Você está na página 1de 5

12/6/2010 Memórias do Instituto Oswaldo Cruz - …

Memórias do Instituto Oswaldo Cruz serviços


Versão ISSN 0074-0276
serviços personalizados
Mem. Inst. Oswaldo Cruz vol.105 no.3 Rio de Janeiro, maio 2010
Artigo em form ato PDF
doi: 10.1590/S0074-02762010000300020
Artigo em form ato XML
NOTAS TÉCNICAS
Referências do artigo

Os indicadores de saúde

Multiplex-PCR baseado detecção de Leptospira em Curriculum ScienTI


amostras de água ambientais obtidos a partir de Como citar es te artigo
um assentamento de favelas Estatísticas de acesso

Citado por SciELO

Similares em SciELO

Juliana Magalhães Vital-BrasilI, +, Ilana Teruszkin BalassianoI; Fabiano A tradução automática

Sutter de OliveiraII; Alberto Dias de Souza CostaII; Leandro HillenII, Mostrar semântica destaques
Martha Maria PereiraI
Envie este artigo por e-mail
I
Laboratório de Zoonoses bacterianas, Centro de Referência Nacional n
Leptospirose, OPAS / OMS Centro Colaborador n Leptospirose, Instituto
Oswaldo Cruz-Fiocruz, Av. Prof. Brasil 4365, 21045-900 Rio de Janeiro, RJ,
Brasil
II SA Águas do Imperador, Petrópolis, RJ, Brasil

RESUMO

O objetivo deste estudo foi aplicar um protocolo molecular para detecção do DNA de leptospira em amostras de
água do ambiente. O estudo foi realizado em um assentamento peri-urbano, em Petrópolis, Estado do Rio de
Janeiro. Um método de PCR multiplex utilizando os primers LipL32 e 16S rRNA foi usada. Três em cada 100
amostras analisadas foram positivas na PCR multiplex, dois foram considerados como tendo leptospiras saprófitas
e um teve leptospiras patogênicas. Os resultados obtidos apoiaram a idéia de que a PCR multiplex pode ser
utilizado para a detecção de Leptospira spp em amostras de água. Este método também foi capaz de diferenciar
entre leptospiras patogênicas e saprófitas e foi capaz de fazer muito mais facilmente do que as metodologias
convencionais.

Palavras-chave: Leptospira spp - PCR multiplex - amostra de água

A leptospirose é uma zoonose causada por Leptospira spp, incluindo espécies patogênicas e saprófitas, e é
reconhecida como um problema mundial de saúde pública importante, especialmente em países tropicais (Mathur
et al. 2009). Os seres humanos podem ser infectados diretamente por meio do contato com a urina de animais
infectados, como roedores e domésticos (cães, bovinos e suínos) ou pode ser infectada indiretamente através da
água contaminada (Tansuphasiri et al. 2006a, Vijayachari et al. 2008, Adler & de la Moctezuma Peña 2009).

No Brasil, a leptospirose é endêmica para ambas as áreas rurais e urbanas. Nas áreas urbanas, a incidência desta
doença pode ser aumentada em comunidades pobres de favelas, onde a falta de saneamento básico contribui
para as condições ecológicas para a transmissão de cargo, roedor de patogenicidade Leptospira (Sarkar et al.
2002, Dias et al. 2007). Focos nessas áreas têm altas taxas de mortalidade e pode resultar em morte dentro de
poucos dias de internação. Estes surtos têm um impacto significativo na saúde pública e contribuir para o
aumento do número de casos notificados (Ko et al. 1999, McBride et al. 2005).

http://www.scielo.br/scielo.php?script… 1/5
12/6/2010 Memórias do Instituto Oswaldo Cruz - …
O principal problema na determinação qualitativa de riscos ambientais para a exposição leptospirose tem sido a
dificuldade de isolar patogênicos Leptospira das águas de superfície. Este fato é atribuído, pelo menos em parte,
à observação de que a cultura dessas bactérias pode ser prejudicado pela predominância de leptospiras
saprófitas, que são morfologicamente semelhantes e crescer mais rapidamente do que os patogênicos e também
pelo fato de que esta metodologia é o tempo consumo (Ganoza et al. 2006, Tansuphasiri et al. 2006a).
ferramentas moleculares baseados em PCR tem se mostrado valioso em superar essas limitações. Esta
metodologia pode ser usada especificamente para detectar o patógeno, uma vez que podem direcionar de genes
específicos, especialmente aqueles relacionados à superfície macromoléculas que não estão presentes no grupo
saprófitas (Adler & de la Peña Moctezuma 2009).

O objetivo deste estudo foi adaptar e avaliar um protocolo baseado em PCR multiplex, que é actualmente utilizado
para a detecção do DNA de leptospira em amostras clínicas, para amostras de água ambiental, utilizando dois
conjuntos de primers que permitem a diferenciação de espécies patogênicas de não patogênicas.

O estudo foi realizado em uma zona de proteção ambiental (ZPE) dentro dos limites de Petrópolis, no estado do
Rio de Janeiro. As amostras de água foram coletadas em um povoado chamado Contorno, a partir de maio-julho
de 2009. Esta área apresenta características semelhantes às áreas de favelas nas áreas urbanas do Brasil e é o
lar de cerca de 440 pessoas. Não há saneamento básico ea água que vem de uma nascente de pequeno porte é
armazenada em um reservatório que é usado para toda a comunidade. Na ausência de um sistema de esgoto, o
esgoto é descartado diretamente no meio ambiente sem tratamento prévio. Um total de 100 amostras de água
foram coletadas a partir do abastecimento de água que é distribuída para toda a comunidade (50 pontos
diferentes) e dos pequenos lagos (25 pontos diferentes) e superfície de água (25 pontos diferentes), onde os
seres humanos e animais domésticos e silvestres podem compartilhar o risco de infecção. Um total de 125 mL de
água foi coletada de cada site em frascos de polipropileno estéreis e transportados em uma caixa de gelo para o
laboratório. As amostras foram mantidas a 4 º C e processadas até 24 h.

Todos os procedimentos foram realizados de forma asséptica, como descrito anteriormente por Tansuphasiri et al.
(2006b) com algumas modificações. Resumidamente, a fim de concentrar as amostras de água, eles foram
filtrados através de duas membranas de nitrocelulose (Millipore, Irlanda) de tamanhos de poros diferentes: de
0,45 μm filtro seguido de 0,22 μm. Cada um dos filtros utilizados para cada amostra separadamente cortadas em
pedaços pequenos e transferida para um tubo de 15 ml de polipropileno e armazenadas a -20 º C antes da
extração do DNA.

Como controles positivos, duas amostras diferentes de 125 mL de água estéril, foram inoculadas artificialmente
com 106 células obtidas a partir de culturas de estirpes de referência de Leptospira interrogans sorovar
Copenhageni estirpe M20 (patogênica) e biflexa Leptospira sorovar Patoc serovar Patoc 1 (saprófitas) e
processadas como descrito supra. Além disso, os controles negativos foram gerados usando 125 mL de água
estéril unseeded artificialmente contaminadas com Escherichia coli, Listeria monocytogenes e Salmonella
enterica.

Em primeiro lugar, 1 mL de solução de lise (10 mM Tris-HCl pH 8,0, EDTA 1 mM, 150 mM NaCl, 1% Triton X-114),
contendo 1 mg / mL de proteinase K (Invitrogen, E.U.A.) foi adicionado aos tubos contendo a peças dos filtros e
foram então incubadas a 65 º C por 15 min. Em seguida, 1,2 mL de clorofórmio foi adicionado e misturado por
vortex. As amostras foram centrifugadas a 15.000 g por 10 min (4 ° C) ea fase aquosa foi transferida para um
tubo de microcentrífuga contendo 0,8% de álcool isopropílico 80 mL e misturados novamente em vórtice. Após
centrifugação a 15.000 g por 20 min (4 ° C), o sobrenadante foi descartado eo pellet foi dissolvido em uma
solução contendo 170 μL de 1,2 M NaCl e 4 mg / RNase mL (Invitrogen, E.U.A.) e então incubadas a 37 º C por
15 min. Como etapa final, 425 μL de etanol absoluto resfriado foi adicionado para precipitar o DNA e, em seguida,
cada amostra foi incubada a -20 º C durante a noite. Posteriormente, as amostras foram centrifugadas a 14.000
g por 15 min. O sobrenadante foi descartado eo pellet foi lavado três vezes com 100 μL de etanol 75% frio. O
DNA foi seco, dissolvidos em 100 μL de tampão TE estéril (1 M Tris-HCl pH 8,0, 0,5 M EDTA) e armazenados a -20
º C.

A ampliação do LipL32, que codifica a lipoproteína de membrana externa LipL32 e 16S RNA ribossomal genes, foi
realizado utilizando os primers descrito por Alves et al. (2006) e Tansuphasiri et al. (2006a), respectivamente. O
primer para a frente de LipL32 foi 5'ATCTCCGTTGCACTCTTTGC3 'eo inverso foi 5'ACCATCATCATCATCGTCCA3. O
atacante do primer 16S rRNA foi 5'GAACTGAGACACGGTCCAT3 'eo inverso foi 5'GCCTCAGCGTCAGTTTTAGG3. Estes
dois conjuntos de primers permitiu distinguir entre patogênicos e saprófitas Leptospira espécies. Ambos os genes
são amplificados em espécies patogênicas, mas apenas 16S rRNA é amplificado nas espécies saprófitas
(Tansuphasiri et al. 2006a).

Multiplex PCR foi realizada em um volume de reação final de 25 μL. Todas as reações contidas 1X PCR buffer
magnésio livre, 1 mM MgCl2, 200 μdNTPs M, 10 μM de cada primer, 1 U de Taq polimerase (QIAGEN). PCR foi
realizada utilizando as seguintes condições: um ciclo de desnaturação a 95 º C por 5 min, 35 ciclos de
desnaturação a 95 º C por 1 min, anelamento a 55 º C por 30 segundos e extensão a 72 º C por 1 min, e uma
extensão final a 72 º C por 7 min. Os produtos amplificados foram submetidos à eletroforese em brometo de etídio
manchadas de 2% agarose gels e observado através de luz UV. O LipL32 e 16S rRNA primers produziram 474 bp e
430 bp fragmentos, respectivamente, estimados usando um 100- bp ladder (Invitrogen, E.U.A.).

O Contorno de resolução teve um caso humano fatal de leptospirose em 2003. A história epidemiológica do caso
revelou uma possível associação profissional e exposição a riscos relacionados com as actividades prolongada em
pequenos lagos localizados no assentamento acima mencionados sem o uso de equipamento de proteção
adequado. Deve-se notar que, segundo a Secretaria Municipal de Saúde de Petrópolis, houve um aumento
significativo no número de casos de leptospirose na região entre 2002-2003 (dados não publicados).

http://www.scielo.br/scielo.php?script… 2/5
12/6/2010 Memórias do Instituto Oswaldo Cruz - …
Três de 100 amostras de água coletadas em diferentes locais tiveram reações positivas de acordo com a análise
de PCR multiplex. O protocolo adaptado, baseado no protocolo utilizado anteriormente para avaliar amostras
clínicas em nosso laboratório (Vital- Brasil, observações não publicadas), foi eficaz na detecção de DNA de
leptospira em amostras de água do ambiente. Não houve reações positivas com o DNA das bactérias de outras
espécies utilizadas como controle (dados não mostrados). Este resultado mostra que ambos os conjuntos de
primers, 16S rRNA e LipL32, amplificar o DNA de Leptospira.

Nós mostramos que 97% das amostras analisadas foram negativas para a amplificação de ambos 16S rRNA e
LipL32 genes. No período anterior à coleta da amostra, não houve registro de chuva ea temperatura média é de
15 º C. A alta incidência de amostras negativas observadas em nosso trabalho pode ser devido ao fato de que a
temperatura é um factor limitante para a sobrevivência das leptospiras (Levett 2001, Bharti et al. 2003). Além
disso, é bem reconhecido que o tempo chuvoso desempenha um papel crucial na difusão ambiental deste agente
patogénico da urina de animais infectados (Kupek et al. 2000, Levett 2001, Vinetz 2001, Tassinari et al. 2008).

A Figura (Lanes 4, 5) mostra a amplificação positiva de apenas 16S rRNA gene usando um primer universal para
Leptospira espécies (Postic et al. 2000, Tansuphasiri et al. 2006b). A detecção desta faixa específica por PCR
multiplex ocorreram em apenas 2% das amostras, em geral, incluindo amostras de um pequeno lago localizado em
frente de uma criança de creche e cuidados no abastecimento de água que é distribuída em toda a área. A
amplificação de RNA relacionadas gene ribossomal não permite a diferenciação entre saprófitas e patogênicas de
Leptospira porque o fragmento de 430 pb do gene 16S rRNA parece ser conservada entre os dois grupos de
microrganismos (merien et al. 1992, Tansuphasiri et al. 2006a). Deve-se salientar que as leptospiras saprófitas
são comumente encontrados em amostras de água do ambiente (Adler & de la Peña Moctezuma 2009). Em
contraste, as leptospiras patogênicas são geralmente mantidos pelas transportadoras animal e raramente são
isoladas de amostras de água de superfície (Ganoza et al. 2006).

Além disso, a Figura (Lane 3) mostra os produtos de PCR resultantes de ambos os conjuntos de primers, indicando
a presença de leptospiras patogênicas (Tansuphasiri et al. 2006b). O PCR positivo amostra de água foi recolhida
perto de um depósito de lixo que provavelmente foi contaminado pela urina de roedores e animais domésticos,
cuja presença foi anteriormente observada no dia da coleta. Nossos dados concordam com outros autores, na
medida em que sugere que esses animais são um fator importante na determinação do risco de transmissão da
leptospirose e pode ser considerada uma fonte persistente do patógeno na comunidade analisada (Ganoza et al.
2006). Multiplex PCR segmentação dos dois genes usados aqui permite a detecção de leptospiras patogênicas,
porque LipL32 é a principal proteína de membrana externa encontrada na superfície de patogenicidade Leptospira
e foi altamente conservada entre as espécies (Stoddard et al. 2009).

http://www.scielo.br/scielo.php?script… 3/5
12/6/2010 Memórias do Instituto Oswaldo Cruz - …
Em conclusão, os resultados obtidos corroboram as observações anteriores de que PCR multiplex, agora com o
especificado dois conjuntos de primers, permitiu a detecção de Leptospira spp em amostras de água e foi capaz
de diferenciar entre leptospiras patogênicas e saprófitas. A ampliação do lipLgene 32 provou ser uma ferramenta
valiosa para identificar leptospiras patogênicas em amostras de água. Futuros estudos serão realizados para
avaliar se a metodologia empregada aqui é capaz de prever a contaminação ambiental e avaliar os riscos
relacionados com actividades ocupacionais envolvendo imersão em água por períodos prolongados.

AGRADECIMENTOS
Para Fabio Teixeira de Oliveira e Patrícia Gomes da Penha de Andrade, por sua ajuda com os estudos de campo,
Monique de Souza Almeida Lopes, de assistência laboratorial e Dr Eliane de Oliveira Ferreira, pela revisão do texto.

REFERÊNCIAS
Adler B, de la Peña Moctezuma A 2009. Leptospira e leptospirose. Vet. Microbiol 140: 287-296. [ Links ]

Alves N, SM Devi, L mde Valverde, Vijayachari P, RS Machang'u, Ellis WA, RA Hartskeerl 2006. seqüência
Multilocus método de tipagem para identificação e classificação de genótipos patogênicos Leptospira espécies.
Ann Clin Microbiol Antimicrob 5: 28. [ Links ]

Bharti AR, JE Nally, JN Ricaldi, Matthias MA, Díaz MM, MA Lovett, PN Levett, RH Gilman, Willig MR, Gotuzzo E, JM
Vinetz 2003. Peru-Estados Unidos Consórcio leptospirose. Leptospirose: uma zoonose de importância mundial.
Lancet Infect Dis 3: 757-771. [ Links ]

Dias JP, Teixeira MG, Costa MC, Mendes CM, P Guimarães, Reis MG, Ko A, Barreto ML 2007. Fatores associados à
Leptospira sp. infecção em um grande centro urbano do Nordeste do Brasil. Rev Soc Bras Med Trop 40: 499-504.
[ Links ]

Ganoza CA, Matthias MA, Collins-Richards D, KC Brouwer, CB Cunningham, ER Segura RH Gilman, Gotuzzo E, 2006
JM Vinetz. Determinação de risco para leptospirose humana através da análise molecular das águas de superfície
ambiental para patogênicas de Leptospira. PLoS Med 3: 308. [ Links ]

Ko AI, RM Galvão, DCM Ribeiro, Johnson Jr WD, Riley LW 1999. Urban epidemia de leptospirose humana no Brasil.
Salvador Grupo de Estudo da leptospirose. Lancet 354: 820- 825. [ Links ]

Kuperk E, SFMC de Sousa, de Souza PJM 2000. A relação entre chuvas e leptospirose humana em Florianópolis,
Brasil, 1991-1996. Braz J Infect Dis 4: 131-134. [ Links ]

Levett PN 2001. Leptospirose. Clin Microbiol Rev 14: 296- 326. [ Links ]

Mathur M, De A, D Turbadkar 2009. Leptospirose surto em 2005: a experiência do hospital LTMG. Indian J Med
Microbiol 27: 153-155. [ Links ]

McBride AJ, DA Athanazio, Reis MG, Ko AI 2005. Leptospirose. Infect Dis Curr Opin 18: 376-386. [ Links ]

Merien F, P Amouriaux, Perolat P, G Baranton, Saint Girons I de 1992. Reação em cadeia da polimerase para
detecção de Leptospira spp em amostras clínicas. J Clin Microbiol 30: 219-224. [ Links ]

Postic D, N-Sertour Riquelme, merien F, P Perolat, Baranton G 2000. Interesse dos 16S sequências parciais do
gene rDNA para resolver heterogeneidades entre Leptospira coleções: aplicativo para L. meyeri. Microbiol Res
151: 333-341. [ Links ]

Sarkar U, Nascimenrto SF, R Barbosa, R Martins, H Nuevo, Kalafanos I, Grunstein I, B Flannery, Dias J, LW Riley,
MG Reis, Ko AI 2002. De base populacional caso-controle investigação dos fatores de risco para leptospirose,
durante uma epidemia urbana. Am J Trop Med Hyg 66: 605- 610. [ Links ]

Stoddard RA, JE Gee, PP Wilkins, K McCaustland, AR Hoffmaster 2009. Detecção de patogenicidade Leptospira spp
através TaqMan reação em cadeia da polimerase visando a Lip32 gene. Diagn Microbiol Infect Dis 64: 247-255.
[ Links ]

Tansuphasiri U, R Chanthadee, Phulsuksombati D, 2006a N Sangjun. Desenvolvimento de uma reação em cadeia


da polimerase duplex para a rápida detecção de patogênicos de Leptospira. Southeast Asian J Trop Med de Saúde
Pública 37: 297-308. [ Links ]

Tansuphasiri U, C Thipsuk, Phulsuksombati D, 2006b C Chanyasanha. Duplex PCR hibridização de detecção


baseado em patogênicas de Leptospira em amostras de água ambientais obtidos a partir de áreas endêmicas no
Nordeste da Tailândia. Southeast Asian J Trop Med Saúde Pública 37: 729-741. [ Links ]

WS Tassinari, DCP Pellegrini, CBP Sá, RB Reis, Ko AI, Carvalho MS 2008. Detecção e modelagem de clusters caso
da leptospirose urbana. Trop Med Int Health 13: 503- 512. [ Links ]

Vijayachari P, AP Sugunan, Shriram AN 2008. Leptospirose: um problema emergente de saúde pública global. J
Biosci 33: 557-569. [ Links ]

http://www.scielo.br/scielo.php?script… 4/5
12/6/2010 Memórias do Instituto Oswaldo Cruz - …
Vinetz JM 2001. Leptospirose. Infect Dis Curr Opin 14: 527- 538. [ Links ]

Recebido 17 dez 2009


Aceito 14 de abril de 2010
Apoio financeiro: SVS-MS, SA Águas do Imperador

+ Autor para correspondência: jumvb@ioc.fiocruz.br

Todo o conteúdo do www.scielo.br, exceto onde indicado em contrário, está licenciado sob a Licença C reative
C ommons Attribution

Fundação Oswaldo Cruz

Av. Brasil, 4365


21040-900 Rio de Janeiro RJ Brasil
Tel.: (55 21) 2562-1222
Fax: (55 21) 2562 1220

memorias@fiocruz.br

http://www.scielo.br/scielo.php?script… 5/5