Você está na página 1de 10

--------------------------------------------------------------------------------------------------------------------------------4 Ficha de Avaliao

----------------------------------------------------------------------------------------------------------------------------------------------------------BIOLOGIA E GEOLOGIA - 11 Ano (Turma C)


Agrupamento de Escolas dos Carvalhos
Ano letivo 2014 / 2015
-----------------------------------------------------------------------------------------------------------------------------------------------------------


A capacidade de errar ligeiramente a verdadeira maravilha do DNA. Sem esse atributo especial, seramos ainda
uma bactria anaerbia e a msica no existiria (...). Errar humano, dizemos, mas a ideia no nos agrada muito, e
mais difcil ainda aceitar o facto de que errar tambm biolgico.
Lewis Thomas.A Medusa e a Lesma, Ed. Nova Fronteira, RJ, 1979
1. Este texto refere-se a uma caracterstica dos seres vivos designada por...
(A) seleo natural.

(B) reproduo diferencial.

(C) mutao.

(D) diferenciao.


2. Ao longo dos tempos tem havido vrias formas de explicar a variabilidade das espcies. Se aceitarmos o Fixismo,
devemos esperar:
(A) Fsseis mais simples nas rochas mais antigas.

(B) Fsseis mais simples nas rochas mais recentes.

(D) Os mesmos tipos de fsseis nas rochas antigas e recentes (C) Fsseis mais complexos nas rochas mais recentes.

3. Em relao teoria da evoluo, segundo ______ a principal fora que promove a evoluo a ______ .
(A)Darwin [...] matriz gentica

(B)Lamarck [...] a necessidade criada pelo ambiente

(C)Darwin [...] mutao

(D)Lamarck [...] reproduo diferencial


4. De acordo com a moderna teoria da evoluo, so considerados fatores de evoluo:
(A) mutao, crossing-over e cruzamento ao acaso.

(C) mitose, segregao cromossmica e seleo natural.

(B) mitose, deriva gentica e fecundao.


(D) mutao, recombinao gnica e seleo natural.

(E) mitose, fecundao e seleo natural.



Experincia de Luria e Delbrck
A experincia de Luria e Delbrck, tambm conhecida por teste de flutuao, foi publicada em 1943 e tornou-se um
marco no estudo dos mecanismos responsveis pelas mutaes nos organismos. Em resultado, Max Delbrck e
Salvador Luria ganharam o prmio Nobel da Medicina em 1969.
Na dcada de 40 do sculo XX, pensava-se que as bactrias eram capazes de alterar o seu DNA em funo das
condies do meio ambiente, mas no existiam evidncias experimentais. Luria e Delbrck implementaram uma
experincia para testar se as mutaes eram:

pr-adaptativas ocorreriam de forma aleatria, antes de as bactrias serem expostas ao agente de seleo;

ps-adaptativas resultariam de presses resultantes do agente de seleo.

Estas duas hipteses encontram-se representadas na figura 1.







Figura 1
Hipteses
levantadas por
Luria e Delbrck.




Luria e Delbrck inocularam bactrias da espcie Escherichia coli em tubos de cultura distintos. Aps o crescimento,
transferiram iguais volumes de cultura celular para placas de Petri contendo agar (meio slido) e repleto de
bacterifagos T1 (vrus que destroem as bactrias).
Luria e Delbrck esperavam que as mutaes que causam resistncia aos bacterifagos fossem causadas pela
exposio aos mesmos, originando uma distribuio semelhante entre as placas de Petri. Os seus resultados
encontram-se representados na figura 2.
Figura 2 Resultados da
experincia de Luria e
Delbrck. Os pontos nas
placas de Petri
correspondem a colnias
de bactrias que foram
capazes de resistir aos
bacterifagos.


5. De acordo com os dados, no incio da experincia Luria e Delbrck defendiam a hiptese ____, pois esperavam
que as mutaes ocorressem ____ da exposio ao agente de seleo.
(A) A () antes

(B) A () em resultado

(C) B () antes

(D) B () em resultado


6. Com base nos resultados da figura 2, possvel verificar que as mutaes ocorreram de forma
(A) aleatria e so pr-adaptativas, pois ocorreram antes do contacto das bactrias com os bacterifagos.
(B) aleatria e so ps-adaptativas, pois ocorreram depois do contacto das bactrias com os bacterifagos.
(C) direcionada e so pr-adaptativas, pois ocorreram antes do contacto das bactrias com os bacterifagos.
(D) direcionada e so ps-adaptativas, pois ocorreram depois do contacto das bactrias com os bacterifagos.

2

7. Relativamente experincia de Luria e Delbrck, possvel afirmar que


(A) nos tubos 2 e 9 os meios de cultura no tinham nutrientes suficientes para a proliferao das bactrias, ao
contrrio do tubo 3.
(B) as possveis mutaes nas bactrias do tubo 4 criaram resistncia aos bacterifagos.
(C) nas bactrias, as mutaes genticas surgem de forma independente do agente de seleo.
(D) a seleo natural apenas pode ser aplicada em seres vivos complexos.

8. De acordo com o sistema de classificao de Whittaker modificado, o critrio que permite colocar a bactria
Escherichia coli inequivocamente no reino Monera
(A) ser unicelular.

(C) possuir parede celular.

(B) ser microconsumidor.

(D) ser constituda por uma clula procaritica.


9. Explica em que medida a experincia de Luria e Delbrck constituiu um forte argumento a favor das ideias de
Darwin, em detrimento das ideias defendidas por Lamarck.

10. O mecanismo de resistncia ao bacterifago T1 est relacionado com uma mutao que ocorre ao nvel de um
gene responsvel pela sntese de uma protena membranar que atua como recetor do vrus e que permite a sua
entrada na bactria.
Explica, numa perspetiva neodarwinista, o aparecimento de novas estirpes de bacterifagos que so capazes de
infetar as bactrias resistentes.

11. A indstria alimentar tem cada vez mais dificuldade em prevenir e erradicar, por exemplo, a contaminao
fngica. Esta dificuldade tem levado progressivamente ao uso de fungicidas. No entanto, aps anos de uso de
fungicidas, constatou-se o aparecimento de fungos resistentes.
Numa perspectiva darwinista, a alterao da resistncia aos fungicidas poderia ser explicada como resultante
(A) da existncia, nos fungos, de genes selecionados pela aplicao continuada de fungicidas.
(B) do surgimento de fungos mutantes resistentes, aps a aplicao continuada de fungicidas.
(C) da necessidade de adaptao individual dos fungos, em resposta aplicao continuada de fungicidas.
(D) da sobrevivncia diferencial dos fungos mais resistentes aplicao continuada de fungicidas.

QUEM SO OS CROCODILOS DO DESERTO DO SAARA?
Actualmente, conhecem-se trs espcies de crocodilos em Africa: Crocodylus niloticus (crocodilo-do-nilo); as outras
duas, Osteolaemus tetraspis (O. tetraspis) e Crocodylus cataphractus (C. cataphractus), habitam florestas e pntanos
das regies oeste e central do continente africano Conforme mapa abaixo.
No passado, Crocodylus niloticus (C. niloticus) ocupava uma rea geogrfica maior, que se estendia ate ao Norte de
Africa e as margens do Mediterrneo.

Nesta zona, abundavam lagos e rios que permitiram o seu desenvolvimento, facto sustentado pelos fsseis
encontrados na regio. Nessa altura, as diferentes regies do Saara eram hmidas, adequadas a fauna afrotropical. A
alterao das condies ambientais conduziu ao aparecimento de uma zona muito rida no Saara Central. Este facto
levou a que a fauna afrotropical se deslocasse para Sul. Contudo, em zonas restritas do Sul da Mauritnia, os
crocodilos-do-nilo sobreviveram at ao presente, constituindo populaes isoladas em lagoas de pequenas
dimenses, vulnerveis a extino. Para identificar as relaes filogenticas existentes entre as populaes isoladas e
as outras populaes de crocodilo-do-nilo, foi feito um estudo comparativo de caractersticas genticas de alguns
exemplares de crocodilos. Foram includos neste estudo outros exemplares de grupos afins, de Africa e de outros
continentes. Foi analisado e sequenciado o DNA mitocondrial
extrado de tecidos de fgado e de musculo, tendo sido
comparadas as sequencias obtidas para um determinado gene,
permitindo reconstruir
as relaes filogenticas
(Fig. 2.)




Figura 2 Relaes filogenticas
entre as espcies estudadas.




12. Classifica como verdadeira (V) ou falsa (F) cada uma das afirmaes seguintes, relativas distribuio geogrfica
das espcies estudadas e s suas relaes filogenticas.
(A) C. niloticus do Egipto filogeneticamente mais relacionado com a sua espcie do Sudo do que com a da Gmbia.
(B) O gnero Osteolaemus filogeneticamente menos relacionado com C. cataphractus do que com C. niloticus.
(C) As populaes de C. niloticus que habitam o Este africano tm sido sujeitas a presses selectivas semelhantes.
(D) A semelhana gentica entre as populaes dos crocodilos da Mauritnia e da Gmbia concordante com a sua
proximidade geogrfica.
(E) Entre as populaes da espcie C. niloticus estudadas no foi verificada divergncia filogentica.
(F) Do ponto de vista filogentico, Crocodylus johnsoni da Austrlia mais diretamente relacionado com C. niloticus
do que com C. cataphractus.
(G) Nas populaes de C. niloticus do Egipto e do Quenia, o DNA mitocondrial estudado apresenta muitas diferenas

13. No estudo efectuado, o estabelecimento de relaes filogenticas actuais foi feito com recurso a _______,
enquanto a determinao da sua distribuio geogrfica passada se fundamentou em argumentos _______.
(A) bioqumicos () anatmicos.

(B) bioqumicos () paleontolgicos.

(C) citolgicos () anatmicos.

(D) citologia () paleontolgicos.


4

14. Os crocodilos do Sul da Mauritnia vivem em populaes isoladas, em condies ambientais adversas. Relaciona
o isolamento dos crocodilos, nas condies referidas, com a possibilidade de extino destas populaes.



Evoluo dos homindeos
A evoluo da nossa espcie ainda
pouco conhecida. Contudo, a partir
dos dados obtidos atravs do estudo
dos fsseis encontrados por todo o
globo e de dados moleculares
possvel

construir

rvores

filogenticas.
Na figura 3 encontra-se uma possvel
relao

filogentica

que

ter

conduzido evoluo da nossa


espcie.


Figura 3 Possvel evoluo dos homindeos.






O DNA mitocondrial de humanos modernos foi comparado com o DNA mitocondrial de chimpanzs
(0 primata filogeneticamente mais prximo) e com amostras recolhidas de vrios Neandertais, um homindeo que
desapareceu da Europa h cerca de 28 000 anos, com resultados que podem ser avaliados na tabela I.

Sequncia de DNA mitocondrial analisado

Tabela I Comparao da sequncia de DNA

Humano moderno
Chimpanz

AATTCCCCGACTGCAATTCACGCACCATCCT
XXXXXXTXATTXXXXXACTGAAAXXXXGXXX

indica que o nucletido de DNA igual ao da

Neandertal 1
Neandertal 2
Neandertal 3

GGXCTTTTATTCXTCCCTGTAAGTATGCTXC
GGXXXXXXATTXATCCCCTGTAAXTATGCTT
XCXXXXXXATTXATCCCCTGTAAXTATGCTT

Organismo

mitocondrial de diferentes organismos. A letra X


sequncia humana.

15. A classificao apresentada para a evoluo dos homindeos :


(A) Racional e filogentica

(B) Racional e natural.

(C) Prtica e natural

(D) Prtica e filogentica

16. A partir da rvore filogentica representada na figura 3, podemos concluir que


(A) os genros Paranthropus e Homo tm origem em ancestrais diferentes.
(B) a espcie mais prxima da nossa o Homo erectus.
(C) o gnero Homo teve origem no gnero Paranthropus.
(D) a divergncia do gnero Australopithecus dos gneros Homo e Paranthropus ocorreu h menos de 3,5 M.a.

17. A explicao mais plausvel para a elevada variabilidade no DNA mitocondrial das populaes humanas dispersas
pelo continente africano o facto de
(A) o homem moderno ter surgido em frica e estar h mais tempo a evoluir neste continente.
(B) o DNA mitocondrial ter uma taxa de mutao superior em frica, quando comparado com outros continentes.
(C) o homem moderno ter surgido em frica e estar h menos tempo a evoluir neste continente.
(D) a seleo natural no operar no DNA mitocondrial dos organismos que habitam o continente africano.

18. Paranthropus aethiopicus, Paranthropus boisei e Homo habilis so designaes de trs espcies que pertencem
famlia Hominidae. Com base nesta nomenclatura, podemos concluir que
(A) P. aethiopicus e P. boisei partilham o mesmo restritivo especfico.
(B) P. boisei e H. habilis partilham a mesma ordem.
(C) P. aethiopicus e H. habilis pertencem ao mesmo gnero.
(D) as trs espcies pertencem a ordens diferentes.

19. Classifica, como verdadeira (V) ou falsa (F), cada uma das afirmaes seguintes tendo como base o estudo
comparativo de DNA mitocondrial (Tabela I).
(A) Existem mais diferenas entre a sequncia de DNA mitocondrial do Homem e do Chimpanz, do que do homem e
do Neandertal 1.
(B) Existem mais diferenas entre as sequncias de DNA mitocondrial dos homens Neandertal 2 e 3, do que do
homem moderno e do chimpanz.
(C) Existem menos diferenas entre as sequncias de DNA mitocondrial dos Neandertais 2 e 3, do que dos
Neandertais 1 e 2.
(D) Com base na semelhana entre as sequncias, os chimpanzs so mais prximos do Neandertal 1 do que dos
humanos modernos.
(E) Se as sequncias de DNA fossem transcritas e traduzidas, a sequncia de aminocidos resultantes seria mais
prxima entre os chimpanzs e o homem moderno do que entre este o Neandertal 1.
(F) O Neandertal 2 e o Neandertal 3 devem partilhar um maior nmero de rgos homlogos do que o Neandertal 1
e o 2.
(G) O RNA resultante da transcrio do DNA mitocondrial humano analisado ter menos nucletidos de uracilos do
que o resultante da transcrio do DNA mitocondrial do chimpanz.
(H) Uma vez que as sequncias de DNA analisadas no so iguais, estes dados contrariam a teoria da evoluo a
partir de um ancestral comum.
6

20. Faz corresponder a cada uma das letras de A a E, que correspondem a afirmaes relativas evoluo da espcie
humana, um dos nmeros romanos da chave. Utiliza cada letra apenas uma vez.
Afirmaes:
(A) Numa populao de homindeos h caractersticas que so transmitidas descendncia e que resultaram de
modificaes que os organismos sofreram para responder s variaes ambientais.
(B) A espcie humana permanece imutvel no tempo desde o momento da sua criao.
(C) Numa populao de homindeos da mesma espcie, os indivduos que apresentam caractersticas mais
vantajosas conseguem adaptar-se de forma mais eficaz s variaes do meio.
(D) O Homo sapiens resulta de mecanismos evolutivos que atuaram ao longo do tempo.
(E) Ao nvel do material gentico ocorrem mutaes que podem promover o aparecimento de novos genes e,
consequentemente, a produo de fentipos que permitem uma melhor adaptao ao meio.
Chave:
1. Darwinismo

2. Fixismo

6. Fixismo e neodarwinismo

3. Fixismo e darwinismo

4. Lamarckismo

5. Neodarwinismo

7. Lamarckismo, darwinismo e neodarwinismo 8. Lamarckismo e neodarwinismo


Os elefantes esto em perigo de extino?
Os elefantes esto muito ameaados (destruio
do habitat e caa pelo marfim. Os elefantes
indianos - Elephas maximus so relativamente
dceis e fceis de domesticar, ao contrrio dos
seus parentes africanos - Loxodonta africana.
Os elefantes africanos so maiores que as
variedades asiticas e tm orelhas mais
desenvolvidas, uma adaptao que permite
libertar calor em condies de altas temperaturas.

Figura 4 Representao das trs hipteses (I, II e III), referentes ao
aparecimento das duas espcies atuais.

21. Relativamente figura, indica em qual dos diagramas, I, II e III se observa:


(A) a. existncia de um ancestral comum s duas espcies atuais de elefantes
(B) alteraes da morfofisiologia dos elefantes com o passar dos anos sem existncia de um ancestral comum
(C) imutabilidade das espcies ao longo do tempo

22. Os diagramas I, II e III correspondem, respectivamente, s teorias:
(A) Darwinismo, Catastrofismo e Fixismo

(B) Lamarckismo, Fixismo e Darwinismo

(C) Fixismo, Lamarckismo e Darwinismo

(D) Fixismo, Lamarckismo e Catastrofismo

(E) Lamarckismo, Fixismo e Catastrofismo

23. Os mecanismos propostos por Lamarck e Darwin explicam o maior desenvolvimento das orelhas dos elefantes
africanos. Classifica como verdadeira (V) ou falsa (F) cada uma das seguintes afirmaes.
(A) Para Darwin os elefantes desenvolveram orelhas maiores atravs da sua utilizao continuada para perder calor.
(B) Os elefantes apresentavam orelhas desenvolvidas porque o seu aumento tinha vantagem na termorregulao dos
elefantes, diria Darwin.
(C) Segundo Lamarck, a alterao do ambiente permitiu uma maior reproduo dos elefantes de orelhas grandes.
(D) Para ambos os autores, Darwin e Lamarck, foram as condies ambientais que determinaram o aumento das
orelhas dos elefantes africanos.
(E) Segundo Darwin, a necessidade transformou os elefantes de orelhas pequenas em elefantes de orelhas grandes.
(F) Lamarck defenderia que as orelhas se desenvolveram nos elefantes como resposta ao esforo de manterem
constante a sua temperatura interna.
(G) Na populao ancestral j haveria diferenas no tamanho das orelhas dos elefantes, segundo Darwin.
(H) Segundo Darwin, para sobreviverem, os elefantes adaptaram-se a um clima muito quente.

24. Relativamente morfologia dos membros anteriores da baleia (A-I), do morcego (B-II) e das barbatanas peitorais
de um peixe (C-III),podemos afirmar que:
(seleciona a opo correta)
(A) A, B e C so homlogas.
(B) A, B e C so anlogas.
(C) A e C so homlogas e B anloga de A.
(D) A e B so homlogas e C anloga de A.

Figura 5

25. Certos argumentos apoiam indiretamente a evoluo dos seres vivos. Utiliza a chave para os identificar:
Chave:
1. Paleontolgicos

2. Anatmicos

3. Bioqumicos

4. Embriolgicos

5. Citolgicos

Argumentos:
(A) A hemoglobina cristaliza diferentemente, conforme a espcie.
(B) O sistema nervoso , fundamentalmente, constitudo da mesma maneira em todos os vertebrados.
(C) O DNA humano combina-se com cerca de 25% de DNA de rato e de cordeiro e s 5 % de peixe.
(D) Os fsseis encontrados nas camadas mais antigas dizem respeito a seres relativamente rudimentares.
(E) O corao dos mamferos inicialmente um tubo em S com duas cavidades, semelhante ao corao dos peixes.
(F) No homem e no chimpanz, as cadeias alfa da hemoglobina so idnticas
(G) Existem atualmente vestgios de membros nos esqueletos de certas cobras.
(H) Numa fase inicial do seu desenvolvimento, todos os vertebrados apresentam cauda que depois no se
desenvolve em alguns grupos.
(I) A sntese proteica idntica nos procariontes atuais.

8

Em 1939, um investigador da indstria farmacutica Sua, descobriu que o


DDT (diclorodifenol-tricloro-etano) era muito eficiente como inseticida.
Durante a 2 Guerra mundial, existiam duas doenas graves que afetavam
os soldados e em que intervinham insetos: a malria (transmitida por
mosquitos) e a febre tifoide (transmitida por piolhos). O DDT foi utilizado pelas tropas e generalizou-se depois da
Guerra. Numa 1 fase de utilizao, as populaes de insetos diminuram, mas depois aumentaram de novo.
Verificou-se, ento, que alguns insetos tornaram-se resistentes.
Investigaes posteriores vieram demonstrar que as aves, que se alimentavam de insetos ou de outras substncias
contaminadas com DDT, estavam tambm a desaparecer e que este produto armazenava-se na gordura dos
organismos, nomeadamente mamferos, causando graves danos. Mesmo depois de proibida a utilizao do DDT,
durante muitos anos, os solos, a gua e muitos organismos sofreram o efeito devastador deste produto.

26. Em resposta ao DDT, os mosquitos desenvolveram resistncia, tornando-se _____e, pela lei_____, passaram essa
caracterstica aos descendentes.
(A) menos aptos () do uso e do desuso.

(B) mais aptos () da herana dos caracteres adquiridos.

(C) mais aptos () do uso e do desuso.

(D) menos aptos () da herana dos caracteres adquiridos.


27. Segundo _____, na populao de mosquitos ______ alguns que eram resistentes ao DDT. Estes reproduziram-se
mais, deixando mais descendentes.
(A) Darwin () surgiam

(C) Darwin () comearam a existir

(B) Neodarwinismo () surgiram

(D) Neodarwinismo () existiam


28. O ____ da populao alterou-se porque determinados genes tornaram-se mais _____ em detrimento de outros
que se tornaram______.
(A) fundo gentico () frequentes () menos frequentes.

(B) tamanho () raros () mais frequentes.

(C) tamanho () frequentes () menos frequentes.

(D) fundo gentico () raros () menos frequentes.


29. Numa perspetiva neodarwinista, a vantagem evolutiva dos mosquitos ao DDT deveu-se ...
(A) seleo natural exercida sobre a populao.

(B) necessidade de sobreviver num ambiente adverso.

(C) adaptao individual alterao ambiental.

(D) ocorrncia de mutaes na populao ancestral.


30. O gene que permite a resistncia dos insetos resultou de __________ , tendo de seguida sido transmitido aos
descendentes graas ao fenmeno de __________ .
(A) Crossing-over () recombinao gentica

(B) Mutao () fecundao

(C) Mutao () recombinao gentica

(D) Crossing-over () fecundao


O diagrama da figura 6 mostra
uma organizao sistemtica
de

diferentes

grupos

taxonmicos.

letra

corresponde

categoria

taxonmica considerada como


unidade biolgica fundamental
de classificao.

Figura 6


31. Classifica, verdadeira (V) ou falsa (F), cada uma das afirmaes seguintes relativas
organizao sistemtica apresentada no diagrama da figura 6.
(A) H menor grau de parentesco entre os seres pertencentes ao taxon c do que os seres
pertencentes ao taxon e.
(B) O taxon d indica Ordem.
(C) No diagrama esto representadas quatro famlias.
(D) Os organismos do grupo c1 possuem entre si um ancestral comum mais recente que os
organismos do grupo c2.
(E) A diversidade de seres vivos aumenta do taxon d para o taxon e.
(F) A nomenclatura binominal aplica-se ao taxon b.
(G) Os seres vivos do taxon a apresentam um maior nmero de caractersticas em comum.
(H) Os seres pertencentes ao taxon c apresentam maior diversidade de caractersticas do
que os seres pertencentes ao taxon e.

32. De acordo com o sistema de classificao de Whittaker, um ser vivo includo inequivocamente no Reino Animal
se for...
(A) ... eucarionte e heterotrfico.

(B) ... eucarionte e se se alimentar por ingesto.

(C) ... multicelular e heterotrfico.

(D) ... multicelular e se se alimentar por ingesto.


Questes de escolha mltipla
Verdadeiro e Falso / Legenda / Correspondncia / Ordenao
Questes de desenvolvimento

5 pontos
1 ponto por item
Exceo: Questo 22, 2 pontos por item
13 pontos


Bom trabalho!!!

10