Dissertação Mariana Leyser RM

ESCOLA DE CIÊNCIAS DA SAÚDE E DA VIDA
PROGRAMA DE PÓS-GRADUAÇÃO EM BIOLOGIA CELULAR E MOLECULAR

CURSO DE MESTRADO EM BIOLOGIA CELULAR E MOLECULAR
MARIANA LEYSER
INVESTIGAÇÃO DE EXPRESSÃO GÊNICA EM CÉLULAS PERSISTERS DE Acinetobacter

baumannii EM CULTIVO PLANCTÔNICO E EM BIOFILME EXPOSTOS A MEROPENEM
Porto Alegre
2023
MARIANA LEYSER
INVESTIGAÇÃO DE EXPRESSÃO GÊNICA EM CÉLULAS PERSISTERS DE

Acinetobacter baumannii EM CULTIVO PLANCTÔNICO E EM BIOFILME
EXPOSTOS A MEROPENEM
Dissertação apresentada como requisito para

a obtenção do grau de Mestre em Biologia
Celular e Molecular da Escola de Ciências da
Saúde e da Vida da Pontifícia Universidade
Católica do Rio Grande do Sul.
Orientadora: Prof.ª Dr.ª Sílvia Dias de Oliveira
Porto Alegre
2023
INVESTIGAÇÃO DE EXPRESSÃO GÊNICA EM CÉLULAS PERSISTERS DE
Acinetobacter baumannii EM CULTIVO PLANCTÔNICO E EM BIOFILME
EXPOSTOS A MEROPENEM
Dissertação apresentada como requisito para

a obtenção do grau de Mestre em Biologia
Celular e Molecular da Escola de Ciências da
Saúde e da Vida da Pontifícia Universidade
Católica do Rio Grande do Sul.
Aprovada em: ___ de _______________ de ________
BANCA EXAMINADORA:
Ana Paula Guedes Frazzon
Renata Medina da Silva

AGRADECIMENTOS
Gostaria de expressar minha profunda gratidão a todas as pessoas que me apoiaram

e contribuíram para a realização deste projeto.
Primeiramente agradeço a minha orientadora, Profa. Dra. Sílvia Dias de Oliveira por
sua orientação valiosa, incentivo, oportunidade e conhecimento que passou durante
todos esses anos. Sua experiência e conhecimento foram fundamentais para o
desenvolvimento deste trabalho. Ao Prof. Dr. Carlos Alexandre Sanchez Ferreira por
todos os conselhos, apoio e paciência comigo, sua presença foi essencial para o
desenvolvimento dessa pesquisa.
Sou grata à minha família pelo amor incondicional e apoio contínuo durante toda essa
jornada. Ao meu pai Filipe Leyser e Vica Lange Leyser por todo os conselhos, por
sempre acreditarem em mim e por todo o apoio, sem vocês eu não estaria onde estou.
Sou grata também aos meus avós e tias por todas as conversas, e por sempre ter um
local para me refugiar quando os momentos ficaram difíceis. E sou grata à minha mãe
Vera Marina Vargas Dias, que eu sei que está orgulhosa de mim, sendo a minha
estrela guia, mesmo de longe.
Aos meus amigos, Simone D’Ambros, Thayana Coelho Monteiro, Theylor Schumacher
Klippel muito obrigada por sempre estarem ao meu lado, compartilhando ideias,
histórias e a companhia por todo esse processo, além de todo o incentivo que vocês
sempre me proporcionaram. Gostaria ainda de agradecer ao Bruno Tarrago Santorum
pelo suporte emocional, paciência, companhia e incentivo, suas palavras de
encorajamento foram essenciais para superar os desafios ao longo do caminho.
Gostaria de agradecer a todas as amizades que o laboratório me proporcionou, além

de todo o suporte durante essa caminhada. Em especial, gostaria de agradecer a
Brenda Landvoigt Schimitt, Maila Pacheco Dias, Vanessa Fey, Kethlen Natiele de
Almeida Pereira e Rafaela Garcia da Rocha por todo apoio neste projeto, sem vocês
nada disso teria sido possível.
À PUCRS por essa oportunidade de trabalho e pelo auxílio financeiro concedido para
o desenvolvimento deste trabalho.
Por fim, expresso minha gratidão a todos aqueles que acreditaram em mim e me
encorajaram a perseguir meus objetivos acadêmicos, muito obrigada a todos!
RESUMO
Acinetobacter baumannii é uma das principais causas de infecções relacionadas à

assistência em saúde, sendo associado a altas morbidade e mortalidade em pacientes
internados. Carbapenêmicos são comumente utilizados como primeira escolha de
tratamento em infecções por A. baumannii, porém falhas terapêuticas já vêm sendo
observadas. Isto se deve às altas taxas de resistência detectadas, e também à tolerância a
antimicrobianos mediada por células persisters. As persisters constituem uma pequena
fração de variantes fenotípicas transitórias capazes de tolerar concentrações supra letais
de antimicrobianos aos quais são geneticamente suscetíveis, retornando ao crescimento
exponencial uma vez que os fármacos tenham sido removidos. Logo, neste trabalho, foram
investigados os níveis de RNAm de deaD, bamA, bamB, bamD, bamE, ftsH, e ppiD em
células de A. baumannii antes e após à exposição a meropenem ou à polimixina B, em
cultivo planctônico e em biofilme. Foi encontrada uma expressão gênica diferencial (p
<0,05) nos genes deaD, bamA, bamB, bamE e ftsH em cultura planctônica, enquanto
somente bamD e ftsH foram diferencialmente expressos em biofilme. Logo, estes genes
podem estar associados ao desenvolvimento e/ou manutenção do fenótipo de persistência
em A. baumannii na presença de meropenem. Finalmente, esses dados contribuem para o
entendimento de mecanismos moleculares de células persisters em A. baumannii, bem
como para o estudo de novos alvos terapêuticos.
Palavras-chave: Acinetobater baumannii, Persistência, Maquinaria de acoplamento β -

barril, Meropenem, Polimixina B
ABSTRACT
Acinetobacter baumannii is a major cause of healthcare-associated infections, being linked

to high morbidity and mortality in hospitalized patients. Carbapenems are commonly used
as the first choice for treating A. baumannii infections, but therapeutic failures have already
been observed. This is due to the high rates of resistance detected, but also to the
antimicrobial tolerance mediated by persister cells. Persisters constitute a small fraction of
transient phenotypic variants capable of tolerating supra-lethal concentrations of
antimicrobials to which they are genetically susceptible, resuming exponential growth once
the drugs have been removed. Therefore, in this work, the mRNA levels of deaD, bamA,
bamB, bamD, bamE, ftsH, and ppiD in A. baumannii cells before and after exposure to
meropenem or polymyxin B, in planktonic and biofilm cultures, we investigated. Differential
gene expression (p-value <0.05) was found in the deaD, bamA, bamB, bamE, and ftsH
genes in planktonic culture, while in biofilm only bamD and ftsH were differentially
expressed. Therefore, these genes may influence the development and/or maintenance of
the persistence phenotype in A. baumannii in the presence of meropenem. Finally, these
data contribute to the understanding of molecular mechanisms of persister cells in A.
baumannii, as well as to the study of new therapeutic targets.
Keywords: Acinetobater baumannii, Persistence, β-Barrel Assembly Machinery,

Meropenem, Polymyxin B
LISTA DE ILUSTRAÇÕES
Fig. 1. Killing curves of Acinetobacter baumannii ......................................................................... 36
Fig. 2. Differential gene expression of persister cells in the planktonic culture of Acinetobacter
baumannii Acb-1 after exposure to meropenem (15 µg/mL) for 0, 96, and 144 h using
quantitative real-time PCR. ............................................................................................................... 39
Fig. 3. Differential gene expression of persister cells in biofilm of Acinetobacter baumannii Acb-
1 after exposure to meropenem (15 µg/mL) for 0, 96, and 144 h using quantitative real-time
PCR.. .................................................................................................................................................... 40
LISTA DE TABELAS
Table 1. Primers used in this study. ................................................................................................ 34
Table 2. Persister cells fractions obtained after exposure to different antibiotics in biofilm and
planktonic cultures. ............................................................................................................................ 36
LISTA DE ABREVIATURAS E SIGLAS
(p)ppGpp- Guanosina pentafosfato

ANOVA- Análise de variância
ANVISA- Agência Nacional de Vigilância Sanitária
ATP- Adenosina trifosfato
BAM- Maquinaria de acoplamento β -barril
CAPES- Coordenação de Aperfeiçoamento de Pessoal de Nível Superior
cDNA- DNA complementar
CFU- Unidade formadora de colônia
CNPq- Conselho Nacional de Desenvolvimento Científico e Tecnológico
DNA- Ácido desoxirribonucleico
dsRNA- RNA fita dupla
eDNA- DNA extracelular
EPS- Substância polimérica extracelular
FAPERGS- Fundação de Amparo à pesquisa do Estado do RS
HAI- Healthcare associated infections
IPCSL- Infecção primária de corrente sanguínea
IRAS- Infecções relacionadas à assistência em saúde
ITU- Infecção do trato urinário
LB- Caldo de Lisogenia
LPS- Lipopolissacarídeo
MIC- Concentração inibitória mínima
nano LC-MS/MS- Cromatografia líquida em nanoescala acoplada à espectrometria de
massa em tandem
OMP- Outer Membrane Protein
PBS- Tampão fosfato-salino
PCR- Reação em Cadeia da Polimerase
PL- Fosfolipídio
PNPCIRAS- Programa Nacional de Prevenção e Controle de Infecções Relacionadas à
Assistência à Saúde
qPCR- PCR quantitativo em tempo real
RNA- Ácido ribonucleico
TA- Sistema toxina-antitoxina
UTI- Unidade de Terapia Intensiva
SUMÁRIO
Capítulo 1 ........................................................................................................................ 13
1. Introdução.............................................................................................................................13
1.1. Acinetobacter baumannii ............................................................................................................... 13
1.2. Células persisters............................................................................................................................ 15
1.3. DEAD-box ....................................................................................................................................... 17
1.4. Complexo BAM .............................................................................................................................. 18
1.5. FtsH ................................................................................................................................................ 20
1.6. PpiD ................................................................................................................................................ 22
2. Objetivos ...........................................................................................................................23
2.1. Objetivo Geral ................................................................................................................................ 23
2.2. Objetivos Específicos...................................................................................................................... 23
Capítulo 2 ........................................................................................................................ 24
3. Artigo Científico .................................................................................................................24
Capítulo 3 ........................................................................................................................ 51
4. Considerações finais ..........................................................................................................51
REFERÊNCIAS ............................................................................................................................52
ANEXO I- ARTIGO CIENTÍFICO ....................................................................................................56
ANEXO II- ARTIGO CIENTÍFICO ...................................................................................................57
ANEXO III- ARTIGO CIENTÍFICO ..................................................................................................58
ANEXO IV- ARTIGO CIENTÍFICO ..................................................................................................59
12
Capítulo 1
1. Introdução
As infecções relacionadas à assistência em saúde (IRAS) são um dos principais
problemas de saúde pública no mundo (THE WHO GUIDELINES DEVELOPMENT
GROUP et al., 2017). Em países em desenvolvimento, estima-se que em torno de
15% dos pacientes sejam acometidos com algum tipo de IRAS em algum momento
da internação, com uma mortalidade atribuída em torno de 10% (THE WHO
GUIDELINES DEVELOPMENT GROUP et al., 2017).
As evidências mostram que o ônus econômico causado por essas infecções nos
Estados Unidos é US$ 35,7 a 45 bilhões anualmente, enquanto na Europa é estimado
um custo de € 7 bilhões anual (THE WHO GUIDELINES DEVELOPMENT GROUP et
al., 2017). No Brasil, é observado um cenário semelhante, visto que um paciente que
adquire uma infecção de corrente sanguínea (IPCSL) em Unidades de Tratamento
Intensivo (UTI) custa em torno de 20,4 vezes mais que um paciente sem IRAS
(PRIMO et al., 2012). Outro estudo demonstra que pacientes hospitalizados com
IRAS no Brasil apresentam custo elevado, maior mortalidade e maior permanência
(LEAL; FREITAS-VILELA, 2021).
Para o período de 2021-2025, a Agência Nacional de Vigilância Sanitária

(ANVISA) estabeleceu o Programa Nacional de Prevenção e Controle de Infecções
Relacionadas à Assistência em Saúde (PNPCIRAS) (2021b). O PNPCIRAS
apresenta metas e indicadores nacionais que devem ser atingidos nacionalmente até
o ano de 2025, sendo um dos objetivos prevenir e controlar a disseminação de
microrganismos multirresistentes prioritários nos serviços de saúde (2021b). Dentre
os organismos elencados como prioritários e definido como meta específica para
redução de incidência é Acinetobacter spp. resistentes aos carbapenêmicos, em
isolados de IPCSL (2021b).
1.1. Acinetobacter baumannii

Em 2021, no Brasil, bactérias do complexo Acinetobacter calcoaceticus-
baumannii foram o segundo microrganismo mais frequente em infecções de IPCSL
13
em UTI adulto, e quinto em infecções do trato urinário (ITU) (2021a). Ainda, para
IPCSL em UTI, apresentaram alta resistência a carbapenêmicos (86,7% dos isolados
testados) e 8,4% dos isolados testados foram resistentes à polimixina B e/ou colistina.
Para ITU, o cenário é similar, apresentando uma taxa de 89,4% de resistência a
carbapenêmicos e 7% de resistência à polimixina B e/ou colistina (2021a).
Tendo em vista o cenário atual de saúde pública no Brasil e no mundo, é

possível afirmar que Acinetobacter spp., e mais especificamente o Acinetobacter
baumannii, são uma das principais ameaças quando se discute IRAS. Acinetobacter
baumannii é caracterizado como um cocobacilo, gram-negativo e não-flagelado. Sua
presença é ubíqua, e possui grande relevância clínica devido à sua capacidade de
resistir ao ressecamento e de formar biofilmes, bem como à sua plasticidade
genômica (PELEG; SEIFERT; PATERSON, 2008; WHITEWAY et al., 2022).
Como discutido anteriormente, infecções causadas por A. baumannii são

geralmente tipificadas por IPCSL e ITU, porém, sua principal ocorrência é em casos
de pneumonia hospitalar (ALMASAUDI, 2018). Por colonizar o ambiente por meio de
biofilme, a presença de ventilação mecânica serve como uma porta de entrada
comum para infecção do patógeno (QUARTIN et al., 2013; WHITEWAY et al., 2022).
As infecções causadas por A. baumannii são geralmente tratadas com β-

lactâmicos, principalmente carbapenêmicos como meropenem. Meropenem é um
antimicrobiano de amplo espectro, estável a hidrólise, que atua ligando-se em
proteínas na parede bacteriana, inibindo a ligação do peptideoglicano, que por sua
vez inibe a síntese da parede celular, levando à morte bacteriana (DHILLON, 2018).
Como mencionado anteriormente, as taxas de resistência a este antimicrobiano são
altas, fazendo-se necessária a busca de novas alternativas para tratamento (2021a;
HIGGINS et al., 2010).
Novas terapias já têm sido analisadas para o combate de isolados resistentes

a carbapenêmicos, como por exemplo a polimixina B (KARAKONSTANTIS;
KRITSOTAKIS; GIKAS, 2020). Polimixinas são polipeptídios catiônicos não
ribossômicos, que possuem atividade bactericida por diversos mecanismos, sendo o
principal, a sua inserção na membrana plasmática bacteriana, levando a um
deslocamento de íons Ca2+ e Mg2+, e consequente desestabilização da membrana e
lise celular (MOHAPATRA; DWIBEDY; PADHY, 2021). No entanto, também já se
14
observa casos de resistência a essa classe de antimicrobianos (2021a; LIMA et al.,
2020).
1.2. Células persisters

A falha terapêutica de infecções por A. baumannii também pode ser devida à
tolerância a antimicrobianos pela presença de células persisters (VAN DEN BERGH;
FAUVART; MICHIELS, 2017). As persisters podem ser definidas como uma pequena
fração de células variantes fenotípicas transitórias, capazes de tolerar concentrações
supra letais de antimicrobianos aos quais são geneticamente suscetíveis (FAUVART;
DE GROOTE; MICHIELS, 2011; VAN DEN BERGH; FAUVART; MICHIELS, 2017).
No fenótipo de persistência, não é observado o crescimento da população quando
exposto a antimicrobianos, porém, quando este é retirado existe a retomada de
crescimento da população (VAN DEN BERGH; FAUVART; MICHIELS, 2017).
A primeira descrição desse fenótipo foi realizada por Bigger em 1944, em

isolados de Staphylococcus aureus (BIGGER, 1944). Atualmente, o entendimento do
que são persisters é muito diferente da definição original, visto que atualmente se
define por um fenótipo altamente heterogêneo, afetado por diversos parâmetros
ambientais e experimentais, podendo se formar estocasticamente na população
bacteriana, bem como ser induzido por agentes estressores, como antimicrobianos e
disponibilidade de nutrientes (VAN DEN BERGH; FAUVART; MICHIELS, 2017).
Este fenótipo tem especial importância no estado de biofilme, visto que é um

ambiente que promove a seleção e proteção de células persisters (FAUVART; DE
GROOTE; MICHIELS, 2011). O estado de biofilme é caracterizado como um sistema
complexo de células, com alta densidade celular, nas quais as células geralmente
estão embebidas em uma matriz autoproduzida de substâncias poliméricas
extracelulares (EPS) (FLEMMING et al., 2016). Biofilmes são ubíquos em quase todos
os ambientes terrestres, e no sentido clínico, possuem especial importância em
colonizar implantes e dispositivos médicos, como tubos de ventilação mecânica
(SHIRTLIFF; LEID, 2009). O estado de biofilme promove diversas mudanças e com
elas, traz um ambiente diverso, com gradientes de aeração, nutrientes, pH,
crescimento e metabolismo celular (FLEMMING et al., 2016). O biofilme promove
também maior interação entre células, podendo levar a uma troca mais frequente de
material genético, além de proporcionar um ambiente para competição e cooperação
entre microrganismos (FLEMMING et al., 2016).
15
Os mecanismos moleculares envolvidos na formação e manutenção da
persistência ainda não são totalmente esclarecidos. Porém, diversos mecanismos já
foram propostos, como por exemplo, diminuição de atividade metabólica ou
transcrição/replicação de DNA, bloqueio de tradução, modulação de metabolismo de
energia, diminuição dos níveis de antibióticos intracelulares, controle da atividade de
RNA ribossomal, entre outros (PANDEY; SAHUKHAL; ELASRI, 2021; PINEL-MARIE
et al., 2021; WANG et al., 2018; WILMAERTS et al., 2019).
Sabe-se que tanto em biofilme quanto em cultivo planctônico a célula

bacteriana passa por diversos estresses, podendo levar ao processo de formação ou
seleção de células persisters (FLEMMING et al., 2016; WILMAERTS et al., 2019).
Condições não favoráveis, sejam estas variações de pH, estresse oxidativo, falta de
nutrientes, estresse osmótico ou presença de antibióticos, podem ser favoráveis para
a célula exibir o fenótipo de persistência para sobreviver (GOLLAN et al., 2019;
RADZIKOWSKI et al., 2016).
A cascata de sinalização intracelular leva a alterações de metabolismo que

podem explicar a sua tolerância a doses letais de antimicrobianos, tanto em estado
planctônico quanto em biofilme, como por exemplo a diminuição do fluxo metabólico,
podendo ser via resposta de estresse mediada por (p)ppGpp, RelA, resposta SOS,
mediada via RecA, sistemas toxina-antitoxina (TA), entre outros mecanismos
(CHANG; LEE; LEE, 2020; GOLLAN et al., 2019; RADZIKOWSKI et al., 2016). Além
disso, principalmente em situação de biofilme, é importante ressaltar o papel de
quorum sensing como forma de sinalização de estresse extracelular que pode levar
à formação de células persisters (GOLLAN et al., 2019).
Nosso grupo de pesquisa tem se dedicado a investigar células persisters de A.

baumannii. Já observamos o perfil heterogêneo de células persisters em A. baumannii
(BARTH et al., 2013), os efeitos da exposição ao meropenem em células persisters
(GALLO et al., 2017), conseguimos erradicar persisters quando tratadas
conjuntamente com meropenem e polimixina B (GALLO; FERREIRA; DE OLIVEIRA,
2017), a influência da aeração em cultivos de células persisters de A. baumannii
(DONAMORE et al., 2018) e a expressão diferencial de ompW e ompA em células
persisters quando tratadas com meropenem em cultivo planctônico de A. baumannii
(SCHMITT et al., 2023).
16
A análise proteômica de cultivo de A. baumannii Acb-1 em estado planctônico
e biofilme após exposição ao meropenem e polimixina B, separadamente, quando
comparado a cultivos não tratados, permitiu selecionar algumas proteínas que
possam estar envolvidas no processo de persistência para a cepa A. baumannii Acb-
1 (GALLO, 2017). Baseando-nos nestes dados, escolhemos analisar os seguintes
genes alvos para investigação do seu envolvimento e possível papel na
formação/manutenção de persisters: deaD, bamA, bamB, bamD, bamE, ftsH e ppiD.
1.3. DEAD-box
As proteínas de caixa de helicase DEAD (DEAD/DEAH-box helicase) são um
grupo presente em diversos organismos, desde protistas a mamíferos (IOST;
BIZEBARD; DREYFUS, 2013), realizando diversas funções. Especificamente em
bactérias, realizam funções primariamente de montagem de ribossomos e
degradação de RNAm (IOST; BIZEBARD; DREYFUS, 2013).
O DEAD-box utiliza ATP para realizar suas funções, sendo sua atividade
altamente regulada por outras proteínas, como RraA em Escherichia coli. O
mecanismo de inibição da RraA é distinto para as diferentes proteínas do grupo
(REDDER et al., 2015). O mecanismo de helicase do DEAD-box atua em sequências
não específicas de RNA dupla-fita (dsRNA) na presença de ATP (REDDER et al.,
2015). O comprimento de RNA que pode ser separado varia, porém, em geral, são
menores que 12 pares de base, embora tenha sido demonstrado que proteína DeaD
pode atuar em dsRNA de até 21 pares de base (STAMPFL et al., 2013).
A proteína DeaD, também conhecida como CsdA, atua na biogênese da

subunidade ribossomal 30S em sua parte final, porém há estudos que mostram que
esta enzima pode atuar também na subunidade 50S (GOH et al., 2021; IOST;
BIZEBARD; DREYFUS, 2013; PEIL; VIRUMÄE; REMME, 2008; REDDER et al.,
2015). A atuação do DeaD na biogênese de ribossomos ainda não possui todos os
passos esclarecidos, porém, estudos mostram que mutantes que não possuem o
gene deaD possuem defeitos visíveis em ribossomos a 37 °C (GOH et al., 2021;
JAGESSAR; JAIN, 2010; PEIL; VIRUMÄE; REMME, 2008).
Sabe-se também que DeaD tem entre suas funções o início da tradução,
principalmente quando a célula se encontra em baixas temperaturas (REDDER et al.,
2015), Neste contexto, por exemplo, rpoS codifica um fator sigma, porém o RNAm de
17
rpoS é degradado pela RNAse III em temperaturas normais ou em crescimento
exponencial. Em baixas temperaturas e em fases estacionárias, , DeaD participa da
desestruturação de uma alça em loop inibitória de rpoS, permitindo a síntese de RpoS
(RESCH et al., 2010).
Existem estudos mostrando também a participação da DEAD-box no

degradossoma de diversas bactérias, e curiosamente mutantes de DeaD
demonstraram uma supressão de letalidade em mutantes de RNase E (essencial para
divisão e crescimento celular), permitindo um crescimento lento (TAMURA; KERS;
COHEN, 2012). Porém, ainda não se sabe se essa atuação é devida à sua atuação
no degradossoma ou em outra via. Também foi demonstrado que DeaD pode conferir
resistência ao estresse oxidativo, bem como pode auxiliar na resistência a alguns
antimicrobianos (DA SILVA et al., 2023; HOSHINO et al., 2022).
Finalmente, entende-se que DeaD se mostra uma proteína importante na

resposta ao estresse, principalmente ao choque frio, além da biogênese ribossomal,
podendo estar envolvida em processos que levam ao estado de persistência
(MARGALIT; CAROLAN; WALSH, 2022).
1.4. Complexo BAM

Bactérias gram-negativas possuem duas bicamadas lipídicas, a membrana
externa e interna. Na membrana externa são alocadas diversas proteínas que
possuem funções essenciais para o funcionamento celular, como por exemplo as
Outer Membrane Proteins- OMPs (KNOWLES et al., 2009; ROLLAUER et al., 2015).
Estas desempenham funções como translocação de solutos e proteínas, absorção de
proteínas, exportação de restos metabólicos, transdução de sinal, adesão celular e,
até mesmo, atuam como fatores de virulência (ROLLAUER et al., 2015). Estas
proteínas possuem sua inserção na membrana externa realizada pelo complexo BAM
(HART; SILHAVY, 2020).
BAM é um complexo heteropentamérico, composto por 4 lipoproteínas,

BamBCDE e uma OMP, BamA (HART; SILHAVY, 2020). As duas proteínas
essenciais para viabilidade celular são BamA e BamD, as outras possuem um suposto
papel redundante (HART; SILHAVY, 2020). É estipulado que BamBCDE forma um
vestíbulo sustentado por BamA para proteger os substratos de OMP e auxiliar nos
estágios iniciais de dobramento (HAGAN; SILHAVY; KAHNE, 2011; HART; SILHAVY,
18
2020). Ainda não é completamente entendido como é realizado o dobramento das
OMPs dentro do complexo BAM mas algumas características já foram elucidadas
(HAGAN; SILHAVY; KAHNE, 2011). O substrato de OMP é transportado para a
membrana externa por diversas vias, a principal é onde o precursor de OMP é
translocado pelo complexo SEC do citoplasma para o periplasma, que é transportada
via SurA até o complexo BAM (HAGAN; SILHAVY; KAHNE, 2011; ROLLAUER et al.,
2015). A segunda via, se utiliza de Skp e DegP como mediadores no periplasma
(HAGAN; SILHAVY; KAHNE, 2011; ROLLAUER et al., 2015).
BamA possui um β-barril inserido na membrana externa celular e um N-terminal

que contém cinco domínios de polipeptídeos de transporte (POTRA), que realizam a
interface de proteína-proteína no complexo (SELKRIG et al., 2014). O direcionamento
e reconhecimento do substrato por BamA ainda não é completamente entendido,
porém é proposto que uma sequência específica no terminal C seja essencial para
este reconhecimento (HAGAN; SILHAVY; KAHNE, 2011). Há evidências in vivo para
interação de SurA com BamA na região da primeira POTRA (BENNION et al., 2010;
SKLAR et al., 2007), podendo auxiliar no reconhecimento do substrato. Porém,
aparentemente Skp não interage com BamA (SKLAR et al., 2007).
É proposto que BamB atue como suporte para auxílio do dobramento das
OMPs e possui uma função redundante a BamD, visto que uma dupla deleção leva à
morte celular (HART; SILHAVY, 2020; SELKRIG et al., 2014). É proposto que BamD,
por mais que seja uma subunidade essencial, não atua criticamente no dobramento
de OMPs, e sim possui um papel mais regulatório (HART; SILHAVY, 2020). Supõe-
se que BamD atue como um checkpoint para que BamA não se associe com
substratos defeituosos (HART; SILHAVY, 2020). O atual modelo propõe que BamBCE
possuem papeis redundantes, porém servem como facilitadores para cooperação
entre BamA e BamD, e caso as 3 subunidades sejam deletadas simultaneamente,
ocasiona morte celular (HART; SILHAVY, 2020).
Devido ao papel essencial de BamA na célula como chaperona de OMPs,

alguns estudos já têm avaliado seu potencial como alvo de novos antimicrobianos.
Assim, um estudo mostrou que polipeptídios quiméricos podem atuar contra esta
proteína (LUTHER et al., 2019), enquanto outro demonstrou que o composto
19
Darobactin, pode interagir também com BamA para gerar morte seletiva de bactérias
gram-negativas (IMAI et al., 2019).
Visto que o complexo BAM possui uma atuação vital para a célula, além de seu
papel em modulação de OMPs, que já foram caracterizadas como envolvidas no
processo de persistência (SCHMITT et al., 2023), é possível que este grupo esteja
envolvido com o mesmo processo.
1.5. FtsH
A proteína FtsH faz parte de um grupo de proteases denominado AAA+, que
utilizam ATP para realizar degradação de diversas proteínas (LANGKLOTZ;
BAUMANN; NARBERHAUS, 2012). FtsH é a única deste grupo que está associada
a membrana celular e a única que é essencial para viabilidade celular (ITO; AKIYAMA,
2005).
Ainda não se conhece todas as proteínas que interagem com FtsH, porém
estudos mostram que até 21 substratos podem ser alvo de FtsH (BITTNER; ARENDS;
NARBERHAUS, 2017). Também é proposto que cada substrato possui sua via de
reconhecimento, e geralmente é caracterizada por uma sequência C ou N-terminal de
aproximadamente 20 resíduos de aminoácidos (BITTNER; WESTPHAL;
NARBERHAUS, 2015). O reconhecimento desses sítios pela FtsH é estritamente
regulado, devido à sua atuação depender de ATP e ser um processo irreversível, logo,
o reconhecimento de substratos geralmente é realizado mediante adaptadores
(BITTNER; ARENDS; NARBERHAUS, 2017).
FtsH possui duas principais finalidades em degradar substratos, a primeira

sendo controle de qualidade, onde esta identifica proteínas aberrantes e as degrada,
e a segunda, proteólise regulada de proteínas intactas sob condições específicas
(BITTNER; ARENDS; NARBERHAUS, 2017). Nesta segunda categoria, os substratos
mais estudados e de maior importância celular são LpxC, RpoH e YfgM (BITTNER;
ARENDS; NARBERHAUS, 2017).
LpxC é uma proteína com meia-vida curta, graças ao FtsH que modula a sua
atuação (ITO; AKIYAMA, 2005). LpxC é a enzima chave na biossíntese de
lipopolisacarídeos (LPS), que junto com fosfolipídeos (PL) compõem a membrana
externa servindo como uma barreira de permeabilidade para o interior celular
(BITTNER; ARENDS; NARBERHAUS, 2017; ITO; AKIYAMA, 2005). Visto que tanto
20
LPS como PL possuem a mesma molécula precursora, a sua síntese é sincronizada,
e LpxC é a enzima que serve como reação limitante para a formação de LPS
(BITTNER; ARENDS; NARBERHAUS, 2017). Tanto a depleção quanto a alta
produção de LPS são tóxicas para a célula, tendo a FtsH como responsável por
manter esse balanço intracelularmente, se configurando essencial para a célula.
Também, se sabe que a concentração de LpxC é dependente caso as células se
encontrem em crescimento exponencial ou não, além da presença de (p)ppGpp
influenciar também na meia-vida da enzima (BITTNER; ARENDS; NARBERHAUS,
2017).
Outro alvo do FtsH é o fator RpoH, que coordena a resposta ao choque térmico
em resposta a temperaturas muito elevadas. Assim, a regulação dos níveis de RpoH
está correlacionada com a temperatura, visto que sua expressão aumenta
exponencialmente quando a célula é exposta a temperaturas de 42°C ou mais
(BITTNER; ARENDS; NARBERHAUS, 2017). Quando observadas culturas de E. coli
em temperaturas fisiológicas, a degradação do RpoH é realizada com assistência de
DnaK/DnaJ, sistema de chaperonas, que guiam o fator até o FtsH para ser degradado
(BITTNER; ARENDS; NARBERHAUS, 2017). Quando existe a elevação da
temperatura, aumenta a formação de proteínas malformadas, saturando o sistema
DnaK/DnaJ-FtsH. Não ocorrendo o aumento de expressão dos genes do sistema de
chaperonas e FtsH na mesma proporção da geração e proteínas com conformação
aberrante, não há moléculas suficientes para permanecer com baixos níveis de RpoH,
que, por sua vez, fica livre para agir, configurando a resposta ao choque ao calor
(BITTNER; ARENDS; NARBERHAUS, 2017).
FtsH ainda degrada YfgM, um mediador localizado na membrana interna,

atuando com diversos sistemas, como a proteína PpiD, além de fazer parte do
translocon Sec (BITTNER; ARENDS; NARBERHAUS, 2017; BITTNER; WESTPHAL;
NARBERHAUS, 2015). A proteína YfgM atua em uma cascata de sinalização,
reprimindo a ativação de RcsB, que, por sua vez, atua em resposta ao estresse,
aumentando a tolerância à osmose e ao ácido, divisão celular e adaptação à fase
estacionária (BITTNER; ARENDS; NARBERHAUS, 2017; BITTNER; WESTPHAL;
NARBERHAUS, 2015). Para aliviar a repressão do RcsB em momentos de estresse,
FtsH atua como modulador do YfgM, degradando-a (BITTNER; WESTPHAL;
NARBERHAUS, 2015).
21
Finalmente, FtsH se apresenta como uma protease essencial para a viabilidade
celular, além de ser importante para adaptação desta em situações de estresse.
Também, existem estudos avaliando a viabilidade de utilizar esta proteína como uma
forma bactericida alternativa aos antimicrobianos (IZERT; KLIMECKA; GÓRNA,
2021).
1.6. PpiD
PpiD é considerada uma chaperona, localizada no periplasma celular, podendo
ser encontrada tanto em sua forma solúvel, quanto localizada na membrana interna
(FÜRST et al., 2018; MATERN; BARION; BEHRENS-KNEIP, 2010). Inicialmente, a
sua designação era de isomerase, visto que sua sequência aparenta possuir um
domínio tipo parvulina, porém, foi estabelecido que PpiD não apresenta atividade
catalítica, não podendo caracterizá-la como isomerase (FÜRST et al., 2018).
Até recentemente, se acreditava que PpiD possuía somente uma atividade

redundante com SurA, chaperona que transporta substratos do complexo SEC até o
complexo BAM (MATERN; BARION; BEHRENS-KNEIP, 2010). Porém, estudos mais
recentes demonstram o envolvimento do PpiD com o complexo SecYEG, além da sua
dimerização com YfgM (FÜRST et al., 2018; MIYAZAKI et al., 2022).
Além das funções previamente discutidas de YfgM, a heterodimerização com

PpiD leva a um complexo estável, que estimula a passagem de polipeptídios pelo
translocon Sec, via captura do substrato e entrega para SecD/F, ou outra chaperona
periplásmica, durante estágios mais evoluídos de translocação (MIYAZAKI et al.,
2022). Com essa atuação, PpiD aumenta a eficiência de translocação nos primeiros
estágios, evitando o dobramento precipitado de substratos quando translocados
(FÜRST et al., 2018).
Também é observada a interação de PpiD com SurA, Skp e outras chaperonas

periplásmicas, reforçando PpiD como uma intermediária para aumentar a eficiência
do processo de translocação (FÜRST et al., 2018; MIYAZAKI et al., 2022).
Finalmente, sua atuação não é essencial para a viabilidade celular, porém, mutantes
duplos que não possuem SurA e PpiD são inviáveis (MATERN; BARION; BEHRENS-
KNEIP, 2010). Levando ao entendimento que esta proteína possui uma atuação na
biogênese de OMPs e possivelmente uma modulação ao estresse, porém não
fundamental e direta
22
2. Objetivos
2.1. Objetivo Geral
Determinação de mecanismos envolvidos na formação de células persisters de A.
baumannii após exposição a fármacos antimicrobianos utilizados para tratamento de
infecções em humanos.
2.2. Objetivos Específicos

• Avaliar os níveis de células persisters de A. baumannii em cultivo planctônico
após exposição à polimixina B;
• Avaliar a expressão diferencial dos genes deaD, bamA, bamB, bamD, bamE,
ftsH e ppiD em células persisters de A. baumannii em cultivo planctônico após
exposição ao meropenem;
• Avaliar a expressão diferencial dos genes deaD, bamA, bamB, bamD, bamE,
ftsH e ppiD em células persisters de biofilmes de A. baumannii após exposição
ao meropenem.
23
Capítulo 2
3. Artigo Científico
Different profiles of gene expression in persister cells of Acinetobacter
baumannii under planktonic or biofilm cultures
Artigo científico a ser submetido ao periódico Journal of Global Antimicrobial

Resistance (JGAR).
Fator de impacto: 4.6 (JCR 2022)
24
Different profiles of gene expression in persister cells of Acinetobacter
baumannii under planktonic or biofilm cultures
Mariana Leyser 1,2, Kethlen Natiele de Almeida Pereira1, Rafaela Garcia da Rocha1,
Carlos Alexandre Sanchez Ferreira 1,2*, Sílvia Dias de Oliveira 1,2*
1
Laboratório de Imunologia e Microbiologia, Escola de Ciências da Saúde e da
Vida, Pontifícia Universidade Católica do Rio Grande do Sul, PUCRS, Av. Ipiranga,
6681, 90619-900, Porto Alegre, RS, Brazil
2
Programa de Pós-Graduação em Biologia Celular e Molecular, Escola de Ciências
da Saúde e da Vida, Pontifícia Universidade Católica do Rio Grande do Sul,
PUCRS.
*Corresponding authors:
E-mail addresses: silviadias@pucrs.br, silviadiasoliveira@gmail.com (S. D. Oliveira);
cferreira@pucrs.br, casanchezferreira@gmail.com (C. A. S. Ferreira)
25
Highlights
• Heterogeneous gene expression of persister cells in planktonic culture.
• Possibly, distinct pathways are involved in the regulation of persisters in both
planktonic and biofilm cultures.
• Up-regulation of deaD, bamA, bamB, and bamE of persister cells in planktonic
culture.
ABSTRACT
Objectives: Acinetobacter baumannii is a significant cause of healthcare-associated
infections with considerable impact on public health and economic burden. While
carbapenems like meropenem are commonly used to treat A. baumannii infections,
therapeutic failures have increased due to the emergence of antimicrobial resistance
and the presence of persister cells. Persisters constitute a fraction of the bacterial
population that present a transient phenotype capable of tolerating supra-lethal
concentrations of antibiotics. Thus, we investigated the mRNA levels of the deaD,
bamA, bamB, bamD, bamE, ftsH, and ppiD in A. baumannii cells before and after
exposure to meropenem, both in planktonic and biofilm culture.
Methods: Transcriptional analysis was performed using reverse transcription
followed by real time PCR assay, using mRNA extracted from A. baumannii persister
cells. The data was analyzed by one-way ANOVA and Tukey test.
Results: We found different gene expression levels (p-value < 0.05) in most genes
tested in planktonic culture (deaD, bamA, bamB, bamE, and ftsH), while in biofilm
culture we found different levels of expression in bamD and ftsH. Therefore, we
26
suggest that these proteins could be part of the mechanism of A. baumannii
persisters to deal with the presence of high doses of meropenem.
Conclusion: This data contributes to the understanding of the molecular features of
A. baumannii persisters, their expression profile when subjected to antimicrobial
stress, and highlights six proteins as potential targets for drug development against
A. baumannii.
Keywords: Acinetobater baumannii, Persistence, β-Barrel Assembly Machinery,
Meropenem, Polymyxin
27
1. Introduction
Healthcare-associated infections (HAI) are among the leading causes of morbidity
and mortality in hospital patients, imposing a significant economic burden and causing
substantial human suffering [1]. Acinetobacter baumannii is an opportunistic pathogen
highly prevalent in HAI [2], particularly implicated in cases of ventilator-associated
pneumonia, sepsis, and wound and bloodstream infections [3–6]. The current gold
standard treatment for A. baumannii infections are carbapenems, such as meropenem,
but the emergence of resistant strains has become increasingly prevalent [7–9].
Consequently, alternative therapeutics like polymyxin B have been considered,
although there have been reports of clinical cases displaying resistance to this agent
as well [10,11].
Therapeutic failure can also come from tolerance to antimicrobials due to the
presence of persister cells [12]. Persisters constitute a small fraction of phenotypic
variants capable of tolerating high-doses of antimicrobial drugs, despite being
genetically susceptible, returning to grow exponentially once the germicides have been
removed [12,13]. Currently, persisters are recognized as a highly heterogeneous
phenotype influenced by several environmental and experimental factors. They can
arise stochastically within the bacterial population and can be induced by stressor
agents, such as antimicrobials [12]. This phenomenon becomes particularly important
in the context of biofilm, given that this differential environment can select, protect, and
maintain persister cells [14–17].
The molecular pathways involved in the regulation and formation of persister cells
have not been completely elucidated. However, several molecular mechanisms have
been proposed and associated with this phenomenon. These mechanisms include
halting DNA replication and/or transcription, blocking translation, modulating energy

28
metabolism, decreasing intracellular antibiotic concentration, and controlling ribosomal
RNA activity [18–21]. Thus, proteins responsible for RNA activity could play an import
role in antimicrobial tolerance. DEAD/DEAH box helicases are an ATP-dependent
group of proteins involved in RNA basal metabolism, RNA degradation and ribosome
biogenesis and assembly [22,23]. These functions have a role in environmental
adaptation, host colonization, infectious processes and cold-shock response [24].
Proteins involved in membrane functions and structure, specifically β-barrel outer
membrane proteins (OMP), may also play an important role in persistence regulation.
OMPs are responsible for protein and solute translocation, signal transduction, cellular
adhesion, and virulence factors [25]. In our previous research, we investigated the
expression of ompW and ompA in persisters and found that these genes were
upregulated in the persister phenotype [26]. Therefore, the β-Barrel Assembly
Machinery (BAM) complex, which is responsible for the folding and insertion of OMPs
into the outer membrane, are also involved in these processes, even if indirectly
[27,28]. It is worth noting that FtsH is another protein involved in the membrane
environment, acting in quality control and degradation of membrane proteins, heat
shock response, and lipopolysaccharide biosynthesis [29,30], and its activity may have
implications for antibiotic tolerance. Additionally, the inner membrane-anchored
periplasmic folding factor PpiD may indirectly contribute to the maturation of OMPs by
aiding in the folding of newly translocated proteins and participating in the network of
periplasmic chaperone activities [31]. In this context, we evaluated the mRNA levels of
membrane proteins BamA, BamB, BamD, BamE, FtsH and PppiD, as well as the
expression of deaD in persister cells of A. baumannii after being exposed to
meropenem in planktonic and biofilm culture. We also assessed the persister levels
after treatment with polymyxin B.
29
2. Materials and Methods
2.1. Acinetobacter baumannii strain
The A. baumannii Acb-1 strain used in this study was obtained from a tracheal
aspirate collected at the Department of Microbiology of the Clinical Pathology
Laboratory of São Lucas Hospital, Porto Alegre, RS, Brazil, following the protocol
approved by the Ethics Committee in Research (number 483469). Acb-1 has been
previously characterized as susceptible to meropenem and polymyxin B, with a
minimum inhibitory concentration (MIC) established as 1 μg/mL for both drugs.
Additionally, Acb-1 has demonstrated the ability to form biofilm in polystyrene
microplates [32,33]. The relative quantification of proteins associated with the persister
state, exposed to meropenem and polymyxin B separately, was determined using
nanoscale liquid chromatography coupled to tandem mass spectrometry (nano LC-
MS/MS) [34], which provided valuable data to support the selection of target genes for
current analysis.
2.2. Persister cell levels
Persister cell levels were determined in planktonic and biofilm cultures after
exposure to meropenem and polymyxin B, separately, according to the protocol
described by Drescher et al. [35], with some modifications. To evaluate persister levels
in planktonically growing cells, overnight cultures in Lysogeny broth (LB) were diluted
1:50 in LB and incubated at 37°C until the mid-exponential growth phase
(approximately 108 colony-forming unit (CFU)/mL). Before antimicrobial exposure, the
initial cell density was determined by diluting a 100 µL-aliquot until 10-8 in 0.85% saline
and spotting 10 µL of dilution in triplicate on nutrient agar, which was then incubated
30
at 37°C for 24h. A 1 mL aliquot was collected for RNA extraction. Afterwards, the mid-
exponential growth phase cultures were exposed to polymyxin B or meropenem at 15-
fold MIC for 96 h and 144 h, respectively. To determine the surviving fractions at 6, 24
and 48 h of polymyxin B and 48, 96, 120, 144 h of meropenem exposure, 1 mL-aliquots
were removed at each time, centrifuged at 3,483 g for 7 min, and the supernatants
discarded. The pellets were washed with 1 mL of 0.85% saline to remove antimicrobial
residues. After washing, the pellets were resuspended in 1 mL of 0.85% saline that
was diluted until 10-6, and 10 µL of each dilution were spotted on nutrient agar. Also,
for each aliquot removed to determine persister cell levels, a 1 mL- aliquot was
collected for RNA extraction.
To determine the persister levels in biofilm, Acb-1 was grown in LB for 24 h at
37°C using 6-well polystyrene plates. After this period, the culture medium containing
non-adherent cells was removed and the biofilm was washed twice with phosphate-
buffered saline (PBS). The initial biofilm population density was evaluated by adding 2
mL of 0.85% saline to each well with subsequent disruption by an ultrasonic water bath
(Ultrasonic Cleaner 1400 A, Unique, Indaiatuba, Brazil) for 10 min. For the
determination of persister levels, 2 mL of fresh LB containing 15-fold MIC of
meropenem were added to the 24 h-biofilms and incubated at room temperature until
96 h. At 48 and 96 h of exposure (evaluated in independent microplates), wells were
washed twice with PBS, and 2 mL of 0.85% saline was added. Biofilms were disrupted
by an ultrasonic water bath for 10 min. The supernatant containing dissociate adherent
cells was removed and their quantification was performed as described for the
planktonic cultures. A 1 mL-aliquot was also reserved at each time point and
subsequentially subjected to RNA extraction.
31
The surviving cell fractions were calculated by dividing the number of remaining
colonies counted by the number of colonies found before the antibiotic treatment. After
a 48-h or 144-h exposure to high concentrations of polymyxin B or meropenem,
respectively, the MIC of each antimicrobial was determined again by broth
microdilution [36] in the surviving cells to exclude the selection of a resistant mutant.
All assays were performed in biological and experimental triplicates, and the CFU
count data were the mean of three replicates.
2.3. RNA extraction
The RNA extraction was adapted from the protocol described by Han et al. [37]. A
1 mL-aliquot taken from the persister assay was centrifuged twice at 8,000 g for 5 min
at 4°C. The supernatant was removed and, the pellet was resuspended in 0.85%
saline. Then, the cells were treated with 700 µL of TRIzol Reagent (ThermoFisher
Scientific, Waltham, MA) and incubated in room temperature for 10 min. Following this,
400 µL of chloroform was added and mixed vigorously and incubated at room
temperature for 3 min. The sample was centrifuged at 12,000 g for 15 min at 4°C. The
supernatant was transferred to a separate microtube containing 500 µL of isopropanol.
The mixture was gently pipetted 20 times and then incubated at room temperature for
10 min. The samples were centrifuged at 12,000 g for 20 min at 4°C, the supernatant
was discarded, and the pellet was washed with 1 mL of 75% ethanol. Then the sample
was centrifuged again at 12,000 g for 10 min at 4°C, the ethanol was carefully removed,
and the pellet was dried at 65°C in a thermal block for 5 min. Finally, the pellet was
resuspended in 20 µL of UltraPure™ DNase/RNase-Free Distilled Water
(ThermoFisher Scientific, Waltham, MA) and incubated at room temperature for 10 min
to increase solubility.
32
RNA concentration and purity were evaluated by spectrophotometry at 260/280 nm
at a NanoDropTM One spectrophotometer (ThermoFisher Scientific, Waltham, MA).
The samples were stored at -80°C until PCR analysis. For execution of the persister
assay three biological replicates were used for RNA extraction at each time point.
2.4. Evaluation of gene expression
The genes were selected from proteomic data of persister cells obtained
previously from our research group [34]. Transcriptional analysis was performed using
reverse transcription followed by real time PCR. Firstly, 1 μg of purified total RNA was
used as a template for reverse transcriptase utilizing the High-Capacity cDNA Reverse
Transcription Kit (ThermoFisher Scientific, Waltham, MA). The target genes selected
for analysis were deaD, bamA, bamB, bamD, bamE, ftsH, and ppiD. Gene-specific
primers were designed based on the Acb1 strain genome, available in Genbank under
the accession number RDOH00000000.1, using the primer-Blast algorithm. The levels
of gene expression were normalized using the single copy housekeeping gene rpoB
as reference [38]. The qPCR assay was performed using the PowerUp™ SYBR™
Green Master Mix (ThermoFisher Scientific, Waltham, MA) in the StepOne™ Real-
Time PCR System (ThermoFisher Scientific, Waltham, MA). Gene expression was
evaluated at 0, 96, and 144 h for planktonic persister cells and at 0, 48, and 96 h for
biofilm assays. Only the samples exposed to meropenem were analyzed. For each of
the three time points analyzed, all RNA replicates were subjected to qPCR.
33
Table 1. Primers used in this study.
Target
Primer Sequence Product length (bp) Reference
gene
bamA- F TTAGCGGTCGGTTATTCGCA
393 This study
bamA- R TGCCTTACCACCATTTGCCA
bamB- F ACCATCGCCAGTGAGTCTTG
284 This study
bamB- R CTTCTGGACGCTTGGTGCTA
bamD- F TGGTGCTTCAACAGGTGTGT
512 This study
bamD- R TTCGTCGCTTCCCAAGTAGC
bamE- F ACTCGTGCTGACGTTATTCGT
254 This study
bamE- R CTGCGGGGATTTTCGCTTTT
deaD- F GCGTTTCATCAGCCAACCAG
273 This study
deaD- R TGGACGAAGCTGACCGTATG
ftsH- F AGCAAGTCACGATTGACGGT
557 This study
ftsH- R ACCCACACCCACGAACATTT
ppiD- F ACACCAGCCGCATGATAGTC
365 This study
ppiD- R ATTGAAGCGGAGACTCAGGC
rpoB- F GAGTCTAATGGCGGTGGTTC
[39]
rpoB- R ATTGCTTCATCTGCTGGTTG
2.5. Statistical analysis
The data obtained were statistically analyzed using GraphPad Prism 9.0 software.
Descriptive statistics were performed, and the data were subjected to analysis of
variance (one-way ANOVA), after which the Tukey test was employed to confirm the
34
differences in each variable. A p-value of <0.05 was considered statistically significant
for all tests.
3. Results
3.1. Acb-1 persister levels after exposure to meropenem and polymyxin B
Persister cells were detected in all persister assays performed, following
exposure to meropenem or polymyxin B, in both planktonic and biofilm cultures. To
ensure the presence of persister cells and rule out the possibility of selecting antibiotic-
resistant mutants, cells were subjected to a new susceptibility test afterwards, and no
differences were observed comparing with the previous MIC, confirming the presence
of persister cells.
When exposed to meropenem, the planktonic cultures displayed a fraction of
persister cells that reached 0.0204% of the initial population after 144 h (Table 2). The
killing curves depicting this phenomenon can be observed in Fig. 1. The exposure to
polymyxin B resulted in a fraction of persister cells reaching 0.0077% in 6 h of
exposure. Subsequently, the fraction increased to 0.16% in 48 h (Table 2), as depicted
in Fig 1.
When cultured in biofilm, the fraction of persister cells after exposure to
meropenem were higher compared to the planktonic culture, reaching 1.69% in 96 h
(Table 2). This observation is consistent with previous studies, which have also
reported that biofilm cultures retain a larger fraction of persister cells [32].
35
Table 2. Persister cells fractions obtained after exposure to different antibiotics in
biofilm and planktonic cultures.
Meropenem (15 µg/mL) Polymyxin B (15 µg/mL)

Time point
Planktonic (%) Biofilm (%) Planktonic (%)
6h - - 0.008
24 h - - 0.120
48 h 18.861 4.440 0.159
96 h 0.351 1.689 -
120 h 0.034 - -
144 h 0.020 - -
Fig. 1. Killing curves of Acinetobacter baumannii Acb-1 after exposure to: (•)
meropenem (15 µg/mL) in planktonic culture for up to 144 h, (■) polymyxin B (15
µg/mL) in planktonic culture for up to 48 h, and (▲) meropenem (15 µg/mL) in biofilm
culture for up to 96 h. Each data point represents mean and standard deviation (error
bars) from three biological replicates. CFU: Colony-forming unit.
36
3.2. Differential gene expression in planktonic culture
Some of the genes evaluated showed differential regulation when exposed to
meropenem for up to 144 h. deaD exhibited an initial down-regulation (0.32-fold) at 96
h and subsequent up-regulation (2.41-fold) at 144 h (Fig. 2A). Conversely, bamA and
bamE displayed an initial up-regulation (3.27-fold and 1.97-fold, respectively) and
subsequent down-regulation (0.34-fold and 0.84 respectively) (Fig. 2B and 2E), but at
144 h no significant difference was observed compared to pre-meropenem exposure.
Although not statistically significant, bamB showed a tendency to downregulation at 96
h and a significant upregulation at 144 h (1.51-fold) when compared to the 96-h time
point, however no significant difference was observed compared to pre-meropenem
exposure (Fig. 2C). bamD and ppiD showed no differential expression (Fig. 2D and
2G). ftsH displayed downregulation (0.12-fold) at 96 h (Fig. 2F).
37
38
Fig. 2. Differential gene expression of persister cells in the planktonic culture of
Acinetobacter baumannii Acb-1 after exposure to meropenem (15 µg/mL) for 0, 96,
and 144 h using quantitative real-time PCR. The gene rpoB was used as the
housekeeping control and six genes already evaluated by proteome analysis were
evaluated: (A) deaD, (B) bamA, (C) bamB, (D) bamD, (E) bamE, (F) ftsH, and (G) ppiD.
The y-axis represents the fold difference of each gene relative to the threshold cycle
(CT) values (2-(ΔΔCT)). The values represent the means of three experimental replicates
obtained from two biological replicates (n=6). A one-way ANOVA was performed, and
a p-value of <0.05 was considered significant. The significance level is indicated as
follows: *= p-value <0.05, **= p-value <0.01 and, and n.s.= not significant.
3.3. Differential gene expression in biofilm culture
In the persister cells from biofilm exposed to meropenem for up to 96 h, most of
the evaluated genes did not show significant differential expression. Unlike what was
observed in planktonic culture, bamD exhibited a down-regulation (0.15-fold) at 96 h
(Fig. 3D). ftsH displayed an up-regulation (10.6-fold) at 48 h (Fig. 3F), but it was
followed by a downregulation, returning to the initial levels before meropenem
exposure. No statistically significant differential gene expression was observed for
deaD, bamA, bamB, bamE, and ppiD in the analyzed samples.
39
Fig. 3. Differential gene expression of persister cells in biofilm of Acinetobacter
baumannii Acb-1 after exposure to meropenem (15 µg/mL) for 0, 96, and 144 h using
quantitative real-time PCR. The analyzed genes were as follows: (A) deaD, (B) bamA,
(C) bamB, (D) bamD, (E) bamE, (F) ftsH, and (G) ppiD. The gene rpoB was used as
control. The y-axis represents the fold difference of each gene relative to the threshold
40
cycle (CT) values (2-(ΔΔCT)). The values represent the means of three experimental
replicates obtained from two biological replicates (n=6). A one-way ANOVA was
performed, and a p-value of <0.05 was considered significant. The significance level
is indicated as follows: *= p-value <0.05, **= p-value <0.01 and, and n.s.= not
significant.
4. Discussion
The molecular mechanisms underlying persister cells are still not completely
understood, however, important progress has been made. Studies have showed that
proteins involved in translation and RNA metabolism may play a role in persister cell
formation [18,40]. Furthermore, the involvement of ribosomal RNA in persister cells
has been proposed [40]. Additionally, there is ongoing discussion about the potential
participation of membrane proteins in the persistence state, as they can contribute to
reducing intracellular antibiotic concentration and act in signal transduction pathways
[18,25]. Previous study conducted by our research group demonstrated an
upregulation of OMP genes in persister cells [26]. Given that proteins which are
involved in RNA metabolism and membrane-associated proteins have been
characterized as involved in the persistence phenotype, in this study, we aimed to
measure the expression of genes that might be involved in these processes. Using the
literature and the current advances in the area, along with a previous proteomic
analysis of the A. baumannii strain Acb-1 (data not shown), six genes were selected.
Comparing the killing curves (Fig. 1) of Acb-1 following meropenem and polymyxin
B treatment, it is possible to observe that when treating with polymyxin B there is a
population growth after 6 h, corroborating what has been observed previously with
41
different A. baumannii strains [34]. The surviving cells observed are bona-fide
persisters, as their susceptibility remained unchanged even after treatment. Notably,
when contrasting planktonic and biofilm cultures, the latter showed a higher count of
persister cells. These findings are likely attributed to the distinct environment
established by biofilm cultures, which promote, protect, and select for persisters
[14,16]. The biofilm, with its nutrient levels, aeration, and pH gradients, potentially acts
as a natural source of stressors and selectors, providing an environment conducive for
the formation and/or maintenance of persisters. Additionally, the biofilm matrix
incorporates several mechanisms that can limit the antimicrobial action, including
extracellular enzymes, efflux pumps, eDNA, facilitated horizontal gene-transfer,
among others [14,15,17].
The observed differential expression of the deaD gene (Fig. 2A) can be due to
several reasons. DEAD-box helicases, especially DeaD, are known to have diverse
functions, including involvement in ribosome assembly and mRNA degradation [22].
DeaD has also been implicated in cold-shock response and growth at low
temperatures [22], as well as in response to oxidative stress in bacteria [41,42]. In this
sense, the Acb-1 proteomic data presented a considerable overproduction of DeaD at
96 h (unpublished data). Therefore, the downregulation of deaD at 96 h followed by an
upregulation at 144 h (Fig. 2A), may be explained by several scenarios. In the initial
96 h, with bacteria experiencing antibiotic stress, A. baumannii may tightly control the
expression of deaD due to its ATP-dependent nature and short mRNA half-life [24].
This could result in a depletion of mRNA levels, while the active protein remains
relatively abundant. Additionally, DeaD plays a role in late-stage ribosomal assembly
and constitutes part of the degradosome, which is essential for the bacterial
metabolism and response to environmental changes [24]. Therefore, the subsequent
42
upregulation of deaD at 144 h may be necessary to maintain enough levels of the
DeaD protein in persister cells, which exhibit distinct gene expression patterns
associated with their phenotype.
The BAM complex, composed of four lipoproteins (BamBCDE) and one OMP
(BamA), plays a crucial role in the folding and insertion of OMPs [43,44]. The current
model suggests that BamD may regulate the engagement of OMP with the complex,
while BamA is primarily responsible for the folding process [43]. The functions of the
other three proteins in the complex, BamB, BamC, and BamE, are still under debate,
with possibly redundant activities, as single deletions of these proteins only lead to
minor folding errors in OMPs [43,44]. In this study, we observed an increase in mRNA
expression for most of the Bam genes evaluated (Fig 2B, C, E). The up-regulation of
bamAE was observed at 96 h (Fig. 2B and E), while bamB was overexpressed at 144
h (Fig. 2C). On the other hand, bamD showed a down-regulation in biofilm culture (Fig.
3D), but did not show significant changes in the planktonic culture (Fig 2D). These
findings suggest that the Bam complex may play a role in the persister phenotype.
These results also corroborate Schmitt et al. findings, who reported an up-regulation
of ompA and ompW genes, which are closely associated with the Bam complex, after
96 h of exposure to meropenem [26]. However, further investigation is needed to
understand the delayed response observed in bamB, with its up-regulation occurring
only at 144 h (Fig. 2C). Additionally, the reason for the lack of differential expression
of bamD in the planktonic culture (Fig. 2D) and its down-regulation in biofilm (Fig. 3D)
needs to be explored, considering its role as a quality checkpoint regulator and an
essential component of the Bam complex [43].
FtsH is a member of the ATPases family (AAA+ proteases), which utilize ATP to
degrade several proteins [45]. It is considered a universal protease with several known
43
targets, including LpxC, RpoH, and YfgM [46]. These substrates play roles in stress
response, interacting with (p)ppGpp, an important alarmone involved in the stringent
response, and YfgM, which acts in intra and extra cytoplasmic stress response [46].
Given the known function of FtsH and our observations in this study, we propose that
FtsH may play an important role in the stress response associated with the persister
phenotype. In planktonic culture, we observed a down-regulation of FtsH mRNA at 96
h (Fig. 2F), suggesting that maintaining the activity of proteins and substrates involved
in initiating and sustaining a stress response is crucial within the cell. On the other
hand, in the biofilm, where cells, persisters or not, have mechanisms that provide
protection [17], the stress response may not be as severe as in planktonic state. This
is supported by the up-regulation of FtsH mRNA at 48 h in biofilm (Fig. 3F). However,
further analysis is required to fully understand the implications of these findings. Taken
together, our data suggest that FtsH may play a significant role in the stress response
observed in the persister phenotype. The dynamic regulation of FtsH expression in
different growth conditions highlights its potential involvement in cellular adaptation
and survival strategies.
PpiD works in cooperation with SecYEG proteins as a chaperone for the
translocation of proteins by the SecYEG complex. It also forms a complex with YfgM
[47,48], which serves as a substrate for FtsH and is involved in the stress response
[46]. Additionally, PpiD plays a role in the proper folding of certain OMPs [47]. However,
both in planktonic and biofilm cultures, we observed no significant changes in ppiD
expression in any of the samples analyzed (Fig 2G and 3G). This indicates that the
expression of ppiD remains relatively stable under the conditions tested and may not
be directly involved in the mechanisms underlying persister formation and
maintenance.
44
Planktonic cultures (Fig. 2) presented a more heterogeneous profile of differential
gene expression compared to biofilms (Fig. 3). This difference can be due to several
reasons. In biofilm state, cells are protected by the extracellular environment, which
can shield them from several stressful conditions [16]. The presence of extracellular
polymeric substances in the biofilm hinders the penetration of antibiotics, in addition to
the potential interference caused by its components [14,16,17]. Due to the protective
nature of the biofilm environment, cells may have a reduced need for an extensive
stress response compared to planktonic cultures, or at least, when faced with the
presence of an antibiotic there is no change in gene expression of the evaluated genes
in this study. However, it should be noted that some studies have shown up-regulation
of specific genes in biofilm cultures, particularly those related to bacterial adhesion,
invasion, and virulence in microorganisms such as Porphyromonas gingivalis [49]. In
Staphylococcus aureus, genes related to fermentation and glycolysis were found to be
up-regulated in biofilms [50]. Furthermore, in the persister phenotype, the biofilm state
may employ distinct pathways to maintain the viability of cells in the presence of
antibiotics. This aspect requires further investigation to fully understand the
mechanisms involved.
5. Conclusion
Our study revealed that deaD, the bam complex, and ftsH may contribute to the
persister phenotype in A. baumannii. Moreover, we observed that genes differentially
expressed in planktonic state did not necessarily show the same pattern in biofilm,
suggesting the existence of different pathways involved in persister formation and/or
maintenance in each environment. Therefore, more studies are needed to elucidate
45
the mechanisms underlying persister formation, which could pave the way for the
development of novel treatments for A. baumannii infections.
Funding
This study was supported by the State of Rio Grande do Sul, through Fundação
de Amparo à Pesquisa do Rio Grande do Sul (FAPERGS) (Programa Pesquisador
Gaúcho - 19/2551-0001976-9), and in part by the Coordenação de Aperfeiçoamento
de Pessoal de Nível Superior – Brasil (CAPES) – [Finance Code 001]. SDO is
Research Career Awarded of the CNPq (grant number 309933/2020-0).
Ethical approval
Not required.
Declaration of competing interest
The authors declare that they have no known competing financial interests or
personal relationships that could have appeared to influence the study reported in this
paper.
Acknowledgments
We thankfully acknowledge to Julia Huppes Majolo for assistance in statistical
analysis, Brenda Landvoigt Schmitt, Vanessa Fey, and Maila Pacheco Dias for
assistance in all technical work.
Data availability statement
The original contributions presented in the study are included in the article; further
inquiries may be directed to the corresponding author.
46
References
[1] Stone PW. Economic burden of healthcare-associated infections: an American perspective.

Expert Rev Pharmacoecon Outcomes Res 2009;9:417–22. https://doi.org/10.1586/erp.09.53.
[2] European Centre for Disease Prevention and Control. Point prevalence survey of healthcare-
associated infections and antimicrobial use in European acute care hospitals :2011 2012. LU:
Publications Office; 2013.
[3] Peleg AY, Seifert H, Paterson DL. Acinetobacter baumannii: emergence of a successful
pathogen. Clin Microbiol Rev 2008;21:538–82. https://doi.org/10.1128/CMR.00058-07.
[4] Quartin AA, Scerpella EG, Puttagunta S, Kett DH. A comparison of microbiology and
demographics among patients with healthcare-associated, hospital-acquired, and ventilator-
associated pneumonia: a retrospective analysis of 1184 patients from a large, international study.
BMC Infect Dis 2013;13:561. https://doi.org/10.1186/1471-2334-13-561.
[5] Simonetti A, Ottaiano E, Diana MV, Onza C, Triassi M. Epidemiology of hospital-acquired

infections in an adult intensive care unit: results of a prospective cohort study. Ann Ig Med Prev E
Comunita 2013;25:281–9. https://doi.org/10.7416/ai.2013.1930.
[6] Nguyen M, Joshi S g. Carbapenem resistance in Acinetobacter baumannii, and their

importance in hospital-acquired infections: a scientific review. J Appl Microbiol 2021;131:2715–38.
https://doi.org/10.1111/jam.15130.
[7] Higgins PG, Dammhayn C, Hackel M, Seifert H. Global spread of carbapenem-resistant

Acinetobacter baumannii. J Antimicrob Chemother 2010;65:233–8.
https://doi.org/10.1093/jac/dkp428.
[8] Karakonstantis S, Kritsotakis EI, Gikas A. Treatment options for K. pneumoniae, P. aeruginosa
and A. baumannii co-resistant to carbapenems, aminoglycosides, polymyxins and tigecycline: an
approach based on the mechanisms of resistance to carbapenems. Infection 2020:1–17.
https://doi.org/10.1007/s15010-020-01520-6.
[9] Kempf M, Rolain J-M. Emergence of resistance to carbapenems in Acinetobacter baumannii

in Europe: clinical impact and therapeutic options. Int J Antimicrob Agents 2012;39:105–14.
https://doi.org/10.1016/j.ijantimicag.2011.10.004.
[10] Hagihara M, Housman ST, Nicolau DP, Kuti JL. In vitro pharmacodynamics of polymyxin B and
tigecycline alone and in combination against carbapenem-resistant Acinetobacter baumannii.
Antimicrob Agents Chemother 2014;58:874–9. https://doi.org/10.1128/AAC.01624-13.
[11] Lima WG, Brito JCM, Cardoso BG, Cardoso VN, de Paiva MC, de Lima ME, et al. Rate of
polymyxin resistance among Acinetobacter baumannii recovered from hospitalized patients: a
systematic review and meta-analysis. Eur J Clin Microbiol Infect Dis 2020;39:1427–38.
https://doi.org/10.1007/s10096-020-03876-x.
[12] Van den Bergh B, Fauvart M, Michiels J. Formation, physiology, ecology, evolution and clinical
importance of bacterial persisters. FEMS Microbiol Rev 2017;41:219–51.
https://doi.org/10.1093/femsre/fux001.
47
[13] Fauvart M, De Groote VN, Michiels J. Role of persister cells in chronic infections: clinical
relevance and perspectives on anti-persister therapies. J Med Microbiol 2011;60:699–709.
https://doi.org/10.1099/jmm.0.030932-0.
[14] Flemming H-C, Wingender J, Szewzyk U, Steinberg P, Rice SA, Kjelleberg S. Biofilms: an
emergent form of bacterial life. Nat Rev Microbiol 2016;14:563–75.
https://doi.org/10.1038/nrmicro.2016.94.
[15] Lewis K. Multidrug Tolerance of Biofilms and Persister Cells. In: Romeo T, editor. Bact.
Biofilms, Berlin, Heidelberg: Springer; 2008, p. 107–31. https://doi.org/10.1007/978-3-540-75418-
3_6.
[16] Dincer S, Uslu FM, Delik A, Dincer S, Uslu FM, Delik A. Antibiotic Resistance in Biofilm. Bact.
Biofilms, IntechOpen; 2020. https://doi.org/10.5772/intechopen.92388.
[17] Flemming H-C, Wingender J. The biofilm matrix. Nat Rev Microbiol 2010;8:623–33.
https://doi.org/10.1038/nrmicro2415.
[18] Wilmaerts D, Windels EM, Verstraeten N, Michiels J. General Mechanisms Leading to

Persister Formation and Awakening. Trends Genet 2019;35:401–11.
https://doi.org/10.1016/j.tig.2019.03.007.
[19] Pinel-Marie M-L, Brielle R, Riffaud C, Germain-Amiot N, Polacek N, Felden B. RNA antitoxin
SprF1 binds ribosomes to attenuate translation and promote persister cell formation in
Staphylococcus aureus. Nat Microbiol 2021;6:209–20. https://doi.org/10.1038/s41564-020-00819-2.
[20] Wang Y, Bojer MS, George SE, Wang Z, Jensen PR, Wolz C, et al. Inactivation of TCA cycle
enhances Staphylococcus aureus persister cell formation in stationary phase. Sci Rep 2018;8:10849.
https://doi.org/10.1038/s41598-018-29123-0.
[21] Pandey S, Sahukhal GS, Elasri MO. The msaABCR Operon Regulates Persister Formation by
Modulating Energy Metabolism in Staphylococcus aureus. Front Microbiol 2021;12:657753.
https://doi.org/10.3389/fmicb.2021.657753.
[22] Iost I, Bizebard T, Dreyfus M. Functions of DEAD-box proteins in bacteria: Current knowledge
and pending questions. Biochim Biophys Acta BBA - Gene Regul Mech 2013;1829:866–77.
https://doi.org/10.1016/j.bbagrm.2013.01.012.
[23] Hausmann S, Gonzalez D, Geiser J, Valentini M. The DEAD-box RNA helicase RhlE2 is a global
regulator of Pseudomonas aeruginosa lifestyle and pathogenesis. Nucleic Acids Res 2021;49:6925–
40. https://doi.org/10.1093/nar/gkab503.
[24] Redder P, Hausmann S, Khemici V, Yasrebi H, Linder P. Bacterial versatility requires DEAD-box
RNA helicases. FEMS Microbiol Rev 2015;39:392–412. https://doi.org/10.1093/femsre/fuv011.
[25] Rollauer SE, Sooreshjani MA, Noinaj N, Buchanan SK. Outer membrane protein biogenesis in
Gram-negative bacteria. Philos Trans R Soc Lond B Biol Sci 2015;370:20150023.
https://doi.org/10.1098/rstb.2015.0023.
[26] Schmitt BL, Leal BF, Leyser M, de Barros MP, Trentin DS, Ferreira CAS, et al. Increased ompW
and ompA expression and higher virulence of Acinetobacter baumannii persister cells. BMC Microbiol
2023;23:157. https://doi.org/10.1186/s12866-023-02904-y.
48
[27] Hagan CL, Silhavy TJ, Kahne D. β-Barrel membrane protein assembly by the Bam complex.
Annu Rev Biochem 2011;80:189–210. https://doi.org/10.1146/annurev-biochem-061408-144611.
[28] Selkrig J, Leyton DL, Webb CT, Lithgow T. Assembly of β-barrel proteins into bacterial outer
membranes. Biochim Biophys Acta 2014;1843:1542–50.
https://doi.org/10.1016/j.bbamcr.2013.10.009.
[29] Langklotz S, Baumann U, Narberhaus F. Structure and function of the bacterial AAA protease
FtsH. Biochim Biophys Acta BBA - Mol Cell Res 2012;1823:40–8.
[30] Akiyama Y, Kihara A, Tokuda H, Ito K. FtsH (HflB) Is an ATP-dependent Protease Selectively
Acting on SecY and Some Other Membrane Proteins *. J Biol Chem 1996;271:31196–201.
https://doi.org/10.1074/jbc.271.49.31196.
[31] Matern Y, Barion B, Behrens-Kneip S. PpiD is a player in the network of periplasmic

chaperones in Escherichia coli. BMC Microbiol 2010;10:251. https://doi.org/10.1186/1471-2180-10-
251.
[32] Gallo SW, Donamore BK, Pagnussatti VE, Ferreira CAS, de Oliveira SD. Effects of meropenem
exposure in persister cells of Acinetobacter calcoaceticus-baumannii. Future Microbiol 2017;12:131–
40. https://doi.org/10.2217/fmb-2016-0118.
[33] Gallo SW, Ferreira CAS, de Oliveira SD. Combination of polymyxin B and meropenem
eradicates persister cells from Acinetobacter baumannii strains in exponential growth. J Med
Microbiol 2017;66:1257–60. https://doi.org/10.1099/jmm.0.000542.
[34] Gallo SW. Avaliação do fenótipo de persistência em isolados nosocomiais de Acinetobacter

calcoaceticus-baumannii 2017.
[35] Drescher SPM, Gallo SW, Ferreira PMA, Ferreira CAS, Oliveira SD de. Salmonella enterica
persister cells form unstable small colony variants after in vitro exposure to ciprofloxacin. Sci Rep
2019;9:7232. https://doi.org/10.1038/s41598-019-43631-7.
[36] M07: Dilution AST for Aerobically Grown Bacteria - CLSI. Clin Lab Stand Inst n.d.
https://clsi.org/standards/products/microbiology/documents/m07/ (accessed April 5, 2023).
[37] Han P, Go MK, Chow JY, Xue B, Lim YP, Crone MA, et al. A high-throughput pipeline for
scalable kit-free RNA extraction. Sci Rep 2021;11:23260. https://doi.org/10.1038/s41598-021-02742-
w.
[38] Krizova L, Poirel L, Nordmann P, Nemec A. TEM-1 β-lactamase as a source of resistance to

sulbactam in clinical strains of Acinetobacter baumannii. J Antimicrob Chemother 2013;68:2786–91.
https://doi.org/10.1093/jac/dkt275.
[39] Hornsey M, Ellington MJ, Doumith M, Thomas CP, Gordon NC, Wareham DW, et al. AdeABC-
mediated efflux and tigecycline MICs for epidemic clones of Acinetobacter baumannii. J Antimicrob
Chemother 2010;65:1589–93. https://doi.org/10.1093/jac/dkq218.
[40] Pinel-Marie M-L, Brielle R, Riffaud C, Germain-Amiot N, Polacek N, Felden B. RNA antitoxin
SprF1 binds ribosomes to attenuate translation and promote persister cell formation in
Staphylococcus aureus. Nat Microbiol 2021;6:209–20. https://doi.org/10.1038/s41564-020-00819-2.
49
[41] da Silva RAG, Wong JJ, Antypas H, Choo PY, Goh K, Jolly S, et al. Mitoxantrone targets both
host and bacteria to overcome vancomycin resistance in Enterococcus faecalis. Sci Adv
2023;9:eadd9280. https://doi.org/10.1126/sciadv.add9280.
[42] Hoshino K, Hamauzu R, Nakagawa H, Kodani S, Hosaka T. Unique Physiological and Genetic
Features of Ofloxacin-Resistant Streptomyces Mutants. Appl Environ Microbiol 2022;88:e02327-21.
https://doi.org/10.1128/aem.02327-21.
[43] Hart EM, Silhavy TJ. Functions of the BamBCDE Lipoproteins Revealed by Bypass Mutations in
BamA. J Bacteriol 2020;202:e00401-20. https://doi.org/10.1128/JB.00401-20.
[44] Knowles TJ, Scott-Tucker A, Overduin M, Henderson IR. Membrane protein architects: the
role of the BAM complex in outer membrane protein assembly. Nat Rev Microbiol 2009;7:206–14.
https://doi.org/10.1038/nrmicro2069.
[45] Ito K, Akiyama Y. Cellular Functions, Mechanism of Action, and Regulation of Ftsh Protease.
Annu Rev Microbiol 2005;59:211–31. https://doi.org/10.1146/annurev.micro.59.030804.121316.
[46] Bittner L-M, Arends J, Narberhaus F. When, how and why? Regulated proteolysis by the
essential FtsH protease in Escherichia coli. Biol Chem 2017;398:625–35. https://doi.org/10.1515/hsz-
2016-0302.
[47] Miyazaki R, Ai M, Tanaka N, Suzuki T, Dhomae N, Tsukazaki T, et al. Inner membrane YfgM–
PpiD heterodimer acts as a functional unit that associates with the SecY/E/G translocon and
promotes protein translocation. J Biol Chem 2022;298. https://doi.org/10.1016/j.jbc.2022.102572.
[48] Fürst M, Zhou Y, Merfort J, Müller M. Involvement of PpiD in Sec-dependent protein

translocation. Biochim Biophys Acta BBA - Mol Cell Res 2018;1865:273–80.
[49] Sánchez MC, Romero-Lastra P, Ribeiro-Vidal H, Llama-Palacios A, Figuero E, Herrera D, et al.

Comparative gene expression analysis of planktonic Porphyromonas gingivalis ATCC 33277 in the
presence of a growing biofilm versus planktonic cells. BMC Microbiol 2019;19:58.
https://doi.org/10.1186/s12866-019-1423-9.
[50] Becker P, Hufnagle W, Peters G, Herrmann M. Detection of Differential Gene Expression in

Biofilm-Forming versus Planktonic Populations of Staphylococcus aureus Using Micro-
Representational-Difference Analysis. Appl Environ Microbiol 2001;67:2958–65.
https://doi.org/10.1128/AEM.67.7.2958-2965.2001.
50
Capítulo 3
4. Considerações finais
Previamente, em uma quantificação diferencial por meio de análise proteômica em
células persisters em A. baumannii, observamos que estas proteínas DeaD, BamA,
BamB, BamD, BamE, FtsH e PpiD foram significativamente mais detectadas nestas
variantes fenotípicas. Desta forma, conduzimos a avaliação da expressão dos genes
codificadores para estas proteínas em células persisters em A. baumannii, tendo
observado que DeaD, o complexo BAM e FtsH podem estar envolvidos no fenótipo de
persistência neste microrganismo. O envolvimento destas proteínas no estresse
mediado pela exposição a antibiótico está em consonância com o papel já descrito na
resposta e tolerância a diferentes formas de estresse, tais como: choque térmico,
estresse osmótico, estresse ácido, e adaptação à fase estacionária.
Conseguimos avaliar a variação de expressão de deaD, bamA, bamB, bamE e

ftsH, em cultivo planctônico, após exposição ao meropenem por até 144 horas.
Também foi avaliado que o cultivo em biofilme aparenta possuir uma certa
estabilidade de expressão dos genes avaliados, com expressão aumentada somente
observada em bamD e ftsH, podendo sugerir uma via de indução diferente para o
processo de persistência.
Ainda são necessários novos estudos para entender as possíveis vias nas quais
estes genes podem estar atuando no processo de persistência, bem como confirmar
diretamente o envolvimento dos alvos do estudo em células persisters. Também, é
necessário avaliar os mecanismos moleculares de persistência em biofilme, visto que
os alvos selecionados não aparentam ter envolvimento expressivo. É necessário
ainda avaliar a expressão de deaD, bamA, bamB, bamD, bamE, ftsH e ppiD após
tratamento com polimixina B, e ainda avaliar outros alvos que foram apontados pela
análise proteômica.
Por fim, estudos como este permitem avaliar possíveis alvos para o
desenvolvimento de novos antimicrobianos e no uso racional dos antimicrobianos
atualmente em uso, além de avançar o conhecimento dos mecanismos moleculares
envolvidos na seleção e indução persisters.
51
REFERÊNCIAS
ALMASAUDI, S. B. Acinetobacter spp. as nosocomial pathogens: Epidemiology and resistance

features. Saudi Journal of Biological Sciences, v. 25, n. 3, p. 586–596, mar. 2018.
ANVISA. Boletim Segurança do Paciente e Qualidade em Serviços de Saúde no 28. , 2021a.

Disponível em:
<https://app.powerbi.com/view?r=eyJrIjoiZDIwZjYyMzUtMmYxZS00MTRjLTk0NWMtZWE2ZDUzOGRj
OTVjIiwidCI6ImI2N2FmMjNmLWMzZjMtNGQzNS04MGM3LWI3MDg1ZjVlZGQ4MSJ9>
ANVISA. PROGRAMA NACIONAL DE PREVENÇÃO E CONTROLE DE INFECÇÕES RELACIONADAS À

ASSISTÊNCIA À SAÚDE (PNPCIRAS) 2021 a 2025. , 3 maio 2021b. Disponível em:
<https://www.gov.br/anvisa/pt-
br/centraisdeconteudo/publicacoes/servicosdesaude/publicacoes/pnpciras_2021_2025.pdf>
BARTH, V. C. et al. Heterogeneous persister cells formation in Acinetobacter baumannii. PloS One, v.
8, n. 12, p. e84361, 2013.
BENNION, D. et al. Dissection of β-barrel outer membrane protein assembly pathways through
characterizing BamA POTRA 1 mutants of Escherichia coli. Molecular Microbiology, v. 77, n. 5, p.
1153–1171, set. 2010.
BIGGER, JOSEPHW. TREATMENT OF STAPHYLOCOCCAL INFECTIONS WITH PENICILLIN BY

INTERMITTENT STERILISATION. The Lancet, Originally published as Volume 2, Issue 6320. v. 244, n.
6320, p. 497–500, 14 out. 1944.
BITTNER, L.-M.; ARENDS, J.; NARBERHAUS, F. When, how and why? Regulated proteolysis by the
essential FtsH protease in Escherichia coli. Biological Chemistry, v. 398, n. 5–6, p. 625–635, 1 maio
2017.
BITTNER, L.-M.; WESTPHAL, K.; NARBERHAUS, F. Conditional Proteolysis of the Membrane Protein
YfgM by the FtsH Protease Depends on a Novel N-terminal Degron. The Journal of Biological
Chemistry, v. 290, n. 31, p. 19367–19378, 31 jul. 2015.
CHANG, J.; LEE, R.-E.; LEE, W. A pursuit of Staphylococcus aureus continues: a role of persister cells.
Archives of Pharmacal Research, v. 43, n. 6, p. 630–638, 1 jun. 2020.
DA SILVA, R. A. G. et al. Mitoxantrone targets both host and bacteria to overcome vancomycin
resistance in Enterococcus faecalis. Science Advances, v. 9, n. 8, p. eadd9280, 22 fev. 2023.
DHILLON, S. Meropenem/Vaborbactam: A Review in Complicated Urinary Tract Infections. Drugs, v.

78, n. 12, p. 1259–1270, 2018.
DONAMORE, B. K. et al. Levels of persisters influenced by aeration in Acinetobacter calcoaceticus-

baumannii. Future Microbiology, v. 13, p. 209–219, fev. 2018.
FAUVART, M.; DE GROOTE, V. N.; MICHIELS, J. Role of persister cells in chronic infections: clinical
relevance and perspectives on anti-persister therapies. Journal of Medical Microbiology, v. 60, n. Pt
6, p. 699–709, jun. 2011.
FLEMMING, H.-C. et al. Biofilms: an emergent form of bacterial life. Nature Reviews Microbiology, v.
14, n. 9, p. 563–575, set. 2016.
52
FÜRST, M. et al. Involvement of PpiD in Sec-dependent protein translocation. Biochimica et
Biophysica Acta (BBA) - Molecular Cell Research, v. 1865, n. 2, p. 273–280, 1 fev. 2018.
GALLO, S. W. Avaliação do fenótipo de persistência em isolados nosocomiais de Acinetobacter

calcoaceticus-baumannii. 2017.
GALLO, S. W. et al. Effects of meropenem exposure in persister cells of Acinetobacter calcoaceticus-

baumannii. Future Microbiology, v. 12, p. 131–140, fev. 2017.
GALLO, S. W.; FERREIRA, C. A. S.; DE OLIVEIRA, S. D. Combination of polymyxin B and meropenem

eradicates persister cells from Acinetobacter baumannii strains in exponential growth. Journal of
Medical Microbiology, v. 66, n. 8, p. 1257–1260, ago. 2017.
GOH, K. J. et al. Translational GTPase BipA Is Involved in the Maturation of a Large Subunit of
Bacterial Ribosome at Suboptimal Temperature. Frontiers in Microbiology, v. 12, 2021.
GOLLAN, B. et al. Bacterial Persisters and Infection: Past, Present, and Progressing. Annual Review of
Microbiology, v. 73, n. 1, p. 359–385, 8 set. 2019.
HAGAN, C. L.; SILHAVY, T. J.; KAHNE, D. β-Barrel membrane protein assembly by the Bam complex.
Annual Review of Biochemistry, v. 80, p. 189–210, 2011.
HART, E. M.; SILHAVY, T. J. Functions of the BamBCDE Lipoproteins Revealed by Bypass Mutations in
BamA. Journal of Bacteriology, v. 202, n. 21, p. e00401-20, 8 out. 2020.
HIGGINS, P. G. et al. Global spread of carbapenem-resistant Acinetobacter baumannii. Journal of

Antimicrobial Chemotherapy, v. 65, n. 2, p. 233–238, 1 fev. 2010.
HOSHINO, K. et al. Unique Physiological and Genetic Features of Ofloxacin-Resistant Streptomyces

Mutants. Applied and Environmental Microbiology, v. 88, n. 3, p. e02327-21, 8 fev. 2022.
IMAI, Y. et al. A new antibiotic selectively kills Gram-negative pathogens. Nature, v. 576, n. 7787, p.
459–464, dez. 2019.
IOST, I.; BIZEBARD, T.; DREYFUS, M. Functions of DEAD-box proteins in bacteria: Current knowledge
and pending questions. Biochimica et Biophysica Acta (BBA) - Gene Regulatory Mechanisms, SI: The
Biology of RNA helicases - Modulation for life. v. 1829, n. 8, p. 866–877, 1 ago. 2013.
ITO, K.; AKIYAMA, Y. CELLULAR FUNCTIONS, MECHANISM OF ACTION, AND REGULATION OF FTSH
PROTEASE. Annual Review of Microbiology, v. 59, n. 1, p. 211–231, 1 out. 2005.
IZERT, M. A.; KLIMECKA, M. M.; GÓRNA, M. W. Applications of Bacterial Degrons and Degraders —
Toward Targeted Protein Degradation in Bacteria. Frontiers in Molecular Biosciences, v. 8, p.
669762, 7 maio 2021.
JAGESSAR, K. L.; JAIN, C. Functional and molecular analysis of Escherichia coli strains lacking multiple
DEAD-box helicases. RNA (New York, N.Y.), v. 16, n. 7, p. 1386–1392, jul. 2010.
KARAKONSTANTIS, S.; KRITSOTAKIS, E. I.; GIKAS, A. Treatment options for K. pneumoniae, P.

aeruginosa and A. baumannii co-resistant to carbapenems, aminoglycosides, polymyxins and
tigecycline: an approach based on the mechanisms of resistance to carbapenems. Infection, p. 1–17,
1 set. 2020.
53
KNOWLES, T. J. et al. Membrane protein architects: the role of the BAM complex in outer membrane
protein assembly. Nature Reviews Microbiology, v. 7, n. 3, p. 206–214, mar. 2009.
LANGKLOTZ, S.; BAUMANN, U.; NARBERHAUS, F. Structure and function of the bacterial AAA
protease FtsH. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research, AAA ATPases:
structure and function. v. 1823, n. 1, p. 40–48, 1 jan. 2012.
LEAL, M. A.; FREITAS-VILELA, A. A. DE. Custos das infecções relacionadas à assistência em saúde em
uma Unidade de Terapia Intensiva. Revista Brasileira de Enfermagem, v. 74, p. e20200275, 24 mar.
2021.
LIMA, W. G. et al. Rate of polymyxin resistance among Acinetobacter baumannii recovered from
hospitalized patients: a systematic review and meta-analysis. European Journal of Clinical
Microbiology & Infectious Diseases, v. 39, n. 8, p. 1427–1438, 1 ago. 2020.
LUTHER, A. et al. Chimeric peptidomimetic antibiotics against Gram-negative bacteria. Nature, v. 576,
n. 7787, p. 452–458, dez. 2019.
MARGALIT, A.; CAROLAN, J. C.; WALSH, F. Global protein responses of multidrug resistance plasmid-
containing Escherichia coli to ampicillin, cefotaxime, imipenem and ciprofloxacin. Journal of Global
Antimicrobial Resistance, v. 28, p. 90–96, 1 mar. 2022.
MATERN, Y.; BARION, B.; BEHRENS-KNEIP, S. PpiD is a player in the network of periplasmic
chaperones in Escherichia coli. BMC Microbiology, v. 10, n. 1, p. 251, 29 set. 2010.
MIYAZAKI, R. et al. Inner membrane YfgM–PpiD heterodimer acts as a functional unit that associates
with the SecY/E/G translocon and promotes protein translocation. Journal of Biological Chemistry, v.
298, n. 11, 1 nov. 2022.
MOHAPATRA, S. S.; DWIBEDY, S. K.; PADHY, I. Polymyxins, the last-resort antibiotics: Mode of action,
resistance emergence, and potential solutions. Journal of Biosciences, v. 46, n. 3, p. 85, 2021.
PANDEY, S.; SAHUKHAL, G. S.; ELASRI, M. O. The msaABCR Operon Regulates Persister Formation by
Modulating Energy Metabolism in Staphylococcus aureus. Frontiers in Microbiology, v. 12, p. 881,
2021.
PEIL, L.; VIRUMÄE, K.; REMME, J. Ribosome assembly in Escherichia coli strains lacking the RNA
helicase DeaD/CsdA or DbpA. The FEBS Journal, v. 275, n. 15, p. 3772–3782, 2008.
PELEG, A. Y.; SEIFERT, H.; PATERSON, D. L. Acinetobacter baumannii: emergence of a successful

pathogen. Clinical Microbiology Reviews, v. 21, n. 3, p. 538–582, jul. 2008.
PINEL-MARIE, M.-L. et al. RNA antitoxin SprF1 binds ribosomes to attenuate translation and promote
persister cell formation in Staphylococcus aureus. Nature Microbiology, v. 6, n. 2, p. 209–220, fev.
2021.
PRIMO, M. G. B. et al. Healthcare-associated Staphylococcus aureus bloodstream infection: length of

stay, attributable mortality, and additional direct costs. The Brazilian Journal of Infectious Diseases,
v. 16, n. 6, p. 503–509, 1 nov. 2012.
QUARTIN, A. A. et al. A comparison of microbiology and demographics among patients with

healthcare-associated, hospital-acquired, and ventilator-associated pneumonia: a retrospective
54
analysis of 1184 patients from a large, international study. BMC Infectious Diseases, v. 13, p. 561, 27
nov. 2013.
RADZIKOWSKI, J. L. et al. Bacterial persistence is an active σS stress response to metabolic flux

limitation. Molecular Systems Biology, v. 12, n. 9, p. 882, 21 set. 2016.
REDDER, P. et al. Bacterial versatility requires DEAD-box RNA helicases. FEMS Microbiology Reviews,
v. 39, n. 3, p. 392–412, 1 maio 2015.
RESCH, A. et al. Requirement of the CsdA DEAD-box helicase for low temperature riboregulation of
rpoS mRNA. RNA biology, v. 7, n. 6, p. 796–802, 2010.
ROLLAUER, S. E. et al. Outer membrane protein biogenesis in Gram-negative bacteria. Philosophical

Transactions of the Royal Society B: Biological Sciences, v. 370, n. 1679, p. 20150023, 5 out. 2015.
SCHMITT, B. L. et al. Increased ompW and ompA expression and higher virulence of Acinetobacter
baumannii persister cells. BMC microbiology, v. 23, n. 1, p. 157, 29 maio 2023.
SELKRIG, J. et al. Assembly of β-barrel proteins into bacterial outer membranes. Biochimica et
Biophysica Acta (BBA) - Molecular Cell Research, Protein trafficking and secretion in bacteria. v.
1843, n. 8, p. 1542–1550, 1 ago. 2014.
SHIRTLIFF, M.; LEID, J. G. (EDS.). The Role of Biofilms in Device-Related Infections. 2009th edition ed.
Berlin: Springer, 2009.
SKLAR, J. G. et al. Defining the roles of the periplasmic chaperones SurA, Skp, and DegP in Escherichia
coli. Genes & Development, v. 21, n. 19, p. 2473–2484, 1 out. 2007.
STAMPFL, S. et al. Characterization of the kinetics of RNA annealing and strand displacement
activities of the E. coli DEAD-box helicase CsdA. RNA biology, v. 10, n. 1, p. 149–156, jan. 2013.
TAMURA, M.; KERS, J. A.; COHEN, S. N. Second-site suppression of RNase E essentiality by mutation
of the deaD RNA helicase in Escherichia coli. Journal of Bacteriology, v. 194, n. 8, p. 1919–1926, abr.
2012.
THE WHO GUIDELINES DEVELOPMENT GROUP et al. Core components for effective infection
prevention and control programmes: new WHO evidence-based recommendations. Antimicrobial
Resistance & Infection Control, v. 6, n. 1, p. 6, dez. 2017.
VAN DEN BERGH, B.; FAUVART, M.; MICHIELS, J. Formation, physiology, ecology, evolution and
clinical importance of bacterial persisters. FEMS Microbiology Reviews, v. 41, n. 3, p. 219–251, 1
maio 2017.
WANG, Y. et al. Inactivation of TCA cycle enhances Staphylococcus aureus persister cell formation in
stationary phase. Scientific Reports, v. 8, n. 1, p. 10849, 18 jul. 2018.
WHITEWAY, C. et al. Acinetobacter baumannii. Trends in Microbiology, v. 30, n. 2, p. 199–200, 1 fev.

2022.
WILMAERTS, D. et al. General Mechanisms Leading to Persister Formation and Awakening. Trends in
Genetics, v. 35, n. 6, p. 401–411, jun. 2019.
55
ANEXO I- ARTIGO CIENTÍFICO
56
ANEXO II- ARTIGO CIENTÍFICO
57
ANEXO III- ARTIGO CIENTÍFICO
58
ANEXO IV- ARTIGO CIENTÍFICO
59
60

Dissertação Mariana Leyser RM

Enviado por

Dados do documento

Direitos autorais

Formatos disponíveis

Compartilhar este documento

Compartilhar ou incorporar documento

Opções de compartilhamento

Você considera este documento útil?

Este conteúdo é inapropriado?

Direitos autorais:

Formatos disponíveis

Dissertação Mariana Leyser RM

Enviado por

Direitos autorais:

Formatos disponíveis

ESCOLA DE CIÊNCIAS DA SAÚDE E DA VIDA

PROGRAMA DE PÓS-GRADUAÇÃO EM BIOLOGIA CELULAR E MOLECULAR

INVESTIGAÇÃO DE EXPRESSÃO GÊNICA EM CÉLULAS PERSISTERS DE Acinetobacter

INVESTIGAÇÃO DE EXPRESSÃO GÊNICA EM CÉLULAS PERSISTERS DE

Dissertação apresentada como requisito para

Orientadora: Prof.ª Dr.ª Sílvia Dias de Oliveira

Dissertação apresentada como requisito para

Aprovada em: ___ de _______________ de ________

Ana Paula Guedes Frazzon

Renata Medina da Silva

Gostaria de expressar minha profunda gratidão a todas as pessoas que me apoiaram

Gostaria de agradecer a todas as amizades que o laboratório me proporcionou, além

Acinetobacter baumannii é uma das principais causas de infecções relacionadas à

Palavras-chave: Acinetobater baumannii, Persistência, Maquinaria de acoplamento β -

Acinetobacter baumannii is a major cause of healthcare-associated infections, being linked

Keywords: Acinetobater baumannii, Persistence, β-Barrel Assembly Machinery,

Fig. 1. Killing curves of Acinetobacter baumannii ......................................................................... 36

Table 1. Primers used in this study. ................................................................................................ 34

(p)ppGpp- Guanosina pentafosfato

Para o período de 2021-2025, a Agência Nacional de Vigilância Sanitária

1.1. Acinetobacter baumannii

Tendo em vista o cenário atual de saúde pública no Brasil e no mundo, é

Como discutido anteriormente, infecções causadas por A. baumannii são

As infecções causadas por A. baumannii são geralmente tratadas com β-

Novas terapias já têm sido analisadas para o combate de isolados resistentes

1.2. Células persisters

A primeira descrição desse fenótipo foi realizada por Bigger em 1944, em

Este fenótipo tem especial importância no estado de biofilme, visto que é um

Sabe-se que tanto em biofilme quanto em cultivo planctônico a célula

A cascata de sinalização intracelular leva a alterações de metabolismo que

Nosso grupo de pesquisa tem se dedicado a investigar células persisters de A.

A proteína DeaD, também conhecida como CsdA, atua na biogênese da

Existem estudos mostrando também a participação da DEAD-box no

Finalmente, entende-se que DeaD se mostra uma proteína importante na

1.4. Complexo BAM

BAM é um complexo heteropentamérico, composto por 4 lipoproteínas,

BamA possui um β-barril inserido na membrana externa celular e um N-terminal

Devido ao papel essencial de BamA na célula como chaperona de OMPs,

FtsH possui duas principais finalidades em degradar substratos, a primeira

FtsH ainda degrada YfgM, um mediador localizado na membrana interna,

Até recentemente, se acreditava que PpiD possuía somente uma atividade

Além das funções previamente discutidas de YfgM, a heterodimerização com

Também é observada a interação de PpiD com SurA, Skp e outras chaperonas

2.2. Objetivos Específicos

Different profiles of gene expression in persister cells of Acinetobacter

baumannii under planktonic or biofilm cultures

Artigo científico a ser submetido ao periódico Journal of Global Antimicrobial

Fator de impacto: 4.6 (JCR 2022)

baumannii under planktonic or biofilm cultures

Carlos Alexandre Sanchez Ferreira 1,2*, Sílvia Dias de Oliveira 1,2*

6681, 90619-900, Porto Alegre, RS, Brazil

da Saúde e da Vida, Pontifícia Universidade Católica do Rio Grande do Sul,

E-mail addresses: silviadias@pucrs.br, silviadiasoliveira@gmail.com (S. D. Oliveira);

cferreira@pucrs.br, casanchezferreira@gmail.com (C. A. S. Ferreira)

• Heterogeneous gene expression of persister cells in planktonic culture.

• Possibly, distinct pathways are involved in the regulation of persisters in both

planktonic and biofilm cultures.

• Up-regulation of deaD, bamA, bamB, and bamE of persister cells in planktonic

Objectives: Acinetobacter baumannii is a significant cause of healthcare-associated

carbapenems like meropenem are commonly used to treat A. baumannii infections,

therapeutic failures have increased due to the emergence of antimicrobial resistance

population that present a transient phenotype capable of tolerating supra-lethal

concentrations of antibiotics. Thus, we investigated the mRNA levels of the deaD,

exposure to meropenem, both in planktonic and biofilm culture.

Aprovada em: _ de _____ de

Carlos Alexandre Sanchez Ferreira 1,2, Sílvia Dias de Oliveira 1,2