Você está na página 1de 43

Fundamentos terico-prticos e

protocolos de extrao e de
amplificao de dna por meio da tcnica
de reao em cadeia da polimerase
Empresa Brasileira de Pesquisa Agropecuria
Embrapa Pecuria Sudeste
Ministrio da Agricultura, Pecuria e Abastecimento
Fundamentos terico-prticos e
protocolos de extrao e de
amplificao de DNA por meio da
tcnica de reao em cadeia da
polimerase
Embrapa Pecuria Sudeste
So Carlos, SP
2007
Embraa Pecuar|a Sudeste
Podovia Washington Luiz, km 234
Caixa Posta| 339
Fone. (16) 3361-5611
Fax. (16) 3361-5754
Home page. http.\\vvv.cppse.embrapa.br
Endereco e|etrnico. sac@cppse.embrapa.br
Ccm|t de Pub||caes da Un|dade
Presidente. A|berto C. de Campos Bernardi
Secretrio-Executivo. Edison Beno Pott
Membros. Car|os Eduardo Si|va Santos, Maria Cristina Campane||i Brito,
Odo Primavesi, Snia Borges de A|encar
Pevisor de texto. Edison Beno Pott
Norma|izaco bib|iogrIica. Snia Borges de A|encar
Capa. Maria Cristina Campane||i Brito
Editoraco e|etrnica. Maria Cristina Campane||i Brito
Tcdcs cs d|re|tcs reservadcs.
A reproduco no-autorizada desta pub|icaco, no todo ou em parte,
constitui vio|aco dos direitos autorais (Lei no 9.610).
Dadcs Internac|cna|s de Cata|cgac na Pub||cac - CIP
Embraa Pecuar|a Sudeste
Fundamentos teorico-prticos e protoco|os de extraco e de amp|iIicaco
de DNA por meio de reaco em cadeia da po|imerase }recurso
e|etrnicoJ. / Mrcia Cristina de Sena O|iveira }et a|.J So Car|os.
Embrapa Pecuria Sudeste, 2007.
Modo de Acesso.
http.//vvv.cppse.embrapa.br/servicos/pub|icacaogratuita/
e-books/LVFundDNA.pdI
Pub|icaces gratuitas (acesso em _/10/2007)
Disponive| tambem em CD-POM (500 exemp|ares)
ISN: 9?B-B5-B6?64-12-?
1. DNA - Extraco - Po|imerase. 2. DNA Amp|iIicaco
Po|imerase. l. O|iveira, Mrcia C. de Sena. ll. Titu|o.
CDD. 591.8
Embrapa 2007
Autores
Mrcia Cristina de Sena Oliveira
Mdica Veterinria, Dra., Embrapa Pecuria Sudeste, Rod. Washington Luiz, km
234, Caixa Postal 339, CEP: 13560-970, So Carlos, SP.
Endereo eletrnico: marcia@cppse.embrapa.br
Luciana Correia de Almeida Regitano
Mdica Veterinria, Dra., Embrapa Pecuria Sudeste, Rod. Washington Luiz, km
234, Caixa Postal 339, CEP: 13560-970, So Carlos, SP.
Endereo eletrnico: luciana@cppse.embrapa.br
Alexandre Dinnys Roese
Engenheiro Agrnomo, Mestre, Embrapa Trigo, Rod. BR 285, km 294, Caixa
Postal 451 CEP 99001-970 Passo Fundo, RS
Endereo Eletrnico: alex@cnpt.embrapa.br
Denilson Gouva Anthonisen
Bacharel em Qumica, Mestre, Embrapa Clima Temperado, Rod. BR 392, km 78,
9 Distrito, Monte Bonito, Caixa Postal 403 CEP 96001-970 Pelotas, RS
Endereo Eletrnico: denilson@cpact.embrapa.br
Epaminondas do Patrocnio
Bacharel em Qumica, Embrapa Mandioca e Fruticultura, Rua Embrapa, s/n, Caixa
Postal 007 CEP 44380-000 Cruz da Almas, BA
Endereo Eletrnico: epami@cnpmf.embrapa.br
Mrcia Maria Parma
Bacharel em Qumica, Embrapa Meio Ambiente, Rod. SP 340, km 127m5,
Tanaquinho Velho, Caixa Postal 69 CEP 13820-000 Jaguarina, SP
Endereo Eletrnico: mmparma@cnpma.embrapa.br
Sandra Maria Mansur Scagliusi
Biloa, Mestre, Dra., Embrapa Trigo, Rod. BR 285, km 294, Caixa Postal 451 CEP
99001-970 Passo Fundo, RS
Endereo Eletrnico: mansur@cnpt.embrapa.br
Wilston Henrique Belem Timteo
Licenciado em Matemtica, Mestre, Embrapa Milho e Sorgo, Rod. MG 424, km 45,
Caixa Postal 151 CEP 35701-970 Sete Lagoas, MG
Endereo Eletrnico: wilston@cnpms.embrapa.br
Silvia Neto Jardim
Biloga, Dra., Embrapa Milho e Sorgo, Rod. MG 424, km 45, Caixa Postal 151
CEP 35701-970 Sete Lagoas, MG
Endereo Eletrnico: silvia@cnpms.embrapa.br
SUMRIO
1. INTRODUO ......................................................................................................................... 1
2. CARACTERIZAO MOLECULAR DOS CIDOS NUCLICOS ..................................... 2
3. OBTENO DE AMOSTRAS PARA EXTRAO DE DNA............................................... 3
4. CUIDADOS DURANTE E APS A EXTRAO DE DNA.................................................. 4
5. MATERIAL NECESSRIO PARA EXTRAO DE DNA................................................... 4
6. EXTRAO DE DNA DE AMOSTRAS DE TECIDOS DE MAMFEROS.......................... 5
6.1. Material (ver Apndice) ...................................................................................................... 5
6.2. Digesto da amostra ............................................................................................................ 5
6.3. Extrao do DNA com fenol ............................................................................................... 5
6.4. Purificao do DNA por meio de precipitao com etanol................................................. 6
7. PROTOCOLOS EMPREGADOS NA ROTINA DE EXTRAO DE DNA DE
AMOSTRAS DE SANGUE...................................................................................................... 7
7.1. Extrao de DNA de amostras de sangue com a utilizao de colunas de extrao........... 7
7.2. Protocolo de extrao de DNA de sangue mediante precipitao com sal ......................... 8
7.3. Extrao de DNA de amostras congeladas de sangue....................................................... 10
8. PROTOCOLOS EMPREGADOS NA EXTRAO DE DNA DE AMOSTRAS DE
ARTRPODES COM UTILIZAO DE COLUNAS DE PURIFICAO ....................... 11
8.1. Protocolo para extrao de DNA de amostras de carrapatos com colunas de purificao11
8.2. Protocolo de extrao de DNA de ovos de carrapatos com a utilizao de colunas de
purificao........................................................................................................................ 12
9. EXTRAO DE DNA DE AMOSTRAS DE SMEN ........................................................ 13
10. EXTRAO DE DNA DE PLANTAS.................................................................................. 14
11. LEITURA DA CONCENTRAO DE DNA NAS AMOSTRAS ....................................... 16
12. INTRODUO TECNICA DE PCR ................................................................................. 16
13. ESCOLHA DOS PRIMERS OU INICIADORES................................................................... 19
14. PCR MULTIPLEX .............................................................................................................. 20
15. NESTED PCR ........................................................................................................................ 20
16. PCR QUANTITATIVA.......................................................................................................... 21
17. ELETROFORESE DE CIDOS NUCLICOS..................................................................... 21
17.1. Eletroforese em gel de agarose....................................................................................... 22
17.2. Variveis que afetam a migrao do DNA atravs do gel de agarose ........................... 23
18. PROTOCOLO PARA ANLISE DE PRODUTOS DE AMPLIFICAO E
FRAGMENTOS DE DIGESTO EM GEL DE AGAROSE................................................. 25
19. ELETROFORESE EM SISTEMA CAPILAR ....................................................................... 26
20. PROTOCOLO PARA ANLISE DE PRODUTOS DE AMPLIFICAO EM SISTEMA
CAPILAR................................................................................................................................ 28
21. PROTOCOLOS DE AMPLIFICAO DE DNA PARASITRIO...................................... 28
21.1. PCR para Babesia bigemina........................................................................................... 28
21.2. Nested PCR para Babesia bigemina.............................................................................. 29
22. ELETROFORESE EM GEL DE AGAROSE PARA VISUALIZAO DOS PRODUTOS
AMPLIFICADOS.................................................................................................................... 31
23. APNDICE............................................................................................................................. 33
24. REFERNCIAS BIBLIOGRFICAS.................................................................................... 37
25. BIBLIOGRAFIA CONSULTADA......................................................................................... 37
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
1
FUNDAMENTOS TERICO-PRTICOS E PROTOCOLOS DE EXTRAO E DE
AMPLIFICAO DE DNA POR MEIO DA TCNICA DE REAO EM CADEIA DA
POLIMERASE
1
1. INTRODUO
A extrao e a purificao de cidos nuclicos a partir de diversas amostras
experimentais (bactrias, fungos, tecidos vegetais e tecidos animais) uma etapa
fundamental para se obter alta eficincia de amplificao nos protocolos que usam a
reao em cadeia da polimerase (PCR). Essa tcnica tem sido amplamente empregada
em estudos moleculares, em razo da facilidade relativa com que possvel amplificar
in vitro regies especficas do genoma de qualquer organismo. A PCR possibilita a
amplificao de seqncias de DNA que estejam presentes em misturas complexas e
permite estudos de natureza variada, tais como desenvolvimento de mtodos de
diagnstico altamente sensveis e especficos, obteno de grandes quantidades de
DNA para seqenciamento e anlises sobre a diversidade gentica de populaes.
Apesar da facilidade de amplificao de DNA possibilitada pela tcnica de PCR, existe
a necessidade da adequada padronizao dos protocolos a serem utilizados em todas
as fases dos procedimentos, desde a obteno do cido nuclico at a reao de
amplificao propriamente dita. O DNA, em sua forma original de dupla fita, apresenta
alta estabilidade e muito resistente e se mantm inalterado em vrias condies de
meio. No entanto, alguns cuidados so aconselhveis, para que seja evitada a
degradao das amostras obtidas em laboratrio. A extrao de DNA inclui
basicamente dois procedimentos principais: a lise das clulas presentes na amostra e a
purificao do DNA. Aps a lise das clulas, o DNA deve ser separado dos restos
celulares e das protenas, precipitado e suspenso em volume adequado de gua
ultrapura ou solues-tampo adequadas. As amostras de DNA podem tambm ser
submetidas a processos de concentrao e de purificao, com a finalidade de se obter
melhores resultados nas amplificaes. Para cada tipo de amostra, vrios protocolos
podem ser testados, adaptados e otimizados, de maneira a se conseguir DNA de boa
qualidade. Neste manual apresentam-se, de maneira simples, alguns fundamentos da
anlise de DNA.

1
Polimerase chain reaction, PCR.
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
2
2. CARACTERIZAO MOLECULAR DOS CIDOS NUCLICOS
As clulas vivas so capazes de preservar e de transferir a informao gentica
para as novas geraes por meio da complementaridade estrutural das molculas de
cidos nuclicos: o DNA e o RNA. A unidade bsica tanto do DNA como do RNA so
polmeros de subunidades monomricas, denominadas nucleotdeos, que esto
arranjados em seqncia precisa. Em organismos eucariticos (cujas clulas
apresentam-se organizadas com membrana, citoplasma e ncleo), o DNA encontrado
no ncleo das clulas e tambm nas mitocndrias e nos cloroplastos. As molculas de
DNA e de RNA consistem de apenas quatro tipos de nucleotdeos. Os nucleotdeos so
compostos precursores da sntese dos cidos nuclicos que contm um grupo fosfato,
uma pentose (molcula de acar com cinco carbonos) e uma base nitrogenada.
Durante o processo de polimerizao do cido nuclico, a ligao de um nucleotdeo
cadeia em extenso ocorre pela ao nucleoflica de uma hidroxila da pentose (3-OH),
do resduo de nucleotdeo mais externo da cadeia, sobre o fosfato ligado ao carbono
5` da pentose (5`-PO
4
) do nucleotdeo que ser incorporado, resultando na liberao
de um on difosfato. A pentose que compe o RNA sempre a ribose e o DNA, a
desoxirribose. As bases adenina, guanina e citosina so encontradas tanto nas
molculas de DNA como de RNA, enquanto timina aparece exclusivamente nas
molculas de DNA e uracila, nas de RNA. Tanto o DNA quanto o RNA so utilizados na
pesquisa, dependendo, principalmente, do objetivo de cada trabalho.
O DNA apresenta diferentes seqncias de nucleotdeos, que formam diferentes
unidades, conhecidas por genes. O gene definido como o segmento de DNA que
codifica a informao requerida para a produo de determinado polipeptdeo ou de um
segmento de RNA. Formas alternativas dos genes so denominados alelos e a
totalidade do DNA presente na clula chamada de genoma. Os genes esto
organizados em cromossomos e a sua posio no cromossomo denominada lcus.
Na maioria dos organismos, chamados diplides, cada clula contm duas cpias de
cada tipo de cromossomo. Nestes organismos, cada indivduo possui dois alelos para
cada lcus, um originrio da me e outro do pai. Se os dois alelos de um lcus no
podem ser diferenciados pela sua seqncia de nucleotdeos, ele chamado de
homozigoto para o lcus considerado; e, caso contrrio, ele denominado
heterozigoto. O princpio da segregao estabelece que cada clula reprodutiva
originria de indivduos heterozigotos contm apenas um dos dois alelos, enquanto as
demais clulas contm os dois alelos em igual freqncia. Em seu estado nativo, o
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
3
DNA apresenta-se arranjado em dupla hlice, com as fitas das seqncias
complementares ligadas entre si por pontes de hidrognio entre as bases nitrogenadas.
O DNA de todas as bactrias (organismos procariticos) e de muitos vrus so
arranjados de forma circular. O cromossomo da Escherichia coli contm cerca de
0,0044 picogramas de DNA, cerca de 4 x 10
6
pares de bases que codificam cerca de
3.300 protenas diferentes. Os seres humanos apresentam ao redor de trs bilhes de
pares de bases que codificam de 50 a 100 milhares de genes em 24 cromossomos. Os
vrus apresentam quantidade reduzida de informao gentica, quando comparados
aos organismos celulares, porque usam recursos da clula hospedeira para se
reproduzir. Apesar do tamanho relativamente pequeno da informao gentica contida
em bactrias e vrus, o DNA desses organismos precisa ser compactado para que
possa ser contido nessas clulas.
Com base nas caractersticas estruturais dos cidos nuclicos, algumas tcnicas
moleculares so utilizadas na manipulao do DNA dos organismos. A hibridizao a
tcnica que se baseia na complementaridade entre as fitas de DNA. Um fragmento de
DNA marcado por uma substncia radioativa usado como sonda para determinar a
presena da fita complementar em uma amostra especfica. Essa tcnica foi muito
utilizada em testes de diagnstico, porm, atualmente em conseqncia de sua baixa
sensibilidade e de problemas advindos do uso de radioatividade, ela caiu em desuso. A
clivagem outra tcnica que pode facilitar a manipulao do DNA. Para esse fim,
existem as chamadas enzimas de restrio, que so capazes de cortar o DNA em
stios especficos, definidos geralmente pela seqncia de bases distribudas ao longo
da molcula, produzindo fragmentos de comprimento menor. As enzimas de restrio
so sintetizadas naturalmente por muitas bactrias e centenas (com especificidade
para diferentes stios de restrio) esto disponveis comercialmente. Outros tipos de
manipulao de DNA incluem a amplificao (utilizando a tcnica de PCR) e a
eletroforese, que sero apresentados em detalhe.
3. OBTENO DE AMOSTRAS PARA EXTRAO DE DNA
As amostras perecveis devem ser acondicionadas de forma adequada at o
momento de serem submetidas extrao do DNA. Amostras de sangue e de outros
tecidos animais devem ser refrigeradas at chegarem ao laboratrio. Amostras de
tecidos vegetais tambm devem ser cuidadosamente colhidas, armazenadas e
refrigeradas. As partes da planta devem ser lavadas e enxaguadas com gua destilada
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
4
ou submetidas a processo de esterilizao superficial, de acordo com o objetivo dos
estudos a serem realizados. Para melhor conservao, as amostras devem ser
mantidas em temperatura de 20C a 80C, dependendo do tempo de
armazenamento. Para utilizao de amostras conservadas em estoque, interessante
o fracionamento em pequenas alquotas, para que o material no sofra
descongelamentos sucessivos, que poderiam contribuir para a oxidao do tecido e
para a degradao do DNA. O manuseio dessas amostras deve ser feito
preferencialmente com o uso de luvas, para que uma parte dos cidos nuclicos no
sejam degradados por nucleases, enzimas que normalmente esto presentes nos
fluidos corporais liberados principalmente nas mos das pessoas.
4. CUIDADOS DURANTE E APS A EXTRAO DE DNA
Com a finalidade de se obter amostras de DNA adequadas aos protocolos de
amplificao, importante que exista uma sala exclusiva para esse fim. O DNA
apresenta grande afinidade pelo vidro e pode ser adsorvido na presena de alguns
sais; por isso, esse material no deve ser empregado durante o processo de extrao.
Todo o material plstico (polipropileno) utilizado deve ser esterilizado e novo (no deve
ser usado material reciclado), para que as amostras apresentem boa qualidade e para
que se diminuam os riscos de contaminao entre amostras no momento da anlise.
5. MATERIAL NECESSRIO PARA EXTRAO DE DNA
Para executar os protocolos de extrao de DNA, necessrio que o laboratrio
tenha os equipamentos bsicos, o material plstico e todas as solues utilizadas nos
procedimentos. O material mnimo necessrio o seguinte:
a) Centrfuga com rotor para vrios tipos de tubos (ou para o tipo de tubo empregado
no laboratrio). aconselhvel que a centrfuga tenha controle de refrigerao.
b) Capelas de exausto.
c) Banho-maria com termostato ou com termmetro para aferio da temperatura.
d) Vidraria para preparo das amostras (provetas, pipetas, bastes de vidro).
e) Microtubos de polipropileno.
f) Micropipetas automticas para volumes diversos (com ponteiras).
g) Gelo e nitrognio lquido, quando necessrio.
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
5
6. EXTRAO DE DNA DE AMOSTRAS DE TECIDOS DE MAMFEROS
6.1. Material (ver Apndice)
a) Tampo de digesto 1.
b) Soluo de fenol, clorofrmio e lcool isoamlico (25:24:1); para essa soluo, usar
fenol tamponado.
c) Acetato de amnio 7,5 M.
d) Etanol absoluto.
e) Etanol a 70%.
f) Tampo TE (trisHCl 10 mM, EDTA 1 mM, com pH 8,0; tris =
hidroximetilaminometano).
g) Soluo de dodecilsulfato de sdio (SDS) a 0,1%.
h) Nitrognio lquido.
i) Frascos e bastes esterilizados.
j) Microtubos de polipropileno.
6.2. Digesto da amostra
As amostras de tecidos de origem animal ou vegetal que sero submetidas
extrao de DNA devem sofrer fragmentao e digesto enzimtica das protenas.
Para produzir a fragmentao, as amostras podem ser cortadas, submetidas a
congelamento em nitrognio lquido e rapidamente pulverizadas por processo manual
(utilizando um basto) ou mecnico (utilizando equipamentos para esse fim).
Quantidades da amostra (entre 200 mg e 1 g) so adicionadas a uma soluo-tampo
de digesto (na proporo de 1,2 mL de tampo para cada 100 mg de tecido) e
colocadas em banho-maria em temperatura prxima a 50C, para que ocorra a
digesto. O tempo de incubao pode variar entre oito e dezesseis horas, ou at que a
amostra se apresente totalmente digerida, ou seja, apresente aspecto viscoso.
6.3. Extrao do DNA com fenol
O mtodo mais utilizado para purificao do DNA a extrao com fenol
tamponado, que provoca a desnaturao das protenas de maneira eficiente. O
clorofrmio tambm usado como agente desnaturante das protenas contidas na
amostra. A mistura de fenol e de clorofrmio muito eficiente para desproteinizar e sua
ao se fundamenta na propriedade hidrfoba das protenas que apresentam afinidade
por solventes orgnicos. O lcool isoamlico previne a formao de espuma quando a
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
6
mistura agitada, o que torna mais fcil a separao da fase orgnica e da fase
aquosa. A protena que foi desnaturada pelo tratamento com fenol e clorofrmio forma
uma camada na interface das duas fases, separando-se do DNA que se mantm na
fase aquosa. Para extrair o DNA de uma amostra, usar igual volume de soluo de
fenol, de clorofrmio e de lcool isoamlico (25:24:1). A extrao com o fenol
dependente do pH. O fenol empregado nas extraes de DNA deve ter o pH prximo
de 8,0 (fenol tamponado), j que faixas mais baixas de pH deslocam o DNA para a
interface na hora da centrifugao. Em pH 7,0 ou acima, o DNA permanece na fase
aquosa e em pH abaixo de 7,0, ele desnaturado e migra para a fase orgnica. Nesse
ltimo caso, o RNA permanece na fase aquosa. Metodologia para tamponamento do
fenol est descrita no Apndice. Aps a adio da soluo de extrao, centrifugar a
amostra por dez minutos a 1.700 g e transferir o sobrenadante para um novo tubo.
Cuidado: A manipulao de solues que contm fenol exige cuidado, pelo fato de
serem extremamente custicas, volteis e irritantes para as mucosas.
6.4. Purificao do DNA por meio de precipitao com etanol
A precipitao do DNA feita por meio da utilizao de etanol absoluto
associado a uma soluo com alta concentrao de um sal catinico. O etanol induz a
transio estrutural nas molculas de cido, fazendo-as se agregarem, com
conseqente precipitao. A precipitao com etanol absoluto, alm de concentrar o
DNA, ajuda a remover resduos de fenol e de clorofrmio presentes na amostra. O
etanol a 70% utilizado para remover resduos de sais. Embora tanto o cloreto de
sdio como o acetato de sdio e o acetato de amnio sejam eficazes na precipitao
do DNA, mais difcil remover o cloreto de sdio, em razo da sua menor solubilidade
em etanol.
Procedimento:
Adicionar meio volume de soluo de acetato de amnio 7,5 M e dois volumes
de etanol absoluto. Centrifugar a 1.700 g por cerca de dois minutos (o tempo deve ser
ajustado de acordo com a amostra). Eliminar a soluo alcolica e preservar o pellet de
DNA. Ressuspender o pellet em etanol a 70% (para eliminar impurezas presentes na
amostra), centrifugar novamente a 1.700 g por dois minutos. Descartar o sobrenadante
e deixar secar o pellet de DNA. Ressuspender o DNA em tampo TE (ver item 6.1.f).
Para facilitar a completa dissoluo do DNA nesse tampo, as amostras podem ser
incubadas em agitador a 65C por algumas horas.
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
7
7. PROTOCOLOS EMPREGADOS NA ROTINA DE EXTRAO DE DNA DE
AMOSTRAS DE SANGUE
Existem muitos tipos de protocolos e muitos kits comerciais para a extrao de
DNA que se adaptam a diversos tipos de amostras. Para cada tipo de tecido podem ser
testadas adaptaes, de acordo com as caractersticas de cada espcime a ser
analisado. A extrao de DNA a ser empregada na PCR com fins de diagnstico deve
seguir um protocolo em que a obteno de amostras de alta pureza fundamental. O
volume a ser submetido extrao muito importante, mesmo porque em alguns
procedimentos ele extremamente restrito (amostras podem ser colhidas com swabs
ou de esfregaos de sangue e de cortes histolgicos). A grande dificuldade verificada
em alguns casos que, quando se extrai DNA de uma amostra, existe a mistura de
cidos nuclicos do hospedeiro e de cidos nuclicos de outros microrganismos que
podem estar presentes no tecido. Para exemplificar, a extrao do DNA de sangue de
um bovino, para pesquisa de hemoparasitas, produz a mistura de DNA que contm o
cido nuclico do hospedeiro e o cido nuclico de todos os microrganismos presentes
na amostra de sangue. O genoma de qualquer microrganismo muito menor do que o
de um mamfero e, para que se consiga a amplificao adequada, preciso obter
amostras muito puras. Existem vrios mtodos para extrao de cidos nuclicos que
podem ser usados no estudo de parasitas, no entanto, em razo da pequena
quantidade de DNA algumas vezes presente nesses agentes, necessria a
otimizao do processo. Nos protocolos de extrao de DNA com a finalidade de
amplificao por meio da tcnica de PCR, so usados como anticoagulantes o citrato
de sdio e o cido etilenodiaminotetractico (EDTA). A heparina no indicada como
anticoagulante, por causa da sua propriedade inibitria sobre a PCR. O sangue colhido
com citrato de sdio (ver Apndice) ou com EDTA pode ser armazenado por cerca de
sete dias a 4C ou durante vrios anos a 80C.
7.1. Extrao de DNA de amostras de sangue com a utilizao de colunas de
extrao
Este protocolo foi adaptado para extrao de DNA de amostras de sangue de
bovinos, para o diagnstico da tristeza parasitria dos bovinos, no Laboratrio de
Sanidade Animal da Embrapa Pecuria Sudeste. Vrios kits disponveis no mercado,
por exemplo o GFX

(GE Healthcare), podem ser empregados. A purificao do DNA
feita por meio do uso de uma coluna que contm fragmentos de slica (coluna de
purificao). Inicialmente, o DNA se liga membrana da coluna de extrao e depois
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
8
ele lavado at que apresente alta pureza. No final do protocolo, o DNA eludo com
gua quente ou com tampo TE. A utilizao de kits permite a purificao do DNA nas
amostras de maneira homognea e rpida.
Procedimento:
a) Colocar 300 L de sangue e 900 L de soluo de lise, em microtubo de 1,5 mL.
b) Homogeneizar e centrifugar a 20.800 g por cinco minutos e descartar o
sobrenadante, deixando cerca de 50 L.
c) Homogeneizar a amostra e adicionar 500 L de soluo de extrao.
d) Incubar por cinco minutos, em temperatura ambiente, e transferir o contedo do
microtubo para a coluna de extrao. Acoplar a coluna de extrao ao tubo coletor.
e) Centrifugar a 5.000 g por um minuto; descartar o contedo do tubo coletor.
f) Adicionar coluna 500 L de soluo de extrao e centrifugar a 5.000 g por um
minuto; descartar o contedo do tubo coletor.
g) Adicionar coluna 500 L de soluo de lavagem e centrifugar a 20.800 g por trs
minutos; descartar o contedo do tubo coletor.
h) Transferir a coluna para um microtubo de 1,5 mL, limpo e livre de enzimas que
decomponham o DNA.
i) Adicionar 100 L de gua ultrapura, autoclavada e aquecida a 70C; incubar por um
minuto, em temperatura ambiente, e centrifugar a 5.000 g por um minuto, obtendo-
se assim a soluo de DNA. O DNA pode ser eludo em tampo TE tambm
aquecido a 70C.
7.2. Protocolo de extrao de DNA de sangue mediante precipitao com sal
Este protocolo, adaptado de Olerup & Zetterquist (1992), usado no Laboratrio
de Biotecnologia da Embrapa Pecuria Sudeste e pode ser empregado com volumes
pequenos de sangue.
Solues:
Soluo A (tampo de hemlise) para cada amostra de 25 mL:
a) TrisHCl 1 M, com pH 7,6 (concentrao final de 10 mM) 250 L.
b) MgCl
2
0,5 M (concentrao final de 5 mM) 250 L.
c) NaCl 5 M (concentrao final de 10 mM) 50 L.
d) Completar com gua ultrapura (q.s.p. 25 mL).
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
9
Soluo B (para cada amostra de 500 l):
a) TrisHCl 1 M, com pH 8,0 (concentrao final de 10 mM) 5 L.
b) NaCl 5 M (concentrao final de 100 mM) 10 L.
c) EDTA 0,5 M, com pH 8,0 (concentrao final de 10 mM) 10 L.
d) Dodecilsulfato de sdio a 20% (concentrao final de 0,5%) 12,5 L.
e) Proteinase K (concentrao final de 20 mg/mL) 2,0 L.
f) H
2
O ultrapura 460,5 L.
Para a precipitao do DNA:
a) Etanol absoluto gelado (manter a 5C).
b) Etanol a 70% gelado (manter a 5C).
Obteno de leuccitos:
a) Colher 5 mL de sangue em tubos com anticoagulante EDTA. Acertar os volumes
dos tubos, completando com soluo salina (soluo de cloreto de sdio 0,9 M).
b) Centrifugar durante cinco minutos a 390 g e descartar o plasma, usando pipeta,
com cuidado, para no descartar as clulas brancas (esta etapa opcional).
c) Lisar os glbulos vermelhos com 10 mL (5 mL no tubo de colheita e 5 mL em tubo
de polipropileno com capacidade para 15 mL) da soluo A, e homogeneizar,
misturando bem por inverso ou agitando os tubos no vortex.
d) Centrifugar durante dez minutos a 700 g na temperatura de 4C.
e) Dispensar o sobrenadante. Se o pellet for muito pequeno, centrifugar novamente.
f) Ressuspender o pellet em 5 mL do tampo de hemlise. Para isso, tampar os tubos
com Parafilm

e misturar bem por inverso e, se preciso, usar o vortex. Centrifugar


a 2.000 rpm por dez minutos a 4C.
g) Repetir a lavagem, at obter somente clulas brancas.
h) Ressuspender o pellet em 500 L de tampo de hemlise (soluo A) e passar para
microtubos de 1,5 mL. Centrifugar por um minuto a 16.000 g e descartar o
sobrenadante.
i) O pellet pode ser conservado a 20C ou em temperatura menor, por vrios meses.
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
10
Obteno do DNA:
a) Ressuspender o pellet em 500 L de soluo B e misturar no vortex. Obs.: destruir
bem o pellet antes de incubar.
b) Incubar a 55C, at dissolver o pellet (durante quatro a seis horas ou de um dia
para o outro). De vez em quando, misturar as amostras no vortex, para que o pellet
fique bem dissolvido.
c) Ajustar o volume para 760 L com tampo TE (210 L). Acrescentar 240 L de
NaCl 5 M.
d) Incubar por quinze minutos em gelo.
e) Agitar os tubos por inverso, at formar pequenos cogulos de protena.
Centrifugar por quinze minutos a 16.000 g.
f) Dividir todo o sobrenadante em dois tubos novos (devidamente marcados), 500 L
em cada um.
g) Ligar o banho-maria a 37C. Adicionar 1 mL de etanol absoluto gelado e inverter o
tubo vrias vezes. Centrifugar por quinze minutos a 16.000 g. Descartar o
sobrenadante. Secar com papel (com cuidado).
h) Lavar com 500 L de etanol a 70%, gelado. Revolver o tubo. Centrifugar por cinco
minutos a 16.000 g. Descartar e colocar a secar (temperatura mxima de 40C).
Adicionar 250 L de tampo TE + soluo de enzima que degrada RNA (RNAse
10 g por mL de amostra) e incubar por uma hora a 37C.
7.3. Extrao de DNA de amostras congeladas de sangue
Solues utilizadas (Ver Apndice):
Tampo PBS.
Tampo de lise 1.
Soluo de proteinase K (20 mg/mL).
Soluo de acetato de amnio 10 M.
Etanol absoluto.
Tampo TE, com pH 8,0.
Procedimento:
a) Descongelar a amostra de sangue em temperatura ambiente e adicionar igual
volume de tampo PBS.
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
11
b) Centrifugar a 3.500 g por quinze minutos, a 4C.
c) Remover o sobrenadante e suspender o pellet em 15 mL de tampo de lise (incubar
por cerca de uma hora a 37C).
d) Transferir o lisado para tubos de centrifugao em quantidade que ocupe apenas
1/3 do tubo.
e) Adicionar soluo de proteinase K, de modo a obter a concentrao final de 100
g/mL e misturar.
f) Incubar a 50C por trs horas, misturando algumas vezes.
g) Adicionar igual volume de fenol tamponado. Misture duas fases, invertendo o tubo
vrias vezes.
h) Centrifugar a 5.000 g por quinze minutos.
i) Transferir o sobrenadante para um tubo limpo, com cuidado.
j) Repetir a extrao com fenol, por mais duas vezes.
k) Adicionar fase aquosa dois dcimos de volume de soluo de acetato de amnio
10 M e dois volumes de etanol absoluto.
l) Retirar com uma ala o DNA desidratado, que se apresenta em suspenso na
soluo aquosa, e transferir para outro microtubo ou, ento, centrifugar a 5.000 g
por cinco minutos e descartar o sobrenadante.
m) Deixar evaporar todo o etanol residual.
n) Adicionar 1 mL de tampo TE com pH 8,0 para cada 0,1 mL de clulas extradas.
8. PROTOCOLOS EMPREGADOS NA EXTRAO DE DNA DE AMOSTRAS DE
ARTRPODES COM UTILIZAO DE COLUNAS DE PURIFICAO
A preparao de amostras de artrpodes para extrao de DNA exige boa
digesto de todo o material, por perodo de tempo varivel, que depender
basicamente do peso da amostra. Uma limitao dos kits que possuem a membrana de
slica que as amostras devem apresentar peso limitado capacidade mxima
indicada no manual. Como regra, cerca de 20 mg de tecido de carrapato macerado so
usados para extrao. Outros artrpodes menores podem ser processados inteiros.
8.1. Protocolo para extrao de DNA de amostras de carrapatos com colunas de
purificao
Nesse protocolo foi empregado o kit GFX

(GE Healthcare). Solues que no


esto no kit (ver o Apndice):
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
12
a) Soluo de proteinase K (20 mg/mL).
b) Tampo de digesto 2.
Procedimento:
a) Pesar 20 mg da amostra e colocar em um microtubo de 1,5 mL.
b) Macerar com a ponta cnica de um basto. As amostras podem ser mergulhadas
em pequenas quantidades de nitrognio lquido, para serem congeladas
rapidamente. O congelamento facilita a macerao das amostras, que se tornam
mais quebradias.
c) Adicionar 10 L de tampo lisozima e incubar por quinze minutos em temperatura
ambiente.
d) Adicionar 15 L de soluo de proteinase K e incubar de um dia para o outro, na
temperatura de 56C.
e) Adicionar 500 L de soluo de extrao e incubar por quinze minutos em
temperatura ambiente.
f) Centrifugar a 5.000 g por dois minutos.
g) Recolher o sobrenadante, colocar na coluna de extrao e centrifugar a 5000 g por
um minuto. Descartar o contedo do tubo coletor.
h) Novamente adicionar 500 L de soluo de extrao e incubar por quinze minutos
em temperatura ambiente. Centrifugar a 5.000 g por um minuto. Descartar o
contedo do tubo coletor.
i) Adicionar 500 L de soluo de lavagem e centrifugar novamente a 20.000 g por
cinco minutos. Descartar o tubo coletor e colocar a coluna em um microtubo de 1,5
mL, novo e livre de enzimas que possam atuar sobre DNA e RNA.
j) Para eluio do DNA, adicionar 100 L de gua ultrapura aquecida a 70C, incubar
por um minuto e centrifugar a 5.000 g por um minuto.
8.2. Protocolo de extrao de DNA de ovos de carrapatos com a utilizao de
colunas de purificao
O mesmo protocolo utilizado para extrao de DNA de carrapato foi adaptado
para extrao de DNA de alquotas de ovos de carrapatos (kit GFX

, GE Healthcare).
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
13
Procedimento:
a) Pesar 20 mg da amostra e colocar em um microtubo de 1,5 mL.
b) Macerar com a ponta cnica de um basto. A macerao pode ser feita aps
congelamento com nitrognio lquido.
c) Adicionar 10 L de tampo de digesto 2 e incubar por quinze minutos em
temperatura ambiente.
d) Adicionar 15 L de proteinase K (20 mg/mL) e incubar por quatro horas na
temperatura de 56C.
e) Adicionar 500 L de soluo de extrao, incubar por quinze minutos em
temperatura ambiente.
f) Centrifugar a 5.000 g por dois minutos.
g) Recolher o sobrenadante, colocar em coluna de extrao e centrifugar a 5.000 g por
um minuto. Descartar o material do tubo coletor.
h) Novamente adicionar 500 L de soluo de extrao e incubar por quinze minutos
em temperatura ambiente. Centrifugar a 5.000 g por um minuto.
i) Adicionar a soluo de lavagem e centrifugar a 20.000 g por trs minutos (16.000
rpm).
j) Transferir a coluna para um tubo limpo de 1,5 mL e colocar 100 L de gua a 70C
(ou tampo TE). Aps um minuto, centrifugar o tubo com a coluna a 5.000 g por um
minuto.
9. EXTRAO DE DNA DE AMOSTRAS DE SMEN
Solues utilizadas (ver Apndice):
Tampo PBS.
Tampo de lise 2.
Procedimento:
a) Descongelar uma palheta de smen (cerca de 0,54 mL) e colocar em um microtubo
de 1,5 mL.
b) Centrifugar durante oito minutos a 16.000 g.
c) Lavar o pellet quatro vezes em 1 mL de tampo PBS (a cada lavagem passar no
vortex e centrifugar novamente).
d) Ressuspender em 100 L de tampo PBS (nesta fase, a amostra pode ser
armazenada no freezer).
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
14
e) Adicionar 400 L de tampo de lise 2 e incubar por trinta minutos a 50C para
dissolver o pellet.
f) Adicionar soluo de proteinase K a 200 g/mL (100 g = 5 L da soluo de
estoque de 20 mg/mL). Agitar no vortex at dissolver. Incubar por dezesseis horas
a 50C.
g) Dividir as amostras em dois tubos, colocando 250 L em cada tubo.
h) Adicionar 80 L de NaCl 5 M por tubo. Agitar vigorosamente por inverso.
Centrifugar a 16.000 g por cinco minutos.
i) Transferir o sobrenadante para tubos limpos. Acrescentar 1 mL de etanol absoluto a
cada tubo e agitar por inverso. Centrifugar a 16.000 g por cinco minutos.
j) Desprezar o sobrenadante. Acrescentar 100 L de etanol a 70% a cada tubo (no
agitar no vortex).
k) Centrifugar a 16.000 g por cinco minutos. Desprezar o sobrenadante. Secar o pellet
e suspender em 100 L de tampo TE + enzima que atue sobre RNA (10 g/mL de
amostra).
l) Incubar por uma hora em temperatura ambiente.
10. EXTRAO DE DNA DE PLANTAS
A extrao de DNA de plantas envolve a lise das clulas vegetais por meio do
tratamento com detergente e posterior separao e precipitao do DNA. A
preparao do DNA das plantas pela tcnica de centrifugao em gradiente de cloreto
de csio produz DNA de alta pureza. Outro protocolo que tem sido largamente utilizado
por sua facilidade e rapidez aquele que usa o detergente CTAB (brometo de
cetiltrimetilamnio), que libera o DNA celular e se complexa a ele. Posteriormente, o
DNA separado por meio do tratamento com isopropanol e etanol. Este protocolo pode
ser adaptado de vrias maneiras, para diversos tipos e para vrias quantidades de
amostra.
Protocolo que emprega o detergente CTAB:
Solues (ver Apndice):
a) soluo-tampo de extrao vegetal.
b) Soluo de clorofrmio e lcool isoamlico a 24:1.
c) Isopropanol.
d) Etanol a 95%.
e) Tampo TE.
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
15
Procedimento:
a) Pesar 300 mg do tecido vegetal (a quantidade de tecido vegetal pode chegar a at
3 g).
b) Macerar com auxlio de nitrognio lquido, at que a amostra esteja pulverizada.
c) Colocar a amostra em microtubo de 2 mL e adicionar 700 L de soluo-tampo de
extrao vegetal e homogeneizar durante dez minutos por inverso.
d) Incubar as amostras em banho-maria a 65C por uma hora, homogeneizando
algumas vezes.
e) Retirar do banho-maria e deixar a temperatura da amostra se igualar temperatura
ambiente.
f) Adicionar 700 L de soluo de clorofrmio e de lcool isoamlico (24:1), e
homogeneizar suavemente.
g) Centrifugar a 5.000 g por dez minutos em temperatura ambiente, para separar a
fase orgnica e a fase aquosa.
h) Remover a fase aquosa (superior) para um novo microtubo, evitando tocar a
interface com a ponta da ponteira.
i) Repetir a extrao com soluo de clorofrmio e lcool isoamlico (24:1) mais uma
ou duas vezes, considerando que maior nmero de extraes pode purificar mais o
DNA, porm com alguma perda.
j) Aps a remoo final do sobrenadante, adicionar 450 L de isopropanol (gelado),
equivalente a aproximadamente 2/3 do volume coletado. Homogeneizar
suavemente.
k) Manter a 20C por dois minutos (para evitar a precipitao de polissacardeos).
l) Centrifugar a 8.600 g por dez minutos.
m) Descartar o sobrenadante.
n) Lavar o pellet uma vez com etanol a 70%.
o) Lavar novamente o pellet com etanol a 95%.
p) Deixar secar por uma hora.
q) Ressuspender em 50 a 100 L de tampo TE (pode-se adicionar RNAse na
concentrao final de 10 g/mL de amostra).
r) Incubar a 37C por uma hora.
s) Manter a 20C.
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
16
11. LEITURA DA CONCENTRAO DE DNA NAS AMOSTRAS
Todas as amostras de DNA obtidas no laboratrio podem ser avaliadas quanto
sua concentrao e sua pureza por meio da anlise da densidade ptica (DO) em
espectrofotmetro. O DNA absorve luz no comprimento de onda de 260 nm e as
protenas, de 280 nm. Diluies das amostras de DNA so preparadas com gua
ultrapura. Pequenas alquotas de 10 L (diluio 1:50) ou 5 L (diluio 1:100) so
misturadas com 490 ou 495 L de gua ultrapura, e lidas em espectrofotmetro, nos
comprimentos de onda citados. Para estimar a concentrao de DNA, utiliza-se a
seguinte relao: 1 DO
260
= 50 g de DNA de dupla hlice. A concentrao de DNA na
amostra pode ser obtida pelo seguinte clculo:
Concentrao de DNA = leitura da DO
260
x 50 x fator de diluio usado na leitura.
A relao entre a quantidade de DNA e de protena usada como parmetro
para avaliao da qualidade do DNA extrado e, desse modo, a relao DO
260
/DO
280
pode ser usada para esse fim. Amostras cujos valores dessa relao so inferiores a
1,8 apresentam contaminao com protenas.
O DNA pode ser quantificado e analisado quanto sua qualidade, por meio da
anlise em gel de agarose. Para esse fim, um gel de agarose entre 0,8% e 1%
preparado e, com as amostras de DNA, aplicada tambm uma amostra cuja
concentrao conhecida. O DNA do bacterifago Lambda em concentraes
conhecidas de 20, 50, 100 e 200 ng/L geralmente utilizado. Aps a eletroforese, o
gel corado com brometo de etdio, visualizado em luz ultravioleta, e as amostras so
comparadas aos padres, determinando-se dessa maneira as concentraes
aproximadas de DNA em cada amostra.
12. INTRODUO TECNICA DE PCR
A PCR apresenta ampla gama de aplicaes em vrios ramos da pesquisa
cientfica. Essa reao possibilita que determinada regio do genoma de qualquer
organismo seja multiplicada em milhes de cpias, o que facilita a anlise gentica e
permite o desenvolvimento de tcnicas de diagnstico muito mais sensveis e mais
especficas do que as tradicionalmente utilizadas. A alta sensibilidade, a especificidade,
a facilidade de execuo e a anlise de grande nmero de amostras simultaneamente
fazem dessa tcnica uma opo atrativa para estudos epidemiolgicos e para
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
17
caracterizao de microrganismos causadores de doenas. Para que se possa
amplificar dado segmento de DNA, necessrio que as partes finais da seqncia
sejam conhecidas. Os elementos envolvidos nessa reao so basicamente os
mesmos componentes do processo de replicao que ocorre nas clulas vivas. A
soluo em que ocorre a reao (master mix), preparada em banho de gelo e
colocada em microtubos de plstico esterilizados.
So componentes da PCR:
a) Amostra de DNA que contm o segmento a ser amplificado (DNA extrado de
amostras de sangue, de culturas de microrganismos, de espcimes clnicos, de
plantas, etc.)
b) Mistura que contenha os nucleotdeos (dNTPs: dATPs, dTTPs, dCTPs e dGTPs)
necessrios para a sntese das novas fitas de DNA.
c) Enzima DNA-polimerase, que responsvel pela sntese das novas fitas de DNA
(Taq-DNA-polimerase) em soluo-tampo.
d) Cloreto de magnsio, co-fator da reao.
e) Dois iniciadores ou primers, que so pequenas seqncias conhecidas de DNA
(oligonucleotdeos), que delimitam e so complementares regio-alvo de
amplificao. Os primers so sintetizados em laboratrios especializados, sob
encomenda, e aps a sua diluio so mantidos a 20C.
A PCR pode ser feita em tubos de 0,5 L ou de 0,2 L ou em placas,
empregando-se volume total de 25 L, sendo 20 L de master mix e 5 L da amostra
de DNA a ser analisada. Outras variaes de volume tm sido utilizadas em diferentes
trabalhos cientficos, como 10 L de master mix e 2,5 L de DNA. O volume das
reaes pode ser reduzido, desde que as concentraes adequadas de todos os
componentes da reao sejam mantidas:
a) 14,7 L de gua ultrapura esterilizada.
b) 2,5 L de tampo 10 X concentrado (trisHCl 10 mM, KCl 500 mM, MgCl
2
15 mM).
c) 0,25 L de soluo 20 mM de nucleotdeos (dNTPs).
d) 1,0 L de primer (10 M) sense.
e) 1,0 L de primer (10 M) antisense.
f) 0,3 L de Taq-DNA-polimerase (5 U/L).
A gua a ser empregada no master mix deve ser a ultrapura, que apresenta
baixa condutividade eltrica. O tampo 10 X, utilizado para o preparo do master mix,
comprado com a Taq-DNA-polimerase. Algumas marcas comerciais de polimerases
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
18
trazem o tampo 10 X j adicionado de cloreto de magnsio, outras trazem essa
soluo separada. Nesses casos, a soluo deve ser adicionada ao master mix logo
aps o tampo 10 X e o volume total deve ser ajustado com gua. O on magnsio no
pode faltar no master mix, porque ele essencial para a ao da enzima DNA-
polimerase.
Para que ocorra a amplificao, com a sntese de novas fitas de DNA, as
amostras devem ser submetidas combinao adequada de temperatura e de tempo.
Cada ciclo da PCR apresenta trs fases fundamentais, que so: desnaturao,
anelamento e extenso. Essas fases ocorrem em temperatura diferente e so
programadas no aparelho chamado termociclador, onde as amostras so incubadas.
Na hora de preparar o programa para a amplificao, devem estar estabelecidos a
temperatura e o tempo exato de cada uma dessas fases e tambm o nmero de
repeties dos ciclos:
a) Desnaturao: a fase na qual o DNA perde sua estrutura de dupla hlice, por
meio da elevao da temperatura, para cerca de 94C a 95C. A desnaturao
permite que os primers se liguem regio complementar sua seqncia na
amostra de DNA. Desnaturao mais longa (hot start) no primeiro ciclo pode ser
utilizada com a finalidade de otimizar essa fase, permitindo o melhor anelamento
dos primers. O DNA genmico permanece desnaturado por todos os ciclos
subseqentes, porque as fitas complementares esto em concentraes muito
baixas, o que impede a sua reunio. Os oligonucleotdeos ou primers, por sua vez,
esto em concentraes muito altas no master mix, fato que facilita o encontro das
regies complementares (anelamento).
b) Anelamento. Uma vez desnaturado o DNA, a temperatura da reao reduzida (a
temperatura de anelamento sempre especfica para cada par de primers). Dessa
forma, cada primer se encaixa nas respectivas seqncias complementares
regio-alvo da amplificao. A determinao da temperatura de anelamento para
um par ou conjunto de primers pode ser feita com o auxlio de programas de
computador especficos para essa finalidade. A temperatura de anelamento
depende, entre outros fatores, do tamanho do primer e de sua seqncia de
nucleotdeos.
c) Extenso. A temperatura elevada at cerca de 72C, para que a enzima DNA-
polimerase (Taq-DNA-polimerase) se posicione junto aos primers que se anelaram
anteriormente e, com o auxlio do magnsio, seja iniciada a sntese da nova fita. A
sntese da nova fita de DNA se inicia a partir dos primers ou iniciadores. A sntese
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
19
se d por meio da utilizao dos nucleotdeos (dNTPs) que foram adicionados ao
tampo e que so sempre complementares fita-molde. Dessa maneira, so
formadas novas fitas de DNA de dupla hlice, correspondente a regio-alvo de
amplificao (delimitada pelos primers).
Aps o trmino de um ciclo (desnaturao, anelamento e extenso), todo o
processo repetido vrias vezes (40 vezes, em mdia), at que se obtenha grande
quantidade do DNA a ser amplificado. A cada ciclo de amplificao, o nmero de
cpias da seqncia-alvo duplicado e, com a evoluo dos ciclos da reao, ocorre
aumento exponencial do nmero dessas seqncias. O aumento do nmero de ciclos
no aconselhado, em decorrncia da reduo da especificidade da reao.
13. ESCOLHA DOS PRIMERS OU INICIADORES
Algumas tcnicas podem ser utilizadas para o desenvolvimento de primers ou
seqncias iniciadoras de PCR. Para fins de diagnstico, a seqncia do gene rDNA
rotineiramente utilizada, em razo da sua disponibilidade para grande nmero de
protozorios e outros parasitas. Os iniciadores podem ser designados a partir dessas
seqncias, porm, em virtude da grande conservao observada nesses genes,
reaes cruzadas com outros organismos que no so alvo de interesse podem
ocorrer. Um mtodo alternativo a construo de bibliotecas de DNA genmico, em
que certas regies do genoma do microrganismo obtidas por meio da digesto
enzimtica so amplificadas por PCR e seqenciadas. Esse mtodo caro, e demanda
tempo e grande quantidade de DNA, que pode ser difcil de se obter, dependendo do
microrganismo em questo. O uso da tcnica de amplificao de DNA ao acaso
(RAPD) tem sido uma opo simples a ser utilizada. Essa tcnica detecta
polimorfismos em seqncias de nucleotdeos de diferentes organismos isolados, sem
a necessidade de informao prvia sobre a seqncia analisada. Como uma tcnica
baseada em PCR, pequenas quantidades de DNA so suficientes para a anlise.
Muitos dos produtos gerados pela RAPDPCR so derivados de seqncias repetitivas
do DNA, portanto espcie-especficas e dessa maneira adequados para o
delineamento de tcnicas de diagnstico. As bandas de DNA geradas por RAPDPCR
podem ser eludas do gel e seqenciadas, para que seqncias que tenham potencial
de uso como primers sejam selecionadas, analisadas e sintetizadas, com base nos
parmetros de especificidade e de anelamento com a seqncia-alvo.
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
20
14. PCR MULTIPLEX
A tcnica de multiplex foi desenvolvida com a finalidade de, com um nico
teste, altamente especfico, promover a diferenciao entre vrias espcies ou entre
vrios gneros simultaneamente. Essa forma de PCR envolve a amplificao
simultnea de mais de uma seqncia-alvo por reao, pela mistura de vrios pares de
primers. Essa tcnica especialmente til para anlise de amostras que contenham
parasitas cuja distino morfolgica difcil ou que se apresentem em nmero muito
baixo. Desse modo, primers altamente especficos so usados para amplificar
seqncias conhecidas do DNA, produzindo padres nicos para cada espcie. Essa
tcnica tambm pode ser utilizada em anlises genmicas.
15. NESTED PCR
A PCR possibilita a amplificao de seqncias especficas contidas em uma
mistura complexa de DNA. Pode-se utilizar primers para amplificar um nico lcus de
um genoma inteiro. A partir de uma nica cpia do DNA contida na amostra, possvel
produzir rapidamente cerca de um bilho de cpias de produtos de PCR. No entanto, a
capacidade de amplificar todas essas cpias aumenta a possibilidade de amplificao
de DNA que no seja o desejado. A especificidade da reao determinada pela
especificidade dos primers. Por exemplo, se os primers usados se ligam a mais de um
lcus, mais segmentos de DNA podem ser amplificados. Para contornar esses
problemas, primers internos (nested) so desenhados e empregados para testar a
especificidade (o segmento de PCR que foi amplificado era realmente o que se
desejava amplificar?). Nessa reao ou sucesso de reaes, dois pares de primers
amplificam uma regio conhecida do genoma de um organismo qualquer. O primeiro
par de primers amplifica determinada regio com nmero conhecido de pares de
bases. O segundo par nested primers se liga a regio dentro do primeiro produto
produzindo um segundo produto de PCR que ser menor do que o primeiro. Dessa
maneira, se o primeiro lcus a ser amplificado no for a seqncia esperada, a
probabilidade de o segundo par de primers funcionar muito baixa. Essas reaes
tambm servem para aumentar a sensibilidade das reaes em cadeia, j que a
segunda reao (nested PCR) pode aumentar em cerca de 100 vezes a sensibilidade
das reaes. Elas tm sido muito usadas para o diagnstico de microrganismos em
amostras de DNA extradas de espcimes clnicos diversos.
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
21
No teste de PCR para diagnstico de Babesia bigemina, a sensibilidade
estimada para as reaes foi de 6 x 10
3
eritrcitos parasitados em 18 x 10
6
eritrcitos,
que corresponde parasitemia de 0,00003%. Na nested PCR, a sensibilidade
estimada foi de 0,0000003%.
16. PCR QUANTITATIVA
A anlise quantitativa por meio do estudo cintico da PCR pode ser feita
adicionando-se um corante fluorescente reao. Com isso, conforme a reao
progride, a amplificao produz quantidades crescentes de DNA de dupla fita, que se
liga ao corante, resultando em aumento da fluorescncia. Se for colocado em um
grfico o aumento da fluorescncia em relao ao nmero de ciclos, pode-se obter o
panorama completo da PCR, inclusive a quantidade inicial do DNA-alvo. Vrios
equipamentos que realizam esse tipo de anlise esto disponveis comercialmente. As
reaes quantitativas so muito utilizadas na determinao da expresso de genes
especficos e tambm em tcnicas de diagnstico, em que se pretende saber a
quantidade inicial de DNA presente na amostra.
17. ELETROFORESE DE CIDOS NUCLICOS
Eletroforese um mtodo simples e muito eficiente para separar, para identificar
e para purificar fragmentos de DNA e de protenas. Ela consiste na separao de
molculas ionizadas (aminocidos, peptdeos, protenas incluindo lipoprotenas e
glicoprotenas , nucleotdeos, cidos carboxlicos e outras substncias de relevncia
biolgica), de acordo com sua carga eltrica e seu peso molecular. Molculas com
carga negativa migram para o plo positivo (nodo) e molculas com carga positiva
migram para o plo negativo (ctodo).
Para haver migrao, preciso desequilibrar eletricamente duas regies
extremas de um meio que contenha eletrlitos, no qual esteja dissolvida ou dispersa
uma substncia com potencial para migrar. Para tanto, estabelecida a diferena de
potencial entre dois eletrodos ligados aos terminais de uma fonte de corrente contnua
e dispostos em dois compartimentos, catdico e andico; ambos os compartimentos
contm, em geral, uma soluo-tampo. O meio fsico de separao, igualmente
tamponado, se comunica atravs de suas extremidades com as solues-tampo dos
eletrodos, fechando assim o circuito eltrico. A corrente eltrica, ao passar pelo meio,
conduzida pelos pequenos ons presentes na soluo, d ensejo ao deslocamento, por
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
22
exemplo, de partculas proticas carregadas para determinado plo. Pelo fato de as
protenas serem substncias anfteras, ou seja, capazes de adquirirem carga positiva
ou negativa de acordo com o pH, indispensvel manter constante o pH do meio
durante a eletroforese, por meio do uso de solues-tampo.
Os cidos nuclicos, por possurem carga total negativa (em decorrncia do
grupamento fosfato), migram sempre em direo ao polo positivo (nodo).
O sistema tampo usado consiste em duas partes: o tampo usado na
preparao do gel e o tampo da cuba eletroltica, na qual se encontram os eletrodos
(nodo e ctodo). Nos tampes das cubas e do gel, a corrente eltrica conduzida por
ons, e nos eletrodos, por eltrons. Na presena de um sistema tampo adequado, a
hidrlise da gua, que se d na superfcie dos eletrodos, permite a troca entre eltrons
e ons. O sistema tampo pode ser contnuo (o mesmo tampo utilizado no gel e nos
eletrodos) ou descontnuo (quando diferentes composies ou concentraes de
tampo so utilizadas no gel e nos eletrodos).
O principal fator a ser considerado na escolha do tampo a sua capacidade de
tamponamento. Os dois tampes mais usados na separao eletrofortica de
molculas de DNA so TAE (tampo tris-acetato-EDTA) e TBE (tampo tris-borato-
EDTA). Esses dois tampes possuem efeito ligeiramente diferente na mobilidade do
DNA. Apesar de o TAE ser mais utilizado, ele mais facilmente exaurido durante
reaes longas ou com alta voltagem. O TBE tem melhor capacidade tamponante, mas
deve ser evitado para purificao de DNA de gis.
A eletroforese pode ser conduzida em soluo com gradiente de densidade ou
em diferentes meios de suporte, tais como papel-filtro, slica-gel, membranas de
acetato de celulose, gel de agarose, amido ou poliacrilamida. O suporte deve ser
qumica e fisicamente inerte, de modo a no interferir na mobilidade das molculas.
Em relao aos gis de agarose ou poliacrilamida, a porosidade do gel
determina o poder de resoluo das bandas e este geralmente decorrente do grau de
polimerizao entre os monmeros.
17.1. Eletroforese em gel de agarose
Quanto ao gel de agarose, o protocolo pode ser dividido em trs estgios:
a) O gel preparado com agarose na concentrao adequada ao tamanho dos
fragmentos de DNA a serem separados.
b) As amostras de DNA so aplicadas nos pocinhos do gel. A voltagem e o tempo so
estabelecidos de modo a propiciar a separao ideal das amostras.
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
23
c) O gel corado e, se o brometo de etdio tiver sido incorporado, as seqncias de
DNA sero visualizadas na presena de luz ultravioleta.
17.2. Variveis que afetam a migrao do DNA atravs do gel de agarose
17.2.1. Concentrao de agarose
Molculas de DNA de fita dupla linear migram atravs da matriz de gel taxa
inversamente proporcional ao logaritmo (base 10) do seu peso molecular. O peso
molecular do fragmento de interesse pode ser determinado por meio da comparao
entre a sua mobilidade e a mobilidade de padres de DNA de peso molecular
conhecido. Essa a caracterstica mais importante da eletroforese em gel de agarose.
Ela propicia a caracterizao dos fragmentos de DNA por tamanho reprodutvel e de
forma acurada.
A concentrao de agarose participa de modo importante na separao
eletrofortica, porque ela que determina a faixa de tamanho das molculas de DNA
que podem ser separadas. As relaes entre concentrao de agarose e resoluo de
molculas lineares de DNA so apresentadas na Tabela 1.
Tabela 1. Limites de eficincia da separao de DNA em diferentes concentraes de
agarose.
Concentrao de agarose no gel (%) Separao de molculas de DNA (Kb).
Limites de eficincia
0,3 60 5,0
0,6 20 1,0
0,7 10 0,8
0,9 7 0,5
1,2 6 0,4
1,5 4 0,2
2,0 0,1
Fonte: Maniatis et al. (1982).
17.2.2. Conformao do DNA
Molculas de DNA de mesmo peso, mas com conformao diferente, possuem
taxas de migrao diferente. Na ausncia de brometo de etdio, molculas de DNA
circulares superenoveladas, como o dos plasmdios, migram mais rapidamente do que
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
24
molculas lineares de mesmo peso molecular. O superenovelamento faz com que as
molculas tenham mais facilidade para migrar atravs da matriz de gel.
O corante brometo de etdio comumente adicionado ao gel ou ao tampo de
reao, mas pode tambm ser adicionado em uma soluo para corar o gel aps a
eletroforese. O corante reduz a mobilidade dos dplices lineares e tem efeito
pronunciado na mobilidade de molculas de DNA circulares fechadas. Com o aumento
da concentrao de brometo de etdio, os superenovelamentos negativos so
gradualmente removidos, causando a diminuio na mobilidade do DNA. Isso ocorre
at a concentrao crtica de corante livre, na qual no h mais superenovelamento,
geralmente entre 0,1 e 0,5 g/mL. A partir desse ponto, a adio de brometo de etdio
acarreta a formao de superenovelamento positivo, causando aumento na mobilidade
das molculas. Quando na reao existe gel com diferentes concentraes de brometo,
as molculas de DNA circulares fechadas podem ser facilmente distinguidas dos seus
topoismeros.
O brometo de etdio usado comumente para visualizao direta do DNA nos
gis. O corante intercalado entre as bases empilhadas dos cidos nuclicos e emite
fluorescncia vermelho-alaranjada (560 nm) quando iluminado com luz ultravioleta (260
a 360 nm). Isso possibilita que sejam detectadas quantidades muito pequenas de DNA
(menos de 5 ng).
17.2.3. Intensidade de corrente
Em geral, fragmentos de DNA migram atravs do gel taxa de migrao
proporcional voltagem aplicada. O aumento de voltagem faz com que a taxa de
migrao de grandes fragmentos de DNA seja maior do que a de pequenos
fragmentos. Conseqentemente, voltagens maiores so menos efetivas na separao
de grandes fragmentos de DNA. Para separar fragmentos de DNA grandes, o ideal
realizar eletroforese com baixa concentrao de agarose e sob baixa voltagem (~1
V/cm, em 0,5% de agarose).
A intensidade da corrente eltrica (i), a resistncia do meio migrao (R) e a
diferena de potencial (ddp) ou a voltagem (V) so variveis importantes no processo
eletrofortico. A fonte de corrente contnua produz fora eletromotriz, que medida em
volts. A diferena de potencial (em volts) entre os eletrodos, ou melhor, o gradiente de
voltagem do meio (volts/m) o resultado da multiplicao da resistncia (em ohms) do
meio pela intensidade de corrente (em ampres) que flui por esse meio. A potncia P
(em watts) desse sistema o produto da voltagem (volts) e da intensidade de corrente
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
25
(em ampres). Para ocorrer migrao eletrofortica, deve haver compromisso entre a
intensidade de corrente i e a voltagem do meio V. Em resumo:
V = Ri e P = Vi ou Ri
2
.
Outras equaes da eletricidade so de ajuda no entendimento da eletroforese.
Assim, a resistncia de um sistema condutor igual sua resistividade () multiplicada
pela razo 1/S, em que 1 o comprimento do condutor e S a rea da sua seo reta.
Por sua vez, a resistividade funo inversa da condutividade (). Da surge:
V = Ri = li / S.
Esta equao mostra como a condutividade de um meio, funo da concentrao
eletroltica, influencia a ddp (V) de um meio, ou melhor, como influencia o gradiente de
voltagem desse meio ou a intensidade de campo eltrico (E = V/1).
18. PROTOCOLO PARA ANLISE DE PRODUTOS DE AMPLIFICAO E
FRAGMENTOS DE DIGESTO EM GEL DE AGAROSE
Para a anlise dos produtos de PCR em gis de agarose, a concentrao do gel
deve ser escolhida de acordo com o tamanho do produto amplificado (ver Tabela 2).
Gel a 1% 0,3 g de agarose para 30 mL de gel, que deve ser preparado com
tampo trisboratoEDTA 1 X. Para isso, aplicar 5 L de produto de amplificao +
1 L de loading buffer (tampo de corrida).
Gel a 3% 0,9 g de agarose de baixo ponto de fuso para 30 mL de gel, que deve
ser preparado com tampo trisboratoEDTA 1 X. utilizado para analisar o
resultado das digestes com enzimas de restrio. Aplicar todo o produto da
digesto (13 L) + 2,6 L de loading buffer.
Procedimento:
a) Pesar a agarose.
b) Coloc-la em um erlenmayer que contenha o volume necessrio de tampo TBE 1
X.
c) Aquecer no forno de microondas, at iniciar a ebulio (aproximadamente trinta
segundos em potncia mdia para gel de 30 mL). Agitar o frasco e retornar ao forno
de microondas por mais alguns segundos.
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
26
d) Aguardar a reduo da temperatura para aproximadamente 60C e adicionar
brometo de etdio, na quantidade indicada para cada gel. Pode ser necessrio
acrescentar gua destilada, para repor aquela perdida por evaporao.
e) Verter no molde previamente nivelado e colocar os pentes.
f) Aps a solidificao, colocar o gel na cuba de eletroforese e cobrir com tampo TBE
1 X.
g) Aplicar as amostras acrescidas de tampo de corrida e estabelecer a corrente de
acordo com o tamanho do gel.
h) A eletroforese deve ser realizada em TBE 1 X, em voltagem constante, na faixa de
2 a 5 V/cm (considerando a distncia entre os eletrodos). Caso o fundo do gel
esteja muito corado, pode-se lavar o excesso de brometo por submerso em TBE 1
X por cinco a dez minutos.
CUIDADOS
O brometo de etdio um potente agente mutagnico. Usar luvas e mscara
para preparar a soluo de estoque e para manipular os gis.
A luz ultravioleta produz queimaduras severas. Usar mscara e culos de
proteo adequados.
19. ELETROFORESE EM SISTEMA CAPILAR
Durante dcadas, a eletroforese em placas de gel de poliacrilamida ou de
agarose foi intensamente utilizada como uma das ferramentas mais importantes dos
laboratrios de biotecnologia e de bioqumica para a anlise de macromolculas. Nos
ltimos anos, porm, a eletroforese capilar tem apresentado vantagens em relao
tcnica de eletroforese em placas. Para a anlise simultnea de amostras,
instrumentos de eletroforese capilar com arranjo de capilares so os mais utilizados.
Existem aparelhos que possuem desde um nico capilar at 384 capilares,
possibilitando a maximizao do tempo necessrio para as mais diferentes anlises,
desde deteco de resduos de drogas at testes de paternidade.
A separao das macromolculas conduzida em tubos com dimenses de 15
a 100 m de dimetro interno e 36 a 100 cm de comprimento, preenchidos com um
eletrlito. O uso do capilar fornece vantagens sobre as placas de gel, por razes
geomtricas: h elevada relao entre a rea superficial e o volume interno, o que
permite a dissipao eficiente do calor gerado pela corrente eltrica e possibilita a
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
27
aplicao de campos eltricos elevados (100 a 500 V/cm). Isso resulta em separaes
de alta eficincia, em alto poder de resoluo e em reduzido tempo de anlise.
Em geral, um aparelho de eletroforese capilar bsico consiste de uma fonte de
alta tenso, capilares (geralmente de slica fundida), eletrodos (de platina,
normalmente), e um detector apropriado. A fonte de alta tenso aplicada nos
eletrodos de platina situados nos reservatrios com soluo eletroltica apropriada. As
extremidades do capilar so imersas nos reservatrios da soluo, para completar o
contato eltrico. As amostras normalmente so introduzidas no capilar por mtodos
eletrocinticos, nos quais uma diferena de potencial estabelecida entre o capilar e o
recipiente que contm a amostra, durante um tempo predeterminado.
O detector localiza-se em algum ponto do capilar, prximo ao reservatrio de
sada.
A eletroforese capilar em gel utilizada exclusivamente para separao de
macromolculas, tais como oligonucleotdeos, fragmentos de DNA e protenas. Essa
tcnica teve incio com a aplicao nas separaes de DNA por tamanho molecular,
por meio de colunas preenchidas com gel, denominados gis qumicos: um capilar
tratado com um reagente que estabiliza o gel junto parede do capilar, atravs de
ligaes covalentes. Esse mtodo foi descartado, dado o grande nmero de problemas
que surgiram, tais como aparecimento de bolhas (perda de condutividade), introduo
limitada de amostra, reteno de fragmentos com alto peso molecular e degradao do
gel por hidrlise. Tais problemas levaram formulao de novos sistemas e que foram
denominados gis fsicos.
Gis fsicos so matrizes polimricas hidroflicas, dissolvidas em tampo
apropriado, que no so ligados parede do capilar. Assim, eles podem ser
substitudos a cada separao, o que permite o aproveitamento do mesmo capilar por
centenas de vezes, sem perda de eficincia. A uma dada concentrao de polmero, as
fitas polimricas individuais comeam a interagir umas com as outras e formam uma
estrutura em rede dentro do capilar, o que possibilita a separao dos fragmentos de
DNA. A concentrao polimrica tima depende do tamanho do DNA a ser separado.
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
28
20. PROTOCOLO PARA ANLISE DE PRODUTOS DE AMPLIFICAO EM
SISTEMA CAPILAR
Antes da injeo no capilar, as amostras so desnaturadas em presena de
formamida, para evitar que a formao de estruturas secundrias afete a velocidade de
migrao. Um padro com fragmentos de tamanho conhecido aplicado com as
amostras para permitir a estimativa do tamanho dos fragmentos analisados. Esse
protocolo utilizado no equipamento IBI 3100 Avant

(Applied Biosystems).
Procedimento:
a) Preparar a mistura de formamida e o padro interno com fragmentos de tamanho
conhecido: para cada amostra, colocar 8,85 L de formamida Hi-Dy e 0,15 L de
padro (GS 500 ROX).
b) Aplicar esses 9 L de mistura em um poo da placa de corrida.
c) Aplicar 1 L de produto de PCR da sua amostra por poo.
d) Desnaturar as amostras (j na placa de corrida), durante cinco minutos, a 95C.
e) Colocar as amostras imediatamente no gelo aps a desnaturao e manter a por
cinco minutos.
f) Preparar a injeo das amostras no analisador e a obteno dos dados no
computador, com o software Data Collection

(Applied Biosystems).
21. PROTOCOLOS DE AMPLIFICAO DE DNA PARASITRIO
21.1. PCR para Babesia bigemina
a) Separar as amostras de DNA, preparar o banho de gelo para os microtubos e retirar
os reagentes do master mix do congelador. As amostras de DNA no devem ter
contato com os reagentes do master mix.
b) Limpar a bancada com lcool.
c) Lavar as mos e colocar luvas novas.
d) Marcar os microtubos para PCR (microtubo de 0,2 L).
e) Preparo do master mix para PCR:
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
29
1 X X
H
2
O ultrapura
7,1 L ____ L
Tampo 10 X
1,25 L ____ L
MgCl
2 0,375 L ____ L
DNTP (20 mM )
0,125 L ____ L
BiIA (10 M) 0,5 L ____ L
BiIB (10 M) 0,5 L ____ L
Taq (5 U/L) 0,15 L ____ L
f) Distribuir 10 L do master mix por microtubo de 0,2 L (PCR).
g) Adicionar 2,5 L de DNA por tubo com o master mix (em local isolado, para evitar
contaminaes).
h) Preparar o programa no termociclador, indicando as temperaturas de desnaturao,
de anelamento e de extenso, e incubar as amostras, de acordo com o esquema da
Fig. 1.
Fig. 1. Demonstrao esquemtica da programao dos ciclos da PCR com
temperatura (C) e tempo de desnaturao, de anelamento e de extenso.
21.2. Nested PCR para Babesia bigemina
a) Preparar o banho de gelo e retirar os reagentes do master mix do congelador.
b) Limpar a bancada com etanol.
c) Lavar as mos e colocar luvas novas.
95,0 95,0
64,0
72,0 72,0
4,0
1
30 30
30
34 ciclos
4

65,0
6466
30
1
o
ciclo
72,0
30"
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
30
d) Marcar os microtubos para PCR.
e) Preparar o master mix para nested PCR (em tubo de 1,5 mL).
1 X X
H
2
O ultrapura
8,6 L ____ L
Tampo 10 X
1,25 L ____ L
MgCl
2 0,375 L ____ L
DNTP (20 mM )
0,125 L ____ L
BiIAN (10 M) 0,5 L ____ L
BiIBN (10 M) 0,5 L ____ L
Taq (5 U/L) 0,15 L ____ L
f) Distribuir 11,5 L do master mix em cada tubo de PCR.
g) Adicionar 1,0 L da PCR aos tubos com o master mix (em local isolado para evitar
contaminaes).
h) Preparar o programa no termociclador e incubar as amostras, de acordo com o
esquema da Fig. 2.
Fig. 2. Demonstrao esquemtica da programao dos ciclos da PCR com
temperatura (C) e tempo de desnaturao, de anelamento e de extenso.
95,0 95,0
68,0
72,0 72,0
4,0
1
30
30"
30
34 ciclos
4

64,00
00
30
1
o
ciclo
72
30"
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
31
A Tabela 2 mostra a seqncia dos primers de PCR e de nestedPCR de
Babesia bigemina e o tamanho dos produtos amplificados.
Tabela 2. Seqncia dos primers de PCR e de nestedPCR de Babesia bigemina e
tamanho dos produtos amplificados.
Seqncia* Primer Oligonucleotdeos (5' 3') Produto (pb)
BiIA CATCTAATTTCTCTCCATACCCCTCC
PCR BiIB CCTCGGCTTCAACTCTGATGCCAAAG
278
BiIAN CGCAAGCCCAGCACGCCCCGGTGC
Nested PCR)
BiIBN CCGACCTGGATAGGCTGTGTGATG
170
* Seqncia amplifica a regio do fragmento de restrio denominado Spel-Aval de Babesia bigemina.
Fonte: Figueroa et al. (1993).
22. ELETROFORESE EM GEL DE AGAROSE PARA VISUALIZAO DOS
PRODUTOS AMPLIFICADOS
Gel de agarose a 1,5%.
O gel de agarose preparado na concentrao de 1,5% para a visualizao dos
produtos da PCR com aproximadamente 278 e 170 pares de bases.
Procedimento:
a) Pesar 0,45 g de agarose em um erlenmayer.
b) Dissolver em 30 mL de tampo trisboratoEDTA (TBE) 1 X.
c) Aquecer no forno de microondas at iniciar a ebulio (aproximadamente trinta
segundos).
d) Agitar o frasco com cuidado (a agarose em ebulio tem tendncia a transbordar).
e) Retornar ao forno de microondas por mais dois a trs segundos.
f) Aguardar a reduo da temperatura para aproximadamente 60C e adicionar
brometo de etdio (acrescentar 1 L de brometo para cada 10 mL de gel).
g) Verter no molde previamente nivelado e colocar os pentes.
h) Aps a solidificao (o gel se torna opaco), colocar na cuba de eletroforese e cobrir
com tampo TBE 1 X (tambm pode ser utilizado tampo 0,5 X).
i) Aplicar 8 L de amostra acrescidos de 2 L de loading buffer (tampo da amostra).
j) Ligar a fonte e manter a 80 V por cerca de uma hora.
k) Visualiz-lo em transiluminador sob luz ultravioleta (Fig. 3).
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
32
CUIDADOS
O brometo de etdio um potente agente mutagnico. Utilizar luvas e mscara
para preparar a soluo de estoque e para manipular os gis.
No olhar diretamente para a luz ultravioleta.
.
Fig. 3. Eletroforese dos produtos de
amplificao de DNA de Babesia
bigemina pelas tcnicas de PCR (poos
2 e 3) e de nested PCR (poos 4 a 8).
1) Padro de pares de bases; 2) DNA
de sangue de bovino; 3) Controle
positivo de B. bigemina; 4) DNA de
sangue bovino; 5) DNA de carrapato
Rhipicephalus (Boophilus) microplus; 6)
DNA de ovos de R. (B.) microplus; 7)
Controle positivo de B. bigemina; 8)
Controle negativo da reao (gua
ultrapura esterilizada)
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
33
23. APNDICE
Preparo do fenol tamponado:
a) Colocar 250 mL de fenol lquido (ou 250 g de cristais de fenol fundido em banho-
maria a 65C) em um frasco de vidro.
b) Adicionar 0,25 g de 8-hidroxiquinolina (antioxidante).
c) Adicionar 250 mL de trisbase (hidroximetilaminometano) 50 mM.
d) Agitar em temperatura ambiente por cerca de quinze minutos (usar agitador
magntico). Deixar repousar a 4C at a separao das fases. Aspirar a fase
aquosa com cuidado.
e) Adicionar 250 mL de soluo tris HCl 50 mM com pH 8,0 e novamente repetir os
procedimentos dos itens c e d. Verificar o pH da fase fenlica (para isso pode ser
usado o papel indicador) e repetir itens c e d at que o fenol atinja o pH 8,0.
f) Finalmente, recuperar a fase fenlica, adicionar 125 mL de soluo tris HCl 50 mM
com pH 8,0 ou tampo TE (tris HCl 10 mM, EDTA 1mM com pH 8,0) e estocar em
frascos escuros a 4C para uso por at dois meses.
g) Nos protocolos de extrao, utilizar a fase fenlica (amarelada) da soluo de
estoque.
Soluo anticoagulante com cido ctrico:
a) cido ctrico 0,48 g.
b) Citrato de sdio 1,32 g.
c) Glicose 1,47 g.
d) gua ultrapura 100 mL.
e) Usar 3,5 mL para cerca de 20 mL de sangue.
Soluo de estoque TBE (tris borato EDTA) concentrada 10 X:
Tris base
108 g
cido brico 55 g
EDTA 0,5 M, com pH 8,0 40 mL
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
34
Soluo de EDTA (cido etilenodiaminotetractico) 0,5 M (pH 8,0):
a) Dissolver 186,1 g de Na
2
EDTA.2H
2
0 em 700 mL de gua.
b) Ajustar o pH para 8,0 com soluo de NaOH 10 M.
c) Adicionar gua ultrapura, q.s.p. 1000 mL.
d) Esterilizar em autoclave a 121C por quinze minutos.
Observaes:
1) O EDTA um agente quelante que impede a ao de enzimas sobre o DNA.
2) O EDTA insolvel em pH inferior a 8,0; por essa razo, importante ajustar o pH
antes de completar o volume.
Soluo-tampo trisHCl (hidroximetilaminometano cido clordrico) 1 M:
a) Dissolver 121 g de tris base em 800 mL de gua ultrapura.
b) Ajustar o pH com HCl concentrado. Cerca de 70 mL de HCl so necessrios para
pH 7,4; e 42 mL, para pH 8,0.
c) Adicione gua ultrapura at completar 1000 mL.
d) Autoclavar a 121C por quinze minutos.
Obs.: O tris tem a funo de manter constante o pH das solues.
Soluo-tampo TE (tris EDTA):
a) TrisHCl 10 mM, com pH 7,4, 7,5 ou 8,0.
b) EDTA 1mM.
Tampo de corrida da amostra 6 X concentrado (estocar a 4C):
Azul de bromofenol a 0,25% 25 mg
Xileno cianol a 0,25% 25 mg
Soluo aquosa de glicerol a 30% 10 mL
Tampo de lise 1:
TrisHCl, com pH 8,0
10 mM
EDTA, com pH 8,0 10 mM
Dodecilsulfato de sdio (SDS) 0,5%
Soluo de RNAse (adicionar no momento do uso)
20 g/mL
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
35
Tampo de lise 2:
2-mercaptoetanol 2%
TrisHCl, com pH 8,0
10 mM
NaCl 100 mM
EDTA, com pH 8,0 10 mM
SDS 0,5%
Obs.: Preparar no momento do uso.
Soluo-tampo de fosfato (PBS):
KCl 2,7 mM
KH
2
PO
4
1,5 mM
NaCl 137 mM
Na
2
HPO
4
8 mM
pH 7,0
Soluo de proteinase K (20 mg/mL):
Proteinase K 100 mg
TrisHCl 10 mM (pH 7,5)
5 mL
Cloreto de clcio 20 mM
Glicerol 50%
Obs.: Estocar a 20C.
Tampo de digesto 1:
NaCl 100 mM
TrisHCl, com pH 8,0
10 mM
EDTA, com pH 8,0 25 mM
SDS 0,5%
Proteinase K 0,1 mg/mL
Tampo de digesto 2:
TrisHCl
10 mM
EDTA, com pH 8,5 1mM
Triton X-100 5%
Obs.: Estocar a 4C.
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
36
Soluo de RNAse 1 (10 mg/mL):
RNAse 10 mg
TrisHCl, com pH 7,5
10 mM
NaCl 15 mM
Obs.: Estocar a 20C.
Soluo de RNAse 2 (10 mg/mL):
RNAse 10 mg
Acetato de sdio (CH
3
COONa) 0,01 M, com pH 5,2 1 mL
TrisHCl 1 M, com pH 7,4
0,1 mL
Obs.: Estocar a 20C.
Soluo de acetato de sdio 0,01 M:
Acetato de sdio (CH3COONa) 0,082 g
gua ultrapura 100 mL
Soluo de CTAB a 10%:
CTAB (brometo de cetiltrimetilamnio) 10 g
gua ultrapura 100 mL
Soluo de NaCl 5 M:
NaCl 292,25 g
gua ultrapura 1.000 mL
Soluo-tampo para extrao vegetal:
Solues e reagentes Concentrao final Volume (final = 10 mL)
CTAB a 10% 2% 2,0 mL
NaCl 5 M 1,4 M 2,8 mL
TrisHCl 1 M, com pH 8,0
0,1 M 1,0 mL
EDTA 0,5 M 20 mM
400 L
2-mercaptoetanol 0,4%
40 L
Polivinilpirrolidona 1,0% 0,1 g
gua ultrapura 3,76 mL
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
37
24. REFERNCIAS
FIGUEROA, J. V.; CHIEVES, L. P.; JOHNSON, G. S.; BUENING, G. M. Multiplex
polymerase chain reaction based assay for the detection of Babesia bigemina, Babesia
bovis and Anaplasma marginale DNA in bovine blood. Veterinary Parasitology, v. 50,
p. 69-81, 1993.
MANIATIS, T.; FRITSCH, E. F.; SAMBROCK, J. Molecular cloning: a laboratory
manual. New York: Cold Spring Harbor Laboratory, 1982. 545 p.
OLERUP, O.; ZETTERQUIST, H. HLA-DR typing by PCR amplification with sequence-
specific primers (PCR-SSCP) in 2 hours: An alternative to serological DR typing in
clinical practice including donor-recipient matching in cadaveric transplantation. Tissue
Antigens, v. 39, p. 225-235, 1992.
25. BIBLIOGRAFIA CONSULTADA
AUSUBEL, F. M.; BRENT, R.; KINGSTON, R. E.; MOORE, D. D.; SEIDMAN, J. G.;
SMITH, J. A.; STRUHL, K. Current protocols in Molecular Biology. New York: Wiley
& Sons, 1996. 4800 p.
BRAMMER, S. P. Atualizaes em tcnicas celulares e moleculares aplicadas ao
melhoramento gentico vegetal. Passo Fundo: Embrapa Trigo, 2002. 404 p.
DOYLE, J. J.; DOYLE, J. L. A rapid DNA isolation procedure for small quantities of
fresh leaf tissue. Phytochemical Bulletin, v. 191, p. 11-15, 1987.
FERREIRA, M. C.; GRATTAPAGLIA, D. Introduo ao uso de marcadores RAPD e
RFLP na anlise gentica. Braslia: Embrapa, Cenargen, 1995. 220 p.
KWOK, S.; HIGUCHI, R. Avoiding false with PCR. Nature, v. 339, p. 237-8, 1989.
LODISH, H; BALTIMORE, D., BERK, A; ZIPURSKY, S. L; MATSUDAIRA, P;
DARNELL, J. Molecular Cell Biology. New York: Scientific American Books, 1995.
1344 p.
MANIATIS, T.; FRITSCH, E. F.; SAMBROCK, J. Molecular cloning: a laboratory
manual. New York: Cold Spring Harbor Laboratory, 1982. 545 p.
MORGAN, U. M.; THOMPSON, R. C. A. Molecular detection of parasitic protozoa.
Parasitology, v. 117, p. 73-85, 1998.
MULLIS, K.; FALOONA, F. Specific synthesis of DNA in vitro via polymerase catalysed
chain reaction. Methods of Enzymology, v. 55, p. 335-350, 1987.
NELSON, D. L.; COX, M. M. Lehninger princpios de Bioqumica. 3
a
ed. So
Paulo: Sarvier Editora de Livros Mdicos Ltda., 2004. 975 p.
OLIVEIRA, M. C. S.; OLIVEIRA-SEQUEIRA, T. C.; ARAUJO JR., J. P.; AMARANTE, A.
F. T.; OLIVEIRA, H. N. Babesia spp. infection in Boophilus microplus engorged females
and eggs in So Paulo State, Brazil. Veterinary Parasitology, v. 130, p. 61-67, 2005.
Fundamentos terico-prticos e protocolos de extrao e de amplificaode DNA por meio da tcnica de Reao em cadeia
da polimerase
38
SILVA JNIOR, J. G. da. Eletroforese de protenas: guia terico e prtico. Rio de
Janeiro: Intercincia, 2001. 125 p.
WELSH, J.; MCCLELLAND, M. Fingerprinting genomes using PCR with arbitrary
primers. Nucleic Acids Research, v. 18, p. 7213-7218, 1990.
WILLIAMS, J. G. K.; KUBELIK, A. R.; LIVAK, K. J.; RAFALSKI, J. A.; TINGEY, S. V.
DNA polymorphisms amplified by arbitrary are useful as genetic markers. Nucleic
Acids Research, v. 18, p. 6531-6535, 1990.
ZARLENGA, D. S.; CHUTE, M. B.; MARTIN, A.; KAPEL, C. M. O. A multiplex PCR for
unequivocal differentiation of six encapsulated and three non encapsulated genotypes
of Trichinella. International Journal for Parasitology, v. 29, p. 141-149, 1999.
ZARLENGA, D. S.; HIGGINS, J. PCR as a diagnostic and quantitative technique in
veterinary parasitology. Veterinary Parasitology, v. 101, p. 215-230, 2001.
ZARLENGA, D. S.; STRINGFELLOW, F.; NOBARY, M.; LICHTENFELS, J. R. Cloning
and characterization of ribosomal RNA genes from three species of Haemonchus
(Nematoda, Trichostrongyloidea) and identification of PCR primers for rapid
differentation. Experimental Parasitology, v. 78, p. 28-36, 1994.