialmente por sntese total, como mostra a reao: N2(g) + 3H2(g) 2NH3(g) O quadro abaixo mostra a variao do nmero de mols de nitrognio durante essa reao.

Considere rendimento de 100% no processo e condies normais de temperatura e presso. Assim, a velocidade mdia da reao em L/min, no intervalo de 2 a 10 minutos, em funo do consumo de H2, equivale a: (A) 22,4 (B) 44,8 (C) 67,2 (D) 89,6
20 Exame de Qualificao Vestibular Estadual 2002

25

146 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 37
Quando ingerimos mais carboidratos do que gastamos, seu excesso armazenado: uma parte sob a forma de glicognio, e a maior parte sob a forma de gorduras. As gorduras so, na sua maioria, steres derivados de cidos carboxlicos de longa cadeia aliftica, no ramificada. Essa cadeia contm um nmero par de carbonos conseqncia natural do modo como se d a sntese das gorduras nos sistemas biolgicos.
(Adaptado de MORRISON, R. e BOYD, R. Qumica orgnica. Lisboa: Fundao Calouste Gulbenkian, 1981.)

Um cido carboxlico, com as caractersticas estruturais citadas no texto, apresenta a seguinte frmula: (A) (B) (C) (D) Questo 38 O brao humano, com o cotovelo apoiado sobre uma superfcie, ao erguer um objeto, pode ser comparado a uma alavanca, como sugere a figura abaixo.

(Adaptado de KING, A.R. & REGEV, O. Physics with answers. Cambridge: Cambridge University Press, 1997.)

Sejam P o peso do objeto a ser erguido, P0 o peso do brao e F o valor da fora muscular necessria para erguer o objeto at a posio em que o brao forma um ngulo com a horizontal. Considere que a distncia L, entre o ponto de aplicao de P e o cotovelo, seja 20 vezes maior do que a distncia l, entre o ponto de aplicao de F e o cotovelo. Neste caso, o mdulo da fora F igual a: (A) 20 P + 10 P 0 (B) 20 P + 20 P 0 (C) 10 P + 10 P 0 (D) 10 P + 20 P 0

26
20 Exame de Qualificao Vestibular Estadual 2002

147 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 39 Leia o texto a seguir.

(Adaptado de Revista Galileu, janeiro de 2001)

Um estudante fez uma experincia semelhante descrita no texto, utilizando uma vareta OA de 2 metros de comprimento. No incio do inverno, mediu o comprimento da sombra OB , encontrando 8 metros. Utilizou, para representar sua experincia, um sistema de coordenadas cartesianas, no qual o eixo das ordenadas (y) e o eixo das abscissas (x) continham, respectivamente, os segmentos de reta que representavam a vareta e a sombra que ela determinava no cho. Esse estudante pde, assim, escrever a seguinte equao da reta que contm o segmento AB: (A) y = 8 (B) x = 6 (C) x = 8 (D) y = 6
4x 3y 4y 3x

Questo 40 Uma manifestao comum nas torcidas de futebol a queima de fogos de artifcio coloridos, de acordo com as cores dos times. Fogos com a cor vermelha, por exemplo, contm um elemento que possui, como mais energtico, um subnvel s totalmente preenchido. Assim, a torcida do Amrica, para saudar o seu time com um vermelho brilhante, dever usar fogos contendo o elemento cujo smbolo : (A) Cd (B) Co (C) K (D) Sr

27
20 Exame de Qualificao Vestibular Estadual 2002

148 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 41 Um professor de matemtica fez, com sua turma, a seguinte demonstrao: - colocou um CD sobre uma mesa e envolveu-o completamente com um pedao de barbante, de modo que o comprimento do barbante coincidisse com o permetro do CD; - em seguida, emendando ao barbante um outro pedao, de 1 metro de comprimento, formou uma circunferncia maior que a primeira, concntrica com o CD. Veja as figuras abaixo.

Calculou, ento, a diferena entre as medidas do raio da circunferncia maior e do raio do CD, chamando-a de x. Logo aps, imaginando um CD com medida do raio idntica do raio da Terra, repetiu, teoricamente, as etapas anteriores, chamando de y a diferena encontrada. Assim, demonstrou a seguinte relao entre essas diferenas, x e y: (A) x + y (B) x + y (C) y x (D) y x = 1 = 2 = 2 = 1

Questo 42 Para demonstrar a relao entre polaridade e solubilidade, um professor realiza um experimento que consiste em adicionar etanol a uma soluo aquosa saturada de sal de cozinha e observar a precipitao do sal. Na falta de sal de cozinha, para realizar o mesmo experimento, o professor poderia utilizar a seguinte substncia: (A) metano (B) tetracloro metano (C) anidrido carbnico (D) iodeto de potssio

28
20 Exame de Qualificao Vestibular Estadual 2002

149 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 43 Apesar de Giordano Bruno ter sido levado fogueira em 1600 por sustentar que o espao infinito, Newton (1642-1727) admite essa possibilidade, implicitamente, em algumas de suas leis, cujos enunciados so:
III - Na ausncia de resultante de foras, um corpo em repouso continua em repouso e um corpo em movimento mantm-se em movimento retilneo com velocidade constante. III - A acelerao que um corpo adquire diretamente proporcional resultante das foras que atuam nele e tem a mesma direo e o mesmo sentido desta resultante. III - Quando um corpo exerce uma fora sobre outro corpo, este reage sobre o primeiro com uma fora de mesmo mdulo, mesma direo e sentido oposto. IV - Dois corpos quaisquer se atraem com uma fora proporcional ao produto de suas massas e inversamente proporcional ao quadrado da distncia entre eles.

As leis que, implicitamente, pressupem a existncia do espao infinito so: (A) I e III (B) I e IV (C) II e III (D) II e IV Questo 44 A 3 lei de Kepler relaciona o perodo (T) do movimento de um planeta ao redor do Sol com a distncia mdia (R) entre ambos, conforme a equao abaixo, na qual K uma constante:

Admitindo que os planetas descrevem rbitas circulares, Newton deduziu, a partir dessa lei de Kepler, sua famosa lei da gravitao universal, na qual G a constante da gravitao universal, M a massa do Sol, m a do planeta e r a distncia entre eles:

Suponha que Newton tivesse encontrado a seguinte lei de gravitao, na qual n um nmero inteiro:

Neste caso, o segundo membro da equao da 3 lei de Kepler deveria ser igual a: (A) KR n- 2 (B) KR n-1 (C) KRn+1 (D) KRn+ 2

29
20 Exame de Qualificao Vestibular Estadual 2002

150 CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 45 Um corpo cai em direo terra, a partir do repouso, no instante t = 0. Observe os grficos abaixo, nos quais so apresentadas diferentes variaes das energias potencial (Ep) e cintica (Ec) deste corpo, em funo do tempo.

O grfico energia x tempo que melhor representa a variao das duas grandezas descritas o de nmero: (A) 1 (B) 2 (C) 3 (D) 4 Questo 46 Em uma experincia de fecundao in vitro, 4 vulos humanos, quando incubados com 4 suspenses de espermatozides, todos igualmente viveis, geraram 4 embries, de acordo com a tabela abaixo.

Observe os grficos:

Considerando a experincia descrita, o grfico que indica as probabilidades de os 4 embries serem do sexo masculino o de nmero: (A) 1 (B) 2 (C) 3 (D) 4

30
20 Exame de Qualificao Vestibular Estadual 2002

151 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 47

(Adaptado de GLAUCO. Abobrinhas da Brasilnia. So Paulo: Circo Editorial, 1985.)

No parecem ter desaparecido plenamente todas as formas tradicionais e degradantes do trabalho, muitas vezes constituindo-se justamente como fonte geradora de maiores ocupaes. (...) O capitalismo tenderia a produzir ocupaes precrias em profuso, a despeito da gerao de empregos com contedo de trabalho mais elevado.
(Adaptado de POCHMAN, Marcio. O emprego na globalizao. So Paulo: Boitempo, 2001.)

A partir da associao entre a charge e o texto, uma causa e uma conseqncia identificveis nas tendncias do mercado de trabalho brasileiro, ao longo das ltimas dcadas, so respectivamente: (A) desemprego e tentativa de insero no setor formal (B) instabilidade econmica e busca de trabalho informal (C) retrao industrial e retorno a ocupaes no setor primrio (D) crescimento urbano e desenvolvimento de estratgias coletivas de sobrevivncia Questo 48
BSNIA-HERZEGOVINA, abril de 1992. Nessa ex-repblica iugoslava, que declarara sua independncia em maro de 1992, se travou nos trs anos seguintes a mais sangrenta das recentes guerras balcnicas. Srvios (cristos ortodoxos) e croatas (catlicos) lutaram para ampliar seus domnios, em detrimento dos muulmanos bsnios. Uma das mais cruis faces dessa guerra foi o implacvel cerco srvio capital da Bsnia, Sarajevo. Franco-atiradores srvios, postados nas montanhas em torno da cidade, alvejaram civis indefesos nas ruas.
(O Globo, 02/04/2001)

O texto ressalta que a disputa nacionalista na ex-repblica da Iugoslvia apresenta o seguinte trao dominante: (A) presena da questo religiosa nos conflitos regionais (B) predomnio de milcias no lugar de exrcitos regulares (C) infiltrao de grupos religiosos estrangeiros nos confrontos (D) participao da populao civil nos enfrentamentos armados

31
20 Exame de Qualificao Vestibular Estadual 2002

152 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 49 Observe a temtica central das canes abaixo.


CANO I CANO II

Quando oiei a terra ardendo Qu fogueira de So Joo Eu perguntei a Deus do cu Por que tamanha judiao ... Int mesmo a asa branca Bateu asas do serto Into eu disse: adeus Rosinha Guarda contigo meu corao Hoje longe muitas lguas Numa triste solido Espero a chuva cair de novo Pra eu voltar pro meu serto
(Asa Branca, Humberto Teixeira e Lus Gonzaga)

Chegaram em So Paulo sem cobre [quebrado, e o pobre acanhado percura um patro, ... Trabalha dois ano, trs ano e mais ano, e sempre nos plano de um dia voltar, mas nunca ele pode, s vive devendo e assim vai sofrendo, sofrer sem parar. Distante da terra to seca mas boa, exposto garoa, lama e o pa, faz pena o nortista to forte e to bravo, viver como escravo no Norte e no Sul
(Poema de Patativa do Assar, musicado por Lus Gonzaga)

A associao correta entre o nmero da cano - I ou II - e a explicao constatada na maioria dos estudos cientficos sobre esta temtica : (A) I - religiosidade do povo como expectativa de soluo dos problemas (B) I - adversidade natural do serto como responsvel pelos deslocamentos (C) II - situao econmica dos migrantes como um determinante dos fluxos (D) II - esperana de retorno dos retirantes como alternativa de sobrevivncia Questo 50
A proclamao da Repblica em 1889, ao promover a descentralizao poltico-administrativa do pas, gerou expectativas de uma efetiva autonomia no agora Estado do Rio de Janeiro. A implantao da Repblica Federativa do Brasil coincidiu, no Estado do Rio, com srias dificuldades econmicas e financeiras que, em fins da dcada de 1890, chegaram a uma situao limite, muito embora esse quadro de crise tenha sido entremeado por breves conjunturas de recuperao. Alm desses problemas de ordem econmica, o exerccio, pelos fluminenses, da autonomia que o federalismo oferecia, foi dificultado, mais uma vez, pela proximidade da capital federal, a ponto de se tornar voz corrente que a poltica estadual era decidida na rua do Ouvidor.
(FERREIRA, Marieta de M. Poltica e poder no Estado do Rio de Janeiro na Repblica Velha. In: Revista Rio de Janeiro. UFF, dezembro de 1985.)

O Estado do Rio de Janeiro, apesar da nova estrutura poltica decorrente da Proclamao da Repblica, apresentou, na virada do sculo XIX, caractersticas que o distinguiam dos estados de So Paulo e Minas Gerais. Uma dessas caractersticas, destacada no texto acima, : (A) enfraquecimento do poder poltico local (B) retomada do poder econmico das elites locais (C) controle do governo da Unio pelos polticos locais (D) subordinao crescente interveno econmico-financeira do poder central
20 Exame de Qualificao Vestibular Estadual 2002

32

153 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 51 A respeito da crise energtica, observe os trechos da reflexo do professor Rogrio C. Cerqueira Leite e da situao do agricultor Luiz Gonzaga da Silva da cidade de Boqueiro na Paraba.
REFLEXO DO PROFESSOR SITUAO DO AGRICULTOR

Para enfrentar as variaes pluviomtricas (...) faz com que haja uma diferena entre a potncia instalada, que est ligada capacidade mxima do reservatrio, e a demanda de energia que depende do consumo. Essa relao, para usinas hidreltricas, gira em torno de 50%, dependendo das variaes pluviomtricas histricas. (...) No Brasil, com 65 milhes de kW instalados e demanda de 56 milhes de kW, o risco se tornou catastrfico.
(Adaptado de Folha de S. Paulo, 03/06/2001)

Na casa de barro batido onde vive com a mulher e 12 filhos, (...) o agricultor (...) explica o milagre de todos os dias para alimentar a famlia. (...) Mas o aperto vai aumentar para a vida daquela gente. H uma semana, tcnicos da recm-privatizada Companhia de Eletricidade da Paraba instalaram relgios medidores de controle de luz no Boqueiro. (...) Eles disseram que a gente tem que economizar 20%. Mas economizar mais o qu?, pergunta o agricultor (...) preocupado em baixar o consumo de trs lmpadas de 60 watts que iluminam sua casa de taipa.
(Adaptado de Folha de S. Paulo, 10/06/2001)

A leitura dos dois textos permite apontar uma causa e uma conseqncia da crise energtica, que so, respectivamente: (A) . nvel baixo de gua nas represas . fragilidade na estrutura de poder na esfera federal (B) . crescimento da demanda sem compatvel aumento da potncia instalada . intensificao das condies de pauperizao de parcela da populao (C) .variao pluviomtrica como determinante da insuficincia do potencial energtico . aumento da carncia social nas reas rurais (D) . privatizaes do setor com incentivo governamental na construo de novas usinas . resistncia da populao ao controle do consumo privado Questo 52
Ao invs do analfabetismo tradicionalmente identificado nos sculos XIX e XX com o noconhecimento pleno da lngua de origem, ganha destaque atualmente um novo tipo de analfabetismo imposto pela mudana tcnica e informacional.
(POCHMAN, Marcio. O emprego na globalizao. So Paulo: Boitempo, 2001.)

No texto acima, o autor compara duas formas de analfabetismo que podem ser associadas s atividades econmicas do passado e do presente, respectivamente. A segunda forma se distingue da primeira por evidenciar um aspecto decorrente das: (A) prioridades ligadas cultura (B) exigncias do modelo produtivo (C) tradies tecnolgicas vindas da manufatura (D) necessidades especficas do mercado informal

33
20 Exame de Qualificao Vestibular Estadual 2002

154 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 53
O trabalho no s foi deslocado objetivamente de seu status de uma realidade de vida central (...), mas inteiramente contrrio aos valores oficiais e aos padres de legitimao dessa sociedade, o trabalho est perdendo tambm seu papel subjetivo de fora estimulante central na atividade dos trabalhadores.
(Adaptado de OFFE, Claus. Capitalismo desorganizado. So Paulo: Brasiliense, 1989.)

O mundo do trabalho tem cada vez mais uma conformao mundializada. Com a expanso do capital em escala global e a nova forma assumida pela diviso internacional do trabalho, as respostas dos movimentos dos trabalhadores assumem cada vez mais um sentido universalizante. Cada vez mais as lutas de recorte nacional devem estar articuladas com uma luta de amplitude internacional.
(ANTUNES, Ricardo. Os sentidos do trabalho. So Paulo: Boitempo, 2000.)

As snteses do que est expresso no 1 e no 2 textos sobre as transformaes presentes no mundo do trabalho, encontram-se, respectivamente, em: (A) . o trabalho vem consolidando sua legitimidade no mundo atual . a dinmica atual da economia globalizada desvaloriza o mundo do trabalho (B) . o trabalho perdeu sua centralidade no mundo contemporneo . as reivindicaes dos trabalhadores se ajustam s novas tendncias do capitalismo (C) . o trabalho se mantm como fora poltica na luta da classe operria . as identidades sindicais se perderam em conseqncia da globalizao econmica (D) . a discusso sobre o trabalho ganhou novos contornos de legitimidade . a mundializao rompeu com a possibilidade de organizao dos trabalhadores

Questo 54
Sempre que os juzes achavam possvel distorcer a lei em benefcio da reao eles o faziam: Hitler, sendo austraco, deveria ter sido deportado aps seu putsch, mas foi-lhe permitido permanecer na Alemanha porque ele se considerava alemo. Por outro lado, contra os espartaquistas, comunistas ou cndidos jornalistas, as cortes procediam com maior rigor.
(GAY, Peter. A cultura de Weimar. Rio de Janeiro: Paz e Terra, 1978. )

O texto acima, sobre a Repblica de Weimar na Alemanha, expressa um dos aspectos da crise vivida por aquele pas no perodo do entreguerras. Alguns dos problemas enfrentados pela Alemanha, nesse perodo, esto relacionados com o seguinte fato: (A) As cortes alems aliavam-se imprensa no combate esquerda. (B) A esquerda alem estabeleceu vnculos de dependncia com o judicirio. (C) Os juzes alemes procuravam conciliar interesses da esquerda e da direita. (D) A direita alem obteve um tratamento diferenciado da esquerda nos tribunais.

34
20 Exame de Qualificao Vestibular Estadual 2002

155 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 55

A bolha especulativa que estourou Nova York comeou a respingar pelo resto do mundo e afetou de maneira especialmente dura a Amrica Latina. Investidores comearam a tirar dinheiro de fundos latino-americanos por averso ao risco da regio.
(Folha de S. Paulo, 18/03/2001)

O sinal mais recente que a crise afetou com intensidade a Amrica Latina veio de um relatrio preparado pelo banco de investimentos Salomon Smith Barney, nos Estados Unidos (...). Embora a fuga dos fundos tenha sido menor na ltima semana, alguns investidores dizem que a regio est sendo vista com mais pessimismo.
(Adaptado de Folha de S. Paulo, 18/03/2001)

A caracterizao do continente latino-americano como regio de risco e o pessimismo dos investidores, apontados nos textos acima, podem ser explicados por: (A) subordinao cultural e isolamento externo (B) especulao financeira e fragilidade industrial (C) desajuste econmico e instabilidade poltica (D) defasagem comercial e saturao do mercado interno

Questo 56
Se se mantm o crescimento demogrfico de 1,2% (77 milhes de pessoas por ano) e se continua aumentando a expectativa de vida tal como nas ltimas dcadas, a populao mundial hoje de 6,1 bilhes poder chegar a 9,3 bilhes no ano 2050. Apesar disso, os ndices demogrficos da Europa e do Japo decrescem dramaticamente: Itlia, Espanha, Rssia e Hungria registraro as maiores perdas de populao, (...) sofrero os efeitos desse fenmeno. Segundo esse ritmo, a populao europia decrescer at 2050 dos 350 milhes atuais para 330 milhes. Nessas reas, o aumento da expectativa de vida multiplica o nmero de maiores de 65 anos, modificando a proporo entre trabalhadores ativos e pessoas dependentes (crianas e idosos). Mesmo sendo difcil (...) para os que se opem chegada de trabalhadores estrangeiros, a velhice digna dos cidados europeus ser assegurada (...).
(Adaptado de PAPP, Edith. El siglo del Sur. Espanha, Centro de Colaboraciones Solidarias, maro de 2001.)

Os pases europeus vm enfrentando esse problema da reduo da populao economicamente ativa com adoo da seguinte prtica: (A) uso do trabalho dos imigrantes (B) reduo no ritmo da atividade econmica (C) estatizao dos servios pblicos essenciais (D) desestmulo emigrao para fora do continente

35
20 Exame de Qualificao Vestibular Estadual 2002

156 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 57
TEXTO I TEXTO II

No contexto maior da economia colonial, a produo para o mercado interno gado e alimentos apresentava um forte carter de subordinao face grande produo de exportao. (...) Enquanto os compradores compareciam a um mercado de preos tabelados, os produtores de alimentos so obrigados a comprar os gneros de que necessitam escravos, ferros, tachos, armas em um mercado livre, quase sempre com preos estabelecidos na base do exclusivo colonial, sem qualquer concorrncia.
(SILVA, Francisco Carlos Teixeira da. In: LINHARES, M. Yedda (org.). Histria geral do Brasil . Rio de Janeiro: Campus, 2000.)

A luta pelos alimentos como direito e pela comida sadia das menos obscurantistas que pode haver, reflete o direito vida e escolha do que comer e ser informado sobre o que est comendo. uma luta dos direitos do consumidor contra a lgica voraz dos grandes consrcios alimentcios, dentre os quais se destaca o Monsanto que ocupa vrios cargos no governo Bush, tal sua fora e voracidade.
(SADER, Emir. In: poca, maro de 2001.)

O primeiro texto procura contextualizar a produo para o abastecimento interno no Brasil Colnia, enquanto que o segundo refere-se invaso de uma propriedade do Monsanto, produtor internacional de alimentos, por ambientalistas e pelo MST, durante o Frum Social Mundial contra a globalizao, realizado em Porto Alegre. A alternativa que aproxima os dois textos por apontar uma semelhana entre o processo brasileiro de produo de alimentos, no passado e no presente, : (A) A produo agrcola se mantm subordinada a interesses externos. (B) O Estado deixa para agricultores de subsistncia a tarefa da produo alimentar. (C) As polticas pblicas para o setor agrrio provocam preos altos dos produtos exportados. (D) As aes do Estado priorizam a produo alimentcia atravs de consrcios internacionais. Questo 58

( Adaptado de http://www.no.com.br, 24/03/2001)

Considerando os estudos atuais da Geografia Urbana, os indicadores sociais apontados na tabela acima contribuem para explicitar o conceito de: (A) rede geogrfica (B) hierarquia urbana (C) desterritorializao (D) segregao socioespacial

36
20 Exame de Qualificao Vestibular Estadual 2002

157 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 59
Nessas condies resta a Goulart, com apoio das organizaes sindicais, dos nacionalistas e dos partidos de esquerda, passar, ento, para a ofensiva e, buscando nas ruas, atravs de manifestaes de massa e de comcios, a base que lhe faltava no Congresso. Esse ver-se-ia na contingncia de recusar a realizao da sua vontade, particularmente no tocante s Reformas de Base. Para implementar as reformas que considerava necessrias, Goulart apoiava-se no ento chamado dispositivo militar sindical: alguns comandos militares fiis e a ampla rede de sindicatos, controlados pelo Estado desde a poca de Vargas.
(RAMALHO, Jos R. & SANTANA, Marco A. (org.). Trabalho e tradio sindical no Rio de Janeiro. Rio de Janeiro: DP&A, 2001.) (SILVA, Francisco Carlos Teixeira da. In: LINHARES, M.Yedda (org.). Histria geral do Brasil . Rio de Janeiro: Campus, 2000.)

A fotografia do astronauta Iuri Gagarin no Sindicato dos Metalrgicos e o texto evidenciam o tipo de relao do Presidente Joo Goulart com o movimento sindical no perodo antecedente ao golpe de 1964. O comportamento dos sindicatos poca est caracterizado em: (A) Apoiavam a ideologia comunista, aproximando-se do Presidente Goulart e da Unio Sovitica. (B) Envolviam-se em questes polticas, abdicando de reivindicaes corporativas e nacionalistas. (C) Procuravam adotar um comportamento radical, opondo-se ao reformismo e conciliao do presidente. (D) Tinham grande proximidade com o poder poltico, comprometendo-se com questes nacionais e internacionais.

Questo 60
No necessrio entrar em detalhes da histria do entreguerras para ver que o acordo de Versalhes no podia ser a base de uma paz estvel. Estava condenado desde o incio, e portanto outra guerra era praticamente certa. (...) os EUA quase imediatamente se retiraram e (...) nenhum acordo no endossado pelo que era agora uma grande potncia mundial (...) podia se sustentar. Como veremos, isto se aplicava tanto s questes econmicas do mundo quanto sua poltica.
(Adaptado de HOBSBAWM, Eric. Era dos extremos: o breve sculo XX; 1914-1991. So Paulo: Companhia das Letras, 1996.)

A partir do texto, uma interpretao mais atenta do perodo do entreguerras evidencia um processo de: (A) recuo do eurocentrismo (B) fragilizao do nacionalismo (C) afirmao da multipolarizao (D) reaparecimento de superpotncias

37
20 Exame de Qualificao Vestibular Estadual 2002

158 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 61 Dados estatsticos veiculados por vrias fontes revelam que no foram as grandes metrpoles as cidades que mais cresceram no Brasil na dcada de 90, mas sim as cidades mdias. Duas causas diretas para esse fenmeno so: (A) . sobrecarga das reas metropolitanas . fixao dos trabalhadores rurais no campo (B) . redirecionamento dos fluxos migratrios internos . disperso espacial de diversos setores produtivos (C) . incentivos fiscais por parte das prefeituras locais . reorganizao da distribuio de recursos pelo governo federal (D) . desacelerao do crescimento populacional . dinamizao do setor agrrio nas imediaes das cidades mdias Questo 62

(Adaptado de OLIVEIRA, Curio de. Curso de cartografia moderna. IBGE, 1988.)

Compare os mapas A e B e suponha um acrscimo de informaes geogrficas do real em cada um deles. Nesse caso, a proporo da escala cartogrfica e a explicao para a menor riqueza de detalhes no mapa A esto indicadas, respectivamente, na seguinte alternativa: (A) maior / muita variao de elementos (B) maior / pouca variao de elementos (C) menor / maior nmero de vezes de reduo (D) menor / menor nmero de vezes de reduo

38
20 Exame de Qualificao Vestibular Estadual 2002

159 CINCIAS HUMANAS E SUAS TECNOLOGIAS

Leia o texto a seguir para responder s questes de nmeros 63 e 64. Aprendemos que somos um dom de Deus e da Natureza porque nossa terra desconhece catstrofes naturais (...) e que aqui, em se plantando, tudo d. (...) Aprendemos tambm que nossa histria foi escrita sem derramamento de sangue, (...) que a grandeza do territrio foi um feito de bravura herica do Bandeirante, da nobreza de carter moral do Pacificador, Caxias, e da agudeza fina do Baro do Rio Branco; e que, forados pelos inimigos a entrar em guerras, jamais passamos por derrotas militares. (...) No tememos a guerra, mas desejamos a paz. (...) somos um povo bom, pacfico e ordeiro, convencidos de que no existe pecado abaixo do Equador. (...) Em suma, essa representao permite que uma sociedade que tolera a existncia de milhes de crianas sem infncia e que, desde seu surgimento, pratica o apartheid social possa ter de si mesma a imagem positiva de sua unidade fraterna.
(Adaptado de CHAU, Marilena. Brasil-mito fundador e sociedade autoritria. So Paulo: Fundao Perseu Abramo, 2000.)

Questo 63 A reflexo da autora aponta ao mesmo tempo uma representao do Brasil e uma crtica da realidade brasileira, que podem ser traduzidas, respectivamente, por: (A) viso ufanista reconhecimento das desigualdades (B) desrespeito ao pas exaltao da misria coletiva (C) nfase nacionalista percepo do atraso tecnolgico (D) fragilidade da nao aclamao dos problemas nacionais

Questo 64 aqui, em se plantando, tudo d A construo do mito de satisfao das necessidades alimentares, evidenciada neste fragmento do texto, contradiz a seguinte afirmativa: (A) As terras frteis resultam da ao de agrotxicos. (B) Os melhores solos destinam-se aos cultivos para exportao. (C) Os avanos tecnolgicos direcionam-se s propriedades improdutivas. (D) Os diversos tipos climticos dificultam a variedade de cultivos agrcolas.

39
20 Exame de Qualificao Vestibular Estadual 2002

160

GABARITO OFICIAL - 2 EXAME DE QUALIFICAO

01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16

D C A B A D B D C B D B C B D B

ESPANHOL

17 18 19 20 21 22

B A D B A C

FRANCS

17 18 19 20 21 22

D B C A D C

INGLS

17 18 19 20 21 22

A C D D B C

23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43

B C B D C A B D C D A C D C C A C D A D B

44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64

C A A B A C A B B B D C A A D D A B C A B

161

1a fase | 1o exame de qualificao


Neste caderno voc encontrar um conjunto de 40 (quarenta) pginas numeradas seqencialmente, contendo 64 (sessenta e quatro) questes das seguintes reas: Linguagens, Cdigos e suas Tecnologias; Cincias da Natureza, Matemtica e suas Tecnologias; Cincias Humanas e suas Tecnologias. A tabela peridica encontra-se na litima pgina. No abra o caderno antes de receber autorizao.

INSTRUES
1. Verifique se o seu nome, nmero de inscrio, nmero do documento de identidade e lngua estrangeira escolhida esto corretos no carto de respostas. Se houver erro, notifique o fiscal. Assine o carto de respostas com caneta. 2. Ao receber autorizao para abrir este caderno, verifique se a impresso, a paginao e a numerao das questes esto corretas. Caso ocorra qualquer erro, notifique o fiscal. 3. As questes de nmeros 17 a 22 da rea de Linguagens, Cdigos e suas Tecnologias devero ser respondidas de acordo com a sua opo de Lngua Estrangeira: Espanhol, Francs ou Ingls. 4. Leia atentamente cada questo e escolha a alternativa que mais adequadamente responde a cada uma delas. Marque sua resposta no carto de respostas, cobrindo fortemente o espao correspondente letra a ser assinalada; utilize caneta preta, preferencialmente, ou lpis preto n 2, conforme o exemplo abaixo:

5. A leitora de marcas no registrar as respostas em que houver falta de nitidez e/ ou marcao de mais de uma letra. 6. O carto de respostas no pode ser dobrado, amassado, rasurado ou manchado. Exceto sua assinatura, nada deve ser escrito ou registrado fora dos locais destinados s respostas. 7. Voc dispe de 4 (quatro) horas para fazer esta prova. 8. Ao terminar a prova, entregue ao fiscal o carto de respostas e este caderno.

162

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS


Com base no texto abaixo, responda s questes de nmeros 01 a 04.
FRUM DE DISCUSSO
01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27

MENSAGEM 1:

28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55

A cincia, para muitos, tem um lado maligno. Para alguns, estamos passando por uma nova Idade Mdia, onde a tcnica alienante faz as vezes da religio catlica. At agora, minha concluso pessimista: por mais que violentemos nosso pensamento, nossa razo ainda estar subordinada ao desejo. E assim, no h certo ou errado. A cincia nos d (ou melhor, vende) armas contra a natureza, que usamos contra ns mesmos, apenas isso. No existe nada mais irracional que o trabalho cientfico dos dias atuais.
MENSAGEM 2:

Caro M., o que voc entende exatamente por cincia? Um orculo todo-poderoso e prepotente que diz aos pobres e tolos homens o que est certo e o que errado? Como pode dizer que ela nos d armas contra a natureza? No me vem cabea neste momento caracterstica mais prpria da natureza humana do que o modo cientfico de pensar. Voc no consegue encontrar nada de cientfico no mtodo de caa de um aborgene australiano? Ou ento no modo de um crenacarore* do Amazonas tratar a terra para o cultivo? Voc est claramente confundindo aplicao da tecnologia com cincia. Muitos filsofos tm tido problemas para separar uma coisa da outra (e

muitos cientistas tambm). Se voc acha que construir uma bomba atmica, por exemplo, um trabalho cientfico, est enganado. pura e simplesmente um trabalho tecnolgico. claro que ele depende do conhecimento cientfico, mas impossvel construir conhecimento cientfico visando sua aplicao imediata. Aqueles que, como voc, confundem Igreja Catlica da Idade Mdia com cincia, esquecem-se (ou no sabem) que esta ltima tem embutida em si um mecanismo de correo de erros, que o motor que a move. Nenhuma questo tratada pela cincia como fechada, nenhum conhecimento est imune de questionamento e dvida. Com certeza eu no concordo com muito do que a humanidade vem construindo atravs da aplicao do conhecimento cientfico; no entanto, a prpria cincia a arma mais poderosa que temos para enfrentar estas questes, e por isso critic-la um tiro pela culatra. Voc pode fazer como muitos histricos e criticar a cincia porque a Monsanto patenteou uma soja que tolera um nico pesticida, cinco vezes mais forte que os tradicionais, alm do fato de o pesticida ser da prpria Monsanto. Mas voc estar tambm sendo contra a salvao de milhares de vidas na frica, onde o nico modo de obter-se vacinas cultivando bananas transgnicas que contm antgenos. Para mim, isto que ser irracional.
Frum Ctico Brasileiro janeiro de 2002 http://www.nitnet.com.br

*indivduo pertencente tribo indgena de mesmo nome

Questo 0 1 01
De acordo com a primeira mensagem, o trabalho cientfico caracteriza-se pelo irracionalismo. Pela exposio do autor, esse irracionalismo no superado porque: (A) o desejo comanda a cincia (B) o trabalho cientfico aproxima-se da religio (C) a alienao resulta do desenvolvimento tcnico (D) a natureza contrape-se ao conhecimento cientfico

1o Exame de Qualificao | Vestibular Estadual 2003

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

163

Questo 0 2 02
Os parnteses so utilizados por ambos os autores para: (A) fazer ironias provocativas (B) acrescentar informao acessria (C) estabelecer intimidade com o leitor (D) preservar a informalidade da mensagem

Questo 03
O autor da segunda mensagem emprega elementos de coeso ou ligao entre frases ou idias para compor sua estratgia argumentativa: aceitar, em um primeiro momento, os argumentos do outro para, depois, combat-los. O trecho que exemplifica o uso de elementos de coeso para construir esse tipo de estratgia : (A) No me vem cabea neste momento caracterstica mais prpria da natureza humana do que o modo cientfico de pensar. (l. 18 - 21) (B) Ou ento no modo de um crenacarore do Amazonas tratar a terra para o cultivo? (l. 23 - 24) (C) Com certeza eu no concordo com muito do que a humanidade vem construindo... no entanto, a prpria cincia a arma...para enfrentar estas questes, (l. 41 - 46) (D) ...porque a Monsanto patenteou uma soja que tolera um nico pesticida,..., alm do fato de o pesticida ser da prpria Monsanto. (l. 48 - 51)

Questo 04
O mesmo autor, na sua resposta, emprega um sofisma: desvia-se da questo em debate e sugere uma desqualificao do oponente. Esse sofisma est contido na seguinte alternativa: (A) Caro M., o que voc entende exatamente por 'cincia'? (l. 14 - 15) (B) Voc est claramente confundindo aplicao da tecnologia com cincia. (l. 24 - 26) (C) Se voc acha que construir uma bomba atmica, por exemplo, um trabalho cientfico, est enganado. (l. 28 - 30) (D) Voc pode fazer como muitos histricos e criticar a cincia (l. 47 - 48)

1o Exame de Qualificao | Vestibular Estadual 2003

164

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Com base no texto abaixo, responda s questes de nmeros 05 a 08.


CINCIA, PODER E TICA
01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30

O desenvolvimento da cincia e da tcnica pode percorrer caminhos diversos e utilizar diferentes mtodos. O conhecimento , por si s, um valor. Mas a deciso sobre quais conhecimentos a sociedade ou os cientistas devem concentrar seus esforos implica a considerao de outros valores. Da mesma forma, no se pode deixar de considerar o papel do cientista ou da atividade que ele exerce. A sua responsabilidade tica deve ser avaliada no s pelo exerccio das suas pesquisas em si, mas, principalmente, pelas conseqncias sociais decorrentes da aplicao das suas pesquisas. Enquanto a cincia, no sendo ideolgica pela sua estrutura, pode estar a servio ou dos fins mais nobres ou dos mais prejudiciais para o gnero humano, o cientista no pode permanecer indiferente aos desdobramentos sociais do seu trabalho, o seu compromisso social. Se a cincia, como tal, no pode ser tica ou moralmente qualificada, pode s-lo, no entanto, a utilizao que dela se faa, os interesses a que serve. E nessa questo dos transgnicos, os interesses so inmeros e altamente comprometedores, e tambm as conseqncias sociais da sua aplicao. Concluo dizendo que o grande n relacionado com a questo da manipulao da vida humana, direta ou indiretamente, no est na utilizao em si de novas tecnologias ainda no assimiladas moralmente pela sociedade. No na utilizao, mas, sim, no controle dessas novidades, que reside

31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

o fulcro da questo. Esse controle deve se dar em patamar diferente ao dos planos tcnicocientficos. O controle no tcnico, nem cientfico; o controle tico! Hoje, a questo cientfica que se coloca no mais eu no vou fazer porque eu no posso fazer". Hoje a cincia praticamente tudo pode. O que se coloca hoje eu no vou fazer porque no devo". Por isso que a tica prtica adquire, cada dia mais, uma importncia maior. Ento, prudente lembrar que a tica sobrevive sem a cincia e a tcnica. A sua existncia independe delas. A cincia e a tcnica, no entanto, no podem prescindir da tica, sob pena de transformarem-se em armas desastrosas para o futuro da humanidade, nas mos de minorias poderosas e/ou mal-intencionadas. O X" do problema, portanto, est no fato de que, dentro de uma escala hipottica de valores vitais para a humanidade, a tica ocupa uma posio diferenciada em comparao com a pura cincia ou com a pura tcnica; nem anterior, nem superior, simplesmente diferenciada. Alm de sua importncia qualitativa, no caso dos transgnicos, especificamente, a tica serve como instrumento preventivo contra abusos atuais e futuros que venham trazer lucros abusivos para poucos com alijamento e sofrimento de grande parte da populao mundial e em detrimento do prprio equilbrio biossociopoltico do planeta.
(Adaptado de GARRAFA, Volney. In: Anais do Seminrio Internacional sobre biodiversidade e transgnicos. Senado Federal. Braslia, 1999.)

Questo 05
Pela linha 25, vemos que este texto, transcrito de uma palestra, est enunciado em 1 pessoa. eu no vou fazer porque eu no posso (5 pargrafo), o emprego da 1 pessoa diferente do Em eu que aparece no restante do texto. Isso ocorre porque: (A) refere-se genericamente aos cientistas (B) dirige-se precisamente a pessoas citadas (C) inclui especificamente os ouvintes da palestra (D) abrange indiscriminadamente cidados leigos

1o Exame de Qualificao | Vestibular Estadual 2003

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

165

Questo 06
Mas a deciso sobre quais conhecimentos a sociedade ou os cientistas devem concentrar seus esforos implica a considerao de outros valores. (l. 04 - 06) O trecho destacado apresenta um problema de regncia. Esse problema seria corrigido se fosse feita a seguinte alterao: (A) ...implica a considerao sobre outros valores. (B) ...implica com a considerao de outros valores. (C) ...a deciso sobre os conhecimentos nos quais a sociedade... (D) Mas a deciso de quais conhecimentos a sociedade ou os cientistas...

Questo 0 7 07
No ltimo pargrafo, o autor acrescenta um elemento discusso sobre cincia e tica. Esse elemento diz respeito relao da cincia e da tica com: (A) os valores humanos vitais (B) a estrutura econmica e social (C) o poder e controle dos transgnicos (D) os instrumentos preventivos da cincia

Questo 08
Os estudos gramaticais costumam apresentar a comparao como um processo ligado aos modificadores adjetivos e advrbios. Um exemplo de comparao construda por meio de adjetivo est em: (A) O desenvolvimento da cincia e da tcnica pode percorrer caminhos diversos (l. 01 - 02) (B) O controle no tcnico, nem cientfico; o controle tico! (l. 33 - 34) (C) Por isso que a tica prtica adquire, cada dia mais, uma importncia maior. (l. 39 - 40) (D) dentro de uma escala hipottica de valores vitais para a humanidade, (l. 49 - 50)

1o Exame de Qualificao | Vestibular Estadual 2003

166

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Com base no texto abaixo, responda s questes de nmeros 09 a 12.


CINCIA VERSUS RELIGIO
POR QUE ACREDITO MAIS NA CINCIA DO QUE NA RELIGIO

Eu acredito na cincia porque ela no pede que acreditemos nela. A cincia nos diz honestamente que conhece apenas parte da natureza. Assume tranqilamente que no tem todas as respostas e que nunca as ter. A cincia no exige f, mas convencimento. Sabe ser reflexo de todos os preconceitos e fraquezas das sociedades que a produziram, mas procura transcend-los. Sabe que falha, limitada e mutvel, e nisso consistem sua fora e sua beleza. Por tudo isso, no que eu acredite na cincia. Eu, simplesmente, confio nela.
(NOGUEIRA, Renata Nascimento. Folha de So Paulo, outubro de 2001.)

POR QUE ACREDITO MAIS NA RELIGIO DO QUE NA CINCIA

Coincidncia. Acaso. Destino. Tantas explicaes que no explicam muito, quando a gente fala de uma coisa que nos intriga e para a qual sabemos que no existe mesmo uma explicao. Acho que a religio supera em muito a cincia porque se apega capacidade mais indmita do ser humano a de acreditar. Gosto de saber que existe algum comigo o tempo todo, que me ouve, que me faz estar neste ou naquele lugar na hora certa por este ou aquele motivo. o inesperado, o salto no escuro. Quem no acredita, fica vagando somente entre as possibilidades. Eu prefiro contar com o impossvel que, convenhamos, vive cruzando nosso caminho. Alm do mais, a quem voc gostaria de recorrer na hora daquele aperto, a um Deus misericordioso que pode te ouvir e dessa vez s dessa vez! livrar sua cara ou ao Einstein, com aquela baita lngua de fora?
(RODRIGUES, Angela Guagnelli. Folha de So Paulo, outubro de 2001.)

Questo 09
Os textos acima formam uma espcie de debate, a partir de ttulos sugeridos por um jornal para seus leitores. A leitora Renata Nogueira questiona o prprio ttulo sugerido pelo jornal, em virtude da seguinte caracterstica que ela atribui cincia: (A) no se opor religio (B) no ser passvel de crena (C) ser falha, limitada e mutvel (D) ser mais honesta do que a religio

Questo 1 0 10
Para estabelecer a superioridade da religio sobre a cincia, Angela Rodrigues se baseia em: (A) acasos do destino (B) evidncias categricas (C) explicaes suficientes (D) necessidades humanas

1o Exame de Qualificao | Vestibular Estadual 2003

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

167

Questo 1 1 11
A leitora partidria da religio recorre a duas metonmias para demonstrar melhor a sua posio. Essas metonmias esto indicadas na seguinte alternativa: (A) Deus e Einstein (B) religio e cincia (C) acreditar e contar (D) coincidncia e explicao

Questo 12
Ao defender a religio, a leitora ngela Rodrigues constri um tipo de discurso diferente do cientfico, normalmente caracterizado por argumentos e provas. Essa diferena, na carta da leitora, marcada por: (A) aluso a fatos inesperados (B) registro de preferncias pessoais (C) referncia a cientistas conhecidos (D) meno a comportamentos sociais

Com base no texto abaixo, responda s questes de nmeros 13 a 16.


O AGENTE
01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23

A placa dizia Imobiliria Ajax, e o agente subiu ao segundo andar. Na sala s havia uma mesa, uma cadeira e um homem sentado nela, imvel, olhando para o teto. O agente olhou para ele e disse: Sou do Instituto de Estatstica e venho fazer o seu questionrio. Que questionrio?, perguntou o homem que estava na mesa. Nome, nacionalidade, estado civil esses dados todos. Para qu? Para o recenseamento, para sabermos quantos somos, o que somos. O que somos? Isso no, disse o homem da mesa, com certo pessimismo. O recenseamento nos dar a resposta de tudo, disse o agente. Mas eu no quero saber de mais nada, disse o homem. O senhor no est vendo, acrescentou, subitamente aborrecido, que eu estou ocupado?. O senhor me desculpe, disse o agente, mas sou obrigado a preencher a sua ficha, o senhor tambm , de certa forma, obrigado a colaborar. O senhor no leu a proclamao do presidente da Repblica? No. Foi publicada em todos os jornais. O presidente disse Isso no interessa, disse o homem levantando da cadeira abrindo os braos, por favor. Mas o agente, lpis em uma das mos e formulrio na outra, no tomou conhecimento do pedido. Seu nome?, inquiriu. Jos Figueiredo. Mas isso no vai lhe adiantar de coisa alguma, disse o homem, sentando novamente. O agente, que j tinha escrito Jos no formulrio, parou e perguntou: Por qu? O senhor no est me dando um nome falso, est? No, oh! no. Meu nome Jos Figueiredo. Sempre foi. Mas se eu morrer amanh, isso no falsificar o resultado?

1o Exame de Qualificao | Vestibular Estadual 2003

168

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Esse risco ns temos que correr, respondeu o agente. Morrer? Sempre morre algum durante o processo de recenseamento, porm est tudo previsto. Outros nascem, porm est tudo previsto. Est tudo previsto, disse o agente. Quer dizer que eu posso morrer amanh sem atrapalhar a vida de ningum, perguntou Jos. Pode ora, o senhor no est com cara de quem vai morrer amanh; est meio plido e abatido, de fato, mas o senhor toma umas injees, que isso passa. Estado civil? O senhor pode guardar um segredo?, disse Jos. Vivo?, disse o agente. Um segredo que vai durar pouco?, continuou Jos. Eu s quero saber o seu estado civil, a sua , comeou o agente. Eu vou me matar amanh, cortou Jos. Como? Isso um absurdo! O senhor est brincando comigo? Olhe bem para mim, disse Jos, estou com cara de quem est brincando com o senhor? No, disse o agente. No escrevi nenhuma carta de despedida; ou melhor, escrevi, escrevi vrias, mas nenhuma me agradou. Alm do mais, no sabia a quem endere-las: ao delegado de polcia? impossvel; A Quem Interessar Possa? muito vago. Que coisa, murmurou o agente, O senhor vai se matar mesmo? Vou. Mas o senhor no precisa ficar to chocado, desculpou-se Jos. Mas isso um absurdo, disse o agente, pela segunda vez naquele dia. O senhor no gosta de viver? Bem, disse Jos botando a mo na face e olhando para o teto, h certas coisas que eu ainda gostaria de fazer, como beijar uma menina loura que passou por mim na rua ontem, tomar com ela um banho de mar e depois deitar na areia e deixar o sol secar meu corpo. Mas isso deve ser influncia do cu, disse ele olhando para a janela, que est hoje muito azul. Concito-o a abandonar esse propsito. Prometa-me que no ir cometer esse gesto, disse o agente. Eu estou com pressa, acrescentou imediatamente, quando viu que Jos balanava a cabea. J decidi; no posso mais voltar atrs. Isso uma loucura. Eu no posso ficar aqui at amanh, a vida inteira, procurando convenc-lo da sua insensatez. No posso perder meu tempo continuou, agora ainda com mais vigor, tambm preciso viver; cada dez minutos do meu tempo corresponde a um questionrio; cada questionrio corresponde a cento e setenta cruzeiros e cinqenta centavos. Eu aprecio muito o seu interesse, disse Jos. De nada, de nada, disse o agente, olhando para o cho. Ainda no fiz nada hoje, acrescentou depois de uma pausa. Jos levantou-se e estendeu a mo. Apertaram as mos em silncio. O agente desceu as escadas lentamente. Quando chegou rua, tirou uma folha de endereos do bolso e, com um lpis, riscou o nome Imobiliria Ajax. Olhou ento o relgio e apressou o passo.
(FONSECA, Rubem. Os prisioneiros. So Paulo: Companhia das Letras, 1989.)

Questo 13
Na estrutura interna do conto, o foco do narrador apresenta-se em 3 pessoa, acompanhando o ponto de vista do seguinte elemento: (A) Jos (B) leitor (C) escritor (D) agente

1o Exame de Qualificao | Vestibular Estadual 2003

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

169

Questo 14
Esse conto fundamentalmente estruturado sob a forma de um dilogo entre dois personagens. Entretanto, pela diferena radical de interesses entre eles, o dilogo, em alguns momentos, no cumpre sua funo comunicativa bsica. A existncia deste dilogo incompleto est melhor representada pela seguinte passagem: (A) Nome, nacionalidade, estado civil esses dados todos. Para qu? (l. 06 - 07) (B) Foi publicada em todos os jornais. O presidente disse Isso no interessa (l. 16 - 17) (C) O senhor pode guardar um segredo?, disse Jos. Vivo?, disse o agente. (l. 31 - 32) (D) O senhor vai se matar mesmo? Vou. Mas o senhor no precisa ficar to chocado (l. 42 - 43)

Questo 15
O ttulo O Agente ambguo, significando ao mesmo tempo o agente do Instituto de Estatstica e o agente da verdade cientfica. Ao longo do texto, a ambigidade, efeito produzido quando um termo assume outro significado, intensificada por vrios dilogos. O melhor exemplo deste efeito encontra-se em: (A) Sou do Instituto de Estatstica e venho fazer o seu questionrio. Que questionrio?, perguntou o homem que estava na mesa. (l. 04 - 05) (B) Esse risco ns temos que correr, respondeu o agente. Morrer? (l. 24 - 25) (C) Eu s quero saber o seu estado civil, a sua , comeou o agente. Eu vou me matar amanh, cortou Jos. (l. 34 - 35) (D) Eu aprecio muito o seu interesse, disse Jos. De nada, de nada, disse o agente, olhando para o cho. (l. 56 - 57)

Questo 16
Eu no posso ficar aqui at amanh, a vida inteira, procurando convenc-lo da sua insensatez. (l. 52 - 53) As duas expresses sublinhadas funcionam como modificadores verbais. Tais expresses postas em seqncia, na fala do agente, adquirem o seguinte efeito: (A) reforam seu incmodo (B) caracterizam sua confuso (C) aprimoram seus argumentos (D) destacam seu profissionalismo

1o Exame de Qualificao | Vestibular Estadual 2003

170

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | ESPANHOL

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

ANHOL | ESP ESPANHOL

Com base no texto abaixo, responda s questes de nmeros 17 a 20.

EN DEFENSA DE LA DIVULGACIN CIENTFICA


01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24

De las diversas encuestas de opinin llevadas a cabo por los responsables de la Unin Europea entre sus ciudadanos, relativas a la actitud del pblico hacia la Ciencia, se desprenden resultados preocupantes al tiempo que, aparentemente, contradictorios. Una gran mayora de encuestados coincide al afirmar que es una de las principales fuentes de progreso y bienestar para la humanidad y, al mismo tiempo, tambin una mayora similar afirma que los descubrimientos cientficos pueden acarrear consecuencias muy peligrosas. Esta especie de relacin amor-odio no es ms que la consecuencia del profundo foso que se ha abierto, sobre todo, en los ltimos aos, entre la Ciencia y la sociedad. Existe entre los ciudadanos una extraordinaria desconfianza hacia la Ciencia y, por extensin, hacia los cientficos. Se impone, por tanto, ir tendiendo puentes, tantos como sean necesarios, para revertir esa indeseable situacin. La divulgacin del conocimiento cientfico es, probablemente, el ms importante de ellos. Somos miembros de una sociedad en contacto diario con los ltimos adelantos cientficos y tecnolgicos pero, por otro lado, incomprensiblemente, una parte significativa de esa sociedad cree a pies juntillas al primer cuentista que se cruza en su camino, vendiendo historias de adivinacin del futuro, viajes astrales, contactos con extraterrestres", curaciones fantsticas mediante energas positivas", etc. Y, a pesar de esto, la inmensa mayora de los cientficos no hace nada por modificar la situacin: nos quejamos todava de que los medios de comunicacin ignoran la Ciencia, porque lo poco que publican no es acerca de principios y mtodos, sino de noticias triviales y sensacionalistas". Es fcil, como apunta, H. Braum, culpar a los editores por esto, pero los cientficos no son menos culpables. Muchos de los investigadores que trabajan en el sector pblico todava se resisten a reconocer que tienen la responsabilidad de comunicar, de una manera asequible, los resultados de su trabajo a la sociedad que les paga, independientemente de la comunicacin que cristaliza en la publicacin cientfica especializada. (...) Todo esto viene a cuento para decir, parafraseando a Lan Entralgo, que se trata de igualar por arriba, nunca por abajo: de poner la imaginacin de puntillas, nunca cmodamente sentada. En definitiva, como ya dijo alguien: las instituciones no deben obtener una victoria estadstica a costa de una derrota intelectual.
DR. JOS MARA RIOL CIMAS http://www.ull.es/noticias

10

1o Exame de Qualificao | Vestibular Estadual 2003

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | ESPANHOL

171

Questo 17
El texto expone el punto de vista del autor respecto a la divulgacin cientfica. Se puede afirmar que el objetivo principal del texto es: (A) criticar la actuacin de los medios de comunicacin (B) presentar el resultado de encuestas de opinin (C) responsabilizar la institucin de investigacin (D) resaltar la omisin de los investigadores

Questo 18
El autor busca apoyo a sus argumentos por medio de distintas citas. La cita que atena la culpabilidad atribuida a los periodistas es: (A) De las diversas encuestas de opinin (...) se desprenden resultados (l. 1 - 2) (B) Es fcil, como apunta, H. Braum, (l. 17) (C) Todo esto viene a cuento para decir, parafraseando a Lan Entralgo, (l. 22) (D) En definitiva, como ya dijo alguien: (l. 23 - 24)

Questo 19
El autor se incluye en una crtica a su propio grupo. El fragmento que expone tal inclusin es: (A) Somos miembros de una sociedad en contacto diario (l. 11) (B) la inmensa mayora de los cientficos no hace nada (l. 15) (C) nos quejamos todava de que los medios de comunicacin ignoran la Ciencia, (l. 15 - 16) (D) Muchos de los investigadores que trabajan en el sector (l. 18)

Questo 20
La divulgacin del conocimiento cientfico es, probablemente, el ms importante de ellos. (l. 9 - 10) Lo subrayado en el fragmento se refiere a: (A) puentes (B) cientficos (C) ciudadanos (D) descubrimientos

1o Exame de Qualificao | Vestibular Estadual 2003

11

172

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | ESPANHOL

Com base no texto abaixo, responda s questes de nmeros 21 e 22.

DOUGLAS WRIGHT

EL DESAFO DE EDIT AR LIBROS P ARA NIOS Y JVENES EDITAR PARA


No es lo mismo producir remeras o zapatillas que libros. No digo alimentos ya que en cada pas hay cdigos alimentarios acerca de lo que est permitido y lo que est prohibido producir y vender. El libro tambin se ingiere. De tal modo que el escritor Joseph Brodsky llega a sostener: somos lo que leemos". Pero, por suerte, las normas acerca de lo que se puede escribir y editar no estn escritas, ya que estaramos hablando de limitaciones o de la odiosa censura. En este contexto, resulta obvio que cada uno de nosotros se gua por sus propios cdigos y valores personales. (...) Y si editar libros no es una tarea inocente, sabemos que menos inocente an es editar libros para nios y adolescentes. En la tarea cotidiana de elegir un texto, un ilustrador, de proyectar una coleccin o un libro singular entrarn en juego sutilmente las fidelidades del editor.
(CANELA, Revista Quincenal de Literatura Infantil y Juvenil.) http://www.imaginaria.com.ar

Questo 2 1 21
La comparacin que el texto establece entre libros y alimentos est representada en la imagen por medio de la: (A) flecha hacia el libro (B) lectura atenta de un libro (C) cita del autor indicada en el texto (D) figura del joven relleno de escrituras

Questo 22
Distinguindose de otros productos, la produccin de libros se caracteriza por: (A) tener reglas flexibles (B) someterse a censura previa (C) presentar semejanzas regionales (D) relacionarse a un cdigo de tica

12

1o Exame de Qualificao | Vestibular Estadual 2003

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | INGLS

173

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

| INGLS

Com base no texto abaixo, responda s questes de nmeros 17 a 20.

SCIENTISTS CALL ON JOURNALS T O DISCLOSE AUTHORS CONFLICTS OF INTEREST TO


01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20

Today, more than two dozen prominent scientists, including two former editors of the New England Journal of Medicine and a former editor of the Journal of the American Medical Association, sent a letter to editors of Science, Proceedings of the National Academy of Sciences, and 200 other scientific journals, urging them to strengthen their policies concerning disclosure of conflicts of interest. The letter reflects increasing concern about financial and other conflicts of interest that may jeopardize the integrity of scientific research. Such conflicts, many of which are associated with the rise of industry-funded science, have already attracted scrutiny from Congress, a number of specialty societies, and several leading medical journals. The scientists are urging journals to publish alongside studies, editorials, and other items: (1) authors sources of funding; (2) financial interests of authors and their immediate families in the last 5 years in companies that may be affected by the published article; (3) the specific contribution of each author of the published paper. In the last few years, a number of spectacular failures of disclosure and editorial oversight have come to light. In one case that resulted in a revision of the journals policy, the New England Journal of Medicine published a negative review of a widely hailed book linking chemical pollution to cancer but failed to disclose that the review was written by the medical director of a major polluter. In another case, the journal Neurobiology of Aging published a panel report endorsing a proprietary blood test for Alzheimers disease but did not disclose that one of the panelists held a patent on the test and another was a co-founder of the company that planned to market the test. Nonetheless, most scientific journals still do not disclose authors conflicts of interest, and for those that do, there is very little uniformity in the requirements or consistency in the application of the policies. With the amount of industry money pouring into scientific research, says Dr. Orrin Pilkey, Director of Duke Universitys Program for the Study of Developed Shorelines, there is a risk that more research will just become client science, where truth is determined according to your clients needs. At the very least, journal editors and the public should be informed of the financial interests behind a study.
http://www.cspinet.org

16

1o Exame de Qualificao | Vestibular Estadual 2003

174

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | INGLS

Questo 17
The text is a piece of criticism where the writer publicly denounces conflicts behind the disclosure of scientific findings. The authors argumentation is developed on the basis of: (A) a description of restrictive policies adopted by Congress (B) a detailed historical account of irregular editing procedures (C) the testimony of renowned scientists concerned with conflicts of interest (D) the transcription of fragments of a letter denouncing financial problems

Questo 18
Scientists' general concern is expressed in the following excerpt: (A) Such conflicts, many of which are associated with the rise of industry-funded science, have already attracted scrutiny from Congress, (l. 6 - 7) (B) In the last few years, a number of spectacular failures of disclosure and editorial oversight have come to light. (l. 12) (C) a panel report endorsing a proprietary blood test for Alzheimers disease but did not disclose that one of the panelists held a patent on the test (l. 16 - 17) (D) there is a risk that more research will just become client science, where truth is determined according to your clients needs. (l. 21 - 22)

Questo 19
One of the corrective actions proposed by scientists is: (A) peer participation in panel reports (B) written statements of journal policies (C) public disclosure of corporate interests (D) detailed account of authors' financial support

Questo 20
Nonetheless, most scientific journals still do not disclose authors conflicts of interest, and for those that do, (l. 18 - 19) The pronoun those above refers to: (A) authors (B) journals (C) conflicts (D) scientists

1o Exame de Qualificao | Vestibular Estadual 2003

17

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | INGLS

175

Com base no texto abaixo, responda s questes de nmeros 21 e 22.

WHY WE NEED SAFER CHEMICALS


Pretty much anything you buy whether its soap or a computer, perfume or paints will contain a mixture of substances produced in a chemical factory. Chemicals are used for all kinds of reasons such as to smell nice or to kill germs.

IMPURE
from

LABORATOIRE TOXIQUE
A cocktail of untested chemicals

Friends of the Earth is teaming up with leading consumer and environmental groups across Europe to demand safety tests for all chemicals. We think we can succeed - and you can help!

http://www.foe.co.uk

Questo 2 1 21
Friends of the Earth is one of the leading environmental pressure groups in the UK, represented in 68 countries, that calls for prompt action to control the use of chemicals.
The image and text on the campaign poster basically suggest that: (A) women are easy targets to serious diseases (B) everyday products are full of risky chemicals (C) cosmetics use up dozens of dangerous chemicals (D) manufacturers never tell consumers about toxic substances

Questo 22
The measure that best conveys the campaigns highest priority is: (A) chemical substances should be assessed for safety (B) irresponsible companies should be closed at once (C) cosmetic industries should be controlled by consumers (D) powerful manufacturers should be prohibited from lobbying

18

1o Exame de Qualificao | Vestibular Estadual 2003

176

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

CINCIAS DA NA TUREZA, MA TEMTICA E SUAS TECNOLOGIAS NATUREZA, MATEMTICA Questo 23


O gs carbnico participa da seguinte reao qumica, que ocorre no sangue humano:

Por sua vez, a concentrao de gs carbnico no sangue regulada pelo ritmo respiratrio. A hiperventilao (respirao acelerada) favorece a expirao de uma quantidade desse gs bem superior da respirao normal. Observe a tabela abaixo.

Levando-se em conta a equao de equilbrio qumico, uma das condies da tabela representa as alteraes dos valores de concentrao de H+ e do pH, encontrados no sangue do indivduo sob hiperventilao, em relao aos seus valores normais. Essa condio a de nmero: (A) I (B) II (C) III (D) IV

Questo 24
Trs candidatos, A, B e C, concorrem a um mesmo cargo pblico de uma determinada comunidade. A tabela abaixo resume o resultado de um levantamento sobre a inteno de voto dos eleitores dessa comunidade.

Pode-se concluir, pelos dados da tabela, que a percentagem de eleitores consultados que no votariam no candidato B : (A) 66,0% (B) 70,0% (C) 94,5% (D) 97,2%

1o Exame de Qualificao | Vestibular Estadual 2003

19

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

177

Questo 25
. O logaritmo decimal do nmero positivo x representado por log x. Ento, a soma das razes de log2 x log x3 = 0 igual a: (A) 1 (B) 101 (C) 1000 (D) 1001

Considere o texto abaixo para responder s questes de nmeros 26 e 27.


O experimento clssico de Rutherford levou descoberta do ncleo atmico e abriu um novo captulo no estudo da Estrutura da Matria, ao fazer incidir um feixe de partculas sobre um alvo fixo no laboratrio. As partculas desviadas eram observadas com detectores de material cintilante. Experimentos desse tipo so ainda realizados hoje em dia.

Questo 26
A experincia de Rutherford mostrou que, ao atravessar uma lmina delgada de ouro, uma em cada 105 partculas alfa desviada de um ngulo mdio superior a 90. Considerando que a lmina de ouro possui 103 camadas de tomos e elaborando a hiptese de que este desvio se deve coliso de partculas alfa com um nico ncleo atmico, Rutherford foi capaz de estimar a ordem de grandeza do ncleo. Se o raio do tomo da ordem de 108 cm, o raio do ncleo, em cm, da ordem de: (A) 1012 (B) 1010 (C) 109 (D) 105

Questo 27
Nesse experimento, o sulfeto de zinco era o material que cintilava quando recebia o choque das partculas alfa. Outra substncia que apresenta excelentes caractersticas para deteco de tais partculas, utilizando ainda material cintilante, possui ligao interatmica de carter predominantemente inico e formada por um metal representativo e um ametal. A frmula dessa outra substncia : (A) BaF2 (B) Bel2 (C) SiO2 (D) FeCl2

20

1o Exame de Qualificao | Vestibular Estadual 2003

178

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 28
Em um estudo sobre a eficincia do emprego de cinco diferentes substncias em processos de descontaminao de alimentos, cinco amostras iguais de uma hortalia foram contaminadas, de maneira idntica, por um inseticida da classe dos organofosforados. Sabe-se que esse fosforado, inibidor da enzima acetilcolinesterase, embora mais estvel em meio cido, degrada-se rapidamente, por hidrlise, em meio alcalinizado. O estudo utilizou o seguinte procedimento: cada amostra contaminada foi mergulhada, por perodos de tempo iguais, em um dos seguintes lquidos: gua pura, solues aquosas de NH4Cl, de NaHCO3 , de CH3COOH e de NaCl; a seguir, extratos obtidos a partir dessas amostras foram testados quanto capacidade de inibir uma preparao de acetilcolinesterase; foi registrada, no grfico abaixo, a atividade enzimtica dessa preparao em relao a cada um dos cinco extratos e, tambm, na ausncia de qualquer inibidor.

A coluna C representa a atividade enzimtica da preparao na ausncia de qualquer inibidor, e a coluna 1 registra essa atividade na presena de extrato da amostra mergulhada em gua pura. Assim, a coluna 2 representa a atividade enzimtica da preparao de acetilcolinesterase na presena de extrato da amostra, quando mergulhada em soluo de: (A) NaCl (B) NH4Cl (C) NaHCO3 (D) CH3COOH

Questo 29
Toda a matria orgnica ou inorgnica constituda por tomos e a massa dos tomos praticamente igual massa do ncleo atmico. Baseando-se no conceito de massa molar, o nmero de prtons e nutrons existentes em um indivduo adulto de 70 kg pode ser estimado em: (A) 4 1028 (B) 6 1023 (C) 1 105 (D) 7 104
1o Exame de Qualificao | Vestibular Estadual 2003

21

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

179

Questo 30
O conjunto de clulas de uma cultura em um determinado tempo produziu 200 mol de ADP, a partir da hidrlise de ATP. Considere que: da energia total liberada pela hidrlise do ATP em ADP e fosfato, 50% dissipada sob a forma de calor; no interior da clula, esta hidrlise libera um total de 50 kJ/mol; no meio de cultura existem 105 clulas por mL e o volume total do meio de 10 mL.

Nestas condies, a produo mdia de trabalho, em joules, por clula, foi igual a: (A) 1,0 104 (B) 5,0 106 (C) 2,5 109 (D) 6,0 109

Questo 3 1 31
Em certos trechos de litoral, como na regio do Cabo Frio, Rio de Janeiro, correntes marinhas profundas afloram superfcie. Este fenmeno, denominado de ressurgncia, conseqncia da disposio peculiar da regio costeira e da direo dos ventos e correntes predominantes, proporcionando, nas proximidades da costa, uma maior produo de matria orgnica por organismos autotrficos. Em relao s guas superficiais, as guas de correntes marinhas profundas apresentam a seguinte caracterstica associada elevao da produo primria da regio de ressurgncia: (A) baixa salinidade (B) temperatura mais alta (C) baixa taxa de iluminao (D) maior teor de sais minerais

Questo 32
No filme O Nome da Rosa h uma cena em que o personagem principal, o frade-detetive, se perde de seu discpulo no ponto A de um labirinto de escadas. Considere que, em um certo instante, o frade esteja em um ponto B, situado alguns metros abaixo do ponto A, para onde deseja retornar. Existem quatro escadas, E1, E2, E3 e E4, todas diferentes entre si, que ligam os pontos A e B. O total de degraus de cada escada , respectivamente, n1 = 20, n2 = 25, n3 = 40 e n4 = 55. Pode-se afirmar que os trabalhos i , realizados pela fora peso do frade ao ir de B at A, satisfazem a seguinte relao: (A)

1 < 2 < 3 < 4 (B) 1 > 2 > 3 > 4 (C) 1 = 2 = 3 = 4 (D) 1 = 2 < 3 < 4
22
1o Exame de Qualificao | Vestibular Estadual 2003

180

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 33
O esquema abaixo representa as duas principais etapas da fotossntese em um cloroplasto. O sentido das setas 1 e 4 indica o consumo e o sentido das setas 2 e 3 indica a produo das substncias envolvidas no processo.

(Adaptado de ALBERTS et alii. Molecular biology of the cell. New York: Garland Publishing, 1986.)

Os nmeros das setas que correspondem, respectivamente, s substncias CO2 , O2 , acares e H2O so: (A) 1, 2, 4, 3 (B) 2, 3, 1, 4 (C) 3, 1, 2, 4 (D) 4, 2, 3, 1

Questo 34
Em um animal, antes de injetar-se um extrato de poro medular de glndula supra-renal, foram medidos sua presso arterial e o nmero de batimentos cardacos por minuto, representados pelo ponto P no grfico abaixo; alguns minutos aps a injeo, foram repetidas essas mesmas medidas.

O nico ponto do grfico que pode representar as medidas feitas aps a injeo o de nmero: (A) 1 (B) 2 (C) 3 (D) 4

1o Exame de Qualificao | Vestibular Estadual 2003

23

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

181

Questo 35
Observe o esquema abaixo, que representa uma mitocndria de uma clula heptica.

(Adaptado de HOLTZMAN, Eric e NOVIKOFF, Alex B. Clulas e estrutura celular. Rio de Janeiro: Interamericana, 1985.)

Os nmeros correspondentes estrutura ou compartimento mitocondrial onde se localizam a enzima ATP sintase, os ribossomas, e as enzimas que geram CO2 so, respectivamente: (A) 5, 1, 2 (B) 4, 5, 3 (C) 3, 2, 2 (D) 2, 1, 5

Questo 36
Darwin afirmou que a teoria da seleo natural baseia-se na convico de que cada nova variedade e, posteriormente, cada nova espcie, produzida e mantida por ter determinada vantagem em relao quelas com que entra em competio. Considere agora as seguintes afirmativas: I Como nascem mais indivduos que os que podem viver, deve existir, em cada caso, luta pela existncia, quer entre indivduos da mesma espcie, quer entre os de espcies diferentes.

II A luta pela existncia resulta inevitavelmente da rapidez com que todos os seres organizados tendem a multiplicar-se. III A seleo natural produz modificaes em qualquer espcie para benefcio exclusivo de outra espcie. IV A seleo natural tende a tornar cada ser organizado to adaptado, ou um pouco mais adaptado, que os outros habitantes da mesma regio com os quais esto em concorrncia. Dentre essas afirmativas, aquela que, se comprovada, poria fim teoria de Darwin, a de nmero: (A) I (B) II (C) III (D) IV

24

1o Exame de Qualificao | Vestibular Estadual 2003

182

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 37
Quatro frascos A, B, C e D so utilizados para a preparao de quatro solues aquosas, cujos solutos so, respectivamente, HBr, NaCl, Ba(OH)2 e Kl. Tais solues apresentam 1 grama de soluto por litro de soluo. Com relao a esses solutos, sabe-se que: a soluo do frasco B possui a menor concentrao em mol L1; a soluo do frasco C possui a maior concentrao em mol L1; as solues dos frascos A e B neutralizam-se quando misturadas em volumes adequados.

Pode-se concluir que os frascos que correspondem s solues de HBr, NaCl, Ba(OH)2 e Kl so, respectivamente: (A) A, B, C, D (B) A, C, B, D (C) D, B, C, A (D) D, C, B, A

Questo 38
Numa cidade, os nmeros telefnicos no podem comear por zero e tm oito algarismos, dos quais os quatro primeiros constituem o prefixo. Considere que os quatro ltimos dgitos de todas as farmcias so 0000 e que o prefixo da farmcia Vivavida formado pelos dgitos 2, 4, 5 e 6, no repetidos e no necessariamente nesta ordem. O nmero mximo de tentativas a serem feitas para identificar o nmero telefnico completo dessa farmcia equivale a: (A) 6

(B) 24 (C) 64 (D) 168

Questo 39
A reciclagem de latas de alumnio permite uma considervel economia de energia eltrica: a produo de cada lata reciclada gasta apenas 5% da energia que seria necessria para produzir uma lata no-reciclada. Considere que, de cada trs latas produzidas, uma no obtida por reciclagem, e que a produo de cada lata reciclada consome 1 unidade de energia. De acordo com essa proporo, o nmero de unidades de energia necessrio para a produo de 24 latas igual a: (A) 24 (B) 42 (C) 150 (D) 176
1o Exame de Qualificao | Vestibular Estadual 2003

25

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

183

Questo 40
Considere as duas tirinhas abaixo.

(DAOU, L. e CARUSO, F. Tirinhas de Fsica - vol. 1. Rio de Janeiro: CBPF, 2000.)

(DAOU, L. e CARUSO, F. Tirinhas de Fsica - vol. 2. Rio de Janeiro: CBPF, 2000.)

Essas tirinhas representam expresses diferentes da lei de: (A) inrcia (B) queda de corpos (C) conservao de energia (D) conservao de momento

Questo 4 1 41
Uma seqncia de cinco tomos est organizada por ordem crescente de seus nmeros atmicos, cujos valores so regidos por uma progresso aritmtica de razo 4. J o nmero de nutrons desses mesmos tomos regido por uma progresso aritmtica de razo 5. Se o tomo mais pesado pertence ao elemento ferro e o mais leve possui o nmero de prtons igual ao nmero de nutrons, o nmero de massa do terceiro tomo da srie : (A) 18 (B) 20 (C) 26 (D) 38

26

1o Exame de Qualificao | Vestibular Estadual 2003

184

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 42
A funo que descreve a dependncia temporal da posio S de um ponto material representada pelo grfico abaixo.

(RAMALHO JNIOR, Francisco et alii. Os fundamentos da fsica. So Paulo: Moderna, 1993.)

Sabendo que a equao geral do movimento do tipo S = A + Bt + Ct2 , os valores numricos das constantes A, B e C so, respectivamente: (A) 0, 12, 4 (B) 0, 12, 4 (C) 12, 4, 0 (D) 12, 4 , 0

Questo 43
Durante muito tempo, a partir da Idade Mdia, foram projetadas mquinas, como a da figura abaixo, que seriam capazes de trabalhar perpetuamente.

(FRISCH, Otto R. A natureza da matria. Lisboa: Verbo, 1972.)

O fracasso desses projetos levou compreenso de que o trabalho no poderia ser criado do nada e contribuiu para a elaborao do conceito fsico de: (A) fora (B) energia (C) velocidade (D) momento angular

1o Exame de Qualificao | Vestibular Estadual 2003

27

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

185

Questo 44
O grfico a seguir refere-se s curvas de distribuio de energia cintica entre um mesmo nmero de partculas, para quatro valores diferentes de temperatura T1, T2, T3 e T4, sendo T1 < T2 < T3 < T4. Note que as reas sob cada uma das curvas so idnticas, uma vez que so proporcionais aos nmeros de partculas.

(Adaptado de GEPEQ. Interaes e Transformaes II. So Paulo: EDUSP, 1998.)

As transformaes qumicas sero tanto mais rpidas quanto maior for o nmero de colises possveis. Mas isso depende no s do valor do nmero de colises, mas tambm do valor mnimo da energia, chamado energia de limiar ou de ativao (por exemplo, a energia E indicada no grfico). Assim, com relao ao grfico apresentado, a transformao qumica torna-se mais rpida na seguinte temperatura: (A) T1 (B) T2 (C) T3 (D) T4

Questo 45
Uma folha de papel retangular, como a da figura 1, de dimenses 8 cm 14 cm, dobrada como indicado na figura 2.

Se o comprimento CE 8 cm, a rea do polgono ADCEB, em cm2, igual a: (A) 112 (B) 88 (C) 64 (D) 24

28

1o Exame de Qualificao | Vestibular Estadual 2003

186

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 46
Os esquemas abaixo ilustram trs experimentos envolvendo diluio seguida de evaporao de solues de NaCl, cujas concentraes iniciais so iguais. As solues resultantes desse processo, em cada um dos experimentos, tm suas concentraes, em quantidade de matria, identificadas por , e .

As concentraes das solues resultantes obedecem seguinte relao: (A) (B) (C) (D) > > > > > > > >

1o Exame de Qualificao | Vestibular Estadual 2003

29

CINCIAS HUMANAS E SUAS TECNOLOGIAS

187

CINCIAS HUMANAS E SUAS TECNOLOGIAS Questo 47


EXRCITO AUMENTA APOIO CAMPANHA DE COMBATE AO DENGUE
Braslia. (...) atendendo a solicitao do Ministrio da Sade, o Comando Militar do Leste foi autorizado a aumentar o apoio dado aos agentes da Fundao Nacional de Sade (Funasa) que combatem a epidemia de dengue no Rio de Janeiro. O Exrcito apia os agentes em transporte, alimentao e alojamento. Segundo a nota, significativo o nmero de militares que participam agora diretamente de aes que objetivam conter a epidemia de dengue.

O sr. nada tem que fazer em casa dos srs. deputados... S pode atacar as casas dos particulares, e no as poupe; carregar pra frente no povo mido.
(J. Carlos. In: LEMOS, Renato (org). Uma histria do Brasil atravs da caricatura. Rio de Janeiro: Bom Texto, Letras e Expresses, 2001.)

(Radiobrs, 19/02/02)

Tanto a legenda da charge quanto a notcia atual evidenciam aspectos da atuao do poder pblico numa situao de combate a epidemias. Comparando os dois contextos, essa atuao e essa interveno no combate epidemia podem ser caracterizadas, respectivamente, pelos seguintes traos: (A) maior eficcia nas reas rurais e menos habitadas permanncia e predomnio da iniciativa privada (B) ao ampla em bairros perifricos e menos atingidos responsabilidade das instituies beneficentes (C) maior competncia em reas privilegiadas e menos afetadas descentralizao por instituies municipais (D) autoritarismo sobre a populao carente e menos esclarecida integrao e aparato tcnico de instituies federais

Questo 48
H um novo horizonte para as relaes de trabalho, denominado por muitos como passagem do fordismo ao ps-fordismo, o que envolve mudanas em termos da combinao entre trabalho e desenvolvimento tecnolgico. Uma afirmativa que caracteriza essa passagem ao longo do sculo XX est explicitada em: (A) os impactos tecnolgicos, produzidos pelo ps-fordismo, indicaram uma revalorizao do trabalho manual (B) o aumento da produtividade do trabalho, iniciado com o fordismo, manteve-se como princpio bsico (C) a valorizao da experincia humana de trabalho, reforada pelo ps-fordismo, assumiu o primeiro plano (D) o trabalho informal, resgatado pelo fordismo, apresentou-se como a principal estratgia da organizao fabril

30

1o Exame de Qualificao | Vestibular Estadual 2003

188

CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 49

Iriam para diante, alcanariam uma terra desconhecida. Fabiano estava contente e acreditava nessa terra, porque no sabia como ela era nem onde era. (...) E andavam para o sul, metidos naquele sonho. Uma cidade grande, cheia de pessoas fortes. Os meninos em escolas, aprendendo coisas difceis e necessrias. (...) Retardaram-se, temerosos. Chegariam a uma terra desconhecida e civilizada, ficariam presos nela. E o serto continuaria a mandar gente para l. O serto mandaria para a cidade homens fortes, brutos, como Fabiano, sinh Vitria e os dois meninos. (1938)

(PORTINARI - Menino morto - Srie Os Retirantes)

(RAMOS, Graciliano. Vidas secas. Rio de Janeiro: Nova Aguilar, 2000.)

O quadro e o trecho retratam uma rea geogrfica e uma temtica muito presentes no cenrio poltico e cultural do Brasil nas dcadas de 1930 e 1940. Uma associao correta entre a identificao da rea e duas temticas est em: (A) serto semi-rido: fome e xodo rural (B) agreste nordestino: seca e imigrao estrangeira (C) Vale do So Francisco: coronelismo e urbanizao (D) Zona da Mata nordestina: latifndio e mortalidade infantil

Questo 50
O trecho do romance de Graciliano Ramos apresentado na questo 49 retrata tambm os dilemas daqueles que decidem migrar do campo para a cidade grande. Neste processo, no qual as condies econmicas tm papel predominante, intervm tambm elementos de natureza pessoal, muitas vezes conflitantes. No texto, esse conflito aparece basicamente como uma diviso entre: (A) a cidade moderna e o serto tradicional (B) a instruo dos jovens e o analfabetismo dos adultos (C) o sonho de uma vida melhor e o medo do desconhecido (D) a expectativa de ascenso social e o temor decadncia

1o Exame de Qualificao | Vestibular Estadual 2003

31

CINCIAS HUMANAS E SUAS TECNOLOGIAS

189

Questo 51

(Nosso Sculo. So Paulo: Abril Cultural,1980.)

Os desenhos que retratam Getlio Vargas sugerem mudanas nas suas opes polticas ou ideolgicas, ao longo das dcadas de 1930 e 1940. Pode-se dizer que, na seqncia de 37 a 45, eles caracterizam, respectivamente: (A) simpatia pelo fascismo e aproximao com a Alemanha aliana com os EUA e afastamento do Eixo guinada esquerda e fundao do PTB (B) nacionalismo e intervencionismo estatal apoio ao imperialismo norte-americano e fundao de novos partidos internacionalismo e criao da CLT (C) influncia do peronismo e aproximao com a Argentina militarismo e disputa por hegemonia na Amrica Latina aliana com Prestes e apoio dos comunistas (D) ditadura estadonovista e aproximao com o fascismo italiano populismo e estatizao de empresas apoio poltica stalinista para a Amrica Latina e legalizao do PCB

Questo 52

(COUTO e SILVA, Golbery. Geopoltica do Brasil. Rio de Janeiro: Jos Olympio,1967.)

Este mapa representa cartograficamente uma ideologia presente no Brasil durante o perodo militar. Do ponto de vista geopoltico, pode-se dizer que o mapa, de autoria de um dos porta-vozes da Doutrina de Segurana Nacional, tambm evidencia: (A) o avano sovitico como ameaa para o bloco capitalista (B) as perdas territoriais da URSS aps a crise do socialismo real (C) a difuso comunista rumo s bases areas norte-americanas (D) a expanso russa sobre as rotas comerciais no Oceano ndico

32

1o Exame de Qualificao | Vestibular Estadual 2003

190

CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 53
Na Copa do Mundo de 1958, o povo cantou a vitria brasileira com: A taa do mundo nossa! Com brasileiro, no h quem possa! Eeeta, esquadro de ouro (...), bom no samba, bom no couro (...) Em 1970, cantou-se: Noventa milhes em ao Pra frente Brasil, do meu corao Todos juntos vamos Pra frente Brasil, salve a seleo De repente aquela corrente pra frente (...)

Essas duas formas de celebrar a vitria brasileira esto relacionadas, em 1958 e em 1970, respectivamente, aos contextos de: (A) alienao frente aos valores nacionais investimentos do governo no setor esportivo (B) nfase na capacidade criativa do brasileiro tentativa de legitimao do governo militar (C) reconhecimento do subdesenvolvimento nacional exaltao arrancada para o desenvolvimento (D) mobilizao aps a vitria aliada na Segunda Guerra Mundial campanha popular pela superao da pobreza

Questo 54
Observe os trechos iniciais das seguintes canes:

A BANDA
Estava toa na vida O meu amor me chamou Pra ver a banda passar Cantando coisas de amor A minha gente sofrida Despediu-se da dor Pra ver a banda passar Cantando coisas de amor
(Chico Buarque)

DISP ARADA
Prepare o seu corao Pras coisas que eu vou contar Eu venho l do serto E posso no lhe agradar Aprendi a dizer no Ver a morte sem chorar E a morte, o destino, tudo Estava fora de lugar Eu vivo pra consertar
(Geraldo Vandr - Theo de Barros)

Estas duas canes, de grande apelo popular, ficaram empatadas em 1 lugar, no Festival de MPB da Record, em 1966. Diferente do que ocorre com A Banda, em Disparada os autores assumem, de forma explcita, uma crtica social que expressa: (A) a aliana poltica entre as elites regionais (B) a fuga dos problemas sociais pelo povo trabalhador (C) o saudosismo das oligarquias rurais afastadas do poder (D) o inconformismo dos marginalizados diante da desigualdade social

1o Exame de Qualificao | Vestibular Estadual 2003

33

CINCIAS HUMANAS E SUAS TECNOLOGIAS

191

Questo 55
CIDADE MDIA LIDERA CRESCIMENTO DA POPULAO
O crescimento da populao brasileira na dcada de 90 foi mais intenso nas cidades de mdio porte, que tm entre 50 mil e 500 mil habitantes, mostram os dados preliminares do Censo 2000 (...). Os grandes centros urbanos - Rio, So Paulo, Belo Horizonte e Porto Alegre - deram claros sinais de saturao da capacidade de crescimento entre 1991 e 2000. No mesmo perodo, pelo menos 50% das cidades mdias tiveram crescimento igual ou superior a 2% anuais, acima da taxa mdia do pas, que ficou em 1,63%. So Paulo e Rio - as duas capitais que mais atraam migrantes - cresceram muito abaixo do registrado no interior desses estados e no Brasil, e esto prximas estagnao. A capital fluminense apresentou taxa anual de 0,74%, contra 1,7% do interior. A capital paulista cresceu 0,85% ao ano, contra expanso de 2,17% do interior.
(BARBOSA, Flvia. O Globo, 10/05/01.)

Os novos dados do crescimento urbano no Brasil mostram que as maiores taxas de crescimento esto agora com as chamadas cidades mdias e no mais com as grandes metrpoles. Uma dupla de fatores que ajudam a explicar esta tendncia : (A) investimentos estatais na industrializao do interior polticas de controle das migraes internas (B) crise no setor metropolitano de servios fragmentao municipal devido poltica de emancipaes (C) reduo da fecundidade nos grandes centros perda da capacidade de reteno de migrantes pelas metrpoles (D) desenvolvimento da agroindstria com atrao de mo-de-obra assentamentos fundirios em regies de conflito

Questo 56

(SANTOS, M. e SILVEIRA, M. L. O Brasil: territrio e sociedade no incio do sculo XXI. Rio de Janeiro: Record, 2001.)

O mapa acima mostra a distribuio espacial de conflitos em torno da propriedade da terra no Brasil. Observando a diferenciao por estados e regies e traando um paralelo com as caractersticas da agricultura brasileira, possvel afirmar que os conflitos ocorrem principalmente em: (A) reas em processo de modernizao agrcola e expanso da agroindstria (B) estados administrados pela oposio ao governo federal e em crise econmica (C) regies de maior densidade demogrfica e crescimento populacional acelerado (D) periferias das grandes metrpoles e reas urbanas em processo de rpida expanso

34

1o Exame de Qualificao | Vestibular Estadual 2003

192

CINCIAS HUMANAS E SUAS TECNOLOGIAS

Com base no mapa abaixo, responda s questes de nmeros 57 e 58.

(WITKOWSKI, Nicolas (coord.). Cincia e tecnologia hoje. So Paulo: Ensaio, 1995.)

Questo 57
A questo da distribuio e da disponibilidade das reservas internacionais de gua est hoje entre as mais estratgicas no plano internacional. Examinando esse planisfrio, constata-se que as reas com maiores reservas de gua por habitante resultam da seguinte combinao entre aspectos fsicos e da densidade demogrfica: (A) florestas tropicais ou savanas / alta (B) lenis freticos ou solos permeveis / alta (C) pluviosidade intensa ou reservas de gelo / baixa (D) zonas litorneas ou regies montanhosas / baixa

Questo 58
O Brasil e a maior parte da Amrica do Sul podem ser considerados como uma das reas mais privilegiadas do planeta em termos da disponibilidade de recursos hdricos. Nesse caso, os problemas recentes como o da diminuio nos nveis das usinas geradoras de hidroeletricidade derivam principalmente de uma poltica caracterizada como: (A) energtica que poupou investimentos e no previu a irregularidade das precipitaes (B) ambiental que transformou as represas em reas de proteo e no priorizou a construo de canais de irrigao (C) industrial que converteu a produo para o uso de energia nuclear e no previu a manuteno das reservas hdricas (D) de transportes que privilegiou o uso dos rios para a navegao e no considerou os riscos para a baixa do nvel das guas fluviais
1o Exame de Qualificao | Vestibular Estadual 2003

35

CINCIAS HUMANAS E SUAS TECNOLOGIAS

193

Questo 59

(Adaptado de Jornal do Brasil, 29/03/02)

Depois de j ter estado entre as dez maiores economias globais, o Brasil encontra-se hoje, conforme o grfico, em 11 lugar em termos do tamanho do Produto Interno Bruto PIB. Uma soluo para explorar a integrao das economias latino-americanas est sendo o Mercosul, que, por enquanto, formado apenas por Brasil, Argentina, Uruguai e Paraguai. J a criao da ALCA rea de Livre Comrcio das Amricas proposta pelo Governo dos EUA, causa apreenso quanto a possveis problemas para o Brasil. Dentre estes problemas, o mais grave que o pas precisaria enfrentar no caso de uma adeso ALCA seria: (A) eliminar as grandes disparidades culturais e regionais latino-americanas (B) ultrapassar o tamanho das economias norte-americanas, canadense e mexicana (C) atender demanda da indstria dos EUA por trabalhadores imigrantes qualificados (D) manter-se frente concorrncia dos parceiros mais desenvolvidos no continente americano

Questo 60
ISRAEL QUER PR ARGENTINOS EM TERRITRIOS OCUP ADOS POR P ALESTINOS

O governo de Israel est aproveitando o momento de crise vivido na Argentina para incentivar a imigrao de argentinos membros da comunidade judaica ao pas. No entanto, gera polmica em Buenos Aires o fato de duas cidades propostas para a fixao de argentinos estarem localizadas na Cisjordnia e nas colinas de Gol, territrios que se encontram ocupados por palestinos e tm sido palco de intensos conflitos nos ltimos meses.
(SANDRINI, Joo. Folha Online, 18/02/02.)

A inteno de Israel em localizar os estrangeiros justamente em reas de intenso conflito pode ser, do ponto de vista poltico, interpretada como: (A) resposta emigrao palestina nas terras mencionadas (B) tentativa de assentar mediadores para o conflito no local (C) estratgia de afirmao da presena judaica nas reas contestadas (D) promoo de maior diversidade social em um espao culturalmente indefinido

36

1o Exame de Qualificao | Vestibular Estadual 2003

194

CINCIAS HUMANAS E SUAS TECNOLOGIAS

Com base no texto abaixo, responda s questes de nmeros 61 e 62.


RACISMO ABALA IMAGEM DA NORUEGA
OSLO - Terra perfeita, prspera e justa, classificada no ano passado pelo Relatrio de Desenvolvimento Humano da ONU como o melhor lugar para se viver em todo o mundo, a Noruega est vendo seu universo de certezas e tranqilidade abalado pelo julgamento, iniciado h poucos dias, de neonazistas acusados de matar um negro. O caso de Benjamin Hermansen, um afro-noruegus de 15 anos esfaqueado at a morte por rapazes brancos, tem levado o pas a questionar sua auto-imagem. Nos ltimos meses, a Escandinvia tem debatido intensamente imigrao e raa, com algumas conseqncias polticas. Na Dinamarca, um partido antiimigrao saiu-se bem nas eleies de novembro. Na Noruega, as eleies de setembro encerraram 80 anos de dominao do Partido Trabalhista e levaram a uma coalizo apoiada pelo Partido Progressista, que contra a imigrao. A morte de Benjamin, filho de uma norueguesa com um ganense, esquentou o debate. MUNDOS - Imigrao e tenso racial no so coisas novas na Escandinvia. Estrangeiros tm vindo para aqui, atrados por generosas leis de asilo e sistemas abrangentes de previdncia social. Mas muitos pases s agora se vem s voltas com o fato de que se tornaram sociedades mistas, com o surgimento de uma segunda gerao constituda pelos filhos dos imigrantes. Hoje, Oslo tem dois mundos. Na Oslo ocidental, h um fervilhar de compristas, algumas com macios casacos de peles, e restaurantes cheios de famlias consumindo especialidades como costelas de cordeiro. Na parte oriental, ruas sujas e sombrias vem passar alguns dos 130 mil imigrantes, asilados e outros estrangeiros que aqui vivem.
(COWELL, Alan. Jornal do Brasil, 04/01/02.)

Questo 61
O crescimento recente da extrema-direita em vrios pases da Europa Ocidental pode ser associado, em termos polticos, : (A) diminuio da imigrao europia do Leste, a partir dos anos oitenta (B) crise das social-democracias no continente, a partir da dcada de noventa (C) maior demanda por fora de trabalho nos pases industrializados, a partir da dcada de oitenta (D) afirmao de polticas de integrao social nas regies de emigrao, a partir dos anos noventa

Questo 62
A citada formao de sociedades mistas em diversos pases da Europa se deve a um processo histrico em que se verifica o seguinte resultado: (A) superao das desigualdades sociais acentuadas aps a criao da Unio Europia (B) afirmao das polticas segregacionistas estabelecidas aps os atentados de setembro (C) renovao das populaes nacionais surgidas aps a queda dos regimes socialistas no Leste (D) enraizamento das geraes de imigrantes do Terceiro Mundo vindos aps a Segunda Guerra

1o Exame de Qualificao | Vestibular Estadual 2003

37

CINCIAS HUMANAS E SUAS TECNOLOGIAS

195

Questo 63
A histria em quadrinhos abaixo ilustra o encontro de dois personagens que comentam como ambos possuem, na atual ordem internacional, objetivos comuns.

(Cadernos Le Monde Diplomatique, janeiro de 2002)

A afirmativa que conjuga uma avaliao quanto aos supostos objetivos comuns destes dois personagens com uma justificativa para esta avaliao : (A) no existem, pois o personagem da esquerda representa o lucro, e o da direita o idealismo (B) no existem, pois o personagem da esquerda representa o mundo capitalista, e o da direita o bloco socialista (C) existem, pois os personagens representam a estratgia poltica e a fora militar da manuteno da ordem internacional (D) existem, pois os personagens representam o aspecto assistencialista e o aspecto policial na superao do subdesenvolvimento

38

1o Exame de Qualificao | Vestibular Estadual 2003

196

CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 64

(Raul Pederneiras. In: DINIZ, Edinha. Chiquinha Gonzaga: uma histria de vida. Rio de Janeiro: Codecri, 1984.)

O desenho, do incio do sculo XX, mostra de forma esquemtica e bem-humorada como os diversos gneros musicais marcavam os bairros do Rio de Janeiro daquela poca. A respeito dessa associao entre bairros e gneros musicais, possvel concluir que o desenho caracteriza: (A) os bairros junto ao porto como reas de difuso de estilos musicais importados (B) a Zona Norte como lugar de estilos influenciados pela cultura musical norte-americana (C) a Zona Sul como espao de distanciamento entre as manifestaes musicais e o pblico (D) os bairros prximos ao Centro como palco de estilos com letras e instrumentos de origem popular

1o Exame de Qualificao | Vestibular Estadual 2003

39

197

GABARITO OFICIAL - 1 EXAME DE QUALIFICAO

01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16

A A C D A C B C B D A B D C B A

ESPANHOL

17 18 19 20 21 22

D B C A D A

FRANCS

17 18 19 20 21 22

D D C A B C

INGLS

17 18 19 20 21 22

C D D B B A

23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43

C B D A A C A B D C D B C C B B D A D D B

44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64

D C A D B A C A A B D C A C A D C B D C D

198

1a fase | 2o exame de qualificao | 18/08/2002


Neste caderno voc encontrar um conjunto de 40 (quarenta) pginas numeradas seqencialmente, contendo 64 (sessenta e quatro) questes das seguintes reas: Linguagens, Cdigos e suas Tecnologias; Cincias da Natureza, Matemtica e suas Tecnologias; Cincias Humanas e suas Tecnologias. A tabela peridica encontra-se na litima pgina. No abra o caderno antes de receber autorizao.

INSTRUES
1. Verifique se o seu nome, nmero de inscrio, nmero do documento de identidade e lngua estrangeira escolhida esto corretos no carto de respostas. Se houver erro, notifique o fiscal. Assine o carto de respostas com caneta. 2. Ao receber autorizao para abrir este caderno, verifique se a impresso, a paginao e a numerao das questes esto corretas. Caso ocorra qualquer erro, notifique o fiscal. 3. As questes de nmeros 17 a 22 da rea de Linguagens, Cdigos e suas Tecnologias devero ser respondidas de acordo com a sua opo de Lngua Estrangeira: Espanhol, Francs ou Ingls. 4. Leia atentamente cada questo e escolha a alternativa que mais adequadamente responde a cada uma delas. Marque sua resposta no carto de respostas, cobrindo fortemente o espao correspondente letra a ser assinalada; utilize caneta preta, azul, ou lpis preto n 2, conforme o exemplo abaixo:

5. A leitora de marcas no registrar as respostas em que houver falta de nitidez e/ ou marcao de mais de uma letra. 6. O carto de respostas no pode ser dobrado, amassado, rasurado ou manchado. Exceto sua assinatura, nada deve ser escrito ou registrado fora dos locais destinados s respostas. 7. Voc dispe de 4 (quatro) horas para fazer esta prova. 8. Ao terminar a prova, entregue ao fiscal o carto de respostas e este caderno.

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

199

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS


Com base no texto abaixo, responda s questes de nmeros 01 a 05.
A ARTE DA CONVERSA
01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31

Estou hoje com bem pouca disposio para escrever. Conversemos. A conversa uma das coisas mais agradveis e mais teis que existe no mundo. A princpio conversava-se para distrair e passar o tempo mas atualmente a conversa deixou de ser um simples devaneio do esprito. Dizia Esopo que a palavra a melhor, e tambm a pior coisa que Deus deu ao homem. Ora, para fazer valer este dom, preciso saber conversar, preciso estudar profundamente todos os recursos da palavra. A conversa, portanto, pode ser uma arte, uma cincia, uma profisso mesmo. H, porm, diversas maneiras de conversar. Conversa-se a dois, en tte--tte1; e palestra-se com muitas pessoas, en causerie2. A causerie uma verdadeira arte como a pintura, como a msica, como a escultura. A palavra um instrumento, um cinzel, um craion3 que traa mil arabescos, que desenha baixos-relevos e tece mil harmonias de sons e de formas. Na causerie o esprito uma borboleta de asas douradas que adeja sobre as idias e sobre os pensamentos, que suga-lhes o mel e o perfume, que esvoaa em ziguezague at que adormece na sua crislida. A imaginao um prisma brilhante, que reflete todas as cores, que decompem os menores tomos de luz, que faz cintilar um raio do pensamento por cada uma de suas facetas difanas.

32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

A conversa a dois, ao contrrio, fria e calculada como uma cincia: tem alguma coisa das matemticas, e muito da estratgica militar. Por isso, quando ela no um clculo de lgebra ou a resoluo de um problema, torna-se ordinariamente um duelo e um combate. Assim, quando virdes dois amigos, dois velhos camaradas, que conversam intimamente e a ss, ficai certo que esto calculando algebricamente o proveito que podem tirar um do outro, e resolvendo praticamente o grande problema da amizade clssica dos tempos antigos. Se forem dois namorados en tte--tte, que estiverem a desfazer-se em ternuras e meiguices, requebrando os olhos e afinando o mais doce sorriso, podeis ter a certeza que ou zombam um do outro, ou buscam uma incgnita que no existe neste mundo a fidelidade. Em outras ocasies, a conversa a dois torna-se, como dissemos, uma perfeita estratgica militar, um combate. A palavra transforma-se ento numa espcie de zuavo 4 pronto ao ataque. Os olhos so duas sentinelas, dois ajudantes-de-campo postos de observao nalguma eminncia prxima. O olhar faz as vezes de espio que se quer introduzir na praa inimiga. A confidncia uma falsa sortida; o sorriso uma verdadeira cilada. Isto sucede freqentemente em poltica e em diplomacia. (...)
(ALENCAR, Jos de. Correio Mercantil, 13/05/1855.)

1 2 3 4

Frente a frente. Conversa, conversao, normalmente em grupo. Lpis. Soldado argelino, pertencente infantaria francesa, caracterizado por uniforme vistoso e colorido.

2o Exame de Qualificao | Vestibular Estadual 2003

200

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 0 1 01
O escritor Jos de Alencar publicou nos jornais vrias crnicas, poca chamadas folhetins. Ele inicia o folhetim A arte da conversa com um recurso retrico comum, que se pode descrever como: (A) imprimir tom coloquial prpria conversa (B) dizer que no vai fazer o que est fazendo (C) negar a importncia do que acha importante (D) invocar a autoridade de um autor j reconhecido

Questo 0 2 02
A conversa uma das coisas mais agradveis e mais teis que existe no mundo. (l. 3 - 4) Apesar dessa afirmao, o autor tambm diz que a palavra pode ser, ao mesmo tempo, a melhor e a pior coisa que Deus deu ao homem. Uma referncia direta s possibilidades negativas da palavra encontra-se no seguinte trecho: (A) A princpio conversava-se para distrair e passar o tempo mas atualmente a conversa deixou de ser um simples devaneio do esprito. (l. 5 - 7) (B) ... preciso saber conversar, preciso estudar profundamente todos os recursos da palavra. (l. 10 - 12) (C) Na causerie o esprito uma borboleta de asas douradas que adeja sobre as idias e sobre os pensamentos, que suga-lhes o mel e o perfume, (l. 23 - 25) (D) Assim, quando virdes dois amigos, dois velhos camaradas, que conversam intimamente e a ss, ficai certo que esto calculando algebricamente o proveito que podem tirar um do outro, (l. 38 - 41)

Questo 03
A palavra um instrumento, um cinzel, um craion que traa mil arabescos, que desenha baixosrelevos e tece mil harmonias de sons e de formas. (l. 19 - 22) O fragmento acima apresenta vrias metforas referentes palavra, construdas a partir da comparao entre a conversa e outras formas de arte. Considerando todas as metforas presentes nesse fragmento, pode-se indicar a seguinte propriedade da arte da palavra: (A) vale por todas as imagens, msicas e esculturas (B) superior a cada uma das artes em todas as situaes (C) diferencia-se de todas as artes e de seus instrumentos (D) tem o valor de cada arte e de todas ao mesmo tempo

2o Exame de Qualificao | Vestibular Estadual 2003

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

201

Questo 04
Se forem dois namorados en tte--tte, que estiverem a desfazer-se em ternuras e meiguices, requebrando os olhos e afinando o mais doce sorriso, podeis ter a certeza que ou zombam um do outro, ou buscam uma incgnita que no existe neste mundo a fidelidade. (l. 44 - 49) Alencar formula, no fragmento destacado, um argumento dedutivo, conhecido como: (A) tese (B) dilema (C) sofisma (D) hiptese

Questo 05
Em vrios momentos o autor usa o verbo na 2 pessoa, como em podeis ter a certeza (l. 47). Esse uso estabelece uma coeso interna com o ttulo e a temtica do texto, porque: (A) sugere um debate polmico (B) valoriza a opinio dos seus leitores (C) simula uma conversa com um leitor (D) dirige informaes a um dado pblico

Com base no texto abaixo, responda s questes de nmeros 06 a 08.


P ARADOXO
01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16

Paradoxo um modo de expresso que se encontra margem da doxa mas ento se torna necessrio definir doxa. Doxa pode ser explicado como a opinio de toda a gente, o conhecimento do senso comum, habitual. Logo, um paradoxo a expresso de um raciocnio que no segue a lgica do senso comum. H vrios tipos de paradoxos. Entre os mais famosos, encontramos aquele que foi formulado pelo grego Epimnides: todos os cretenses so mentirosos. Como Epimnides era cretense, constitui-se em um paradoxo: se a afirmao correta, Epimnides, por ser cretense, est mentindo; se Epimnides est mentindo, a afirmao, entretanto, deveria ser falsa. Este paradoxo e um outro, de Macedonio Fernandes neste mundo faltam tantas coisas que, se faltasse mais uma, no haveria lugar para ela , no se podem classificar nem como falsos, nem como verdadeiros. Justamente pelo fato de se constiturem em complicadores para o pensamento, os paradoxos podem promover descobertas importantes. Seu valor pode ser resumido na sentena de Miguel de Unamuno: o supremo triunfo da razo consiste em duvidar da sua validade. Em outras palavras: nos termos do pensamento, vence quem no acredita em vitria e continua: continua lutando, duvidando, pensando, escrevendo. Em termos mais populares, equivale noo de que o melhor da festa se encontra no preparar a festa, e no na festa propriamente dita. Em termos filosficos, equivale a compreender que o sentido do esforo intelectual no reside na resposta, mas sim na pergunta, to metdica quanto permanente.
(Verbete em CEIA, Carlos (Org). Dicionrio de Termos Literrios. Lisboa: Editorial Verbo, 2002.)

2o Exame de Qualificao | Vestibular Estadual 2003

202

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 06
A descrio do paradoxo formulado pelo grego Epimnides (2 pargrafo) mostra a dificuldade de se atribuir o juzo de falso ou verdadeiro a esse tipo de formulao. Em todos os cretenses so mentirosos, um exemplo de paradoxo, a dificuldade de julgar o contedo como falso ou verdadeiro ocorre porque: (A) o enunciador da frase pertence ao conjunto dos cretenses (B) uma definio generalizante passvel de interpretaes contraditrias (C) a avaliao acerca da veracidade da afirmao depende de cada interlocutor (D) a noo de verdade contida na frase referente a um ponto de vista particular

Questo 0 7 07
H vrios tipos de paradoxos. Entre os mais famosos, encontramos aquele que foi formulado pelo grego Epimnides: (l. 4 - 5) Na frase acima, apesar de os nomes que o antecedem estarem no plural, o pronome aquele est no singular. O uso no singular justifica-se pela seguinte caracterstica desse pronome no texto: (A) concorda com o singular da primeira forma verbal (B) refere-se a um elemento enunciado posteriormente (C) possui concordncia facultativa com os nomes citados (D) associa-se a uma classe gramatical invarivel quanto ao nmero

Questo 08
A apresentao do significado de paradoxo poderia ser desmembrada da seguinte forma: I) para significa proximidade, ao lado de; II) doxa pode ser explicado como a opinio de toda a gente; III) Logo, um paradoxo a expresso de um raciocnio que est margem do senso comum. Quanto forma, essa construo com duas afirmaes seguidas de uma concluso poderia ser associada ao silogismo, meio de expresso do raciocnio dedutivo. Porm, sabendo-se que a deduo um mtodo que parte do geral para o particular, a construo acima no pode ser vista como silogismo, porque: (A) a concluso carece de sustentao ou comprovao suficiente (B) a concluso no decorrente da associao entre as duas outras afirmaes (C) a primeira afirmativa no representa uma proposio maior em relao segunda (D) a segunda afirmativa expressa uma considerao especfica e a primeira, abrangente

2o Exame de Qualificao | Vestibular Estadual 2003

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

203

Com base no texto abaixo, responda s questes de nmeros 09 a 12.


O MUNDO P ARA T ODOS PARA TODOS
01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41
(BUARQUE, Cristovam. O Globo, 23/10/2000.)

Durante debate recente, nos Estados Unidos, fui questionado sobre o que pensava da internacionalizao da Amaznia. O jovem introduziu sua pergunta dizendo que esperava a resposta de um humanista e no de um brasileiro. Foi a primeira vez que um debatedor determinou a tica humanista como o ponto de partida para uma resposta minha. De fato, como brasileiro eu simplesmente falaria contra a internacionalizao da Amaznia. Por mais que nossos governos no tenham o devido cuidado com esse patrimnio, ele nosso. Respondi que, como humanista, sentindo o risco da degradao ambiental que sofre a Amaznia, podia imaginar a sua internacionalizao, como tambm de tudo o mais que tem importncia para a Humanidade. Se a Amaznia, sob uma tica humanista, deve ser internacionalizada, internacionalizemos tambm as reservas de petrleo do mundo inteiro. O petrleo to importante para o bem-estar da humanidade quanto a Amaznia para o nosso futuro. Apesar disso, os donos das reservas sentem-se no direito de aumentar ou diminuir a extrao de petrleo e subir ou no o seu preo. Os ricos do mundo, no direito de queimar esse imenso patrimnio da Humanidade. Da mesma forma, o capital financeiro dos pases ricos deveria ser internacionalizado. Se a Amaznia uma reserva para todos os seres humanos, ela no pode ser queimada pela vontade de um dono, ou de um pas. Queimar a Amaznia to grave quanto o desemprego provocado pelas decises arbitrrias dos especuladores globais. No podemos deixar que as reservas financeiras sirvam para queimar pases inteiros na volpia da especulao. Antes mesmo da Amaznia, eu gostaria de ver a internacionalizao de todos os grandes museus do mundo. O Louvre no deve pertencer apenas Frana. Cada museu do mundo guardio das mais belas peas produzidas pelo gnio humano. No se pode deixar que esse patrimnio cultural, como o patrimnio natural amaznico, seja manipulado e destrudo pelo gosto de um proprietrio ou de um pas. No faz muito, um milionrio japons decidiu enterrar com ele um quadro de um grande mestre. Antes disso, aquele quadro deveria ter sido internacionalizado. Durante o encontro em que recebi a pergunta, as Naes Unidas reuniam o Frum do Milnio, mas alguns presidentes de pases tiveram dificuldades em comparecer por constrangimentos na fronteira dos EUA. Por isso, eu disse que Nova York, como sede das Naes Unidas, deveria ser internacionalizada. Pelo menos Manhatan deveria pertencer a toda a Humanidade. Assim como Paris, Veneza, Roma, Londres, Rio de Janeiro, Braslia, Recife, cada cidade, com sua beleza especifica, sua histria do mundo, deveria pertencer ao mundo inteiro. Se os EUA querem internacionalizar a Amaznia, pelo risco de deix-la nas mos de brasileiros, internacionalizemos todos os arsenais nucleares dos EUA. At porque eles j demonstraram que so capazes de usar essas armas, provocando uma destruio milhares de vezes maior do que as lamentveis queimadas feitas nas florestas do Brasil. Nos seus debates, os atuais candidatos presidncia dos EUA tm defendido a idia de internacionalizar as reservas florestais do mundo em troca da dvida. Comecemos usando essa dvida para garantir que cada criana do mundo tenha possibilidade de ir escola. Internacionalizemos as crianas tratando-as, todas elas, no importando o pas onde nasceram, como patrimnio que merece cuidados do mundo inteiro. Ainda mais do que merece a Amaznia. Quando os dirigentes tratarem as crianas pobres do mundo como um patrimnio da Humanidade, eles no deixaro que elas trabalhem quando deveriam estudar; que morram quando deveriam viver. Como humanista, aceito defender a internacionalizao do mundo. Mas, enquanto o mundo me tratar como brasileiro, lutarei para que a Amaznia seja nossa. S nossa.

2o Exame de Qualificao | Vestibular Estadual 2003

204

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 09
Cristovam Buarque, ao revelar os interesses ocultos na defesa da internacionalizao da Amaznia, utiliza um recurso argumentativo conhecido como reduo ao absurdo. Esse recurso consiste na aceitao inicial de uma proposio para dela extrair decorrncias absurdas ou inaceitveis. O trecho que melhor exemplifica o uso deste recurso, em relao proposta de internacionalizao, : (A) No podemos deixar que as reservas financeiras sirvam para queimar pases inteiros na volpia da especulao. (l. 16 - 17) (B) Cada museu do mundo guardio das mais belas peas produzidas pelo gnio humano. (l.19 - 20) (C) No se pode deixar que esse patrimnio cultural, como o patrimnio natural amaznico, seja manipulado e destrudo pelo gosto de um proprietrio ou de um pas. (l. 20 - 21) (D) Se os EUA querem internacionalizar a Amaznia, pelo risco de deix-la nas mos de brasileiros, internacionalizemos todos os arsenais nucleares dos EUA. (l. 29 - 30)

Questo 1 0 10
No pargrafo de concluso, o autor responde, de maneira indireta, ao jovem que lhe fez a pergunta no primeiro pargrafo. Essa resposta de Cristovam Buarque, presente no ltimo pargrafo, est melhor explicitada em: (A) Internacionalista antes aquele que defende o patrimnio da Humanidade. (B) Brasileiro antes aquele que luta para que a Amaznia seja nossa e s nossa. (C) Humanista antes aquele que defende a internacionalizao de todo o mundo. (D) Patriota antes aquele que luta por todas as ptrias e por todos os seres humanos.

Questo 1 1 11
Os ricos do mundo, no direito de queimar esse imenso patrimnio da Humanidade. (l. 12) Na frase acima, a pontuao assume um papel fundamental para a compreenso do que est dito. Essa importncia verifica-se no uso da vrgula, que est empregada para: (A) marcar elipse de um verbo (B) explicitar uma enumerao (C) separar o sujeito do verbo (D) marcar inverso de ordem direta

Questo 12
O jovem introduziu sua pergunta dizendo que esperava a resposta de um humanista e no de um brasileiro. (l. 2 - 3) O objetivo da fala do jovem, ao solicitar que Cristovam Buarque se comportasse como humanista, est corretamente descrito em: (A) ressaltar a inteligncia e a cultura patritica do interlocutor (B) fazer um questionamento e um protesto dirigido ao debatedor (C) demonstrar conscincia e tolerncia ante a pluralidade de opinies (D) desvalorizar o ponto de vista e a posio do brasileiro acerca do assunto
2o Exame de Qualificao | Vestibular Estadual 2003

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

205

Com base no texto abaixo, responda s questes de nmeros 13 a 16.


PREFCIO
01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41

Verdadeiramente est comprovado: no Brasil fazer um livro de poemas mais fcil que votar. Como cidados ns lutamos pela liberdade de expresso, pela igualdade de direitos. Como poetas ns lutamos pela liberdade de expresso, pela igualdade de direitos. Ns somos persistentes e resistimos ao medo e inrcia. Hoje no Brasil publicao de livros e livretos de poesia virou moda. Mas quase impossvel ter conhecimento de tudo. Tampouco necessrio ou agradvel se ater a tantas inutilidades. Ferreira Gullar seria dolo nacional se jogasse futebol. Carlos Drummond de Andrade seria canonizado se fizesse milagres. Joo Cabral de Melo Neto seria subversivo se morasse na Vila Esperana. E ns seramos bons poetas se a parania e o medo no avassalassem nossas cabeas. Contudo, apesar de tudo, acreditamos que a poesia provoca mudana na cabecinha das pessoas. Somos poetas. Utpicos. Lutamos contra o desespero, contra a injustia. Esperana acumulada. Teimosia necessria. Qualquer crtico de literatura poder dizer que este livro representa a insatisfao e as contradies estticas de jovens poetas sitiados na cidade de So Paulo. Uma bela amostra de rebeldia potica. Tolice. Estamos na CONTRAMO porque todo brasileiro est cometendo infrao. Todo mundo insistindo em sobreviver. Povo malucado. At o pensar est sendo proibido. Gestos coagidos. Inocentes foragidos. A contradio de um homem hoje a mais legtima de suas armas. Se todos os 110 milhes de poetas brasileiros resolvessem falar de repente a poesia deixaria de ser necessria. Mas isso coisa do futuro. Ento eis a poesia como investigao formal, como experincia existencial, como instrumento de conhecimento humano. Eis a poesia como denncia da misria contempornea. Sntese das ambigidades intelectuais. Eis ento a poesia dardejando mensagens que propem a

41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75

pluralidade de significados. Eis a poesia em busca da compreenso das contradies de seu tempo. Na CONTRAMO, em que pese as barreiras e as ameaas constantes. Mesmo armadilhados podemos lucidamente afirmar que no temos a conscincia tranqila. Tampouco temos conscincia do que seja tranqilidade. Os tempos so de cravos enferrujados sobre a tumba de um heri qualquer. Os tempos no deixaram margem nem leito originalidade de nossos pensamentos. No deixaram coerncia s nossas conscincias. Os tempos so de calabouo. Por isso publicamos esse livro. E este mais um livro possivelmente insignificante. Como so todos os livros publicados neste pas que clama, no por teorias ou futilidades, mas por po e trabalho justo. Clama por total reestruturao social e econmica. Por justia. Por atos concretos, atitudes honestas. Porque, por incrvel que possa parecer, esta tambm uma terra habitada por seres humanos; no por vermes. Estamos entupidos de decises e determinaes inconseqentes. No queremos apenas resistir. Queremos avanar. Nossa pretenso ao editar este livro a de manifestar, peremptoriamente, nosso compromisso com a vida e com a m literatura feita em nosso pas. Por ltimo, queremos avisar os sindicatos, as associaes de bairros, os teatros, os jornais, as escolas e faculdades, os rdios, as fbricas, as televises, a Academia Brasileira de Letras, a Escola Superior de Guerra, a Unio Brasileira de Escritores, que atualmente estamos fazendo apresentaes pblicas de poesias. s nos chamar. No cobramos nada. Apenas reclamamos seriedade. Porque preciso fazer alguma coisa pela sensibilidade do homem. E poesia e poeta no so to chatos assim. bom sabermos que no Brasil tudo est por fazer. Apesar dos vigias. Porque ningum precisa deles.
(In: PEREIRA, Carlos A. M. Retrato de poca. Rio de Janeiro: FUNARTE, 1981.)

2o Exame de Qualificao | Vestibular Estadual 2003

206

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 13
O Prefcio constitui a abertura de um livro coletivo de poemas datado de 1978, no contexto da ditadura militar no Brasil. Nesse texto de abertura, os autores estabelecem relaes entre a produo literria e a situao social do pas naquele momento. De acordo com o texto, essa situao social relaciona-se, principalmente, seguinte caracterstica da poesia no perodo: (A) comprometimento da qualidade (B) divulgao em lugares pblicos (C) manifestao do inconformismo (D) originalidade no engajamento poltico

Questo 14
Quanto aos objetivos discursivos, pode-se afirmar que no Prefcio os autores adotam predominantemente a atitude de: (A) informar (B) polemizar (C) descrever (D) exemplificar

Questo 15
Somos poetas. Utpicos. Lutamos contra o desespero, contra a injustia. Esperana acumulada. Teimosia necessria. (l. 19 - 22) O trecho acima exemplifica um modo de escrita que emprega muitas frases curtas mas poucas palavras de ligao. Tais frases, no entanto, no poderiam ser consideradas fragmentos dispersos, sem unidade. A unidade e a coerncia entre elas garantida pelo fato de: (A) haver uma seqncia fixa na ordem de aparecimento no trecho (B) manterem uniformidade nas formas verbais flexionadas no presente (C) apresentarem-se como uma justaposio marcada pelo uso do ponto (D) possurem inter-relaes de sentido indicadas pelo contexto lingstico

Questo 16
No texto, os autores expressam aquilo que seria sua concepo ideal de arte potica. Essa concepo que, para eles, no pode ser posta em prtica no contexto vivido naquele momento histrico, relaciona-se ao seguinte fragmento: (A) Somos poetas. Utpicos. ... Esperana acumulada. Teimosia necessria. (l. 19 - 22) (B) Uma bela amostra de rebeldia potica. (l. 25 - 26) (C) Eis ento a poesia dardejando mensagens que propem a pluralidade de significados. (l. 39 - 41) (D) Como so todos os livros publicados neste pas que clama, no por teorias ou futilidades, mas por po e trabalho justo. (l. 54 - 56)
2o Exame de Qualificao | Vestibular Estadual 2003

207

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

ANHOL | ESP ESPANHOL

Com base no texto abaixo, responda s questes de nmeros 17 a 20.

RETRICA Y PROPUEST A DE REALIDAD (LA AMPLIACIN RETRICA DEL MUNDO) PROPUESTA

01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24

Es la literatura la actividad de creacin lingstica que generalmente es asociada de manera ms directa a la construccin de mundo. Escribir una obra literaria es ampliar el mundo, no solamente porque la creacin literaria ofrece una obra, un poema, en definitiva una construccin lingstica que antes no exista y que es producida con la intencin de que persista, sino tambin porque la escritura literaria puede dar como resultado la existencia virtual de una realidad que est configurada y fundamentada por el lenguaje, es decir, la existencia de un mundo virtual, una realidad virtual. La creacin de El ingeniosos hidalgo Don Quijote de la Mancha por Miguel de Cervantes supuso que no slo la ampliacin del mundo debida a la existencia en el mismo de un nuevo objeto artstico como es esta obra literaria, sino tambin la producida por la existencia virtual de Don Quijote, Sancho Panza, Sansn Carrasco, los viajes del caballero y su escudero, etc., personajes, es decir, personas virtuales, y acontecimientos igualmente virtuales que estn sostenidos por el lenguaje artstico con el que est construida la obra. El mundo es ms grande despus del acto de creacin de una obra literaria. Las obras literarias pueblan el mundo y lo amplan. (...) Otras actividades de construccin lingstica tambin pueden ser consideradas como formas de produccin de realidad que es propuesta a los receptores, como formas de propuesta de realidad. Son aquellas en las que los productores ofrecen a los receptores una realidad construida por medio del lenguaje, una realidad que tiene existencia en tanto en cuanto est constituida por un referente que puede llegar a tener existencia en el futuro, dependiendo esta existencia en gran medida de la actitud o de la actuacin de los receptores. (...) La propuesta retrica de realidad depende de la fuerza y los poderes inherentes al lenguaje (Lpez Eire, 1999; Hernndez Guerrero, 1999). Gracias al lenguaje regulado y conformado por la retrica, el orador puede no slo construir y proponer realidad, sino tambin hacer que la realidad propuesta llegue a ser efectiva al persuadir a los oyentes de que acepten su propuesta de realidad y de que acten en el sentido de que sta llegue a tener existencia real. La capacidad del lenguaje para ampliar el mundo es activada tanto en la creacin discursiva de realidad como en la transformacin de la realidad propuesta en efectiva.
TOMS ALBALADEJO MAYORDOMO http://www.tonosdigital.com

10

2 o Exame de Qualificao | Vestibular Estadual 2003

208

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | ESPANHOL

Questo 17
El autor del ensayo deja claro que su objetivo es: (A) restringir conceptos sobre ampliacin del mundo (B) proponer una reflexin sobre el papel de los textos literarios (C) garantizar la relevancia de la retrica en los estudios literarios (D) atribuir al lenguaje la responsabilidad de la creacin de realidades

Questo 18
Para el autor, el texto literario tiene las siguientes funciones: (A) llenar el mundo y aumentarlo (B) crear personas virtuales y deshacerlas (C) depender de la fuerza del lenguaje y vencerla (D) ofrecer una construccin de realidad y negarla

Questo 19
una realidad que tiene existencia en tanto en cuanto est constituida por un referente que (l. 15 - 16) Lo subrayado en el fragmento tiene los sentidos de: (A) finalidad y tiempo (B) causa y condicin (C) consecuencia y modo (D) concesin y explicacin

Questo 20
El argumento conclusivo de ese texto nos presenta el lenguaje como capaz de: (A) producir una verdad y realizarla (B) establecer una artificialidad y regularla (C) sostener una virtualidad y contradecirla (D) desarrollar una incertidumbre y explicarla

2o Exame de Qualificao | Vestibular Estadual 2003

11

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | ESPANHOL

209

Com base no texto abaixo, responda s questes de nmeros 21 e 22.

COLECTIVO MEXICANO DE YO A LA NIEZ / COMEXANI APOY APO

Por una sociedad donde se respeten los derechos de la niez, reconociendo en todo momento a los nios y nias como sujetos sociales.

CAMP AA CONTRA EL MAL TRA T O A NIAS Y NIOS CAMPAA MALTRA TRAT


El maltrato infantil es una forma de violencia que forma parte de un proceso histrico-cultural que se transmite de generacin a generacin. Esta violencia, generada por la desigualdad social y el abuso del poder en las relaciones interpersonales, se valida socialmente y se ejerce cotidianamente. Est al margen de la ley y se fundamenta en las costumbres, creencias y valores, as como en el deber ser de las personas.
http://www.laneta.apc.org/comexani

Questo 2 1 21
En el cartel de la campaa, se comprende la relacin entre los nios y la mariposa como smbolo de la: (A) ternura a exigrseles (B) libertad a obligrseles (C) suavidad a dedicrseles (D) educacin a estimulrseles

Questo 22
Entre otras posibilidades, Comexani est dedicado a: (A) fundamentarse en la costumbre (B) validar la actuacin de las familias (C) estudiar el deber ser de las personas (D) discutir las relaciones interpersonales

12

2 o Exame de Qualificao | Vestibular Estadual 2003

210

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

| INGLS

Com base no texto abaixo, responda s questes de nmeros 17 a 20.

WHA T IS RHET ORIC? WHAT RHETORIC?


01 02 03 04 05 06 07 08 10 11 12 13 14 15 16 17 18 19 20

Rhetoric is a very human-centered study of reality. Whereas science and philosophy search for universals or truths that transcend humanity, rhetoric understands truth as an unavoidably human construct. Indeed, perhaps there are universal truths beyond our senses, but rhetoricians recognize that humans are always interpreting those truths through our human contexts. In other words, who we are and where we are will always be factors in how we define truth. And, since the who and where of our lives are always changing, so is our understanding of truth. But some rhetoricians, including myself, ask whether universal truths exist in the first place. Western philosophy has always assumed that stability is the norm and change is the exception. And yet, our experiences in this world seem to suggest exactly the opposite. Very little around us stays the same for long. Indeed, change seems to be norm in reality, while things that stay the same are the exception. Rhetoric is a way of coping and adapting to that unavoidable change in our everyday lives. To manage the change in our lives, rhetoric has two main functions: interpretation and expression. The study of interpretation, called hermeneutics, is the study of how people interpret their rhetorical situations and the discourse of others. Humans are always in a process of anticipating the evolution of discourse and resolving their misunderstandings through interpretive strategies (i.e. guessing, dialogue). A specialized form of interpretation is rhetorical criticism. A rhetorical critic studies texts to determine how particular speakers or writers use words to be persuasive or perhaps create whole new conceptions of reality. The second function of rhetoric, expression, is probably more familiar to most people. The study of expression concentrates on how humans can use language to create change in their lives. Expression concerns everything from the use of a well placed word to the use of a genre to organize an argument. By studying both interpretation and expression, the rhetorician researches the endless dance between how we understand each other and how we persuade each other. So what is rhetoric? Rhetoric is a perspective from which we interpret and express the evolving reality around us. It is a metaphor from which we invent a particular conception of what we believe and what we hold as true. Rhetoric is the study of how we use language to come to terms with the evolving reality in which we find ourselves. It studies how we use interpretive and expressive strategies to get along in the world.
RICHARD JOHNSON-SHEEHAN, Ph.D. http://www.unm.edu

16

2o Exame de Qualificao | Vestibular Estadual 2003

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | INGLS

211

Questo 17
An essay is a short piece of writing, where the writer expresses his points of view on a particular subject. In What is rhetoric?, Prof. Sheehan develops the topic by: (A) defining the term rhetoric and its practical applications (B) comparing and contrasting former and current perspectives (C) establishing the dividing line between science and philosophy (D) arguing in favor of the teaching and practice of rhetoric at universities

Questo 18
One of the functions of rhetoric is justified in the following excerpt: (A) In other words, who we are and where we are will always be factors in how we define truth. (l. 4 - 5) (B) Indeed, change seems to be norm in reality, while things that stay the same are the exception. (l. 9 - 10) (C) Humans are always in a process of anticipating the evolution of discourse and resolving their 'misunderstandings' through interpretive strategies (l. 13 - 14) (D) A rhetorical critic studies texts to determine how particular speakers or writers use words to be persuasive or perhaps create whole new conceptions of reality. (l. 15 - 16)

Questo 19
According to the author, the overall goal of rhetorical research is to: (A) understand how human experiences are related to each other (B) analyze communication strategies employed by language users (C) study appropriateness levels of vocabulary chosen by speakers (D) compare the different types of discourse used to persuade others

Questo 20
And, since the who and where of our lives are always changing, so is our understanding of truth. (l. 5 - 6) Since and so in the sentence above may be notionally replaced by: (A) if and thus (B) therefore and but (C) hence and instead (D) because and likewise

2o Exame de Qualificao | Vestibular Estadual 2003

17

212

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | INGLS

Com base no texto abaixo, responda s questes de nmeros 21 e 22.


ACTION ALERT : ST OP HARD LIQUOR ADS ON TELEVISION ALERT: STOP

LOOK AT THE FACTS AND DECIDE FOR YOURSELF

1. Research clearly shows that exposure to alcohol advertising makes kids more likely to start using those products. 2. Children and teens watch, on average, more than 1,000 hours of television per year. 3. About a fourth of American families even have a TV set in a childs bedroom.

http://www.cspinet.org

Questo 2 1 21
Campaign and advertisement posters make frequent use of visual aids such as pictures, drawings and charts to cause an immediate impact on viewers. The idea conveyed by the image for the campaign is found in the following sentence: (A) The risk of underage alcohol consumption is increasing. (B) Hard liquor addiction is related to ethnic and age variables. (C) Alcohol drinking rates among kids are higher than those among adults. (D) Teenage girls are more prone to alcohol drinking than their male counterparts.

Questo 22
The reason for the action alert is contained in: (A) parents must restrict their kids TV viewing time (B) youth exposure to alcohol ads on TV may lead to addiction (C) the number of TV sets in a house contributes to alcohol addiction (D) alcoholic teenagers watch much more TV as compared to other age groups

18

2o Exame de Qualificao | Vestibular Estadual 2003

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

213

CINCIAS DA NA TUREZA, MA TEMTICA E SUAS TECNOLOGIAS NATUREZA, MATEMTICA Questo 23


Quatro vasos idnticos 1, 2, 3 e 4 contendo ps de feijo, foram colocados em um ambiente controlado, no qual fatores como a umidade, as concentraes de CO2 e de O2 e a temperatura foram mantidos constantes. Variou-se, apenas, o tempo de iluminao para cada vaso: 3, 6, 9 ou 12 horas/dia. No incio do experimento, os vasos foram colocados, um a um, em um prato de uma balana, sendo todos eles equilibrados pelo mesmo peso P0, colocado no outro prato, como mostra o esquema.

Aps alguns dias, os vasos 1, 2, 3 e 4 foram equilibrados pelos pesos P1, P2, P3 e P4, respectivamente, de modo que P3 > P2 > P1 > P4. Pode-se concluir que o vaso submetido a um perodo dirio de iluminao de 6 horas o de nmero: (A) 1 (B) 2 (C) 3 (D) 4

Questo 24
Jorge quer distribuir entre seus filhos os ingressos ganhos para um show. S e cada um de seus filhos ganhar 4 ingressos, sobraro 5 ingressos; se cada um ganhar 6 ingressos, ficaro faltando 5 ingressos. Podemos concluir que Jorge ganhou o nmero total de ingressos correspondente a: (A) 15 (B) 25 (C) 29 (D) 34

Questo 25
A anlise qualitativa de uma substncia orgnica desconhecida revelou a presena de carbono, oxignio e hidrognio. Podemos afirmar que essa substncia no pertence funo denominada: (A) ster (B) fenol (C) hidrocarboneto (D) cido carboxlico
2o Exame de Qualificao | Vestibular Estadual 2003

19

214

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 26
Observe, a seguir, o esquema de uma clula eucariota.

(Adaptado de HOLTZMAN & NOVIKOFF. Clulas e estrutura celular. Rio de Janeiro: Interamericana, 1985.)

Os processos relativos gliclise em condies anaerbicas, sntese de RNA, parte aerbica da respirao e ao transporte ativo de ons sdio e potssio ocorrem, respectivamente, nas estruturas celulares correspondentes aos seguintes nmeros: (A) 8, 5, 3, 7 (B) 6, 5, 4, 7 (C) 6, 2, 1, 8 (D) 1, 3, 8, 4

Questo 27
Jos deseja construir, com tijolos, um muro de jardim com a forma de uma espiral de dois centros, como mostra a figura abaixo.

Para construir esta espiral, escolheu dois pontos que distam 1 metro um do outro. A espiral tem 4 meias-voltas e cada tijolo mede 30 cm de comprimento. Considerando = 3, o nmero de tijolos necessrios para fazer a espiral : (A) 100 (B) 110 (C) 120 (D) 130

20

2o Exame de Qualificao | Vestibular Estadual 2003

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

215

Questo 28
Leia a tirinha abaixo:

(RAMALHO, F., FERRARO, N. e SOARES, P.A.T. Os fundamentos da Fsica. So Paulo: Moderna, 1989.)

Considere que esta situao possa ocorrer sob presso de 1 atm, quando o gelo se funde a 273 K. A seguir, observe o grfico que mostra o tipo de relao matemtica entre a presso p e a temperatura absoluta t, num certo intervalo de t, para substncias como a gua, que se contraem na fuso.

O ponto triplo, representado por T, corresponde a 273,16 K para a gua. Pode-se afirmar que a temperatura de fuso do gelo, em C, sob presso de 8,0 atm, aproximadamente de: (A) (B) (C) 0,08 0,16 0

(D) 0,06

Questo 29
freqente observarmos, em espetculos ao ar livre, pessoas sentarem nos ombros de outras para tentar ver melhor o palco. Suponha que Maria esteja sentada nos ombros de Joo que, por sua vez, est em p sobre um banquinho colocado no cho. Com relao terceira lei de Newton, a reao ao peso de Maria est localizada no: (A) cho (B) banquinho (C) centro da Terra (D) ombro de Joo

2o Exame de Qualificao | Vestibular Estadual 2003

21

216

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 30
Observe a matriz a seguir.

sen x sen x sen x

cos2 x cos x 1

1 0 1

Resolvendo seu determinante, ser obtido o seguinte resultado: (A) 1 (B) sen x (C) sen2 x (D) sen3 x

Questo 3 1 31
Pardal a denominao popular do dispositivo ptico-eletrnico utilizado para fotografar veculos que superam um determinado limite estabelecido de velocidade V. Em um trecho retilneo de uma estrada, um pardal colocado formando um ngulo com a direo da velocidade do carro, como indica a figura abaixo.

Suponha que o pardal tenha sido calibrado para registrar velocidades superiores a V, quando o ngulo = 0. A velocidade do veculo, que acarretar o registro da infrao pelo pardal, com relao velocidade padro V, ser de: (A) V sen (B) V cos (C) (D) V sen V cos

22

2o Exame de Qualificao | Vestibular Estadual 2003

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

217

Questo 32
Um barco navega na direo AB, prximo a um farol P, conforme a figura abaixo.

(Adaptado de BONGIOVANNI, Vincenzo et alii . Matemtica e Vida. So Paulo: tica, 1990.)

No ponto A, o navegador verifica que a reta AP, da embarcao ao farol, forma um ngulo de 30 com a direo AB. Aps a embarcao percorrer 1.000 m, no ponto B, o navegador verifica que a reta BP, da embarcao ao farol, forma um ngulo de 60 com a mesma direo AB. Seguindo sempre a direo AB, a menor distncia entre a embarcao e o farol ser equivalente, em metros, a: (A) (B) 500 500 3

(C) 1.000 (D) 1.000 3

Questo 33
A tabela abaixo apresenta algumas propriedades de trs substncias inorgnicas binrias.

Em condies normais, podemos concluir que as substncias I, II e III se apresentam, respectivamente, nos seguintes estados fsicos: (A) slido, slido, lquido (B) slido, lquido, slido (C) lquido, lquido, slido (D) lquido, slido, lquido

2o Exame de Qualificao | Vestibular Estadual 2003

23

218

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Considere a tabela abaixo para responder s questes de nmeros 34 e 35.

Questo 34
O poder calorfico de um combustvel pode ser definido como o calor produzido na queima por unidade de massa. Dentre os combustveis apresentados, aquele que possui o maior poder calorfico : (A) etino (B) etano (C) eteno (D) metano

Questo 35
Um experimento consiste na combusto completa de 1 mol de cada um dos combustveis relacionados na tabela acima, utilizando 4 cmaras de combusto idnticas ilustrada, uma para cada um dos combustveis. Observe que um pisto mantm a presso constante em 1 atm na cmara de combusto.

Inicialmente, temperatura de 25C, cada combustvel, no estado gasoso, colocado numa cmara juntamente com a quantidade estequiomtrica de oxignio adequada reao. Terminada a combusto, a cmara resfriada at 25C e verifica-se a presena, apenas, de anidrido carbnico e de um volume desprezvel de gua no estado lquido. As alturas inicial e final do pisto so diferentes em cada cmara. Considerando o comportamento ideal dos gases, a cmara onde o pisto realizou o maior trabalho continha o seguinte combustvel: (A) etino (B) etano (C) eteno (D) metano

24

2o Exame de Qualificao | Vestibular Estadual 2003

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

219

Questo 36
Num experimento sobre absoro intestinal foi utilizado o seguinte procedimento:

fechar um pedao de ala intestinal em uma das extremidades, formando um saco; virar o saco, expondo a mucosa para o lado externo; colocar soluo salina no interior do saco; mergulh-lo, parcialmente, numa soluo salina idntica, porm acrescida de glicose; medir, em funo do tempo, a variao da concentrao da glicose na soluo externa, mantendo as condies adequadas; da cadeia respiratria mitocondrial.

- adicionar, em um determinado momento T, soluo externa, cianeto de sdio, um forte inibidor


O resultado deste experimento est representado por uma das curvas do grfico abaixo.

A curva que representa as variaes da concentrao de glicose na soluo em que o saco foi mergulhado a de nmero: (A) 1 (B) 2 (C) 3 (D) 4

Questo 37
Numa certa regio ocenica, os nveis de mercrio na gua e nos peixes so, respectivamente, de 0,05 e 200 ppb. Sabe-se que 1 ppb corresponde a 1 mg por tonelada. Comparando-se pesos iguais de peixes e de gua, o fator que expressa a relao entre as massas de mercrio nos peixes e na gua, : (A) 4,0 103 (B) 2,5 104 (C) 2,5 103 (D) 4,0 104

2o Exame de Qualificao | Vestibular Estadual 2003

25

220

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 38
Quatro frascos I, II, III e IV contm oxignio molecular nas condies normais. A quantidade de substncia contida em cada um est representada nos rtulos transcritos abaixo:

O frasco que contm o maior nmero de tomos de oxignio o de nmero: (A) I (B) II (C) III (D) IV

Questo 39
Mediu-se a concentrao do on clcio no interior do retculo sarcoplasmtico e no sarcoplasma de clulas de msculo esqueltico, adequadamente preparado e submetido a pulsos de estmulo contrtil. Parte dos resultados obtidos esto mostrados no grfico abaixo.

O msculo testado est sob contrao mxima no seguinte intervalo de tempo: (A) T1 T3 (B) T3 T5 (C) T6 T8 (D) T9 T11

26

2o Exame de Qualificao | Vestibular Estadual 2003

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

221

Questo 40
O grfico abaixo representa a variao da velocidade v em relao ao tempo t de dois mveis A e B, que partem da mesma origem.

A distncia, em metros, entre os mveis, no instante em que eles alcanam a mesma velocidade, igual a: (A) 5 (B) 10 (C) 15 (D) 20

Questo 4 1 41
Considere que um vulo de abelha possui 5 1014 g de DNA. Nesse inseto, embora as fmeas se originem de reproduo sexuada, os machos originam-se de vulos no-fecundados, por partenognese. A quantidade de DNA encontrada em uma clula somtica de zango, no perodo correspondente prfase da mitose , em mg, igual a: (A) 1,0 1010 (B) 2,5 109 (C) 5,0 1011 (D) 5,0 1017

Questo 42
A ptialina uma enzima digestiva secretada por glndulas salivares. No entanto, muitas pessoas no a produzem e no tm problemas na digesto de alimentos. Isso explicado porque um dos sucos digestivos contm uma enzima similar. O nome desse suco digestivo e de sua enzima, similar ptialina, esto indicados em: (A) salivar tripsina (B) entrico lipase (C) gstrico pepsina (D) pancretico amilase

2o Exame de Qualificao | Vestibular Estadual 2003

27

222

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Considere o esquema do circuito de Interlagos abaixo para responder s questes de nmeros 43 e 44.

(Adaptado de O Globo, 31/03/2002)

Questo 43
A velocidade vetorial mdia de um carro de Frmula 1, em uma volta completa do circuito, corresponde a: (A) 0

(B) 24 (C) 191 (D) 240

Questo 44
Suponha constante a desacelerao de um dos carros no trecho retilneo entre as curvas Laranja e Laranjinha, nas quais ele atinge, respectivamente, as velocidades de 180 km/h e 150 km/h. O tempo decorrido entre as duas medidas de velocidade foi de 3 segundos. O mdulo da desacelerao, em m/s2, equivale, aproximadamente, a: (A) 0 (B) 1,4 (C) 2,8 (D) 10,0

28

2o Exame de Qualificao | Vestibular Estadual 2003

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

223

Questo 45
Cometer erros a chave para o progresso. H momentos em que importante no cometer erro algum pergunte a qualquer cirurgio ou piloto de avio. No entanto (...) os erros no so apenas oportunidades valiosas para aprendermos; eles so, de forma significativa, a nica oportunidade para aprendermos algo relativamente novo. (...) A evoluo biolgica se d atravs de uma grande e inexorvel seqncia de tentativas e erros e sem os erros as tentativas no teriam levado a nada.
(Adaptado de DENNETT, Daniel C. In: BROCKMAN, J. e MATSON K. (Org.). As coisas so assim. So Paulo: Cia. das Letras, 1997.)

O processo que se relaciona com o conceito de evoluo biolgica apresentado pelo autor : (A) reparao das leses gnicas (B) induo de mutaes programadas (C) gerao de organismos transgnicos (D) alterao aleatria na estrutura do DNA

Questo 46
Certa vez uma criana se perdeu. Como fazia frio, decidiu procurar material para atear fogo. medida que ia trazendo objetos para sua fogueira, observava que alguns queimavam e outros no. Comeou, ento, a fazer a lista abaixo, relacionando os que queimavam e os que no queimavam. Depois de algumas viagens, sua classificao continha as seguintes informaes: QUEIMAM galhos de rvore cabos de vassoura mastro de bandeira lpis NO QUEIMAM rochas cacos de vidro pedrinhas tijolos

A partir dessa lista, ela tentou encontrar uma regularidade que a guiasse na procura de novos materiais combustveis, chegando seguinte concluso: Todos os objetos cilndricos queimam.
(Adaptado de Chemical Educational Material Study (Org.). Qumica: uma cincia experimental. So Paulo: EDART, 1976.)

Quanto ao mtodo cientfico, o procedimento e o tipo de raciocnio utilizados pela criana, em sua concluso, so exemplos, respectivamente, de: (A) formulao de lei; dedutivo (B) criao de modelo; dedutivo (C) proposio de teoria; indutivo (D) elaborao de hiptese; indutivo

2o Exame de Qualificao | Vestibular Estadual 2003

29

224

CINCIAS HUMANAS E SUAS TECNOLOGIAS

CINCIAS HUMANAS E SUAS TECNOLOGIAS Questo 47

(Nosso Sculo. So Paulo: Abril Cultural, 1980.)

A charge de Ziraldo relaciona o autoritarismo ao nacionalismo caracterstico dos governos militares brasileiros, porque faz a seguinte denncia: (A) a palavra de ordem seguia uma diretriz de patriotismo obrigatrio (B) o nacionalismo militarista supunha a negao da explorao capitalista (C) o abandono do pas significava a manuteno de f no futuro da nao (D) o autoritarismo tinha um respaldo inegvel dos diversos segmentos sociais

Questo 48
GERAO COCA-COLA
Quando nascemos fomos programados A receber o que vocs nos empurraram Com os enlatados dos USA, de 9 s 6. Desde pequenos ns comemos lixo Comercial e industrial Mas agora chegou nossa vez Vamos cuspir de volta o lixo em cima de vocs. Somos os filhos da revoluo Somos burgueses sem religio Somos o futuro da nao Gerao Coca-Cola. Depois de vinte anos na escola No difcil aprender Todas as manhas do jogo sujo No assim que tem que ser? Vamos fazer nosso dever de casa E a ento, vocs vo ver Suas crianas derrubando reis Fazer comdia no cinema com as suas leis.

(Renato Russo)

O ttulo e a letra da cano expressam a insatisfao e a viso crtica de parte da juventude brasileira da dcada de 1980, em relao a padres de comportamento dominantes na sociedade. Dois problemas caractersticos da juventude dessa dcada, que esto identificados na letra e que melhor justificam o rtulo gerao coca-cola, so: (A) decadncia moral rgido controle social (B) pobreza econmica limitaes culturais (C) alienao cultural insatisfao poltica (D) nacionalismo musical falta de acesso escola

30

2o Exame de Qualificao | Vestibular Estadual 2003

CINCIAS HUMANAS E SUAS TECNOLOGIAS

225

Questo 49

(STORNI, 1927. In: LEMOS, Renato. Uma histria do Brasil atravs da caricatura. Rio de Janeiro: Bom Texto, Letras e Expresses, 2001.)

A dominao dos grandes proprietrios rurais durante a Repblica Velha deu origem expresso popular voto de cabresto, mecanismo eleitoral que resulta de: (A) influncia poltica das oligarquias regionais (B) adaptao do campesinato realidade do mundo urbano (C) inconformismo do eleitor nas pequenas cidades do interior (D) submisso dos trabalhadores rurais aos valores soberanos das cidades

Questo 50
Bzios est venda e a leva quem der mais ao correr do martelo. A favelizao tomou conta do bairro Cem Braas, na entrada da cidade, as barracas de lona se espalham pelo bairro da Rasa, a Serra das Emergncias est sendo invadida por posseiros.
(Jornal do Brasil, 12/05/2002)

Esse cenrio de crise urbana parece indicar que os graves problemas sociais no se limitam mais s metrpoles brasileiras. O caso de Bzios, que uma cidade turstica e de veraneio, possui inmeras semelhanas com o de qualquer grande cidade. Duas semelhanas entre Bzios e uma grande cidade brasileira esto apontadas na seguinte alternativa: (A) restrio legal do espao edificvel investimentos em loteamentos populares (B) chegada crescente de migrantes polticas municipais de estmulo ao xodo rural (C) mercantilizao do solo urbano segregao dos menos favorecidos em reas desvalorizadas (D) ocupao agrcola desordenada aglomerao da populao de baixa renda na orla martima

2o Exame de Qualificao | Vestibular Estadual 2003

31

226

CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 5 1 51
ENTREVIST A COM X., DE 17 ANOS ENTREVISTA

Voc no pensa que pode morrer ou no ver seu filho crescer? No penso no amanh. Hoje eu posso usar um cordo, um relgio e dar uma moral ao meu filho. Quanto voc ganha por ms? (...) Garanto que bem mais do que se eu estivesse ralando das 8h s 17h, a troco de uma cesta bsica. J pensou em ter profisso? Quando eu era menor queria ser da Aeronutica. O que eu quero agora ser um gerente de trfico. o meu sonho. Sou respeitado aqui, carrego uma pistola 45 na cintura. L fora [da favela] no sou nada. Virar trabalhador para ser esculachado? Jamais!
(Adaptado de O Globo, 22/04/2002)

O entrevistado estabelece uma oposio entre o que imagina ser a vida de um trabalhador regular e as vantagens que obtm atuando na ilegalidade. Faz parte dessa oposio a sua referncia ao mundo l fora, onde ele no seria nada. Esses dois mundos, apontados na entrevista, que coexistem na cidade do Rio de Janeiro, podem ser explicados, historicamente, por uma srie de processos, tais como: (A) descentralizao das desigualdades sociais no espao da cidade privatizao indiscriminada das empresas estatais, como no setor agrcola consumismo acentuado das elites (B) esvaziamento de investimentos governamentais nas reas ocupadas pelas camadas mdias degradao de servios pblicos, como o de sade diminuio da concentrao de renda (C) decadncia das polticas de desenvolvimento na rea central da metrpole reduo da presena do Estado em reas carentes, como as favelas eliminao de investimentos para o transporte pblico (D) desigualdade na distribuio espacial das benfeitorias urbanas pelo poder pblico crise aguda dos servios pblicos associados ascenso social, como o da educao queda geral do nvel salarial

Questo 52
A estratgia do milagre econmico, no Brasil do incio da dcada de 1970, buscava conter os nimos da oposio, atravs da diminuio do desemprego e da exaltao patritica. Essa estratgia motivou, dentre outras, a seguinte poltica: (A) ao no setor de servios, com a diminuio de impostos e o aumento na oferta de bens durveis (B) ocupao da Amaznia, com a construo da rodovia Transamaznica e a propaganda da integrao nacional (C) valorizao das atividades administrativas, com a adoo dos concursos pblicos e o estmulo organizao sindical (D) criao de incentivos fiscais para a agricultura, com a absoro do homem do campo e o desenvolvimento de novas atividades primrias

32

2o Exame de Qualificao | Vestibular Estadual 2003

CINCIAS HUMANAS E SUAS TECNOLOGIAS

227

Questo 53
BRASIL PERDE JOVENS P ARA MERCADO EXTERNO PARA
O mercado de trabalho brasileiro est perdendo grande fatia de jovens com boa escolaridade e que poderiam se tornar profissionais qualificados. So pessoas de 15 a 24 anos que esto deixando o Pas em busca de novas oportunidades e experincias profissionais. Na dcada de 90, cerca de 1,3 milho de jovens cruzaram as fronteiras brasileiras em busca de chances de melhorar o rendimento. Talvez, nunca mais voltem. (...)
(Adaptado de O Estado de Minas, 07/05/2002)

UM DE CADA CINCO ARGENTINOS PENSA EM IR-SE DO P AS PAS


Uma pesquisa revela que na capital e Grande Buenos Aires 22% das pessoas pensam em emigrar. A maior parte quer ir para a Espanha e os EUA. (...) Os mais propensos so os menores de 35 anos, os desempregados e as pessoas com bom nvel de instruo.
(Adaptado do jornal argentino Pgina 12, 17/05/2002)

A alternativa que contm a melhor explicao para esse processo de emigrao : (A) fracasso das polticas agrria e industrial para as classes camponesas (B) ausncia de metas econmicas e educacionais para os setores populares (C) indefinio da identidade cultural e poltica dos segmentos da alta burguesia (D) frustrao das expectativas de emprego e de ascenso social das camadas mdias urbanas

Questo 54
O mais novo dos imprios e a nica monarquia do Novo Mundo, to ricamente contemplado com belezas naturais e riquezas materiais ainda enterradas em seu seio, to esplndido em posio geogrfica (...) parece ser o filho predileto da Fortuna. (...) Agricultores de primeira categoria parecem inclinados a vir para um pas onde uma rea igual de terreno produz trs vezes mais do que na Luisiana. (...) Comeou, assim, um acentuado influxo de homens trabalhadores e diligentes, acostumados a utilizar maquinaria agrcola e formando, em cada colnia, um ncleo, em torno do qual podem fixar-se agricultores europeus.
(BURTON, Richard. Viagem do Rio de Janeiro a Morro Velho. So Paulo: Itatiaia / EDUSP, 1976.)

O naturalista e explorador ingls Richard Burton esteve no Brasil durante a dcada de 1860. Aps percorrer o interior do pas, produziu uma narrativa sobre o que observou, fazendo sugestes para o progresso nacional. Pelo que se diz no texto, no que se refere s relaes entre natureza e populao, Burton avaliava as potencialidades da economia como boas, desde que se criasse a seguinte condio: (A) o trabalho agrcola fosse financiado pelas elites nacionais e estrangeiras (B) a posio geogrfica e a fertilidade da terra permitissem a fixao de imigrantes (C) a natureza generosa fosse trabalhada por mo-de-obra produtiva e qualificada (D) os recursos existentes fossem utilizados para o desenvolvimento do setor urbano e industrial

2o Exame de Qualificao | Vestibular Estadual 2003

33

228

CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 55

(Adaptado de Jornal do Brasil, 28/03/2002)

O grfico indica a variao do desemprego, durante o perodo assinalado, e estabelece uma relao entre a dinmica do desemprego na Regio Metropolitana de So Paulo e os atentados terroristas de setembro nos EUA. Isso sugere uma possvel relao entre os dois processos, num contexto de economia globalizada. Os EUA tm enorme influncia econmica no restante do mundo, fundamentalmente, porque: (A) exportam armas e veculos de guerra para os pases perifricos (B) importam bens manufaturados das reas metropolitanas do Hemisfrio Sul (C) centralizam parte significativa do comrcio e dos fluxos de capital no mundo (D) distribuem ajuda humanitria para as economias emergentes do Terceiro Mundo

Questo 56
O sertanejo , antes de tudo, um forte. No tem o raquitismo exaustivo dos mestios neurastnicos do litoral. (...) A seca no o apavora. um complemento sua vida tormentosa, emoldurando-a em cenrios tremendos.
(CUNHA, Euclides. Os Sertes. So Paulo: Ateli Editorial, 2001.)

Essa avaliao de Euclides da Cunha, em 1902, sugere um contraste entre o habitante do serto e o do litoral. Pode-se dizer que as caractersticas prprias do sertanejo so apresentadas, no texto, como: (A) energia intelectual capacidade de controle do clima (B) resistncia fsica superao da adversidade natural (C) isolamento cultural adaptao vegetao regional (D) superioridade racial flexibilidade nas respostas ao meio

34

2o Exame de Qualificao | Vestibular Estadual 2003

CINCIAS HUMANAS E SUAS TECNOLOGIAS

229

Questo 57
Varre, varre, varre, varre, vassourinha. Varre, varre a bandalheira, Que o povo j est cansado De sofrer desta maneira. Jnio Quadros a esperana deste povo abandonado.
(Nosso Sculo. So Paulo: Abril Cultural, 1980.)

Esse jingle acompanhou o candidato Jnio Quadros durante a sua campanha presidncia da Repblica, em 1960. A letra sintetiza a seguinte poltica de resoluo dos problemas da poca: (A) a austeridade do governo e o controle dos gastos pblicos conteriam a inflao e a corrupo oficial (B) a disputa de mercados externos e a ideologia nacionalista aumentariam o supervit comercial e a gerao de renda (C) o atendimento economia popular e produo de alimentos baixariam o custo de vida e os gastos do governo (D) a defesa dos interesses nacionais e a adoo de uma poltica externa independente gerariam emprego e novas possibilidades econmicas

Questo 58
CUBA J RECEBE OS EUROS DOS TURIST AS TURISTAS
O euro comeou a circular em Varadero, o balnerio turstico mais importante de Cuba, onde a empresa Transtur anunciou que os servios de txi e aluguel de automveis j podem ser pagos com a moeda.
(Gazeta Mercantil, 12/05/2002)

TENSO ENTRE FIDEL E W ASHINGT ON WASHINGT ASHINGTON


A viagem de Jimmy Carter acontece num dos momentos mais tensos das relaes entre EUA e Cuba nos ltimos anos. No dia 6 de maio, durante um pronunciamento em Washington, o subsecretrio de Estado para Controle de Armas e Segurana Nacional americano, John Bolton, incluiu Cuba na lista de pases que apiam o terrorismo.
(Jornal do Brasil, 12/05/2002)

As duas notcias revelam atitudes distintas com relao a Cuba. Do lado da Unio Europia, h a valorizao do turismo e do comrcio; do lado dos EUA, desconfiana e tentativa de controle. A dificuldade dos governos norte-americanos em lidar com o regime cubano decorre do fato de que este tem sido visto como: (A) um plo de fundamentalismo religioso na Amrica Central (B) uma exceo poltica no espao de dominao norte-americana (C) um posto avanado das tecnologias alternativas na regio do Caribe (D) um aliado ideolgico da Unio Europia no contexto latino-americano
2o Exame de Qualificao | Vestibular Estadual 2003

35

230

CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 59
No incio do sculo XX, a produo de ferro e ao era um dos principais elementos da industrializao europia. Todavia, ela no se desenvolveu da mesma forma em todas as partes do continente, como se pode ver abaixo.

(POUNDS, N. J. G.. A historical geography of Europe. New York: Cambridge University Press, 1990.)

Com apoio dos mapas, pode-se afirmar que a predominncia da industrializao, em certas reas, expressa uma combinao entre: (A) clima temperado e crise da produo agrcola (B) proximidade do litoral e centralizao poltica (C) abundncia de matrias-primas e reduzido nvel de urbanizao (D) disponibilidade de recursos energticos e concentrao de capitais

Questo 60
O dia 11 de setembro de 2001 no ser esquecido. Nessa data, o mundo se deu conta da sua fragilidade e de que alguma coisa havia mudado com relao ao sculo XX, no que diz respeito s relaes internacionais. Trata-se de um acontecimento que expressa as modificaes que integram o processo iniciado com o fim dos regimes socialistas do Leste Europeu na passagem da dcada de 1980 para a de 1990. Esse processo pode ser considerado como a transio entre as duas seguintes situaes: (A) polarizao entre dois blocos econmicos, polticos e militares avano da globalizao sob a liderana dos EUA (B) intolerncia religiosa entre pases de origens culturais diferentes crescimento das religies ocidentais em detrimento da cultura oriental (C) coexistncia entre diversos continentes de poderio econmico equivalente acirramento da rivalidade ideolgica entre capitalismo e comunismo (D) integrao entre um mundo exportador de alimentos e um outro produtor de manufaturados isolamento crescente entre os grandes produtores internacionais

36

2o Exame de Qualificao | Vestibular Estadual 2003

CINCIAS HUMANAS E SUAS TECNOLOGIAS

231

Com base no texto abaixo, responda s questes de nmeros 61 e 62.


O FIM DE UMA ERA
Em seu discurso de despedida do Senado, em dezembro de 1994, o presidente Fernando Henrique Cardoso anunciou o fim da Era Vargas, como um prenncio das mudanas que estavam por vir. Supunha-se sepultado um modelo econmico que tinha como principal ator o intervencionismo do Estado, como atrao poltica o paternalismo de cooptao e como modelo social a previdncia pblica e a legislao trabalhista.
(NOGUEIRA, Octaciano. Jornal da Tarde, 11/11/1998.)

Questo 6 1 61
Embora a citao acima apresente a legislao trabalhista de Getlio Vargas como parte de um ultrapassado modelo econmico, possvel apontar aspectos que, no sentido contrrio, revelem o significado da contribuio trazida pela Consolidao das Leis do Trabalho - CLT - para as relaes de trabalho. Um aspecto dessa contribuio est indicado em: (A) manuteno da ao sindical e de direitos trabalhistas durante a ditadura militar (B) estabelecimento da pluralidade sindical e de partidos trabalhistas durante o Estado Novo (C) criao de normas legais para os aumentos salariais reais e do gatilho salarial durante o governo Sarney (D) instituio do estatuto poltico dos trabalhadores e do Tribunal Superior do Trabalho durante o segundo governo Vargas

Questo 62
Uma contraposio entre um ganho da CLT e uma exigncia do empresariado na atualidade est indicada em: (A) medidas de estabilidade no emprego facilidade para dispensa e contratao (B) normas de organizao sindical representao do trabalhador atravs dos partidos polticos (C) regras de estruturao do funcionalismo pblico estabelecimento de um padro trabalhista nico (D) livre negociao das condies de trabalho limitao de jornada de trabalho estipulada em contrato

2o Exame de Qualificao | Vestibular Estadual 2003

37

232

CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 63
Existem dois pases, entre os quais difcil distinguir o verdadeiro; na fazenda do interior, o homem do campo trabalha de enxada e transporta uma colheita insignificante em carroas rangentes (...); na cidade de So Paulo, a cada hora termina-se um prdio.
(LAMBERT, Jacques. Os dois Brasis. So Paulo: Companhia Editora Nacional, 1984.)

MET A DE FAMINT O META FAMINTO


JK Voc agora tem automvel brasileiro, para correr em estradas pavimentadas com asfalto brasileiro, com gasolina brasileira. Que mais quer? JECA Um prato de feijo brasileiro, seu dout!
(THO, 1960. In: LEMOS, Renato. Uma histria do Brasil atravs da caricatura. Rio de Janeiro: Bom Texto, Letras e Expresses, 2001.)

O texto e a charge representam, de formas diferentes, um dos principais dilemas do desenvolvimentismo no governo Juscelino Kubitschek, durante a 2a metade da dcada de 1950. A alternativa que melhor apresenta esse dilema : (A) os contrastes culturais e educacionais entre as elites paulistas e nortistas (B) a desigualdade poltica e ideolgica entre as oligarquias nordestinas e sulistas (C) a defasagem histrica e tecnolgica entre o setor petrolfero e o agroexportador (D) as disparidades econmicas e sociais entre os setores agrrio e urbano-industrial

38

2o Exame de Qualificao | Vestibular Estadual 2003

CINCIAS HUMANAS E SUAS TECNOLOGIAS

233

Questo 64
CANO DO EXLIO
Minha terra tem palmeiras, Onde canta o Sabi; As aves, que aqui gorjeiam, No gorjeiam como l. Nosso cu tem mais estrelas, Nossas vrzeas tm mais flores, Nossos bosques tm mais vida, Nossa vida mais amores. (...)
(Gonalves Dias, 1847)

MARGINLIA 2
(...) Minha terra tem palmeiras Onde sopra o vento forte Da fome, do medo e muito Principalmente da morte (...) Aqui o fim do mundo Aqui o fim do mundo Aqui o fim do mundo
(Torquato Neto e Gilberto Gil, 1967)

Aqui temos duas maneiras distintas de imaginar minha terra Brasil. Cada uma dessas imagens expressa caractersticas da sociedade brasileira associadas aos respectivos contextos histricos. Essas caractersticas so, respectivamente: (A) a idia da nao como resultado da preservao ambiental a ideologia pessimista decorrente da globalizao (B) o elogio da natureza como elemento de construo da nao brasileira a instabilidade social decorrente do subdesenvolvimento (C) o exlio poltico dos intelectuais como negao da nao as desvantagens ecolgicas da nao decorrentes de suas condies naturais (D) a imaturidade dos intelectuais como resultado da dominao monrquica a misria e a fome decorrentes do extrativismo econmico

2o Exame de Qualificao | Vestibular Estadual 2003

39

234

GABARITO OFICIAL - 2 EXAME DE QUALIFICAO

01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16

B D D B C A B C D C A D A B D C

ESPANHOL

17 18 19 20 21 22

D A B A C D

FRANCS

17 18 19 20 21 22

A B B C D A

INGLS

17 18 19 20 21 22

A C B D A B

23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43

A B C A A D C D D B B D B B A B C C A D A

44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64

C D D A C A C D B D C C B A B D A A A D B

235

E X A M E D E Q UA L I F I C A O . 1 7 / 0 8 / 2 0 0 3
Neste caderno voc encontrar um conjunto de 40 (quarenta) pginas numeradas seqencialmente, contendo 64 (sessenta e quatro) questes das seguintes reas: Linguagens, Cdigos e suas Tecnologias; Cincias da Natureza, Matemtica e suas Tecnologias; Cincias Humanas e suas Tecnologias. A tabela peridica encontra-se na ltima pgina. No abra o caderno antes de receber autorizao.

INSTRUES
1. Verifique se o seu nome, nmero de inscrio, nmero do documento de identidade e lngua estrangeira escolhida esto corretos no carto de respostas. Se houver erro, notifique o fiscal. Assine o carto de respostas com caneta. 2. Ao receber autorizao para abrir este caderno, verifique se a impresso, a paginao e a numerao das questes esto corretas. Caso ocorra qualquer erro, notifique o fiscal. 3. As questes de nmeros 17 a 22 da rea de Linguagens, Cdigos e suas Tecnologias devero ser respondidas de acordo com a sua opo de Lngua Estrangeira: Espanhol, Francs ou Ingls. 4. Leia atentamente cada questo e escolha a alternativa que mais adequadamente responde a cada uma delas. Marque sua resposta no carto de respostas, cobrindo fortemente o espao correspondente letra a ser assinalada; utilize caneta preta, preferencialmente, ou lpis preto n 2, conforme o exemplo abaixo:

5. A leitora de marcas no registrar as respostas em que houver falta de nitidez e/ou marcao de mais de uma letra. 6. O carto de respostas no pode ser dobrado, amassado, rasurado ou manchado. Exceto sua assinatura, nada deve ser escrito ou registrado fora dos locais destinados s respostas. 7. Voc dispe de 4 (quatro) horas para fazer esta prova. 8. Ao terminar a prova, entregue ao fiscal o carto de respostas e este caderno.

BO A PRO VA! BOA PROV

236

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS


Com base no texto abaixo, responda s questes de nmeros 01 a 04.
PRECONCEIT O E EXCLUSO PRECONCEITO
01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24

Os preconceitos lingsticos no discurso de quem v nos estrangeirismos uma ameaa tm aspectos comuns a todo tipo de posio purista, mas tm tambm matizes prprios. Tomando a escrita como essncia da linguagem, e tendo diante de si o portugus, lngua de cultura que dispe hoje de uma norma escrita desenvolvida ao longo de vrios sculos, [o purista] quer acreditar que os emprstimos de hoje so mais volumosos ou mais poderosos do que em outros tempos, em que a lngua teria sido mais pura. (...) Ao tomar-se a norma escrita, fcil esquecer que quase tudo que hoje ali est foi inicialmente estrangeiro. Por outro lado, fcil ver nos emprstimos novos, com escrita ainda no padronizada, algo que ainda no nosso. Com um pouco menos de preconceito, s esperar para que esses elementos se sedimentem na lngua, caso permaneam, e que sejam padronizados na escrita, como a panqueca. Afinal, nem tudo termina em pizza! Na viso alarmista de que os estrangeirismos representam um ataque lngua, est pressuposta a noo de que existiria uma lngua pura, nossa, isenta de contaminao estrangeira. No h. Pressuposta tambm est a crena de que os emprstimos poderiam manter intacto o seu carter estrangeiro, de modo que somente quem conhecesse a lngua original poderia compreend-los. Conforme esse raciocnio, o estrangeirismo ameaa a unidade nacional porque emperra a compreenso de quem no conhece a lngua estrangeira. (...) O raciocnio o de que o cidado que usa estrangeirismos ao convidar para uma happy hour, por exemplo estaria excluindo quem no entende ingls, sendo que aqueles que no tiveram a oportunidade de aprender ingls, como a vastssima maioria da populao brasileira, estariam assim excludos do convite. Expandindo o processo, por analogia, para outras tantas situaes de maior conseqncia, o uso de estrangeirismos seria um meio lingstico de excluso social. A instituio financeira banco que oferece home banking estaria excluindo quem no sabe ingls, e a loja que oferece seus produtos numa sale com 25% off estaria fazendo o mesmo. um processo de excluso. O equvoco est em no ver que usamos a linguagem, com ou sem estrangeirismos, o tempo todo, para demarcarmos quem de dentro ou de fora do nosso crculo de interlocuo, de dentro ou de fora dos grupos sociais aos quais queremos nos associar ou dos quais queremos nos diferenciar. (...)
(GARCEZ, Pedro M. e ZILLES, Ana Maria S. In: FARACO, Carlos Alberto (org.). Estrangeirismos - guerras em torno da lngua. So Paulo: Parbola, 2001.)

25 O equvoco desse raciocnio lingisticamente preconceituoso no est em dizer que esse pode ser

Questo 0 1 01
Pode-se afirmar que o objetivo do texto defender uma opinio, a partir do estabelecimento de uma polmica com os que defendem outro ponto de vista. Esta polmica constri-se, nesse texto, pelo seguinte modo de organizao interna: (A) as duas posies so apresentadas por um nico enunciador (B) os argumentos enunciados contrapem os usos oral e escrito da lngua (C) as opinies de cada lado so referendadas por testemunhos autorizados (D) os defensores de cada posio alternam-se na defesa de seu ponto de vista

Exame de Qualificao | Vestibular Estadual 2004

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

237

Questo 0 2 02
Na construo do texto, os autores utilizam alguns recursos de linguagem para se distanciar da posio que eles combatem. Um desses recursos est assinalado e caracterizado em: (A) os emprstimos de hoje so mais volumosos ou mais poderosos do que em outros tempos, (l. 4 - 5) comparao (B) Na viso alarmista de que os estrangeirismos representam um ataque lngua, (l. 12) adjetivao (C) ao convidar para uma happy hour, por exemplo estaria excluindo quem no entende ingls, (l. 18 - 19) citao de exemplo (D) no tiveram a oportunidade de aprender ingls, como a vastssima maioria da populao brasileira, (l. 19 - 20) emprego de superlativo

Questo 03
O equvoco desse raciocnio lingisticamente preconceituoso no est em dizer que esse pode ser um processo de excluso. (l. 25 - 26) O fragmento acima inicia, no ltimo pargrafo, uma estratgia que busca demonstrar uma falha no raciocnio criticado pelos autores. Essa falha pode ser definida como: (A) observao incompleta dos fatos (B) apresentao de falso testemunho (C) construo inadequada de silogismo (D) ausncia de exemplificao suficiente

Questo 04
s esperar para que esses elementos se sedimentem na lngua, caso permaneam, e que sejam padronizados na escrita, como a panqueca. Afinal, nem tudo termina em pizza! (l. 9 - 11) No contexto do segundo pargrafo, o trecho acima desempenha a funo de: (A) reafirmar a certeza j apresentada de que as questes da linguagem devem ser tratadas com a devida objetividade (B) exemplificar o comentrio contido nas frases anteriores ao mesmo tempo em que ironiza a preocupao dos puristas (C) registrar estrangeirismos cuja grafia comprova que h necessidade de adaptao de novos termos s convenes do portugus (D) demonstrar o argumento central de que no podemos abrir mo dos estrangeirismos e frases feitas na comunicao corrente

Exame de Qualificao | Vestibular Estadual 2004

238

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Com base no texto abaixo, responda s questes de nmeros 05 a 09.


SALA DE ESPERA
01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22

(Ah, os rostos sentados numa sala de espera. Um Dirio Oficial sobre a mesa. Uma jarra com flores. A xcara de caf, que o contnuo vem, amvel, servir aos que esperam a audincia marcada. Os retratos em cor, na parede, dos homens ilustres que exerceram, j em remotas pocas, o manso ofcio de fazer esperar com esperana. E uma resposta, que ser sempre a mesma: s amanh. E os quase eternos amanhs daqueles rostos sempre adiados e sentados numa sala de espera.) Mas eu prefiro a rua. A rua em seu sentido usual de l fora. Em seu oceano que ter bocas e ps para exigir e para caminhar. A rua onde todos se renem num s ningum coletivo. Rua do homem como deve ser: transeunte, republicano, universal.

23 Onde cada um de ns um pouco mais dos outros 24 do que de si mesmo. 25 Rua da procisso, do comcio,

do desastre, do enterro. Rua da reivindicao social, onde mora o Acontecimento. A rua! uma aula de esperana ao ar livre.
(RICARDO, Cassiano. Antologia Potica. Rio de Janeiro: Editora do Autor, 1964.)

Questo 05
sentados numa sala de espera. O emprego repetido dessa cena no incio e no trmino da caracterizao da sala de espera contribui para a construo do sentido do texto porque: (A) refora a idia de confinamento oposta liberdade da rua (B) confirma uma alternncia entre o espao individual e o coletivo (C) sugere atitudes banais reproduzidas em diversos espaos pblicos (D) expressa uma perspectiva de mudana ligada ao movimento social

Exame de Qualificao | Vestibular Estadual 2004

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

239

Questo 06
O poema divisvel em dois segmentos cujos temas so a sala e a rua. Considerando o sentido geral do texto, o contraste entre esses ambientes definido por: (A) elite x povo (B) ordem x caos (C) passado x futuro (D) passividade x participao

Questo 0 7 07
A construo potica do discurso baseia-se freqentemente na utilizao de figuras de linguagem, como a metonmia. O poeta recorreu a esta figura em: (A) Ah, os rostos sentados (v. 1) (B) Os retratos em cor, na parede, (v. 7) (C) que exerceram (...) o manso ofcio (v. 9 - 10) (D) de fazer esperar com esperana. (v. 11)

Questo 08
Algumas partes do texto so apresentadas abaixo seguidas de variantes. A alternativa em que a variao alterou o sentido da forma original : (A) A xcara de caf, que o contnuo vem, amvel, servir A xcara de caf, que o amvel contnuo vem servir (B) dos homens ilustres que exerceram, j em remotas pocas, o manso ofcio dos homens ilustres que exerceram o manso ofcio j em pocas remotas (C) Mas eu prefiro a rua. O que eu prefiro, porm, a rua. (D) A rua onde todos se renem num s ningum coletivo. A rua em que todos se renem num s ningum coletivo.

Questo 09
E uma resposta, que ser sempre a mesma: s amanh. (v. 12) O emprego do futuro do presente - ser - assume, nesse verso, um valor expressivo que se encontra devidamente explicado na seguinte alternativa: (A) garantir, com a ajuda do advrbio amanh, a ocorrncia futura da resposta (B) enfatizar, articulado com o advrbio sempre, uma convico do enunciador (C) expressar, com o reforo do predicativo a mesma, uma experincia pessoal do poeta (D) antecipar, coerentemente com o verso 11, a aluso ao substantivo esperana no final do poema
Exame de Qualificao | Vestibular Estadual 2004

240

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Com base no texto abaixo, responda s questes de nmeros 10 a 12.


J se sentiu vtima de algum tipo de marginalizao e/ou discriminao dentro de sua universidade?

05 06 07 08 09 10

Infelizmente, devo dizer que sim. No se trata de discriminao ou marginalizao pelo fato de ser brasileiro, porm. Trata-se de uma dificuldade (talvez natural) que tem um novo imigrante em penetrar na elite da sociedade local, que controla as posies de poder. Essa elite constituda por pessoas que estudaram juntas na escola, que fizeram o servio militar juntas, que pertencem ao mesmo partido poltico etc. e que se apiam mutuamente. Tive a oportunidade de sentir esse tipo de hostilidade quando fui eleito diretor da Faculdade de Cincias Humanas. Cheguei mesmo a ouvir expresses como a mfia latino-americana em nossa faculdade, quando somos nada mais que dois professores titulares de procedncia latino-americana. Mas, verdade seja dita, trata-se de uma hostilidade proveniente dos que estavam habituados ao poder e no se conformavam em perd-lo. A maioria no s me elegeu, mas tambm me apoiou e continua apoiando as reformas que institu em minha gesto.
(DASCAL, Marcelo. Entrevista publicada no caderno Mais / Folha de S. Paulo, 18/05/2003.)

Questo 1 0 10
A expresso mfia latino-americana em nossa faculdade mostrada, no texto, como representao do pensamento da elite local. Para atacar o uso de tal expresso na referncia aos latino-americanos, o entrevistado recorre ao seguinte procedimento: (A) valoriza a origem social do corpo docente titular (B) denuncia o emprego de um termo segregacionista (C) defende a pluralidade democrtica na universidade (D) destaca a insuficincia do nmero de professores estrangeiros

Questo 1 1 11
Certos substantivos participam do processo de coeso textual quando recuperam alguma informao ou conceito j enunciado. O termo do texto que tem esta funo : (A) sociedade (l. 4) (B) oportunidade (l. 6) (C) hostilidade (l. 7) (D) gesto (l. 12)

Questo 12
Infelizmente, devo dizer que sim. (l. 2) O advrbio infelizmente, na resposta do entrevistado, exprime um ponto de vista ou julgamento a respeito dos fatos relatados. A alternativa cujo elemento sublinhado desempenha essa mesma funo : (A) J se sentiu vtima de algum tipo de marginalizao (...)? (l. 1) (B) que pertencem ao mesmo partido poltico etc. e que se apiam mutuamente. (l. 5 - 6) (C) Mas, verdade seja dita, trata-se de uma hostilidade (l. 9 - 10) (D) e continua apoiando as reformas que institu em minha gesto. (l. 11 - 12)

Exame de Qualificao | Vestibular Estadual 2004

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

241

Com base no texto abaixo, responda s questes de nmeros 13 a 16.


RECORDAES DO ESCRIVO ISAAS CAMINHA A minha situao no Rio estava garantida. Obteria um emprego. Um dia pelos outros iria s aulas, e todo o fim de ano, durante seis, faria os exames, ao fim dos quais seria doutor! Ah! Seria doutor! Resgataria o pecado original do meu nascimento humilde, amaciaria o suplcio premente, cruciante e onmodo1 de minha cor... Nas dobras do pergaminho da carta, traria presa a 05 considerao de toda a gente. Seguro do respeito minha majestade de homem, andaria com ela 06 mais firme pela vida em fora. No titubearia, no hesitaria, livremente poderia falar, dizer bem alto 07 os pensamentos que se estorciam2 no meu crebro.
08 O flanco, que a minha pessoa, na batalha da vida, oferecia logo aos ataques dos bons e dos maus, 09 ficaria mascarado, disfarado... 10 11 12 13 14 15

Ah! Doutor! Doutor!... Era mgico o ttulo, tinha poderes e alcances mltiplos, vrios polifrmicos... Era um pallium3, era alguma cousa como clmide4 sagrada, tecida com um fio tnue e quase impondervel, mas a cujo encontro os elementos, os maus olhares, os exorcismos se quebravam. De posse dela, as gotas da chuva afastar-se-iam transidas5 do meu corpo, no se animariam a tocar-me nas roupas, no calado sequer. O invisvel distribuidor de raios solares escolheria os mais meigos para me aquecer, e gastaria os fortes, os inexorveis6, com o comum dos homens que no doutor. Oh! Ser formado, de anel no dedo, sobrecasaca e cartola, inflado7 e grosso, como um sapo-entanha antes de ferir a martelada beira do brejo; andar assim pelas ruas, pelas praas, pelas estradas, pelas salas, recebendo cumprimentos: Doutor, como passou? Como est, doutor? Era sobre-humano!...
(BARRETO, Lima. In: VASCONCELOS, Eliane (org.). Prosa seleta . Rio de Janeiro: Nova Aguilar, 2001.)

1 2 3 4

de todos os modos, irrestrito agitavam manto, capa manto

5 6 7

assustadas inflexveis vaidoso

Questo 13
O discurso do personagem-narrador manifesta uma nsia de reconhecimento social expressa em detalhes ou em pequenos objetos. Um exemplo desse procedimento narrativo est em: (A) faria os exames, ao fim dos quais seria doutor! (l. 2) (B) Nas dobras do pergaminho da carta, traria presa a considerao de toda a gente. (l. 4 - 5) (C) Era mgico o ttulo, tinha poderes e alcances mltiplos, vrios polifrmicos... (l. 10) (D) era alguma cousa como clmide sagrada, (l.11)

Exame de Qualificao | Vestibular Estadual 2004

242

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 14
O entusiasmo do personagem com o sonho de obter o ttulo de doutor construdo por um discurso em primeira pessoa marcadamente emotivo. Essa emotividade do discurso do personagem realada pelo uso de recursos, tais como: (A) estilo indireto e formas de negao (B) registro informal e perguntas retricas (C) discurso repetitivo e inverses sintticas (D) pontuao exclamativa e expresses interjetivas

Questo 15
A matria narrada neste texto no representada como um fato, mas como um projeto. O recurso lingstico que caracteriza essa representao o emprego de: (A) vocbulos cultos e raros (B) reticncias na maioria dos pargrafos (C) formas verbais no futuro do pretrito (D) metforas relativas ao objeto de desejo

Questo 16
A realidade social compe a obra literria sob diversas formas. No texto de Lima Barreto, o ponto de vista do autor acerca dos efeitos da excluso social revela-se por meio do seguinte procedimento narrativo: (A) construo simblica de problemas existenciais do personagem-narrador (B) descrio pormenorizada das contradies do sistema de ensino pelo narrador (C) representao caricatural das esperanas de um personagem de origem humilde (D) referncia metafrica s dificuldades de integrao entre personagens de classes distintas

Exame de Qualificao | Vestibular Estadual 2004

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | ESPANHOL

243

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

ANHOL | ESP ESPANHOL

Com base no texto abaixo, responda s questes de nmeros 17 a 20.

LA OBRA DE ARTE PBLICO De qu manera podemos contribuir a encontrar un balance entre el rol creativo de aqullos que envan mensajes con aqullos que los recibimos e interpretamos? El Primer Congreso Nacional de Arte Pblico trat de interesarnos y hacernos participar en el futuro del arte pblico y las estrategias inmediatas que a mediano plazo nos permitan mejorar tica y estticamente este asentamiento 05 esquizoide que llamamos Managua; definido hasta ahora por su paisaje devastado y los antivalores 06 de agresividad, calor, basura, burocracia y descomposicin social.
07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27

En ese sentido, esta reflexin intenta contribuir a la comprensin del lugar del arte en una sociedad plural y democrtica que est tratando de ampliar las definiciones de sus constituyentes ciudadanos y ciudadanas de todo gnero, creencia, color, y tamao. No podemos presumir que sabemos lo que el pblico quiere. Tenemos que establecer con los diferentes actores que conforman el pblico un dilogo en donde se aborden temas y preocupaciones especficas. (...) Como espectadores y espectadoras somos una audiencia involuntaria que tiene como primer marco de referencia el contexto de la vida cotidiana. Compartimos un modo de vida y tratamos de descubrir o inventar smbolos para la realidad de nuestras vidas. Esos smbolos estn especialmente en nuestras artes, mensajes que intercambiamos entre nosotros acerca de la vida, la verdad, la imaginacin, y todo lo que queremos compartir. (...) Como conciencia crtica y fuerza creadora nos corresponde construir redes y fortalecer la relacin horizontal entre el pblico que somos, los creadores, artistas y especialistas que nos permitan trabajar coherentemente para darle carcter e institucionalidad a la gestin y produccin cultural de nuestro pas y participar crtica y propositivamente en la investigacin de nuestra realidad y diversidad cultural. El arte pblico ha cambiado tanto en forma como en funcin. Ya no es ms un discreto objeto de arte, empez a abordar las condiciones de ambiente urbano y las preocupaciones del pblico que lo habita. Ciertamente el arte pblico es una manifestacin de actividades artsticas, funcionales y estratgicas que toman las ideas del pblico y responden a las expectativas y necesidades de ese pblico como su gnesis y tema de anlisis. Es pblico por el tipo de preguntas que hace o responde y no slo por su accesibilidad o volumen de espectadores.

28 Sera un error tratar de ver el arte pblico como una creacin meramente esttica abstrada de 29 todos los juicios. Hay que entender el simbolismo, el contexto social y los efectos que provocan en 30 aquellos que participan en su creacin y en quienes lo captan. Nuevas ideas acerca de la naturaleza

de los espacios pblicos y el pblico que los habita conducen a diferentes desarrollos que buscan alcanzar una mayor democratizacin del arte.
MARICELA KAUFFMANN http://www-ni.laprensa.com.ni

Exame de Qualificao | Vestibular Estadual 2004

244

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | ESPANHOL

Questo 17
El autor inicia el texto con una pregunta. Respecto al lector, ese recurso establece un sentido de: (A) solicitar una explicacin (B) proponer una reconciliacin (C) justificar su desconocimiento (D) compartir su cuestionamiento

Questo 18
A lo largo del texto, se observa que el enunciador ora se aproxima del pblico del arte, ora se aleja de l. El fragmento que comprueba tal alejamiento es: (A) (...) encontrar un balance entre (...) aqullos que envan mensajes con aqullos que los recibimos e interpretamos? (l. 1 - 2) (B) No podemos presumir que sabemos lo que el pblico quiere. (l. 9 - 10) (C) Como espectadores y espectadoras somos una audiencia involuntaria (l. 12) (D) darle carcter e institucionalidad a la gestin y produccin cultural de nuestro pas y participar (l. 19 - 20)

Questo 19
En ese sentido, esta reflexin intenta contribuir a la comprensin del lugar del arte en una sociedad plural y democrtica que est tratando de ampliar las definiciones de sus constituyentes ciudadanos y ciudadanas de todo gnero, creencia, color, y tamao. (l. 7 - 9) El fragmento aclara el objetivo del texto. El fundamento principal de este objetivo est expuesto en la siguiente afirmativa: (A) Los habitantes deben buscar ultrapasar prejuicios. (B) Las personas han de desconsiderar a las minoras raciales. (C) La gente necesita descubrir otros objetivos para su accin. (D) Los ciudadanos tienen que encargarse de la divulgacin del arte.

Questo 20
Se puede considerar que lo que motiv la escritura del texto ha sido: (A) el inters del lector sobre arte pblico (B) la dificultad de delimitacin del asunto (C) la realizacin de un congreso sobre el tema (D) la exposicin de soluciones para un problema

10

Exame de Qualificao | Vestibular Estadual 2004

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | ESPANHOL

245

Com base na imagem e no texto abaixo, responda s questes de nmeros 21 e 22.


Mural de Hector Ponce, http://www.sparcmurals.org

EL MURALISMO LA TINOAMERICANO LATINOAMERICANO El muralismo, el ms antiguo en la expresin del hombre, siempre busc dialogar reteniendo pasajes histricos, relatando fbulas, reviviendo hechos y fantasas para cuestionar y confrontar los pensamientos y los sentidos. Los maestros muralistas estaban convencidos que la principal funcin del muralismo no era decorativa, sino comunicacional. (...) Los muralistas entienden que los problemas de las naciones giran alrededor de la invasin de las culturas dominantes y del exacerbado individualismo que llev al artista a perder el compromiso con el pueblo y a dedicarse a hacer arte para el mercado o para pequeos grupos de entendidos. Un arte pblico y social como el muralismo rescata los valores nacionales, crea conciencia de grupo y proyecta un compromiso de nacin para construir entre todos. Esto se comprueba con el surgimiento de grupos muralistas donde no existe un lder determinado, sino que las obras son realizadas colectivamente (...).
DEL VITTO CRISTIAN http://www.minotaurodigital.net

Questo 2 1 21
El Sub-comandante Marcos y Emiliano Zapata son los dos lderes mexicanos de movimientos populares que se ve en el mural presentado en la foto. El fragmento del texto que justifica el origen de esa clase de pintura es: (A) El muralismo (...) siempre busc dialogar reteniendo pasajes histricos, relatando fbulas, reviviendo hechos y fantasas (B) Los muralistas entienden que los problemas de las naciones giran alrededor de la invasin de las culturas dominantes (C) del exacerbado individualismo que llev al artista a perder el compromiso con el pueblo y a dedicarse a hacer arte para el mercado (D) el surgimiento de grupos muralistas donde no existe un lder determinado,

Questo 22
Segn el texto, se puede comprender la funcin principal del arte muralista como la de: (A) representar el arte oficial (B) borrar la historia de una nacin (C) expresar la visn de un individuo (D) apoyar un sentimiento de grupo
Exame de Qualificao | Vestibular Estadual 2004

11

246

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | INGLS

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

| INGLS

Com base no texto abaixo, responda s questes de nmeros 17 a 20.

THE ROLE OF THE ARTS IN PROMO TING SOCIAL INCLUSION PROMOTING 1948 Declaration of Human Rights: Everyone has the right freely to participate in the cultural life of the community, to enjoy the arts Members of the National Campaign for the Arts (NCA) have been working in the arts to combat the effects of unemployment, racial tension, family breakdown, crime, poor housing and many of the other issues that lead individuals and groups to feel excluded from the mainstream of society. Access to art works and productions, as well researched reports indicate, promotes a decrease in
05 social isolation through personal growth, enhanced personal confidence and improved social contacts. 06 Exposure to the arts also contributes to greater understanding of different cultures and a stronger 07 sense of community identity. 08 In addition, participation in arts projects encourages a deeper appreciation of the arts and a more 09 informed understanding of diverse cultural perspectives. 10 11 12 13 14 15

However, while innovative projects are being undertaken across the country, arts advocates face a number of difficulties. The arts are perceived by a significant proportion of the general public and non-arts organisations to be elitist, having little relevance to the everyday lives of people today. Partnerships are also difficult to establish owing to general misconceptions about the relevance of the arts to social regeneration projects. Finally, funding for arts projects is frequently short-term. This imposes severe limitations on the development opportunities for regeneration projects which 16 produce results over extended periods of time. 17 I believe that by educating the population of the value of the arts in relation to regeneration and 18 social renewal, community participation in initiatives will be fostered. And to achieve the goals 19 that the NCA project seeks, members and associated organisations have been developing ways of 20 encouraging participation in arts events from a broader section of the community for some time. 21 Innovative strategies, such as pay-as-you-can have provided people from low-income backgrounds 22 with the opportunity to participate in arts events to which they would otherwise have been excluded.
23 With the development of policies encouraging arts-based projects as a tool in combating social 24 exclusion, funding agencies should adopt evaluation systems that appropriately reflect the aims 25 and objectives of programmes to bring arts practices into the communities. It is very important that

arts are seen by all of us to be breaking down barriers, and tackling issues around social inclusion.
PHILIP HEDLEY http://www.artscampaign.org.uk

Exame de Qualificao | Vestibular Estadual 2004

15

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | INGLS

247

Questo 17
1948 Declaration of Human Rights: Everyone has the right freely to participate in the cultural life of the community, to enjoy the arts
The epigraph at the beginning of the text is intended to: (A) weaken the authors logical pressupositions (B) express the historical relevance of the theme (C) contest the ideology of non-arts organisations (D) establish a communication channel with the reader

Questo 18
The writer may either expand or reduce the distance from the audience. The fragment below that includes reference to the audience is: (A) issues that lead individuals and groups to feel excluded from the mainstream of society. (l. 3) (B) I believe that by educating the population of the value of the arts in relation to regeneration and social renewal, (l. 17 - 18) (C) members and associated organisations have been developing ways of encouraging participation in arts events (l. 19 - 20) (D) arts are seen by all of us to be breaking down barriers, and tackling issues around social inclusion. (l. 26)

Questo 19
The statement that best conveys the basic premise of the authors argumentation is: (A) Funding for arts is a useless tool for the renewal of society. (B) Cultural diversity offers a chance for unlimited artistic expression. (C) Engagement in arts-based activities discourages social segmentation. (D) Arts practitioners should educate low-income community members.

Questo 20
The authors main reason for writing the text is motivated by: (A) initiatives to develop arts-oriented policies (B) the need to observe public interest in arts events (C) challenges to promote effective exposure to the arts (D) the intent to find solutions to fund research on the arts

16

Exame de Qualificao | Vestibular Estadual 2004

248

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | INGLS

Com base na imagem e no texto abaixo, responda s questes de nmeros 21 e 22.

THE GULF STREAM 1899 Winslow Homer was one of best and most influential American painters in the 19th century. Having worked as an illustrator, Homer became first known for a number of paintings with motifs from the American Civil War. The most marked change of his highly individual style took place in the early 1880s during a stay in a small fishing village on the north coast of England and later in the Bahamas. In these places, Homer found the motif that would occupy him for the rest of his life: man against the sea, the self in the huge and indifferent nature. Winslow Homers The Gulf Stream - oil on canvas is in the Metropolitan Museum of Art, in New York City. This painting shows a solitary black sailor in a small, disabled boat adrift in a tumultuous sea, at the center of a ring of predatory sharks, with an approaching ship in the distance on the left.
http://tvm.tigtail.org

Questo 2 1 21
The drama of the sea scene is imbued with an epic and heroic quality. The theme expressed in this work of art is: (A) ethnic and social fight after the end of slavery (B) beauty and the amazing vastness of the ocean (C) mans long and cheerful relationship with the sea (D) mortality and human struggle with the forces of nature

Questo 22
The ship on the horizon in the distance, on the left, signals that: (A) death is a matter of fate (B) fear of isolation is intense (C) hope for rescue is possible (D) attempt at escaping is pointless
Exame de Qualificao | Vestibular Estadual 2004

17

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

249

CINCIAS DA NA TUREZA, MA TEMTICA E SUAS TECNOLOGIAS NATUREZA, MATEMTICA Questo 23

(Adaptado de CARUSO, F. & DAOU, L. Tirinhas de fsica, vol. 6. Rio de Janeiro, 2002.)

Levantar-se pelo cadaro do tnis puxando-o para cima uma impossibilidade real. A explicao desse fato deve-se a uma lei de Newton, identificada como: (A) (B) (C) (D) primeira lei segunda lei terceira lei lei da gravitao

Questo 24
O esquema abaixo representa a frmula estrutural de uma molcula formada pela ligao peptdica entre dois aminocidos essenciais, o cido asprtico e a fenilalanina.

As frmulas moleculares dos aminocidos originados pela hidrlise dessa ligao peptdica so: (A) C4H8N2O3 - C9H10O3 (B) C4H8N2O4 - C9H10O2 (C) C4H7NO3 - C9H11NO3 (D) C4H7NO4 - C9H11NO2

18

Exame de Qualificao | Vestibular Estadual 2004

250

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 25
Na tirinha abaixo, considere A1 a rea inscrita na circunferncia que representa o acelerador americano e A2 a rea inscrita naquela que representa o suo. Observe que A1 menor do que A2.

(Adaptado de CARUSO, F. & DAOU, L. Tirinhas de fsica, vol. 6. Rio de Janeiro, 2002.)

De acordo com os dados da tirinha, a razo (A) 0,167 (B) 0,060 (C) 0,046 (D) 0,023

corresponde, aproximadamente, a:

Questo 26
A forma de uma raquete de tnis pode ser esquematizada por um aro circular de raio R e massa m1 , preso a um cabo de comprimento L e massa m2. Quando R = (A)

L 4

e m1 = m2 , a distncia do centro de massa da raquete ao centro do aro circular vale:

R 2

(B) R (C)

3R 2

(D) 2R

Exame de Qualificao | Vestibular Estadual 2004

19

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

251

Questo 27
A figura abaixo foi proposta por um ilustrador para representar um tomo de ltio (Li) no estado fundamental, segundo o modelo de Rutherford-Bohr.

Constatamos que a figura est incorreta em relao ao nmero de: (A) nutrons no ncleo (B) partculas no ncleo (C) eltrons por camada (D) partculas na eletrosfera

Questo 28
As esferas da figura abaixo representam os ons formadores de um cristal de cloreto de sdio.

Considere que o on com maior nmero de camadas eletrnicas representado pela esfera de maior raio e que a distncia entre os ncleos dos ons X e Y vale unidades de comprimento. O smbolo do elemento formador do on de menor tamanho e a menor distncia, na mesma unidade de comprimento, entre o ncleo de um ction e o ncleo de um nion, so: (A) Cl, 3 (B) Na, 3 (C) Cl, 5 (D) Na, 5

20

Exame de Qualificao | Vestibular Estadual 2004

252

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 29
Seja a altura de um som, medida em decibis. Essa altura est relacionada com a intensidade do som, 1, pela expresso abaixo, na qual a intensidade padro, 10, igual a 1012 W / m2.

Observe a tabela a seguir. Nela, os valores de 1 foram aferidos a distncias idnticas das respectivas fontes de som.

Sabendo que h risco de danos ao ouvido mdio a partir de 90 dB, o nmero de fontes da tabela cuja intensidade de emisso de sons est na faixa de risco de: (A) 1 (B) 2 (C) 3 (D) 4

Questo 30
Os intervalos de tempo entre as doses dos medicamentos so calculados para garantir que a concentrao plasmtica do princpio ativo seja mantida entre um valor mnimo eficaz e um valor mximo seguro. Para um certo medicamento, o princpio ativo apresenta massa molar de 200 g e sua concentrao plasmtica reduz-se metade a cada 8 horas. O valor mnimo eficaz da concentrao plasmtica igual a 1 seguro de 9,5 105 mol L1.

105 mol

L1 e seu valor mximo

A concentrao plasmtica mxima atingida imediatamente aps a ingesto da primeira dose igual a 16 mg L1. Nessas condies, o intervalo de tempo ideal, em horas, entre a ingesto da primeira e da segunda doses de: (A) 24 (B) 12 (C) 6 (D) 3

Exame de Qualificao | Vestibular Estadual 2004

21

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

253

Questo 31
Quatro plantas jovens idnticas, numeradas de 1 a 4, desenvolveram-se em ambientes ideais, nos quais apenas a intensidade da iluminao foi diferenciada: a fonte de luz branca provm de quatro circuitos eltricos diferentes W, X, Y e Z todos contendo um mesmo tipo de lmpada de filamento para 127 V, conforme indicam os esquemas abaixo.

O grfico a seguir mostra a taxa de crescimento de cada planta aps algum tempo.

Os circuitos utilizados para a iluminao das plantas 1 ,2, 3 e 4 foram, respectivamente: (A) W, Z, X e Y (B) X, Y, Z e W (C) Y, Z, W e X (D) Z, X, W e Y

Questo 32
Uma pesquisa comparou a velocidade de converso de monosteres pela fosfatase. Na presena dessa enzima, a converso de uma certa massa de monosteres se d em 10 ms; em sua ausncia, usando apenas gua como meio reacional, a converso da mesma massa ocorre em 1 trilho de anos. Considerando que um ano possui 3,15 10 segundos, o nmero aproximado de vezes em que a reao enzimtica mais rpida do que a ocorrida em meio aquoso equivale a: (A) 10 19 (B) 10 21 (C) 10 23 (D) 10 25
7

22

Exame de Qualificao | Vestibular Estadual 2004

254

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 33
Uma pessoa mantm o brao em posio vertical e o antebrao flexionado em ngulo de 90. Observe as duas situaes abaixo, nas quais a posio descrita mantida.

Considere, agora, as seguintes condies: o msculo bceps o nico responsvel pela flexo do antebrao sobre o brao; a fora exercida pelo msculo para manter apenas a flexo do antebrao desprezvel; os estiramentos sofridos pelas fibras musculares nas situaes 1 e 11 so muito pequenos em relao posio na ausncia de peso, podendo ser igualados para fins de clculo; para manter a contrao na situao 1, o bceps despende a energia liberada pela hidrlise de 25 103 mol de ATP min1; na reao ATP + H2O ADP + fosfato inorgnico, catalisada pela miosina ATPase, 100% da energia liberada convertida em trabalho muscular.

Nestas condies, para manter durante 5 minutos a contrao esquematizada na situao 11 , a quantidade, em mmol, de ATP hidrolisado pelo bceps igual a: (A) 10,0 (B) 25,0 (C) 50,0 (D) 62,5

Questo 34
Em processos fsicos que produzem apenas eltrons, prtons e nutrons, o nmero total de prtons e eltrons sempre par.
Esta afirmao expressa a lei de conservao de: (A) massa (B) energia (C) momento (D) carga eltrica
Exame de Qualificao | Vestibular Estadual 2004

23

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

255

Questo 35
O esquema abaixo representa a distribuio mdia dos elementos qumicos presentes no corpo humano.

(Adaptado de SNYDER, Carl H. The extraordinary chemistry of ordinary things. New York: John Wiley & Sons, Inc., 1997.)

O elemento que contribui com a maior massa para a constituio do corpo humano : (A) carbono (B) oxignio (C) nitrognio (D) hidrognio

Questo 36
Desde o incio, Lavoisier adotou uma abordagem moderna da qumica. Esta era sintetizada por sua f na balana.
(STRATHERN, Paul. O sonho de Mendeleiev: a verdadeira histria da qumica. Rio de Janeiro: Jorge Zahar, 2002.)

Do ponto de vista do mtodo cientfico, esta frase traduz a relevncia que Lavoisier atribua a: (A) teorias (B) modelos (C) hipteses (D) experimentos

Questo 37
O alumnio metlico, devido a sua baixa massa molar, apresenta um calor especfico de 900 J kg 1 C 1, um dos mais elevados dentre os metais. A energia necessria para elevar a temperatura de 25 kg de alumnio de 25C at 35C pode ser fornecida, em condies-padro, pela seguinte reao qumica: (A) (B) (C) (D)

24

Exame de Qualificao | Vestibular Estadual 2004

256

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Considere as informaes abaixo para responder s questes de nmeros 38 e 39.


Algumas controvrsias ainda existem quanto relao entre a presena de gorduras na dieta alimentar e a incidncia de doenas cardacas. O grfico abaixo mostra resultados de uma pesquisa recente, na qual estes fatores foram comparados em duas populaes com dietas tradicionalmente diferentes.

(Adaptado de WILLET, W.C. & STAMPER, M. J. As novas bases da pirmide alimentar. So Paulo: Scientific American Brasil, 2003.)

Questo 38
Os resultados da pesquisa apiam a idia de que a dieta adequada para a preveno de doenas coronarianas deve, preferencialmente, conter gorduras ricas em cidos graxos de cadeia do tipo: (A) saturada (B) alicclica (C) ramificada (D) insaturada

Questo 39
Considere os valores calricos mdios abaixo, em kcal/g, para os seguintes componentes de uma dieta: carboidratos = 4,0 protenas = 4,0 gorduras = 8,0

Sabe-se que o consumo dirio de carboidratos, em ambas as populaes, o dobro do consumo de protenas. Na dieta que apresenta maior efeito protetor contra doenas cardacas, a percentagem mdia, em massa de gordura ingerida, de: (A) 25% (B) 35% (C) 40% (D) 50%
Exame de Qualificao | Vestibular Estadual 2004

25

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

257

Questo 40
O esquema abaixo resume as etapas da sntese e da degradao do glicognio no fgado, rgo responsvel pela regulao da taxa de glicose no sangue.

Um paciente portador de um defeito gentico apresenta crises freqentes de hipoglicemia nos intervalos entre as refeies, embora a taxa de glicognio heptico permanea elevada. Nesse paciente, as enzimas que podem apresentar atividade deficiente, dentre as identificadas, so: (A) glicoquinase / UDPG sintase (B) glicognio fosforilase / glicoquinase (C) fosfoglicomutase / glicognio sintase (D) glicose-6 fosfato fosfatase / glicognio fosforilase

Questo 41
Em determinado tipo de camundongo, a pelagem branca condicionada pela presena do gene A, letal em homozigose. Seu alelo recessivo a condiciona pelagem preta. Para os filhotes vivos de um cruzamento de um casal de heterozigotos, esperam-se as seguintes propores de camundongos de pelagem branca e preta, respectivamente: (A) (B) (C) (D)
1 1 e 2 2 1 3 e 4 4 2 1 e 3 3 3 1 e 4 4
Exame de Qualificao | Vestibular Estadual 2004

26

258

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 42
A relao entre as coordenadas x e y de um corpo em movimento no plano dada por y = 10 log x. O grfico correspondente a esta relao :

(A)

(B)

(C)

(D)

Exame de Qualificao | Vestibular Estadual 2004

27

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

259

Questo 43
Considere a seguinte afirmao:

Uma bola de sinuca colide com outra de mesma massa que est em repouso, em uma coliso frontal, sem efeito, ou seja, sem qualquer tipo de rotao. Observa-se, nesta situao, que, aps o choque, os ngulos que cada uma das direes de movimento fazem com a direo inicial so iguais.
Observe as fotografias abaixo, nas quais esto registrados os resultados da coliso de um ncleo do elemento He com ncleos de quatro elementos: H, He, F e Cl.

(RESNICK, R. & HALLIDAY, D. Fsica. Rio de Janeiro: Livros Tcnicos e Cientficos, 1982.)

A fotografia que representa a coliso entre dois ncleos de He a de nmero: (A) 1 (B) 11 (C) 111 (D) 18

Questo 44
Um litro de combustvel para avies a jato tem massa igual a 1,8 libras, medida no sistema ingls de unidades. A mesma massa, no sistema internacional de unidades, equivale a 810 g. Suponha que o tanque de um determinado tipo de avio, quando cheio, contm 900 kg de combustvel. Despreze possveis influncias de temperatura e de presso. Se, por um engano, a massa de 900 kg de combustvel for medida em uma balana calibrada em libras, podemos afirmar que a percentagem preenchida do tanque desse avio ser de: (A) 9% (B) 45% (C) 50% (D) 90%

28

Exame de Qualificao | Vestibular Estadual 2004

260

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 45
No recente acidente que atingiu rios da regio norte-noroeste fluminense, o principal contaminante da gua foi a soda custica (NaOH). Considere que: - a mortalidade observada em algumas espcies de peixes desses rios foi diretamente relacionada a alteraes do seu equilbrio cido-bsico; - o pH do sangue dos peixes pode ser calculado pela frmula - na frmula citada, carbnico. refere-se concentrao molar de bicarbonato e ; , de cido

Observe os grficos abaixo, nos quais y representa medidas do pH de amostras de gua e x, medidas de concentrao de substncias encontradas em amostras de sangue de peixes. As amostras de gua e os peixes foram coletados, simultaneamente, em diversas reas dos rios contaminados.

Quando x = (A) 1 (B) 11 (C) 111 (D) 18

, a variao de x em funo de y pode ser representada pelo grfico de nmero:

Questo 46
Ao comprar uma barra de ouro, com 2 kg de massa, um investidor desconfiou haver tambm prata em sua composio. Para certificar-se, mergulhou a barra em um recipiente contendo gua e verificou que o deslocamento da gua correspondeu a um volume de 140 cm3. Sabendo que as massas especficas do ouro e da prata so, respectivamente, 20 g cm3 e 10 g cm3, o investidor pode concluir que h, na barra, uma massa em prata equivalente, em gramas, a: (A) 600 (B) 800 (C) 1000 (D) 1200

Exame de Qualificao | Vestibular Estadual 2004

29

CINCIAS HUMANAS E SUAS TECNOLOGIAS

261

CINCIAS HUMANAS E SUAS TECNOLOGIAS Questo 47

(Vamos compreender o Brasil. Rio de Janeiro: CDDI/IBGE, 2001.)

No desenho acima, a representao da estrutura etria do Brasil atual expressa uma transio demogrfica. Os indicadores que explicam esta situao de transio esto apontados em: (A) aumento da imigrao e reduo da expectativa de vida (B) reduo da imigrao e aumento da taxa de mortalidade (C) reduo da taxa de natalidade e aumento da expectativa de vida (D) aumento da taxa de natalidade e reduo da taxa de mortalidade

Questo 48
AS ENCHENTES As chuvaradas de vero, quase todos os anos, causam no nosso Rio de Janeiro inundaes desastrosas. Alm da suspenso total do trfego, com uma prejudicial interrupo das comunicaes entre os vrios pontos da cidade, essas inundaes causam desastres pessoais lamentveis (...). O Rio de Janeiro, da avenida, dos squares, dos freios eltricos, no pode estar merc de chuvaradas, mais ou menos violentas, para viver a sua vida integral. No sei nada de engenharia, mas, pelo que me dizem os entendidos, o problema no to difcil de resolver (...). Infelizmente, porm, nos preocupamos muito com os aspectos externos, (...) e no com o que h de essencial nos problemas de nossa vida urbana, econmica, financeira e social.
(Vida Urbana, 19/01/1915) (BARRETO, Lima. Crnicas escolhidas. So Paulo: tica, 1995.)

Lima Barreto considerado um cronista perspicaz da sociedade carioca do incio do sculo XX. O trecho acima apresenta o problema das enchentes, que at hoje tumultua a vida dos cariocas. Dentre as diversas causas apresentadas para a recorrncia das enchentes na cidade do Rio de Janeiro, as duas especialmente ressaltadas por Lima Barreto so: (A) ocupao desordenada e ineficincia das comunicaes (B) stio escarpado da cidade e problemas com a engenharia (C) falta de desenvolvimento tecnolgico e traado colonial da cidade (D) nfase no embelezamento urbano e precariedade da infra-estrutura

30

Exame de Qualificao | Vestibular Estadual 2004

262

CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 49

(BENJAMIN, Csar & CECCON, Claudius. Os desafios do Brasil. Rio de Janeiro: Contraponto, 2002.)

As ilustraes acima representam dois lados do fenmeno denominado globalizao. A interpretao conjunta das charges permite identificar a seguinte conseqncia desse fenmeno em pases como o Brasil: (A) dependncia poltica, estabelecida pela dominao econmica e pela criao de uma aldeia global (B) democratizao tecnolgica, favorecida pelo consumo de bens importados e pela informatizao (C) contradio cultural, expressa pelo consumismo e pela aquisio do conhecimento via tecnologia (D) limitao da soberania nacional, originada pela importao de suprfluos e pelo domnio da informao

Questo 50
SURDEZ HISTRICA Com a ligeireza habitual, em notas encurtadas pelo tdio, parte da imprensa brasileira registrou, no dia 28 de maio, o referendo que aprovou a nova Constituio de Ruanda, um dos grotes da frica profunda. O texto estabelece que nenhum partido poder ter mais de 50% das vagas no parlamento. Nem podero pertencer mesma legenda poltica o presidente, o vice-presidente e o chefe do Poder Legislativo. (...) Se o Brasil no fosse surdo s vozes da frica, a imprensa teria anunciado o fato com pompas e fitas. (...) Pouco antes do referendo, a paz entre os tutsi e os hutu parecia condenada a arder na fogueira dos dios ancestrais. Um governo compartilhado pode existir em democracias ultradesenvolvidas do Primeiro Mundo. Como implantar a frmula em Ruanda? (...)
(Adaptado de NUNES, Augusto. Jornal do Brasil, 08/06/2003.)

Ruanda, como vrios dos pases africanos, viveu longos perodos de guerra civil desde sua descolonizao. A proposta de um governo compartilhado mais uma tentativa de pr fim aos conflitos internos e inmeras mortes. No que se refere s caractersticas histricas dos povos africanos, as razes para a indagao do jornalista, em relao sorte da proposta em Ruanda, podem ser explicadas por: (A) atraso no processo de industrializao e liberalizao dos costumes (B) existncia de disputas entre etnias e acesso reduzido a direitos polticos (C) influncia de religies fundamentalistas e presena de governos autoritrios (D) manuteno de valores tradicionais e adoo de medidas econmicas monopolistas
Exame de Qualificao | Vestibular Estadual 2004

31

CINCIAS HUMANAS E SUAS TECNOLOGIAS

263

Questo 5 1 51

Rio e So Paulo brigam pelo ICMS do petrleo desde que uma emenda do ento senador paulista Jos Serra, na Constituinte de 1988, determinou a tributao no destino do imposto incidente nas operaes de comercializao de petrleo. A deciso da atual governadora do Rio, no entanto, foi a iniciativa mais contundente para reverter a deciso. Questionada sobre as manifestaes da Petrobras e da indstria de equipamentos, a governadora atribuiu a reao a presses polticas. - Isso tudo faz parte de presso poltica. O projeto de lei que vamos sancionar tambm faz parte do processo de garantir uma refinaria no nosso Estado. Faz parte do jogo poltico. No podia imaginar que uma emenda no tivesse nenhuma reao. A Petrobras paga imposto e, se paga no destino, vai passar a pagar na origem. Inconstitucional tirarem do nosso Estado e ficarmos de braos cruzados esses anos todos como ns estamos. Agora, que estamos querendo consertar, tem grito. afirmou a governadora.
(Adaptado de Jornal do Brasil, 12/06/2003)

As disputas polticas regionais, como a que apresentada na matria acima, evidenciam a presena do elemento federalista na atual estrutura poltica brasileira. Presente em todas as constituies republicanas, o federalismo foi mais expressivo na primeira delas. Uma caracterstica e um exemplo histrico do federalismo nas disputas polticas regionais da 1 Repblica esto assinalados em: (A) diferenciao na estrutura poltica dos estados influenciada pelo processo imigratrio europeu Lei Celerada (B) espao poltico no nvel federal estabelecido a partir do peso demogrfico Poltica dos governadores (C) desigualdade poltica no Congresso Nacional relacionada diferena territorial entre as partes da federao Encilhamento (D) prejuzos polticos para os estados decorrentes da preponderncia do eixo Rio de Janeiro-So Paulo Repblica do caf-com-leite

Questo 52
Com a morte do imperador do Japo a 1 hora e 25 minutos do dia 25 de dezembro de 1926, um fato bastante curioso aconteceu. No dia 24 de dezembro, a embaixada daquele pas, no Rio de Janeiro, decretava o luto pela morte do soberano, e os jornais brasileiros anunciavam: Faleceu hoje o imperador do Japo.
A confuso provocada, no Brasil, com o anncio da morte do imperador do Japo, naquele ano, pode ser esclarecida pela seguinte explicao geogrfica: (A) utilizao do Fuso Horrio Civil em trechos do territrio brasileiro (B) posio do Brasil a leste da Linha Internacional de Mudana de Data (C) adoo diferenciada do Horrio Universal de Greenwich em cada pas (D) localizao do Brasil a oeste do limite aceito como Horrio Fracionado

32

Exame de Qualificao | Vestibular Estadual 2004

264

CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 53

(Veja, 24/01/1996)

Ao longo dos tempos, inmeras levas migratrias ocorreram no Brasil. Contudo, chama ateno o processo retratado pela reportagem de 1996, sobre a mobilidade gacha das ltimas dcadas. Um fator explicativo da onda migratria gacha para diferentes regies do pas : (A) mudana na base produtiva do campo, levando excluso do mdio produtor (B) transferncia de empresas gachas, expulsando a mo-de-obra para outras regies (C) exploso demogrfica nas principais cidades do estado, aumentando os nveis de desemprego urbano (D) diviso da propriedade por herana, dificultando a sobrevivncia da pequena produo familiar

Questo 54

(Gazeta Mercantil, 28/05/2002)

A histria em quadrinhos ilustra um aspecto da reorganizao da economia mundial compatvel com a seguinte mudana na relao entre o capital produtivo e o espao mundial: (A) expanso de grandes empresas transnacionais com origem em pases desenvolvidos (B) identificao das grandes corporaes com os projetos especficos dos diferentes pases (C) internacionalizao da economia com perda relativa da identidade nacional do capital (D) ao do grande capital com reflexos sobre a economia dos pases da periferia e semiperiferia
Exame de Qualificao | Vestibular Estadual 2004

33

CINCIAS HUMANAS E SUAS TECNOLOGIAS

265

Questo 55

CRIANAS EM BALI TRABALHANDO COM ESCULTURAS

MENINA EM PLANTAO NA GUATEMALA


(AZEVEDO, J et alii. Serafina e a criana que trabalha. So Paulo: tica, 1999.)

A eliminao do trabalho infantil um dos principais desafios para os pases em desenvolvimento, pois tem impacto direto sobre os seguintes indicadores sociais: (A) reduo do ndice de analfabetismo e retrao da mortalidade infantil (B) aumento da taxa de escolaridade e reduo do crescimento populacional (C) aumento da taxa de crescimento populacional e elevao da renda per capita (D) elevao do ndice de desenvolvimento humano e aumento da taxa de fecundidade

Questo 56
LEI DE TERRAS Art. 1 Ficam proibidas as aquisies de terras devolutas por outro ttulo que no seja o de compra. Excetuam-se as terras situadas nos limites do Imprio com pases estrangeiros em uma zona de 10 lguas as quais podero ser concedidas gratuitamente. Art. 2 Os que se apossarem de terras devolutas ou de alheias, e nelas derrubarem matos ou lhes puserem fogo, sero obrigados a despejo (...) e, de mais, sofrero a pena de dois a seis meses de priso e multa de cem mil ris, alm da satisfao do dano causado (...).
(Lei n 601, de 18/09/1850. In: Coleo das leis do Brasil)

As motivaes que originaram a Lei de Terras, de 1850, ainda hoje so causas de conflitos em relao propriedade rural no Brasil. Dentre as questes levantadas nos artigos transcritos, aquelas que caracterizam a atual estrutura fundiria no Brasil so: (A) mercantilizao da terra e expulso de posseiros pobres (B) excluso de grileiros e internacionalizao da propriedade (C) obrigatoriedade de registro oficial e predomnio de terras devolutas (D) instituio de gratuidade nas fronteiras e obrigatoriedade de produo

34

Exame de Qualificao | Vestibular Estadual 2004

266

CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 57

1824

1999
(Revista Petrobras, julho de 2002)

As paredes centenrias do convento de Santo Antnio guardam histrias da poca em que nas proximidades do Largo da Carioca encontrava-se uma lagoa. As ilustraes acima evidenciam mudanas na forma e no uso do Largo, atravs dos sculos, que esto relacionadas com: (A) predomnio do padro arquitetnico ibrico (B) satisfao das necessidades da oligarquia agrria (C) consolidao dos interesses da burguesia urbana (D) implementao de projetos privados de saneamento

Questo 58
Mais 17 dias e, pronto: adeus vero. J vai tarde. Ufa! Foi o vero mais quente dos ltimos tempos e tambm o mais chuvoso, pegajoso e calamitoso. Foi, no, est sendo. E bem possvel que no se despea no equincio de maro, pois o vero no Brasil no costuma acabar quando termina". O que vale dizer que ainda teremos muito calor pela frente. Mais 17 dias e, pronto: adeus inverno. No hemisfrio norte. Para os que l vivem, ele tambm j vai tarde. Brrr! Foi o inverno mais rigoroso e cruel dos ltimos tempos. (...) O tempo piorou, em toda parte. E os meteorologistas advertem: o calor e o frio vo aumentar nas prximas dcadas. Nos dois hemisfrios.
(Adaptado de Folha de S. Paulo, 03/03/1996)

A mudana climtica global de que trata a reportagem pode ser explicada, dentre outros, pelo seguinte comportamento: (A) emisso de gases poluentes responsveis pela maior reteno do calor irradiado pela superfcie da Terra, ampliando a destruio da camada de oznio (B) intensificao do efeito estufa com a emisso de gases poluentes, destruindo a camada atmosfrica responsvel pela filtragem dos raios nocivos vida na Terra (C) estabilizao da circulao atmosfrica pela reteno de ar frio em baixas altitudes e do ar quente em camadas mais elevadas, promovendo a inverso trmica (D) expanso do fenmeno El Nio, nos meses de final de ano, provocando um deslocamento da massa de gua quente na costa americana do Pacfico para leste

Exame de Qualificao | Vestibular Estadual 2004

35

CINCIAS HUMANAS E SUAS TECNOLOGIAS

267

Questo 59
A imagem tradicional do campo mudou. As chamadas atividades no-agrcolas tm hoje um peso importante na composio da renda agrria, conforme se verifica na tabela abaixo.

(Adaptado de Veja, 19/07/2000)

Dentre estas atividades no-agrcolas, a que merece maior destaque : (A) turismo (B) indstria (C) comrcio (D) piscicultura

Questo 60
O que exatamente o fascismo que o senhor fundou? O fascismo antes de tudo uma f. O fascismo uma grande mobilizao de foras morais e materiais. O que mais importante, o arado ou a espada? O arado abre o sulco na terra, mas a espada que o protege. Quando as massas pensam, elas no se opem s polticas imperialistas? O raciocnio jamais ser o motor das multides. A multido ama os homens fortes. A multido mulher. O que os fascistas pensam sobre a violncia? A violncia imoral quando fria e calculada, mas no quando instintiva e impulsiva. Ento a violncia fascista no deve ser planejada? A violncia fascista deve ser pensante, racional, cirrgica. No me parece muito coerente, mas vamos adiante. O capitalismo na Itlia no precisa da democracia? possvel que no sculo XIX o capitalismo tenha precisado da democracia. Hoje, pode muito bem passar sem ela.
(Adaptado de KONDER, Leandro. Jornal do Brasil, maio de 2003.)

No texto acima, o filsofo brasileiro Leandro Konder produziu uma entrevista fictcia com Mussolini. Ele inventou as perguntas, mas as respostas foram retiradas de escritos desse lder fascista italiano. A partir do trecho da entrevista, pode-se caracterizar o fascismo pelo seguinte trao: (A) apoio ao expansionismo militarista (B) estmulo participao poltica reflexiva (C) descrena no sistema capitalista de produo (D) valorizao dos interesses das massas populares

36

Exame de Qualificao | Vestibular Estadual 2004

268

CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 6 1 61
Foi ento que estreou no teatro Municipal de So Paulo a pea clssica Electra, tendo comparecido ao local alguns agentes do DOPS para prender Sfocles, autor da pea e acusado de subverso, mas j falecido em 406 a.C. A minissaia era lanada no Rio e execrada em Belo Horizonte, onde o delegado de Costumes declarava aos jornais que prenderia o costureiro francs Pierre Cardin, caso aparecesse na capital mineira (...) Toda essa cocorocada iria influenciar um deputado estadual de l (...) que fez discurso na cmara sobre o tema: Ningum levantar a saia da mulher mineira.
(HOLLANDA, Heloisa Buarque de & GONALVES, Marcos Augusto. Cultura e participao poltica nos anos 60. So Paulo: Brasiliense, 1999.)

Os trechos acima, retirados do livro de Stanislaw Ponte Preta, FEBEAP Festival de besteira que assola o pas, satirizam uma situao que se tornou comum no Brasil, no ps-1964. Esta situao est corretamente apontada na aliana entre: (A) Estado e setores das classes mdias, pelo ufanismo patritico e controle de opinio (B) intelectuais e consumidores, pela defesa dos valores da ptria e contra a alienao cultural (C ) militantes de esquerda e igreja catlica, contra o processo de modernizao e a bolchevizao do pas (D) classe artstica e universidades pblicas, pela moralidade e desenvolvimento de atividades culturais

Questo 62

(Adaptado de Veja, 10/01/2001)

Nas ltimas dcadas, vrias foram as mudanas incorporadas ao processo de produo industrial, como as apresentadas na reportagem sobre a fabricao do automvel. O modelo de produo relacionado a estas recentes transformaes est definido em: (A) sistmico-flexvel, que incorpora a pesquisa como base para a reorganizao da produo (B) taylorista, que implica a crescente integrao do trabalhador qualificado atividade mecnica (C) fordista, que se apia na fragmentao do trabalho humano em inmeras etapas simplificadas (D) toyotista, que altera a organizao das unidades produtivas com a introduo da linha de montagem

Exame de Qualificao | Vestibular Estadual 2004

37

CINCIAS HUMANAS E SUAS TECNOLOGIAS

269

Questo 63
BRASIL: MOBILIDADE DE TRABALHADORES

(Adaptado de AGUILAR, Maria Ldia. Trabalhando com mapas de histria. So Paulo: tica, 1992.)

O mapa acima apresenta exemplos da mobilidade de trabalhadores no Brasil durante a 2 metade do sculo XIX. A alternativa que indica dois fatores adequadamente correlacionados a duas das rotas assinaladas : (A) ampliao da imigrao para o Sul e trfico de escravos para o Nordeste (B) surto industrial na regio Sudeste e incio da ocupao econmica do Norte (C) expanso da cafeicultura em So Paulo e explorao da borracha no Norte (D) desenvolvimento da exportao na regio Sul e declnio da cafeicultura no Rio de Janeiro

38

Exame de Qualificao | Vestibular Estadual 2004

270

CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 64

(ARRUDA, Jos Jobson de A. Atlas histrico bsico. So Paulo: tica, 1995.)

No mapa acima assinalam-se transformaes territoriais verificadas no continente europeu aps a Primeira Guerra Mundial. Uma causa dessas transformaes e um efeito da Primeira Guerra Mundial sobre as relaes internacionais no perodo entre-guerras, respectivamente, so: (A) formao de novos estados-nao incio da Unio Europia (B) enfraquecimento da Inglaterra consolidao de regimes fascistas (C) recrudescimento de disputas imperialistas exploso da revoluo bolchevique (D) aplicao do princpio das nacionalidades enfraquecimento poltico da Europa

Exame de Qualificao | Vestibular Estadual 2004

39

271

EXAME DE QUALIFICAO - VESTIBULAR 2004 GABARITO OFICIAL

01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16

A B A B A D A A B D C C B D C C

ESPANHOL

17 18 19 20 21 22

D B A C A D

FRANCS

17 18 19 20 21 22

A B D C C B

INGLS

17 18 19 20 21 22

B D C A D C

23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43

C D C C C D B A A B C D B D A D A D C A B

44 - Anulada 45 - C 46 - B 47 - C 48 - D 49 - C 50 - B 51 - B 52 - B 53 - D 54 - C 55 - A 56 - A 57 - C 58 - D 59 - A 60 - A 61 - A 62 - A 63 - C 64 - D

272

10 EXAME DE QUALIFICAO 20/06/2004


Neste caderno voc encontrar um conjunto de 40 (quarenta) pginas numeradas seqencialmente, contendo 60 (sessenta) questes das seguintes reas: LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS; CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS; CINCIAS HUMANAS E SUAS TECNOLOGIAS. A tabela peridica encontra-se na pgina 39. No abra o caderno antes de receber autorizao.

INSTRUES
1. Verifique se o seu nome, nmero de inscrio, nmero do documento de identidade e lngua estrangeira escolhida esto corretos no carto de respostas. Se houver erro, notifique o fiscal. Assine o carto de respostas com caneta. 2. Ao receber autorizao para abrir este caderno, verifique se a impresso, a paginao e a numerao das questes esto corretas. Caso ocorra qualquer erro, notifique o fiscal. 3. As questes de nmeros 16 a 21 da rea de LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS devero ser respondidas de acordo com a sua opo de Lngua Estrangeira: ESPANHOL, FRANCS ou INGLS. 4. Leia atentamente cada questo e escolha a alternativa que mais adequadamente responde a cada uma delas. Marque sua resposta no carto de respostas, cobrindo fortemente o espao correspondente letra a ser assinalada; utilize caneta preta, preferencialmente, ou lpis preto n 2, conforme o exemplo abaixo:

5. A leitora de marcas no registrar as respostas em que houver falta de nitidez e/ou marcao de mais de uma letra. 6. O carto de respostas no pode ser dobrado, amassado, rasurado ou manchado. Exceto sua assinatura, nada deve ser escrito ou registrado fora dos locais destinados s respostas. 7. Voc dispe de 4 (quatro) horas para fazer esta prova. 8. Ao terminar a prova, entregue ao fiscal o carto de respostas e este caderno.

BOA PROVA!

273

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

MESMO QUANDO NO PROFERIMOS UMA PALAVRA SEQUER, ESTAMOS NOS EXPRESSANDO. EIS A RAZO DE O TEMA DA PROVA DESTA REA SER A LINGUAGEM E OS SENTIDOS: COMUNICAMO-NOS NO APENAS QUANDO FALAMOS, LEMOS E ESCREVEMOS, MAS AINDA QUANDO VEMOS OU OUVIMOS, DEGUSTAMOS OU TOCAMOS, NO TRABALHO E NO CIO, NA VIGLIA E NO SONO...

Com base no texto abaixo, responda s questes de nmeros 01 a 04.

GAVET A DOS GUARDADOS VETA


A memria a gaveta dos guardados. Ns somos o que somos, no o que virtualmente seramos capazes de ser.
05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 26 27 28 29 30 31 32 33 34 35 06 07 08

Minha bagagem so os meus sonhos. Fui o poeta das ruas, das vielas silenciosas do Rio, antes que se tornasse uma cidade assolada pela violncia. Sempre fui ligado terra, ao meu ptio. No Rio Grande do Sul estou no colo da me. Creio que minha fase atual, neste momento, em 1993, reflete a eterna solido do homem. A obra s se completa e vive quando expressa. Nos meus quadros, o ontem se faz presente no agora. Lano-me na pintura e na vida por inteiro, como um mergulhador na gua. A arte tambm histria. E expressa a nossa humanidade. A arte intemporal, embora guarde a fisionomia de cada poca. Conheci em Paris um escultor brasileiro, bolsista, que no freqentava museus para no perder a personalidade, esquecendo que s se perde o que se tem. (...)

A memria pertence ao passado. um registro. Sempre que a evocamos, se faz presente, mas permanece intocvel, como um sonho. A percepo do real tem a concreteza, a realidade fsica, tangvel. Mas como os instantes se sucedem feito os tique-taques do relgio, eles vo se transformando em passado, em memria, e isso to inaferrvel* como um instante nos confins do tempo. Escrever pode ser, ou , a necessidade de tocar a realidade que a nica segurana de nosso estar no mundo o existir. difcil, se no impossvel, precisar quando as coisas comeam dentro de ns. (...)

09 40 11 12 13 14 45

21 22 23 24 25 26

A memria a gaveta dos guardados, repito para sublinhar. O clima dos meus quadros vem da solido da campanha, do campo, onde fui guri e adolescente. Na velhice perde-se a nitidez da viso e se agua a do esprito.

A vida di... Para mim o tempo de fazer perguntas passou. Penso numa grande tela que se abre, que se me oferece intocada, virgem. A matria tambm sonha. Procuro a alma das coisas. Nos meus quadros o ontem se faz presente no agora. A criao um desdobramento contnuo, em unssono com a vida. O auto-retrato do pintor pergunta que ele faz a si mesmo, e a resposta tambm interrogao. A verdade da obra de arte a expresso que ela nos transmite. Nada mais do que isso!
FOLHA
DE

SO PAULO, 09/05/1998

(CAMARGO, Iber. In: NESTROVSKI, Arthur (Org.). Figuras do Brasil: 80 autores em 80 anos de Folha. So Paulo: Publifolha, 2001.)

* Pode ser entendido como inalcanvel.


1 Exame de Qualificao |

| Vestibular Estadual 2005

274

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 01
A memria a gaveta dos guardados (l. 1 e l. 21)
A frase acima expressa a importncia das experincias individuais na criao artstica. A passagem do texto em que mais facilmente se percebe o vnculo entre memria e obra de arte : (A) A obra s se completa e vive quando expressa. (l. 11) (B) Nos meus quadros, o ontem se faz presente no agora. (l. 12 - 13) (C) Lano-me na pintura e na vida por inteiro, (l. 13) (D)A percepo do real tem a concreteza, a realidade fsica, (l. 28 - 30)

Questo 02
Conheci em Paris um escultor brasileiro, bolsista, que no freqentava museus para no perder a personalidade, esquecendo que s se perde o que se tem. (l. 17 - 20)
No quarto pargrafo, o fragmento acima constitui uma estratgia utilizada pelo autor para desconstruir um determinado ponto de vista contrrio ao seu. Essa estratgia e a justificativa para seu uso esto definidas na seguinte alternativa: (A) exemplo demonstrao irnica do vnculo entre arte e histria (B) paralelismo destaque retrico da experincia individual e coletiva (C) reiterao valorizao excessiva do elo entre cultura e humanidade (D)comparao fundamentao lgica da relao entre o artista e sua criao

Questo 03
Na velhice perde-se a nitidez da viso e se agua a do esprito. (l. 24 - 25)
As duas idias presentes nesse fragmento estabelecem relao semntica de: (A) alternncia (B) implicao (C) explicao (D)oposio

Questo 04
Escrever pode ser, ou , a necessidade de tocar a realidade que a nica segurana de nosso estar no mundo o existir. difcil, se no impossvel, precisar quando as coisas comeam dentro de ns.
(l. 35 - 38) Esse pargrafo relaciona-se com o pargrafo anterior, pela associao de: (A) registro e dor (B) texto e verdade (C) escrita e passado (D)literatura e solido
1 Exame de Qualificao |

| Vestibular Estadual 2005

275

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Com base no texto abaixo, responda s questes de nmeros 05 a 07.

OLHOS DE RESSACA
11 01 02 03 04 05 06 07 08 09 10

Enfim, chegou a hora da encomendao e da partida. Sancha quis despedir-se do marido, e o desespero daquele lance consternou a todos. Muitos homens choravam tambm, as mulheres todas. S Capitu, amparando a viva, parecia vencer-se a si mesma. Consolava a outra, queria arranc-la dali. A confuso era geral. No meio dela, Capitu olhou alguns instantes para o cadver to fixa, to apaixonadamente fixa, que no admira lhe saltassem algumas lgrimas poucas e caladas.

12 13 14 15 16 17 18 19 20

As minhas cessaram logo. Fiquei a ver as dela; Capitu enxugou-as depressa, olhando a furto para a gente que estava na sala. Redobrou de carcias para a amiga, e quis lev-la; mas o cadver parece que a retinha tambm. Momento houve em que os olhos de Capitu fitaram o defunto, quais os da viva, sem o pranto nem palavras desta, mas grandes e abertos, como a vaga do mar l fora, como se quisesse tragar tambm o nadador da manh.
(ASSIS, Machado de. Dom Casmurro. Captulo 123. So Paulo: Martin Claret, 2004.)

Questo 05
O personagem-narrador do romance Dom Casmurro encontra-se, no captulo transcrito, angustiado pela dvida: o possvel adultrio de sua esposa, Capitu, com seu melhor amigo, cujo velrio ora se narra. O ttulo Olhos de Ressaca pode ser justificado pela seguinte passagem: (A) Capitu olhou alguns instantes para o cadver (l. 8 - 9) (B) olhando a furto para a gente que estava na sala. (l. 13 - 14) (C) Redobrou de carcias para a amiga, e quis lev-la; (l. 14 - 15) (D)como se quisesse tragar tambm o nadador da manh. (l. 20 - 21)

Questo 06
No texto, a descrio dos fatos no objetiva, pois temos acesso aos traos e s aes dos demais personagens apenas por meio do olhar comprometido do personagem-narrador. A alternativa que indica uma estratgia utilizada pelo personagem-narrador para expressar um ponto de vista individual dos fatos e a passagem que a exemplifica : (A) enumerao de aes Consolava a outra, queria arranc-la dali. (l. 6 - 7) (B) seleo de adjetivos e advrbios to fixa, to apaixonadamente fixa, (l. 9) (C) narrao em 1 pessoa As minhas cessaram logo. (l. 12) (D)impreciso cronolgica Momento houve em que os olhos de Capitu fitaram o defunto, (l. 16 - 17)

1 Exame de Qualificao |

| Vestibular Estadual 2005

276

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 07
(...) no admira lhe saltassem algumas lgrimas poucas e caladas. (l. 10 - 11) As minhas cessaram logo. (l. 12)
Nessa passagem, encontra-se um recurso de coeso textual em que o termo sublinhado retomado por meio de elipse. Esse mesmo recurso empregado em: (A) quis despedir-se do marido, e o desespero daquele lance consternou a todos. (l. 2 - 3) (B) Muitos homens choravam tambm, as mulheres todas. (l. 4 - 5) (C) Redobrou de carcias para a amiga, e quis lev-la; (l. 14 - 15) (D)quais os da viva, sem o pranto nem palavras desta, (l. 17 - 18)

Com base no texto abaixo, responda s questes de nmeros 08 a 10.

O CORPO
01 02 03 04 05

Acrobata enredado Em clausura de pele Sem nenhuma ruptura Para onde me leva Sua estrutura? Doce mquina Com engrenagem de msculos Suspiro e rangido O espao devora Seu movimento (Braos e pernas sem exploso) Engenho de febre

06 07 08 09 10

11 12

13 1415

Sono e lembrana Que arma E desarma minha morte Em armadura de treva.

ARMANDO FREITAS FILHO http://geocities.yahoo.com.br/jerusalem_13/armandofreitasfilho.html

1 Exame de Qualificao |

| Vestibular Estadual 2005

277

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 08
No poema, o eu lrico desenvolve, empregando diferentes imagens, a idia de corpo como clausura. Isso no ocorre no seguinte verso: (A) Acrobata enredado (v. 1) (B) Sem nenhuma ruptura (v. 3) (C) Com engrenagem de msculos (v. 7) (D)Em armadura de treva. (v. 17)

Questo 09
A conciso uma das caractersticas que mais se destacam na estrutura do poema. Essa conciso pode ser atribuda a: (A) clara ausncia de conectivos, explorando a sonoridade do poema (B) pouco uso de metforas, enfatizando a fragmentao dos versos (C) abrupta mudana de versos, reforando a lgica das idias (D)baixa freqncia de verbos, exprimindo a inrcia do eu lrico

Questo 10
Engenho de febre Sono e lembrana Que arma E desarma minha morte Em armadura de treva.

A ausncia de pontuao nessa ltima estrofe do poema pode nos levar a diferentes leituras do texto. A nica interpretao incoerente desse trecho apresentada em: (A) Engenho de febre e de sono, e lembrana que arma e desarma minha morte em armadura de treva. (B) Engenho de febre, de sono e de lembrana, a qual arma e desarma minha morte em armadura de treva. (C) Engenho de febre, de sono e de lembrana, o qual arma e desarma minha morte em armadura de treva. (D)Engenho de febre, engenho que sono e lembrana, e que arma e desarma minha morte em armadura de treva.

1 Exame de Qualificao |

| Vestibular Estadual 2005

278

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Com base no texto abaixo, responda s questes de nmeros 11 a 13.

PALA VRAS ALADAS ALAVRAS


Silncio era a coisa de que aquele rei mais gostava. E de que, a cada dia, mais parecia gostar. Qualquer rudo, dizia, era faca em seus ouvidos.
05 06 07 08

Por isso, muito jovem ainda, mandou construir altssimos muros ao redor do castelo. E logo, no satisfeito, ordenou que por cima dos muros, e por cima das torres, por cima dos telhados e dos jardins, passasse imensa redoma de vidro. (...)

45 06 07 08 09 50 11 12 13 14 55 16 17 18 19 60 21 22 23 64 65 26 27 28

ter apanhado entre os dedos o delicado no de uma donzela. Enfim, divertiram-se tanto, to entusiasmados ficaram com a tarefa, que acabaram por instituir a Temporada Anual de Caa Palavra. De temporada em temporada, esvaziava-se o castelo de seus sons, enchia-se o calabouo de conversas. A tal ponto que o momento chegou em que ali no cabia mais sequer o quase silncio de uma vrgula. E o Mordomo Real viu-se obrigado a transferir secretamente parte dos sons para aposentos esquecidos do primeiro andar. Foi portanto por acaso que o rei passou frente a um desses cmodos. E passando ouviu um murmrio, rasgo de conversa. Pronto a reclamar, j a mo pousava na maaneta, quando o calor daquela voz o reteve. E inclinado fechadura para melhor ouvir, o rei colheu as lavas, palavras, com que um jovem, de joelhos talvez, derramava sua paixo aos ps da amada. A lembrana daquelas palavras pareceu voltar ao rei de muito longe, atravessando o tempo, ardendo novamente no peito. E em cada uma ele reconheceu com surpresa sua prpria voz, sua jovem paixo. Era sua aquela conversa de amor h tantos anos trancada. Fio da longa meada do passado, vinha agora envolv-lo, relig-lo a si mesmo, exigindo sair de calabouos. (...)

09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40

Mas se os sons no podiam entrar, verdade que tambm no podiam sair. Qualquer palavra dita, qualquer espirro, soluo, canto, ficava vagando prisioneiro do castelo, sem que lhe fossem de valia fresta de janela ou porta esquecida aberta. Pois se ainda era possvel escapar s paredes, nada os libertava da redoma. Aos poucos, tempo passando sem que ningum lhe ouvisse os passos, palavras foram se acumulando pelos cantos, frases serpentearam na superfcie dos mveis, interjeies salpicaram as tapearias, um miado de gato arranhou os corredores. E tudo teria continuado assim, se um dia, no exato momento em que sua majestade recebia um embaixador estrangeiro, no atravessasse a sala do trono uma frase desgarrada. Frase de cozinheiro que, sobrepondo-se aos elogios reais, mandou o embaixador depenar, bem depressa, uma galinha. Mais do que os ouvidos, a frase feriu o orgulho do rei. Furioso, deu ordens para que todos os sons usados fossem recolhidos, e para sempre trancados no mais profundo calabouo. Durante dias os cortesos empenharam-se naquele novo esporte que os levava a sacudir cortinas e a rastejar sob os mveis. A audio certeira abatia exclamaes em pleno vo, algemava rimas, desentocava cochichos. Uma condessa encheu um cesto com um cento de acentos. Um marqus de monculo fez montinhos de monosslabos. E houve at quem garantisse

29 70 31 32 33 34 75

Que se derrube a redoma! lanou ento o rei com todo o poder de seus pulmes. Que se abatam os muros! E desta vez vai o grito por entre o estilhaar, subindo, planando, pssaro-grito que no azul se afasta, trazendo atrs de si em revoada frases, cantigas, epstolas, ditados, sonetos, epopias, discursos e recados, e ao longe maritacas um bando de risadas. Sons que no espao se espalham levando ao mundo a vida do castelo, e que, aos poucos, em liberdade se vo.
(COLASANTI, Marina. Doze reis e a moa no labirinto do vento. So Paulo: Global, 1999.)

1 Exame de Qualificao |

| Vestibular Estadual 2005

279

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 11
O ttulo do texto Palavras Aladas relaciona-se com a idia de: (A) liberdade de expresso (B) efemeridade do poder (C) fragilidade dos sentidos (D)fragmentao da linguagem

Questo 12
A explorao da linguagem simblica uma das caractersticas dos contos de fadas. O uso dessa linguagem est presente na seguinte passagem: (A) mandou construir altssimos muros ao redor do castelo. (l. 4 - 5) (B) Mas se os sons no podiam entrar, verdade que tambm no podiam sair. (l. 9 - 10) (C) Furioso, deu ordens para que todos os sons usados fossem recolhidos, (l. 30 - 31) (D)E em cada uma ele reconheceu com surpresa sua prpria voz, (l. 63 - 64)

Questo 13
Para manter a progresso, o texto apresenta uma srie de marcas lingsticas que estabelecem, por meio de encadeamentos sucessivos, diferentes tipos de relaes entre suas partes. A alternativa que apresenta sublinhada uma dessas marcas e o tipo de relao estabelecida por ela : (A) Silncio era a coisa de que aquele rei mais gostava. E de que, a cada dia, mais parecia gostar.(l. 1 - 2) comprovao (B) Mas se os sons no podiam entrar, verdade que tambm no podiam sair. (l. 9 - 10) correo (C) Aos poucos, tempo passando sem que ningum lhe ouvisse os passos, palavras foram se acumulando pelos cantos, (l. 16 - 18) temporalidade (D)Foi portanto por acaso que o rei passou frente a um desses cmodos. (l. 53 - 54) concluso

1 Exame de Qualificao |

| Vestibular Estadual 2005

280

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Com base na propaganda abaixo, responda s questes de nmeros 14 e 15.

(INFANTE, Ulisses. Curso de gramtica: aplicada aos textos. So Paulo: Scipione, 2001.)

Questo 14
O anncio, concebido para uma campanha contra drogas, utiliza pouco a linguagem verbal. Entretanto, o elemento verbal utilizado nesse anncio ganha fora pela seguinte razo: (A) explora o campo sonoro da lngua, desvinculando a imagem do som (B) ambivalente, evocando a designao de uma droga e as conseqncias de seu uso (C) constitui um neologismo, levando ao estranhamento do receptor e averso s drogas (D)apresenta clareza, evidenciando as marcas do desolamento e da solido no rosto da pessoa retratada

Questo 15
O emprego de ponto ao final da palavra crack, no anncio, um recurso utilizado para mostrar que: (A) a legenda constitui enunciado completo, expressando idia de princpio, meio e fim (B) a mensagem tem carter moralizante, ressaltando o potencial destrutivo das drogas (C) a construo fere a norma padro da lngua, enfatizando o impacto da mensagem (D)a palavra adquire valor onomatopico, reproduzindo o som da fratura presente na imagem

1 Exame de Qualificao |

| Vestibular Estadual 2005

281

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | ESPANHOL

Com base no texto abaixo, responda s questes de nmeros 16 a 19.

LA FOTOGRAFA ES TEXTO, PAISAJE HUMANO QUE RETRA TA LO COTIDIANO ETRAT


Hace treinta aos que desarrollo mi oficio dentro del fotoperiodismo y la fotografa de autor. Sin embargo, en lo que atae al trabajo personal, me orient hacia el retrato fotogrfico y la columna artstica. La labor es captar el proceso creativo de los artistas e intelectuales ms destacados, tanto mexicanos como extranjeros. En mi obra estn presentes la msica, la danza, la literatura, el cine, la poesa, el teatro y la fotografa misma. ()
10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32

35 06 07 08 09 40 11 12 13 14 45 16 17 18 19 50 21 22 23 24 55 26 27 28 29 60

05 06 07 08 09

me mira no hay comunicacin. El hecho de vernos a los ojos propicia una corriente elctrica. Slo as puedo penetrar su persona con el lente, acercarme a l y capturar su esencia. No basta poner una cmara enfrente y apretar el botn. Hay que sentir, pensar, intercambiar miradas. El 85 por ciento de mi obra la realizo en blanco y negro porque son la sntesis del color en la fotografa. Permiten al lector de imgenes hacer diversas lecturas, entrar en un juego de texturas, contrastes y tensin de puntos. Procuro trabajar con luz ambiente. Empiezo con un long shot, luego hago una serie de fotografas de todo el espacio que constituye el mbito del creador. Capto sus elementos: libros, pinturas, fotografas, lugares, amigos, atmsferas. Todo aquello que se relacione con su personalidad. Mxico es un pas de imgenes, con gran riqueza visual y una fuerza tremenda en la palabra. Las fotos que tomo son un registro de las vivencias que comparto con los dems, del aprendizaje que experimento al estar cerca de los creadores. Son parte de m, de un tiempo y un espacio precisos. Desde mi punto de vista, exponer es una forma de cerrar ciclos, de comunicar. Mi ideal es publicar en libros o revistas impecablemente impresos, pero tampoco soy exigente. Busco la foto silenciosa, la del hombre en su entorno. La fotografa representa a los instantes robados que se descubren cotidianamente.

Aunque tuve la oportunidad de ejercer el diarismo, decid dejar de fotografiar a polticos por una razn: uno como fotgrafo debe creer en las personas que retrata. Captar aquellos momentos en los que estos hombres repartan abrazos y daban discursos apoteticos era una demagogia visual. Esto me llev a la expresin artstica, y en una tercera vertiente me lanc como fotgrafo callejero. Con la cmara en el hombro sal a buscar el paisaje humano. No me importaba hacer un registro o memoria turstica del paisaje superficial, sino de las personas, ya fuera en un contexto rural o urbano. Me considero seguidor de la tradicin del retrato fotogrfico. No en el estudio sino en el espacio, donde aprend que para construir un retrato es necesario conocer al creador, convivir con l, no nada ms en el concepto formal sino tambin en el conceptual. Mi obra es una constante del retrato silencioso , es decir, aquel que por s mismo representa al creador. Otra constante es la bsqueda de lo cotidiano, la necesidad de captar las miradas. Si el creador no

ROGELIO CULLAR http://www.cnca.gob.mx

1 Exame de Qualificao |

10

| Vestibular Estadual 2005

282

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | ESPANHOL

Questo 16
El texto corresponde a una conferencia presentada en un canal educativo de Mxico. Se puede observar que el enunciador busca justificar la invitacin recibida. El fragmento que mejor lo comprueba es: (A) Hace treinta aos que desarrollo mi oficio dentro del fotoperiodismo y la fotografa de autor. (l. 1 - 2) (B) Esto me llev a la expresin artstica, y en una tercera vertiente me lanc como fotgrafo callejero. (l. 16 - 18) (C) Me considero seguidor de la tradicin del retrato fotogrfico. (l. 23 - 24) (D)El 85 por ciento de mi obra la realizo en blanco y negro porque son la sntesis del color en la fotografa. (l. 39 - 41)

Questo 17
(...) uno como fotgrafo debe creer en las personas que retrata. (l. 12 - 13)
El fragmento nos informa la razn de desear el autor cambiar el rumbo de su actividad de fotgrafo. Esa decisin ha provocado que buscara dedicarse de primero a: (A) las fotos en espacios cerrados (B) la captacin de lo artstico (C) el long shot como tcnica (D)lo callejero como tema

Questo 18
El enunciador presenta sus ideas como verdades indiscutibles, puesto que ancladas en su punto de vista. El recurso lingstico que favorece ese resultado es la predominancia de: (A) prrafos con frases cortas (B) conectivos con idea de adicin (C) comas en situaciones no usuales (D)modalidad verbal en la forma asertiva

Questo 19
No me importaba hacer un registro o memoria turstica del paisaje superficial, sino de las personas, ya fuera en un contexto rural o urbano. (l. 19 - 22)
Se comprende lo subrayado en el fragmento como la expresin de una idea de: (A) reiteracin (B) aprobacin (C) aproximacin (D)aseguramiento

1 Exame de Qualificao |

11

| Vestibular Estadual 2005

283

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | ESPANHOL

Com base na imagem e no texto abaixo, responda s questes de nmeros 20 e 21.

Observa este cartel del Instituto Cubano del Arte y la Industria Cinematogrficos (ICAIC) que divulga un programa de cine que se lleva a varias ciudades. El autor del cartel opina: Soy del criterio de que toda ilustracin que se haga, bien sea para las pginas de un libro o para las de una revista, para un cartel o para la cartula de un disco, o hasta para la sealizacin de un hospital infantil, debe contribuir a que el nio se familiarice con todos los lenguajes de las artes plsticas.
EDUARDO MUOZ BACHS www.cuatrogatos.org/galeria.html

Questo 20
Las palabras del autor del cartel definen su pblico previsto como el infantil. La caracterstica del cartel que mejor confirma esa definicin es: (A) el espacio ocupado por la imagen en el cartel (B) la naturaleza del trazado del dibujo (C) el uso de pocos elementos verbales (D)la presencia del personaje Carlitos

Questo 21
Considerando la propuesta del programa de cine para el cual se elabor el cartel, se comprende la presencia de las ruedas de una bici como un recurso para reiterar la idea de: (A) comunicabilidad (B) excepcionalidad (C) periodicidad (D)movilidad

1 Exame de Qualificao |

12

| Vestibular Estadual 2005

284

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | INGLS

Com base no texto abaixo, responda s questes de nmeros 16 a 19.

TRAVEL PHOTOGRAPHY: A MOMENT IN TIME


The use of images to represent knowledge and synthesize information has a long tradition within the history of humanity. One reason for this is the ease with which we can remember pictures. Indeed, as early as Plato, writers have considered visual images easier to remember than words. This emphasis on the power of images has naturally led to the notion of a perfect language based on images instead of words. Images, after all, have the ability to speak universally to many cultures with varying languages. When we get caught up in lifes trivial pursuits we easily miss the sights, sounds and smells all around us and tend to take for granted the beauty of the natural world. As our pace of life quickens, it becomes increasingly important to find ways to stay calm and attentive. For me, this practice of being present and in the moment is a daily task requiring constant attention one that keeps me focused and helps offer a sense of fulfillment in my life. This practice not only translates into daily life but into many other areas as well, such as travel photography. As an art form, travel photography has a unique set of variables. In order to succeed at it, one must be extremely attentive. Not only is your main light source, the sun, constantly shifting, but also your subject, often people, rarely remain in the same place for long periods of time. When I grab my camera and set off to explore, my senses awaken. On many occasions, a morning has passed and I have found myself on the other side of a strange city, having spent hours following light. Even images not exposed on film remain indelibly etched in my mind. For me, being in the moment is what I enjoy most about travel photography. When first arriving in a new city I usually spend the first day or two simply strolling in the early morning with my camera exposed, allowing people to notice me and absorbing the scenery, but taking very few photos. This becomes a good opportunity to locate vantage points like hilltops and bridges and areas such as local markets that can be returned to when the lighting is just right. Being aware of your surroundings while traveling will certainly have beneficial effects on your photography, but plays an important role in safety as well. I have often been tempted to wander down dark alleys or lonely beaches at night but have decided against it after carefully surveying present characters. If you are always aware of what is happening around you, it becomes much more difficult to be taken advantage of. Succeeding at travel photography takes much more than just the latest technical gadgetry. I reckon it is the least important factor. Your photographic adventure will be much more successful if you have the will to explore while remaining relaxed, focused and eager to establish relationships. Most importantly, keep your eyes open!
September 2003 ROBERT POWER http://www.theartscourt.com

35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

05 06 07 08 09 10 11 12 13 14 15 16 17 18 18 20 21 22 23 24 25 26 27 28 29 30 31 32

1 Exame de Qualificao |

16

| Vestibular Estadual 2005

285

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | INGLS

Questo 16
Due to its semantic relations and structural organization, the text can be classified as: (A) a personal account (B) a descriptive report (C) a comparative analysis (D)an appreciative review

Questo 17
Writers always have an intention when expressing their feelings and ideas in writing. The authors intention in this text is that of: (A) sharing traveling experience with a specific public (B) advising photographers on how to restrain emotions (C) suggesting methods for capturing the perfect moment (D)convincing readers of the importance of photojournalism

Questo 18
Being aware of your surroundings while traveling will certainly have beneficial effects on your photography,
(l. 46 - 48) The idea expressed in the fragment above is best related to: (A) Images, after all, have the ability to speak universally to many cultures with varying languages. (l. 9 - 11) (B) When first arriving in a new city I usually spend the first day or two simply strolling in the early morning (l. 38 - 40) (C) If you are always aware of what is happening around you, it becomes much more difficult to be taken advantage of. (l. 52 - 54) (D)Succeeding at travel photography takes much more than just the latest technical gadgetry. (l. 55 - 56)

Questo 19
Cohesion in the text is achieved through the use of transition signals in the discourse. The marker Not only... but also (l. 26 - 27) expresses the following notions: (A) comparison and addition (B) contrast and enumeration (C) identification and emphasis (D)introduction and exemplification

1 Exame de Qualificao |

17

| Vestibular Estadual 2005

286

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | INGLS

Com base na imagem e no texto abaixo, responda s questes de nmeros 20 e 21.

This image for the Golden Gate National Parks was created as part of an identity project to raise awareness of the parks in the San Francisco area. The mark was created by graphic artist Michael Schwab in an effort to create icons with a timeless American style to them. The image was used as bus shelter posters, as well as reproduced on T-shirts, mugs and posters for sale at each of the park sites. The response to the image has been greater than expected; many of the transit posters were stolen right out of their frames. A limited edition of 40 x 60" screen-printed posters will be available at The Louvre, a San Francisco gallery. To receive a catalog of available posters, T-shirts or other items call The Parks at 415-657-2757.
http://www.commarts.com

Questo 20
The intention underlying the combination of image and words is to: (A) protect animal life (B) draw city park-goers (C) control sea water pollution (D)sponsor environmental campaigns

Questo 21
Public reaction toward the National Park poster can be described as: (A) neutral with positive outcomes (B) negative with insufficient results (C) predicted with sufficient evidence (D)positive with disorderly behavior

1 Exame de Qualificao |

18

| Vestibular Estadual 2005

287

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS


CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 22
Clulas do tipo X absorvem a substncia S apenas por transporte ativo. Essa absoro, em clulas do tipo Y, feita por transporte passivo mediado por um transportador especfico. Num experimento, foram medidas as velocidades iniciais de transporte de S atravs das membranas plasmticas de X e de Y, em funo de concentraes crescentes dessa substncia no meio extracelular. O experimento foi repetido, ento, em presena de um inibidor da gerao de ATP nas clulas. A tabela abaixo resume as condies do experimento. Tipo de clula X
I II

Inibidor de ATP ausente presente Observe o grfico.


velocidade inicial de transporte

Y
III IV

3
concentrao extracelular de S

As curvas que representam as medidas obtidas, respectivamente, nas condies experimentais I, II, III e IV, so: (A) 1 2 1 3 (B) 2 3 2 2 (C) 2 3 2 3 (D) 3 3 1 1

Questo 23
Um veculo consumiu 63,0 L de gs natural para percorrer uma distncia de 225 km. A queima de 28,0 L de gs natural libera 1,00 106 J de energia. A energia consumida, em joules, por quilmetro, foi igual a: (A) 5,10 106 (B) 4,50 105 (C) 1,00 104 (D) 2,25 103

1 Exame de Qualificao |

19

| Vestibular Estadual 2005

288

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Considere as informaes abaixo para responder s questes de nmeros 24 a 26.


Estudos mostram que as molculas de dois gases, a uma mesma temperatura, possuem igual energia cintica mdia. Para ilustrar esta teoria, um professor montou o experimento abaixo esquematizado, no qual, em cada extremidade de um tubo de vidro com 1 m de comprimento, foram colocados dois chumaos de algodo embebidos, respectivamente, em uma soluo de amnia e em uma soluo de cido clordrico, ambas com a mesma concentrao. Aps determinado perodo de tempo, observou-se a formao do cloreto de amnio na regio do tubo mais prxima extremidade que contm o cido.

Chumao de algodo embebido em amnia

Chumao de algodo embebido em cido clordrico

Anel de cloreto de amnio: produto slido formado pela reao entre vapores de NH3 e HCl
(Adaptado de SANTOS, Wildson Luiz P. et alii (Coord.). Qumica e sociedade. So Paulo: Nova Gerao, 2003.)

Considere que os vapores formados no experimento se comportam como gases.

Questo 24
A relao entre as velocidades mdias V e a relao entre as massas M das molculas dos vapores envolvidos no experimento esto expressas, respectivamente, na seguinte alternativa: (A) VHCl = VNH ; MHCl < MNH
3 3 3 3 3 3 3 3

(B) VHCl = VNH ; MHCl > MNH (C) VHCl > VNH ; MHCl = MNH (D) VHCl < VNH ; MHCl > MNH

Questo 25
Decorridos 15 segundos do incio da difuso dos vapores, verificou-se a formao do anel de cloreto de amnio a 59,4 cm da extremidade que contm o algodo com amnia e a 40,6 cm da extremidade que contm o algodo com cido clordrico. A razo entre as velocidades mdias de difuso das molculas de NH3 e HCl : (A) 1,75 (B) 1,46 (C) 0,96 (D) 0,74

1 Exame de Qualificao |

20

| Vestibular Estadual 2005

289

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 26
Admita que a reao entre os vapores das substncias contidas nos dois chumaos de algodo ocorra em meio aquoso, formando dois produtos. A alternativa que indica o tipo de reao ocorrida e as funes qumicas correspondentes aos produtos formados : (A) dupla-troca ; sal hidrxido (B) reduo ; cido hidrxido (C) neutralizao ; sal xido (D) oxidao ; xido cido

Questo 27
Uma rolha de cortia tem a forma de um cilindro circular reto cujo raio mede 2 cm. Num recipiente com gua, ela flutua com o eixo do cilindro paralelo superfcie. Sabendo que a massa especfica da cortia 0,25 g/cm3 e que a da gua 1,0 g/cm3, a correta representao da rolha no recipiente est indicada em:

(A)

(B)

(C)

(D)

1 Exame de Qualificao |

21

| Vestibular Estadual 2005

290

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 28
Uma indstria solicitou a um laboratrio determinada quantidade da substncia trifluoreto de fsforo puro, que ser utilizada na obteno de um produto de grande importncia. Para atender ao pedido, os tcnicos do laboratrio realizaram quatro experincias, utilizando fsforo e flor puros, que, combinados em condies adequadas, formaram o trifluoreto de fsforo, em um sistema fechado. Observe a tabela abaixo.
Massa dos reagentes em gramas fsforo 31,0 15,5 9,3 10,0 flor 19,0 28,5 19,0 30,0

Experincia

I II III IV

Considerando 100% de rendimento, a experincia que atende especificao solicitada pela indstria a de nmero: (A) I (B) II (C) III (D) IV

Questo 29
O on Ca++ livre no citosol das fibras musculares esquelticas tem importante papel no desencadeamento da contrao muscular. Observe, no grfico abaixo, o resultado de um experimento no qual dois dos quatro pontos indicados, P ,P,P eP , representam os comprimentos da fibra e as concentraes de Ca++ no citosol, no estado de 1 2 3 4 repouso e sob contrao.
concentrao de Ca++

P1

P2

P3
0

P4
comprimento da fibra

A alternativa que indica a seqncia da passagem do estado de repouso para o de contrao da fibra : (A) P1 (B) P2 (C) P3 (D) P4 P4 P3 P2 P1

1 Exame de Qualificao |

22

| Vestibular Estadual 2005

291

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 30
A velocidade de reao V de uma enzima dependente da concentrao de seu substrato quando ele est em baixas concentraes; no entanto, quando essas concentraes so muito altas, V torna-se constante e denominada velocidade mxima de reao (Vmx). A tabela abaixo fornece algumas caractersticas das reaes, determinadas em condies ideais, de uma mesma enzima atuando sobre trs diferentes substratos, S1, S2 e S3 .
Substrato (S) S1 S2 S3 Vmx
(unidades)

Concentrao de S quando V= Vmx


(mol L1)

10 10 10

7 108 5 1010 2 109

Uma preparao desta enzima foi colocada em trs frascos, adicionando-se a cada um deles um substrato diferente: S1, S2 ou S3. Estes substratos so, assim, transformados nos produtos P1, P2 e P3, respectivamente. Considere que: - a concentrao de enzima foi a mesma em todos os frascos; - a concentrao de cada um dos substratos foi mantida constante e igual a 2 experimento; - as reaes foram realizadas em condies ideais. Ao fim de um minuto de reao, a ordem crescente das quantidades de produtos formados nos trs frascos foi: (A) P1 < P3 < P2 (B) P1 < P2 < P3 (C) P2 < P3 < P1 (D) P3 < P1 < P2

109 mol

L1, durante o

Questo 31
Observe na ilustrao abaixo estruturas de importantes substncias de uso industrial.
N
O
O
O

NH

Em cada uma dessas substncias, o nmero de tomos de carbono pode ser representado por x e o nmero de heterotomos por y. O maior valor da razo (A) ter (B) ster (C) amina (D) amida
1 Exame de Qualificao |

x encontrado na substncia pertencente seguinte funo qumica: y

23

| Vestibular Estadual 2005

292

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 32
O organoclorado conhecido como DDT, mesmo no sendo mais usado como inseticida, ainda pode ser encontrado na natureza, em conseqncia de sua grande estabilidade. Ele se acumula em seres vivos pelo processo denominado de biomagnificao ou magnificao trfica. Foram medidas, em partes por milho, as concentraes desse composto obtidas em tecidos de indivduos de trs espcies de um mesmo ecossistema, mas pertencentes a diferentes nveis trficos, com resultados iguais a 15,0 , 1,0 e 0,01. As concentraes de DDT nos tecidos dos indivduos da espcie situada mais prxima da base da cadeia alimentar e da situada mais prxima do topo dessa cadeia, em gramas de DDT por 100 gramas de tecido, foram, respectivamente, iguais a: (A) 1,0 103 e 1,0 105 (B) 1,5 104 e 1,0 104 (C) 1,0 104 e 1,5 104 (D) 1,0 106 e 1,5 103

Questo 33
A combusto completa do gs metano, feita em presena de ar, a temperatura e presso constantes, pode ser representada pela seguinte equao qumica no balanceada:
CH4(g) + O2(g) CO2(g) + H2O (l)

Admita que: - 60,0 L deste combustvel foram queimados por um veculo; - o oxignio reagente represente 20% do volume total do ar; - o rendimento do processo seja de 90%. Nestas condies, o volume de ar, em litros, necessrio combusto equivale a: (A) 810 (B) 540 (C) 480 (D) 270

Questo 34
Numa operao de salvamento martimo, foi lanado um foguete sinalizador que permaneceu aceso durante toda sua trajetria. Considere que a altura h, em metros, alcanada por este foguete, em relao ao nvel do mar, descrita por h = 10 + 5t t2, em que t o tempo, em segundos, aps seu lanamento. A luz emitida pelo foguete til apenas a partir de 14 m acima do nvel do mar. O intervalo de tempo, em segundos, no qual o foguete emite luz til igual a: (A) 3 (B) 4 (C) 5 (D) 6
1 Exame de Qualificao |

24

| Vestibular Estadual 2005

293

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 35
Um pesquisador, interessado em estudar uma determinada espcie de cobras, verificou que, numa amostra de trezentas cobras, suas massas M, em gramas, eram proporcionais ao cubo de seus comprimentos L, em metros, ou seja M = a L3 , em que a uma constante positiva. Observe os grficos abaixo.
log M log M log M log M

log L

log L

log L

log L

Aquele que melhor representa log M em funo de log L o indicado pelo nmero: (A) I (B) II (C) III (D) IV

Questo 36
Uma caixa est sendo puxada por um trabalhador, conforme mostra a figura abaixo.

Para diminuir a fora de atrito entre a caixa e o cho, aplica-se, no ponto X, uma fora f. O segmento orientado que pode representar esta fora est indicado na seguinte alternativa: (A) x

f f

(B) x

f
(C) x (D) x

1 Exame de Qualificao |

25

| Vestibular Estadual 2005

294

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 37
Com base na tabela de Classificao Peridica dos Elementos, podemos formar um composto qumico por meio da escolha aleatria de um elemento da famlia IIA e de outro da famlia VA. A probabilidade desse composto apresentar ligao qumica predominantemente inica de: (A) (B) (C) (D) 1 6

1 5 2 3
4 5

Utilize as informaes abaixo para responder s questes de nmeros 38 e 39.


A eletroforese, um mtodo de separao de protenas, utiliza um suporte embebido em soluo salina, no qual estabelecida uma corrente eltrica contnua. Uma protena colocada sobre o suporte pode migrar para um dos dois plos do gerador. A velocidade de migrao das molculas da protena ser tanto maior quanto maiores forem a carga eltrica de suas molculas e a intensidade da corrente. A carga eltrica da protena resulta do grau de ionizao de seus grupos carboxila ou amina livres e depende das diferenas existentes entre o pH do meio que embebe o suporte e o ponto isoeltrico (pHI) da protena. Quanto maior o pH do meio em relao ao pHI, mais predomina a ionizao da carboxila sobre a da amina e vice-versa. O pHI definido como o pH do meio onde a carga da protena nula.

Questo 38
Os pontos isoeltricos das protenas W, X, Y e Z esto relacionados na tabela abaixo.
Protena W X Y Z pHI 8,3 9,2 7,7 6,2

Estas protenas foram separadas por um sistema de eletroforese no qual o pH do meio que embebia o suporte era de 8,6. A protena que migrou com menor velocidade em direo ao plo positivo foi a identificada pela seguinte letra: (A) W (B) X (C) Y (D) Z
1 Exame de Qualificao |

26

| Vestibular Estadual 2005

295

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 39
Observe, abaixo, os esquemas de quatro circuitos eltricos de corrente contnua, disponveis para uso na eletroforese das protenas. Considere a resistncia interna do gerador nula.
150 50 200 250

suporte 100

105 V

suporte 100

100 V

suporte 100

50

200

150

50

50

250

Se a intensidade da corrente eltrica no suporte de eletroforese for superior a 0,2 A, a quantidade de calor dissipada no suporte ser capaz de promover a desnaturao trmica das protenas a serem separadas. Dentre os quatro circuitos disponveis, aquele que permitiria a maior velocidade de migrao, sem acarretar a desnaturao das protenas, o de nmero: (A) I (B) II (C) III (D) IV

Questo 40
Num experimento, algas verdes nutridas em meio de crescimento adequado so colocadas em uma caixa. A seguir, a caixa vedada e mantida no escuro. Foram medidas as concentraes de O2 e de CO 2 no ar contido na caixa, em dois momentos: no instante de seu fechamento e no final do experimento. No grfico abaixo, o ponto P define as concentraes dos dois gases, medidas no instante do fechamento da caixa.
concentrao de O2

3 4

concentrao de CO2

No final do experimento, o sentido do deslocamento do ponto que define as concentraes desses gases na caixa est identificado pela seta de nmero: (A) 1 (B) 2 (C) 3 (D) 4

1 Exame de Qualificao |

27

| Vestibular Estadual 2005

suporte 100

120 V

50 V

296

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 41
A vitamina C, cuja estrutura mostrada abaixo, apresenta vrios grupos hidrfilos, o que facilita sua dissoluo na gua. Por esta razo, ao ser ingerida em excesso, eliminada pelos rins.
OH O O OH

HO

OH

Considerando suas atraes interatmicas e intermoleculares, esse carter hidrossolvel justificado pelo fato de a vitamina C apresentar uma estrutura composta de: (A) heterotomos (B) ons aglomerados (C) dipolos permanentes (D) carbonos assimtricos

Questo 42
Dois atletas partem simultaneamente do ponto A, com movimento uniforme, e chegam ao mesmo tempo ao ponto C. Um deles segue a trajetria AC, com velocidade v1 km/h, e o outro segue a trajetria ABC, com velocidade v2 km/h, conforme ilustra a figura abaixo.
A

Sendo a e c, respectivamente, as medidas, em quilmetros, dos catetos BC e BA , podemos afirmar que


v2 v1

corresponde a:

(A)

a2 + c 2 a+c a2 + c2 a+ c a+c a + c2 a2 + c 2 a+c


1 Exame de Qualificao |
2

(B)

(C)

(D)

28

| Vestibular Estadual 2005

297

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 43
A equao qumica, a seguir, representa uma das etapas da obteno industrial do cido sulfrico.

2 SO2(g) + O2(g)

2 SO3(g) + 196 kJ

Medindo-se as concentraes de cada substncia desta reao em funo do tempo, sob temperatura constante, obtm-se o seguinte grfico:
[ ]
0,8

[SO 3] = 0,50 mol


0,4

L 1 L 1 L 1
tempo

[SO 2] = 0,32 mol [O2] = 0,12 mol

Aps ter sido atingido o estado de equilbrio, foram retiradas quatro amostras desse sistema, mantendo-se constantes as condies de equilbrio. Cada uma dessas amostras foi submetida a uma ao diferente. Observe, a seguir, os grficos que representam os resultados obtidos em cada amostra.
[ ]
0,8

[ ]
0,8

[SO3] = 0,60 mol L1


0,4 0,4

[SO3] = 0,44 mol L1 [SO2] = 0,38 mol L1 [O2] = 0,15 mol L1

[SO2] = 0,22 mol L1 [O2] = 0,07 mol L1


tempo

tempo

[ ]
0,8

[ ]
0,8

[SO3] = 0,60 mol L1


0,4

[SO3] = 0,50 mol L1


0,4

[SO2] = 0,38 mol L1 [O2] = 0,15 mol L1


tempo

[SO2] = 0,32 mol L1 [O2] = 0,12 mol L1


tempo

Os resultados das aes de aquecimento e de adio de catalisador esto indicados, respectivamente, pelos grficos de nmeros: (A) I e III (B) I e IV (C) II e IV (D) III e II
1 Exame de Qualificao |

29

| Vestibular Estadual 2005

298

CINCIAS HUMANAS E SUAS TECNOLOGIAS CINCIAS HUMANAS E SUAS TECNOLOGIAS

A PROVA DESTA REA TEM COMO TEMA A TERRA, O TRABALHO E OS MOVIMENTOS SOCIAIS EM DIFERENTES TEMPOS E ESPAOS. Questo 44
Observe a charge abaixo que apresenta uma crtica relao estabelecida entre as sociedades centrais e perifricas do Capitalismo no que diz respeito ao domnio das tecnologias.

(Jornal da Campanha contra a ALCA, agosto de 2002)

Esta crtica se justifica pelo exposto na seguinte alternativa: (A) a pesquisa em tecnologia reduz fluxos de capitais (B) a concentrao tecnolgica hierarquiza relaes econmicas (C) a legislao sobre propriedade intelectual agiliza trocas mercantis (D) a capacidade tecnolgica diferenciada inviabiliza relaes comerciais

Questo 45
O Grande Rio uma das regies metropolitanas com maior incidncia de trabalhadores informais do pas. Em 1998, trabalhadores sem carteira assinada e autnomos representavam 42,4% da fora de trabalho, contra 43,1% dos empregados com carteira. A inverso, ao que parece, questo de tempo. (...) A economista Valria Pero afirma que a decadncia da qualidade do emprego na regio metropolitana foi causada pela desindustrializao (...).
(BARBOSA, Flvia. Jornal do Brasil, 30/05/1999.)

O texto aponta uma das conseqncias do processo de desindustrializao. De acordo com a lgica atual de localizao dos investimentos e da produo, uma alternativa possvel para superar a decadncia econmica da regio metropolitana : (A) reestruturao setorizada da mo-de-obra, viabilizando o retorno das indstrias (B) articulao poltica com o governo estadual, resgatando a funo financeira da capital (C) reorganizao da legislao trabalhista, favorecendo as empresas ainda nela instaladas (D) realizao de investimentos a partir da infra-estrutura existente, redefinindo o seu papel econmico
1 Exame de Qualificao |

30

| Vestibular Estadual 2005

299

CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 46
Povoando dramaticamente esta paisagem e esta realidade social e econmica, vagando entre o sonho e o desespero existem 4.800.000 famlias de rurais sem terras. A terra est ali, diante dos olhos e dos braos, uma imensa metade de um pas imenso, mas aquela gente (quantas pessoas ao todo? 15 milhes? mais ainda?) no pode l entrar para trabalhar, para viver com a dignidade simples que s o trabalho pode conferir, porque os voracssimos descendentes daqueles homens que haviam dito: Esta terra minha (...) rodearam a terra de leis que os protegem (...).
(SARAMAGO, Jos. In: MORISSAWA, Mitsue. A Histria da luta pela terra e o MST. So Paulo: Expresso Popular, 2001.)

OS SERTES
Foi no sculo passado No interior da Bahia Um homem revoltado com a sorte Do mundo em que vivia Ocultou-se no serto Espalhando a rebeldia (...) Defendendo Canudos Naquela guerra fatal.
Edeor de Paulo Samba-enredo da escola de samba Em Cima da Hora, 1976

Os dois textos acima tm como principais elementos geradores das problemticas apontadas os processos de: (A) assentamento agrcola e xodo rural (B) proletarizao rural e reforma agrria (C) modernizao agrcola e revolta social (D) concentrao fundiria e conflitos no campo

Questo 47
A violncia no Brasil mata mais do que a guerra na Colmbia. O custo do aparato de segurana, de proteo privada e das perdas econmicas chega a 7% do PIB. S com turismo o Brasil poderia estar recolhendo US$ 7 bilhes em divisas, mas recebe menos turistas do que o Uruguai. A violncia tambm um problema econmico, alm de ser uma tragdia social.
(LEITO, Mriam. O Globo, 15/08/2003.)

O modelo carioca de segregao social combina distncia social com proximidade fsica. Voc tem um espao muito polarizado nas reas nobres (...). Isso cria possibilidade de uma interao social entre grupos (...). O Rio o que muito em funo dessa proximidade entre ricos e pobres. (...) Toda essa violncia (...) est cortando um pouco essa mistura social.(...)
(RIBEIRO, Luiz Cesar. O Globo, 28/04/2001.)

Os textos acima apontam a gravidade da questo da segurana em grandes cidades como o Rio de Janeiro. Com base nessas leituras, pode-se dizer que a violncia tem como desdobramento: (A) o retraimento da economia, ampliando sua terceirizao (B) a intensificao dos conflitos espaciais, promovendo a polarizao poltica (C) a instabilidade do quadro scio-econmico, enfraquecendo a identidade coletiva (D) a degradao de antigos espaos produtivos, reduzindo a disponibilidade de mo-de-obra

1 Exame de Qualificao |

31

| Vestibular Estadual 2005

300

CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 48

(Nossa Histria, maio de 2004)

(Folha de So Paulo, 25/04/2004)

As imagens acima nos remetem a diferentes momentos histricos das celebraes do 1 de maio no Brasil. Assim como no Estado Novo e nos dias de hoje, desde o incio do sculo passado, o trabalho tem sido alvo de ateno. No perodo da Repblica Velha, a instituio responsvel pela mediao da relao capital-trabalho e sua respectiva base jurdica eram: (A) empresariado normas do Ministrio do Trabalho (B) sindicato direitos constitucionais dos operrios (C) Estado legislao trabalhista consolidada (D) polcia leis do trabalho incipientes

Questo 49
PERGUNTAS DE UM OPERRIO QUE L
Para onde foram os pedreiros Na noite em que ficou pronta a Muralha da China?
Bertold Brecht

BRASIL
Brasil Mostra a tua cara Quero ver quem paga Pra gente ficar assim
Cazuza / George Israel / Nilo Romero

O poema de Brecht e a letra da msica de Cazuza nos remetem ao papel dos trabalhadores como sujeitos da histria em diferentes momentos. O trabalho em sociedades contemporneas como a brasileira pode ser caracterizado pela tendncia progressiva de: (A) crescimento de mo-de-obra informal, ampliando o setor industrial (B) aumento da demanda por trabalho qualificado, estimulando a imigrao (C) reduo do nmero de trabalhadores ativos, estagnando o setor agrrio (D) fragilizao das relaes de trabalho, inchando o setor de comrcio e de servios
1 Exame de Qualificao |

32

| Vestibular Estadual 2005

301

CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 50
TERRAS INDGENAS E DIAMANTES

Obs. Mapa montado a partir do cruzamento de dados do DNPM (Departamento Nacional de Produo Mineral) com informaes da Funai (reservas demarcadas e em processo de demarcao).

(Adaptado de Folha de So Paulo, 25/04/2004)

Considerando as informaes do mapa, a atual poltica de Estado em relao s terras indgenas deve estar voltada para o atendimento dos seguintes objetivos constitucionais: (A) garantir a posse das terras e controlar a explorao do subsolo (B) ampliar limites demogrficos e incentivar a extrao mineral nas reservas (C) expandir a variedade das atividades agrcolas e terceirizar a mo-de-obra local (D) impulsionar a explorao do solo e do subsolo e delimitar a explorao das terras agriculturveis

1 Exame de Qualificao |

33

| Vestibular Estadual 2005

302

CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 51
PRA NO DIZER QUE NO FALEI DAS FLORES
Caminhando e cantando, E seguindo a cano Somos todos iguais, Braos dados ou no. Nas escolas, nas ruas, Campos e construes, Caminhando e cantando, E seguindo a cano.
Geraldo Vandr

A letra desta msica foi escrita no contexto do regime militar, iniciado com o Golpe de 1964. Uma das medidas polticas reveladora do carter autoritrio desse regime est apresentada, corretamente, em: (A) instituio do AI N 2, extinguindo os partidos polticos existentes (B) promulgao da Constituio de 1967, abolindo a diviso de poderes (C) supresso do Poder Legislativo, gerando a institucionalizao da ditadura (D) criao da Lei de Imprensa, impondo a estatizao dos meios de comunicao

Questo 52
Ou esto do nosso lado ou do lado dos terroristas.
George W. Bush

Com um fervor patritico e unio nacional nunca vistos desde a II Guerra Mundial, os Estados Unidos vo ao contra-ataque ao terror.
(Veja, 26/09/2001)

As relaes internacionais vm, nos ltimos anos, dando cada vez mais destaque discusso sobre o terrorismo. Neste sentido, as atuais aes norte-americanas no espao poltico do Oriente Mdio tm por objetivo: (A) inserir sociedades perifricas nos fluxos globais de produo e informao (B) alterar as diretrizes das polticas interna e externa dos pases dessa regio (C) democratizar as monarquias totalitrias e fomentadoras do terrorismo internacional (D) neutralizar os movimentos favorveis ocidentalizao das instituies polticas e jurdicas

1 Exame de Qualificao |

34

| Vestibular Estadual 2005

303

CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 53
A DEPENDNCIA DO PETRLEO

A crescente demanda de energia no mundo atual, fruto da dinmica do Capitalismo, est condicionada ao seguinte fator: (A) expanso industrial dos pases perifricos (B) distribuio regular das fontes energticas (C) retrao dos recursos energticos disponveis (D) padro de consumo dos centros dinmicos

Questo 54
Um dos traos marcantes do atual perodo histrico , pois, o papel verdadeiramente desptico da informao. Conforme j vimos, as novas condies tcnicas deveriam permitir a ampliao do conhecimento do planeta, dos objetos que o formam, das sociedades que o habitam e dos homens em sua realidade intrnseca. Todavia, nas condies atuais, as tcnicas da informao so principalmente utilizadas por um punhado de atores em funo de seus objetivos particulares (...) aprofundando assim os processos de criao de desigualdades.
(SANTOS, Milton. Por uma outra globalizao. Rio de Janeiro: Record, 2000.)

As redes informacionais criadas pela globalizao so criticadas pelo autor por elas agirem no sentido de: (A) reforar interesses polticos, contrapondo objetivos econmicos (B) ampliar a acumulao capitalista, difundindo a ideologia dominante (C) romper com a barreira espao-tempo, desarticulando a estrutura de governo (D) favorecer os interesses da grande mdia, criando contradies entre as elites econmicas

1 Exame de Qualificao |

35

| Vestibular Estadual 2005

304

CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 55
A Agncia Nacional de guas comeou a criar mercados estaduais de gua no Nordeste. (...) Os produtores rurais da regio do Baixo Jaguaribe vo pagar R$ 0,01 para assegurar o direito a consumir cada mil litros (m3) de gua. Os recursos arrecadados vo indenizar aqueles agricultores que ficaro sem gua para irrigar a produo, desde que estejam dispostos a partir para novos tipos de cultura (...) de alto valor agregado, como a fruticultura, (...) mais rentvel que arroz e feijo, culturas que no so propcias regio seca (...). O volume de gua armazenada na bacia do rio Jaguaribe s ser suficiente para atender metade da demanda do setor agrcola neste ano. O objetivo preparar a regio apenas para a produo de culturas que so de alto valor agregado e que economizem gua.
(Adaptado de LEAL, Gabriela. Jornal do Brasil, 20/08/2001.)

No texto, as relaes entre manejo adequado dos recursos ambientais e crescimento econmico so apresentadas basicamente como instrumento de: (A) monopolizao dos recursos hdricos (B) potencializao do processo produtivo (C) fomentao de servios e produtos lucrativos (D) excluso dos atores econmicos menos dinmicos

Questo 56
RETRATO DO VELHO
Bota o retrato do velho outra vez Bota no mesmo lugar O sorriso do velhinho Faz a gente se animar, oi. (...) O sorriso do velhinho Faz a gente trabalhar.
Marino Pinto e Haroldo Lobo

A CULPA DO GOVERNO
Bossa-nova mesmo ser presidente desta terra descoberta por Cabral. Para tanto basta ser to simplesmente simptico... risonho... original.
Juca Chaves

Os estilos de governar de Getlio Vargas e de Juscelino Kubitschek so abordados nas letras de msica acima. Um elemento comum das polticas econmicas destes dois governos est indicado na seguinte alternativa: (A) trabalhismo (B) monetarismo (C) industrialismo (D) corporativismo

1 Exame de Qualificao |

36

| Vestibular Estadual 2005

305

CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 57
Os limites de Vila Isabel so to confusos que a esttua de Noel Rosa pode estar fora do bairro. O monumento fica na Praa Maracan, no incio do Boulevard Vinte e Oito de Setembro, no Maracan. Estranho, no? Como Vila Isabel est entrelaada com Andara, Graja, Engenho Novo, Tijuca e Maracan, essa geografia confunde a populao.
(Adaptado de Notcias da Vila. Faculdade de Comunicao Social / UERJ. Rio de Janeiro, maio, 2002.)

O texto apresenta a dificuldade no reconhecimento de limites geogrficos estabelecidos para determinado lugar. A origem desta dificuldade est relacionada ao seguinte fator: (A) a dinmica scio-espacial que cria limites territoriais difusos (B) as tradies culturais que produzem espaos indiferenciados (C) a ao dos interesses econmicos que impedem a delimitao dos espaos (D) os fluxos sociais que cristalizam a diviso poltico-administrativa dos lugares

Questo 58
O tecido social brasileiro sofre um contnuo e histrico processo de esgaramento em funo das desigualdades sociais e da ausncia de um ideal coletivo de progresso e bem-estar. A expulso de trabalhadores do campo interfere na dinmica interna das cidades, determinando alteraes na hierarquia urbana. Uma importante conseqncia desse fluxo migratrio a: (A) reduo dos servios urbanos (B) favelizao das reas perifricas (C) atrofia do mercado de consumo (D) retrao do mercado imobilirio

Questo 59
A maior notcia que neste momento o governo pode dar ao pas (...): trata-se dos 50 milhes de hectares que, at o comeo de dezembro, sero tomados de grileiros no Amazonas. quase um tero do estado, que tem 153 milhes de hectares. Mas s um quarto maior do que os 39,6 milhes de hectares cancelados at a semana passada, sem qualquer anncio oficial. (...) A desembargadora Marinildes Costeira de Mendona Lima encontrou municpios em que havia mais grilagem do que terras.
(CORRA, Marcos S. Jornal do Brasil, 28/10/2001.)

Em contraponto grande disponibilidade de terras, o processo de grilagem na Amaznia avana associado seguinte situao: (A) especulao fundiria, buscando maior lucratividade (B) demanda acentuada por terra, determinando novas invases (C) procura de terras devolutas, ampliando a produo agrcola extensiva (D) ausncia da fiscalizao do Estado, propiciando o aumento de latifndios
1 Exame de Qualificao |

37

| Vestibular Estadual 2005

306

CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 60
CLASSES DE PIB PER CAPITA NA EUROPA DOS 25

(Adaptado de Jornal Mundo Geografia e Poltica Internacional, abril de 2004)

A alternativa que descreve, adequadamente, um dos fatores responsveis pela variao do PIB per capita entre pases pertencentes Unio Europia : (A) decadncia industrial nos pases de baixa renda, resultante do modelo econmico liberal engendrado durante a Guerra Fria (B) avano histrico da industrializao nos pases de mdia renda per capita, decorrente da modernizao da agricultura no final do sculo XX (C) desenvolvimento do capitalismo nos pases nrdicos de alta renda, em funo da afirmao do Estado Mnimo a partir da segunda metade do sculo XX (D) crescimento das economias nos pases com alta renda per capita, devido s diferentes correlaes de foras estabelecidas na reconstruo europia do ps-guerra

1 Exame de Qualificao |

38

| Vestibular Estadual 2005

307

1 EXAME DE QUALIFICAO - VESTIBULAR 2005 GABARITO OFICIAL 22 - B 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 C D B C B B D A A D B A C C A A D D C D C

01 - B 02 - A 03 04 05 06 07 08 09 10 11 12 13 14 15 D C D B B C D A A C D B A

ESPANHOL

44 - B 45 - D 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 D C D D A A B D B B C A B A D

16 - A 17 18 19 20 21 B D C B D

FRANCS

16 17 18 19 20 21

D B D A A C

INGLS

16 17 18 19 20 21

A C B A B D

308

20 EXAME DE QUALIFICAO 22/08/2004


Neste caderno voc encontrar um conjunto de 40 (quarenta) pginas numeradas seqencialmente, contendo 60 (sessenta) questes das seguintes reas: LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS; CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS; CINCIAS HUMANAS E SUAS TECNOLOGIAS. A tabela peridica encontra-se na pgina 39. No abra o caderno antes de receber autorizao.

INSTRUES
1. Verifique se o seu nome, nmero de inscrio, nmero do documento de identidade e lngua estrangeira escolhida esto corretos no carto de respostas. Se houver erro, notifique o fiscal. Assine o carto de respostas com caneta. 2. Ao receber autorizao para abrir este caderno, verifique se a impresso, a paginao e a numerao das questes esto corretas. Caso ocorra qualquer erro, notifique o fiscal. 3. As questes de nmeros 16 a 21 da rea de LINGUAGENS , C DIGOS E SUAS TECNOLOGIAS devero ser respondidas de acordo com a sua opo de Lngua Estrangeira: ESPANHOL, FRANCS ou INGLS. 4. Leia atentamente cada questo e escolha a alternativa que mais adequadamente responde a cada uma delas. Marque sua resposta no carto de respostas, cobrindo fortemente o espao correspondente letra a ser assinalada; utilize caneta preta, preferencialmente, ou lpis preto n 2, conforme o exemplo abaixo:

5. A leitora de marcas no registrar as respostas em que houver falta de nitidez e/ou marcao de mais de uma letra. 6. O carto de respostas no pode ser dobrado, amassado, rasurado ou manchado. Exceto sua assinatura, nada deve ser escrito ou registrado fora dos locais destinados s respostas. 7. Voc dispe de 4 (quatro) horas para fazer esta prova. 8. Ao terminar a prova, entregue ao fiscal o carto de respostas e este caderno.

BOA PROVA!

309

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

NA COMUNICAO, CONSTRUMOS SENTIDOS EM UM PROCESSO QUE OSCILA ENTRE CONTROLE E NEGOCIAO, PODER E COMPREENSO, CONQUISTA E ENTREGA... ATRAO. EIS A RAZO PELA QUAL OS TEXTOS DE NOSSA PROVA ABORDAM A LINGUAGEM E A SEDUO: COMUNICANDO- NOS, SEGUIMOS TRILHAS QUE PODEM NOS ENREDAR EM CILADAS E ARMADILHAS, MAS TAMBM NOS LEVAR EM DIREO AO OUTRO, CRIANDO INTIMIDADE E CUMPLICIDADE...
Com base no texto abaixo, responda s questes de nmeros 01 a 04.

MYSTERIUM

Eu vi ainda debaixo do sol que a corrida no para os mais ligeiros, nem a batalha para os mais fortes, nem o po para os mais sbios, nem as riquezas para os mais inteligentes, mas tudo depende do tempo e do acaso. ECLESIASTES

05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30

Ao tempo e ao acaso eu acrescento o gro de imprevisto. E o gro da loucura, a razovel loucura que infinita na nossa finitude. Vejo minha vida e obra seguindo assim por trilhos paralelos e to prximos, trilhos que podem se juntar (ou no) l adiante mas tudo sem explicao, no tem explicao. Os leitores pedem explicaes, so curiosos e fazem perguntas. Respondo. Mas se me estendo nas respostas, acabo por pular de um trilho para outro e comeo a misturar a realidade com o imaginrio, fao fico em cima de fico, ah! Tanta vontade (disfarada) de seduzir o leitor, esse leitor que gosta do devaneio. Do sonho. Queria estimular sua fantasia mas agora ele est pedindo lucidez, quer a luz da razo. No gosto de teorizar porque na teoria acabo por me embrulhar feito um caramelo em papel transparente, me d um tempo! Eu peo. Quero ficar fria, espera. Espera que estou me aventurando na busca das descobertas, Devagar j pressa!, disse Guimares Rosa. Preciso agora atravessar o cipoal2 dos detalhes e so tantos! E tamanha a minha perplexidade diante do processo criador, Deus! Os indevassveis signos e smbolos. Ainda assim, avano em meio da nvoa, quero ser clara em meio desse claro que de repente ficou escuro, estou perdida? Mais perguntas, como nasce um conto? E um romance? Recorro a uma certa aula distante (Antonio Candido) onde aprendi que num texto literrio h sempre trs elementos: a idia, o enredo e a personagem. A personagem, que pode ser aparente
1 2

235 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55

ou inaparente, no importa. Que pode ser nica ou se repetir, tive uma personagem que recorreu mscara para no ser descoberta, quis voltar num outro texto e usou disfarce, assim como faz qualquer ser humano para mudar de identidade. Na tentativa de reter o questionador, acabo por inventar uma figurao na qual a idia representada por uma aranha. A teia dessa aranha seria o enredo. A trama. E a personagem, o inseto que chega naquele vo livre e acaba por cair na teia da qual no consegue fugir, enleado pelos fios grudentos. Ento desce (ou sobe) a aranha e nhac! Prende e suga o inseto at abandon-lo vazio. Oco. O questionador acha a imagem meio dramtica mas divertida, consegui faz-lo sorrir? Acho que sim. Contudo, h aquele leitor desconfiado, que no se deixou seduzir porque quer ver as personagens em plena liberdade e nessa representao elas esto como que sujeitas a uma destinao. A uma condenao. E cita Jean-Paul Sartre que pregava a liberdade tambm para as personagens, ah! Odiosa essa fatalidade dos seres humanos (inventados ou no) caminhando para o bem e para o mal. Sem mistura. Comeo a me sentir prisioneira dos prprios fios que fui inventar, melhor voltar s divagaes iniciais onde vejo (como eu mesma) o meu prximo tambm embrulhado. Ou embuado3 ? Desembrulhando esse prximo, tambm vou me revelando e na revelao, me deslumbro para me obumbrar4 novamente nesta viragem-voragem do ofcio.
(TELLES, Lygia Fagundes. Durante aquele estranho ch: perdidos e achados. Rio de Janeiro: Rocco, 2002.)

palavra latina para mistrio mato abundante de cips

3 4

escondido cobrir de sombras

2 Exame de Qualificao |

| Vestibular Estadual 2005

310

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 01
O ttulo do texto de Lygia Fagundes Telles relaciona-se com o processo de construo da narrativa literria. Nesse sentido, a alternativa que melhor justifica o ttulo Mysterium : (A) surpresa da narradora diante do ato de criao (B) explorao de idias contrrias ao longo da narrao (C) combinao do texto ficcional com referncias bblicas (D)predominncia de elementos da fico sobre os da realidade

Questo 02
Todo texto pressupe relaes com outros textos, por isso nele esto presentes vrias vozes, que podem ser reconhecidas com maior ou menor facilidade. A isso chamamos intertextualidade. Um exemplo de intertextualidade cujo sentido est corretamente definido verifica-se em: (A) mas tudo depende do tempo e do acaso. (epgrafe Eclesiastes) afirmar a existncia de um momento certo para escrever (B) Devagar j pressa!, disse Guimares Rosa. (! . 19 - 20) revelar o sentido da obra ao leitor pouco a pouco (C) Recorro a uma certa aula distante (Antonio Candido) (!. 27 - 28) esclarecer o modo de construo do texto literrio (D)E cita Jean-Paul Sartre que pregava a liberdade tambm para as personagens, (!. 50 - 51) criticar o poder das personagens no processo de criao literria

Questo 03
As figuras de linguagem so recursos que afastam as construes lingsticas de seu valor literal, com o objetivo de tornar essas construes mais expressivas. O emprego de uma figura de linguagem e sua correta nomeao esto presentes em: (A) E o gro da loucura, a razovel loucura que infinita na nossa finitude. (!. 2 - 3) aluso (B) Ainda assim, avano em meio da nvoa, (!. 23) metfora (C) quero ser clara em meio desse claro que de repente ficou escuro, (!. 24 - 25) ironia (D)O questionador acha a imagem meio dramtica mas divertida, (!. 44 - 45) metonmia

Questo 04
(...)tive uma personagem que recorreu mscara para no ser descoberta, quis voltar num outro texto e usou disfarce, assim como faz qualquer ser humano para mudar de identidade. (!. 32 - 35)
Esse fragmento revela um ponto de vista da autora acerca da autonomia das personagens de suas obras. A passagem do texto que no confirma esse ponto de vista : (A) e comeo a misturar a realidade com o imaginrio, fao fico em cima de fico, (!. 9 - 11) (B) E tamanha a minha perplexidade diante do processo criador, Deus! Os indevassveis signos e smbolos. (! . 21 - 23) (C) A personagem, que pode ser aparente ou inaparente, no importa. Que pode ser nica ou se repetir, (!. 30 - 32) (D)nessa representao elas esto como que sujeitas a uma destinao. A uma condenao. (! . 48 - 49)
2 Exame de Qualificao |

| Vestibular Estadual 2005

311

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Com base no texto abaixo, responda s questes de nmeros 05 a 07.


Carlos estava homem. Sem que se amedrontasse, assuntou a noite envelhecer. S reparou no vagar dela. Muito sereno, porm apressado.
05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26
(ANDRADE, Mrio de. Amar, verbo intransitivo. Belo Horizonte/Rio de Janeiro: Itatiaia, 2002.)
1 2 3 4 5

Aos poucos se apagaram as bulhas1 da casa, vinte e trs horas. Se irritou com a impacincia chegando, que o fazia banzar2 pelo quarto assim, e lhe dava sensao do prisioneiro que espera o minuto pra fugir. Puxa! Corao aos priscos3 . A calma era exterior. No. O corao tambm se fatigou e sentou. Carlos tambm sentou. Cruzou os braos pra no mexer tanto assim, disposto a esperar com pacincia. Tomou o cuidado de pr o brao esquerdo sobre o outro, que assim o relgio ficava mostra na munheca. E os minutos se acabando, tardonhos 4. Alis nem tinha pressa mais, o aproximar da aventura lhe apaziguava as ardncias. Resfriado. Qualquer coisa lhe tirava o calor dos dedos... Se lembrou de vestir pijama limpo, fez. Depois pensou. No tinha propsito trocar de pijama s porque. (...) Vestiu outra vez o pijama usado e se reconciliou consigo, j confiante. E outra vez se sentou. Olhava a imobilidade dos ponteiros que lhe abririam a porta de Frulein5. Que o entregariam a Frulein. Uma comoo

30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45

doce, quase filial esquentou Carlos novamente. E porque amava sem temor nem pensamento, sem gozo, apenas por instinto e por amor, por gozo, iria se entregar. Est certo. Carlos amava com paixo. A imobilidade a sala de espera do sono. Procurou ler e cochilou. Vinte e trs e trinta, se ergueu. Caceteao esperar! Tambm o momento estava estourando por a, graas a Deus! Sentou na cama. Mais vinte e sete minutos. Vinte e seis... Vinte e cinco... Vinte e... Nos braos cruzados sobre a guarda da cama, a cabea dele pousou. A posio incmoda acordou Carlos. Espreguiou, empurrando com as mos a dor do corpo, sentado por qu? Ah! Lembrana viva enxota qualquer sono. Hora e meia! Desejo furioso subiu. Sem reflexo, sem vergonha da fraqueza, corre pra porta de Frulein. Fechada! Bate. Bate forte, com risco de acordar os outros, bate at a porta se abrir, entra. Aqui devem se trocar naturalmente umas primeiras frases de explicao se ele der espao para tanto entre os dois! porm obedeo a vrias razes que obrigam-me a no contar a cena do quarto.

sons meditar saltos lentos em alemo, forma de tratamento para senhorita

Questo 05
Amar, verbo intransitivo nos fala sobre a iniciao amorosa do adolescente Carlos por sua preceptora, Frulein Elza, contratada pelo pai do rapaz para tal tarefa. No texto, a passagem que melhor resume as mudanas ocorridas no jovem em virtude da descoberta do amor : (A) Carlos estava homem. (! . 1) (B) A calma era exterior. (! . 8 - 9) (C) Carlos tambm sentou. (!. 10) (D)Alis nem tinha pressa mais, (! . 15 - 16)

2 Exame de Qualificao |

| Vestibular Estadual 2005

312

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 06
O foco narrativo um dos elementos que organizam o texto, definindo o ponto de vista de quem conta a histria e delimitando a situao narrada por meio de diversas estratgias. No fragmento apresentado, o narrador no faz uso da seguinte estratgia: (A) dirigir-se diretamente ao leitor, comentando os fatos narrados (B) expor as prprias idias, deixando suas percepes na narrativa (C) empregar a terceira pessoa, criticando as aes do personagem principal (D)mostrar conhecimento das emoes dos personagens, revelando-lhes os pensamentos

Questo 07
Aqui devem se trocar naturalmente umas primeiras frases de explicao se ele der espao para tanto entre os dois! porm obedeo a vrias razes que obrigam-me a no contar a cena do quarto. (! . 46 - 50)
O narrador opta por no descrever o encontro entre os amantes, no declarando suas razes para isso. Essa opo do narrador pode ser confirmada na seguinte passagem do texto: (A) Aos poucos se apagaram as bulhas da casa, vinte e trs horas. (!. 4 - 5) (B) o aproximar da aventura lhe apaziguava as ardncias. (!. 16 - 17) (C) No tinha propsito trocar de pijama s porque. (!. 19 - 20) (D)Sem reflexo, sem vergonha da fraqueza, corre pra porta de Frulein. (!. 41 - 43)

Com base no texto abaixo, responda s questes de nmeros 08 a 10.


Lri, pela primeira vez na sua vida, sentiu uma fora que mais parecia uma ameaa contra o que ela fora at ento. Ela ento falou sua alma para Ulisses:
05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20

_ Sim.
Lri estava suavemente espantada. Ento isso era a felicidade. De incio se sentiu vazia. Depois seus olhos ficaram midos: era felicidade, mas como sou mortal, como o amor pelo mundo me transcende. O amor pela vida mortal a assassinava docemente, aos poucos. E o que que eu fao? Que fao da felicidade? Que fao dessa paz estranha e aguda, que j est comeando a me doer como uma angstia, como um grande silncio de espaos? A quem dou minha felicidade, que j est comeando a me rasgar um pouco e me assusta. No, no quero ser feliz. Prefiro a mediocridade. Ah, milhares de pessoas no tm coragem de pelo menos prolongar-se um pouco mais nessa coisa desconhecida que sentir-se feliz e preferem a mediocridade. Ela se despediu de Ulisses quase correndo: ele era o perigo.
(LISPECTOR, Clarice. Uma aprendizagem ou O livro dos prazeres. Rio de Janeiro: Francisco Alves, 1990.)

soberba versus a minha extrema individualidade de pessoa mas seremos um s.

_ Um dia ser o mundo com sua impersonalidade

25 26 27 28 29 30 31 32 33 34 35

Olhou para Ulisses com a humildade que de repente sentia e viu com surpresa a surpresa dele. S ento ela se surpreendeu consigo prpria. Os dois se olharam em silncio. Ela parecia pedir socorro contra o que de algum modo involuntariamente dissera. E ele com os olhos midos quis que ela no fugisse e falou:

_ Repita o que voc disse, Lri. _ No sei mais.


literalmente disse: um dia ser o mundo com sua impersonalidade soberba versus a minha extrema individualidade de pessoa mas seremos um s.
2 Exame de Qualificao |

_ Mas eu sei, eu vou saber sempre. Voc

| Vestibular Estadual 2005

313

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 08
Uma aprendizagem ou O livro dos prazeres tem como protagonista uma personagem Lri , que se depara com a descoberta do amor em sua totalidade, iniciando a busca do reconhecimento de si mesma, do mundo e do outro Ulisses. A alternativa que melhor expressa esse processo de descoberta pela personagem Lri : (A) S ento ela se surpreendeu consigo prpria. ( !. 10) (B) Os dois se olharam em silncio. (! . 11) (C) E ele com os olhos midos quis que ela no fugisse (!. 13 - 14) (D) Mas eu sei, eu vou saber sempre. (!. 17)

Questo 09
_ Um dia ser o mundo com sua impersonalidade soberba versus a minha extrema individualidade de pessoa mas seremos um s. (!. 5 - 7)
Nessa declarao, o discurso da personagem se estrutura a partir de um raciocnio que pode ser caracterizado como: (A) silogstico (B) dedutivo (C) dialtico (D)indutivo

Questo 10
Ela se despediu de Ulisses quase correndo: ele era o perigo. (!. 38 - 39)
Na percepo de Lri, Ulisses representa o perigo. Pela leitura do texto, isso se explica porque ele foi capaz de: (A) amea-la com uma crtica inesperada (B) assust-la com uma interpretao insensvel (C) contrari-la com um questionamento irnico (D)inquiet-la com um sentimento desconhecido

2 Exame de Qualificao |

| Vestibular Estadual 2005

314

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Com base no texto abaixo, responda s questes de nmeros 11 a 13.

AS S EM-RAZES DO AMOR
Eu te amo porque te amo. No precisas ser amante, e nem sempre sabes s-lo. Eu te amo porque te amo. Amor estado de graa e com amor no se paga. Amor dado de graa, semeado no vento, na cachoeira, no eclipse. Amor foge a dicionrios e a regulamentos vrios. Eu te amo porque no amo bastante ou demais a mim. Porque amor no se troca, no se conjuga nem se ama. Porque amor amor a nada, feliz e forte em si mesmo. Amor primo da morte, e da morte vencedor, por mais que o matem (e matam) a cada instante de amor.
(ANDRADE, Carlos Drummond de. Corpo. Rio de Janeiro: Record, 2002.)

05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20

Questo 11
No ttulo do poema, est presente um jogo de idias contrrias que problematiza o amor sentimento de muitas razes e de razo alguma. Os versos que melhor expressam a problematizao do sentimento amoroso esto transcritos em: (A) No precisas ser amante, / e nem sempre sabes s-lo. (v. 2 - 3) (B) Amor estado de graa / e com amor no se paga. (v. 5 - 6) (C) semeado no vento, / na cachoeira, no eclipse. (v. 8 - 9) (D)Amor primo da morte, / e da morte vencedor, (v. 18 - 19)

Questo 12
Na terceira estrofe do poema, verifica-se um movimento de progresso textual que reitera as razes para o amor. Essa progresso est caracterizada pela repetio do seguinte procedimento lingstico: (A) construo frasal em ordem indireta (B) estrutura sinttica em paralelismo (C) pontuao com efeito retrico (D)rima como recurso fonolgico
2 Exame de Qualificao |

| Vestibular Estadual 2005

315

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 13
Amor primo da morte, e da morte vencedor, por mais que o matem (e matam) a cada instante de amor.
Os dois ltimos versos transcritos estabelecem com os dois anteriores uma relao de: (A) conformidade (B) causalidade (C) concesso (D)concluso

Com base na propaganda abaixo, responda s questes de nmeros 14 e 15.

(In: CARVALHO, Nelly de. Publicidade : a linguagem da seduo. So Paulo: tica, 2003.)

2 Exame de Qualificao |

| Vestibular Estadual 2005

316

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Questo 14
Para atrair a ateno do receptor, essa propaganda substitui o discurso autoritrio pela linguagem da seduo. Dentre os recursos para seduzir seu pblico-alvo, a propaganda no se utiliza de: (A) diminutivos que invocam a inocncia e o poder de atrao de potenciais consumidoras (B) marcas de interlocuo que atraem a ateno e a confiana para o produto anunciado (C) enfoques sintticos que harmonizam a imagem apresentada e as seqncias textuais (D)ironias que destacam a idia de prazer e a possibilidade de novas conquistas

Questo 15
A citao de um conto infantil Chapeuzinho Vermelho desperta a simpatia do consumidor para o produto anunciado ao compartilhar conhecimentos. Na propaganda apresentada, esse conto retomado pelo uso da seguinte estratgia: (A) eliminao de seus personagens originais (B) valorizao de seu contedo moralizante (C) confirmao de seu final feliz (D)subverso de seu enredo

2 Exame de Qualificao |

| Vestibular Estadual 2005

317

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | ESPANHOL

Com base no texto abaixo, responda s questes de nmeros 16 a 19.

EL LENGUAJE Y SUS TRAMPAS


Durante milenios las palabras encerraban los secretos del nacimiento y de la muerte, del xito y del fracaso, de la vida y de todas sus posibilidades. Los problemas, sin embargo, aparecen cuando comienza a cuestionarse la representacin de los hechos desde el universo del lenguaje. Llegamos as a una primera e inquietante conclusin: las palabras nunca son inocentes o cristalinas, constituyen una realidad compleja. Estn sumergidas en un conjunto de relaciones que si son guiadas por la mala fe o por una intencin torcida desvan su sentido, alteran su contenido y pervierten su significado. Surge as el lenguaje como arma poltica, que en vez de incluir, excluye; en vez de aglutinar, separa; en vez de sumar, resta; en vez de agrupar, dispersa; en vez de permitir, censura, y en vez de ayudar, traiciona. El poder de las palabras, en su lado oscuro, se desarrolla a travs de un entramado expansivo y totalitario que pretende imponer el dominio del significante sobre el significado. De esta manera, el primero, en manos de un poder interesado y corporativo, borra el sentido de lo real, deforma el orden social y poltico y facilita la manipulacin y el engao. (...)
27 28 29 30 31 32

35 06 07 08 09 40 11 12 13 14 45 16 17 18 19 50 21 22 23 24

relevante, lo que se debe hablar y lo que debe ser disimulado u ocultado. As, el poder protege la forma de pensar y actuar de los ciudadanos al informar y modelar nuestra psique. El truco es de sobra conocido: un ejrcito de lexicgrafos al servicio del poder nos vende, desplazados por deportados o expulsados, daos colaterales por vctimas civiles, valla de seguridad por muro de la vergenza, ayuda humanitaria por ocupacin militar en toda regla o movimiento de liberacin nacional por terrorismo. Y esto ocurre para acomodar armoniosamente la realidad a la visin de cada una de las partes dentro de lo que se entiende como polticamente correcto . Las palabras, as utilizadas, esconden la realidad o en el peor de los casos consuman su muerte, y se convierten en mera incoherencia o sonido que ni siquiera llega a tener una clara articulacin de significados. Con toda razn deca Adamov: Gastadas, radas, vacas, las palabras se han vuelto fantasmas en las que nadie cree. (...) Retornar a las palabras esenciales significa decretar una guerra incruenta al lenguaje parasitario, frvolo y truculento, propio de algunos medios de comunicacin, repleto de pontificaciones enlatadas y de lugares comunes que mantienen y propagan la bulimia consumista. Frente a stos, la intransigencia tica debe ser la norma. Frente a un lenguaje prostituido se debe luchar por otro que defienda los valores bsicos de la dignidad, la libertad, la tolerancia y la democracia.
BALTASAR GARZN http://www.elperiodico.es

05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26

55 26 27 28 29 60

En este mercado lingstico, las reglas del discurso gobiernan lo que se dice y queda sin decir e identifican a los que pueden hablar con autoridad y a los que slo deben escuchar y callar. El discurso verbal dominante en la clase poltica determina lo que cuenta como verdadero y

2 Exame de Qualificao |

10

| Vestibular Estadual 2005

318

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | ESPANHOL

Questo 16
En el texto se exponen argumentos sobre el poder de las palabras. Ese poder se justifica si se comprende el lenguaje como: (A) oportunidad de la improvisacin (B) manifestacin de la ideologa (C) espacio de la imaginacin (D)representacin de lo real

Questo 17
El autor considera que a los polticos les interesa establecer un determinado sentido de las palabras como el verdadero. El fragmento que mejor expone el resultado del inters por esa prctica es: (A) Los problemas, (...), aparecen cuando comienza a cuestionarse la representacin de los hechos desde el universo del lenguaje. (!. 4 - 6) (B) El poder de las palabras, en su lado oscuro, se desarrolla a travs de un entramado expansivo y totalitario (! . 19 - 21) (C) As, el poder protege la forma de pensar y actuar de los ciudadanos al informar y modelar nuestra psique. (! . 34 - 36) (D)Las palabras, as utilizadas, esconden la realidad o en el peor de los casos consuman su muerte, (!. 47 - 49)

Questo 18
Observa el fragmento.

(...) desplazados por deportados o expulsados, daos colaterales por vctimas civiles, valla de seguridad por muro de la vergenza, ayuda humanitaria por ocupacin militar en toda regla o movimiento de liberacin nacional por terrorismo. ( !. 39 - 44)
El enunciador emplea las comillas con el propsito de: (A) reforzar la exencin del lenguaje (B) disfrazar su responsabilidad delante del tema (C) atenuar la distancia entre las dos enunciaciones (D)resaltar el enmascaramiento del sentido de las palabras

Questo 19
Frente a un lenguaje prostituido se debe luchar por otro que defienda los valores bsicos de la dignidad, la libertad, la tolerancia y la democracia. (!. 62 - 64)
Lo subrayado en el fragmento se comprende como una idea en la que predomina el sentido de: (A) sugerencia (B) obligacin (C) prevencin (D)advertencia
2 Exame de Qualificao |

11

| Vestibular Estadual 2005

319

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS |

ESPANHOL

Com base nos quadrinhos abaixo, responda s questes de nmeros 20 e 21.

http://www.cienpies.org

Questo 20
Los malentendidos en muchas situaciones de comunicacin suelen ocurrir ya que es posible que con las mismas palabras se comprendan distintas cosas. En la historieta el malentendido resulta de: (A) una disparidad de conocimientos lingsticos (B) un cambio en las reglas gramaticales (C) una inadecuacin en el vocabulario (D)una confusin de base sonora

Questo 21
La hermana mayor no comprende el malentendido, y eso se constata a partir de la presencia de los signos de interrogacin. Esos signos se pueden comprender como indicadores de: (A) perplejidad (B) impaciencia (C) ansiedad (D)enfado

2 Exame de Qualificao |

12

| Vestibular Estadual 2005

320

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | INGLS

Com base no texto abaixo, responda s questes de nmeros 16 a 19.

SEDUCING THE R OMANCE READER


Heart, mind, body and soul, or words to that effect, appear in the climatic scenes of nearly every romance novel, and for good reason. Those words suggest the four levels of fulfillment every reader of romance fiction wants to share with the heroine of the book. A reader of romance fiction is demanding. She buys books with certain definite expectations. She knows the difference between love and lust, and will not settle for the latter without the former. She wants the heroine to be rewarded for virtue, patience and determination. The reward, of course, is the undying love of the hero. There must be a linking of two hearts, unity of two minds, fulfillment of two bodies and the cosmic melding of two souls. To satisfy a reader of romance fiction, the writer must make the seduction complete. Writers of the best romance novels know how to seduce both the heroine and the reader. After reading a great romance, the reader should be satisfied, fulfilled, and ready to search bookstore shelves for more offerings from the same writer. That is a magical and mutually rewarding form of love between writer and reader. How can a writer seduce a reader? The same way she seduces the hero and heroine of her novel. She appeals to heart, mind, body and soul. She first wins the readers heart with appealing characters with whom the reader can identify and empathize. Good romantic heroes and heroines must never be too perfect. A battle scar, a light limp, hair that is an untamable mass of curls, or any other minor flaw will make the character more relatable, more lovable. Totally virtuous characters are more annoying than endearing. A touch of pride, stubbornness, or mischief will enliven the hero and heroine and make them more acceptable to the readers discerning heart. It would be wise for a writer to consider that if a reader shows the good judgment to buy her book, that same reader deserves a fresh plot, logical conclusions and something to stimulate her imagination. Writers of historical romances must be meticulously accurate. Gothic writers have to make sure their mysteries are plausible. Good writers carefully season their stories with interesting facts to provide texture and a feeling of authenticity to their stories. Readers want to be enlightened. A reader knows when an author has really gotten to her. Her body responds. Goose bumps, shivers up her spine, warm feelings deep inside, laughter or even smiles, are physical evidence of the effect of a story on the reader. These reactions are not easily measurable, but they are essential to the seduction of the reader. If the writer finds herself wiping away a few tears when writing, or occasionally finds herself a bit over stimulated and flushed, it is safe to assume the readers body will respond in a similar manner. What could be more fulfilling than a book that caresses the reader with love, wit, sensuality and a feeling of goodness? A romance novel that combines those elements will seduce the reader from the first chapter to the last, leaving her satisfied, but wanting more.
SUSAN DONAHUE http://harris-donahue.tripod.com

35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

05 06 07 08 09 10 11 12 13 14 15 16 17 18 18 20 21 22 23 24 25 26 27 28 29 30 31 32 33

2 Exame de Qualificao |

16

| Vestibular Estadual 2005

321

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | INGLS

Questo 16
The author organizes her ideas in the text in a schematic way that consists of: (A) introducing the writers point of view first and then the readers perspective (B) shifting the focus from the reader to the writer and finally back to the reader (C) describing the writers attributions and the readers perceptions simultaneously (D)drawing the attention to the effects of seduction among writers and the reactions from readers

Questo 17
In the fourth paragraph, the author describes how to seduce readers. This is best expressed in the following statement: (A) Realistic portrayals of characters attract the readers. (B) Protagonists of novels function as role models. (C) Qualities of fictional heroes reflect perfection. (D)Descriptions of females enhance beauty.

Questo 18
It would be wise for a writer to consider that if a reader shows the good judgment to buy her book, that same reader deserves a fresh plot, logical conclusions and something to stimulate her imagination. (!. 39 - 43)
The communicative goal of the sentence above is to: (A) illustrate characteristics of good novels (B) indicate reactions from various readers (C) establish plots for different stories (D)offer advice to romance writers

Questo 19
Pronouns may have different functions according to the contexts where they occur. The use of the pronoun that establishing reference to the previous content of the paragraph is found in: (A) That is a magical and mutually rewarding form (!. 23) (B) A battle scar, a light limp, hair that is an untamable mass of curls, (!. 31 - 32) (C) What could be more fulfilling than a book that caresses the reader"(!. 61 - 62) (D)A romance novel that combines (!. 63 - 64)

2 Exame de Qualificao |

17

| Vestibular Estadual 2005

322

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | INGLS

Com base no cartum abaixo, responda s questes de nmeros 20 e 21.

http://www.badpuns.com

Questo 20
A pun is a play on words, transposing meanings of different words with similar sounds. In the cartoon, the idea underlying the pun is best described in the following popular saying: (A) Seeing into darkness is light. (B) A life full of light fears no death. (C) Once there is light, there is life. (D)A useless life leads to lack of light.

Questo 21
One of the pictorial clues that best justifies the concern expressed by the candle on the left is the: (A) edge of smoky wicks (B) amount of melted wax (C) source of light reflection (D)contour of facial features

2 Exame de Qualificao |

18

| Vestibular Estadual 2005

323

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 22
O grfico abaixo, que mostra a variao da solubilidade do dicromato de potssio na gua em funo da temperatura, foi apresentado em uma aula prtica sobre misturas e suas classificaes.
solubilidade (g soluto/100 g H2O)

60

20

30

70 temperatura (oC)

Em seguida, foram preparadas seis misturas sob agitao enrgica, utilizando dicromato de potssio slido e gua pura em diferentes temperaturas, conforme o seguinte esquema:

30oC 15 g K2Cr2O7 100 g H2O


+

30oC 3,5 g K2Cr2O7 20 g H2O


+

30oC 2 g K2Cr2O7 10 g H2O


+

70oC 200 g K2Cr2O7 300 g H2O


+

70oC 320 g K2Cr2O7 500 g H2O


+

70oC 150 g K2Cr2O7 250 g H2O


+

Aps a estabilizao dessas misturas, o nmero de sistemas homogneos e o nmero de sistemas heterogneos formados correspondem, respectivamente, a: (A) 5 1 (B) 4 2 (C) 3 3 (D) 1 5

Questo 23
Considere a hiptese de que o ambiente marinho primitivo, sem oxignio molecular, onde viveram os primeiros organismos, contivesse molculas orgnicas produzidas por sntese abitica. Admita, ainda, que essas molculas eram por eles decompostas para obteno de energia. O tipo de nutrio e a forma de obteno de energia desses organismos deveriam ser, respectivamente: (A) homeotrfica oxidao (B) autotrfica fotossntese (C) isotrfica quimiossntese (D) heterotrfica fermentao

2 Exame de Qualificao |

19

| Vestibular Estadual 2005

324

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 24
A maioria dos elementos qumicos constituda por um conjunto de tomos quimicamente idnticos, denominados istopos. Observe, a seguir, os istopos de dois elementos qumicos: - hidrognio 1H, 2H e 3H; - oxignio 16O, 17O e 18O. Combinando-se os istopos do hidrognio com os do oxignio em condies adequadas, obtm-se diferentes tipos de molculas de gua num total de: (A) 6 (B) 9 (C) 12 (D) 18

Questo 25
Em um experimento, solicitou-se a uma pessoa que respirasse o ar existente dentro de um saco plstico durante alguns minutos. Foram medidos, antes e durante o perodo de respirao do ar contido no saco, os seguintes parmetros: 1 - presso parcial do O2 no sangue; 2 - concentrao de H2CO3 no sangue; 3 - presso parcial do CO2 no saco plstico. Observe os grficos orientados abaixo, nos quais as ordenadas representam as medidas desses parmetros e as abcissas, o tempo de durao do experimento.

O grfico que representa adequadamente a variao dos trs parmetros nas condies experimentais o identificado pela letra: (A) W (B) X (C) Y (D) Z

2 Exame de Qualificao |

20

| Vestibular Estadual 2005

325

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 26
A Terra pode ser representada por uma esfera cujo raio mede 6.400 km. Na representao abaixo, est indicado o trajeto de um navio do ponto A ao ponto C, passando por B.

Qualquer ponto da superfcie da Terra tem coordenadas (x ; y), em que x representa a longitude e y, a latitude. As coordenadas dos pontos A, B e C esto indicadas na tabela a seguir.
Pontos A B C Coordenadas

x
135 o 135 o 90 o

y
0o 60 o 60 o

Considerando igual a 3, a distncia mnima, em quilmetros, a ser percorrida pelo navio no trajeto ABC igual a: (A) 11.200 (B) 10.800 (C) 8.800 (D) 5.600

Questo 27
O excesso de gordura no organismo nocivo sade. Considere uma pessoa, com massa corporal estvel, que deseje perder gordura, sem alterar sua dieta alimentar. Para essa pessoa, um dispndio energtico de 9 kcal em atividades fsicas corresponde perda de 1 g de gordura corporal. Para perder 6,0 kg de gordura, o tempo, em minutos, que ela necessita dedicar a atividades fsicas, despendendo, em mdia, 12 kcal/min, corresponde a: (A) 2,0 102 (B) 4,5 103 (C) 8,0 104 (D) 6,0 105

2 Exame de Qualificao |

21

| Vestibular Estadual 2005

326

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 28
Alguns peixes podem permanecer em repouso, isto , em equilbrio esttico, dentro dgua. Esse fato explicado fisicamente pelo Princpio de Arquimedes denominado empuxo. Nessa situao de equilbrio, a expresso que apresenta o mesmo valor tanto para grandezas associadas ao peixe como para a gua deslocada por ele : (A) (B) peso rea massa volume

(C) peso rea (D) massa volume

Utilize as informaes abaixo para responder s questes de nmeros 29 e 30.


Um procedimento comum em engenharia gentica consiste em cortar uma molcula de DNA com enzimas de restrio. Os fragmentos assim formados podem ser separados por eletroforese em suporte de gel com poros apropriados, embebido em soluo salina de pH igual a 8,6. Nessa tcnica, uma corrente eltrica passa atravs do gel, fazendo com que os fragmentos de DNA migrem, atravs desses poros, para o plo positivo. Considere trs fragmentos de DNA, F1 , F2 e F3 , cujas velocidades de migrao so identificadas como VF1, VF2 e VF3 e cujos pesos moleculares so respectivamente iguais a 2 109, 1 106 e 1 107. Observe os grficos abaixo, que indicam as variaes da velocidade de migrao dos fragmentos em funo da intensidade da corrente e do tamanho das molculas.
velocidade velocidade
0

intensidade da corrente

peso molecular

Questo 29
Durante a eletroforese, a velocidade de migrao dos fragmentos F1 , F2 e F3 obedecer seguinte ordem: (A) VF < VF < VF
1 3 2 1 2

(B) VF < VF < VF (C) VF < VF < VF


3 1

(D) VF < VF < VF


3 2

2 Exame de Qualificao |

22

| Vestibular Estadual 2005

327

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 30
O esquema mostrado a seguir representa o circuito eltrico de corrente contnua a ser utilizado para a separao dos fragmentos de DNA.
R

3,0 V

15 W

A tabela abaixo relaciona as caractersticas fsicas de quatro condutores cilndricos, em ordem decrescente de resistividade, que podem ser empregados como resistores nesse circuito eltrico.

Condutor
1 2 3 4

Comprimento
(102 m)

rea da seco
(10 6 m 2 )

60 50 60 50

12 W

gel

10 15 10 15

O condutor que deve ser colocado na posio R para proporcionar as maiores velocidades de migrao desses fragmentos de DNA o de nmero: (A) 1 (B) 2 (C) 3 (D) 4

Questo 31
As mudanas de presso que o ar atmosfrico sofre, ao entrar nos pulmes ou ao sair deles, podem ser consideradas como uma transformao isotrmica. Ao inspirar, uma pessoa sofre uma diminuio em sua presso intrapulmonar de 0,75%, no mximo. Considere 0,60 L de ar presso atmosfrica de 740 mmHg. A variao mxima de volume, em litros, sofrida por essa quantidade de ar ao ser inspirado aproximadamente de: (A) 4,5 100 (B) 4,5 101 (C) 4,5 102 (D) 4,5 103

2 Exame de Qualificao |

23

| Vestibular Estadual 2005

328

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 32
A mutao em um gene, por conseqncia da substituio de uma nica base na estrutura do DNA, pode acarretar modificaes importantes na atividade biolgica da protena codificada por esse gene. Considere que a estrutura normal de um RNA mensageiro de um peptdio e sua estrutura alterada em virtude da troca de uma nica base no gene correspondente so: 5 AUGUGGUUUGCACACAAAUGAUAA 3 (normal) 5 AUGUGGUUUGAACACAAAUGAUAA 3 (alterada) A tabela abaixo identifica alguns codons.
Aminocido alanina cido asprtico cistena glicina cido glutmico fenil alanina metionina triptofano treonina lisina Codon
GCC, GCG, GCU, GCA GAC, GAU UGC, UGU GGA, GGC, GGG, GGU GAA, GAG UUC, UUU AUG UGG ACA, ACC, ACG, ACU AAA, AAG

Observe que: - o codon da metionina tambm o do incio da traduo; - os codons de trmino da traduo so UAA, UAG e UGA. O aminocido encontrado no peptdio normal e aquele que o substituiu no peptdio mutante so, respectivamente: (A) lisina e cistena (B) treonina e triptofano (C) alanina e cido glutmico (D) fenil alanina e cido asprtico

Questo 33
Para um mergulhador, cada 5 m de profundidade atingida corresponde a um acrscimo de 0,5 atm na presso exercida sobre ele. Admita que esse mergulhador no consiga respirar quando sua caixa torcica est submetida a uma presso acima de 1,02 atm. Para respirar ar atmosfrico por um tubo, a profundidade mxima, em centmetros, que pode ser atingida pela caixa torcica desse mergulhador igual a: (A) 40 (B) 30 (C) 20 (D) 10

2 Exame de Qualificao |

24

| Vestibular Estadual 2005

329

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 34
Um pesquisador verificou que a substncia por ele estudada apresentava como efeito, em meio de cultura de linfcitos, a diminuio da concentrao intracelular do on potssio. A explicao admitida pelo pesquisador para essa diminuio foi a ocorrncia de alteraes na funo de, pelo menos, um dos seguintes sistemas: a bomba de sdio-potssio, os canais de transporte passivo de potssio ou a sntese de ATP na clula. Os grficos abaixo mostram possveis alteraes nas funes de cada um desses sistemas; o ponto 0 representa a funo normal, na ausncia da substncia estudada, e o sinal positivo e o negativo representam, respectivamente, o aumento e a diminuio da funo.

atividade da bomba de sdio-potssio

permeabilidade dos canais de potssio

sntese de ATP

O grfico no qual cada um dos trs sistemas apresenta uma alterao compatvel com o efeito da substncia o de nmero: (A) I (B) II (C) III (D) IV

Questo 35
Um ve culo com velocidade constante de V km/h percorre S km em um intervalo de tempo de T horas, sendo T diferente de 1. Considere que T, V e S estejam em progress o geom trica, nessa ordem. A alternativa que indica a relao entre o espao percorrido S e a velocidade V : (A) S = V3 (B) (C)
S = V2

S = V V

(D) 3 S =

2 Exame de Qualificao |

25

| Vestibular Estadual 2005

330

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 36
Bactrias de duas espcies foram cultivadas separadamente e em conjunto, nas mesmas condies experimentais e com suprimento constante do mesmo tipo de alimento. No grfico abaixo, as curvas mostram a variao da densidade populacional das bactrias estudadas em funo do tempo de cultivo. As curvas 1 e 2 representam os resultados encontrados para as duas espcies quando cultivadas separadamente e as curvas 3 e 4, quando cultivadas em conjunto.
densidade da populao

1 2 3

4 tempo

A relao ecolgica estabelecida entre as bactrias que melhor explica os resultados encontrados classificada como: (A) predao (B) parasitismo (C) competio (D) comensalismo

Questo 37
Um aluno, para calcular o pH da gua, sabendo que seu produto inico, a 25C, corresponde a 1014, utilizou, por engano, a seguinte frmula:

pH = log

100

[H ]

O valor encontrado pelo aluno foi igual a: (A) 1,4 (B) 3,5 (C) 7,0 (D) 10,0

2 Exame de Qualificao |

26

| Vestibular Estadual 2005

331

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 38
Em nosso planeta, ocorrem diariamente eventos ssmicos, provocados por diversos fatores. Observe o esquema mostrado na figura abaixo, em que um desses eventos, representado pelo raio ssmico e produzido pela fonte ssmica, atravessa trs regies geolgicas distintas o oceano, o plat e o continente e chega estao sismolgica, onde registrado por equipamentos adequados.

s raio s

mico

F
F - fonte ssmica E - estao sismolgica o - oceano p - plat c - continente

E
c p o

Considere do , dp e dc as distncias percorridas pelo evento ssmico, respectivamente, no oceano, no plat e no continente, e vo , vp e vc as velocidades mdias correspondentes a cada um desses trechos. Assim, a razo entre a distncia total percorrida pelo evento ssmico e a velocidade mdia ao longo de toda sua trajetria equivale a:
dp d d + c (A) o + vo
2

vp
2

vc
2

(B)

do + dp + dc

v o + vp + v c do vo dp vp dc vc

(C)

(D)

d o + dp + d c vo vp vc

Questo 39
O gelo seco, ou dixido de carbono solidificado, muito utilizado em processos de refrigerao, sofre sublimao nas condies ambientes. Durante essa transformao, ocorrem, dentre outros, os fenmenos de variao de energia e de rompimento de interaes. Esses fenmenos so classificados, respectivamente, como: (A) exotrmico interinico (B) exotrmico internuclear (C) isotrmico interatmico (D) endotrmico intermolecular
2 Exame de Qualificao |

27

| Vestibular Estadual 2005

332

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 40
Quatro esferas metlicas e macias, E1 , E2 , E3 e E4 , todas com a mesma massa, so colocadas simultaneamente no interior de um recipiente contendo gua em ebulio. A tabela abaixo indica o calor especfico e a massa especfica do metal que constitui cada esfera.

Metal Esfera tipo alumnio ferro nquel cobre calor especfico


(cal/goC)

massa especfica
(g/cm3)

E1 E2 E3 E4

0,215 0,113 0,056 0,093

2,7 7,8 10,5 8,9

Atingido o equilbrio trmico, essas esferas so retiradas da gua e colocadas imediatamente na superfcie de um grande bloco de gelo que se encontra na temperatura de fuso. A esfera que fundiu a maior quantidade de gelo e a esfera que produziu a cavidade de menor dimetro no bloco de gelo so, respectivamente: (A) E3 ; E4 (B) E2 ; E4 (C) E1 ; E3 (D) E1 ; E2

Questo 41
As equaes qumicas abaixo representam reaes de sntese, realizadas em diferentes condies, para a obteno de uma substncia hipottica XY. I - X2 (g) + Y2 (g) II - X2 (g) + Y2 (g) III - X2 (g) + Y2 (g) 2 XY(!) + Q1 2 XY(s) + Q2 2 XY(g) + Q3

Considere Q1 , Q2 e Q3 as quantidades de calor liberadas, respectivamente, nas reaes I, II e III. A relao entre essas quantidades est expressa na seguinte alternativa: (A) Q1 > Q2 > Q3 (B) Q2 > Q1 > Q3 (C) Q3 > Q1 > Q2 (D) Q3 > Q2 > Q1

2 Exame de Qualificao |

28

| Vestibular Estadual 2005

333

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

Questo 42
As fitas de gravao contm, na sua composio, acetato de celulose, que se decompe sob a ao da umidade atmosfrica, liberando cido actico. A curva que representa o aumento do teor desse cido em funo do tempo est indicada no grfico abaixo.
teor de cido actico em mol L-1

tempo (min)

A velocidade da reao de decomposio do acetato de celulose pode ser determinada a partir da equao da reta r , tangente curva no ponto P, que definida por y =
1 50 t + 1 , na qual t representa o tempo em minutos.

A velocidade dessa reao no instante t , em mol L1 min1, e sua classificao esto indicadas em: (A) 0,002 oxidao (B) 0,002 esterificao (C) 0,020 dupla-troca (D) 0,200 neutralizao

Questo 43
Suponha que a tabela de classificao peridica apresentada nesta prova, com os smbolos de 112 elementos qumicos, seja recortada em 112 quadrados congruentes, cada um deles contendo a representao de somente um elemento qumico. Esses recortes so colocados em uma caixa da qual Ana retira, de uma nica vez, aleatoriamente, dois deles. Se pelo menos um recorte apresentar o smbolo de um metal alcalino, ela ser premiada com um livro. A probabilidade de Ana ganhar o livro aproximadamente de: (A) 6% (B) 10% (C) 12% (D) 15%

2 Exame de Qualificao |

29

| Vestibular Estadual 2005

334

CINCIAS HUMANAS E SUAS TECNOLOGIAS CINCIAS HUMANAS E SUAS TECNOLOGIAS

A PROVA DESTA REA TEM COMO TEMA O ESTADO , OS CONFLITOS SOCIAIS E A CIDADANIA ATRAVS DO TEMPO E EM DIFERENTES ESPAOS.

Questo 44
COMPOSIO TNICA DOS ESTUDANTES NAS UNIVERSIDADES BRASILEIRAS

(Adaptado de O Globo, 26/08/2001)

O grfico, elaborado a partir de dados do IBGE, apresenta um quadro de desigualdades tnicas no mbito educacional. Para enfrentar essas desigualdades, historicamente constitudas, intensificaram-se, na ltima dcada, as chamadas polticas afirmativas. Tais polticas tm origem na necessidade de: (A)reduzir a diversidade cultural (B) minorar a segregao espacial (C) redimensionar a insero social (D)desacelerar a expanso demogrfica

Questo 45
O Brasil, desde sua emancipao poltica at os dias de hoje, concebeu diferentes ordens jurdicas constitucionais. Muitos pesquisadores consideram as Constituies brasileiras de 1934 e 1988 as mais progressistas por estabelecerem, respectivamente, dentre outros, os seguintes avanos sociais: (A)voto feminino e crime de racismo inafianvel (B) corporativismo sindical e voto dos analfabetos (C) Fundo de Garantia por Tempo de Servio e direito de greve irrestrito (D)voto obrigatrio para maiores de 18 anos e Estatuto da Criana e do Adolescente

2 Exame de Qualificao |

30

| Vestibular Estadual 2005

335

CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 46
O BALANO DAS PRIVATIZAES
O que o governo diz:
Dinheiro arrecadado + dvidas transferidas 85,2 bilhes de reais

As contas que o governo esconde:


Dinheiro que no entrou nos cofres do governo ou que saiu deles 87,6 bilhes de reais

(Adaptado de BIONDI, Aloysio. O Brasil privatizado. So Paulo: Fundao Perseu Abramo, 1999.)

Os dados apresentados referem-se ao processo de privatizaes no Brasil, nos anos 90. A expanso desse processo, em escala global, como parte das polticas neoliberais, decorrente da relao entre: (A)falncia das empresas estatais e endividamento do Estado (B) especializao produtiva e flexibilizao da legislao trabalhista (C) manuteno do sistema previdencirio e crescimento dos gastos pblicos (D)expanso dos conglomerados internacionais e desregulamentao econmica

Questo 47
Arriba Mxico
PIB
(em bilhes de dlares)

608 160 25 47 9

MXICO: PERTO DO INFERNO


Nos 10 anos de vigncia do Tratado de Livre Comrcio da Amrica do Norte (Nafta), o salrio real da maioria dos trabalhadores diminuiu, aumentou a desigualdade e os trabalhadores do campo viram recair sobre suas costas o preo mais duro dos ajustes fiscais.
(SADER, Emir. Jornal do Brasil, 06/06/2004.)

Exportaes
(em bilhes de dlares)

Investimento estrangeiro direto


(em bilhes de dlares)

Reservas internacionais
(em bilhes de dlares)

Posio da economia no ranking mundial

Taxa risco - pas


Dados de 2001 Fontes: JP Morgan. EMBI e Latin America Monitor

366
pontos

(Adaptado de Veja , 27/03/2002)

Pelas informaes acima, pode-se constatar a contradio entre ndices econmicos favorveis e crescimento de desigualdades sociais no Mxico. Contradio semelhante verificou-se no Brasil na poca do chamado Milagre Econmico . Essa contradio, considerando os casos de Mxico e Brasil, est vinculada essencialmente ao processo de: (A)endividamento interno (B) desemprego estrutural (C) modernizao conservadora (D)concentrao regional da riqueza

2 Exame de Qualificao |

31

| Vestibular Estadual 2005

336

CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 48

(NOVAES, Carlos E. e LOBO, Csar. Histria do Brasil para principiantes. So Paulo: tica, 1999.)

A charge acima nos remete s eleies presidenciais de 1989, vencidas por Fernando Collor, que governou de 1990 at seu impeachment em 1992. Uma caracterstica da poltica econmica implementada por esse governo que o diferencia dos anteriores : (A)estatizao das indstrias de base (B) adoo do ortodoxismo monetrio (C) aumento do nmero de empresas estatais (D)abertura da economia aos produtos estrangeiros

Questo 49
Venda Nova, distrito de Terespolis, tem como vocao econmica a agricultura hortigranjeira. Vrios pequenos plantadores de verduras se espalham pelas encostas das montanhas, em propriedades operadas, em geral, pela famlia do agricultor. (...) Se o tempo no ajuda, perde-se toda uma produo. (...) A atividade rural mal paga e (...) o risco da comercializao corre por conta do pobre agricultor que no participa do lucro da operao, s do prejuzo eventual. Os atravessadores, que possuem frotas de caminhes, passam pela manh (...) para levar o produto para os mercados centrais. Estipulam um preo que no pago na hora, s depois de [ser vendida] a mercadoria. Caso no consigam vend-la, devolvem a carga ao agricultor (...) praticamente estragada pela viagem.
(MALTA, Maria Teresa. Um sonho que se tornou realidade. Revista da Comunidade Emanuel, 2003.)

Apesar dos incrementos de produtividade e da expanso do agronegcio, o texto nos aponta dificuldades enfrentadas por parte dos pequenos agricultores brasileiros, que devem ser compreendidas a partir das relaes polticas e econmicas vigentes hoje no campo. Uma causa bsica e uma conseqncia para as dificuldades enfrentadas pelos pequenos produtores rurais so: (A)ausncia de linhas de financiamento lucratividade retrada (B) precria base tecnolgica sistema de transportes subutilizado (C) fracionamento das propriedades mercado de consumo depreciado (D)carncia de uma poltica agrcola favorvel produo familiar inviabilizada

2 Exame de Qualificao |

32

| Vestibular Estadual 2005

337

CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 50
RNAGEL ESTDIO/ARQUIVO DO ESTADO DE SO PAULO

Greve Geral de 1917: multido de operrios descendo a Ladeira do Carmo.

(CAMPOS, Flavio de e MIRANDA, Renan G. Oficina de histria . So Paulo: Moderna, 2000.)

Ao longo do sculo XX, o movimento operrio brasileiro se organizou e lutou de diferentes formas. Em 1917, ocorreu em So Paulo e no Rio de Janeiro a primeira greve geral na histria desse movimento. A orientao ideolgica das lideranas dessa greve e uma de suas reivindicaes esto indicadas, respectivamente, em: (A)socialista fim dos castigos corporais (B) comunista luta por melhores salrios (C) liberal interveno do Estado na economia (D)anarcossindicalista diminuio da jornada de trabalho

Questo 51
No Brasil um grupo de tcnicos e assessores do IBAMA Instituto Brasileiro do Meio Ambiente e dos Recursos Naturais Renovveis vem propondo (...) a criao do salrio-defeso. O defeso um instrumento de proteo de uma determinada espcie quando se estabelecem limitaes pesca nos perodos de reproduo dos peixes. Com a instituio do salrio-defeso os pescadores passam a receber um salrio mnimo durante todo o perodo do defeso. Nesse perodo os pescadores desenvolvem o aprendizado de uma srie de atividades visando diversificar suas fontes de sustentao. A proposta do salrio-defeso extremamente interessante porque supera a falsa dicotomia que separa a natureza da sociedade, essa verdadeira armadilha ideolgica do pensamento ocidental.
(GONALVES, Carlos W. P. In: Territrio Territrios / Programa de Ps-Graduao em Geografia. Niteri: UFF/AGB, 2002.)

O texto remete a uma nova concepo do Estado em relao ao uso dos recursos naturais. Ao longo da histria, a explorao dos recursos naturais em nosso pas foi predominantemente caracterizada como: (A)ambientalista, por criar leis de proteo do ambiente (B) predatria, por priorizar a explorao dos ecossistemas (C) excludente, por estatizar a extrao das riquezas naturais (D)conservacionista, por propor o uso racional dos recursos naturais

2 Exame de Qualificao |

33

| Vestibular Estadual 2005

338

CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 52

(NOVAES, Carlos E. e LOBO, Csar. Histria do Brasil para principiantes. So Paulo: tica, 1999.)

Pode-se relacionar a charge acima seguinte ao econmica empreendida na Repblica Velha: (A)compra de excedentes dos cafeicultores pelo governo federal (B) concesso de moratria a fazendeiros para cancelamento das dvidas (C) limitao do crdito expanso cafeeira decorrente do encilhamento (D)desvalorizao do caf pela troca de favores entre os governos estaduais e o federal

Questo 53
HAITI
H duzentos anos, a revoluo dos jacobinos negros derrotou a Frana napolenica e aboliu a escravido. Hoje, o Haiti amarga o fim das esperanas na segunda independncia prometida por Aristide.
(CARLOS, Newton. Jornal Mundo, abril de 2004.)

Ningum cidado Se voc for ver a festa do Pel E se voc no for Pense no Haiti O Haiti aqui O Haiti no aqui
Gilberto Gil e Caetano Veloso

A situao crtica do Haiti hoje nos reporta ao perodo de sua independncia, demonstrando que as esperanas dos jacobinos negros foram frustradas. Em sua msica, Gil e Caetano mencionam o Haiti, correlacionando seus problemas com os do Brasil. Atualmente, o principal elemento comum entre a crise que afeta a sociedade do Haiti e a do Brasil : (A)governo antidemocrtico (B) desigualdade econmica (C) intolerncia religiosa (D)preconceito racial

2 Exame de Qualificao |

34

| Vestibular Estadual 2005

339

CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 54
MENESTREL DAS ALAGOAS
Quem esse viajante quem esse menestrel que espalha a esperana e transforma sal em mel? (...) De quem essa ira santa essa sade civil que tocando na ferida redescobre o Brasil?
Milton Nascimento e Fernando Brant

TANTO MAR
Foi bonita a festa, p Fiquei contente E ainda guardo, renitente Um velho cravo para mim. (...) Manda novamente Algum cheirinho de alecrim.
Chico Buarque

A msica Menestrel das Alagoas foi um dos hinos do movimento pelas Diretas J, que aconteceu em nosso pas em 1984, enquanto Tanto Mar homenageia a Revoluo dos Cravos, que teve incio em Portugal, em 25 de abril de 1974. Neste ano, portanto, o movimento pelas Diretas J completa 20 anos, e a Revoluo dos Capites de Abril, 30 anos. Nesses dois movimentos, identificamos como objetivos comuns: (A)trmino do regime militar e anistia poltica geral (B) derrubada da ditadura e reafirmao do parlamentarismo (C) redemocratizao do governo e retorno ao sistema presidencialista (D)fim do Estado autoritrio e restabelecimento dos direitos polticos plenos

Questo 55
Um pesquisador da Unesco no Brasil acaba de criar o ndice de Desenvolvimento Juvenil (IDJ), resultante do cruzamento de sete indicadores, que abrangem reas de educao, sade, renda e ocupao. Como, no clculo do IDJ, no basta saber quantos jovens esto na escola, os pesquisadores criaram um novo ndice o de escolarizao adequada e descobriram um dado desalentador. De cada 100 jovens brasileiros, apenas 48 esto na escola e, desses, 29 encontram-se numa srie compatvel com sua idade.
(Adaptado de GASPAR, Malu. Veja, 17/03/2004.)

O ndice de escolarizao adequada da populao jovem est relacionado precria situao do sistema educacional brasileiro. A baixa escolaridade verificada influencia diretamente a dinmica social, provocando a seguinte manifestao: (A)rejeio a valores religiosos (B) oposio aos conflitos socioculturais (C) negao da identidade coletiva nacional (D)alienao frente ao sistema poltico-representativo

2 Exame de Qualificao |

35

| Vestibular Estadual 2005

340

CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 56
As causas do neonazismo levam ao nascimento do prprio nazismo: a ausncia do Estado. A Repblica de Weimar, nascida no mesmo caldo que fabricou o Tratado de Versalhes, teria de gerar um monstro. (...) Fazer da poltica a expresso da vitria do mais forte o centro de gravidade do nazismo. De qualquer tipo de nazismo. O resto tempero, produo teatral. Uma sociedade centrada na justia social jamais ser nazista. No o caso do Brasil, onde se discriminam negros, nordestinos, crianas sem casa e torcedores do Botafogo.
(CONY, Carlos Heitor. Proibio intil. Folha de S. Paulo, 09/06/1994.)

Conforme mostra Carlos Heitor Cony, j em 1994, o neonazismo deve ser motivo de preocupao para os governos e as sociedades democrticas em todo mundo. As duas caractersticas poltico-ideolgicas que identificam tanto o nazismo quanto o neonazismo so: (A)federalismo arianismo (B) xenofobismo militarismo (C) fascismo bipartidarismo (D)pluripartidarismo corporativismo

Questo 57
ROSA DE HIROSHIMA
Pensem nas feridas Como rosas clidas Mas oh no se esqueam Da rosa da rosa Da rosa de Hiroshima (...) A anti-rosa atmica.
Vincius de Moraes

Vincius de Moraes, no poema acima, fala-nos do horror da bomba atmica jogada sobre Hiroshima em 1945, um dos marcos mais trgicos da Segunda Guerra Mundial. Um desdobramento poltico do ps-guerra est caracterizado em: (A)esfacelamento do territrio japons, determinando a diviso do seu imprio colonial (B) fortalecimento das ideologias fascistas, gerando a expanso do totalitarismo no Oriente (C) constituio de uma nova ordem mundial, contribuindo para a intensificao dos conflitos regionais (D)enfraquecimento poltico-econmico do Japo, permitindo a ascenso de novas potncias regionais

2 Exame de Qualificao |

36

| Vestibular Estadual 2005

341

CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 58
No dia 11 de setembro de 2001, o mundo assistiu destruio do World Trade Center, em Nova Iorque, e ao ataque ao Pentgono, em Washington, intensificando o medo em relao ao terrorismo. No dia 11 de maro de 2004, novos atentados terroristas foram realizados, dessa vez em Madri. A ameaa de aes terroristas que paira sobre os Estados-nao gera, entre outras, a seguinte conseqncia: (A)agravamento dos conflitos tnicos e culturais (B) fim do prprio Estado-nao e da bipolaridade (C) enfraquecimento dos nacionalismos de direita e de esquerda (D)incorporao dos movimentos sociais e polticos s foras armadas

Questo 59
TRFICO DE ARMAS PARA O BRASIL
O caminho
So Paulo Rio de Janeiro

PARAGUAI

Paran

BRASIL

1
ARGENTINA URUGUAI

1 As armas desviadas por militares argentinos

dos arsenais das Foras Armadas atravessam a fronteira e so entregues a militares paraguaios. traficantes cariocas fazem o pagamento e recebem as armas, que so postas em caminhes. de balsa o Rio Paran e chegam cidade de Guara, no Paran. passando antes por So Paulo.

2 No Paraguai, contrabandistas enviados pelos

3 Na fronteira com o Brasil os veculos atravessam 4 Os caminhes seguem ento para o Rio,

(Adaptado de O Globo, 27/04/2003)

O trfico de armas, cujo percurso de entrada no Brasil mostrado no mapa, constri redes de poder que ultrapassam os territrios nacionais e nas quais circulam armas, drogas e recursos ilegais, tornando-se um dos mais graves problemas da atualidade. Das estratgias abaixo, aquela que deve ser priorizada pelo Estado, no combate s redes ilegais, por sua maior eficcia, : (A)ampliao da soberania, fortalecendo grupos paramilitares regionais (B) controle do territrio, reforando o aparato policial em dimenso local (C) intensificao da segurana nas fronteiras, articulando foras internacionais (D)fortalecimento da vigilncia alfandegria, criando estruturas militarizadas supranacionais
2 Exame de Qualificao |

37

| Vestibular Estadual 2005

342

CINCIAS HUMANAS E SUAS TECNOLOGIAS

Questo 60
TAXA DE MORTALIDADE INFANTIL (0/00 NASCIDOS VIVOS)
Amrica Brasil: Regio Sul

ESCALA 1:25.000.000 0 125 250 km PROJEO POLICNICA

ESCALA 1:200.000.000 1.000 0 2.000 km

PROJEO DE ROBINSON

(Adaptado de Atlas geogrfico escolar . Rio de Janeiro: IBGE, 2002.)

Os mapas acima apresentam, em diferentes escalas cartogrficas, o fenmeno da mortalidade infantil, evidenciando a importncia da cartografia como instrumento para o planejamento e a ao do Estado. A alternativa que indica uma ao do Estado para cujo planejamento necessrio o emprego de uma representao em maior escala cartogrfica : (A)gesto de regies metropolitanas (B) construo de infra-estrutura urbana (C) explorao econmica de macrorregies (D)delimitao de parques de proteo ambiental

2 Exame de Qualificao |

38

| Vestibular Estadual 2005

343

2 EXAME DE QUALIFICAO - VESTIBULAR 2005 GABARITO OFICIAL 22 - B 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 D D A C B B A D D C C A D C B A D C B C B

01 - A 02 - C 03 04 05 06 07 08 09 10 11 12 13 14 15 B D A C C A C D D B C D D

ESPANHOL

44 - C 45 - A 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 D C D A D B A B D D B C A C B

16 - B 17 18 19 20 21 C D B D A

FRANCS

16 17 18 19 20 21

D A B C C D

INGLS

16 17 18 19 20 21

B A D A C B

344

10 EXAME DE QUALIFICAO 31/07/2005


Neste caderno voc encontrar um conjunto de 40 (quarenta) pginas numeradas seqencialmente, contendo 60 (sessenta) questes das seguintes reas: Linguagens, Cdigos e suas Tecnologias; Cincias da Natureza, Matemtica e suas Tecnologias; Cincias Humanas e suas Tecnologias. A tabela peridica encontra-se na pgina 39. No abra o caderno antes de receber autorizao.

INSTRUES
1. Verifique se o seu nome, nmero de inscrio, nmero do documento de identidade e lngua estrangeira escolhida esto corretos no carto de respostas. Se houver erro, notifique o fiscal. Assine o carto de respostas com caneta. 2. Ao receber autorizao para abrir este caderno, verifique se a impresso, a paginao e a numerao das questes esto corretas. Caso ocorra qualquer erro, notifique o fiscal. 3. As questes de nmeros 16 a 21 da rea de Linguagens, Cdigos e suas Tecnologias devero ser respondidas de acordo com a sua opo de Lngua Estrangeira: Espanhol, Francs ou Ingls. 4. Leia com ateno cada questo e escolha a alternativa que mais adequadamente responde a cada uma delas. Marque sua resposta no carto de respostas, cobrindo fortemente o espao correspondente letra a ser assinalada; utilize caneta preta, preferencialmente, ou lpis preto n 2, conforme o exemplo abaixo:

5. A leitora de marcas no registrar as respostas em que houver falta de nitidez e/ou marcao de mais de uma letra. 6. O carto de respostas no pode ser dobrado, amassado, rasurado ou manchado. Exceto sua assinatura, nada deve ser escrito ou registrado fora dos locais destinados s respostas. 7. Voc dispe de 4 (quatro) horas para fazer esta prova. 8. Ao terminar a prova, entregue ao fiscal o carto de respostas e este caderno.

BOA PROVA!

345

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

Nada mais antigo e tambm atual... nada mais complexo, e ainda assim comum, do que as relaes de poder. Entre as diversas faces do poder, entre os mltiplos braos que, a partir dele, estendem-se sobre ns como uma teia, encontra-se o discurso da autoridade. Este o tema desta prova Autoridade e Poder. Falamos deles porque impossvel esquec-los, independentemente do tempo ou do lugar... nas engrenagens das instituies... nas esquinas da memria... nos meandros da linguagem... eles sempre estaro l. COM BASE NO TEXTO ABAIXO, RESPONDA S QUESTES DE NMEROS 01 A 05.

O Lder
O sono do lder agitado. A mulher sacode-o at acord-lo do pesadelo. Estremunhado, ele se levanta, bebe um gole de gua. Diante do espelho refaz uma expresso de homem de meia-idade, alisa os cabelos das tmporas, volta a se deitar. Adormece e a agitao recomea. No, no! debate-se ele com a garganta seca. O lder se assusta enquanto dorme. O povo ameaa o lder? No, pois se lder aquele que guia o povo exatamente porque aderiu ao povo. O povo ameaa o lder? No, pois se o povo escolheu o lder. O povo ameaa o lder? No, pois o lder cuida do povo. O povo ameaa o lder? Sim, o povo ameaa o lder do povo. O lder revolve-se na cama. De noite ele tem medo. Mas o pesadelo um pesadelo sem histria. De noite, de olhos fechados, v caras quietas, uma cara atrs da outra. E nenhuma expresso nas caras. s este o pesadelo, apenas isso. Mas cada noite, mal adormece, mais caras quietas vo se reunindo s outras, como na fotografia de uma multido em silncio. Por quem este silncio? Pelo lder. uma sucesso de caras iguais como na repetio montona de um rosto s. Nas caras no h seno a inexpresso. A inexpresso ampliada como em fotografia ampliada. Um painel e cada vez com maior nmero de caras iguais. s isso. Mas o lder se cobre de suor diante da viso incua de milhares de olhos vazios que no pestanejam. Durante o dia o discurso do lder cada vez mais longo, ele adia cada vez mais o instante da chave de ouro. Ultimamente ataca, denuncia, denuncia, denuncia, esbraveja e quando, em apoteose, termina, vai para o banheiro, fecha a porta e, uma vez sozinho, encosta-se porta fechada, enxuga a testa molhada com o leno. Mas tem sido intil. De noite sempre maior o nmero silencioso. Cada noite as caras aproximam-se um pouco mais. Cada noite ainda um pouco mais. At que ele j lhes sente o calor do hlito. As caras inexpressivas respiram o lder acorda num grito. Tenta explicar mulher: sonhei que... sonhei que... Mas no tem o que contar. Sonhou que era um lder de pessoas vivas.
(LISPECTOR, Clarice. Para no esquecer. So Paulo: Siciliano, 1992.)

25

30

10

35

15

40

20

QUESTO

01

Esse texto de Clarice Lispector nos leva reflexo sobre a responsabilidade e a tenso inerentes ao papel do lder. Tal reflexo desencadeada pela inquietao e pelo medo do personagem principal. O desconhecimento das origens desses sentimentos que afligem o lder evidencia-se na seguinte passagem: (A) No, pois se o povo escolheu o lder. (l. 11) (B) Mas o pesadelo um pesadelo sem histria. (l. 15 - 16) (C) Durante o dia o discurso do lder cada vez mais longo, (l. 29 - 30) (D) At que ele j lhes sente o calor do hlito. (l. 38 - 39)

1 Exame de Qualificao

Vestibular Estadual 2006

346

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

QUESTO

02

No segundo pargrafo do texto, h uma pergunta que se repete O povo ameaa o lder? Essa pergunta respondida por uma srie de negativas, que culminam, contudo, em uma resposta afirmativa, no incio do terceiro pargrafo Sim, o povo ameaa o lder do povo. (l. 14) Todavia, esse jogo entre opostos no constitui contradio. A justificativa que valida essa estrutura de argumentao est descrita em: (A) as negativas so falsas, porque se baseiam em fatos irrelevantes (B) a afirmativa inverossmil, porque se refora por uma repetio (C) as negativas so possveis, pois se vinculam a condies (D) a afirmativa falaciosa, pois se estrutura em ironia

QUESTO

03

O texto clariceano nos conta uma histria de carter universal. Uma das estratgias para alcanar esse efeito de universalidade est relacionada com a seguinte caracterstica do texto: (A) ausncia de foco narrativo (B) explorao das seqncias descritivas (C) indeterminao do contexto espacial (D) especificao das circunstncias temporais

QUESTO

04

uma sucesso de caras iguais como na repetio montona de um rosto s. Nas caras no h seno a inexpresso. (l. 22 - 24)
Embora no marcada lingisticamente, h uma relao semntica clara entre os dois perodos apontados acima. Essa relao pode ser explicitada pelo emprego do conectivo indicado em: (A) mas (B) quando (C) embora (D) porque

QUESTO

05

Sonhou que era um lder de pessoas vivas. (l. 41 - 42)


Em relao ao sentimento do lder, a interpretao que melhor se aplica ao fragmento apresentado : (A) temia o fim de sua autoridade (B) planejava a diviso de seu poder (C) adiava a cobrana de seus deveres (D) desejava a morte de seus liderados

1 Exame de Qualificao

Vestibular Estadual 2006

347

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

COM BASE NO TEXTO ABAIXO, RESPONDA S QUESTES DE NMEROS 06 A 10.

Balada do Rei das Sereias


O rei atirou Seu anel ao mar E disse s sereias: Ide-o l buscar, Que se o no trouxerdes, Virareis espuma Das ondas do mar! Foram as sereias, No tardou, voltaram Com o perdido anel. Maldito o capricho De rei to cruel! O rei atirou Gros de arroz ao mar E disse s sereias: Ide-os l buscar, Que se os no trouxerdes, Virareis espuma Das ondas do mar!
20

Foram as sereias No tardou, voltaram, No faltava um gro. Maldito o capricho Do mau corao! O rei atirou Sua filha ao mar E disse s sereias: Ide-a l buscar, Que se a no trouxerdes, Virareis espuma Das ondas do mar! Foram as sereias... Quem as viu voltar?... No voltaram nunca! Viraram espuma Das ondas do mar.

25

10

30

15

35

(BANDEIRA, Manuel. Poesia completa e prosa. Rio de Janeiro: Jos Aguilar, 1974.)

QUESTO

06

Em Balada do rei das sereias, Manuel Bandeira faz uso de diferentes inverses sintticas. O verso que no contm inverso sinttica encontra-se transcrito em: (A) Ide-o l buscar, (v. 4) (B) Que se o no trouxerdes, (v. 5) (C) Foram as sereias, (v. 8) (D) Sua filha ao mar (v. 26)

1 Exame de Qualificao

Vestibular Estadual 2006

348

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

QUESTO

07

Notam-se, no texto, escolhas lingsticas que visam caracterizao do autoritarismo do rei. A construo lingstica que no visa a essa caracterizao e o fragmento no qual utilizada esto apresentados na seguinte alternativa: (A) verbo atirar, que acentua a violncia da ao O rei atirou (v. 1) (B) pronome seu, que expressa sentido de posse Seu anel ao mar (v. 2) (C) adjetivo maldito, que revela a crueldade do comando Maldito o capricho (v. 23) (D) imperativo ide, que indica a prescrio de ordem Ide-a l buscar, (v. 28)

QUESTO

08

Entre os traos estilsticos presentes no poema, destaca-se o emprego da pontuao em desacordo com as prescries propostas pela norma culta. A passagem do texto modificada para atender aos padres de pontuao da norma culta est presente em: (A) Seu anel ao mar, (v. 2) (B) Que, se o no trouxerdes, (v. 5) (C) No tardou voltaram, (v. 9) (D) Ide-os, l, buscar (v. 16)

QUESTO

09

Que se o no trouxerdes, Virareis espuma Das ondas do mar! (v. 5 - 7)


No que se refere ao modo como as aes de trazer e virar se relacionam, pode-se afirmar que a segunda ao ocorrer na seguinte circunstncia: (A) em virtude da no realizao da primeira (B) juntamente com a finalizao da primeira (C) antes da no concretizao da primeira (D) depois da verificao da primeira

QUESTO

10

Considerando-se as implicaes relativas ao abuso de poder que se podem depreender do texto de Manuel Bandeira, o desfecho do poema permite concluir que o rei no previu a hiptese de: (A) ser atendido pelas ondas do mar (B) ficar comovido pelo sacrifcio das sereias (C) ser contestado pela ao de seus subordinados (D) ficar surpreso com a fraqueza de seus comandados

1 Exame de Qualificao

Vestibular Estadual 2006

349

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

COM BASE NO TEXTO ABAIXO, RESPONDA S QUESTES DE NMEROS 11 A 13.

Nem a Rosa, Nem o Cravo


As frases perdem seu sentido, as palavras perdem sua significao costumeira, como dizer das rvores e das flores, dos teus olhos e do mar, das canoas e do cais, das borboletas nas rvores, quando as crianas so assassinadas friamente pelos nazistas? Como falar da gratuita beleza dos campos e das cidades, quando as bestas soltas no mundo ainda destroem os campos e as cidades? J viste um loiro trigal balanando ao vento? das coisas mais belas do mundo, mas os hitleristas e seus ces danados destruram os trigais e os povos morrem de fome. Como falar, ento, da beleza, dessa beleza simples e pura da farinha e do po, da gua da fonte, do cu azul, do teu rosto na tarde? No posso falar dessas coisas de todos os dias, dessas alegrias de todos os instantes. Porque elas esto perigando, todas elas, os trigais e o po, a farinha e a gua, o cu, o mar e teu rosto. (...) Sobre toda a beleza paira a sombra da escravido. como ua nuvem inesperada num cu azul e lmpido. Como ento encontrar palavras inocentes, doces palavras cariciosas, versos suaves e tristes? Perdi o sentido destas palavras, destas frases, elas me soam como uma traio neste momento.
(...)
25 30

35

Hoje s o dio pode fazer com que o amor perdure sobre o mundo. S o dio ao fascismo, mas um dio mortal, um dio sem perdo, um dio que venha do corao e que nos tome todo, que se faa dono de todas as nossas palavras, que nos impea de ver qualquer espetculo desde o crepsculo aos olhos da amada sem que junto a ele vejamos o perigo que os cerca. Jamais as tardes seriam doces e jamais as madrugadas seriam de esperana. Jamais os livros diriam coisas belas, nunca mais seria escrito um verso de amor. Sobre toda a beleza do mundo, sobre a farinha e o po, sobre a pura gua da fonte e sobre o mar, sobre teus olhos tambm, se debruaria a desonra que o nazifascismo, se eles tivessem conseguido dominar o mundo. No restaria nenhuma parcela de beleza, a mais mnima. Amanh saberei de novo palavras doces e frases cariciosas. Hoje s sei palavras de dio, palavras de morte. No encontrars um cravo ou uma rosa, uma flor na minha literatura. Mas encontrars um punhal ou um fuzil, encontrars uma arma contra os inimigos da beleza, contra aqueles que amam as trevas e a desgraa, a lama e os esgotos, contra esses restos de podrid o que sonharam esmagar a poesia, o amor e a liberdade!

10

40

15

45

20

50

Mas eu sei todas as palavras de dio e essas, sim, tm um significado neste momento. Houve um dia em que eu falei do amor e encontrei para ele os mais doces vocbulos, as frases mais trabalhadas.

65
(AMADO, Jorge. Folha da Manh, 22/04/1945.)

1 Exame de Qualificao

Vestibular Estadual 2006

350

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

QUESTO

11

O uso das palavras rosa e cravo recusado pelo enunciador do texto de Jorge Amado. Essa recusa ocorre, pois essas palavras assumem, no texto, o sentido de: (A) ameaa (B) alienao (C) infelicidade (D) cumplicidade

QUESTO

12

Para expressar um ponto de vista definido, o enunciador de Nem a rosa, nem o cravo emprega determinados recursos discursivos. Um desses recursos e a justificativa para seu uso esto presentes em: (A) emprego da 1a pessoa discusso de um tema polmico (B) resgate de prticas pessoais passadas conservao de uma viso de mundo (C) interlocuo direta com os possveis leitores fortalecimento de um pacto de omisso (D) presena de um interlocutor em 2a pessoa desenvolvimento de uma estratgia de confisso

QUESTO

13

O enunciador do texto defende, como modo de reao s crueldades referidas, a utilizao das mesmas armas dos agressores. O trecho em que essa idia se apresenta mais claramente : (A) Sobre toda a beleza paira a sombra da escravido. (l. 18 - 19) (B) Houve um dia em que eu falei do amor e encontrei para ele os mais doces vocbulos, (l. 26 - 28) (C) Hoje s o dio pode fazer com que o amor perdure sobre o mundo. (l. 29 - 30) (D) Jamais as tardes seriam doces e jamais as madrugadas seriam de esperana. (l. 37 - 38)

1 Exame de Qualificao

Vestibular Estadual 2006

351

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

COM BASE NAS PROPAGANDAS ABAIXO, RESPONDA S QUESTES DE NMEROS 14 E 15.

II

(In: DE NICOLA, Jos. Lngua, literatura e redao. So Paulo: Scipione, 1998.)

QUESTO

14

As seqncias textuais e as imagens das propagandas destacam a violncia caracterstica do dia-a-dia da prtica jornalstica. Dos recursos das propagandas abaixo apresentados, aquele que no est corretamente justificado : (A) mensagem de denncia de abusos motiva o armamento contra a opresso (B) informao estatstica sobre vtimas revela a dificuldade de trabalho seguro (C) lpis quebrado com sangue indica a morte de profissionais da imprensa (D) pssaro de jornal com asa rasgada alude priso de jornalistas

QUESTO

15

Nas propagandas I e II, os textos verbais que melhor sintetizam as idias presentes nas imagens so, respectivamente: (A) A LIBERDADE UMA CONQUISTA / 180 JORNALISTAS ESTO PRESOS EM 22 PASES (B) 500 JORNALISTAS FORAM MORTOS EM AO, NO MUNDO, DESDE 1986. / A LIBERDADE UMA CONQUISTA (C) 3 DE MAIO DIA MUNDIAL DA LIBERDADE DE EXPRESSO / 3 DE MAIO DIA MUNDIAL DA LIBERDADE DE EXPRESSO (D) 500 JORNALISTAS FORAM MORTOS EM AO, NO MUNDO, DESDE 1986. / 180 JORNALISTAS ESTO PRESOS EM 22 PASES

1 Exame de Qualificao

Vestibular Estadual 2006

352

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | E SPANHOL

COM BASE NO TEXTO ABAIXO, RESPONDA S QUESTES DE NMEROS 16 A 19.

Crisis de autoridad, crisis de poder


Propuesta para el dilogo
Algunos autores se quejan de que hoy en da vivimos una crisis de autoridad que repercute en todos los mbitos de la vida social y poltica y, de una manera muy directa, en el mbito familiar y educativo en general. Manifiestan que la sociedad actual est confundiendo la democracia con la falta de autoridad y con una tolerancia absoluta. Democracia no significa tolerancia para todo, sino que la autoridad no se ejerce de una manera arbitraria o desptica, sino que es velada por la misma colectividad. A lo largo de los siglos, y despus de muchas luchas y sufrimientos, hemos llegado a comprender que ningn ser humano tiene potestad sobre ningn otro. Todas las personas somos iguales y por esta raz n nadie nace siendo s bdito de otro. Es indiferente ser carpintero, jardinero, ministro o presidente, blanco o negro; lo que realmente importa es que somos seres humanos. La sociedad nos debe dar a todos las mismas oportunidades, porque todos somos iguales y nadie tiene potestad sobre nadie. La autoridad slo es un servicio que la gente encarga, y sea cual sea el mbito de servicio confiado, ha de contribuir al respeto de la libertad y la dignidad de todo el mundo. La sociedad delega en unas personas e instituciones una serie de servicios para administrar el bien comn. Si alguien tiene autoridad es porque le ha sido dada por el conjunto de la sociedad. Aquellas personas que sin haber recibido este encargo quieren tener o ejercer una falsa autoridad caen en la tentacin del poder. Se imponen por la va de la fuerza en el intento de doblegar la libertad de los dems a sus intereses. Se otorgan una potestad que no tienen y que de ninguna manera no pueden justificar, porque nadie se la ha podido dar. Para legitimarla, deben invocar a los dioses, a la historia, a falsas ideologas o a la necesidad de conseguir, dicen ellos, un futuro mejor para la humanidad. Cuando me adjudico el poder es cuando me convierto en un lobo para los dems hombres. Este uso del poder ha puesto en crisis el mismo concepto de autoridad. Las actitudes en contra de aquellas personas e instituciones a quienes hemos delegado el servicio de la autoridad son el resultado de la confusin existente entre autoridad y poder. Esta confusin va en detrimento del legtimo ejercicio de la autoridad: con el pretexto de que la autoridad est en crisis, se imponen los propios criterios y decisiones. En este inicio de milenio son necesarios hombres y mujeres que, renunciando a tener poder, sepan ejercer con prudencia y sabidura el servicio de la autoridad. Y que con su correcto ejercicio se conviertan en referentes para construir una sociedad ms slida y democrtica.

35

10

40

15

45

20

50

25

55

30

20 de enero del 2005


JORDI CUSS I PORREDON

http://www.ua-ambit.org

1 Exame de Qualificao

Vestibular Estadual 2006

353

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | E SPANHOL

QUESTO

16

El texto expone inquietudes respecto a la relacin entre autoridad y poder. La alternativa que mejor sintetiza la opinin del autor respecto a esa relacin es: (A) la diferencia entre autoridad y poder se origina de falacias (B) el rechazo a la autoridad procede del uso inadecuado del poder (C) los ocupantes de cargos de autoridad se otorgan una potestad compatible (D) la gente encarga servicios de autoridad a quienes no tienen poder legitimado

QUESTO

17

En el texto se identifica la presentacin de otros puntos de vista que no coinciden con el del autor. El fragmento que contiene una posicin diferente de la del autor es: (A) la sociedad actual est confundiendo la democracia con la falta de autoridad y con una tolerancia absoluta. (l. 5 - 7) (B) hemos llegado a comprender que ningn ser humano tiene potestad sobre ningn otro. (l. 13 - 15) (C) La sociedad delega en unas personas e instituciones una serie de servicios para administrar el bien comn. (l. 26 - 28) (D) Aquellas personas que sin haber recibido este encargo quieren tener o ejercer una falsa autoridad caen en la tentacin del poder. (l. 31 - 33)

QUESTO

18

El intento de legitimar el poder se puede justificar de distintos modos. En el cuarto prrafo, esas justificaciones se elaboran a partir de: (A) opiniones categricas (B) posiciones antagnicas (C) explicaciones contradictorias (D) argumentaciones inconsistentes

QUESTO

19

La comprensin de los pronombres personales slo se establece en el contexto. El pronombre subrayado que identifica claramente al enunciador del texto est expreso en el siguiente fragmento: (A) La sociedad nos debe dar a todos las mismas oportunidades, (l. 19 - 20) (B) Si alguien tiene autoridad es porque le ha sido dada por el conjunto de la sociedad. (l. 28 - 30) (C) Cuando me adjudico el poder es cuando me convierto en un lobo para los dems hombres. (l. 41 - 43) (D) Y que con su correcto ejercicio se conviertan en referentes para construir una sociedad ms slida y democrtica. (l. 56 - 58)

1 Exame de Qualificao

10

Vestibular Estadual 2006

354

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | E SPANHOL

COM BASE NA IMAGEM E NO TEXTO ABAIXO, RESPONDA S QUESTES DE NMEROS 20 E 21.

El Movimiento Manuela Ramos es una asociacin civil peruana sin fines de lucro que desde hace 26 aos viene trabajando para mejorar la situacin y posicin de las mujeres. Manuela Ramos produjo este espacio radial para que los y las jvenes puedan expresar sus dudas y preguntas en torno a la sexualidad. Se elaboraron ms de 100 programas con un promedio de 60 llamadas por emisin. A pesar que la emisora estaba en el puesto 14 de rating, Prohibido Escuchar...Nos ocup el cuarto lugar de sintona en su horario.
http://www.manuela.org.pe

QUESTO

20

En el cartel se evidencia una relacin entre el gesto de poner los dedos en los odos y el ttulo del programa radial. El significado que se construye en esa relacin es el de: (A) aceptacin (B) reparacin (C) oposicin (D) nfasis

QUESTO

21

Prohibido Escuchar Nos


El sentido de este ttulo indica una interdiccin. En relacin al programa, esa interdiccin funciona como forma especial de llamar la atencin hacia la: (A) naturaleza del tema (B) preferencia del pblico (C) definicin del patrocinio (D) censura a la programacin

1 Exame de Qualificao

11

Vestibular Estadual 2006

355

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | I NGLS

COM BASE NO TEXTO ABAIXO, RESPONDA S QUESTES DE NMEROS 16 A 19.

What is authority? Differentiating authority, power and legitimacy


The term authority refers to an abstract concept with both sociological and psychological components. As a child born of a myriad of different social situations which have some rough similarities, no easy definition exists. Of particular concern throughout the literature on the topic is the entanglement of the concepts of authority, power and legitimacy. Power is the ability, whether personal or social, to get things done either to enforce ones own will or to enforce the collective will of some group over others. Legitimacy is a socially constructed and psychologically accepted right to exercise power. A person can have legitimacy but no actual power (the legitimate king might reside in exile, destitute and forgotten). A person can have actual power but not legitimacy (the usurper who exiled the king and appropriates the symbols of office). In all social situations a person is treated as an authority only when he has both power and legitimacy. We might consider, for example, the phrase uttered so often when someone intrudes into our business in order to give commands: You have no authority here. What does that mean? It might mean that the person has no legitimate claim to be heard or heeded. It might mean that the person has no social power he has not the ability to enforce his will over the objections of others. Or, it might be both. In any event, both must be present for authority to exist (socially) and be acknowledged (psychologically). When a person has authority over others, it means something a bit more than simply that he has a right to exercise existing power. The missing ingredient is psychological the previously mentioned but not explicated issue of acknowledgment. Both power and legitimacy are social in that they exist in the interplay between two or more humans. Yet what goes on in the mind of a person when he acknowledges the authority of another? It isnt simply that he accepts the factual existence of power or legitimacy; rather, its that he accepts that an authority figure is justified in making a decision without also explaining the reason for that, and persuading others to accept that the decision was reached properly. If I have authority over you, I can expect that when I make a decision you will go along with that decision, even if I dont take the time to explain it to you and persuade you that it is indeed right. Your acceptance of me as an authority implies that you have implicitly agreed to be persuaded, and wont demand explicit explanations and reasons. When you act, it wont be because of me enforcing my will over you, nor will it have anything to do with the legitimacy of my power. Instead, it will simply be you exercising your will for your own reasons.

35

40

10

45

15

50

20

55

25

30

AUSTIN CLINE

http://atheism.about.com

1 Exame de Qualificao

15

Vestibular Estadual 2006

356

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | I NGLS

QUESTO

16

The text establishes interrelations between the concepts of authority, power and legitimacy. The position of the author is best expressed in the following relationship: (A) legitimacy weakens power (B) power undermines authority (C) authority presupposes legitimacy (D) legitimacy encompasses authority

QUESTO

17

The argumentative structure of the text contains three phases that reflect the writers reasoning process. The correct ordering of stages in the argumentation developed by the author is: (A) thesis problem explanation (B) opinion assertion synthesis (C) suggestion justification contrast (D) hypothesis discussion disagreement

QUESTO

18

The author conceptualizes authority in psychological terms, describing the kind of influence exerted by those who are in power. The psychological component is more clearly expressed in the following fragment: (A) In all social situations a person is treated as an authority only when he has both power and legitimacy. (l. 19 - 21) (B) It might mean that the person has no legitimate claim to be heard or heeded. (l. 24 - 26) (C) When a person has authority over others, it means something a bit more than simply that he has a right to exercise existing power. (l. 32 - 34) (D) Your acceptance of me as an authority implies that you have implicitly agreed to be persuaded, and wont demand explicit explanations and reasons. (l. 50 - 53)

QUESTO

19

Connectors establish a set of semantic roles while linking clauses. Observe the kind of link employed in the sentence below.

It isnt simply that he accepts the factual existence of power or legitimacy; rather, its that he accepts that an authority figure is justified in making a decision without also explaining the reason for that, (l. 41 - 44)
The information that follows the underlined connector functions as: (A) enumeration (B) replacement (C) reinforcement (D) exemplification

1 Exame de Qualificao

16

Vestibular Estadual 2006

357

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS |

INGLS

COM BASE NA IMAGEM E NO TEXTO ABAIXO, RESPONDA S QUESTES DE NMEROS 20 E 21.

http://www.danisch.de

Harrods is Londons most famous department store. The store began in the mid-19th century when Henry Charles Harrod opened a small shop. Today the foodhalls alone fill seven rooms.

QUESTO

20

Signs are public displays of usually written messages. From the locations listed below, the one that is most appropriate for the posting of the sign above would be: (A) outside bakeries (B) on grocers counters (C) at recreational areas (D) inside eating facilities

QUESTO

21

Politeness in language attenuates the force of commands, partially hiding the intended meaning. The message on the sign has the same meaning as: (A) pay prior to exiting (B) refunds are not allowed (C) money back guaranteed (D) no eating in the premises

1 Exame de Qualificao

17

Vestibular Estadual 2006

358

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

QUESTO

22

Para estudar os processos de diluio e mistura foram utilizados, inicialmente, trs frascos contendo diferentes lquidos. A caracterizao desses lquidos apresentada na ilustrao abaixo.

A seguir, todo o contedo de cada um dos frascos foi transferido para um nico recipiente. Considerando a aditividade de volumes e a ionizao total dos cidos, a mistura final apresentou uma concentrao de ons H + , em mol L- 1, igual a: (A) 0,60 (B) 0,36 (C) 0,24 (D) 0,12

QUESTO

23
V(cm 3 ) 8 6 4 2

A relao entre o volume e a massa de quatro substncias, A,B,C, e D, est mostrada no grfico.

A B C D

8 9 10

12

m(g)

Essas substncias foram utilizadas para construir quatro cilindros macios. A massa de cada cilindro e a substncia que o constitui esto indicadas na tabela abaixo.

Se os cilindros forem mergulhados totalmente em um mesmo lquido, o empuxo ser maior sobre o de nmero: (A) I (B) II (C) III (D) IV

1 Exame de Qualificao

18

Vestibular Estadual 2006

359

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

UTILIZE AS INFORMAES ABAIXO PARA RESPONDER S QUESTES DE NMEROS 24 E 25.

A cincia da fisiologia do exerccio estuda as condies que permitem melhorar o desempenho de um atleta, a partir das fontes energticas disponveis. A tabela a seguir mostra as contribuies das fontes aerbia e anaerbia para gerao de energia total utilizada por participantes de competies de corrida, com durao variada e envolvimento mximo do trabalho dos atletas.

QUESTO

24

Observe o esquema abaixo, que resume as principais etapas envolvidas no metabolismo energtico muscular.

Ao final da corrida de 400 m, a maior parte da energia total dispendida por um recordista dever originar-se da atividade metablica ocorrida nas etapas de nmeros: (A) 1 e 3 (B) 1 e 4 (C) 2 e 4 (D) 2 e 5

QUESTO

25

Considere um recordista da corrida de 800 m com massa corporal igual a 70 kg. Durante a corrida, sua energia cintica mdia, em joules, seria de, aproximadamente: (A) 1.120 (B) 1.680 (C) 1.820 (D) 2.240

1 Exame de Qualificao

19

Vestibular Estadual 2006

360

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

QUESTO

26

Uma das condies necessrias para o perfeito funcionamento do organismo humano a manuteno da adequada faixa de concentrao de ons nos lquidos orgnicos, como o plasma sangneo e o lquido intracelular. Os grficos abaixo mostram as concentraes, em miliequivalentes por litro, de alguns ctions e nions em diversas solues.

As faixas de concentraes inicas mais compatveis com as do plasma sangneo e as do lquido intracelular esto representadas, respectivamente, nos seguintes grficos: (A) I e II (B) II e IV (C) III e I (D) IV e III

QUESTO

27

Para a obteno do ndice pluviomtrico, uma das medidas de precipitao de gua da chuva, utiliza-se um instrumento meteorolgico denominado pluvimetro. A ilustrao abaixo representa um pluvimetro com rea de captao de 0,5 m2 e raio interno do cilindro de depsito de 10 cm. captao

cilindro de depsito

nvel de gua

Considere que cada milmetro de gua da chuva depositado no cilindro equivale a 1 L/m 2. No ms de janeiro, quando o ndice pluviomtrico foi de 90 mm, o nvel de gua no cilindro, em dm, atingiu a altura de, aproximadamente: (A) 15 (B) 25 (C) 35 (D) 45

1 Exame de Qualificao

20

Vestibular Estadual 2006

361

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

QUESTO

28

Observe as situaes abaixo, nas quais um homem desloca uma caixa ao longo de um trajeto AB de 2,5 m.

F1

F2

As foras F1 e F2, exercidas pelo homem nas duas situaes, tm o mesmo mdulo igual a 0,4 N e os ngulos entre suas direes e os respectivos deslocamentos medem e 2 . Se k o trabalho realizado, em joules, por F1, o trabalho realizado por F2 corresponde a: (A) 2 k (B) k 2 (C) k 2 + 1 2 (D) 2k 2 1

QUESTO

29

Numa aula experimental, foram preparadas quatro solues eletrolticas com a mesma concentrao de soluto e as mesmas condies adequadas para o estabelecimento de um estado de equilbrio.

A seguir, cada uma dessas solues foi submetida a um teste de condutividade eltrica. Observe abaixo o esquema do teste realizado.
U
lmpada

eletrodos soluo eletroltica

A soluo na qual a posio de equilbrio est acentuadamente deslocada no sentido 2, e provocar, quando submetida ao teste, menor intensidade luminosa da lmpada, a de nmero: (A) I (B) II (C) III (D) IV

1 Exame de Qualificao

21

Vestibular Estadual 2006

362

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

QUESTO

30

Num experimento para a determinao do nmero de partculas emitidas pelo radnio, foi utilizada uma amostra contendo 0,1 mg desse radioistopo. No primeiro dia do experimento, foram emitidas 4,3 1016 partculas. Sabe-se que a emisso de um dia sempre 16% menor que a do dia anterior. O nmero total de partculas que essa amostra emite, a partir do primeiro dia do experimento, aproximadamente igual a: (A) 4,2 (B) 2,6 (C) 4,3 (D) 2,7 1018 1018 1017 1017

UTILIZE AS INFORMAES ABAIXO PARA RESPONDER S QUESTES DE NMEROS 31 E 32.

- As solues-tampo so utilizadas para regular a acidez de alguns sistemas, pois resistem s variaes do pH quando pequenas quantidades de um cido ou de uma base so adicionadas a esses sistemas. - Os tampes tm importante funo nos processos qumicos e biolgicos, como, por exemplo, a de impedir grandes variaes do pH do sangue. - Um dos sistemas que contribuem para o tamponamento do sangue constitudo pelas substncias H2CO3 e NaHCO3. As equaes qumicas abaixo representam os equilbrios dessas substncias no sangue.

- O pH desse sistema-tampo pode ser calculado pela seguinte expresso:

- No sangue, a concentrao de cido carbnico varia com a presso parcial do CO2.

QUESTO

31

Considere o pH fisiolgico e o pKa iguais a 7,4 e 6,1, respectivamente. Para que esse pH seja mantido, a razo (A) 0,1 (B) 2,5 (C) 10,0 (D) 20,0 dever ser igual a:

1 Exame de Qualificao

22

Vestibular Estadual 2006

363

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

QUESTO

32

Uma pessoa em repouso respira normalmente. Em determinado momento, porm, ela prende a respirao, ficando em apnia pelo maior tempo que consegue suportar, provocando, da em diante, hiperventilao pulmonar. As curvas mostradas no grfico abaixo representam alteraes de pH do sangue num determinado perodo de tempo, a partir do incio da apnia.
pH do sangue
7,5

W X Y

7,4

Z
7,3

tempo

A nica curva que representa as alteraes do pH do sangue dessa pessoa, durante a situao descrita, a identificada pela seguinte letra: (A) W (B) X (C) Y (D) Z

QUESTO

33

Experimentos recentes indicam que clulas-tronco retiradas da medula ssea de um indivduo adulto, portador de leso no miocrdio, puderam formar tecido normal quando implantadas na regio lesada do corao. As clulas-tronco podem ser retiradas, tambm, de embries em sua fase inicial de desenvolvimento. A tabela abaixo informa as caractersticas de algumas variveis analisadas em clulas-tronco embrionrias e adultas.

Considerando o uso teraputico das clulas-tronco, a alternativa que indica o tipo de clula que possui a caracterstica mais vantajosa para as variveis I, II e III, respectivamente, : (A) embrionria adulta adulta (B) adulta embrionria adulta (C) embrionria adulta embrionria (D) embrionria embrionria embrionria

1 Exame de Qualificao

23

Vestibular Estadual 2006

364

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

QUESTO

34
Na natureza nada se cria, nada se perde; tudo se transforma.

Esse enunciado conhecido como Lei da Conservao das Massas ou Lei de Lavoisier. Na poca em que foi formulado, sua validade foi contestada, j que na queima de diferentes substncias era possvel observar aumento ou diminuio de massa. Para exemplificar esse fenmeno, considere as duas balanas idnticas I e II mostradas na figura abaixo. Nos pratos dessas balanas foram colocadas massas idnticas de carvo e de esponja de ao, assim distribudas: - pratos A e C: carvo; - pratos B e D: esponja de ao.

prato A

prato B

prato C

prato D

II

A seguir, nas mesmas condies reacionais, foram queimados os materiais contidos em B e C, o que provocou desequilbrio nos pratos das balanas. Para restabelecer o equilbrio, sero necessrios procedimentos de adio e retirada de massas, respectivamente, nos seguintes pratos: (A) A e D (B) B e C (C) C e A (D) D e B

QUESTO 35
Duas importantes aes na luta contra o aumento do efeito estufa so a limitao da queima de combustveis fsseis e a promoo do crescimento de florestas. A importncia do crescimento das florestas se deve ocorrncia, nas plantas, da etapa metablica resumida na seguinte equao qumica: (A) (B) (C) (D)

1 Exame de Qualificao

24

Vestibular Estadual 2006

365

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

QUESTO

36

A intensidade I de um terremoto, medida pela escala Richter, definida pela equao abaixo, na qual E representa a energia liberada em kWh.

O grfico que melhor representa a energia E, em funo da intensidade I, sendo E0 igual a 10 3 kWh, est indicado em:
(A) E

(B) E

(C) E

(D) E

1 Exame de Qualificao

25

Vestibular Estadual 2006

366

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

UTILIZE AS INFORMAES ABAIXO PARA RESPONDER S QUESTES DE NMEROS 37 A 40.

- Uma rea agrcola, prxima a um lago, precisa ser adubada antes do incio do plantio de hortalias. - O esquema abaixo indica as medidas do terreno a ser plantado. Os dois lados paralelos distam 10 km e os trs ngulos obtusos indicados so congruentes.
10 km

10 km

45

20 km
lago

- Para corrigir a elevada acidez do solo, o produto recomendado foi o calcrio (CaCO3), na dosagem de 5 g/m2 de solo. - Para a adubao do terreno, emprega-se um pulverizador com 40 m de comprimento, abastecido por um reservatrio de volume igual a 2,16 m3, que libera o adubo vazo constante de 1.200 cm3/s. Esse conjunto, rebocado por um trator que se desloca velocidade constante de 1 m/s, est representado na figura abaixo.

www.copercampos.com.br

- A partir do incio da adubao, a qualidade da gua do lago passou a ser avaliada com regularidade.

QUESTO

37

A rea do terreno a ser plantada , em km2, igual a: (A) 160 (B) 165 (C) 170 (D) 175

1 Exame de Qualificao

26

Vestibular Estadual 2006

367

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

QUESTO

38

Para corrigir a acidez do solo, a quantidade de matria necessria, em mol de CaCO3, por km2 de rea a ser plantada, corresponde a: (A) 4,0 106 (B) 5,0 104 (C) 1,5 103 (D) 2,5 102

QUESTO

39

Considere o reservatrio do pulverizador completamente cheio de adubo. A rea mxima, em m 2, que o trator pode pulverizar com todo esse adubo, aproximadamente igual a: (A) 18.000 (B) 60.000 (C) 72.000 (D) 90.000

QUESTO

40

Os resultados das avaliaes da qualidade da gua do lago indicaram alteraes na concentrao de alguns de seus componentes, condizentes com o aumento da poluio orgnica, conforme mostra o grfico abaixo.

As curvas que correspondem s variaes na concentrao de microorganismos aerbios e anaerbios, respectivamente, so: (A) I II (B) I III (C) II I (D) II III

1 Exame de Qualificao

27

Vestibular Estadual 2006

368

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

QUESTO

41

As milhares de protenas existentes nos organismos vivos so formadas pela combinao de apenas vinte tipos de molculas. Observe abaixo as frmulas estruturais de diferentes molculas orgnicas, em que R1 e R2 representam radicais alquila.

0
R1 NH2 OH R1 NO2

0
OH R1 NH2

0
H R1 NO2

0
H

II

III

IV

0
R2 NH2 OH R2 NO2

0
OH R2 NH2

0
H R2 NO2

0
H

VI

VII

VIII

As duas frmulas que, combinadas, formam uma ligao qumica encontrada na estrutura primria das protenas so: (A) I e V (B) II e VII (C) III e VIII (D) IV e VI

QUESTO

42

Um grupo de alunos, ao observar uma tempestade, imaginou qual seria o valor, em reais, da energia eltrica contida nos raios. Para a definio desse valor, foram considerados os seguintes dados: - potencial eltrico mdio do relmpago = 2,5 107 V; - intensidade da corrente eltrica estabelecida = 2,0 105 A; - custo de 1 kWh = R$ 0,38. Admitindo que o relmpago tem durao de um milsimo de segundo, o valor aproximado em reais, calculado pelo grupo para a energia nele contida, equivale a: (A) 280 (B) 420 (C) 530 (D) 810

1 Exame de Qualificao

28

Vestibular Estadual 2006

369

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

QUESTO

43

Duas barras metlicas A e B, de massas mA=100 g e mB=120 g, inicialmente temperatura de 0 oC, so colocadas, durante 20 minutos, em dois fornos. Considere que toda a energia liberada pelas fontes trmicas seja absorvida pelas barras. O grfico a seguir indica a relao entre as potncias trmicas fornecidas a cada barra e o tempo de aquecimento.

Aps esse perodo, as barras so retiradas dos fornos e imediatamente introduzidas em um calormetro ideal. O diagrama abaixo indica a variao da capacidade trmica de cada barra em funo de sua massa.

A temperatura que corresponde ao equilbrio trmico entre as barras A e B , em oC, aproximadamente igual a: (A) 70 (B) 66 (C) 60 (D) 54

1 Exame de Qualificao

29

Vestibular Estadual 2006

370

CINCIAS HUMANAS E SUAS TECNOLOGIAS

A prova desta rea aborda os temas Territrio, Ideologia e Trabalho em diferentes tempos e espaos sociais.

QUESTO

44

(Adaptado de Atlas histrico escolar. Rio de Janeiro: IBGE, 2002.)

No mapa acima, est representado o processo de estruturao da atual diviso poltico-administrativa do territrio brasileiro. Ao longo da histria, dois fatores responsveis pelas alteraes dessa diviso esto relacionados com: (A) centralizao do poder e zoneamento extrativo (B) crescimento das oligarquias e investimento na produo (C) domnio do territrio e explorao dos recursos naturais (D) fortalecimento do nacionalismo e expanso da agricultura

QUESTO

45

Em Ancara e Istambul, conversei com Alain Touraine [socilogo] e perguntei o que ele achava da idia de desfuso do Estado do Rio de Janeiro como maneira de encaminhar solues para problemas como a violncia. A primeira pergunta que fez foi: E a Baixada Fluminense fica com quem?
(Adaptado de PEREIRA, Merval. O Globo, 20/04/2005.)

A questo apresentada por Alain Touraine est relacionada aos vnculos de ordem social, poltica e econmica estabelecidos no interior das regies metropolitanas. A proposta da desfuso do atual Estado do Rio de Janeiro, se desconsiderar esses vnculos, promover novas formas de segregao socioespacial, em funo basicamente da: (A) ciso poltico-partidria (B) descaracterizao cultural (C) disperso da mo-de-obra (D) polarizao de investimentos

1 Exame de Qualificao

30

Vestibular Estadual 2006

371

CINCIAS HUMANAS E SUAS TECNOLOGIAS

QUESTO

46

(Adaptado de REZENDE, A. P. e DIDIER, M. T. Rumos da histria. So Paulo: Atual, 2001.)

A economia cafeeira comeou a prosperar significativamente na regio do Vale do Paraba fluminense e paulista na dcada de 1840 e entrou em decadncia a partir dos anos de 1870. Um dos fatores que contriburam para essa decadncia est descrito em: (A) doao das terras devolutas aos colonos, em conseqncia da Lei de Terras (B) reduo do nmero de escravos, devido proibio imposta pela Lei Euzbio de Queiroz (C) baixa produtividade agrcola, em razo da falta de escravos gerada pela Lei do Ventre Livre (D) proibio do trfico de escravos interprovincial, em funo das imposies do Bill Aberdeen

QUESTO

47

Nos ltimos meses, crianas indgenas Guarani-Kaiow que vivem na regio de Dourados, no Mato Grosso do Sul, esto morrendo pela combinao de duas causas terrveis: desnutrio e falta de gua potvel. A cada 1.000 crianas nascidas no Brasil, 25 morrem antes de completar um ano de idade. Das crianas de etnia Guarani-Kaiow na aldeia de Tacuru, 99 morrem antes de completar um ano de vida. Ou seja, uma taxa de mortalidade infantil 4 vezes maior do que a mdia nacional.
(Adaptado de POIRIER, Marie-Pierre. Carta da representante do UNICEF no Brasil, maio de 2005.)

A situao de indigncia descrita no texto expressa o processo precrio de incorporao das diferentes etnias indgenas sociedade brasileira contempornea, especialmente nas regies exploradas pelo agronegcio. Esse processo provoca a perda de condies de sustentabilidade dessas populaes e sua conseqente insero perifrica na economia do pas. O fator que inviabiliza a sustentabilidade e uma das conseqentes formas de insero perifrica da populao indgena citada, respectivamente, so: (A) deteriorao das condies de produo e sujeio ao capital (B) corte do financiamento pblico e dependncia do consumo urbano (C) inacessibilidade aos insumos bsicos e subordinao ao mercado fundirio (D) xodo da mo-de-obra jovem e desvinculao das relaes capitalistas de produo

1 Exame de Qualificao

31

Vestibular Estadual 2006

372

CINCIAS HUMANAS E SUAS TECNOLOGIAS

QUESTO

48

O jovem operrio entra ento de vez na idade adulta? Seguramente no. Ele requer proteo e controle. Proteo: segundo a lei de 1841 (na Inglaterra), at os dezesseis anos proibido faz-lo trabalhar aos domingos e mais de doze horas por dia.
(PERROT, M. In: LEVI, G. & SCHMITT, J. C. Histria dos jovens. So Paulo: Companhia das Letras, 1996.)

No Brasil, o artigo 67 do Estatuto da Criana e do Adolescente probe a contratao de menores para trabalho noturno, perigoso, insalubre e penoso. O Estatuto tambm probe que os adolescentes trabalhem em locais prejudiciais sua formao e ao seu desenvolvimento fsico, psquico, moral e social.
(MOTA, M. B. e BRAICK, P. R. Histria: das cavernas ao terceiro milnio. So Paulo: Moderna, 1997.)

Apesar da existncia de leis e estatutos que impedem a explorao do trabalho de crianas e adolescentes, essa ainda uma realidade do mundo contemporneo. O emprego das mos-de-obra infantil e adolescente, tanto na poca da Revoluo Industrial inglesa como nos dias atuais, tem razes comuns, como: (A) xodo rural e industrializao tardia (B) retraimento demogrfico e baixa escolaridade (C) desvalorizao salarial e concentrao fundiria (D) excesso de leis trabalhistas e desigualdade socioeconmica

QUESTO

49

LADEIRA DA MISERICRDIA, MORRO DO CASTELO, INCIO DO SCULO XX

PAO IMPERIAL, PRAA QUINZE, INCIO DO SCULO XXI

(Jornal do Brasil , 27/02/1994)

O desmonte do Morro do Castelo, em 1922, e a reabilitao do Pao Imperial, a partir de 1985, so exemplos de aes polticas que se baseiam em distintas concepes de preservao de stios histricos. Os fatores ideolgicos que nortearam tais aes nesses momentos histricos de mudana e de permanncia, respectivamente, so: (A) superao da ordem colonial e resgate da memria social (B) negao da origem europia e estruturao do poder pblico (C) difuso dos princpios positivistas e construo da cidadania ativa (D) substituio do iderio monrquico e emergncia da cultura popular

1 Exame de Qualificao

32

Vestibular Estadual 2006

373

CINCIAS HUMANAS E SUAS TECNOLOGIAS

QUESTO

50

(PEREIRA, R.F. Revista do estudante. Rio de Janeiro: Arquivo Nacional, 2002.)

O ano de 1922 foi um marco na transformao da sociedade brasileira, durante o qual se assistiu a diversos movimentos de contestao da ordem, alm das comemoraes do Centenrio da Independncia. Caracterizam a dcada de 1920 os seguintes acontecimentos histricos: (A) ecloso da Revolta da Vacina e crescimento da Aliana Liberal (B) instalao da Semana de Arte Moderna e organizao dos sindicatos corporativistas (C) incio da reforma urbana do Rio de Janeiro e instituio da Poltica dos Governadores (D) rebelio tenentista do Forte de Copacabana e fundao do primeiro partido comunista brasileiro

QUESTO

51

PASSEATA DOS CEM MIL NO RIO DE JANEIRO, JUNHO DE 1968

PROTESTO EM PARIS, MAIO DE 1968

(FREIRE, Amrico e outros. Histria em curso. Rio de Janeiro: FGV, 2004.)

(MOCELLIN, R. e CAMARGO, R. de. Passaporte para a Histria. So Paulo: Editora do Brasil, 2004.)

Em 1968, vrios pases foram palco de movimentos que expressaram insatisfaes em relao ao sistema estabelecido. Tanto no Brasil quanto na Frana, estudantes e intelectuais se destacaram nas manifestaes pblicas de protesto. Dois objetivos que esses grupos pretendiam alcanar esto apontados em: (A) valorizao da contracultura e supresso dos organismos polticos (B) democratizao de instituies vigentes e crtica cultura dominante (C) recuperao das propostas stalinistas e contestao ao mundo burgus (D) unificao dos movimentos sociais por meio da luta armada e combate s estruturas burocratizantes
1 Exame de Qualificao

33

Vestibular Estadual 2006

374

CINCIAS HUMANAS E SUAS TECNOLOGIAS

LEIA OS FRAGMENTOS DAS LETRAS DE MSICA ABAIXO E RESPONDA S QUESTES DE NMEROS 52 E 53. I II

Quem trabalha quem tem razo Eu digo e no tenho medo de errar O bonde de So Janurio Leva mais um operrio Sou eu que vou trabalhar
(Wilson Batista / Ataulfo Alves - 1940)

E se grande o cu, a terra e o mar O seu povo bom no menor (...) Quem v o Brasil que no tem fim No chega a saber por que razo Este pas to grande assim Cabe inteirinho em meu corao!
(Joo de Barro / Alberto Ribeiro / Alcir Pires Vermelho - 1940)

III

IV

Para nos orientar No Brasil no falta nada Mas precisa trabalhar (...) E quem for pai de quatro filhos O presidente manda premiar negcio casar.
(Ataulfo Alves / Felisberto Martins 1941)

Acertei no milhar Ganhei 500 contos No vou mais trabalhar E me d toda a roupa velha aos pobres E a moblia podemos quebrar.
(Wilson Batista / Geraldo Pereira 1940)

QUESTO

52

A leitura desses fragmentos permite depreender valores sociais e polticos predominantes no pas na Era Vargas (1930-1945). Utilizando-se da msica em seu favor, o governo Vargas adotou a seguinte postura: (A) popularizou o chorinho e determinou a produo de chanchadas (B) estimulou o teatro de revista e reprimiu a msica clssica nas escolas (C) valorizou o samba-exaltao e oficializou o desfile das escolas de samba (D) permitiu a ascenso do jongo e imps carter didtico aos sambas-enredo

QUESTO

53

A difuso de uma ideologia disciplinadora sobre o cotidiano dos indivduos, promovida pelo governo Vargas, e a resistncia popular a essa ideologia so expressas, respectivamente, pelos fragmentos de nmeros: (A) I e II (B) I e III (C) II e IV (D) III e IV

1 Exame de Qualificao

34

Vestibular Estadual 2006

375

CINCIAS HUMANAS E SUAS TECNOLOGIAS

QUESTO

54

O IBGE contou 10,34 milhes de empreendimentos de pequenos negcios informais em 2003, que empregavam 13,86 milhes de pessoas, o equivalente a 25,45% da fora de trabalho das cidades brasileiras. um exrcito de trabalhadores, superior, por exemplo, a toda a populao de Portugal.
(Adaptado de O Globo, 20/05/2005)

(Adaptado de JAKOBSEN, K. e outros (Org.). Mapa do trabalho informal. So Paulo: Fundao Perseu Abramo, 2000.)

Ao longo das duas ltimas dcadas, a estrutura do mercado de trabalho no Brasil e na Amrica Latina experimentou transformaes tanto no setor formal quanto no informal, conforme revelam os dados acima. Uma das causas dessas mudanas na estrutura do mercado de trabalho est diretamente relacionada com: (A) a descapitalizao do Estado, que restringe sua funo empregadora (B) o desemprego estrutural, que deprecia a qualificao profissional (C) a renovao tecnolgica, que rebaixa a remunerao salarial (D) a terceirizao de servios, que reduz mo-de-obra informal

QUESTO

55

A explorao das Florestas Nacionais pelo setor privado , para o Secretrio de Biodiversidade e Florestas do Ministrio do Meio Ambiente, Joo Paulo Capobianco, a nica sada possvel para inibir o desmatamento e a grilagem. Para o secretrio, desde o Brasil Colnia, doam-se florestas pblicas para terceiros, que a partir da passam a utilizar essas reas sem nenhum tipo de remunerao para a sociedade. No sistema de gesto, as florestas continuaro pblicas, e os interessados tero de identificar reas prioritrias para conservao e explorar de forma sustentvel as demais.
(Adaptado de Carta Capital, 02/02/2005)

Esse modelo de gesto florestal, j adotado em outros pases, apresentado sociedade brasileira como uma alternativa tcnica e poltica para a explorao da Floresta Amaznica, frente expanso do desmatamento. Na prtica, para a sociedade brasileira, um aspecto positivo e outro negativo desse modelo esto explicitados, respectivamente, em: (A) manejo da biodiversidade e fiscalizao precria (B) controle do acesso terra e minimizao dos lucros (C) preservao da biomassa e reduo da produtividade (D) manuteno dos recursos hdricos e estatizao dos recursos

1 Exame de Qualificao

35

Vestibular Estadual 2006

376

CINCIAS HUMANAS E SUAS TECNOLOGIAS

QUESTO

56
(O Globo, 06/05/2005)

Sessenta anos se passaram desde o fim da Segunda Guerra Mundial, mas terror, fanatismo, fundamentalismo, dio racial ainda freqentam os noticirios de hoje. Considerando as relaes poltico-econmicas na Europa, um dos fatores determinantes dessa Guerra est descrito em: (A) ecloso da Guerra Civil espanhola, que propagou movimentos revolucionrios por diversos pases (B) imposio dos tratados de paz, que submeteram os vencidos a pagamentos de reparaes de guerra (C) deflagrao da crise de 1929, que deixou vrias naes do continente em posio desvantajosa frente aos pases americanos (D) instalao do cordo sanitrio, que se ops ao avano do comunismo nos pases do Leste com a formao da Liga das Naes

QUESTO

57

(Correio da Manh, 25/07/1917)

(O Globo, 15/05/2005)

A manchete do Correio da Manh e a caricatura de Chico Caruso retratam diferentes momentos do movimento operrio brasileiro. Nas duas primeiras dcadas do sculo passado, esse movimento se estruturou principalmente sob a influncia da ideologia anarquista; j no final da dcada de 1970, sob a liderana de Lula, o movimento sofreu influncia de idias socialistas. As caractersticas que identificam, respectivamente, tais ideologias no movimento operrio brasileiro so: (A) gesto econmica comunitria participao poltica pela representao parlamentar (B) crena no acordo com patres e governo direito liberdade religiosa e de atuao poltica (C) supresso do Estado e das formas de represso livre organizao dos indivduos e da economia (D) combate s relaes de produo capitalista substituio de partidos operrios por organizaes sindicais

1 Exame de Qualificao

36

Vestibular Estadual 2006

377

CINCIAS HUMANAS E SUAS TECNOLOGIAS

AS REPORTAGENS ABAIXO APONTAM UM NOVO PAPEL DO BRASIL NAS RELAES INTERNACIONAIS, PARTICULARMENTE NA AMRICA DO SUL, A PARTIR DA EXPANSO DE SUA ECONOMIA. UTILIZE-AS PARA RESPONDER S QUESTES DE NMEROS 58 E 59.

Brasil avana na Amrica do Sul


A estratgia do governo de reafirmar a presena do Brasil na Amrica do Sul, aliada ao processo de internacionalizao de empresas brasileiras, est fazendo com que o apelido de Gigante do Sul saia dos discursos e vire realidade. A expanso econmica para os pases vizinhos se deve, do lado do governo, estratgia de reafirmar a presena do Brasil no continente e, do lado das empresas, ao caminho natural da internacionalizao pela proximidade do mercado.
(Adaptado de CAETANO, Valderez. O Globo, 23/05/2005.)

Ministrio admite pior cenrio


O Ministrio das Minas e Energia afirmou ontem que o governo brasileiro est bastante preocupado com a situao na Bolvia, onde milhares de camponeses cercaram a capital, La Paz, em protestos exigindo a nacionalizao do setor de hidrocarbonetos. A Petrobras vem operando na Bolvia desde 1996 e hoje a maior empresa do pas, onde investiu US$1,5 bilho.
(Adaptado de SCOFIELD, Gilberto. O Globo, 26/05/2005.)

QUESTO

58

O sistema de transporte, parte integrante do sistema logstico, essencial para o crescimento da presena brasileira em outros pases. Tal sistema estruturado no espao sulamericano, basicamente, a partir do processo de: (A) circulao livre de mo-de-obra (B) unificao jurdica do sistema modal (C) nacionalizao progressiva dos mercados (D) articulao gradual de etapas de produo

QUESTO

59

A atual crise boliviana pe em discusso as contradies existentes entre o exerccio da soberania de um pas e a sua insero nos fluxos globais. Uma dessas contradies, vivida hoje pela Bolvia, pode ser melhor explicitada pelo conflito verificado entre: (A) autonomia poltica e privatizao da produo (B) iderio liberal e desregulamentao da economia (C) participao popular e flexibilizao da legislao trabalhista (D) fortalecimento do Estado e nacionalizao do sistema financeiro

1 Exame de Qualificao

37

Vestibular Estadual 2006

378

CINCIAS HUMANAS E SUAS TECNOLOGIAS

QUESTO

60

(O Globo, 11/05/2005)

A charge de Henfil acima faz referncia influncia dos meios de comunicao, especialmente da televiso, na construo de uma identidade nacional. A interao entre realidades regionais e a chamada mdia de massa, na sociedade brasileira atual, tem como principal conseqncia: (A) resgate da histria local (B) difuso de modelos culturais (C) crescimento da integrao regional (D) fortalecimento da diversidade social

1 Exame de Qualificao

38

Vestibular Estadual 2006

379

1 EXAME DE QUALIFICAO - VESTIBULAR 2006 GABARITO OFICIAL

01 02 03 04 05 06 07 08 09 10 11 12 13 14 15

B C C D A D B B A C B D C A D

ESPANHOL

16 17 18 19 20 21

B A D A D A

FRANCS

16 17 18 19 20 21

D A C D B C

INGLS

16 17 18 19 20 21

C A D B D A

22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43

C B A D C A D A D D C C A C B D B C A A C B

44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

C D B A C A D B C D A A B A D A B

380

20 EXAME DE QUALIFICAO

2/10/2005

Neste caderno voc encontrar um conjunto de 40 (quarenta) pginas numeradas seqencialmente, contendo 60 (sessenta) questes das seguintes reas: Linguagens, Cdigos e suas Tecnologias; Cincias da Natureza, Matemtica e suas Tecnologias; Cincias Humanas e suas Tecnologias. A tabela peridica encontra-se na pgina 39. No abra o caderno antes de receber autorizao.

INSTRUES
1. Verifique se o seu nome, nmero de inscrio, nmero do documento de identidade e lngua estrangeira escolhida esto corretos no carto de respostas. Se houver erro, notifique o fiscal. Assine o carto de respostas com caneta. 2. Ao receber autorizao para abrir este caderno, verifique se a impresso, a paginao e a numerao das questes esto corretas. Caso ocorra qualquer erro, notifique o fiscal. 3. As questes de nmeros 16 a 21 da rea de Linguagens, Cdigos e suas Tecnologias devero ser respondidas de acordo com a sua opo de Lngua Estrangeira: Espanhol, Francs ou Ingls. 4. Leia com ateno cada questo e escolha a alternativa que mais adequadamente responde a cada uma delas. Marque sua resposta no carto de respostas, cobrindo fortemente o espao correspondente letra a ser assinalada; utilize caneta preta, preferencialmente, ou lpis preto n 2, conforme o exemplo abaixo:

5. A leitora de marcas no registrar as respostas em que houver falta de nitidez e/ou marcao de mais de uma letra. 6. O carto de respostas no pode ser dobrado, amassado, rasurado ou manchado. Exceto sua assinatura, nada deve ser escrito ou registrado fora dos locais destinados s respostas. 7. O tempo disponvel para fazer esta prova de, no mximo, 4 (quatro) horas. Nada mais poder ser registrado no carto de respostas aps o trmino deste prazo. 8. Ao terminar a prova, entregue ao fiscal o carto de respostas e este caderno.

BOA PROVA!

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

381

Tudo o que existe no se perde porque se transforma, mas as transformaes tm seu preo: preciso que o antigo chegue tenso mxima para que o novo possa emergir do corte das revolues. Eis por que abordamos o tema Tenses e Transformaes : qual equilibristas que se aventuram sobre o fio das tenses, persistimos nesse perigo em nome do desejo de ir alm, do direito e do dever de conquistarmos um mundo melhor. Viver por esse sonho j compensa todos os riscos. COM BASE NO TEXTO ABAIXO, RESPONDA S QUESTES DE NMEROS 01 A 05.

O suor e a lgrima
Fazia calor no Rio, 40 graus e qualquer coisa, quase 41. No dia seguinte, os jornais diriam que fora o mais quente deste vero que inaugura o sculo e o milnio. Cheguei ao Santos Dumont, o vo estava atrasado, decidi engraxar os sapatos. Pelo menos aqui no Rio, so raros esses engraxates, s existem nos aeroportos e em poucos lugares avulsos. Sentei-me naquela espcie de cadeira cannica, de coro de abadia pobre, que tambm pode parecer o trono de um rei desolado de um reino desolante. O engraxate era gordo e estava com calor o que me pareceu bvio. Elogiou meus sapatos, cromo italiano, fabricante ilustre, os Rosseti. Uso-o pouco, em parte para poup-lo, em parte porque quando posso estou sempre de tnis. Ofereceu-me o jornal que eu j havia lido e comeou seu ofcio. Meio careca, o suor encharcou-lhe a testa e a calva. Pegou aquele paninho que d brilho final nos sapatos e com ele enxugou o prprio suor, que era abundante. Com o mesmo pano, executou com maestria aqueles movimentos rpidos em torno da biqueira, mas a todo instante o usava para enxugar-se caso contrrio, o suor inundaria o meu cromo italiano.
25

05

E foi assim que a testa e a calva do valente filho do povo ficaram manchadas de graxa e o meu sapato adquiriu um brilho de espelho custa do suor alheio. Nunca tive sapatos to brilhantes, to dignamente suados. Na hora de pagar, alegando no ter nota menor, deixei-lhe um troco generoso. Ele me olhou espantado, retribuiu a gorjeta me desejando em dobro tudo o que eu viesse a precisar nos restos dos meus dias. Sa daquela cadeira com um baita sentimento de culpa. Que diabo, meus sapatos no estavam to sujos assim, por mseros tostes, fizera um filho do povo suar para ganhar seu po. Olhei meus sapatos e tive vergonha daquele brilho humano, salgado como lgrima.
(CONY, Carlos Heitor. Folha de S. Paulo, 19/02/2001.)

10

30

15

35

20

QUESTO

01

As palavras que compem o ttulo O suor e a lgrima so usadas fora de seu campo de significao prprio, adquirindo, no texto, significao figurada. As possveis interpretaes para o sentido figurado observado, respectivamente, nas palavras suor e lgrima so: (A) aflio alvio (B) medo reprovao (C) dor condescendncia (D) explorao remorso

2 Exame de Qualificao

Vestibular Estadual 2006

382

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

QUESTO

02

Na composio da narrativa, certos elementos lingsticos explicitam circunstncias diversas, imprimindo coerncia ao texto. O fragmento que apresenta um desses elementos sublinhado e a circunstncia por ele expressa : (A) Ofereceu-me o jornal que eu j havia lido ( l . 16) tempo (B) executou com maestria aqueles movimentos rpidos em torno da biqueira, (l . 21 - 22) finalidade (C) Nunca tive sapatos to brilhantes, ( l . 28) modo (D) tudo o que eu viesse a precisar nos restos dos meus dias. (l . 33 - 34) lugar

QUESTO

03

A tomada de conscincia do personagem-narrador acerca dos abismos sociais vai-se aguando gradativamente a partir de certo ponto da narrativa. Os primeiros sinais dessa tomada de conscincia esto adequadamente representados por um processo de adjetivao presente na seguinte alternativa: (A) Pelo menos aqui no Rio, so raros esses engraxates, s existem nos aeroportos ( l . 5 - 7) (B) Sentei-me naquela espcie de cadeira cannica, de coro de abadia pobre, ( l . 8 - 9) (C) O engraxate era gordo e estava com calor ( l . 11) (D) Meio careca, o suor encharcou-lhe a testa e a calva. ( l . 17 - 18)

QUESTO

04

As comparaes, ao destacarem semelhanas e diferenas entre elementos colocados lado a lado, funcionam como estratgias por meio das quais se ressaltam determinados pontos de vista. Uma comparao est indicada no seguinte fragmento: (A) Fazia calor no Rio, 40 graus e qualquer coisa, quase 41. ( l . 1 - 2) (B) caso contrrio, o suor inundaria o meu cromo italiano. ( l . 23 - 24) (C) e o meu sapato adquiriu um brilho de espelho custa do suor alheio. ( l . 26 - 27) (D) deixei-lhe um troco generoso. ( l . 31)

QUESTO

05

A crnica de Carlos Heitor Cony uma crtica hierarquia econmico-social que prevalece em nossa sociedade. O ponto de vista do narrador sobre essa hierarquia est exemplificado por meio de metfora em: (A) Elogiou meus sapatos, cromo italiano, fabricante ilustre, os Rosseti. ( l . 12 - 13) (B) Pegou aquele paninho que d brilho final nos sapatos e com ele enxugou o prprio suor, ( l . 18 - 19) (C) Sa daquela cadeira com um baita sentimento de culpa. ( l . 35 - 36) (D) por mseros tostes, fizera um filho do povo suar para ganhar seu po.( l . 37 - 38)

2 Exame de Qualificao

Vestibular Estadual 2006

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

383

COM BASE NO TEXTO ABAIXO, RESPONDA S QUESTES DE NMEROS 06 A 10.

A aldeia que nunca mais foi a mesma


Era uma aldeia de pescadores de onde a alegria fugira, e os dias e as noites se sucediam numa monotonia sem fim (...).
05 35

no seu colo os desejos que a morte em vida proibira...

At que o mar, quebrando um mundo, anunciou de longe que trazia nas suas ondas coisa nova, desconhecida, forma disforme que flutuava, e todos vieram praia, na espera... E ali ficaram, at que o mar, sem se apressar, trouxe a coisa e a depositou na areia, surpresa triste, um homem morto... E o que que se pode fazer com um morto, se no enterr-lo? Tomaram-no ento para os preparativos de funeral, que naquela aldeia ficavam a cargo das mulheres: s vezes mais grato preparar os mortos para a sepultura que acompanhar os vivos na morte que perderam ao viver. Foi levado pra uma casa, os homens de fora, olhando... (...) As mos comearam o trabalho, e nada se dizia, s os rostos tristes... At que uma delas, um leve tremor no canto dos lbios, balbuciou: , se tivesse vivido entre ns, teria de se ter curvado sempre para entrar em nossas casas. muito alto... E todas assentiram com o silncio. (...) Foi ento que uma outra, olhando aquelas mos enormes, inertes, disse as saudades que arrepiavam a sua pele: Estas mos... Que tero feito? Tero tomado no seu vazio um rosto de mulher? Tero sido ternas? Tero sabido amar?

10

15

E os homens, do lado de fora, perceberam que algo estranho acontecia: os rostos das mulheres, mas em fogo, os olhos brilhantes, os lbios midos, o 40 sorriso selvagem, e compreenderam o milagre: vida que voltava, ressurreio de mortos... E tiveram cimes do afogado... Olharam para si mesmos, se acharam pequenos e domesticados, e perguntaram se aquele homem teria feito gestos nobres (que eles 45 no mais faziam) e pensaram que ele teria travado batalhas bonitas (onde a sua coragem?), e o viram brincando com crianas (mas lhes faltava a leveza...), e o invejaram amando como nenhum outro (mas onde se escondera o seu prprio amor?)...
50

Termina a estria dizendo que eles, finalmente, o enterraram. Mas a aldeia nunca mais foi a mesma...

20

25

30

E elas sentiram que coisas belas e sorridentes, h muito esquecidas, passadas por mortas, nas suas funduras, saam do ouvido e vinham, mansas, se dizer no silncio do morto. A vida renascia na morte graciosa de um morto desconhecido e que, por isto mesmo, por ser desconhecido, deixava que pusessem

No, no toa que conto esta estria. Foi quando eu soube da morte ela cresceu dentro de mim. 55 Claro que eu j suspeitava: os cavalos de guerra odeiam crianas, e o bronze das armas odeia canes, especialmente quando falam de flores, e no se ouve o ruflar lgubre dos tambores da morte. (...) Foi ento que me lembrei da estria. No, foi ela que se 60 lembrou de mim, e veio, para dar nome aos meus sentimentos, e se contou de novo. S que agora os rostos annimos viraram rostos que eu vira, caminhando, cantando, seguindo a cano, risos que corriam para ver a banda passar contando coisas de 65 amor, os rojes, as buzinas, as panelas, sinfonia que se tocava, sobre a desculpa de um morto... Mas no era isto, no era o morto: era o desejo que jorrava, vida, mar que saa de funduras reprimidas e se espraiava como onda, espumas e conchinhas, mansa e brincalhona... (...)
(ALVES, Rubem. Folha de S. Paulo, 19/05/1984.)

2 Exame de Qualificao

Vestibular Estadual 2006

384

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

QUESTO

06

O texto de Rubem Alves, ao abordar essencialmente tenses e transformaes, divide-se em duas partes. Pode-se dizer que a primeira e a segunda partes do texto se caracterizam, respectivamente, por: (A) nfase na realidade e na fico (B) foco na terceira e na primeira pessoa (C) predomnio da descrio e da narrao (D) desenvolvimento da argumentao e da contra-argumentao

QUESTO

07

A metonmia uma figura de linguagem que consiste no uso de uma palavra em lugar de outra, estabelecendo-se entre elas diferentes relaes de sentido. O fragmento que apresenta um exemplo de metonmia construda por meio da relao entre matria e objeto : (A) E o que que se pode fazer com um morto, se no enterr-lo? ( l . 10 - 11) (B) At que uma delas, um leve tremor no canto dos lbios, balbuciou: ( l . 18 - 19) (C) deixava que pusessem no seu colo os desejos que a morte em vida proibira... ( l . 34 - 36) (D) e o bronze das armas odeia canes, especialmente quando falam de flores, ( l . 56 - 57)

QUESTO

08

Na histria da aldeia em que todas as coisas eram sempre as mesmas, o agente de transformao da atitude dos personagens um homem morto trazido pelo mar. Essa afirmativa est justificada no seguinte fragmento: (A) Era uma aldeia de pescadores de onde a alegria fugira, ( l . 1) (B) s vezes mais grato preparar os mortos para a sepultura que acompanhar os vivos na morte ( l . 13 - 14) (C) A vida renascia na morte graciosa de um morto desconhecido ( l . 32 - 33) (D) Termina a estria dizendo que eles, finalmente, o enterraram. ( l . 50 - 51)

QUESTO

09

Olharam para si mesmos, se acharam pequenos e domesticados, e perguntaram se aquele homem teria feito gestos nobres (que eles no mais faziam) e pensaram que ele teria travado batalhas bonitas (onde a sua coragem?), e o viram brincando com crianas (mas lhes faltava a leveza...), e o invejaram amando como nenhum outro (mas onde se escondera o seu prprio amor?)... (l. 42 - 49)
As passagens apresentadas entre parnteses relacionam-se com as passagens que lhes so imediatamente anteriores, caracterizando uma estrutura de argumentao especfica. O tipo de relao estabelecida entre essas passagens e o valor argumentativo nela presente so: (A) concluso tese (B) condio ironia (C) concesso falcia (D) comparao anttese

2 Exame de Qualificao

Vestibular Estadual 2006

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

385

QUESTO
(l . 40 - 42)

10

(...) e compreenderam o milagre: vida que voltava, ressurreio de mortos... E tiveram cimes do afogado...
A substituio do conectivo destacado no acarreta alterao de valor semntico em: (A) Assim, tiveram cimes do afogado... (B) Embora tivessem cimes do afogado... (C) Contudo, tiveram cimes do afogado... (D) Para que tivessem cimes do afogado...

COM BASE NO TEXTO ABAIXO, RESPONDA S QUESTES DE NMEROS 11 A 13.

(...) Atrs de portas fechadas, luz de velas acesas, entre sigilo e espionagem, acontece a Inconfidncia. (...)
05 LIBERDADE, AINDA QUE TARDE, 15

Atravs de grossas portas, sentem-se luzes acesas, e h indagaes minuciosas dentro das casas fronteiras. Que esto fazendo, to tarde? Que escrevem, conversam, pensam? Mostram livros proibidos?
20

ouve-se em redor da mesa. E a bandeira j est viva, e sobe, na noite imensa. E os seus tristes inventores
10 j

Lem notcias nas Gazetas? Tero recebido cartas de potncias estrangeiras? (...) vitrias, festas, flores das lutas da Independncia!

so rus pois se atreveram


25

a falar em Liberdade (que ningum sabe o que seja).

Liberdade essa palavra que o sonho humano alimenta: que no h ningum que explique, e ningum que no entenda! (...)

(MEIRELES, Ceclia. Romanceiro da Inconfidncia. Rio de Janeiro: Nova Fronteira, 1989.)

2 Exame de Qualificao

Vestibular Estadual 2006

386

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

QUESTO

11

O poema de Ceclia Meireles enfoca um momento especfico de tenso poltica e de oposio aos poderes estabelecidos na histria do Brasil. Os nicos versos que no apresentam explicitamente essa referncia histrica esto transcritos na seguinte alternativa: (A) entre sigilo e espionagem, / acontece a Inconfidncia. (v. 3 - 4) (B) LIBERDADE, AINDA QUE TARDE, / ouve-se em redor da mesa. (v. 5 - 6) (C) e h indagaes minuciosas / dentro das casas fronteiras. (v. 15 - 16) (D) vitrias, festas, flores / das lutas da Independncia! (v. 23 - 24)

QUESTO

12

Existem, no poema, diferentes mecanismos de coeso que retomam termos anteriormente citados. No fragmento Liberdade essa palavra (v. 25), a expresso sublinhada corresponde a um desses mecanismos, que caracterizado como: (A) elipse (B) repetio (C) substituio (D) pronominalizao

QUESTO

13

A necessidade de transformao, em meio a uma sociedade politicamente repressora, est presente em todo o fragmento do poema apresentado. Essa necessidade mostra-se, de forma mais clara, em: (A) a falar em Liberdade / (que ningum sabe o que seja). (v. 11 - 12) (B) Atravs de grossas portas, / sentem-se luzes acesas, (v. 13 - 14) (C) Que esto fazendo, to tarde? / Que escrevem, conversam, pensam? (v. 17 - 18) (D) Tero recebido cartas / de potncias estrangeiras? (v. 21 - 22)

2 Exame de Qualificao

Vestibular Estadual 2006

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

387

COM BASE NA PROPAGANDA ABAIXO, RESPONDA S QUESTES DE NMEROS 14 E 15.

http://www.ilo.org

QUESTO

14

Nessa propaganda, para expressar a necessidade de erradicao do trabalho escravo, as ferramentas apresentam um valor simblico representado como: (A) armas de defesa que sugerem medo de transformaes (B) grades de priso que marcam a intensidade da explorao (C) instrumentos de luta que mostram o poder dos exploradores (D) objetos de tortura que expressam a insignificncia do trabalho

QUESTO

15

Pior que no conseguir trabalho no conseguir sair dele.


O trecho sublinhado constitui uma expresso ambivalente que apresenta os seguintes significados: (A) ser subjugado e no poder se demitir (B) trabalhar muito e no querer progredir (C) valorizar o emprego e no lutar por melhorias (D) ter estabilidade e no reivindicar seus direitos

2 Exame de Qualificao

Vestibular Estadual 2006

388

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | E SPANHOL

COM BASE NO TEXTO ABAIXO, RESPONDA S QUESTES DE NMEROS 16 A 19.

Crtica a la no-violencia
El entorno educativo se ha llenado de todo un discurso y una pedagoga dirigida a inculcar la conducta no violenta en los alumnos. Una pedagoga que aboga por una resolucin pacfica y dialogada de los conflictos. Esto suena de maravilla y de hecho es muy positivo en muchos casos, sin embargo el descartar la violencia y verla como un camino siempre desacertado tiene un trasfondo mucho ms complejo que va ms all de las simples relaciones personales y que merece la pena analizar. Es curioso ver como toda manifestacin de violencia por parte de algn colectivo de personas, trabajadores, estudiantes, etc., es siempre condenada sin dilacin por muy injusto que sea el motivo de esa rabia que la produce: despidos, explotacin. Este hecho es como digo, curioso y susceptible de reflexin de por s, pero an lo es ms cuando lo comparamos con las manifestaciones violentas que se producen desde el estado y sus instituciones. Cuando hablamos de intervenciones policiales, represin de manifestaciones, intervenciones militares, etc., el hecho se carga inconscientemente de una increble legitimidad, que crea una condena mucho ms dbil, por no decir inexistente, y que hace referencia a una actitud respecto a unas fuentes de violencia diferentes y no a hechos concretos justificados o no. Por lo tanto el continuo bombardeo desde las escuelas para inculcar el rechazo a la violencia se hace con un doble sentido, porque ese rechazo no es igual para cada caso y depende de quien la ejerza. Recordemos que los educadores en muchas ocasiones justificamos la accin violenta por parte de las fuerzas represivas del estado para acabar con los ladrones malos o la gente que no sigue la ley y mandamos el mensaje de la necesidad de que exista un cuerpo con legitimidad para ejercer la violencia y guardar el orden, sin ni siquiera hacer cuestionar los cimientos de ese orden y sus injusticias. Este tipo de educacin, no crtica y fomentadora de reflexiones y discrepancias va poniendo esas bases para que en un futuro tambin legitime ese tipo de acciones de los estados y que con el peso de la misma sociedad, medios de comunicacin, etc. reproducirn esa manera de pensar. Deberamos de recordar para intentar completar esta reflexin, que el mensaje: la violencia nunca llega a ninguna parte, tan odo hasta la saciedad, es uno de los mayores aliados del nuevo orden econmico mundial, el cual a su vez cuenta con ese tipo de violencia legitimada a la que no duda recurrir en caso de encontrarse con obstculos. Para terminar he de dejar claro que mi intencin es la de conseguir una visin sobre la violencia que se base, no en verdades absolutas y rechazos ciegos, sino en razonamientos y valoraciones de las fuentes de esas expresiones y las estimaciones de sus consecuencias, adems de una legitimidad basada en la justicia social y no en las leyes de mercado.
CLAUDIO VELZQUEZ http://www.lahaine.org

35

10

40

15

45

20

50

25

55

30

2 Exame de Qualificao

Vestibular Estadual 2006

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | E SPANHOL

389

QUESTO

16

El ttulo anticipa la tesis defendida en el texto argumentativo. El autor defiende la siguiente posicin con relacin al movimiento de la no-violencia en el entorno educativo: (A) resistir a sus lderes (B) cuestionar su legitimidad (C) involucrarse en sus acciones (D) validar su modo de organizacin

QUESTO

17

la violencia nunca llega a ninguna parte (l. 46 - 47)


Segn lo expuesto en el artculo, esta frase popular debe evaluarse como: (A) una opinin general a ser apoyada (B) una verdad incontestable a ser revista (C) un recurso persuasivo a ser demostrado (D) un objetivo educativo a ser desarrollado

QUESTO

18

Para Velzquez, existe un conflicto social relacionado al crecimiento de la violencia. Este conflicto se expresa a travs de la siguiente afirmacin: (A) La poblacin desea una vida tranquila que demanda prcticas violentas de las instituciones del poder. (B) La escuela intenta imponer una actitud pacfica que se opone a la naturaleza violenta de la humanidad. (C) La vida moderna requiere sumisin a la violencia que implica un proceso educativo pacfico del pueblo. (D) Los individuos son recriminados por su agresividad que es fruto de violencias practicadas por grupos sociales.

QUESTO

19

A lo largo del texto, se percibe que el autor pertenece a la clase de los profesores. El fragmento que comprueba la asociacin entre Velzquez y el magisterio es: (A) El entorno educativo se ha llenado de todo un discurso y una pedagoga dirigida a inculcar la conducta no violenta en los alumnos. ( l . 1 - 3) (B) Cuando hablamos de intervenciones policiales, represin de manifestaciones, intervenciones militares, etc., el hecho se carga inconscientemente de una increble legitimidad, ( l . 20 - 23) (C) Recordemos que los educadores en muchas ocasiones justificamos la accin violenta por parte de las fuerzas represivas del estado ( l . 31 - 33) (D) Este tipo de educacin, no crtica y fomentadora de reflexiones y discrepancias va poniendo esas bases para que en un futuro tambin legitime ese tipo de acciones (l . 39 - 42)

2 Exame de Qualificao

10

Vestibular Estadual 2006

390

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | E SPANHOL

COM BASE NA IMAGEM E NO TEXTO ABAIXO, RESPONDA S QUESTES DE NMEROS 20 E 21.

http://www.humanisten.ch

QUESTO

20

La campaa de no-violencia en contra la guerra utiliza diferentes recursos grficos para enfatizar su mensaje. El foco de esta campaa se puede simbolizar a travs del siguiente recurso grfico: (A) el sol transmitiendo vida (B) la negrilla simulando gritos (C) la espiral indicando inquietud (D) el verde representando sabidura

QUESTO

21

El texto expone una visin positiva ante la realidad violenta de la guerra. Esa visin positiva est directamente relacionada a la: (A) adhesin a una semana de lucha (B) divulgacin de una campaa de xito (C) valoracin del interlocutor como amigo (D) creencia en el poder de transformacin

2 Exame de Qualificao

11

Vestibular Estadual 2006

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | I NGLS

391

COM BASE NO TEXTO ABAIXO, RESPONDA S QUESTES DE NMEROS 16 A 19.

Ways of meeting oppression


Oppressed people deal with their oppression in three characteristic ways. One way is acquiescence: the oppressed resign themselves to their doom. They tacitly adjust themselves to oppression, and thereby become conditioned to it. In every movement toward freedom some of the oppressed prefer to remain oppressed. There is such a thing as the freedom of exhaustion. Some people are so worn down by the yoke of oppression that they give up. This is the type of negative freedom and resignation that often engulfs the life of the oppressed. But this is not the way out. To accept passively an unjust system is to cooperate with that system; thereby the oppressed become as evil as the oppressor. Non-cooperation with evil is as much a moral obligation as is cooperation with good. A second way that oppressed people sometimes deal with oppression is to resort to physical violence and corroding hatred. Violence often brings about momentary results. Nations have frequently won their independence in battle. But in spite of temporary victories, violence never brings permanent peace. It solves no social problem; it merely creates new and more complicated ones. The third way, open to oppressed people in their quest for freedom, is the way of nonviolent resistance. Nonviolence can touch men where the law cannot reach them. When the law regulates
30

35

behavior it plays an indirect part in molding public sentiment. The enforcement of the law itself is a form of peaceful persuasion. But the law needs help. Here nonviolence comes in as the ultimate form of persuasion. It is the method which seeks to implement the just law by appealing to the conscience of the great decent majority who through blindness, fear, pride, or irrationality has allowed their consciences to sleep. The nonviolent resisters can summarize their message in the following simple terms: We will take direct action against injustice without waiting for other agencies to act. We will not obey unjust laws or submit to unjust practices. We will do this peacefully, openly, cheerfully because our aim is to persuade. We adopt the means of nonviolence because our end is a community at peace with itself. We will try to persuade with our words, but if our words fail, we will try to persuade with our acts. We will always be willing to talk and seek fair compromise, but we are ready to suffer when necessary and even risk our lives to become witnesses to the truth as we see it. The way of nonviolence means a willingness to suffer and sacrifice. It may mean going to jail. It may even mean physical death. But if physical death is the price that a man must pay to free his children from a permanent death of the spirit, then nothing could be more redemptive.
MARTIN LUTHER KING Jr. http://www.gibbsmagazine.com

10

40

15

45

20

50

25

55

2 Exame de Qualificao

15

Vestibular Estadual 2006

392

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS | I NGLS

QUESTO

16

In the text, the argumentation is structured by means of descriptions of situations and restrictions. The following elements contribute to this structural organization: (A) definite articles and gradable adjectives (B) forceful tone and contrastive connectives (C) short paragraphs and independent clauses (D) plural personal pronouns and enumerative conjuncts

QUESTO

17

Nonviolent resistance is central to Martin Luther King Jr.s philosophy as a way to cure societys ills. This action is best understood as a way of: (A) turning the other cheek (B) avoiding retaliation (C) disregarding power (D) rejecting injustice

QUESTO

18

Laws are not so effective as nonviolent behavior. The fragment that reiterates the idea of the sentence above is: (A) Nonviolence can touch men where the law cannot reach them. ( l . 28 - 29) (B) When the law regulates behavior it plays an indirect part in molding public sentiment. ( l . 29 - 31) (C) Here nonviolence comes in as the ultimate form of persuasion. ( l . 33 - 34) (D) We will not obey unjust laws or submit to unjust practices. ( l . 42 - 43)

QUESTO

19

Reflexive pronouns have two distinct uses: basic and emphatic. The reflexive pronoun used emphatically is found in: (A) the oppressed resign themselves to their doom. ( l . 2 - 3) (B) They tacitly adjust themselves to oppression, ( l . 3 - 4) (C) The enforcement of the law itself ( l . 31) (D) our end is a community at peace with itself. ( l . 46)

2 Exame de Qualificao

16

Vestibular Estadual 2006

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS |

393

INGLS

COM BASE NA IMAGEM E NO TEXTO ABAIXO, RESPONDA S QUESTES DE NMEROS 20 E 21.

http://print-a-poster.p-rposters.com

QUESTO

20

The text and image above are very effective in claiming for peace. According to Indira Gandhi, peacemaking is essentially related to: (A) strength (B) persuasion (C) receptivity (D) competition

QUESTO

21

The popular quotation that best expresses the message of the campaign is: (A) A peacemaker does not mean a peaceful person. (B) No one is really working for peace unless he is willing to do so. (C) You dont have to kill a person to make him agree with your positions. (D) All men desire peace, but very few desire those things which make for peace.

2 Exame de Qualificao

17

Vestibular Estadual 2006

394

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

QUESTO

22

Com o intuito de separar o lixo para fins de reciclagem, uma instituio colocou em suas dependncias cinco lixeiras de diferentes cores, de acordo com o tipo de resduo a que se destinam: vidro, plstico, metal, papel e lixo orgnico.

Sem olhar para as lixeiras, Joo joga em uma delas uma embalagem plstica e, ao mesmo tempo, em outra, uma garrafa de vidro. A probabilidade de que ele tenha usado corretamente pelo menos uma lixeira igual a: (A) 25% (B) 30% (C) 35% (D) 40%

QUESTO

23

Em breve, os veculos automotivos podero utilizar o combustvel diesel S-500, menos poluente que o metropolitano por conter menor teor de enxofre. Observe a tabela a seguir.

A poluio da atmosfera se d aps a transformao do enxofre em dixido de enxofre, ocorrida na queima de leo diesel. A equao qumica abaixo indica essa transformao.

Dois caminhes, um utilizando diesel S-500 e outro, diesel metropolitano, deslocam-se com velocidade mdia de 50 km/h, durante 20h, consumindo, cada um, 1L de combustvel a cada 4 km percorridos. Considerando as condies acima descritas e a converso total do enxofre em dixido de enxofre, a reduo da poluio proporcionada pelo caminho que usa diesel S-500, em relao quele que usa diesel metropolitano, expressa em gramas de SO2 lanado na atmosfera, corresponde a: (A) 800 (B) 600 (C) 500 (D) 300

2 Exame de Qualificao

18

Vestibular Estadual 2006

395

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

QUESTO

24

A sacarose uma importante fonte de glicdios alimentares. Durante o processo digestivo, sua hidrlise catalisada pela enzima sacarase ou invertase. Em um laboratrio, essa hidrlise foi feita por aquecimento, em presena de HCl. As variaes da velocidade de reao da hidrlise da sacarose em funo do pH do meio esto mostradas em dois dos grficos abaixo.

II

III

IV

Aqueles que representam a hidrlise catalisada pela enzima e pelo HCl so, respectivamente, os de nmeros: (A) I e II (B) I e III (C) IV e II (D) IV e III

QUESTO

25

Sdio metlico, Na0, e ction sdio, Na+, so exemplos de espcies que apresentam propriedades qumicas diferentes. Quando so utilizados 3g de sal de cozinha (NaCl) na dieta alimentar, o organismo absorve sdio na forma inica. No entanto, a ingesto de quantidade equivalente de sdio metlico, por sua violenta reao com a gua do organismo e pelo efeito corrosivo do hidrxido de sdio formado, causaria srios danos sade. A equao a seguir mostra essa reao.

Considerando rendimento de 100%, a ingesto de 3g de sdio metlico produziria, aproximadamente, uma massa de hidrxido de sdio, em gramas, igual a: (A) 5,2 (B) 8,3 (C) 12,1 (D) 23,0

2 Exame de Qualificao

19

Vestibular Estadual 2006

396

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

UTILIZE AS INFORMAES ABAIXO PARA RESPONDER S QUESTES DE NMEROS 26 A 28.

A tcnica de centrifugao usada para separar os componentes de algumas misturas. Pode ser utilizada, por exemplo, na preparao de fraes celulares, aps o adequado rompimento das membranas das clulas a serem centrifugadas. Em um tubo apropriado, uma camada de homogeneizado de clulas eucariotas rompidas foi cuidadosamente depositada sobre uma soluo isotnica de NaCl. Esse tubo foi colocado em um rotor de centrfuga, equilibrado por um outro tubo. O esquema abaixo mostra o rotor em repouso e em rotao.

Considere as seguintes massas mdias para algumas organelas de uma clula eucariota: - mitocndria: 2 10-8 g; - lisossoma: 4 10-10 g; - ncleo: 4 10-6 g.

QUESTO

26

Durante a centrifugao do homogeneizado, em um determinado instante, uma fora centrpeta de 5 10- 4 N atua sobre um dos ncleos, que se desloca com velocidade de mdulo constante de 150 m/s. Nesse instante, a distncia desse ncleo ao centro do rotor da centrfuga equivale, em metros, a: (A) 0,12 (B) 0,18 (C) 0,36 (D) 0,60

QUESTO

27

O homogeneizado celular centrifugado em rotao e em tempo suficientes para sedimentar as organelas mitocndrias, lisossomas e ncleos. Essas organelas devero depositar-se, a partir do fundo do tubo, na seguinte seqncia: (A) ncleos, mitocndrias e lisossomas (B) lisossomas, mitocndrias e ncleos (C) mitocndrias, lisossomas e ncleos (D) ncleos, lisossomas e mitocndrias

2 Exame de Qualificao

20

Vestibular Estadual 2006

397

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

QUESTO

28

Dentre os sistemas abaixo, aquele cujos componentes podem ser separados por centrifugao : (A) petrleo (B) lcool hidratado (C) soluo de sacarose em gua (D) suspenso de leite de magnsia

QUESTO

29

Duas esferas, A e B, deslocam-se sobre uma mesa conforme mostra a figura a seguir.

Quando as esferas A e B atingem velocidades de 8 m/s e 1 m/s, respectivamente, ocorre uma coliso perfeitamente inelstica entre ambas. O grfico abaixo relaciona o momento linear Q, em kg m/s, e a velocidade , em m/s, de cada esfera antes da coliso.

Aps a coliso, as esferas adquirem a velocidade, em m/s, equivalente a: (A) 8,8 (B) 6,2 (C) 3,0 (D) 2,1

2 Exame de Qualificao

21

Vestibular Estadual 2006

398

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

QUESTO

30

O consumo inadequado de hortalias pode provocar srios danos sade humana. Assim, recomenda-se, aps lavar as hortalias em grande quantidade de gua, imergi-las nesta seqncia de solues aquosas: - hipoclorito de sdio; - vinagre; - bicarbonato de sdio. Dos quatro materiais empregados para limpeza das hortalias, dois deles pertencem seguinte funo qumica: (A) sal (B) cido (C) xido (D) hidrxido

UTILIZE AS INFORMAES ABAIXO PARA RESPONDER S QUESTES DE NMEROS 31 E 32.

Uma suspenso de clulas animais em um meio isotnico adequado apresenta volume igual a 1 L e concentrao total de ons sdio igual a 3,68 g/L. A esse sistema foram acrescentados 3 L de gua destilada.

QUESTO

31

Aps o processo de diluio, a concentrao total de ons sdio, em milimol/L, de: (A) 13,0 (B) 16,0 (C) 23,0 (D) 40,0

QUESTO

32

Considerando no haver rompimento da membrana plasmtica, com a adio de gua destilada, o citosol das clulas sofre a seguinte alterao: (A) aumento da densidade (B) diminuio do volume de gua (C) aumento da concentrao de ons (D) diminuio da concentrao de protenas

2 Exame de Qualificao

22

Vestibular Estadual 2006

399

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

QUESTO

33

Para demonstrar as condies de equilbrio de um corpo extenso, foi montado o experimento abaixo, em que uma rgua, graduada de A a M, permanece em equilbrio horizontal, apoiada no pino de uma haste vertical.

Um corpo de massa 60g colocado no ponto A e um corpo de massa 40g colocado no ponto I.

Para que a rgua permanea em equilbrio horizontal, a massa, em gramas, do corpo que deve ser colocado no ponto K, de: (A) 90 (B) 70 (C) 40 (D) 20

QUESTO

34

Na Tabela de Classificao Peridica, as fileiras horizontais correspondem aos perodos, e as colunas verticais, aos grupos ou famlias. Nos perodos, os elementos so dispostos em ordem crescente de seus nmeros atmicos. Considere trs elementos qumicos cujos nmeros atmicos so consecutivos, representados por x, y e z. Na equao 2x + 2y + 2z = 7 164, y o nmero atmico de um elemento qumico da famlia denominada: (A) alcalinos (B) halognios (C) calcognios (D) gases nobres

2 Exame de Qualificao

23

Vestibular Estadual 2006

400

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

QUESTO

35

Uma mola, que apresenta uma determinada constante elstica, est fixada verticalmente por uma de suas extremidades.

Ao acloparmos a extremidade livre a um corpo de massa M, o comprimento da mola foi acrescido de um valor X, e ela passou a armazenar uma energia elstica E.

Em funo de X , o grfico que melhor representa E est indicado em: (A) E

X2

(B) E

X2

(C) E

X2

(D) E

2 Exame de Qualificao

24

Vestibular Estadual 2006

401

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

QUESTO

36

Na fotografia abaixo, podemos identificar organismos produtores e consumidores, participantes da cadeia alimentar.

Observe, agora, o esquema a seguir, que apresenta uma sntese das etapas, numeradas de 1 a 8, associadas ao consumo e produo de carboidratos nesses organismos, incluindo as que se passam no tubo digestivo.
celulose
3 4

amido
5 6 7

glicognio
8

C6H12O6
1 2

CO2 + H2O

As etapas encontradas nos organismos consumidores primrios mostrados na fotografia so as identificadas, no esquema, pelos seguintes nmeros: (A) 1, 2, 5, 7 e 8 (B) 1, 3, 4, 5 e 6 (C) 2, 3, 6, 7 e 8 (D) 4, 5, 6, 7 e 8

QUESTO

37

Durante uma experincia em laboratrio, observou-se que uma bola de 1 kg de massa, deslocando-se com uma velocidade , medida em km/h, possui uma determinada energia cintica E, medida em joules. Se ( , E, 1) uma progresso aritmtica e (A) 2 (B) (C) 2 (D) 3 , o valor de corresponde a:

2 Exame de Qualificao

25

Vestibular Estadual 2006

402

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

QUESTO

38

Na tabela a seguir, so relacionados quatro hormnios esterides e suas correspondentes funes orgnicas.

O hormnio que secretado pelas clulas de Leydig, encontradas nas gnadas masculinas, representado pela seguinte estrutura:
OH

(A)
O
OH

(B)
HO

(C)
H0

(D)
O

2 Exame de Qualificao

26

Vestibular Estadual 2006

403

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

QUESTO

39

Embora sua realizao seja impossvel, imagine a construo de um tnel entre os dois plos geogrficos da Terra, e que uma pessoa, em um dos plos, caia pelo tnel, que tem 12.800 km de extenso, como ilustra a figura abaixo.

Admitindo que a Terra apresente uma constituio homognea e que a resistncia do ar seja desprezvel, a acelerao da gravidade e a velocidade da queda da pessoa, respectivamente, so nulas nos pontos indicados pelas seguintes letras: (A) Y W (B) W X (C) X Z (D) Z Y

QUESTO

40

Pandemias graves de gripe por vrus influenza repetem-se, no mundo, a determinados intervalos de tempo, causando milhes de mortes. Cientistas da OMS alertam para o fato de que a gripe aviria, surgida no sudeste asitico, pode provocar uma nova pandemia. O controle do alastramento deste vrus problemtico, no s devido s facilidades de transporte no mundo, mas, tambm, porque as vacinas produzidas para combat-lo podem perder a sua eficcia com o tempo. Essa perda de eficcia est associada seguinte caracterstica dos vrus influenza: (A) sofrer alteraes em seu genoma com certa freqncia (B) inibir com eficincia a produo de anticorpos pelo hospedeiro (C) destruir um grande nmero de clulas responsveis pela imunidade (D) possuir cpsula protetora contra a maioria das defesas do hospedeiro

2 Exame de Qualificao

27

Vestibular Estadual 2006

404

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

QUESTO

41

O grfico abaixo apresenta os valores das tenses e das correntes eltricas estabelecidas em um circuito constitudo por um gerador de tenso contnua e trs resistores R1, R2 e R3.

Quando os trs resistores so ligados em srie, e essa associao submetida a uma tenso constante de 350 V, a potncia dissipada pelos resistores, em watts, igual a: (A) 700 (B) 525 (C) 350 (D) 175

QUESTO

42

P X A O

Q B

No esquema acima esto representadas as trajetrias de dois atletas que, partindo do ponto X, passam simultaneamente pelo ponto A e rumam para o ponto B por caminhos diferentes, com velocidades iguais e constantes. Um deles segue a trajetria de uma semicircunferncia de centro O e raio 2R. O outro percorre duas semicircunferncias cujos centros so P e Q. Considerando 2 = 1,4, quando um dos atletas tiver percorrido 3 do seu trajeto de A para B, a distncia entre 4 eles ser igual a: (A) 0,4 R (B) 0,6 R (C) 0,8 R (D) 1,0 R

2 Exame de Qualificao

28

Vestibular Estadual 2006

405

CINCIAS DA NATUREZA, MATEMTICA E SUAS TECNOLOGIAS

QUESTO

43

Um barco percorre seu trajeto de descida de um rio, a favor da correnteza, com a velocidade de 2 m/s em relao gua. Na subida, contra a correnteza, retornando ao ponto de partida, sua velocidade de 8 m/s, tambm em relao gua. Considere que: - o barco navegue sempre em linha reta e na direo da correnteza; - a velocidade da correnteza seja sempre constante; - a soma dos tempos de descida e de subida do barco seja igual a 10 min. Assim, a maior distncia, em metros, que o barco pode percorrer, neste intervalo de tempo, igual a: (A) 1.250 (B) 1.500 (C) 1.750 (D) 2.000

2 Exame de Qualificao

29

Vestibular Estadual 2006

406

CINCIAS HUMANAS E SUAS TECNOLOGIAS

A prova desta rea aborda diversas tenses sociais em diferentes tempos e espaos, considerando os processos de ruptura e continuidade. QUESTO

44
A mo da limpeza
(...) , imagina s O que o negro penava (...) Negra a mo de quem faz a limpeza Lavando a roupa encardida, esfregando o cho Negra a mo, a mo da pureza (...) Limpando as manchas do mundo com gua e sabo Negra a mo da imaculada nobreza (...)
Gilberto Gil (REZENDE, A. P. e DIDIER, M. T. Rumos da histria. So Paulo: Atual, 2001.)

A luta dos negros pela igualdade de direitos contou, nos Estados Unidos, nas dcadas de 1950 e 1960, com a liderana do pacifista Martin Luther King. No Brasil, por meio de sua msica, Gilberto Gil uma das vozes que denunciam as condies precrias de vida de parcela dessa populao. O processo histrico que deu origem excluso social de parte considervel da populao negra, tanto no caso norte-americano quanto no brasileiro, e uma de suas conseqncias esto relacionados em: (A) oficializao do apartheid acesso a escolas segregadas (B) implantao do escravismo nas colnias desvalorizao do trabalho manual (C) empreendimento de poltica imperialista restrio ocupao de cargos de liderana (D) existncia de relaes escravistas na frica uso diferenciado de meios de transporte coletivos

QUESTO

45

O populismo brasileiro surge sob o comando de Vargas e os polticos a ele associados. Desde 1930, pouco a pouco, vai-se estruturando esse novo movimento poltico. Ao lado das medidas concretas, desenvolveu-se a ideologia e a linguagem do populismo.
(IANNI, Otvio. In: MOTA, Myriam Becho e BRAICK, Patrcia Ramos. Histria: das cavernas ao Terceiro Milnio. So Paulo: Moderna, 1997.)

Duas aes representativas do populismo varguista esto apontadas em: (A) implantao de organizaes econmicas e redistribuio de terras aos camponeses (B) estatizao das indstrias de bens de capital e limitao dos investimentos estrangeiros (C) modernizao das estruturas econmicas e concesso de direitos aos trabalhadores urbanos (D) adoo de discurso antiimperialista e estmulo ao alistamento contra a ingerncia norte-americana

2 Exame de Qualificao

30

Vestibular Estadual 2006

CINCIAS HUMANAS E SUAS TECNOLOGIAS

407

QUESTO

46

Hoje no h potncias dispostas a dominar outros territrios, embora as oportunidades, e talvez at a necessidade, do colonialismo sejam to grandes quanto foram no sculo XIX. Aqueles pases deixados de fora da economia global correm o risco de cair em um crculo vicioso. Governo fraco sinnimo de desordem, e isso significa queda nos investimentos. Mesmo assim, os pases fracos ainda precisam dos fortes, e os fortes ainda precisam de um mundo ordeiro. Um mundo em que os eficientes e bem governados exportam estabilidade e liberdade e que est aberto a investimentos e crescimento tudo isso parece eminentemente desejvel.
Robert Cooper diplomata britnico (Adaptado de Jornal do Brasil, 05/05/2002)

Ainda que o domnio direto proposto no texto no seja usual nos dias de hoje, os Estados centrais valem-se de estratgias de controle sobre os Estados perifricos. Uma dessas estratgias : (A) regulao dos setores energtico e tecnolgico (B) fiscalizao do fluxo de mo-de-obra e de capitais (C) negociao de polticas socioeducativas e culturais (D) militarizao da explorao e da comercializao de recursos estratgicos

QUESTO

47

(MAGNOLI, D. e ARAJO, R. Projeto de ensino de geografia. So Paulo: Moderna, 2001.)

As mudanas na estrutura demogrfica brasileira projetadas no grfico, de natureza quantitativa, exigem do Estado a implementao de novas polticas sociais. Uma mudana demogrfica evidenciada pelo grfico e um adequado programa social para o seu enfrentamento esto apresentados na seguinte alternativa: (A) reduo do total de jovens promoo da sade da mulher (B) declnio do crescimento populacional planejamento familiar (C) queda da taxa de fecundidade requalificao de mo-de-obra (D) diminuio do ndice de mortalidade incentivo ao aumento da natalidade

2 Exame de Qualificao

31

Vestibular Estadual 2006

408

CINCIAS HUMANAS E SUAS TECNOLOGIAS

QUESTO

48

( Folha de S. Paulo, 18/04/2004)

O mapa mostra a intensidade do processo de favelizao no municpio do Rio de Janeiro, ao longo da dcada de 1990. O crescimento da populao nessas comunidades e a distribuio das mesmas no espao urbano podem ser explicados, respectivamente, por: (A) estagnao dos nveis de escolaridade e oferta igualitria dos servios pblicos (B) reduo do valor dos salrios e concentrao espacial das atividades tecnolgicas (C) segregao de parte da classe trabalhadora e acesso desigual rede de transporte (D) desacelerao dos fluxos migratrios e crescimento acentuado da especulao fundiria

QUESTO

49

Foi do capito do barco que ouvi dizer pela primeira vez que o mundo iria se acabar se continuassem matando os animais do rio. Hoje, o rio Magdalena est morto, com suas guas apodrecidas e seus animais extintos. Os trabalhos de recuperao dos quais tanto falaram os sucessivos governos que nada fizeram requereriam o plantio tcnico de uns sessenta milhes de rvores em noventa por cento de terras privadas, cujos donos teriam que renunciar, s por amor ptria, a noventa por cento de sua renda.
(Adaptado de MRQUEZ, Gabriel Garca.Viver para contar. Rio de Janeiro: Record, 2003.)

Gabriel Garca Mrquez, recordando sua vida na Colmbia, fornece um exemplo real do conflito entre polticas de preservao ambiental e a explorao dos recursos naturais. A alternativa que indica uma interveno prioritria do Estado contra o processo de degradao ambiental da bacia do rio Magdalena : (A) desapropriao das terras (B) requalificao da mo-de-obra (C) regularizao de reservas ecolgicas (D) reordenao do processo produtivo

2 Exame de Qualificao

32

Vestibular Estadual 2006

CINCIAS HUMANAS E SUAS TECNOLOGIAS

409

QUESTO

50
Disneylndia Samba do approach
Venha provar meu brunch saiba que eu tenho approach na hora do lunch eu ando de ferryboat eu tenho savoir-faire meu temperamento light minha casa hi-tech toda hora rola um insight (...)
Zeca Baleiro

(...) Msica hindu contrabandeada por ciganos poloneses faz sucesso no interior da Bolvia. (...) Multinacionais japonesas instalam empresas em Hong-Kong e produzem com matria-prima brasileira para competir no mercado americano. (...)
Tits

Os fragmentos das letras de msica fazem referncia a vrias dimenses do processo de globalizao vigente no sistema capitalista, sobretudo a partir da dcada de 1980. Uma caracterstica econmica e uma tendncia desse processo, respectivamente, so: (A) estatizao das empresas homogeneizao do consumo (B) reduo da interveno estatal padronizao de culturas (C) internacionalizao dos processos de produo diminuio da excluso social (D) segmentao dos investimentos internacionais diversificao dos modelos educacionais

QUESTO

51
Radiografia do sculo XX no seu final

Metade da populao do mundo cerca de 3 bilhes de pessoas vive subalimentada, enquanto outros 10% sofrem graves deficincias alimentcias, totalizando 60% dos habitantes com algum tipo de problema de nutrio. De outro lado, 15% das pessoas do mundo esto superalimentadas. Alimentos no faltam, h excedentes agrcolas conforme os critrios de mercado, no das necessidades humanas de 15%.
(Adaptado de SADER, Emir. In: MOCELLIN, R. e CAMARGO, R. de. Passaporte para a Histria. So Paulo: Editora do Brasil, 2004.)

Com base nos dados apresentados no texto, um aspecto marcante da conjuntura macroeconmica mundial do final do sculo passado e incio deste milnio : (A) aumento da desigualdade social, devido ao desenvolvimento diferenciado entre os pases (B) elevao das taxas do desemprego estrutural,em decorrncia da concentrao industrial nos pases desenvolvidos (C) baixa produtividade agrcola, em funo do acelerado crescimento demogrfico nos pases do hemisfrio sul (D) distribuio desigual de alimentos, pelo esgotamento de reas agriculturveis nos pases subdesenvolvidos

2 Exame de Qualificao

33

Vestibular Estadual 2006

410

CINCIAS HUMANAS E SUAS TECNOLOGIAS

QUESTO

52

( Jornal Mundo - Geografia e Poltica Internacional, maio de 2004)

A imagem acima focaliza manifestantes palestinos protestando contra o assassinato do xeque Ahmed Yassin, destacado lder palestino. Um fator preponderante que deu origem s tenses e lutas entre palestinos e israelenses apresentado na seguinte alternativa: (A) dispora palestina ocorrida a partir de 1945, acarretando a migrao de palestinos para os kibutzin israelenses (B) movimento sionista surgido a partir de 1917, definindo a Palestina como o lar nacional de judeus e palestinos (C) fundao da Organizao para a Libertao da Palestina na dcada de 1950, iniciando o processo de luta liderado por Yasser Arafat (D) partilha da Palestina aprovada pela Organizao das Naes Unidas na dcada de 1940, provocando rejeio pelos pases rabes

QUESTO

53

As trs dcadas que se seguiram ao fim da Segunda Guerra Mundial foram de grande importncia para os povos asiticos e africanos, que em sua maioria se emanciparam. Uma transformao poltico-econmica decorrente do processo de descolonizao nesses continentes : (A) criao de sociedades igualitrias (B) surgimento de potncias regionais (C) reduo das reas de influncia das superpotncias (D) restabelecimento das fronteiras anteriores colonizao

2 Exame de Qualificao

34

Vestibular Estadual 2006

CINCIAS HUMANAS E SUAS TECNOLOGIAS

411

QUESTO

54

(FREIRE, Amrico e outros. Histria em curso. Rio de Janeiro: FGV, 2004.)

As propagandas acima, publicadas na revista O Cruzeiro, no perodo de 1954 a 1964, apresentam bens de consumo que estavam sendo incorporados ao cotidiano de parte da populao brasileira. Esses novos padres de consumo foram favorecidos pelo incentivo do Estado brasileiro : (A) produo de bens durveis (B) pesquisa tecnolgica nacional (C) implantao da indstria pesada (D) fixao dos preos das mercadorias

QUESTO

55

A General Motors classifica o complexo industrial de Gravata (RS) como o mais moderno e eficiente do grupo em todo o mundo. Com todas as inovaes tecnolgicas, a produtividade da nova fbrica deve ser uma das mais altas. At os lderes sindicais americanos foram conferir de perto se o novo conceito de produo pode provocar desemprego. De fato, o nmero de postos de trabalho reduzido na fbrica, mas cresce na cadeia de fornecedores.
(Adaptado de Exame, 14/06/2000)

Nas ltimas dcadas do sculo XX, ocorreram mudanas na estrutura produtiva, inclusive no setor secundrio. Tais transformaes, consideradas por muitos autores como a 3 a Revoluo Industrial, produziram impactos na dinmica do mercado de trabalho e, conseqentemente, do movimento sindical. A correta associao entre as transformaes na estrutura produtiva e na organizao sindical, no perodo referido, est descrita em: (A) automao reduo no nmero de sindicatos patronais (B) flexibilizao desaparecimento dos interesses por categoria (C) terceirizao enfraquecimento da articulao entre os trabalhadores (D) desindustrializao precariedade de legitimao das centrais sindicais

2 Exame de Qualificao

35

Vestibular Estadual 2006

412

CINCIAS HUMANAS E SUAS TECNOLOGIAS

QUESTO

56
ALEGORIA PROCLAMAO DA REPBLICA

(MOCELLIN, R. e CAMARGO, R. de. Passaporte para a Histria. So Paulo: Editora do Brasil, 2004.)

Um segmento social que participou ativamente da derrubada da monarquia brasileira e uma das conseqncias polticas desse movimento esto indicados em: (A) burguesia cafeeira paulista implantao do federalismo (B) aristocracia rural fluminense imposio do bipartidarismo (C) camadas populares urbanas instituio do presidencialismo (D) profissionais liberais urbanos estabelecimento do parlamentarismo

QUESTO

57
Oeste baiano: a terra do agronegcio

Uma populao de 25 mil habitantes que vivia h sculos nas mesmas condies de misria e carncia, sem energia eltrica, estradas, transporte e escolas. Em alguns povoamentos, o ndice de analfabetismo era de 100%. Os pioneiros chegaram do Sul, principalmente do Rio Grande do Sul, na dcada de 1980. Traziam seus tratores e implementos usados em caminhes, armavam barracas de lona preta onde abrigavam a mulher e os filhos. Os sulistas investem pesado na produo, ou seja, em mquinas, irrigao, adubos e silos.
(Adaptado de O Globo, 03/05/2003)

Os trechos da reportagem sobre o oeste baiano descrevem realidades socioeconmicas distintas: a excluso histrica vivida pela maior parte da populao local e a organizao produtiva dos migrantes sulistas. As condies de vida da populao local e a ascenso econmica dos migrantes, respectivamente, esto associadas principalmente a fatores relacionados com: (A) mo-de-obra disponvel e insumos produtivos (B) estrutura fundiria regional e condies ambientais (C) rede de transporte ampla e financiamentos bancrios (D) poltica agrcola nacional e investimentos na produtividade

2 Exame de Qualificao

36

Vestibular Estadual 2006

CINCIAS HUMANAS E SUAS TECNOLOGIAS

413

QUESTO

58

(MOSER, SOYER. Apud: PAZZINATO, A. L. e SENISE, M. H. V. Histria moderna e contempornea. So Paulo: tica, 2003.)

Em vrios momentos da Histria, arte e poder se encontram. O quadro de Moser Soyer retrata diversos artistas pintando imagens esperanosas e otimistas, associadas ao New Deal , implementado pelo governo Roosevelt. Nesse clima de euforia e com o objetivo de reerguer a economia norte-americana, esse governo adotou como medidas: (A) reduo da produo agrcola e realizao de grandes obras pblicas (B) represso aos movimentos dos trabalhadores urbanos e elevao do poder aquisitivo (C) valorizao da moeda e incentivo ao aumento da produo industrial de bens durveis (D) concesso de emprstimos aos pequenos agricultores e estabelecimento de um modelo econmico de livre-mercado

QUESTO

59

O MST uma coletividade de prias, certamente a nica organizada, a mais consciente em relao a sua identidade e a seu sentido, e por isso a mais competente: uma coletividade de condenados que se fez sujeito da histria para revogar a sua condenao. Essa contradio mostra que os prias deixam de ser prias quando se organizam, pois organizar-se , antes de mais nada, inocular-se a substncia social e ocupar um espao social.
(Adaptado de BISOL, Jos Paulo. In: A questo agrria no Brasil. So Paulo: Atual, 1997.)

O texto acima apresenta reflexes sobre a origem e a identidade dos movimentos sociais organizados. Um componente da nossa sociedade que explica o surgimento desses movimentos e uma caracterstica de sua organizao, respectivamente, esto indicados em: (A) luta pela incluso social centralizao sindical (B) concentrao da riqueza nacional unidade partidria (C) expropriao dos meios de produo ativismo poltico (D) contestao do sistema representativo coerncia ideolgica

2 Exame de Qualificao

37

Vestibular Estadual 2006

414

CINCIAS HUMANAS E SUAS TECNOLOGIAS

QUESTO

60

O mapa apresenta a extenso territorial alcanada pelo expansionismo britnico, entre os sculos XVII e XX.

(Adaptado de SCALZARETTO, R. e MAGNOLI, D. Atlas geopoltica. So Paulo: Scipione, 1996.)

A contnua expanso de imprios coloniais, a exemplo do britnico, est associada estruturao, consolidao e expanso do sistema capitalista. Considerando esse processo histrico, uma funo assumida pelos territrios submetidos s potncias expansionistas : (A) aquisio de material blico (B) produo de bens de consumo (C) importao de gneros alimentcios (D) absoro de excedentes populacionais

2 Exame de Qualificao

38

Vestibular Estadual 2006

415

2 EXAME DE QUALIFICAO - VESTIBULAR 2006 GABARITO OFICIAL

01 02 03 04 05 06 07 08 09 10 11 12 13 14 15

D A B C D B D C D A C C A B A

ESPANHOL

16 17 18 19 20 21

B B D C A D

FRANCS

16 17 18 19 20 21

A B D C D B

INGLS

16 17 18 19 20 21

B D A C C B

22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43

C B C A B A D C A D D B B A C B C C A D B B

44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

B C A B C D B A D B A C A D A C D

416

1 EXAME DE QUALIFICAO 06/08/2006


Neste caderno voc encontrar um conjunto de 40 (quarenta) pginas numeradas seqencialmente, contendo 60 (sessenta) questes das seguintes reas: Linguagens, Cdigos e suas Tecnologias; Cincias da Natureza, Matemtica e suas Tecnologias; Cincias Humanas e suas Tecnologias. A tabela peridica encontra-se na pgina 38. No abra o caderno antes de receber autorizao.

INSTRUES
1. CARTO DE RESPOSTAS Verifique se o seu nome, nmero de inscrio, nmero do documento de identidade e lngua estrangeira escolhida esto corretos. Se houver erro, notifique o fiscal. Assine o carto de respostas com caneta. Exceto sua assinatura, nada alm da marcao das respostas deve ser escrito ou registrado no carto, que no pode ser dobrado, amassado, rasurado ou manchado. 2. CADERNO DE QUESTES Ao receber autorizao para abrir este caderno, verifique se a impresso, a paginao e a numerao das questes esto corretas. Caso ocorra qualquer erro, notifique o fiscal. As questes de nmeros 16 a 21 da rea de Linguagens, Cdigos e suas Tecnologias devero ser respondidas de acordo com a sua opo de Lngua Estrangeira: Espanhol, Francs ou Ingls. 3. MARCAO DAS RESPOSTAS Leia com ateno as questes e escolha a alternativa que melhor responde a cada uma delas. Marque sua resposta cobrindo totalmente o espao que corresponde letra a ser assinalada; utilize caneta preta, preferencialmente, ou azul, conforme o exemplo abaixo:

As respostas em que houver falta de nitidez ou marcao de mais de uma letra no sero registradas.

INFORMAES GERAIS
O tempo disponvel para fazer a prova, incluindo a marcao do carto de respostas, de 4 (quatro) horas. Ao terminar a prova, entregue ao fiscal este caderno e o carto de respostas. Ser eliminado do Vestibular Estadual 2007 o candidato que, durante a prova, utilizar mquinas ou relgios de calcular, aparelhos de reproduo de som ou imagem, com ou sem fones de ouvido, telefones celulares ou fontes de consulta de qualquer espcie. Ser tambm eliminado o candidato que se ausentar da sala de prova levando consigo este caderno ou o carto de respostas.

BOA PROVA!

LINGUAGENS, CDIGOS E SUAS TECNOLOGIAS

417

Costuma-se dizer que a distncia entre as pessoas uma marca de nossos tempos... Na relao com o outro, contudo, cada um de ns sempre esteve sozinho, o que significa dizer que, at mesmo nas relaes mais ntimas, sempre haver distncias a vencer. Ao optarmos, nesta prova, pelo tema Distncia na Proximidade , esperamos contribuir para a diminuio dos espaos vazios e dos silncios: aqueles que abrem distncias entre ns e as pessoas que nos so mais prximas.

COM BASE NO TEXTO ABAIXO, RESPONDA S QUESTES DE NMEROS 01 A 04.

Em volta da moa
J ento os dois gmeos cursavam, um a Faculdade de Direito, em S. Paulo; outro a Escola de Medicina, no Rio. No tardaria muito que sassem formados e prontos, um para defender o direito e o torto da gente, outro para ajud-la a viver e a morrer. Todos os contrastes esto no homem. No era tanta a poltica que os fizesse esquecer Flora, nem tanta Flora que os fizesse esquecer a poltica. Tambm no eram tais as duas que prejudicassem estudos e recreios. Estavam na idade em que tudo se combina sem quebra de essncia de cada coisa. L que viessem a amar a pequena com igual fora o que se podia admitir desde j, sem ser precis