Você está na página 1de 190

RAPP - Volume 24, 2016

RAPP
RAPP
RREVISO A NUAL DE
RAPP
EVISO ANUAL DE
PPATOLOGIA D E PLANTAS
ATOLOGIA DE PLANTAS
REVISO A23,NUAL
Volume 24,
Volume 2016
2015
DE
PATOLOGIA DE PLANTAS
Volume 23, 2015

Valorize sua formao profissional,


seu futuro e sua conscincia.

Valorize sua formao profissional,


RAPP - Volume 23, 2015 seu futuro e sua conscincia.

RAPP - Volume 23, 2015

II RAPP - Volume 24, 2016


REVISO ANUAL DE PATOLOGIA DE PLANTAS
COPYRIGHT REVISO ANUAL DE PATOLOGIA DE PLANTAS
2016

RAPP
REVISO ANUAL DE PATOLOGIA DE PLANTAS

Nenhuma parte desta publicao poder ser reproduzida sem prvia


autorizao, por escrito, do editor.

RAPP - REVISO ANUAL DE PATOLOGIA DE PLANTAS


SGAS 902 Bloco B Salas 102 e 103
Edifcio Athenas Asa Sul
Braslia DF Brasil
CEP 70390-020
Site SBF: www.sbfito.com.br
Site RAPP: rappsbf.weebly.com

Publicado no Brasil

Diagramao:
Grfica Diagrama

RAPP - Volume 24, 2016 III


RAPP

VOLUME 24, 2016

COMISSO EDITORIAL

Edson L. Furtado
Fernando Cezar Juliatti
Francisco Murilo Zerbini
Mario Lcio V. Resende
Marcos A. Machado
Srgio F. Pascholati

RONALDO J. D. DALIO

Editor chefe
RAPP

Uma publicao da REVISO ANUAL DE PATOLOGIA DE PLANTAS

Braslia DF
ISSN 0104 - 0383

IV RAPP - Volume 24, 2016


EDITORIAL

Renovar para avanar

T oda a comunidade da fitopatologia brasileira concordar que a Reviso Anual de Patologia de


Plantas se incorporou definitivamente como obra de referncia para todos os profissionais e
estudantes que atuam nessa rea. Com seus captulos atualizados e abrangendo no s assuntos
especficos do Brasil, mas de toda a cincia da fitopatologia ela, juntamente com a Tropical Plant Pa-
thology e a Summa Phytopathologica, consolidam e difundem informaes cientficas e tecnolgicas
essenciais para o avano ainda maior da agricultura brasileira.
Ao ser definitivamente incorporada Sociedade Brasileira de Fitopatologia a RAPP tornou-
-se institucional e passa a ter abrangncia maior, sendo uma publicao que continuar consolidando
assuntos atuais e importantes. Ao ser disponibilizada eletronicamente ela segue a tendncia irre-
versvel de publicaes cientficas. Quando se tornar completamente aberta seu ndice de citao
aumentar expressivamente.
Seu novo formato editorial demonstra leveza e alinha-se com outras publicaes de revi-
ses. Melhoria contnua no contedo e formato sinalizar que ela est no caminho de ser compara-
da, em futuro prximo, s melhores publicaes do gnero. evidente que a comunidade cientfica
que mantm dinmica e competitiva a Fitopatologia Brasileira est mais que habilitada a enriquecer
e elevar o nvel das revises publicadas pela RAPP.
Como toda rea da cincia, a Fitopatologia defronta-se com desafios crescentes, principal-
mente face s questes relacionadas a sustentabilidade de produo agrcola, aumento e agrava-
mento de problemas fitossanitrios e a problemas ambientais, principalmente aqueles associados
a mudanas climticas, cada vez mais determinantes na agricultura. A resposta a isso dever vir na
forma de novas tecnologias de manejo, novos cultivares e novas tecnologia de produo. O caminho
para todos esses desafios passa necessariamente pela cincia da Fitopatologia. Avanos somente
podem alcanados se o caminho da cincia for mantido e fortalecido. Fora disso no h milagres. A
RAPP a medida que seguir o caminho da qualidade de suas revises dever contribuir em muito para
que os avanos se concretizem.
A RAPP passa tambm a adotar o sistema de trabalho com reviso submetidas ao invs
de revises convidadas. Com isso espera-se que maior nmero de revises sero submetidas para
avaliao e eventual publicao, ampliando sobremaneira o nmero de colaboradores. Revises con-
vidadas podem sugerir que sejam revises aceitas, o que nunca foi o caso. Somente mantendo sua
qualidade editorial que ela se fortalecer como veculo importante na Fitopatologia Brasileira. To-
das as frentes de avano do conhecimento e da tecnologia devem ser priorizados. A diversidade e a
amplitude da Fitopatologia permitem isso.
Toda a comunidade da Fitopatologia Brasileira est convidada a fazer com que a RAPP ali-
nhe-se cada vez maiss mais prestigiadas publicaes brasileiras.

Dr. Marcos A. Machado


Membro do corpo editorial da RAPP e
Diretor do Centro de Citricultura Sylvio Moreira IA- SP

RAPP - Volume 24, 2016 V


CONTEDO

VRUS TRANSMITIDOS POR MOSCAS-BRANCAS Alice Kazuko Inoue-Nagata 8-9


NO BRASIL: VETORES, PRINCIPAIS Claudine Mrcia Carvalho
DOENAS E MANEJO Francisco Murilo Zerbini
Jorge Alberto Marques Rezende
Renate Krause Sakate
Tatsuya Nagata

MANCHA DE MICOSFERELA: O GRANDE Martha Maria Passador 30-41


OBSTCULO PARA O CULTIVO DEEUCALYPTUS Edson Luiz Furtado
GLOBULUSNO BRASIL

MANEJO DO MLDIO DA CEBOLA: AVANOS E Edivnio R. Arajo 42-54


BARREIRAS DA PESQUISA CIENTFICA Daniel P. Alves

FUNGOS DARK SEPTATE E SUA RELAO Peter Soares Medeiros 55-69


COM AS PLANTAS E Carlos Vergara Torres Jnior
FITOPATGENOS Claudia Maria Xavier Faria
Kerly Martnez Andrade
Jerri dson Zilli
Carlos Antonio Incio

NEMATOIDES QUARENTENRIOS PARA O BRASIL - Paulo Sergio Torres Brioso 70-103


DIAGNOSE, CONTROLE E PERSPECTIVAS Ricardo Moreira de Souza

RISCOS POTENCIAIS DE PATGENOS FLORESTAIS Celso Garcia Auer 104-114


EXTICOS PARA O SETOR FLORESTAL BRASILEIRO lvaro Figueredo dos Santos

BACTRIAS ENDOFTICAS: PASSADO, PRESENTE E Bruna Canabarro Pozzebon 115-129


PERSPECTIVAS VISANDO UM FUTURO SUSTENTVEL Juliano dos Santos

EFEITO DAS MUDANAS CLIMTICAS NO Mathias Ferrari Rockenbach 130-144


SISTEMA DE DEFESA DAS PLANTAS Mateus Brusco de Freitas
Marciel Joo Stadnik

RESISTNCIA DE MONILINIA SPP. AOS FUNGICIDAS Paulo dos Santos Faria Lichtemberg 145-173
DOS GRUPOS DOS INIBIDORES DA DESMETILAO Isabela Vescove Primiano
(IDM), DOS INIBIDORES DA QUINONA Juliana Muehlmann Fischer
EXTERNA (IQE) E DOS METILO BENZIMIDAZOL Chirley Glienke
CARBAMATOS (MBC)
Lilian Amorim
Louise Larissa May De Mio

SCLEROTINIA SCLEROTIORUM: MOLECULAR Wei Wei 174-189


ASPECTS IN PLANT-PATHOGENIC INTERACTIONS Steven J. Clough

VI RAPP - Volume 24, 2016


Alice Kazuko Inoue-Nagata, et al. (7-29)

VRUS TRANSMITIDOS POR


MOSCAS-BRANCAS NO BRASIL: VETORES,
PRINCIPAIS DOENAS E MANEJO
Alice Kazuko Inoue-Nagata1; Claudine Mrcia Carvalho2;
Francisco Murilo Zerbini2; Jorge Alberto Marques Rezende3;
Renate Krause Sakate4; Tatsuya Nagata5

RESUMO
A mosca-branca Bemisia tabaci tem sido considerada a praga do scu-
lo. Ainda no conseguimos conviver com essa praga cosmopolita, que alm de
produzir prejuzos diretos para a agricultura tem nos efeitos indiretos a principal
fonte de preocupao dos produtores. A sua capacidade de atuar como vetor
de diferentes espcies de vrus e a extrema dificuldade de seu controle resulta-
ram na emergncia de doenas srias para a agricultura brasileira. Esta reviso
aborda as principais viroses associadas a B. tabaci no Brasil, com descries dos
vrus, das doenas e dos prejuzos que estas vm causando cadeia de produo
agrcola. Ainda h muito o que aprender para viabilizar um manejo adequado
dessas viroses e esta reviso tem como propsito apresentar as informaes
atualizadas sobre os vrus e incentivar os interessados a trabalharem com esse
tema que complexo e ao mesmo tempo atrativo e desafiador.

1. Introduo das pragas mais srias da agricultura mundial. Junto


No Brasil, at o final da dcada de 1980, os com ela, emergiram viroses devastadoras para a
insetos vetores de vrus mais relevantes eram os agricultura, destacando-se o mosaico dourado do
afdeos (pulges) e os tripes. Algumas espcies de tomateiro, o amarelo do meloeiro e o amarelo
vrus dos gneros Potyvirus, Polerovirus, Closterovirus, do tomateiro. Fomos testemunhas da rpida e
Cucumovirus e Tospovirus representavam os vrus extensiva invaso do complexo mosca-branca-
de maior ocorrncia em vrias culturas. A nica vrus. Atualmente, as viroses associadas s moscas-
exceo era o mosaico dourado do feijoeiro, causado brancas despontam em todo o Brasil pela alta
por um begomovrus transmitido pela mosca- incidncia e pelas perdas que elas causam. O seu
branca Bemisia tabaci. Esse cenrio se modificou manejo dificultado pela complexidade do sistema
radicalmente a partir da dcada de 1990, quando agrcola brasileiro, onde reas de produo contm
ocorreu a introduo de um novo bitipo de Bemisia bons hospedeiros da mosca-branca, presentes ao
tabaci. O bitipo B (atualmente considerado uma longo de todo o ano. Sendo um inseto polfago, a
espcie crptica, B. tabaci Middle East-Asia Minor mosca-branca coloniza e multiplica-se em inmeras
1, MEAM1) rapidamente se dispersou em todo o plantas cultivadas, silvestres e invasoras, sendo,
territrio nacional e hoje considerado como uma porm, as plantas cultivadas as mais prejudicadas.
1
Embrapa Hortalias, Braslia, DF, 70351-970 - E-mail: alice.nagata@embrapa.br; 2Dep. de Fitopatologia/BIOAGRO, Universidade Fe-
deral de Viosa, Viosa, MG, 36570-900 - E-mail: claudine.carvalho@ufv.br e zerbini@ufv.br; 3Dep. de Fitopatologia e Nematologia,
Escola Superior de Agricultura Luiz de Queiroz, Universidade de So Paulo, Piracicaba, SP, 13418-900 - E-mail: jrezende@usp.br;
4
Dep. de Defesa Fitossanitria, FCA/UNESP, Botucatu, SP, 18610-370 - E-mail: renatekrause@fca.unesp.br; 5Dep. de Biologia Celular,
Universidade de Braslia, Braslia, DF, 70910-000 - E-mail: tatsuya@unb.br

RAPP - Volume 24, 2016 7


Alice Kazuko Inoue-Nagata, et al. (7-29)

Dentre as grandes culturas mais afetadas destacam- como o estabelecimento de vazios fitossanitrios
se a soja, o algodoeiro e o feijoeiro, e dentre as foram regulamentadas na tentativa de conter o
hortalias, o tomateiro, a batateira, as brssicas e mosaico dourado do feijoeiro e do tomateiro,
as cucurbitceas. Verdadeiras nuvens de moscas- respectivamente. O perodo de vazio fitossanitrio,
brancas so regularmente observadas nas lavouras e nestes casos, serve para reduzir a fonte de inculo e
no raro nas cidades nas pocas de pico populacional, no a populao do vetor.
particularmente na poca de senescncia da soja. Esta reviso tem a finalidade de reunir de
O controle da mosca-branca muitas vezes forma concisa as informaes disponveis sobre as
negligenciado, principalmente em culturas onde as viroses associadas mosca-branca e as principais
viroses associadas a esse vetor no causam prejuzos caractersticas de B. tabaci, seguidas de um
relevantes, como o caso da soja e do algodoeiro. detalhamento sobre os principais vrus transmitidos
Considerando-se as graves perdas registradas em por esse vetor no Brasil (listados na Tabela 1).
cultivos de feijoeiro e tomateiro, medidas extremas

Tabela 1. Vrus transmitidos por mosca-branca relatados no Brasil em plantas cultivadas.


Nome (acrnimo) Genoma Vetor(es) Hospedeiros naturais Nome comum da Importncia
doena (se existir) econmica
Gnero Begomovirus
Bean golden mosaic virus ssDNA, dois B. tabaci, feijoeiro, soja, mosaico dourado alta
(BGMV) componentes persistente Macroptilium spp. do feijoeiro
Macroptilium yellow spot virus ssDNA, dois B. tabaci, feijoeiro, P. lunatus, mosaico dourado baixa
(MaYSV) componentes persistente Macroptilium spp. do feijoeiro (predominante
em AL)
Cotton chlorotic spot virus ssDNA, dois B. tabaci, algodoeiro -- baixa
(CCSV) componentes persistente
Okra mottle virus ssDNA, dois B. tabaci, quiabeiro -- baixa
(OMoV) componentes persistente
Sweet potato leaf curl virus ssDNA, um B. tabaci, batata-doce enrolamento das baixa (?)
(SPLCV) componente persistente folhas
Sweet potato leaf curl So ssDNA, um B. tabaci, batata-doce enrolamento das baixa (?)
Paulo virus (SPLCSPV) componente persistente folhas
Tomato chlorotic mottle virus ssDNA, dois B. tabaci, tomateiro mosaico dourado baixa
(ToCMoV) componentes persistente
Tomato common mosaic virus ssDNA, dois B. tabaci, tomateiro mosaico dourado baixa
(ToCmMV) componentes persistente (predominante
no ES)
Tomato golden vein virus ssDNA, dois B. tabaci, tomateiro mosaico dourado baixa
(TGVV) componentes persistente
Tomato mottle leaf curl virus ssDNA, um B. tabaci, tomateiro mosaico dourado alta (NE)
(ToMoLCV) componente persistente
Tomato rugose mosaic virus ssDNA, dois B. tabaci, tomateiro mosaico dourado/ baixa
(ToRMV) componentes persistente rugoso
Tomato severe rugose virus ssDNA, dois B. tabaci, batateira, tomateiro, mosaico dourado/ alta (SE, CO)
(ToSRV) componentes persistente pimento, Nicandra rugoso
physaloides
Tomato yellow vein streak ssDNA, dois B. tabaci, batateira, tomateiro mosaico dourado baixa
virus (ToYVSV) componentes persistente
Tomato yellow spot virus ssDNA, dois B. tabaci, tomateiro, feijoeiro, mosaico dourado baixa
(ToYSV) componentes persistente soja, Leonurus
sibiricus
Gnero Crinivirus
Tomato chlorosis virus (+)ssRNA, dois B. tabaci e T. tomateiro, pimento amarelo do intermediria
(ToCV) componentes vaporariorum, tomateiro
semi-persistente
Gnero Carlavirus
Cowpea mild mottle virus (+)ssRNA, um B. tabaci, no- soja, feijoeiro necrose da haste intermediria
(CPMMV) componente persistente
Melon yellowing-associated (+)ssRNA, um B. tabaci, no- meloeiro amarelo do intermediria
virus (MYaV) componente persistente meloeiro

8 RAPP - Volume 24, 2016


Alice Kazuko Inoue-Nagata, et al. (7-29)

2. A mosca-branca Bemisia tabaci vida compreendido por seis estdios: ovo, ninfa de
Bemisia tabaci (Gennadius) (Hemiptera: primeiro, segundo, terceiro e quarto instares (esta
Aleyrodidae), comumente denominada mosca- ltima referida como pupa) e adulto (Loureno,
branca, passou a ter destaque como praga global a 2015). B. tabaci um inseto multivoltino, que no
partir da dcada de 1980, quando principalmente apresenta diapausa ou estdio quiescente, de forma
pelo comrcio de plantas ornamentais este inseto que as populaes so mantidas por meio dos recursos
foi disseminado a partir de seu centro de origem vegetais existentes. No Brasil as principais culturas
(Oriente Mdio e sia Menor Middle East-Asia infestadas e prejudicadas por este inseto incluem o
Minor) para ao menos 54 pases. Nas Amricas sua tomateiro, feijoeiro, meloeiro e a batateira, em que
introduo se deu inicialmente nos Estados Unidos, a transmisso de vrus expressiva, alm de culturas
associada a infestaes em poinstia (Euphorbia como algodoeiro, soja, aboboreira, melancia, videira,
pulcherrima) e mais tarde ao sintoma do prateamento hortalias diversas e ornamentais em que o ataque
das folhas da aboboreira (Maynard e Cantliffe, 1989 do inseto tem se manifestado de forma cada vez mais
citados por Morales, 2006a, b). Rapidamente a praga intensa. Diversas plantas da vegetao espontnea
se dispersou aos demais pases, chegando ao Brasil tambm so hospedeiras do inseto, bem como de
na dcada de 1990 (Loureno, 1994). Seguiram- alguns vrus (Loureno, 2015).
se relatos de vrus transmitidos pela mosca-branca, As populaes de B. tabaci, apesar de
principalmente para solanceas (Ribeiro et al., 1998; morfologicamente idnticas, exibem variabilidade
Zerbini et al., 2002). biolgica quanto aos hospedeiros preferencialmente
B. tabaci causa danos diretos planta colonizados, polimorfismo gentico, diferenas na
como o aparecimento de desordens fisiolgicas, fecundidade e na capacidade de causar fitotoxicidade.
perda de vigor e liberao de secreo aucarada H tambm diferenas na composio de procariotas
(honeydew) que favorece o desenvolvimento de endossimbiontes e na capacidade de transmisso
fungos, dentre outros (Brown et al., 1995). Alm de vrus, tendo sido tradicionalmente classificadas
disso, excelente vetora de vrus, sendo capaz de em bitipos (Brown et al., 1995). Recentemente,
transmitir mais de 200 espcies de vrus pertencentes baseado na anlise molecular do gene mitocondrial
aos gneros Begomovirus, Carlavirus, Crinivirus, citocromo oxidase I (mtCOI), passou-se a considerar
Ipomovirus e Torradovirus (Gilbertson et al., 2015; B. tabaci como um complexo de 37 espcies crpticas
Navas-Castillo et al., 2011; ipomovrus e torradovrus (De Barro e Ahmed, 2011; Dinsdale et al., 2010;
no foram relatados no Brasil at o presente, e no Firdaus et al., 2013; Alemandri et al., 2012; Chowda-
sero abordados nesta reviso). Os begomovrus e os Reddy et al., 2012; Esterhuizen, 2013; Hu et al., 2011;
crinivrus causam impacto econmico relevante em Parrella et al., 2014), das quais as espcies MEAM1
vrias culturas, sendo reconhecidos como os mais (correspondente ao bitipo B) e Mediterranean (MED
importantes vrus de plantas emergentes em regies - correspondente ao bitipo Q), so consideradas
tropicais e subtropicais (Navas-Castillo et al., 2011a). mundialmente as mais invasivas e danosas (Dinsdale
Por ser um inseto altamente polfago alimentando- et al., 2010).
se de plantas de mais de 500 espcies de plantas de No Brasil j foram relatadas quatro espcies
74 famlias botnicas (Brown et al., 1995), apresentar crpticas de B. tabaci, das quais New World 1
alta taxa de fecundidade e excelente habilidade (NW1) e New World 2 (NW2), correspondentes ao
de disperso, B. tabaci considerada uma super- bitipo A, so consideradas nativas das Amricas
vetora de vrus (Gilbertson et al., 2015), facilitando e foram quase extintas aps a disseminao de
a transferncia de vrus nativos de plantas no- MEAM1 (Marubayashi, 2013; Barbosa et al., 2014).
cultivadas para plantas cultivadas (Bedford et al., Mais recentemente a espcie MED foi relatada,
1994; Navas-Castillo et al., 2011a; Rocha et al., 2013). inicialmente no Rio Grande do Sul (Barbosa et al.,
A reproduo em B. tabaci sexuada ou 2015) e em seguida no estado de So Paulo (R.
por partenognese arrentoca, na qual ovos no Krause-Sakate, dados no publicados). B. tabaci
fertilizados originam machos e ovos fertilizados MED tem sua origem na Bacia do Mediterrneo
originam fmeas. A taxa de oviposio pode atingir e sua presena nas Amricas mais restrita, com
at 394 ovos por fmea (Byrne, 1991). Seu ciclo de relatos nos Estados Unidos (Dalton, 2006), Mxico

RAPP - Volume 24, 2016 9


Alice Kazuko Inoue-Nagata, et al. (7-29)

(Martinez-Carrillo, 2007), Guatemala (Bethke et al., sorologia. Somente a partir de meados da dcada de
2008), Costa Rica (Guevara-Coto, 2011), Argentina, 1990, com a popularizao de tcnicas moleculares
Uruguai (Grille, 2011) e Brasil (Barbosa et al., 2015). de diagnose e clonagem, a deteco e identificao
Como importantes caractersticas desta espcie rpida e precisa do agente causal tornou-se possvel.
ressaltam-se a alta resistncia aos inseticidas Assim, a compreenso da situao dos begomovrus
neonicotinoides; a adaptao a ambientes fechados, experimentou um progresso rpido no s no Brasil,
como estufas e casas-de-vegetao (Horowitz et mas em todo o mundo.
al., 2005); a adaptao a culturas como o pimento Os begomovrus possuem genoma de DNA
(Muniz, 2001), atualmente pouco afetadas por circular de fita simples, com um ou dois componentes.
begomovrus no Brasil; e a excelente habilidade em A absoluta maioria dos begomovrus encontrados nas
transmitir o begomovrus Tomato yellow leaf curl Amricas possuem genoma com dois componentes
virus (TYLCV) (Li, 2010), ainda no relatado no Brasil (bissegmentado), denominados DNA-A e DNA-B.
e um dos patgenos mais devastadores do tomateiro Cada componente possui aproximadamente
(Moriones e Navas-Castillo, 2000). Nas Amricas, o 2600 nucleotdeos (nt) e uma regio comum de
TYLCV j foi relatado no Caribe, Mxico, Sudeste dos aproximadamente 200 nt na qual est localizada a
EUA e Venezuela (Navas-Castillo et al., 2011a). origem de replicao. O DNA-A possui cinco genes
que codificam protenas associadas replicao
3. Begomovrus do genoma viral, supresso de respostas de defesa
Historicamente, a primeira descrio de uma do hospedeiro e formao das partculas. O DNA-B
doena de planta causada por um begomovrus possui dois genes envolvidos no movimento clula-a-
encontrada em um poema escrito pela imperatriz clula do vrus na planta (Brown et al., 2012).
Koken, no Japo. Ela descreve as folhas amareladas
(clorticas) da planta conhecida como Eupatorium 3.1. Begomovrus em fabceas
makinoi. Alguns trabalhos sucederam essa descrio, O Brasil um centro de diversidade gentica
porm somente aps mais de 1200 anos foi de begomovrus, com relatos de sua deteco em
confirmada a associao do begomovrus Eupatorium plantas no-cultivadas desde a dcada de 1950
yellow vein virus, suposto causador da virose naquela (Costa e Bennett, 1950; Flores et al., 1960; Costa,
poca (Saunders et al., 2003). No Brasil h relatos de 1955). A partir da dcada de 1970, o grande aumento
begomovrus em diversas plantas desde a dcada de da rea plantada com soja favoreceu a emergncia
1930 (Costa, 1937; Costa, 1955; Costa e Bennett, 1950). de begomovrus na cultura do feijoeiro (Costa, 1975).
A etiologia viral foi comprovada com a transmisso A soja um excelente hospedeiro de B. tabaci e sofre
para plantas sadias pelas moscas-brancas, reproduo poucos danos com a presena da praga e, por isso, o
de sintomas e tambm pela presena de partculas seu controle frequentemente negligenciado pelos
virais geminadas (Costa, 1955; Costa e Bennett, 1950; produtores. Essa falha permite que as populaes
Matyis et al., 1975; Orlando, 1945; Orlando, 1946). de insetos atinjam nveis altssimos, com a posterior
Muitas doenas com sintomatologia semelhante, migrao para outras plantas no perodo de
como o mosaico do algodoeiro e a clorose variegada senescncia das plantas de soja. Esse contexto levou
das malvceas, no tiveram a etiologia confirmada disseminao do begomovrus Bean golden mosaic
na poca (Costa, 1955, Flores et al., 1960; Orlando, virus (BGMV), agente causal do mosaico dourado do
1945; Orlando, 1946). Apesar da falta de identificao feijoeiro, nos plantios de feijoeiro prximos a reas
definitiva do patgeno, esses relatos constituem de cultivo de soja (Menten e Roston, 1980; Vicente
registros preciosos sobre as doenas e refletem et al., 1985). O mosaico dourado tornou-se um fator
as contribuies altamente relevantes de grandes limitante cultura do feijoeiro ao longo das dcadas
pesquisadores como A. A. Bitancourt, E. W. Kitajima, de 1970 e 1980, essencialmente impedindo o cultivo
A. S. Costa, A. Orlando e K. Silberschmidt. em regies de clima quente e seco. O problema foi
Estudos com begomovrus progrediram agravado com a disperso de B. tabaci MEAM1, que
lentamente no sculo XX, principalmente por coloniza bem o feijoeiro.
eles no serem transmitidos por extrato vegetal O mosaico dourado apresenta como
tamponado e serem detectados com dificuldade por caracterstica o aparecimento nas folhas de clorose

10 RAPP - Volume 24, 2016


Alice Kazuko Inoue-Nagata, et al. (7-29)

intensa, mosaico, bolhas, rugosidade, deformao, todos os elos da cadeia de produo, foi decidida a
diminuio da rea foliar e nanismo da planta (Figura implementao de um vazio fitossanitrio em GO,
1A). Em muitos casos, a forte clorose produz uma DF e MG (IN 15, SDA, MAPA, 16/06/2014). As regies
cor amarelo-ouro nas folhas, o que originou o nome produtoras foram divididas em duas sub-regies. A
comum da doena. Frequentemente o vrus causa primeira sub-regio abrange os municpios ao sul de
reduo da produo de vagens, resultando em GO, onde o vazio fitossanitrio do feijoeiro ocorre
drstica diminuio de produtividade. Os prejuzos entre 5 de setembro e 5 de outubro. Na sub-regio 2,
so altos e essa doena tornou-se uma das principais compreendendo MG, DF e o norte de GO, o perodo
preocupaes dos produtores de feijo do pas na foi institudo entre os dias 20 de setembro e 20 de
atualidade. A frequente ocorrncia de epidemias outubro. A incidncia da virose foi reduzida (Canal
em feijoeiro evidencia que o controle do mosaico Rural, 2015), porm a medida ainda questionada
dourado permanece como um grande desafio para por alguns produtores. O vazio fitossanitrio tem
a cadeia produtiva. No h cultivares de feijoeiro como objetivo principal a reduo do inculo do
com bom nvel de resistncia ao mosaico dourado. vrus no incio da estao de cultivo, pelo fato de
O controle qumico do vetor com inseticidas nem os begomovrus no apresentarem transmisso
sempre satisfatrio, devido alta eficincia de transovariana e infectarem uma gama reduzida de
transmisso e presena de hospedeiros da mosca- hospedeiros. Entretanto, durante o perodo h a
branca nas regies agrcolas ao longo de todo o ano. presena de outras plantas hospedeiras da mosca-
Em vista das frequentes epidemias que branca, como o tomateiro e a soja, que multiplicam
ocorreram nos ltimos anos, destacando-se aquelas eficientemente o vetor. Apesar da controvrsia,
do ano agrcola 2012/2013 (Figura 1A), houve uma acredita-se que a medida tem contribudo
presso forte da cadeia produtiva para que medidas efetivamente para a diminuio dos prejuzos.
enrgicas fossem tomadas pelos rgos pblicos At o momento, no se conseguiu por
para conter a doena. Aps intenso debate entre melhoramento gentico clssico o desenvolvimento

A B C

D E F
Figura 1. Plantas expressando sintomas de infeco por vrus transmitidos por B. tabaci. A. Lavoura de feijoeiro em que
100% das plantas apresentam sintomas de clorose, bolhas e mosaico, causados por infeco pelo begomovrus Bean
golden mosaic virus (BGMV). B. Tomateiro de crescimento determinado infectado pelo begomovrus Tomato severe ru-
gose virus (ToSRV), apresentando sintomas de clorose internerval, enrolamento foliar e nanismo. C. Planta de pimento
infectado pelo ToSRV com sintoma de manchas clorticas, bolhosidade e deformao foliar. D. Planta de soja infectada
pelo carlavrus Cowpea mild mottle virus, com necrose severa do ponteiro. E. Tomateiro de crescimento indeterminado
infectado pelo crinivrus Tomato chlorosis virus, apresentando mosaico e clorose internerval. F. Meloeiro com infeco
pelo carlavrus Melon yellowing-associated virus apresentando sintomas de clorose foliar intensa.

RAPP - Volume 24, 2016 11


Alice Kazuko Inoue-Nagata, et al. (7-29)

de uma cultivar de feijoeiro com resistncia ao alvo de infeco com outro vrus transmitido por
mosaico dourado. Devido a essa dificuldade, um mosca-branca, o carlavrus Cowpea mild mottle virus,
programa de produo de uma planta geneticamente descrito mais frente). Mais recentemente, houve um
modificada (GM) com resistncia foi iniciado com relato da ocorrncia de Sida micrantha mosaic virus
base na estratgia do silenciamento gnico. A planta (SiMMV), um begomovrus que infecta naturalmente
GM expressa uma fita dupla de RNA correspondente malvceas, infectando o feijoeiro no estado de
parte do genoma viral e desencadeia uma Gois (Fernandes-Acioli, 2011). A importncia e a
resposta de defesa da planta com a destruio do distribuio desta espcie em feijoeiro ainda no so
RNA especfico do vrus, o que leva a uma reduo conhecidas.
expressiva de protenas essenciais para o ciclo Em termos de variabilidade gentica, existem
replicativo do patgeno. No caso do BGMV, as diferenas significativas entre o BGMV e o MaYSV.
plantas transgnicas expressam parte do gene Rep Populaes de BGMV obtidas de feijoeiro comum (P.
e so altamente resistentes infeco viral (Aragao vulgaris) apresentam baixa variabilidade, enquanto
et al., 2013). Aps anos de testes em ambiente populaes obtidas de feijo-fava (P. lunatus) so
confinado e no campo, e todas as avaliaes de recombinantes e mais variveis (Faria e Maxwell,
biossegurana, o feijoeiro transgnico foi liberado 1999; Ramos-Sobrinho et al., 2014). J o MaYSV
para cultivo comercial em 2011 (http://ctnbio.mcti. apresenta um elevado grau de variabilidade gentica,
gov.br/publicacoes/-/document_library_display/ independentemente do hospedeiro (P. vulgaris,
cwksGAQxt1lp/view/678011). Essa uma ferramenta P. lunatus ou M. lathyroides), em parte devido a
a mais que dever fazer parte de um programa de vrios eventos de recombinao (Silva et al., 2012;
manejo integrado de pragas (Gilbertson et al., 2011) Ramos-Sobrinho et al., 2014; Lima et al., 2013). Alm
para um manejo efetivo do mosaico dourado do disso, a populao de BGMV analisada por Ramos-
feijoeiro. Sobrinho et al. (2014) estava estruturada com base
No Brasil, a diversidade de espcies de em hospedeiro/regio geogrfica, o que no foi
begomovrus que infectam fabceas baixa. O observado para a populao de MaYSV.
BGMV foi a nica espcie encontrada em amostras Apesar da ocorrncia frequente de BGMV
de feijoeiro comum (Phaseolus vulgaris) e de em feijoeiro, infeces de begomovrus em soja
Macroptilium lathyroides coletadas em 2011 e 2012 no so comuns no Brasil. Ocorrncias espordicas,
nas regies Sudeste e Centro-Oeste (Ramos-Sobrinho sem impacto econmico, tm sido relatadas desde
et al., 2014). Na regio Nordeste, alm do BGMV, 1980, com a deteco de BGMV, SiMMV, Okra mottle
foi detectada tambm a presena do Macroptilium virus (OMoV), Tomato yellow spot virus (ToYSV) e
yellow spot virus (MaYSV) (Ramos-Sobrinho et al., Soybean chlorotic spot virus (SoCSV) (Coco et al.,
2014; Silva et al., 2012). O BGMV foi o begomovrus 2013; Fernandes et al., 2009; Rodrguez-Pardina
predominante em amostras de fabceas cultivadas et al., 2011). Este cenrio est em contraste com a
e no-cultivadas coletadas em 2003-2005 em trs Argentina, onde a infeco de soja pelos begomovrus
estados do Nordeste (AL, BA e PE) (Wyant et al., Soybean blistering mosaic virus (SbBMV) e ToYSV
2012; Ramos-Sobrinho et al., 2014). Entretanto, em frequente na regio Noroeste, causando perdas
amostras coletadas em 2011 em Alagoas, o MaYSV moderadas a severas na produo (Rodrguez-
foi o vrus predominante (Ramos-Sobrinho et al., Pardina et al., 2011). Como os sintomas causados
2014). O MaYSV foi relatado pela primeira vez em pelos begomovrus, caracterizados como mosqueado
amostras de M. lathyroides coletadas em 2010 (Silva e manchas clorticas, so suaves, possvel que
et al., 2012). Os resultados de Ramos-Sobrinho et al. sua ocorrncia no esteja sendo percebida pelos
(2014) sugerem que o MaYSV pode estar substituindo tcnicos e produtores brasileiros. Considerando-se
o BGMV como o begomovrus predominante em a presena de vrus capazes de infectar as plantas
fabceas em AL. Caso essa tendncia se confirme e o de soja e a alta preferncia de B. tabaci MEAM1 por
MaYSV se torne comum em cultivos de feijoeiro em essas plantas, acredita-se que em um futuro prximo
outras regies, o sucesso do plantio do feijoeiro GM os begomovrus possam emergir como um problema
com resistncia ao BGMV poder ser comprometido srio para a sojicultura nacional. Considerando que
(alm disso, esse feijoeiro transgnico poder ser a soja excelente multiplicador da mosca-branca, o

12 RAPP - Volume 24, 2016


Alice Kazuko Inoue-Nagata, et al. (7-29)

manejo eficiente do inseto nessa cultura essencial anloga ao que observado para begomovrus em
para a agricultura brasileira. outras culturas (feijoeiro, algodoeiro, mandioca), uma
3.2. Begomovrus em solanceas alta taxa de infeco frequentemente observada,
Uma situao oposta a que ocorre em particularmente em tomateiro de crescimento
fabceas observada para begomovrus que determinado, quando perdas de 100% podem ser
infectam solanceas, a exemplo do tomateiro, onde observadas (Bergamin Filho et al., 2016). O controle
um grande nmero de espcies tem sido descritas qumico do vetor uma das estratgias mais
e a variabilidade gentica entre os isolados de uma empregadas na tentativa de reduo da incidncia
determinada espcie normalmente muito alta da doena, porm apresenta baixa eficincia em
(Rocha et al., 2013; Zerbini et al., 2005). perodos de alta populao de moscas-brancas.
Os primeiros relatos de begomovrus em Evidncias crescentes apontam que o controle
tomateiro no Brasil datam da dcada de 1960 (Costa dever ser voltado para conter a disperso primria
et al., 1975; Flores et al., 1960). Plantas de tomateiro da doena, isto , as moscas-brancas virulferas que
apresentando sintomas de deformao foliar, vm de fora da lavoura de tomateiro (Bergamin Filho
encrespamento e clorose internerval difusa foram et al., 2016).
relatadas. O vrus foi caracterizado e denominado O uso de plantas com resistncia gentica a
Tomato golden mosaic virus (TGMV). Alm do TGMV, begomovrus representa uma realidade para a cultura
cinco outros vrus transmitidos por mosca-branca do tomateiro. H no mercado um considervel leque
foram identificados, porm sem causar danos de de ofertas de hbridos F1 com resistncia moderada
importncia econmica (Matyis et al., 1975). Isso ou tolerncia. Esses hbridos possuem um ou mais
provavelmente ocorria porque as moscas-brancas dos principais genes de resistncia conhecidos,
nativas do grupo NW, nicas que ocorriam no Pas como Ty-1, Ty-2, Ty-3, Ty-4, Ty-5, ty-5, tcm-1e tgr-
naquela poca, colonizam o tomateiro com baixa 1. Esses genes foram identificados em programas
eficincia (Bedford et al., 1994). No entanto, no incio de melhoramento visando resistncia ao TYLCV, um
da dcada de 1990 um complexo de begomovrus begomovrus monossegmentado que no ocorre no
surgiu em tomateiro no Brasil, coincidindo com a Brasil. A resistncia conferida por esses genes aos
introduo e disseminao de B. tabaci MEAM1 begomovrus bissegmentados existentes no Brasil
(Ambrozevicius et al., 2002; Ribeiro et al., 2003). no completa. As cultivares so menos suscetveis
Desde ento, dezesseis espcies de begomovrus infeco, e quando infectadas, os sintomas so
j foram descritas, incluindo o Tomato chlorotic mais brandos, com expresso de leves manchas
mottle virus (ToCMoV), Tomato rugose mosaic clorticas. Em situaes de alta presso de inculo,
virus (ToRMV), Tomato severe rugose virus (ToSRV), os sintomas podem ser severos (Boiteux et al., 2007;
Tomato yellow spot virus (ToYSV), Tomato golden Gonzales-Aguilera et al., 2011). O uso de cultivares
vein virus (TGVV) e Tomato yellow vein streak virus com resistncia mandatrio em regies de alta
(ToYVSV) (Calegario et al., 2007; Fernandes et al., incidncia, como GO, DF, MG, CE e SP.
2006; Ribeiro et al., 2007; Firmino et al., 2009). A Levantamentos realizados ao longo dos
introduo de B. tabaci MEAM1 causou um grande ltimos 20 anos para acessar a distribuio relativa
impacto para a tomaticultura brasileira, e no se de begomovrus em tomateiro indicam que
sabe se a recente introduo de B. tabaci MED pode determinadas espcies tornaram-se prevalentes
resultar em impactos semelhantes ou ainda maiores. em diferentes regies do pas (Rocha et al., 2013;
Os begomovrus causam uma grande Fernandes et al., 2008; Albuquerque et al., 2012b).
diversidade de sintomas em tomateiro, incluindo O sequenciamento direto de fragmentos de PCR
clareamento de nervuras, manchas clorticas, clorose de amostras de tomateiro coletadas nos quatro
internerval, mosaico de diferentes intensidades, estados da regio Sudeste entre os anos de 1998 e
deformao foliar, diminuio do limbo foliar, 2004 indicou o ToYVSV e o ToSRV como as espcies
enrolamento foliar e nanismo (Figura 1B) (Inoue- predominantes em SP, o ToCMoV e o ToSRV como as
Nagata et al., 2006) . Em infeces precoces, os espcies predominantes em MG e ES, e o ToCMoV
sintomas so severos com uma dramtica reduo e o ToYVSV como as espcies predominantes no RJ
de produtividade (Giordano et al., 2005). De forma (Cotrim et al., 2007; Ambrozevicius et al., 2002).

RAPP - Volume 24, 2016 13


Alice Kazuko Inoue-Nagata, et al. (7-29)

A mesma estratgia foi utilizada para identificar (Barreto et al., 2013; Silva et al., 2010), mas so
begomovrus em amostras de tomateiro coletadas dispensveis epidemiologicamente caso o tomateiro
entre 2002 e 2004 no DF e nos estados de SP, MG, GO, esteja presente no campo durante todo o ano. Assim,
BA e PE. O ToSRV foi o vrus predominante no Sudeste uma das medidas mais eficientes de controle de
e Centro-Oeste, enquanto o Tomato mottle leaf curl begomovrus em tomateiro o estabelecimento do
virus (ToMoLCV) foi predominante no Nordeste vazio fitossanitrio (Salati et al., 2002).
(Fernandes et al., 2008). A prevalncia do ToMoLCV Devido aos srios prejuzos causados pelos
no Nordeste foi confirmada por Albuquerque et al. begomovrus em tomateiros, foi implementado em
(2012b) [interessantemente, resultados recentes 2003 um perodo de vazio fitossanitrio (IN 024, SDA,
sugerem que esse begomovrus pode ter o genoma MAPA, 15/03/2003). Essa normativa tem o objetivo
monossegmentado (Vu et al., 2015)]. Nos anos de reduzir a populao de tomateiro, considerado a
de 2005 e 2007, foi realizado um estudo sobre a principal fonte de vrus, e no de moscas-brancas. Uma
diversidade de begomovrus em duas importantes Instruo Normativa da Agrodefesa instituiu o vazio
regies produtoras de tomate na regio Sudeste, fitossanitrio em Gois a partir de 2007 (Agrodefesa,
Paty do Alferes (RJ) e Coimbra (Zona da Mata de IN 05/2007) e foi reeditada em 2011 (Agrodefesa, IN
MG). A anlise de sequncias de nucleotdeos do 06/2011). Desde ento, no permitido o plantio
DNA-A revelou que em Paty do Alferes o ToYVSV de tomateiro para processamento nos meses de
era o begomovrus predominante, encontrado em dezembro e janeiro, isto , o transplantio somente
56,4% das amostras analisadas, seguido pelo Tomato pode ser realizado entre os meses de fevereiro a
common mosaic virus (ToCmMV). J em Coimbra junho. Entretanto, a normativa restrita a tomateiro
o ToCmMV foi o nico begomovrus encontrado de crescimento determinado e no restringe o cultivo
infectando tomateiro. Dados mais recentes de tomateiro de crescimento indeterminado. Essa
confirmaram a prevalncia do ToSRV e ToCMoV na situao leva em conta a dificuldade de fiscalizao
Zona Metalrgica de MG (municpios de Caranda e de pequenos produtores, porm contribui para a
Florestal) e do ToSRV e ToCmMV na Zona da Mata de reduo da eficincia da medida. Considerando-se
MG e na Regio Serrana do Esprito Santo (Gonzlez- a importncia da tomaticultura para processamento
Aguilera et al., 2012; Rocha et al., 2013; Barbosa et industrial em certas regies, a Instruo Normativa de
al., 2016). 2011 estendeu o vazio fitossanitrio para o tomateiro
Rocha et al. (2013) observaram que as estaqueado em alguns municpios. A realizao de
populaes de begomovrus que infectam o medidas de manejo integrado de pragas tambm
tomateiro no Brasil so altamente recombinantes, preconizada pela Instruo Normativa. Outros
possuem uma rpida taxa de evoluo molecular e estados como SP e MG tambm seguem este perodo
so estruturadas com base em localizao geogrfica. de vazio fitossanitrio, apesar de no regulamentado
A hiptese mais aceita para explicar a emergncia oficialmente.
dos begomovrus que infectam tomateiro no Brasil O controle qumico do vetor baseado na
a transferncia horizontal de vrus nativos que aplicao sistemtica e frequente de inseticidas
infectam plantas no-cultivadas por B. tabaci MEAM1, na lavoura, o que resulta na baixa eficincia do
inseto que possui uma gama de hospedeiros muito controle. O controle do vetor precisa ser realizado
maior do que B. tabaci NW. Uma vez presentes no em escala regional, abrangendo as culturas vizinhas
novo hospedeiro, esses vrus evoluem rapidamente, e considerando a flora nativa e plantas invasoras. A
dando origem s espcies detectadas em plantas complexidade do sistema agrcola brasileiro, que
cultivadas (Zerbini et al., 2010; Rocha et al., consiste de cultivos contnuos de hospedeiros de
2013). A predominncia de algumas espcies pode moscas-brancas e de vrus, dificulta esse controle.
ser devido a diferenas na adaptao ao tomateiro Assim como em fabceas, o manejo de begomovrus
(Alves-Junior et al., 2009) ou diferenas na eficincia em tomateiro requer um programa de manejo
de transmisso pelo vetor (Macedo et al., 2015). Uma integrado de pragas (Gilbertson et al., 2011).
vez que os vrus estejam estabelecidos no tomateiro, Em pimenteiras (Capsicum annuum, C.
as plantas no-cultivadas passam a servir como frutescens, C. chinense e C. baccatum), a ocorrncia
reservatrio natural e fonte de inculo primrio de begomovrus parece ser menos expressiva,

14 RAPP - Volume 24, 2016


Alice Kazuko Inoue-Nagata, et al. (7-29)

provavelmente pela baixa atratividade dessas plantas vrus. Os begomovrus tm sido observados em
s populaes de B. tabaci presentes no Brasil (em batata-doce em todo o mundo, inclusive no Brasil.
contraste com outros pases como ndia e Mxico). At o momento, dois begomovrus foram relatados
Os begomovrus causam em pimenteiras sintomas na cultura: Sweet potato leaf curl virus (SPLCV) e
de manchas clorticas e deformao foliar (Figura Sweet potato leaf curl Sao Paulo virus (SPLCSPV)
1C). Em 2001, Lima e colaboradores relataram a (Albuquerque et al., 2012a; Albuquerque et al.,
ocorrncia de begomovrus em C. annuum (Lima, 2011; Paprotka et al., 2010a; Brown et al., 2015).
2001), seguido do relato de ToSRV em C. baccatum Ambos possuem genoma monossegmentado, em
(Bezerra-Agasie et al., 2006) e Tomato golden vein contraste com os begomovrus relatados em outras
virus (TGVV) e ToYVSV em pimento (Nozaki, 2010). culturas cujos genomas so bissegmentados. Apesar
Em batateira, houve nos anos recentes de estarem amplamente disseminados no pas,
um destacado aumento da infestao de moscas- no h conhecimento sobre danos causados por
brancas. Junto com a alta populao de moscas- begomovrus nesta cultura.
brancas, cresceu a incidncia da virose conhecida
como mosaico deformante da batateira. O primeiro 3.4. Begomovrus em malvceas
relato de begomovrus em batateira data da dcada Uma paisagem comum pode ser
de 1980, mais tarde confirmado como uma infeco frequentemente observada em reas rurais,
causada por ToYVSV (Ribeiro, 2006). Atualmente principalmente em pastagens: pontos amarelos em
so relatadas a ocorrncia de ToYVSV e ToSRV nas meio vegetao verde. Ao se aproximar, verifica-
principais regies produtoras de batata do Brasil se que so malvceas cujas folhas apresentam forte
(Albuquerque et al., 2010; Souza-Dias et al., 2008). sintoma de clorose e mosaico. Trata-se da clorose
Assim, verifica-se que os mesmos begomovrus variegada das malvceas. Essas plantas chamaram a
infectam tomateiros, pimenteiras e batateiras. ateno de inmeros pesquisadores no Brasil e foram
Os begomovrus constituem o grupo mais alvo de relatos pioneiros nas dcadas de 1930-1960.
numeroso de geminivrus, e certamente so os Foi possvel verificar naquela poca que o agente
mais importantes economicamente no Brasil. No causal da clorose variegada das malvceas tinha
entanto, h relatos da ocorrncia de vrus causando como vetor a mosca-branca e que o agente etiolgico
encrespamento apical em fumo e tomateiro no Brasil, [que se acreditava ser o Abutilon mosaic virus,
e que seriam transmitidos por cigarrinhas (Agallia descrito no incio do sculo XX na Alemanha (Baur,
albidul) (Bennett, 1949). Embora a identidade 1906)] causava mosaico em diversas malvceas,
desses vrus no tenha sido confirmada por mtodos incluindo Sida spp. e algodoeiro (Costa, 1937;
moleculares, os sintomas e a transmisso por Costa, 1955; Orlando, 1946; Costa, 1960; Costa,
cigarrinha sugerem que seriam curtovrus (um outro 1954 ). Entretanto, a caracterizao de begomovrus
gnero da famlia Geminiviridae). No h relatos em malvceas, realizada utilizando ferramentas
recentes desses vrus no Brasil e, portanto, essa moleculares, no confirmou a presena de Abutilon
questo permanece indefinida. mosaic virus no Brasil. Todos os begomovrus
relatados em malvceas no pas at o presente so
3.3. Begomovrus em batateira-doce de ocorrncia exclusiva no Brasil: Cotton chlorotic
A batata-doce, devido a sua caracterstica spot virus (CCSV), Melochia mosaic virus (MelMV),
de propagao vegetativa, enfrenta uma srie de Melochia yellow mosaic virus (MelYMV), Okra mottle
problemas fitossanitrios, principalmente pela virus (OMoV), Pavonia mosaic virus (PavMV), Pavonia
ausncia de um programa de produo de material yellow mosaic virus (PavYMV), Sida common mosaic
propagativo livre de vrus. Justamente devido falta virus (SiCmMV), Sida mottle Alagoas virus (SiMoAV),
de propgulos comprovadamente sadios, a avaliao Sida mottle virus (SiMoV), SiMMV, Sida yellow blotch
da importncia dos vrus que infectam a batata-doce virus (SiYBV),Sida yellow leaf curl virus (SiYLCV), Sida
dificultada. Os begomovrus causam sintomas yellow mosaic Alagoas virus (SiYMAV), Sida yellow
como enrolamento foliar, mosqueado e clareamento mosaic virus (SiYMV), Sida yellow net virus (SiYNV)
de nervuras, porm a diagnose complexa pela (Almeida et al., 2013, Barreto et al., 2013, Castillo-
possvel ocorrncia de infeco mista com outros Urquiza et al., 2008, Fiallo-Oliv et al., 2015, Jovel et

RAPP - Volume 24, 2016 15


Alice Kazuko Inoue-Nagata, et al. (7-29)

al., 2004, Pinto et al., 2015, Tavares et al., 2012). Uma virus (ToCrLYV) j foi demonstrada (Andrade et al.,
ou mais dessas espcies podem ter sido responsveis 2006).
pela clorose variegada das malvceas estudada nas Um exemplo do grau de promiscuidade entre
dcadas de 1930-1960. os begomovrus que infectam o tomateiro no Brasil,
3.5. A alta diversidade dos begomovrus no Brasil com infeces mistas que facilitam a ocorrncia de
Um grande nmero de begomovrus eventos de recombinao e pseudo-recombinao,
infectando plantas no-cultivadas tem sido aquele envolvendo o Tomato rugose mosaic virus
caracterizado no Brasil (Arnaud et al., 2007; Castillo- (ToRMV) e o ToSRV. A identidade das sequncias de
Urquiza et al., 2008; Silva et al., 2012; Silva et al., nucleotdeos do DNA-A dos dois vrus de 86%, porm
2011; Tavares et al., 2012; Fernandes et al., 2011; para o DNA-B de 98%, indicando que na verdade
Pinto et al., 2015; Fiallo-Oliv et al., 2015; Blawid esses dois vrus constituem pseudo-recombinantes
et al., 2013; Paprotka et al., 2010b; Paprotka et al., naturais, no qual dois DNA-A distintos compartilham
2010a). A anlise comparativa de populaes de o mesmo DNA-B. Todas as combinaes possveis
begomovrus encontradas em plantas cultivadas entre o DNA-A e o DNA-B de isolados dos dois
e no-cultivadas indicou que aquelas infectando vrus apresentam o mesmo grau de infectividade e
plantas no-cultivadas apresentam um grau de induzem os mesmos sintomas em tomateiro (Silva
variabilidade gentica mais elevado em comparao et al., 2014). Alm disso, o DNA-A do ToRMV inclui
quelas presentes em plantas cultivadas (Lima et al., um fragmento recombinante doado pelo ToSRV, com
2013; Rocha et al., 2013). Um estudo comparando cerca de 1400 nt, incluindo a maior parte do gene
populaes dos begomovrus MaYSV (proveniente Rep (Ribeiro et al., 2007; Silva et al., 2014). Assim, a
de Macroptilium lathyroides) e ToSRV (proveniente origem do ToRMV envolve eventos de recombinao
de tomateiro) sugeriu que a recombinao, e no a e pseudo-recombinao com o ToSRV. interessante
seleo adaptativa, explica a maior variabilidade de ressaltar que o ToSRV muito mais comumente
begomovrus em hospedeiros no-cultivados (Lima et encontrado no campo do que o ToRMV. Entretanto,
al., 2013). Os resultados desses trabalhos do suporte em infeces mistas envolvendo componentes
hiptese de que os begomovrus encontrados em genmicos dos dois vrus, os componentes do ToRMV
tomateiro no Brasil so originados de vrus nativos so replicados preferencialmente em relao aos do
presentes em plantas no-cultivadas, e que aps a ToSRV (Silva et al., 2014). Os autores propem que
transferncia para o tomateiro as populaes virais a prevalncia do ToSRV no campo pode ser devida
evoluram rapidamente, originando novas espcies transmisso preferencial pelo inseto vetor, somado
mais adaptadas ao novo hospedeiro. ocorrncia de infeces simples apenas pelo ToSRV.
A presena de diversas espcies no campo,
todas transmitidas pelo mesmo inseto vetor, torna 3.6. Caractersticas da transmisso de
comum a ocorrncia de infeces mistas, com begomovrus por B. tabaci
dois ou mais vrus presentes simultaneamente na O gnero Begomovirus contm o maior
mesma planta, aumentando a probabilidade da nmero de vrus transmitidos por B. tabaci (Navas-
ocorrncia de eventos de recombinao e pseudo- Castillo et al., 2011a; Gilbertson et al., 2015) e
recombinao, o que pode levar ao surgimento de o vrus-modelo para estudos de transmisso o
espcies melhor adaptadas ao hospedeiro (Andrade TYLCV. Vrios estudos demonstram que a eficincia
et al., 2006; Inoue-Nagata et al., 2006; Ribeiro et de transmisso de begomovrus varia de acordo
al., 2007). Evidncias de recombinao e pseudo- com as diferentes espcies crpticas de B. tabaci, e
recombinao j foram encontradas em associao mesmo entre populaes da mesma espcie. As
ao complexo de begomovrus infectando o tomateiro diferenas na habilidade de transmisso podem ser
no Brasil. Galvo et al. (2003)2003 e Ribeiro et al. atribudas a hbitos alimentares, aos hospedeiros
(2007) sugeriram que os isolados MG-Bt1 e BA-Se1 do preferencialmente colonizados, constituio de
ToCMoV possuem origem recombinante. A formao endossimbiontes secundrios na mosca branca, e
de pseudo-recombinantes viveis entre clones principalmente constituio gentica (Ghanim,
infecciosos do TGMV (DNA-A) e ToYSV (DNA-B), e 2014; revisado por Rosen et al., 2015).
entre o ToYSV (DNA-A) e o Tomato crinkle leaf yellow Ghanim et al. (1998) verificaram que um

16 RAPP - Volume 24, 2016


Alice Kazuko Inoue-Nagata, et al. (7-29)

isolado de TYLCV proveniente de Israel foi transmitido et al., 2015). Alm disso, a alimentao em plantas
de forma transovariana de fmeas virulferas para infectadas pelo TYLCV tem um efeito negativo sobre
sua prognie, bem como entre copulaes entre MEAM1 e positivo sobre MED. Estas diferenas de
fmeas e machos (Ghanim e Czosnek, 2000). Bosco comportamento das duas espcies podem explicar
et al. (2004) detectaram o DNA do Tomato yellow a substituio de MEAM1 por MED como a espcie
leaf curl Sardinia virus (TYLCSV) em ovos, ninfas dominante na China (Liu et al., 2013), e sugerem que
e raramente em adultos da primeira gerao da a espcie MED pode se tornar prevalente tambm no
prognie, indicando transmisso do DNA de forma Brasil.
transovariana, porm este DNA no foi infectivo, No caso de begomovrus brasileiros, os
sendo portanto sem relevncia epidemiolgica. primeiros estudos apontaram que os vrus podem
A relao vrus-vetor do tipo persistente ser adquiridos pelos insetos durante perodos muito
circulativa. O incio da transmisso ocorre aps um curtos (~10 min) de alimentao, e que a taxa de
perodo de latncia, que corresponde ao tempo transmisso aumenta com o aumento do tempo de
necessrio para que as partculas virais atravessem alimentao na fonte de vrus, at 24 horas, e com o
todas as barreiras do inseto e alcancem as glndulas perodo de inoculao na planta sadia (Costa, 1998).
salivares (Ghanim, 2014). O perodo de latncia para Trabalhos realizados com o ToSRV confirmaram que
o TYLCV foi inicialmente definido como sendo de 21 a aquisio do vrus pode ocorrer com um minuto
horas (Cohen e Nitzany, 1966; citados por Ghanim, de alimentao na planta (J.A.M. Rezende, dados
2014) e mais recentemente de 8 horas (Ghanim et no publicados), porm a eficincia de transmisso
al., 2001). O estilete de B. tabaci penetra a epiderme aumenta medida que o inseto tem maior perodo
da planta e move intracelularmente pelo parnquima de acesso aquisio do vrus (Freitas, 2012). O
at alcanar o floema, local onde os begomovrus perodo de reteno do ToSRV na mosca-branca pode
so adquiridos e transmitidos. O perodo mnimo chegar a 25 dias (Freitas et al., 2012). Com relao
de acesso aquisio (PAA) do TYLCV (isolados do ao ToYVSV, verificou-se que o perodo mnimo de
Oriente Mdio) varia de 15 a 60 minutos e o perodo acesso de aquisio de 30 minutos e o perodo de
mnimo de inoculao (PAI) de 15 a 30 minutos. No acesso de inoculao de 10 minutos (Firmino et al.,
inseto, os vrus se movem pelo canal alimentar at 2009). Estudos realizados com o ToRMV constataram
alcanar o intestino mdio (midgut), atravessam as que os perodos mnimos de acesso de aquisio e
clulas epiteliais do intestino para cair na hemolinfa inoculao do vrus foram de 15 minutos e de 30
e serem levados s glndulas salivares, de onde sero minutos, respectivamente. O perodo de latncia
liberados no interior da planta pela salivao do foi superior a 16 horas. A capacidade do inseto em
inseto durante o processo de alimentao (Ghanim, transmitir o vrus aumentou com o aumento do
2014). perodo de aquisio (Santos et al., 2003).
A presena do endossimbionte secundrio A populao predominante do vetor e a
de B. tabaci, Hamiltonella defensa, essencial para capacidade de transmisso de cada espcie de
a transmisso do TYLCV pela mosca-branca. Este begomovrus podem influenciar de forma decisiva
endossimbionte produz uma protena de 63kDa, a prevalncia de espcies virais no campo e, por
homloga protena GroEL de E. coli, com a provvel conseguinte, impactar a incidncia, a severidade e a
funo de proteger as partculas virais da protelise distribuio das viroses, e a resistncia das plantas.
incitada pelo sistema imune do inseto (Morin et Acredita-se que B. tabaci NW era a nica espcie
al., 1999; Morin et al., 2000). Bemisia tabaci pode presente no Brasil at a dcada de 1990, quando
transmitir o TYLCV por vrias semanas e muitas os begomovrus ocorriam em feijoeiro, malvceas e
vezes durante todo o seu perodo de vida, porm a euforbiceas. Aps a introduo de B. tabaci MEAM1,
eficincia de transmisso reduz com a idade do inseto verificou-se a rpida emergncia de begomovrus em
(Rubinstein e Czosnek, 1997). Insetos da espcie MED tomateiro, o amarelo em meloeiro e o amarelo em
passam mais tempo se alimentando e salivando em tomateiro, alm do mosaico dourado do feijoeiro.
comparao com a espcie MEAM1 (Liu et al., 2012; O carter polfago de B. tabaci MEAM1 certamente
Liu et al., 2013), e consequentemente adquirem contribuiu para a transferncia dos begomovrus
e transmitem o TYLCV com maior eficincia (Ning nativos no pas, presentes em espcies silvestres

RAPP - Volume 24, 2016 17


Alice Kazuko Inoue-Nagata, et al. (7-29)

e daninhas, para plantas cultivadas. Isso tambm Um relato de infeco dessa solancea por um
influenciou de forma decisiva a elevao da taxa closterovrus, no completamente caracterizado,
de infeco mista de vrus na mesma planta, na regio de Campinas, SP, em 1998, cuja descrio
desencadeando a ocorrncia de processos de dos sintomas semelhante descrita para o ToCV,
recombinao e pseudo-recombinao entre os foi feito por Pavan et al. (1999). Mais tarde o ToCV
vrus, descritos anteriormente. Um exemplo do efeito foi encontrado nos estados de MG, RJ, ES, GO e BA
da relevncia desta inter-relao entre vrus-vetor o (Barbosa et al., 2011). possvel que o ToCV ocorra
relato da maior taxa de transmisso de um isolado em outras regies do pas, visto infectar espcies de
de ToSRV quando em infeco mista com o TGVV solanceas que ocorrem em todo territrio nacional
(Macedo et al., 2015). Isso sugere que a prevalncia e ser transmitido por um vetor cosmopolita.
atual de ToSRV em tomateiro relacionada com a No Brasil, alm do tomateiro e do pimento,
ampla disperso de B. tabaci MEAM1 e eficiente o ToCV j foi encontrado infectando naturalmente
transmisso de ToSRV por esse vetor. Um outro outras espcies cultivadas de solanceas como a
estudo foi realizado com Euphorbia yellow mosaic batateira (Freitas et al., 2012), a berinjela e o jiloeiro
virus (EuYMV) em Euphorbia heterophylla. A espcie (Fonseca et al., 2015). A incidncia do ToCV, tanto
nativa B. tabaci NW2 uma excelente vetora do no Brasil como em outros pases, principalmente em
EuYMV comparada a MEAM1, sugerindo que NW2 tomateiro e pimenteira bastante varivel, podendo
pode ter um papel crucial na disperso desse vrus em alguns casos chegar a 100% (Barbosa et al., 2008;
no Brasil (Marchi, 2014). Conforme mencionado Dovas et al., 2002; Fortes et al., 2012; Macedo et al.,
anteriormente, a recente introduo de B. tabaci 2014; Navas-Castillo et al., 2000; Orfanidou et al.,
MED pode ocasionar mudanas significativas na 2014; Velasco, 2008). O efeito do ToCV na produo
ocorrncia de viroses no Brasil, seja em culturas ainda no foi avaliado de maneira quantitativa para
onde as viroses associadas a moscas-brancas j so a maioria das solanceas cultivadas, com exceo
importantes ou em culturas em que essas viroses no do pimento (Fortes et al., 2012) e do tomateiro
so relatadas ou ocorrem em baixa incidncia. (Mansilla, 2015). Para o pimento, em avaliaes
experimentais em casa-de-vegetao, encontraram-
4. Crinivrus em tomateiro e pimento se redues na produo da ordem de 45-75%, em
Tomato chlorosis virus (ToCV) e Tomato funo da variedade. Em ensaios de avaliao de
infectious chlorosis virus (TICV) so as duas nicas resistncia/tolerncia de diferentes gentipos de
espcies do gnero Crinivirus (famlia Closteroviridae) tomateiro ao amarelo causado pelo ToCV, a reduo
associadas com doenas de importncia econmica, do peso dos frutos colhidos das plantas infectadas
principalmente na cultura do tomateiro, em diferentes quando jovens variou de 21 a 52 %, dependendo do
pases. O TICV j foi relatado em 12 pases, localizados gentipo.
principalmente na Amrica do Norte, Europa e sia, Os sintomas induzidos pelo ToCV em
mas at o presente no foi encontrado no Brasil tomateiros aparecem normalmente aps trs a
(Navas-Castillo et al., 2011). O ToCV j foi relatado quatro semanas da inoculao e caracterizam-se
em 23 pases, entre os quais o Brasil (Barbosa et al., principalmente por reas clorticas internervais
2008). nas folhas baixeiras (Figura 1E). Esse sintoma pode
O ToCV foi identificado pela primeira vez vir acompanhado por bronzeamentos ou manchas
infectando tomateiros na Florida, EUA, causando avermelhadas, enrolamento das margens das folhas
a doena denominada yellow dwarf disorder, para cima e engrossamento do limbo foliar, que se
inicialmente atribuda a fatores nutricionais torna quebradio. No h sintomas em flores e frutos
(Simone et al., 1996; Wisler et al., 1998). A partir (Wisler et al., 1998). Os mesmos sintomas j foram
de ento esta espcie de crinivrus foi encontrada observados em plantas de pimento e batateira.
infectando tomateiro e pimento em mais de 20 Apesar de no ocorrerem sintomas bvios nas frutas,
pases (Navas-Castillo et al., 2011b). No Brasil, o a produo frequentemente afetada pela reduo
ToCV foi primeiramente constatado em tomateiros do tamanho e do nmero de frutos.
no municpio de Sumar, So Paulo (Barbosa et al., O ToCV apresenta partculas alongadas e
2008), causando a doena denominada amarelo. flexuosas, com comprimentos que variam de 800 -

18 RAPP - Volume 24, 2016


Alice Kazuko Inoue-Nagata, et al. (7-29)

850 nm (Liu et al., 2000). O genoma composto por Wisler, 2006). B. tabaci MEAM1 e T. abutilonea so
duas molculas de RNA de fita simples, senso positivo. os vetores mais eficientes do vrus. Este persiste
Os RNA1 e RNA2 do isolado brasileiro possuem 8594 por at cinco dias em T. abutilonea, trs dias em B.
e 8242 nt, respectivamente (Albuquerque et al., tabaci MEAM1, e apenas um dia em B. tabaci NW1
2013), e apresentam as caractersticas tpicas de e T. vaporariorum (Wintermantel e Wisler, 2006).
outros isolados do ToCV cujos genomas completos A aquisio e a transmisso do vrus pelos vetores
esto depositados em bancos de dados pblicos: ocorrem aps curtos perodos de alimentao,
o RNA1 apresenta quatro genes, dos quais os dois embora a transmisso seja mais eficiente aps
maiores codificam protenas associadas replicao, algumas horas. No Brasil no h relato da presena
e o RNA2 possui nove genes que codificam protenas de T. abutilonea, porm sabe-se que T. vaporariorum
associadas com a proteo do genoma, movimento, tambm transmite o ToCV (Freitas et al., 2012). O
transmisso pelo vetor e outras funes ainda no ToCV no transmitido por extrato vegetal (Dovas et
identificadas (Albuquerque et al., 2013; Wintermantel al., 2002). Tambm no h evidncia de transmisso
e Wisler, 2006). Ambos componentes genmicos por sementes. Ressalte-se que o TICV transmitido
codificam protenas com atividade de supresso do de maneira semi-persistente somente por T.
silenciamento de RNA (Canizares et al., 2008). vaporariorum (Navas-Castillo et al., 2011).
Anlises filogenticas realizadas com base nas A deteco do ToCV em plantas sintomticas,
sequncias de nucleotdeos dos genes que codificam bem como a sua diferenciao do TICV, pode ser
a protena HSP70h (homloga da heat shock feita por RT-PCR (Dovas et al., 2002; Wintermantel
protein) e do genoma completo de isolados do ToCV e Hladky, 2010) e hibridizao com sonda de cido
indicaram alto nvel de conservao dos isolados nuclico (Fortes et al., 2012; Garca-Cano et al.,
brasileiros, com identidades de sequncia superiores 2010). Adicionalmente, o ToCV e o TICV podem ser
a 99% (Albuquerque et al., 2013; Barbosa et al., 2013). diferenciados e identificados por meio da transmisso
Em ambos os trabalhos, as maiores identidades nas pelo vetor, visto que o TICV transmitido somente
sequncias de nucleotdeos ocorreram entre isolados por T. vaporariorum (Navas-Castillo et al., 2011).
de ToCV de pases do Mediterrneo, sugerindo que O manejo do amarelo em tomateiro, bem
os isolados brasileiros devem ter origem a partir de como em outras solanceas cultivadas, baseia-se
uma nica introduo. Wintermantel e Wisler (2006) principalmente no manejo do vetor, por meio de
tambm constataram um alto grau de identidade pulverizaes com inseticidas e prticas culturais.
gentica quando compararam as sequncias de Embora os inseticidas possam reduzir a populao
nucleotdeos do gene que codifica a protena capsidial do vetor, eles no so eficientes no controle da
de isolados do ToCV dos EUA (incluindo Porto Rico) doena, pois geralmente no impedem que insetos
com as sequncias correspondentes de isolados de virulferos inoculem o vrus antes de serem mortos.
outros pases. Tendo em conta que o ToCV no Eliminao de plantaes velhas de solanceas e de
transmitido verticalmente e a relao com o vetor hospedeiros alternativos do vrus, para reduo de
semi-persistente, o mais provvel que a introduo fontes de inculo, deve ser implementada antes do
desse vrus no Brasil tenha acontecido por meio de incio da nova plantao (Tzanetakis et al., 2013). No
material vegetativo infectado (Barbosa et al., 2013). h variedades ou hbridos de tomateiros comerciais
Dados recentes apontam que a gama de resistentes ao ToCV. O mesmo verdadeiro para as
hospedeiros do ToCV envolve 52 espcies de plantas outras espcies de solanceas cultivadas. Solanum
pertencentes a 18 famlias (Kil et al., 2015) e este peruvianum fonte de resistncia ao ToCV que pode
quadro no parece definitivo, pois mais recentemente ser usada em programas de melhoramento para
foram includas as espcies Raphanus sativus, R. desenvolvimento de hbridos de tomateiro resistentes
raphanistrume Eruca sativa (Boiteux et al., 2015). a esse crinivrus (Garca-Cano et al., 2010).
O ToCV um vrus limitado ao floema e
transmitido de forma semi-persistente por vrias 5. Carlavrus em soja e feijoeiro
espcies de mosca-branca: B. tabaci NW1, MEAM1 Na safra de 2000/01, os produtores de
e MED, Trialeurodes abutilonea e T. vaporariorum soja do estado de Gois observaram plantas com
(Navas-Castillo et al., 2011b; Wintermantel e sintomas de nanismo, queima do broto e necrose

RAPP - Volume 24, 2016 19


Alice Kazuko Inoue-Nagata, et al. (7-29)

da haste (Figura 1D), denominando a nova doena 1991; Thouvenel et al., 1982).
de necrose da haste. Acreditava-se que a doena Hospedeiros naturais do CPMMV pertencem
seria de origem fngica, porm estudos com enxertia famlia Fabaceae, e a gama de hospedeiros
comprovaram que a doena tem etiologia viral e a experimentais inclui plantas das famlias
caracterizao molecular, sorolgica, com ensaios Chenopodiaceae e Solanaceae (Marubayashi et al.,
de transmisso e microscopia eletrnica revelaram 2010; Zanardo et al., 2014a). Os sintomas variam
que o vrus causador pertence espcie Cowpea de acordo com o hospedeiro e a poca do ano. Em
mild mottle virus (CPMMV), um carlavrus (Almeida caupi, o CPMMV causa manchas clorticas nas folhas
et al., 2005). Nos anos seguintes, ocorrncias severas primrias e distoro foliar (Brunt e Kenten, 1973).
foram relatadas nos estados do MT, BA, MA, PR e Em feijoeiro, o CPMMV causa clorose das nervuras,
MG, limitando a produo de soja (Almeida et al., clorose internerval, faixa verde das nervuras e mosaico
2005; Zanardo et al., 2014b). em forma de manchas angulares amarelas limitadas
O CPMMV foi descrito pela primeira vez pelas nervuras (mosaico angular) (Costa et al., 1983).
infectando caupi (Vigna unguiculata) em Gana, Em plantas de soja, causa clorose e mosaico nas
onde foram observados sintomas como mosqueado, folhas, necrose apical, distoro e nanismo (Figura
manchas clorticas e deformao foliar (Brunt e 1D). Os sintomas em soja tornam-se mais aparentes
Kenten, 1973; Menzel et al., 2010; Naidu et al., 1998; na poca de surgimento das vagens: queima do broto
Tavassoli et al., 2008). Desde ento sua ocorrncia e necrose das hastes, que pode levar morte das
tem sido relatada em diversos hospedeiros da famlia plantas (Almeida et al., 2005; Zanardo et al., 2014a).
Fabaceae em diferentes regies geogrficas (Menzel As caracterizaes biolgica, molecular e de
et al., 2010; Naidu et al., 1998; Tavassoli et al., 2008). diversidade gentica do CPMMV mostraram que os
O primeiro relato de CPMMV no Brasil ocorreu em seis isolados brasileiros cujos genomas completos
1979, causando uma virose do feijoeiro denominada foram sequenciados constituem uma estirpe do
mosaico angular (Costa et al., 1983). O vrus causador CPMMV, denominada CPMMV-BR, enquanto o
do mosaico angular, na poca denominado Bean isolado relatado em Gana corresponderia a uma
angular mosaic virus (BAMV), foi observado tambm estirpe distinta (Zanardo et al., 2014b)2014b. Dentre
no Paran infectando outras fabceas, incluindo a soja os seis isolados brasileiros, cinco so altamente
(Costa et al., 1983). Mais tarde, estudos sorolgicos relacionados, e um isolado (BR:GO:01:1) possui um
realizados por Gaspar e Costa (1993) comprovaram relacionamento um pouco mais distante devido a um
que o BAMV era idntico ao CPMMV descrito em evento de recombinao englobando as ORFs 2 a 6
Gana (Brunt e Kenten, 1973). (Zanardo et al., 2014b).
O CPMMV pertence ao gnero Carlavirus, A emergncia da necrose da haste em soja
famlia Betaflexiviridae, que inclui vrus de partculas preocupou os sojicultores inicialmente, porm o uso
flexuosas com dimenses de aproximadamente 610- de cultivares com tolerncia doena (Arias et al.,
700 nm de comprimento e 12-15 nm de dimetro 2015) amenizou o problema. No h informaes
(Adams et al., 2012). Seu genoma composto de na literatura sobre danos causados pelo CPMMV em
RNA fita simples, sentido positivo, com comprimento outras culturas no Brasil.
entre 6500 e 8600 nt. Sequncias completas de nove
isolados de CPMMV esto disponveis em bancos de 6. Carlavrus em meloeiro
dados pblicos. A doena conhecida como amarelo do
A transmisso natural de CPMMV ocorre de meloeiro foi observada em plantios comerciais do
forma no-persistente pelo vetor B. tabaci MEAM1 municpio de Baranas, RN, em 1997. O sintoma
(Marubayashi et al., 2010). O CPMMV, juntamente principal a clorose generalizada nas folhas mais
com o Melon yellowing-associated virus (MYaV), velhas (Figura 1F), de colorao amarelo intensa.
so os nicos carlavrus transmitidos por mosca- O sintoma de amarelecimento foliar aparece
branca, sendo os demais comumente transmitidos inicialmente nas folhas velhas e depois atinge as
por afdeos (Nagata et al., 2003). Tambm h relatos folhas mais novas (Nagata et al., 2003). Nas folhas
da ocorrncia de transmisso de alguns isolados do medianas, sintomas de mosaico so normalmente
CPMMV via extrato vegetal e semente (Horn et al., observados. Nas plantas doentes no se observa

20 RAPP - Volume 24, 2016


Alice Kazuko Inoue-Nagata, et al. (7-29)

alterao no tamanho e peso dos frutos, porm h importante no Nordeste em cultivos de meloeiro,
diminuio do contedo de slidos solveis (grau tanto para exportao como para o consumo interno
Brix), o que restringe a exportao dos frutos. A causa dos frutos.
da doena ficou por muitos anos desconhecida, com
a hiptese de alguma desordem nutricional sendo a 7. Consideraes finais
mais favorecida. Testes de transmisso por enxertia A mosca-branca representa um dos problemas
demonstraram o carter patognico da doena mais preocupantes da agricultura mundial. No Brasil,
(Nagata et al., 2003). Verificou-se tambm que o contrastando com a ocorrncia de viroses associadas
vrus transmitido por mosca-branca (Santos, 2004; a B. tabaci anteriormente restrita a fabceas e
Nagata et al., 2003). Mais tarde, verificou-se em malvceas, a lista atual de culturas afetadas pelo
tecido de meloeiro doente a presena de incluses inseto extensa. Acredita-se que dois fatores
citoplasmticas semelhantes queles produzidos por estejam particularmente envolvidos com a exploso
carlavrus. Foi detectada, em seguida, a presena da mosca-branca no Brasil, notadamente a partir da
de um vrus de RNA com organizao genmica dcada de 1990: a expanso da cultura da soja e a
semelhante a um carlavrus e a sequncia parcial do introduo de B. tabaci MEAM1. Levando-se em
seu genoma demonstrou ser um vrus desconhecido, conta tambm o aumento da rea irrigada na regio
nomeado como Melon yellowing-associated virus do cerrado, o sistema agrcola brasileiro propicia a
(MYaV) (Nagata et al., 2005, Nagata et al., 2003). constante e abundante presena de alimento para B.
Esse vrus distinto de outros carlavrus, que so em tabaci. A caracterstica de alta polifagia de B. tabaci
geral transmitidos por afdeos (exceo tambm do MEAM1, em comparao a B. tabaci NW, tambm
CPMMV). foi essencial para disperso e estabelecimento deste
O MYaV apresenta partculas alongadas e inseto por todo territrio brasileiro. A presena
flexuosas, com comprimentos que variam de 600 - de grande diversidade de vrus eficientemente
700 nm (Nagata et al., 2003). O genoma formado por transmitidos por este inseto em plantas nativas e
uma molcula de RNA de fita simples. Apenas parte invasoras desencadeou a emergncia de diversas
da sequncia genmica foi determinada, incluindo doenas de importncia econmica. Hoje, viroses
os 1612 nt da extremidade 3 (Nagata et al., 2005). importantes so relatadas em fabceas, solanceas
Esta regio contm duas ORFs em sobreposio, a e cucurbitceas, causando prejuzos altssimos para
que codifica a protena capsidial e a possvel protena a cadeia produtiva. possvel que os danos causados
que se liga a cidos nucleicos, seguida da regio 3 pelos vrus associados a B. tabaci aumentem, face
no-traduzida (3UTR) e uma cauda poliadenilada. os relatos recentes de ocorrncia de begomovrus
Essa organizao genmica tpica dos carlavrus. em culturas como soja, algodoeiro e maracujazeiro;
A protena capdisial apresenta a maior identidade ou com a introduo de novo begomovrus em
com a sequncia do carlavrus Garlic latent virus, um cucurbitceas e brssicas, crinivrus em cucurbitceas
carlavrus relatado somente no Brasil. e torradovrus em tomateiro. Fica claro que a
O MYaV um vrus restrito ao floema, introduo de B. tabaci MEAM1 no Brasil, seguido da
que se encontra em baixa concentrao na planta sua rpida disperso em todas as reas agrcolas, foi
infectada e no transmissvel via extrato vegetal. decisiva para os problemas atuais. Entretanto, ainda
Testes sorolgicos demonstraram a associao entre no se sabe o que acontecer com a disperso de
plantas de meloeiro com sintomas e a presena do B. tabaci MED, recentemente encontrada no Brasil.
MYaV (vila et al., 2008, Lima et al., 2009). Esforos Necessita-se de mais grupos atuando na pesquisa
para o desenvolvimento de cultivares resistentes com esses vrus e insetos. H tambm necessidade
esto sendo realizados, porm ainda no h oferta de viabilizar a realizao de um conjunto de prticas
de meloeiros com resistncia ao vrus. Atualmente, visando o manejo integrado de pragas em nvel
a doena controlada com o uso de um tnel de regional, considerando toda a paisagem agrcola e
TNT (tecido-no-tecido) sobre as plantas desde a natural.
fase inicial de desenvolvimento at a florao, aps o
qual a transmisso do vrus ocorre e afeta o meloeiro 8. Referncias
no final de cultivo. A doena particularmente Adams MJ, Candresse T, Hammond J, Kreuze JF,

RAPP - Volume 24, 2016 21


Alice Kazuko Inoue-Nagata, et al. (7-29)

Martelli GP, Namba S, Pearson MN, Ryu KH, Otoni WC, Zerbini FM (2009) Synergism and
Saldarelli P, Yoshikawa N (2012) Betaflexiviridae. negative interference during co-infection of
In: King AMQ, Adams MJ, Carstens EB, Lefkowitz tomato and Nicotiana benthamiana with two
EJ (Eds.) Virus Taxonomy - Ninth Report of the bipartite begomoviruses. Virology 387:257-266.
International Committee on Taxonomy of Viruses. Ambrozevicius LP, Calegario RF, Fontes EPB, Carvalho
San Diego, EUA, Elsevier Academic Press. pp. 920- MG, Zerbini FM (2002) Genetic diversity of
941. begomoviruses infecting tomato and associated
Albuquerque LC, Inoue-Nagata AK, Pinheiro B, weeds in Southeastern Brazil. Fitopatologia
Resende RO, Moriones E, Navas-Castillo J (2012a) Brasileira 27:372-377.
Genetic diversity and recombination analysis of Andrade EC, Manhani GG, Alfenas PF, Calegario RF,
sweepoviruses from Brazil. Virology Journal 9:241. Fontes EPB, Zerbini FM (2006) Tomato yellow spot
Albuquerque LC, Inoue-Nagata AK, Pinheiro B, Ribeiro virus, a tomato-infecting begomovirus from Brazil
SG, Resende RO, Moriones E, Navas-Castillo J with a closer relationship to viruses from Sida sp.,
(2011) A novel monopartite begomovirus infecting forms pseudorecombinants with begomoviruses
sweet potato in Brazil. Archives of Virology from tomato but not from Sida. Journal of General
156:1291-1294. Virology 87:3687-3696.
Albuquerque LC, Martin DP, Avila AC, Inoue-Nagata Arago FJ, Nogueira EO, Tinoco ML, Faria JC (2013)
AK (2010) Characterization of tomato yellow vein Molecular characterization of the first commercial
streak virus, a begomovirus from Brazil. Virus transgenic common bean immune to Bean golden
Genes 40:140-147. mosaic virus. Journal of Biotechnology 166:42-50.
Albuquerque LC, Varsani A, Fernandes FR, Pinheiro B, Arias CAA, Almeida AMR, Mituti T, Kitajima EW (2015)
Martin DP, Ferreira PTO, Lemos TO, Inoue-Nagata Inheritance of tolerance to cowpea mild mottle
AK (2012b) Further characterization of tomato- virus in soybean. Crop Breeding and Applied
infecting begomoviruses in Brazil. Archives of Biotechnology 15:132-138.
Virology 157:747-752. Arnaud LSEP, Santos CDG, Lima JAA, Feitosa FAA
Albuquerque LC, Villanueva F, Resende RO, Navas- (2007) Predominance of begomoviruses in
Castillo J, Barbosa JC, Inoue-Nagata AK (2013) tomatoes in the region of Serra de Ibiapaba, Cear
Molecular characterization reveals Brazilian state, and their detection in weeds. Fitopatologia
Tomato chlorosis virus to be closely related to a Brasileira 32:241-246.
Greek isolate. Tropical Plant Pathology 38:332- vila AC, Inoue-Nagata AK, F.M. N, Matos LG, Dias
336. RCS, Rangel M, Nagata T (2008) Production of
Alemandri V, De Barro P, Bejerman N, Arguello- antiserum and detection of melon yellowing-
Caro EB, Dumon AD, Mattio MF, Rodriguez SM, associated virus by DAS-Elisa on melon. Tropical
Truol G (2012) Species within the Bemisia tabaci Plant Pathology 33:245-247.
(Hemiptera: Aleyrodidae) complex in soybean Barbosa JC, Costa H, Gioria R, Rezende JAM (2011)
and bean crops in Argentina. Journal of Economic Occurrence of Tomato chlorosis virus in tomato
Entomology 105:48-53. crops in five Brazilian states. Tropical Plant
Almeida AMR, Piuga FF, Marin SRR, Kitajima EW, Pathology 36:256-258.
Gaspar JO, Oliveira TGO, Moraes TG (2005) Barbosa JC, Rezende JAM, Bergamin-Filho A (2013)
Detection and partial characterization of a Low genetic diversity suggests a single introduction
carlavirus causing stem necrosis of soybean in and recent spread of Tomato chlorosis virus in
Brazil. Fitopatologia Brasileira 30:191-194. Brazil. Journal of Phytopathology 161:884-886.
Almeida MM, Jain S, Barroso PA, Hoffmann LV, Barbosa JC, Teixeira APM, Moreira AG, Camargo
Lucena MG, Resende RO, Inoue-Nagata AK LEA, Bergamin-Filho A, Kitajima EW, Rezende
(2013) Complete sequence of a new bipartite JAM (2008) First report of Tomato chlorosis virus
begomovirus infecting cotton plants in Brazil. infecting tomato crops in Brazil. Plant Disease
Genome Announcements 1:e00661-13. 92:1709.
Alves-Junior M, Alfenas-Zerbini P, Andrade EC, Barbosa LF, Marubayashi JM, De Marchi BR, Yuki VA,
Esposito DA, Silva FN, Cruz ACF, Ventrella MC, Pavan MA, Moriones E, Navas-Castillo J, Krause-

22 RAPP - Volume 24, 2016


Alice Kazuko Inoue-Nagata, et al. (7-29)

Sakate R (2014) Indigenous American species of Reaction of tomato hybrids carrying the Ty-1
the Bemisia tabaci complex are still widespread in locus to Brazilian bipartite begomovirus species.
the Americas. Pest Management Science 70:1440- Horticultura Brasileira 25:20-23.
1445. Bosco D, Mason G, Accotto GP (2004) TYLCSV DNA,
Barbosa LF, Yuki VA, Marubayashi JM, De Marchi but not infectivity, can be transovarially inherited
BR, Perini FL, Pavan MA, Barros DR, Ghanim M, by the progeny of the whitefly vector Bemisia
Moriones E, Navas-Castillo J, Krause-Sakate R tabaci (Gennadius). Virology 323:276-283.
(2015) First report of Bemisia tabaci Mediterranean Brown JK, Frohlich DR, Rosell RC (1995) The sweet-
(Q biotype) species in Brazil. Pest Management potato or silverleaf whiteflies - biotypes of Bemisia
Science 71:501-504. tabaci or a species complex. Annual Review of
Barreto SS, Hallwass M, Aquino OM, Inoue-Nagata Entomology 40:511-534.
AK (2013) A study of weeds as potential inoculum Brown JK, Fauquet CM, Briddon RW, Zerbini FM,
sources for a tomato-infecting begomovirus in Moriones E, Navas-Castillo J (2012) Family
central Brazil. Phytopathology 103:436-444. Geminiviridae. In: King AMQ, Adams MJ, Carstens
Baur E (1906) Uber die infektiose Chlorose der EB, Lefkowitz EJ (Eds.) Virus Taxonomy. Ninth
Malvaceas. S. B. Preuss Akad. Wiss. 1:11-29. Report of the International Committee on
Bedford ID, Briddon RW, Brown JK, Rosell RC, Taxonomy of Viruses. Londres, Elsevier Academic
Markham PG (1994) Geminivirus transmission Press. pp. 351-373.
and biological characterization of Bemisia tabaci Brown JK, Zerbini FM, Navas-Castillo J, Moriones E,
(Gennadius) biotypes from different geographical Ramos-Sobrinho R, Silva JCF, Fiallo-Oliv E, Briddon
regions. Annals of Applied Biology 125:311-325. RW, Hernndez-Zepeda C, Idris A, Malathi VG,
Bennett CW, Costa AS (1949) The Brazilian curly top of Martin DP, Rivera-Bustamante R, Ueda S, Varsani A
tomato and tobacco resembling North American (2015) Revision of Begomovirus taxonomy based
and Argentine curly top of sugar beet. Journal of on pairwise sequence comparisons. Archives of
Agricultural Research 78:675-693. Virology 160:1593-1619.
Bergamin-Filho A, Inoue-Nagata AK, Bassanezi RB, Brunt AA, Kenten RH (1973) Cowpea mild mottle
Belasque J, Amorim L, Macedo MA, Barbosa JC, virus, a newly recognized virus infecting cowpeas
Willocquet L, Savary S (2016) The importance (Vigna unguiculata) in Ghana. Annals of Applied
of primary inoculum and area-wide disease Biology 74:67-74.
management to crop health and food security. Byrne DN, Bellows TS (1991) Whitefly biology. Annual
Food Security 8:221-238. Review of Entomology 36:431-457.
Bethke JA, Byrne FJ, Hodges GS, McKenzie CL, Calegario RF, Ferreira SS, Andrade EC, Zerbini
Shatters Jr. RG (2008) First record of the Q biotype FM (2007) Characterization of Tomato yellow
of the sweetpotato whitefly, Bemisia tabaci, in spot virus, (ToYSV), a novel tomato-infecting
Guatemala. Phytoparasitica 37:61-64. begomovirus from Brazil. Pesquisa Agropecuria
Bezerra-Agasie IC, Ferreira GB, vila AC, Inoue-Nagata Brasileira 42:1335-1343.
AK (2006) First report of Tomato severe rugose Canal Rural (2015) Produtores de feijo do DF
virus in chili pepper in Brazil. Plant Disease 90:114. desrespeitam vazio sanitrio atrs de maior
Blawid R, Fontenele RS, Lacorte C, Ribeiro SG (2013) lucratividade. Disponvel em: http://www.
Molecular and biological characterization of canalrural.com.br/noticias/feijao/ produtores-
corchorus mottle virus, a new begomovirus from feijao-desrespeitam-vazio-sanitario-atras-maior-
Brazil. Archives of Virology 158:2603-2609. lucratividade-58978. Acesso em 23 Setembro
Boiteux LS, Fonseca MEN, Reis A, Costa AF, Fontes MG, 2015.
Gonzlez-Arcos M (2015) Wild radish (Raphanus Canizares MC, Navas-Castillo J, Moriones E (2008)
spp.) and garden rocket (Eruca sativa) as new Multiple suppressors of RNA silencing encoded
Brassicaceae hosts of Tomato chlorosis virus in by both genomic RNAs of the crinivirus, Tomato
South America. Plant Disease 100:1027. chlorosis virus. Virology 379:168-174.
Boiteux LS, Oliveira VR, Silva CH, Makishima N, Inoue- Castillo-Urquiza GP, Beserra Jr. JEA, Bruckner FP, Lima
Nagata AK, Fonseca MED, Giordano LD (2007) ATM, Varsani A, Alfenas-Zerbini P, Zerbini FM

RAPP - Volume 24, 2016 23


Alice Kazuko Inoue-Nagata, et al. (7-29)

(2008) Six novel begomoviruses infecting tomato of the Bemisia tabaci cryptic species complex
and associated weeds in Southeastern Brazil. reveals pattern of biological invasions. PLoS One
Archives of Virology 153:1985-1989. 6:e25579.
Chowda-Reddy R, Kirankumar M, Seal SE, Muniyappa Dinsdale A, Cook L, Riginos C, Buckley YM, De Barro
V, Valand GB, Govindappa M, Colvin J (2012) PD (2010) Refined global analysis of Bemisia
Bemisia tabaci phylogenetic groups in India and tabaci (Hemiptera: Sternorrhyncha: Aleyrodoidea:
the relative transmission efficacy of tomato leaf Aleyrodidae) mitochondrial cytochrome oxidase
curl Bangalore virus by an indigenous and an exotic 1 to identify species level genetic boundaries.
population. Journal of Integrative Agriculture Annals of the Entomological Society of America
11:235-248. 103:196-208.
Coco D, Calil IP, Brustolini OJ, Santos AA, Inoue-Nagata Dovas CI, Katis NI, Avgelis AD (2002) Multiplex
AK, Fontes EP (2013) Soybean chlorotic spot virus, detection of criniviruses associated with epidemics
a novel begomovirus infecting soybean in Brazil. of a yellowing disease of tomato in Greece. Plant
Archives of Virology 158:457-462. Disease 86:1345-1349.
Costa AS (1937) Nota sobre o mosaico do algodoeiro. Esterhuizen LL, Mabasa KG, Van Heerden SW, Czosnek
Revista Agrcola 12:453-470. H, Brown JK, Van Heerden H, Rey MEC (2013)
Costa AS (1954) Identidade entre o mosaico comum Genetic identification of members of the Bemisia
do algodoeiro e a clorose infecciosa das malvceas. tabaci cryptic species complex from South Africa
Bragantia 13:23-27. reveals native and introduced haplotypes. Journal
Costa AS (1955) Studies on Abutilon mosaic in Brazil. of Applied Entomology 137:122-135.
Phytopathologische Zeitschrift 24:97-112. Faria JC, Maxwell DP (1999) Variability in geminivirus
Costa AS (1975) Increase in the populational density isolates associated with Phaseolus spp. in Brazil.
of Bemisia tabaci, a threat to widespread virus Phytopathology 89:262-268.
infection of legume crops in Brazil. In: Bird Fernandes-Acioli NA, Carvalho RCP, Fontenele RS,
J, Maramorosch K (Eds.) Tropical Diseases of Lacorte C, Ribeiro SG, Fonseca MEN, Boiteux
Legumes. New York, Academic Press. pp. 27-49. LS (2011) First report of Sida micrantha mosaic
Costa AS, Bennett CW (1950) Whitefly transmitted virus in Phaseolus vulgaris in Brazil. Plant Disease
mosaic of Euphorbia prunifolia. Phytopathology 95:1196.
40:266-283. Fernandes FR, Albuquerque LC, Giordano LB, Boiteux
Costa AS, Gaspar JO, Vega J (1983) Mosaico angular LS, vila AC, Inoue-Nagata AK (2008) Diversity
do feijoeiro jalo causado por um carla vrus and prevalence of Brazilian bipartite begomovirus
transmitido pela mosca branca Bemisia tabaci. species associated to tomatoes. Virus Genes
Fitopatologia Brasileira 8:325-337. 36:251-258.
Costa AS, Oliveira AR, Silva DM (1975) Transmisso Fernandes FR, Albuquerque LC, Oliveira CL, Cruz
mecnica do mosaico dourado do tomateiro. ARR, Rocha WB, Pereira TG, Naito FYB, Dias ND,
Revista da Sociedade Brasileira de Fitopatologia Nagata T, Faria JC, Zerbini FM, Arago FJL, Inoue-
6:147. Nagata AK (2011) Molecular and biological
Costa AS, Carvalho AMB (1960) Comparative studies characterization of a new Brazilian begomovirus,
between Abutilon and Euphorbia mosaic viruses. euphorbia yellow mosaic virus (EuYMV), infecting
Phytopathologische Zeitschrift 38:129-152. Euphorbia heterophylla plants. Archives of Virology
Costa CL (1998) Vetores de vrus de plantas. 1. Insetos. 156:2063-2069.
Reviso Anual de Patologia de Plantas 6:103-167. Fernandes FR, Cruz AR, Faria JC, Zerbini FM, Aragao
Cotrim MA, Krause-Sakate R, Narita N, Zerbini FM, FJ (2009) Three distinct begomoviruses associated
Pavan MA (2007) Genetic diversity ot tomato- with soybean in central Brazil. Archives of Virology
infecting begomoviruses in Central So Paulo 154:1567-1570.
state. Summa Phytopathologica 33:300-303. Fernandes JJ, Carvalho MG, Andrade EC,
Dalton R (2006) Whitefly infestations: the Christmas Brommonschenkel SH, Fontes EPB, Zerbini FM
Invasion. Nature 443:898-900. (2006) Biological and molecular properties of
De Barro P, Ahmed MZ (2011) Genetic networking Tomato rugose mosaic virus (ToRMV), a new

24 RAPP - Volume 24, 2016


Alice Kazuko Inoue-Nagata, et al. (7-29)

tomato-infecting begomovirus from Brazil. Plant Gaspar JO, Costa AS (1993) Vrus do mosaico angular
Pathology 55:513-522. do feijoeiro: purificao e ultraestrutura dos
Fiallo-Oliv E, Zerbini FM, Navas-Castillo J (2015) tecidos infectados. Fitopatologia Brasileira 18:534-
Complete nucleotide sequences of two new 540.
begomoviruses infecting the wild malvaceous Ghanim M (2014) A review of the mechanisms and
plant Melochia sp. in Brazil. Archives of Virology components that determine the transmission
160:3161-3164. efficiency of Tomato yellow leaf curl virus
Firdaus S, Vosman B, Hidayati N, Jaya Supena ED, (Geminiviridae; Begomovirus) by its whitefly
Visser RG, van Heusden AW (2013) The Bemisia vector. Virus Research 186:47-54.
tabaci species complex: additions from different Ghanim M, Czosnek H (2000) Tomato yellow leaf
parts of the world. Insect Science 20:723-733. curl geminivirus (TYLCV-Is) is transmitted among
Firmino AC, Yuki VA, Moreira AG, Rezende JAM (2009) whiteflies (Bemisia tabaci) in a sex-related manner.
Tomato yellow vein streak virus: relationship with Journal of Virology 74:4738-4745.
Bemisia tabaci biotype B and host range. Scientia Ghanim M, Morin S, Czosnek H (2001) Rate of tomato
Agricola 66:793-799. yellow leaf curl virus translocation in the circulative
Flores E, Silberschmidt K, Kramer M (1960) transmission pathway of its vector, the whitefly
Observaes de clorose infecciosa das malvceas Bemisia tabaci. Phytopathology 91:188-196.
em tomateiros do campo. O Biolgico 26:65-69. Gilbertson RL, Batuman O, Webster CG, Adkins S
Fonseca MEN, Boiteux LS, Lima MF, Mendona JL, (2015) Role of the insect supervectors Bemisia
Costa AF, Fontes MG, Costa H, Gonzlez-Arcos tabaci and Frankliniella occidentalis in the
M (2015) First report of Tomato chlorosis virus emergence and global spread of plant viruses.
infecting eggplant and scarlet eggplant in Brazil. Annual Review of Virology 2:67-93.
Plant Disease 100:867. Gilbertson RL, Rojas M, Natwick E (2011) Development
Fortes IM, Moriones E, Navas-Castillo J (2012) Tomato of integrated pest management (IPM) strategies
chlorosis virus in pepper: prevalence in commercial for whitefly (Bemisia tabaci)-transmissible
crops in southeastern Spain and symptomatology geminiviruses. In: Thompson WMO (Ed.) The
under experimental conditions. Plant Pathology whitefly, Bemisia tabaci (Homoptera: Aleyrodidae)
61:994-1001. interaction with geminivirus-infected host plants.
Freitas DMS (2012) Tomato severe rugose virus Amsterdam, Springer Netherlands. pp. 323-356.
(ToSRV) e Tomato chlorosis virus (ToCV): relaes Giordano LB, Fonseca MEN, Silva JBC, Inoue-Nagata
com Bemisia tabaci bitipo B e eficincia de um AK, Boiteux LS (2005) Efeito da infeco precoce
inseticida no controle da transmisso do ToSRV. por begomovrus com genoma bipartido em
Tese D.Sc. (Fitopatologia). Piracicaba, USP-Esalq. caractersticas de frutos de tomate industrial.
Freitas DMS, Nardin I, Shimoyama N, Souza-Dias Horticultura Brasileira 23:815-818.
JAC, Rezende JAM (2012) First report of Tomato Gonzlez-Aguilera J, Hurtado FD, Xavier CAD, Laurindo
chlorosis virus in potato in Brazil. Plant Disease BS, Nick C, Gil MA, da Silva DJH, Zerbini FM (2011)
96:593. Identification of the begomovirus resistance genes
Galvo RM, Mariano AC, Luz DF, Alfenas PF, Andrade Ty-2 and Ty-3 in tomato genotypes. Pesquisa
EC, Zerbini FM, Almeida MR, Fontes EPB (2003) Agropecuria Brasileira 46:772-775.
A naturally occurring recombinant DNA-A of a Gonzlez-Aguilera J, Tavares SS, Sobrinho RR, Xavier
typical bipartite begomovirus does not require the CAD, Dueas-Hurtado F, Lara-Rodrigues RM,
cognate DNA-B to infect Nicotiana benthamiana Silva DJH, Zerbini FM (2012) Genetic structure
systemically. Journal of General Virology 84:715- of a Brazilian population of the begomovirus
726. Tomato severe rugose virus (ToSRV). Tropical Plant
Garca-Cano E, Navas-Castillo J, Moriones E, Pathology 37:346-353.
Fernndez-Muoz R (2010) Resistance to Tomato Grille GN, Buenahora J, Basso C, Bonato O (2011)
chlorosis virus in wild tomato species that First report of the Q biotype of Bemisia tabaci in
impair virus accumulation and disease symptom Argentina and Uruguay. Phytoparasitica 39:235-
expression. Phytopathology 100:582-592. 238.

RAPP - Volume 24, 2016 25


Alice Kazuko Inoue-Nagata, et al. (7-29)

Guevara-Coto JB, Hernandez-Jimenez E, Hammond R, Horticultura Brasileira 27:478-483.


Ramirez-Fonseca P (2011) Bemisia tabaci Biotype Lima MFB, Bezerra IC, Ribeiro SG, vila AC (2001)
Q is present in Costa Rica. European Journal of Distribuio de geminivrus nas culturas do tomate
Plant Pathology 131:167-170. e pimento em doze municpios do Submdio do
Horn NM, Saleh N, Baliadi Y (1991) Cowpea mild Vale So Francisco. Fitopatologia Brasileira 26:81-
mottle virus could not be detected by ELISA in 85.
soybean and groundnut seeds in Indonesia. Liu BM, Yan FM, Chu D, Pan HP, Jiao XG, Xie W, Wu QJ,
European Journal of Plant Pathology 97:125-127. Wang SL, Xu BY, Zhou XG, Zhang YJ (2012) Difference
Horowitz AR, Kontsedalov S, Khasdan V, Ishaaya I in feeding behaviors of two invasive whiteflies on
(2005) Biotypes B and Q of Bemisia tabaci and host plants with different suitability: implication
their relevance to neonicotinoid and pyriproxyfen for competitive displacement. International
resistance. Archives of Insect Biochemistry and Journal of Biological Sciences 8:697-706.
Physiology 58:216-225. Liu BM, Preisser EL, Chu D, Pan HP, Xie W, Wang SL,
Hu J, De Barro P, Zhao H, Wang J, Nardi F, Liu SS Wu QJ, Zhou XG, Zhang YJ (2013) Multiple forms
(2011) An extensive field survey combined with a of vector manipulation by a plant-infecting virus:
phylogenetic analysis reveals rapid and widespread Bemisia tabaci and Tomato yellow leaf curl virus.
invasion of two alien whiteflies in China. PLoS One Journal of Virology 87:4929-4937.
6:e16061. Liu HY, Wisler GC, Duffus JE (2000) Particle lengths
Inoue-Nagata AK, Martin DP, Boiteux LS, Giordano LD, of whitefly-transmitted criniviruses. Plant Disease
Bezerra IC, Avila AC (2006) New species emergence 84:803-805.
via recombination among isolates of the Brazilian Loureno AL, Krause-Sakate R, Valle GE (2015)
tomato-infecting begomovirus complex. Pesquisa Mosca-branca, Bemisia tabaci (Gennadius) bitipo
Agropecuria Brasileira 41:1329-1332. B. In: Vilela EF, Zucchi RA (Eds.) Pragas Introduzidas
Jovel J, Reski G, Rothenstein D, Ringel M, Frischmuth T, no Brasil: Insetos e caros. Piracicaba, FEALQ. pp.
Jeske H (2004) Sida micrantha mosaic is associated 682-707.
with a complex infection of begomoviruses Loureno AL, Nagai H (1994) Surtos populacionais de
different from Abutilon mosaic virus. Archives of Bemisia tabaci no estado de So Paulo. Bragantia
Virology 149:829-841. 53:53-59.
Kil E-J, Lee Y-J, Cho S, Auh C-K, Kim D, Lee K-Y, Kim Macedo MA, Barreto SS, Hallwass M, Inoue-Nagata
M-K, Choi H-S, Kim C-S, Lee S (2015) Identification AK (2014) High incidence of Tomato chlorosis virus
of natural weed hosts of Tomato chlorosis virus alone and in mixed infection with begomoviruses
in Korea by RT-PCR with root tissues. European in tomato fields in the Federal District and Gois
Journal of Plant Pathology 142:419-426. state, Brazil. Tropical Plant Pathology 39:449-452.
Li MH, Xu F-C, Liu S-S (2010) Transmission of tomato Macedo MA, Michereff M, Navas-Castillo J, Inoue-
yellow leaf curl virus by two invasive biotypes Nagata AK (2015) Host range and whitefly
and a Chinese indigenous biotype of the whitefly transmission efficiency of Tomato severe rugose
Bemisia tabaci. International Journal of Pest virus and Tomato golden vein virus in tomato
Management 56:275-280. plants. Tropical Plant Pathology 40:405-409.
Lima ATM, Sobrinho RR, Gonzalez-Aguilera J, Rocha Mansilla PJ (2015) Resistncia de gentipos de
CS, Silva SJC, Xavier CAD, Silva FN, Duffy S, Zerbini tomateiro infeco com o Tomato chlorosis virus
FM (2013) Synonymous site variation due to e tolerncia doena. Tese D.Sc. (Fitopatologia).
recombination explains higher genetic variability in Piracicaba, USP-Esalq.
begomovirus populations infecting non-cultivated Marchi BR (2014) Associao de begomovrus e
hosts. Journal of General Virology 94:418-431. crinivrus com Bemisia tabaci espcie New World
Lima MF, Nagata T, Neves FM, Inoue-Nagata AK, Moita 2 e Trialeurodes vaporariorum. Dissertao M.Sc.
AW, Sousa C, Della Vecchia M, Rangel MG, Dias RCS, (Proteo de Plantas). Botucatu, FCA/Unesp.
Dutra LS, vila AC (2009) Deteco por sorologia Mariano-Muiz GN (2001) Differential variation in
do Melon yellowing associated virus (MYaV) em development of the B and Q biotypes of Bemisia
reas produtoras de melo no Nordeste brasileiro. tabaci (Homoptera: Aleyrodidae) on sweet

26 RAPP - Volume 24, 2016


Alice Kazuko Inoue-Nagata, et al. (7-29)

pepper at constant temperatures. Environmental melon flexivirus transmitted by whitefly. Archives


Entomology 30:720-727. of Virology 150:379-387.
Martinez-Carrillo JB (2007) First report of the Q Nagata T, Kitajima EW, Alves DM, Cardoso JE, Inoue-
biotype of Bemisia tabaci in southern Sonora, Nagata AK, Oliveira MRV, vila AC (2003) Isolation
Mexico. Phytoparasitica 35:282-284. of a novel carlavirus from melon in Brazil. Plant
Marubayashi JM, Yuki VA, Wutke EB (2010) Pathology 52:797.
Transmisso do Cowpea mild mottle virus pela Naidu RA, Gowda S, Satyanarayana T, Boyko V, Reddy
mosca branca Bemisia tabaci bitipo B para AS, Dawson WO, Reddy DV (1998) Evidence that
plantas de feijo e soja Summa Phytopathologica whitefly-transmitted cowpea mild mottle virus
36:158-160. belongs to the genus Carlavirus. Archives of
Marubayashi JM, Yuki VA, Rocha KCG, Mituti T, Virology 143:769-780.
Pelegrinotti FM, Ferreira FZ, Moura MF, Navas- Navas-Castillo J, Camero R, Bueno M, Moriones E
Castillo J, Moriones E, Pavan MA (2013) At least (2000) Severe yellowing outbreaks in tomato
two indigenous species of the Bemisia tabaci in Spain associated with infections of Tomato
complex are present in Brazil. Journal of Applied chlorosis virus. Plant Disease 84:835-837.
Entomology 137:113-121. Navas-Castillo J, Fiallo-Oliv E, Snchez-Campos S
Matyis JC, Silva DM, Oliveira AR, Costa AS (1975) (2011) Emerging virus diseases transmitted by
Purificao e morfologia do vrus do mosaico whiteflies. Annual Review of Phytopathology
dourado do tomateiro. Summa Phytopathologica 49:219-248.
1:267-275. Ning WX, Shi XB, Liu BM, Pan HP, Wei WT, Zeng Y,
Menten JO, Roston AJ (1980) Mosaico dourado e Sun XP, Xie W, Wang SL, Wu QJ, Cheng JX, Peng
a necessidade da regionalizao da cultura do ZK, Zhang YJ (2015) Transmission of Tomato yellow
feijoeiro no Estado de So Paulo. Revista da leaf curl virus by Bemisia tabaci as affected by
Agricultura 55:287-300. whitefly sex and biotype. Scientific Reports 5:8.
Menzel W, Winter S, Vetten HJ (2010) Complete Nozaki DN, Krause-Sakate R, Pavan MA (2010)
nucleotide sequence of the type isolate of Cowpea Begomovrus infectando a cultura de pimento
mild mottle virus from Ghana. Archives of Virology no estado de So Paulo. Summa Phytopathologica
155:2069-2073. 36:244-247.
Morales FJ (2006a) History and current distribution Orfanidou CG, Dimitriou C, Papayiannis LC, Maliogka
of begomoviruses in Latin America. Advances in VI, Katis NI (2014) Epidemiology and genetic
Virus Research 67:127-162. diversity of criniviruses associated with tomato
Morales FJ (2006b) Tropical whitefly IPM project. yellows disease in Greece. Virus Research 186:120-
Advances in Virus Research 69:249-311. 129.
Morin S, Ghanim M, Sobol I, Czosnek H (2000) The Orlando A, Silberschmidt K (1945) O vetor da clorose
GroEL protein of the whitefly Bemisia tabaci infecciosa das malvceas. Biolgico 11:138-139.
interacts with the coat protein of transmissible Orlando A, Silberschmidt K (1946) Estudos sobre
and nontransmissible begomoviruses in the yeast a disseminao natural do vrus da clorose
two-hybrid system. Virology 276:404-416. infecciosa das malvceas (Abutilon virus 1. Baur)
Morin S, Ghanim M, Zeidan M, Czosnek H, Verbeek M, e sua relao com o inseto-vetor Bemisia tabaci
van den Heuvel JF (1999) A GroEL homologue from (Genn.). Archivos do Instituto Biolgico 17:1-36.
endosymbiotic bacteria of the whitefly Bemisia Paprotka T, Metzler V, Jeske H (2010a) The
tabaci is implicated in the circulative transmission complete nucleotide sequence of a new bipartite
of tomato yellow leaf curl virus. Virology 256:75- begomovirus from Brazil infecting Abutilon.
84. Archives of Virology 155:813-816.
Moriones E, Navas-Castillo J (2000) Tomato yellow Paprotka T, Metzler V, Jeske H (2010b) The first
leaf curl virus, an emerging virus complex causing DNA 1-like alphasatellites in association with
epidemics worldwide. Virus Research 71:123-134. New World begomoviruses in natural infections.
Nagata T, Alves DM, Inoue-Nagata AK, Tian TY, Virology 404:148-157.
Kitajima EW, Cardoso JE, Avila AC (2005) A novel Parrella G, Nappo AG, Manco E, Greco B, Giorgini M

RAPP - Volume 24, 2016 27


Alice Kazuko Inoue-Nagata, et al. (7-29)

(2014) Invasion of the Q2 mitochondrial variant of infecting begomoviruses in northwestern


Mediterranean Bemisia tabaci in southern Italy: Argentina. Annals of Applied Biology 158:69-78.
possible role of bacterial endosymbionts. Pest Rosen R, Kanakala S, Kliot A, Cathrin Pakkianathan
Management Science 70:1514-1523. B, Farich BA, Santana-Magal N, Elimelech M,
Pavan MA, Mello PCT, Sitolin IM (1999) Caracterizao Kontsedalov S, Lebedev G, Cilia M, Ghanim M
parcial de um closterovrus infectando tomateiro (2015) Persistent, circulative transmission of
na regio de Campinas, SP. Summa Phytopatologica begomoviruses by whitefly vectors. Current
25:36-37. Opinion in Virology 15:1-8.
Pinto VB, Silva JP, Fiallo-Oliv E, Navas-Castillo J, Rubinstein G, Czosnek H (1997) Long-term association
Zerbini FM (2016) Novel begomoviruses recovered of tomato yellow leaf curl virus with its whitefly
from Pavonia sp. in Brazil. Archives of Virology vector Bemisia tabaci: effect on the insect
161:735-739. transmission capacity, longevity and fecundity.
Ramos-Sobrinho R, Xavier CAD, Pereira HMB, Lima Journal of General Virology 78:2683-2689.
GSA, Assuno IP, Mizubuti ESG, Duffy S, Zerbini Salati R, Nahkla MK, Rojas MR, Guzman P, Jaquez
FM (2014) Contrasting genetic structure between J, Maxwell DP, Gilbertson RL (2002) Tomato
two begomoviruses infecting the same leguminous yellow leaf curl virus in the Dominican Republic:
hosts. Journal of General Virology 95:2540-2552. characterization of an infectious clone, virus
Ribeiro SG, Ambrozevicius LP, vila AC, Bezerra IC, monitoring in whiteflies, and identification of
Calegario RF, Fernandes JJ, Lima MF, Mello RN, reservoir hosts. Phytopathology 92:487-496.
Rocha H, Zerbini FM (2003) Distribution and genetic Santos AA, Cardoso, JE, Oliveira JN, Vidal JC, Cardoso
diversity of tomato-infecting begomoviruses in JW (2004) Transmisso do amarelo-do-meloeiro
Brazil. Archives of Virology 148:281-295. pela mosca-branca. Comunicado Tcnico 93.
Ribeiro SG, Avila AC, Bezerra IC, Fernandes JJ, Faria Fortaleza, Embrapa Agroindstria Tropical.
JC, Lima MF, Gilbertson RL, Maciel-Zambolim Santos CDG, vila AC, Resende RO (2003) Estudo
E, Zerbini FM (1998) Widespread occurrence of da interao de um begomovrus isolado de
tomato geminiviruses in Brazil, associated with a tomateiro com a mosca branca. Fitopatologia
new biotype of the whitefly vector. Plant Disease Brasileira 28:664-673.
82:830. Saunders K, Bedford ID, Yahara T, Stanley J (2003)
Ribeiro SG, Martin DP, Lacorte C, Simes IC, Orlandini The earliest recorded plant virus disease. Nature
DRS, Inoue-Nagata AK (2007) Molecular and 422:831.
biological characterization of Tomato chlorotic Silva AKF, Santos CDG, Nascimento AKQ (2010)
mottle virus suggests that recombination underlies Begomovirus transmission from weeds to tomato
the evolution and diversity of Brazilian tomato by the whitefly. Planta Daninha 28:507-514.
begomoviruses. Phytopathology 97:702-711. Silva FN, Lima ATM, Rocha CS, Castillo-Urquiza GP,
Ribeiro SG, Inoue-Nagata AK, Daniels J, vila AC Alves M, Zerbini FM (2014) Recombination and
(2006) Potato deforming mosaic disease is caused pseudorecombination driving the evolution of
by an isolate of Tomato yellow vein streak virus. the begomoviruses Tomato severe rugose virus
Plant Pathology 55:569. (ToSRV) and Tomato rugose mosaic virus (ToRMV):
Rocha CS, Castillo-Urquiza GP, Lima ATM, Silva FN, two recombinant DNA-A components sharing the
Xavier CAD, Hora-Junior BT, Beserra-Junior JEA, same DNA-B. Virology Journal 11:66.
Malta AWO, Martin DP, Varsani A, Alfenas-Zerbini Silva SJC, Castillo-Urquiza GP, Hora-Junior BT, Assuno
P, Mizubuti ESG, Zerbini FM (2013) Brazilian IP, Lima GSA, Pio-Ribeiro G, Mizubuti ESG, Zerbini
begomovirus populations are highly recombinant, FM (2012) Species diversity, phylogeny and genetic
rapidly evolving, and segregated based on variability of begomovirus populations infecting
geographical location. Journal of Virology 87:5784- leguminous weeds in northeastern Brazil. Plant
5799. Pathology 61:457-467.
Rodrguez-Pardina PE, Hanada K, Laguna IG, Zerbini Silva SJC, Castillo-Urquiza GP, Hora-Jnior BT,
FM, Ducasse DA (2011) Molecular characterisation Assuno IP, Lima GSA, Pio-Ribeiro G, Mizubuti
and relative incidence of bean- and soybean- ESG, Zerbini FM (2011) High genetic variability

28 RAPP - Volume 24, 2016


Alice Kazuko Inoue-Nagata, et al. (7-29)

and recombination in a begomovirus population begomovirus. Phytopathology 105:S4.143.


infecting the ubiquitous weed Cleome affinis in Wintermantel WM, Hladky LL (2010) Methods for
northeastern Brazil. Archives of Virology 156:2205- detection and differentiation of existing and
2213. new crinivirus species through multiplex and
Simone GW, Hochmuth RC, Wisler GC, Duffus JE, degenerate primer RT-PCR. Journal of Virological
Liu HY, Li RH (1996) A new whitefly-vectored Methods 170:106-114.
closterovirus of tomato in Florida. Proceedings of Wintermantel WM, Wisler GC (2006) Vector
the Florida Tomato Institute:71-74. specificity, host range, and genetic diversity of
Souza-Dias JAC, Sawazaki HE, Pernambuco-Filho Tomato chlorosis virus. Plant Disease 90:814-819.
PCA, Elias LM, Maluf H (2008) Tomato severe Wisler GC, Li RH, Liu HY, Lowry DS, Duffus JE (1998)
rugose virus: another begomovirus causing leaf Tomato chlorosis virus: a new whitefly-transmitted,
deformation and mosaic symptoms on potato in phloem-limited, bipartite closterovirus of tomato.
Brazil. Plant Disease 92:487-487. Phytopathology 88:402-409.
Tavares SS, Ramos-Sobrinho R, Gonzalez-Aguilera J, Wyant PS, Strohmeier S, Schafer B, Krenz B, Assuncao
Lima GSA, Assuno IP, Zerbini FM (2012) Further IP, Lima GSD, Jeske H (2012) Circular DNA genomics
molecular characterization of weed-associated (circomics) exemplified for geminiviruses in bean
begomoviruses in Brazil with an emphasis on Sida crops and weeds of northeastern Brazil. Virology
spp. Planta Daninha 30:305-315. 427:151-157.
Tavassoli M, Shahraeen N, Ghorbani S (2008) Detection Zanardo LG, Silva FN, Bicalho AAC, Castillo-Urquiza GP,
and some properties of cowpea mild mottle virus Lima ATM, Almeida AMR, Zerbini FM, Carvalho CM
isolated from soybean in Iran. Pakistani Journal of (2014a) Molecular and biological characterization
Biological Sciences 11:2624-2628. of cowpea mild mottle virus isolates infecting
Thouvenel JC, Monsarrat A, Fauquet C (1982) soybean in Brazil and evidence of recombination.
Isolation of Cowpea mild mottle virus from Plant Pathology 63:456-465.
diseased soybeans in Ivory Coast. Plant Disease Zanardo LG, Silva FN, Lima AT, Milanesi DF, Castilho-
66:336-337. Urquiza GP, Almeida AM, Zerbini FM, Carvalho
Tzanetakis IE, Martin RR, Wintermantel WM (2013) CM (2014b) Molecular variability of cowpea mild
Epidemiology of criniviruses: an emerging problem mottle virus infecting soybean in Brazil. Archives
in world agriculture. Frontiers in Microbiology of Virology 159:727-737.
4:119. Zerbini FM, Andrade EC, Barros DR, Ferreira SS, Lima
Velasco L, Simn B, Janssen D, Cenis JL (2008) ATM, Alfenas PF, Mello RN (2005) Traditional and
Incidences and progression of tomato chlorosis novel strategies for geminivirus management in
virus disease and tomato yellow leaf curl virus Brazil. Australasian Plant Pathology 34:475-480.
disease in tomato under different greenhouse Zerbini FM, Inoue-Nagata AK, Ribeiro SG, Resende RO
covers in southeast Spain. Annals of Applied (2010) From wild to domesticated and back to
Biology 153:335-344. wild: genetic diversity and evolution of Brazilian
Vicente M, Kudamatsu M, Fazio G, Alexandre MAV, begomoviruses. 6th International Geminivirus
Chagas CM (1985) Incidncia do mosaico dourado Symposium (Program and Abstracts in CD-ROM).
do feijoeiro em trs municpios do estado de So Guanajuato, Mexico.
Paulo zoneados para o plantio do feijo-da-seca. Zerbini FM, Ribeiro SG, Andrade EC, Lopes EF,
O Biolgico 51:147-155. Fernandes JJ, Fontes EPB (2002) Identificao e
Vu S, Melgarejo T, Chen L-F, Souza J, Macedo M, Inoue- taxonomia de novas espcies de vrus transmitidos
Nagata AK, Gilbertson RL (2015) Evidence that por mosca-branca no Brasil. O Biolgico 64:151-
Tomato mottle leaf curl virus from Northeastern 152.
Brazil is an indigenous New World monopartite

RAPP - Volume 24, 2016 29


Martha Maria Passador e Edson Luiz Furtado (30-41)

MANCHA DE MICOSFERELA: O
GRANDE OBSTCULO PARA O CULTIVO
DEEUCALYPTUS GLOBULUSNO BRASIL
Martha Maria Passador1 e Edson Luiz Furtado2

RESUMO
OEucalyptus globulus uma espcie que apresenta boa capacidade de
produo e adapta-se bem em diversos tipos de solos, e em regies de clima
temperado. O avano das reas reflorestadas, o plantio de espcies mais sus-
cetveis a determinadas pragas e patgenos e a utilizao repetitiva de uma
mesma rea para plantio, criaram condies favorveis ocorrncia de muitos
problemas fitossanitrios. Algumas doenas foram constatadas concomitantes
ao crescimento do cultivo de eucalipto no Brasil, como a doena causada por
espcies deMyscosphaerellae Teratosphaeria.No Brasil, surtos epidmicos de
manchas foliares, devido esses agentes causais eram pouco comuns, porm
a partir do ano de 2007 essa doena proporcionou grandes perdas em plan-
tios dessa espcie no Sul do Brasil. Nos anos seguintes, j foi possvel constatar
a mancha de micosferela em plantios comerciais localizados no estado de So
Paulo.

SUMMARY
Eucalyptus globulus is a species that has good production capacity and
can easily adapt in different types of soils and temperate regions. The advance
of reforested areas, the planting of species more susceptible to certain pests
and pathogens and the repetitive use of the same area for planting created
favorable conditions to the occurrence of many plant health problems. Some
diseases were found concomitant with the growth of eucalyptus plantations in
Brazil, among them, the disease caused by species of Myscosphaerella and Ter-
atosphaeria. In Brazil, outbreaks of leaf spots, due to these causative agents
were unusual, but from 2007 this disease brought great losses in crops of this
species in southern Brazil. In the following years, it has been possible to verify
Mycosphaerella leaf disease in commercial plantations in So Paulo state.

Introduo pertencem aos gneros Mycosphaerella e Teratos-


Muitos patgenos, principalmente fungos, phaeria. Os fungos T. nubilosa e T. cryptica so con-
ocorrem em vrias espcies de eucalipto, desde a siderados os mais importantes em nvel mundial e
fase de viveiro at os plantios adultos. Dentre as do- so responsveis pela doena foliar mais significati-
enas fngicas, destaca-se a mancha de micosferela, va para espcies de eucalipto, especialmente para o
causada por um complexo de espcies de fungos que Eucalyptus globulus (Labill) (Carnegie e Ades, 2002;

1
Centro de Fitossanidade- Quarentenrio IAC, CEP-13020-902, Campinas-SP. 2Departamento Cincias Florestais, Faculdade de
Cincias Agronmicas UNESP, CEP-18.610-307, Botucatu-SP.

30 RAPP - Volume 24, 2016


Martha Maria Passador e Edson Luiz Furtado (30-41)

Hunter et al., 2009). um fator importante a especificidade, porm, mui-


Outras espcies de Mycosphaerella e Tera- tas espcies podem tambm infectar outros hospe-
tosphaeria demonstram patogenicidade aparen- deiros. Portanto, a taxonomia de Mycosphaerella
temente fraca ou podem atuar como saprfitas no spp. e Teratosphaeria spp. baseada em uma srie
tecido necrtico, seguidas pela infeco de outras de dados e caractersticas, incluindo sintomas no
espcies patognicas, insetos ou senescncia natu- hospedeiro, padres de germinao dos esporos,
ral da folha. Devido a alguns rearranjos taxonmi- morfologia do fungo em meio de cultivo, e filogenia.
cos, principalmente relacionados a anlises filogen- A metodologia mais efetiva de controle para essa do-
ticas, algumas espcies que pertenciam ao gnero ena pode estar relacionada com o desenvolvimento
Mycosphaerella, foram transferidas para o gnero de variedades resistentes, ou a substituio de plan-
Teratosphaeria (Crous, 2009). tas suscetveis por espcies mais resistentes.
Os sintomas associados a essa doena so As fontes de inculo podem ser provenien-
variveis, e diferem entre si, dependendo da espcie tes de qualquer pas com o qual o Brasil realize im-
do hospedeiro e do patgeno. Nas folhas os sinto- portaes de materiais. provvel que esses fungos
mas so caracterizados por manchas necrticas lo- tenham sido introduzidos no pas por meio de ascs-
calizadas, que reduzem a capacidade fotossinttica poros dispersos pelo vento ou por insetos, ou tam-
das folhas ocasionando desfolha precoce em plantas bm pelo movimento de sementes e mudas entre
juvenis. Brasil, Uruguai e Argentina, devido deteco de al-
Em muitos casos, as manchas crescem e coa- gumas espcies que tambm foram constatadas nos
lescem formando leses muito grandes que podem referidos pases.
ocupar toda a superfcie da rea foliar resultando na
degradao da folha. As manchas podem ser arre- O hospedeiro: Eucalyptus globulus
dondadas ou irregulares, de colorao variando de A qualidade da madeira e o seu rpido de-
amarelo-pardo a marrom-escuro, onde se formam senvolvimento fazem com que o eucalipto seja a r-
pontuaes escuras, que correspondem aos corpos vore mais plantada, impulsionando o crescimento de
de frutificao do patgeno (pseudotcios). Devido cultivos comerciais em muitas regies onde foi intro-
a fatores relacionados estrutura e constituio ce- duzido (Alfenas et al., 2009; Medrado et al., 2005).
lular do parnquima, a intensidade dos sintomas Atualmente, espcies de eucalipto so cultivadas
maior em folhas jovens quando comparadas s fo- para os mais diversos fins, tais como papel, celulose,
lhas adultas (Smith et al., 2007). lenha, carvo, serraria, leos para indstrias farma-
Os danos causados por esses patgenos tam- cuticas, mel, ornamentao e quebra-vento, dentre
bm incluem cancros e morte prematura dos ramos, outros. No Brasil, os plantios de eucalipto ocupam
e em alguns casos, atrofia e morte da rvore do topo 5,56 milhes de hectares da rea de rvores planta-
para a base. As alteraes no metabolismo das r- das no Pas, localizados principalmente nos Estados
vores resultam em reduo do crescimento, alm de Minas Gerais (25,2%), So Paulo (17,6%) e Mato
disso, essa doena pode contribuir para infeces Grosso do Sul (14,5%) (IB, 2015).
provocadas por patgenos secundrios e promover O E. globulus foi a primeira espcie de eu-
considerveis prejuzos econmicos. calipto introduzida no Brasil, no incio do sculo XX
Quando h condies de umidade favorveis, (Braga, 1971; Vitti e Brito, 2003). Originria do su-
os esporos (ascsporos) do fungo so liberados dos deste da Austrlia, incluindo a Ilha da Tasmnia, o sul
pseudotcios e infectam o hospedeiro por meio da de Vitria e as ilhas de Bass Strait (Lavrabre, 2001;
abertura dos estmatos. Em condies de campo os Vitti e Brito, 2003; Barrela, 2011). Apresenta boa ca-
ascsporos so dispersos pelo vento, gua de chuva pacidade de produo podendo chegar a at dois ci-
e insetos. Em condies de viveiro a doena tambm clos de produo vegetativa aps a primeira explora-
disseminada por gua de irrigao, circulao de o integral (Vitti e Brito, 2003). capaz de suportar
pessoas, ferramentas, maquinrio entre outras ma- invernos chuvosos e temperaturas mais baixas, e por
neiras que permitam que os esporos alcancem os este motivo foi introduzida no Rio Grande do Sul de-
hospedeiros suscetveis. vido s condies de clima favorveis (Xavier et al.,
Para identificao de muitos fitopatgenos, 2007).

RAPP - Volume 24, 2016 31


Martha Maria Passador e Edson Luiz Furtado (30-41)

Apresenta heterofilia muito aparente. As em nvel mundial (Carnegie e Ades, 2002; Hunter et
folhasjuvenis so ssseis, ovaladas e reco bertas al., 2009), e segundo Park e Keane (1982b) e Hun-
poruma camada cerosa de cor azulada, surgindo ter et al. (2009), so as primeiras espcies a infec-
opostasem caules de seco quadrangular. As folhas tar tecidos jovens e suculentos, adquirindo nutrien-
dasrvores adultas so estreitas, alongadas, falci- tes por meio de uma relao hemibiotrfica com o
formescom uma camada cerosa verde acinzentada hospedeiro. Essas duas espcies de Teratosphaeria
(particularmentena face abaxial), surgindo alterna- so relevantes para as espcies de eucalipto E. glo-
damenteao longo de caules arredondados (Johnson, bulus (Labill) e E. nitens (Deane and Maid.) Maid.,
1926; Rocha e Santos, 2007). das quais muitos plantios concentram-se em regies
Devido sua rpida taxa de crescimento, da temperadas (Hunter et al., 2004).
polpa de madeira macia e da excelente qualidade Os gneros de fungos Mycosphaerella e Te-
para produo de papel e celulose, uma das es- ratosphaeria (Capnodiales, Dothideomycetes, As-
pcies de maior demanda no mercado internacional comycota), se caracterizam pela formao dos
(Yang e Fife, 2000). Apresenta madeira clara de co- ascos no interior de lculos e estroma unilocular
lorao amarelo-plido, compacta, rija, muito forte periteciide, denominado pseudotcio (Alexo-
e de grande durabilidade (30 a 50 anos), muito utili- poulos et al., 1996, Putzke e Putzke, 1998). Os
zada em construo naval, pilares de pontes e quais- pseudotcios so produzidos em um aglomerado
quer obras hidrulicas, marcenaria, lenha e carvo de hifas entrelaadas junto ao substrato prprio
(Correa, 1931). bem desenvolvido composto por hifas de colora-
Existem quatro subespcies de E. globulus: o marrom a marrom acinzentada (Alexopoulos
E. globulus subesp. bicostata, E. globulus subesp. et al., 1996), caractersticas da ordem Capnodia-
maideni, E. globulus subesp. globulus, E .globulus les (Crous, 1998). Atualmente so conhecidas
subesp. pseudoglobulus (Boland et al., 1991, citado mais de 150 espcies de fungos dentro dos g-
por Vitti e Brito, 2003). Seus principais sinnimos po- neros Mycosphaerella e Teratosphaeria, e vrios
pulares no Brasil so: rvore-de-febre, gomeiro-azul, gneros anamorfos (alguns ainda no identifica-
eucalipto-limo (Lorenzi e Matos, 2002). dos) associados ao eucalipto, causando manchas
O avano das reas reflorestadas para regi- foliares e cancros na haste. (Jackson et al., 2004;
es mais quentes e midas, o plantio de espcies Crous et al., 2007b; Hunter et al., 2011). Segundo
mais suscetveis e a utilizao repetitiva de uma Crous (1998) e Crous et al. (2006), outras espcies de
mesma rea para plantio criaram condies favor- Mycosphaerella e Teratosphaeria demonstram pato-
veis ocorrncia de doenas (Furtado et al., 2008). genicidade aparente fraca ou podem atuar como sa-
Algumas doenas foram constatadas concomitantes prfitas no tecido necrtico, seguidas pela infeco
ao crescimento do cultivo de eucalipto no Brasil, de outras espcies patognicas, insetos ou senes-
como as manchas causadas por espcies de Myscos- cncia natural da folha.
phaerella e Teratosphaeria, responsveis por gran- Alm de E. globulus, existem relatos na Aus-
des perdas econmicas em plantios de E. globulus. trlia de T. cryptica associada com E. marginata e E.
patens (Carnegie e Keane, 1998). Espcies de agen-
A mancha de Micosferela tes causais de mancha de micosferela tambm fo-
ram isoladas de E. dunnii, E. benthamii, E. grandis,
A doena e seus agentes causais: Mycosphaerella E. moluccana, E.nitens, E. saligna, E. urophylla, E.
spp. e Teratoaphaeria spp. tereticornis, E. platyphylla, E. deanei, E. grandis,
Dentre as doenas foliares mais significati- E. aglomerata, E. camaldulensis, E. botryoides, E.
vas para o eucalipto, est a mancha de Micosferela quadrangulata, E. smithii, E. viminalis, E. maide-
(Mycosphaerella leaf disease - MLD) tambm cha- nii, E. grandiflora, Corymbia henryii, C. variegata e
mada de mancha de Teratosferia (Teratosphaeria seus hbridos (Ganapathi, 1979; Carnegie e Keane,
leaf disease- TLD), causada por um complexo de es- 1994,1998; Crous, 1998; Crous et al., 2000; Carne-
pcies de Mycosphaerella e Teratosphaeria (Crous et gie e Ades, 2002; Maxwell et al., 2003; Alfenas et al.,
al., 2009; Hunter et al., 2011). Os fungos T. nubilosa 2009; Hunter et al., 2004; Crous et al., 2007a, 2007b;
e T. cryptica so considerados os mais importantes Smith et al., 2007; Crous et al., 2009; Perez et al.,

32 RAPP - Volume 24, 2016


Martha Maria Passador e Edson Luiz Furtado (30-41)

2009a; Perez et al. 2009b, 2009c; Teodoro et al.,


2012; Passador et al.,, 2013; Garrett, 2015;Cndido
et al., 2014; Perez et al., 2014; Soria et al., 2014).

Sintomas nos hospedeiros e ciclo vital do patgeno
Os sintomas podem variar de acordo com a
espcie do hospedeiro e do patgeno, bem como o
estdio foliar. Primeiramente, so observadas man-
chas necrticas localizadas que reduzem a capaci-
dade fotossinttica das folhas, ocasionando desfo-
lha precoce em plantas juvenis (Ganapathi, 1979),
segundo Carnegie (2007), o fungo T. nubilosa pode
causar 95% de desfolha das rvores.
Quando no h metodologias eficientes para
o controle, a desfolha pode se repetir ao longo do
ciclo da cultura ocasionando perdas de produtivida- Figura 1. Sintomas de MLD em diferentes estdios foliares
de E. gobulus. Juvenil (). Transio - juvenil para adulta
de, bem como perdas econmicas (Wingfield et al., (T). Adulta (*). Foto: Martha Maria Passador.
2013). No vero, que corresponde ao perodo de
maior converso de energia solar em crescimento,
a desfolha diminui a eficincia dessa converso. No
inverno alm da reduo de temperatura e pluvio-
sidade que afeta naturalmente o desenvolvimento
vegetal, a desfolha leva a planta a redirecionar ener-
gia destinada ao crescimento secundrio para a re-
composio de sua rea foliar, o que prejudica o de-
senvolvimento da planta (Freitas e Berti Filho, 1994;
Garrett, 2015).
As manchas ocasionadas podem ser arre-
dondadas ou irregulares com colorao amarelo-
-pardo a marrom-escuro, e para algumas espcies,
com bordas de cor marrom escuro (Park e Keane,
1982b; Crous, 1998) (Figura 1). Frequentemente, as
leses crescem e coalescem formando leses mui-
to grandes que podem ocupar toda a superfcie da
rea foliar e devido a isso, pode ocorrer a degra-
dao e queda da folha. Os patgenos podem ser
encontrados de maneira unitria ou associados na
mesma folha, bem como na mesma mancha, com
possvel contato de miclios de diferentes espcies
de Mycosphaerella e Teratosphaeria levando anas-
Figura 2. rvores de E. globulus em plantio comercial. r-
tomose e troca de material gentico (Hunter et al., vores com desfolha causada pela mancha de micosferela
2009). Dependendo da espcie do fungo e hospedei- (esq.); rvore tolerante (dir.). Foto: Martha Maria Passa-
ro, possvel observar os pseudotcios do patgeno dor.
na regio das manchas, na face abaxial ou em ambas
as faces da folha. Tambm possvel a formao de o que pode levar morte da rvore (Smith et al.,
cancros nas hastes, como por exemplo, T. cryptica 2007) (Figura 2). As rvores frequentemente tm o
em E. delegatensis. seu metabolismo alterado e isto ocasiona reduo
As plantas altamente suscetveis podem do crescimento. O estresse resultante da doena
ter o seu rendimento comprometido pela doena, faz com que a rvore esteja pr-disposta a outros

RAPP - Volume 24, 2016 33


Martha Maria Passador e Edson Luiz Furtado (30-41)

patgenos e insetos, bem como a fatores abiticos phaerella so submersos, pequenos, simples, globo-
desfavorveis (Carnegie e Keane, 1994; Hunter et al., sos e pretos com paredes espessas, alguns podem
2004). estar proeminentes, e possuem ostolos centrais fre-
Os ascsporos consistem na primeira fonte quentemente revestidos por perfises (Crous, 2009).
de inculo, para a maioria das espcies de Mycos- Os pseudotcios de Teratosphaeria no se encon-
phaerella e Teratosphaeria (Crous, 2007b; Park e tram totalmente imersos no tecido do hospedeiro,
Keane, 1987). Para ocorrncia da doena e necess- sendo parcialmente superficiais, e possuem partes
rio que haja condies favorveis, umidade a partir de hamatcios (Crous, 1998; Crous, 2009).
de 90% e temperaturas entre 15oC e 25oC (Alfenas, Nos pseudotcios se formaro as ascas,
2009; Crous, 2009). Quando h condies de umida- com oito ascsporos bicelulares ou tricelulares
de favorveis os ascsporos so liberados dos pseu- dependo da espcie (Park et al., 2000), que aps
dotcios, dispersos pelo vento e infectam o hospe- 24 horas germinam formando tubos germinativos
deiro por meio da abertura dos estmatos (Figura 3) que se desenvolvem a partir das duas extremi-
(Park, 1988; Alfenas, 2009). dades dos esporos. Os ascsporos so altamente
Aps a infeco, os primeiros sintomas da adaptados para sobreviverem desidratao na
doena podem aparecer em um perodo de trs a superfcie das folhas, por um perodo de at oito
quatro semanas em materiais genticos mais susce- semanas, com baixa perda da infectividade. Estes
tveis, e seis semanas em materiais mais tolerantes esporos em geral podem apresentar forma elip-
(Park et al., 2000). Os pseudotcios formam-se aps soidal, fusiforme ou com extremidades arredon-
oito semanas (Park e Keane, 1987), individualmente dadas, e possuem um ou mais septos. Em Mycos-
abaixo dos estmatos no tecido necrtico, que por phaerella so hialinos, lisos, possuem um septo, e
sua vez, fornecem lugar para a formao dos pseu- no apresentam apndices e camadas, e formam-
dotcios, e assim a distribuio dos estmatos pode -se em ascas bitunicadas e fasciculadas (Crous,
refletir a quantidade dos pseudotcios. Em Mycos- 2009). Os ascsporos de Teratosphaeria diferem

Figura 3. Ciclo vital de Teratosphaeria nubilosa. Adaptado de Mansilla, P. et al. (2005).Fotos: Martha M. Passador.

34 RAPP - Volume 24, 2016


Martha Maria Passador e Edson Luiz Furtado (30-41)

de Mycosphaerella por possurem com camadas j se encontrava amplamente distribudo na Nova


que geralmente se tornam marrons quando ainda Zelndia (Mohamed et al., 2003). Segundo Lindquist
esto nos seus ascos (Crous, 2009). e Purnell (1987), surtos epidmicos em plantaes
Muitos estudos sobre esses patgenos apre- de E. nitens, promoveram um comprometimento de
sentam algumas dificuldades relacionadas espo- at 32% de rea foliar por manchas causadas por es-
rulao para realizao de inoculaes artificiais, ses patgenos, causando desfolha de 35 a 50% em
sendo de grande importncia a formao do estado plantas de at trs anos de idade, e tendo como con-
anamorfo. Os estdios conidiais de anamorfos de es- sequncia uma reduo de at 17% no incremento
pcies de Mycosphaerella e Teratosphaeria so va- de madeira.
riados, algumas espcies produzem condios em pic- A ocorrncia de mancha de micosferela, cau-
ndios, outras em acrvulos, outras em conidiforos sada pelo complexo Mycospharella e Teratosphae-
(Alexopoulos et al., 1997). ria, principalmente por T. nubilosa em plantios de
Algumas espcies infectam primeiramente eucalipto, apresentam distribuio mundial (Fi-
por condios, porm certos estados anamorfos ainda gura 4). Alm da Austrlia (Park e Keane, 1982a;
so desconhecidos, incluindo o estado anamorfo de Carnegie e Keane, 1994, Maxwell et al., 2003) e
T. nubilosa (Jackson et al., 2008, Alfenas et al., 2009). Nova Zelndia (Hunter, 2004), h relatos na fri-
Embora este fungo tenha sido relacionado Uwe- ca do Sul (Lundquist & Purnell, 1987), Etipia
braunia juvenis, essa relao foi considerada duvido- (Gezahgne et al., 2006), Zimbabwe (Jimu et al.,
sa devido rara ocorrncia de condios em meio de 2015) e China (Hunter et al., 2009). Os agentes
cultura (Crous et al., 2006). causais tambm foram relatados em alguns pa-
ses da Amrica do Sul, como Uruguai (Perez et
Distribuio mundial da doena al., 2009a, 2009b; Soria et al., 2014), Argentina
A introduo de espcies de eucalipto em (Crouset al., 2006; Ramos e Perez, 2014), Chile
muitos pases do Hemisfrio Sul no sculo XX con- (Ahumada et al., 2003) e Brasil (Perez et al., 2009c,
tribuiu consideravelmente para a distribuio geo- Passador et al., 2012; Teodoro et al., 2012; Passador
grfica de T. nubilosa (Hunter et al., 2009). A pri- et al., 2013; Cndido, 2014).
meira constatao desse fungo, fora da Austrlia, A primeira constatao de T. nubilosa no Qu-
foi no ano de 1950 na frica do Sul. Porm, Lund- nia, Tanznia e Zmbia foi em 1995 como Mycos-
quist e Purnell (1987) acreditam que o fungo j po- phaerella juvenis (Crous, 1998), e na Etipia em 2000
deria estar presente no pas desde 1930. Posterior- (Hunter et al., 2009). provvel que esse fungo te-
mente, foi relatado em outros pases e, em 1982, nha chegado Europa por volta do ano 2001, pos-

Figura 4. Distribuio mundial dos agentes causais de mancha de micosferela em eucalipto.

RAPP - Volume 24, 2016 35


Martha Maria Passador e Edson Luiz Furtado (30-41)

teriormente constatado em E. globulus na Espanha Existem relatos no Brasil em E. dunnii, E.


(Crous et al, 2004) e em Portugal (Silva et al., 2008; globulus, E. benthamii, E. grandis, E. moluccana,
Hunter et al., 2009; Silva et al., 2009). E.nitens, E. saligna, E. urophylla e seus hbridos,
No Brasil, surtos epidmicos de manchas fo- ocorrendo em reas de temperaturas entre 15oC
liares, devido a esses agentes causais eram pouco e 25oC e presena de gua nas folhas (Alfenas et
comuns. At o ano de 2004, foram relatadas apenas al., 2009; Perez et al, 2009c; Cndido et al., 2014).
quatro espcies, sem muita importncia epidemio- Alm de T. nubilosa, outras espcies tambm foram
lgica, sendo elas M. heimii, M. parkii, M. suttoniae e constatadas no pas: T. pseudafricana, T. ohnowa,
T. suberosa, em E. globulus e E. nitens (Alfenas et al., T. pseudoeucalypti, T. flexuosa, T. perpendicularis,
2009) e tambm M. scytalidii em E. globulus (Crous Mycosphaerella heimii,, M. marksii, M. lateralis, M.
et al., 2006). A preocupao com relao doena gregaria, M. communis, M. crystallina, M. scytali-
teve seu incio em 2007, com a primeira constata- dii, Dissoconium dekkeri (=M. lateralis) (Perez et al,
o de T. nubilosa (Figura 5) no Rio Grande do Sul, o 2009c; Passador et al, 2012; Teodoro et al., 2012;
que resultou em muitos danos em plantaes de E. Passador et al., 2013; Cndido et al., 2014).
globulus (Perez et al., 2009a). Estudos realizados em A deteco de espcies de agentes causais de
plantios nesta regio constataram que 50 a 90% das mancha de micosferela no Brasil sugere que foram
rvores de E. globulus apresentavam sintomas cla- introduzidas por meio de mudas e sementes, e as-
ros desta doena, bem como a morte de 2,5 a 18,4% sim tambm promoveu a introduo em diferentes
das rvores em plantios de 16 meses, tambm foi as- locais no pas. Tambm possvel que a introduo
sociada referida doena (Ramiro et al., 2007). Nos e disseminao tenham ocorrido por meio da dis-
anos seguintes, j foi possvel constatar esse patge- perso natural de ascsporos pelo vento, sendo esse
no em plantios comerciais localizados no estado de um grande fator responsvel pela distribuio destes
So Paulo (Passador et al., 2012). fungos (Park e Keane, 1982b; Park, 1988; Hunter et

Figura 5. A-D: Folhas de Eucalyptus globulus com manchas causadas por T. nubilosa. A: manchas em folha jovem. B:
face abaxial de folha jovem. C: manchas em folha adulta. D: face abaxial de folha adulta. E: pseudotcio contendo ascas
e ascsporos. F: ascsporos germinados em meio de extrato de malte (MEA). F: cultura de T. nubilosa em meio MEA.
Barras: 5 mm (B, D) e 20 m (E, F). Fonte: Passador et al., 2012.

36 RAPP - Volume 24, 2016


Martha Maria Passador e Edson Luiz Furtado (30-41)

al., 2009). phaerella, foram transferidas para o gnero Teratos-


provvel tambm que a introduo dos phaeria, como: T. molleriana, T. nubilosa, T.cryptica,
patgenos tenha ocorrido pelo movimento de se- T. ohnowa, T. parva, T. africana. Porm, muitas con-
mentes e mudas entre Brasil, Uruguai e Argentina. tinuam em Mycosphaerella, como: M. crystalina, M.
Algumas das espcies Mycosphaerella e Teratospha- lateralis, M. marksii, M. gregaria, M. parkii. Apesar
eria isoladas no Brasil, tambm foram constatadas das mudanas nos nomes das espcies dos agentes
no Uruguai como M. lateralis, M. marksii, T. nubilosa causais, o nome comum para a doena no foi al-
e T. ohnowa, T. nubilosa (Prez et al., 2009a, 2009b). terado (Crous, et al., 2007a, 2007b; Hunter et al.,
Alm do Uruguai, as fontes de inculo podem ser 2009). Recentemente os termos mancha de Micos-
provenientes de qualquer pas com o qual o Brasil ferela (Mycosphaerella leaf disease - MLD) e man-
realize importaes de materiais. cha de Teratosphaeria (Teratosphaeria leaf disease
- MLD) foram propostos para as doenas causadas
Os agentes causais e suas distncias taxonmicas por Mycosphaerella spp. e Teratosphaeria spp, res-
Algumas espcies podem ser diferenciadas pectivamente (Hunter et al., 2011).
umas das outras por meio dos padres de germina-
o dos ascsporos (Ganapathi, 1979; Park e Keane, Metodologias para controle
1982a; Crous, 1998), e quando cultivadas em meio Tcnicas de melhoramento gentico so bas-
de cultura podem apresentar miclio cotonoso ou tante importantes para o controle de mancha de
no, e coloraes distintas (Crous, 1998; Maxwell, micosferela, principalmente em plantios de E. glo-
2003). Por exemplo: germinao bipolar em linha bulus, nos quais acarreta grandes prejuzos. A forma
reta e com tubo germinativo sem ramificaes como mais efetiva de controle para essa doena pode estar
o fungo T. nubilosa; em apenas em um dos plos do relacionada com o desenvolvimento de variedades
esporo como em M. gregaria; ou germinao bipo- resistentes, ou a substituio de plantas suscetveis
lar com ramificaes perpendiculares como em M. por espcies consideradas mais resistentes, como foi
lateralis. aplicado em alguns locais como frica do Sul (Lund-
Na maioria das espcies, no ocorre forma- quist e Purnell, 1987) e noroeste da Austrlia (Mo-
o do pseudotcio em meio de cultura, mesmo hammed et al., 2003). Esta estratgia tambm foi
que sejam axnicas, e so encontradas somente nas utilizada em plantaes jovens com E. delegatensis
manchas em folhas (Park e Keane, 1982a; 1982b). e E. regnans, na Nova Zelndia, que foram toma-
Em meio de cultura (extrato de malte MEA), o cres- das pela doena, o que conduziu ao uso de espcies
cimento micelial e a colorao podem variar entre como o E. nitens (Crous, 2009).
tons de cinza, marrom e verde escuro, porm com Em viveiros, o controle com produtos qumi-
velocidades de crescimento semelhantes, crescen- cos torna-se mais fcil, porm, no a melhor solu-
do cerca de dois centmetros em quatro semanas o quando se trata de condies de campo. Fatores
(Crous, 1998, Maxwell, 2003). como a penetrao exclusivamente por aberturas es-
A taxonomia relacionada Mycosphaerella tomticas podem ser levados em considerao para
e Teratosphaeria e a identificao de espcies que o desenvolvimento de plantas por meio de melhora-
pertencem a estes gneros torna-se difcil algumas mento gentico. Por exemplo, o atraso na abertura
vezes, principalmente em funo dos hospedeiros, dos estmatos pode contribuir para resistncia, pois
o que j foi considerado como fator primrio para os ascsporos germinados na superfcie do hospe-
identificao. Atualmente, caractersticas morfol- deiro durante o perodo noturno no encontrariam
gicas, conexes com teleomorfos, bem como os pa- os estmatos abertos e dessecariam, evitando a en-
dres de germinao dos ascsporos, tm sido ca- trada do patgeno e, consequentemente, a infeco
ractersticas taxonmicas teis para a classificao do hospedeiro.
desses patgenos (Crous, 1998, Hunter et al., 2011). A utilizao de hbridos entre espcies resis-
Devido a alguns rearranjos taxonmicos, tentes e suscetveis tambm uma alternativa vi-
principalmente relacionados a anlises filogenticas vel, por exemplo, hbridos de E. globulus (suscetvel
(Crous 2001, Crous, 2006, 2007b; Perez 2009c), al- a T. nubilosa) e E. grandis (resistente a T. nubilosa)
gumas espcies que pertenciam ao gnero Mycos- (Carnegie e Ades, 2002; Carnegie e Keane., 1998;

RAPP - Volume 24, 2016 37


Martha Maria Passador e Edson Luiz Furtado (30-41)

Milgate et al. 2005). Hbridos interespecficos que o de materiais ainda mais resistentes dentro de E.
apresentem transio mais rpida de folhas jovens globulus.
para adultas tambm podem ser utilizados como for- A hibridao interespecfica outro caminho
ma de controle (Hamilton et al., 2010). que est sendo seguido visando incorporao do
A busca de material gentico resistente, tam- carter da qualidade da madeira presente em E. glo-
bm pode envolver estudos relacionados aos meca- bulus em outras espcies como: E. grandis,E. uro-
nismos de defesa estruturais pr-formados do hos- phyllae E. saligna. Estes materiais mais resistentes
pedeiro, como pilosidade, espessamento da cutcula, selecionados apresentam atualmente grande valor
nmero e distribuio dos estmatos, lignificao pra obteno de hbridos.
das paredes celulares, nmero e espaamento das
clulas do parnquima, xilema e fibras esclerenqui- Referncias
mticas presentes nas nervuras das folhas. Segundo Ahumada R (2003) Pathogens in commercial Euca-
Silva et al. (2005), tecidos parenquimticos tambm lyptus plantations in Chile, with special reference
podem exibir resistncia aos patgenos, atravs da to Mycosphaerella and Botryosphaeria species.
organizao e caractersticas das clulas. Smith et al. Dissertao de Mestrado. University of Pretoria,
(2007) verificaram que E. nitens, uma espcie consi- Pretoria, South Africa. Disponvel em: http://hdl.
derada resistente aos agentes causais de mancha de handle.net/2263/25928. Acessado em: 13 de fe-
micosferela, possui uma maior proporo de parn- vereiro de 2011.
quima palidico e uma menor quantidade de espa- Alexopoulos CJ, Mims CW, Blackwell M (1996) Intro-
os intercelulares em suas folhas. ductory mycology. 4th Ed. New York, United States.
Outro fator que pode contribuir fortemente Wiley & Sons.
o gerenciamento de aes quarentenrias, pois o Alfenas AC, Zauza EAV, Mafia RG, Assis TF (2009)
primeiro passo para o controle de doenas. Tais me- Clonagem e doenas do eucalipto. 2ed.Viosa,
didas devem ser aplicadas e atualizadas para reduzir Brasil. Editora UFV.
o risco da disperso de fungos fitopatognicos (Auer Auer CG, Santos FDos (2009) Reconhecimento e
e Santos, 2009), assim como para T. nubilosa, que Identificao dos Principais Patgenos de Impor-
est cada vez mais presente em novos ambientes tncia Quarentenria Associados a Materiais de
(Hunter et al., 2009; Garret, 2015). Portanto, im- Propagao ou Madeira. Colombo, Brasil. EM-
portante que as espcies de Mycosphaerella e Tera- BRAPA Florestas.
tosphaeria, relatadas no Brasil e em pases vizinhos Barrela RJMBM (2011) Identificao E Sequenciao
sejam incorporadas em normas quarentenrias e lis- De Genes Da Via Da Lenhificao Em Bibliotecas
tas de discusso para controlar o avano da doena BAC De Eucalyptus Globulus. Tese de doutorado,
no Brasil. Instituto Superior de Agronomia, Universidade
De maneira geral, para o desenvolvimento Tcnica De Lisboa, Lisboa.
de metodologias de controle torna-se necessrio o Braga HC (1971) Os leos essenciais no Brasil es-
conhecimento dos patgenos, seu habitat e exign- tudo econmico. Rio de Janeiro, Brasil, Departa-
cias fisiolgicas para sua sobrevivncia, no somente mento de Pesquisa Agropecuria.
para espcies de Mycosphaerella e Teratosphaeria, Cndido TS, Silva AC, Guimares LMS, Ferraz HGM,
como tambm para agentes causais de muitas doen- Jnior NB, Alfenas AC (2014) Teratosphaeria
as. Desta maneira, podero ser desenvolvidas solu- pseudoeucalypti on eucalyptus in Brazil. Tropical
es eficazes e menos agressivas ao meio ambiente. Plant Pathology 39(5):407-412.
Dentre as medidas adotadas atualmente por Carnegie AJ (2007) Forest health condition in New
empresas localizadas na regio Sul do pas, assim South Wales, Australia, 19962005. Fungal dam-
como no Uruguai, a seleo de plantas resistentes, age recorded in eucalypt plantations during forest
principalmente aquelas remanescentes dos campos health surveys and their management. Austral-
atacados e sem sintomas uma metodologia vivel. asian Plant Pathology 36(3): 225-239.
A partir destas plantas possvel obter clones e fa- Carnegie AJ, Ades P (2002) Added phosphorus is as-
zer cruzamentos para futuros testes de prognies, e sociated with reduced severity of Mycosphaerella
inoculaes em ambientes controlados para a sele- cryptica in Eucalyptus globulus. Australian Forest-

38 RAPP - Volume 24, 2016


Martha Maria Passador e Edson Luiz Furtado (30-41)

ry 64(4): 203-208. impactos sobre doenas de plantas no Brasil.


Carnegie AJ, Keane PJ (1994) Further Mycosphaer- Braslia, Brasil. Embrapa Informao Tecnolgi-
ella species associated with leaf diseases of Euca- ca,p.273-286.
lyptus. Mycological Research 98(4): 413-418. Ganapathi A (1979) Studies of the etiology of the leaf
Carnegie AJ, Keane PJ (1998) Mycosphaerella ves- bloch disease of Eucalyptus spp. caused by Myco-
pa from diseased Eucalyptus leaves in Australia. sphaerella nubilosa (Cke) Hansf. Tese de doutora-
Mycological Research 102(10): 1274-1276. do. Univesity of Auckland, New Zeland.
Correa MP (1931) Dicionrio das plantas teis do Garrett ATA (2015) Influncia da mancha foliar de
Brasil e das exticas cultivadas. Rio de Janeiro, Mycosphaerella no desenvolvimento de Eucalyp-
Brasil. Imprensa Nacional. tus dunnii na regio serrana de Santa Catarina.
Crous PW (1998) Mycosphaerella spp. and their Dissertao de Mestado. Universidade Estadual
anamorphs associated with leaf spot diseases of do Centro-Oeste, Paran, Brasil.
Eucalyptus. Mycologia Memoirs. St. Paul,United Gezahgne A, Roux J, Hunter GC, Wingfield MJ (2006)
States. APS Press. Mycosphaerella species associated with leaf dis-
Crous PW (2009) Taxonomy and phylogeny of the ease of Eucalyptus globulus in Ethiopia. Forestry
genus Mycosphaerella and its anamorphs. Fungal Pathology 36: 253263.
Diversity 38: 1-24. Hamilton M, Williams D, Wardlaw T, Potts BM
Crous PW, Kang JC, Braun U (2001) A phylogenetic (2010) Early phase change may protect against
redefinition of anamorph genera in Mycosphae- Mycosphaerella leaf disease. Disponvel em:
rella based on ITS rDNA sequence and morphol- http://www.crcforestry.com.au/view/index.
ogy. Mycologia 93(6): 1081-1101. aspx?id=66157. Acessado em 1 de janeiro de
Crous PW, Aptroot A, Kang JC, Braun U, Wingfield 2010.
MJ (2000) The genus Mycosphaerella and its ana- Hunter GC, Crous PW, Carnegie AJ, Burgess TI,
morphs. Studies in Mycology 45: 107-121. Wingfield MJ (2011) Mycosphaerella and Terato-
Crous PW, Groenewald JZ, Mansilla JP, Hunter GC, sphaeria diseases of Eucalyptus; easily confused
Wingfield MJ (2004) Phylogenetic reassessment and with serious consequences. Fungal Diversity
of Mycosphaerella spp. and their anamorphs oc- 50:145-166.
curring on Eucalyptus. Studies in Mycology 50: Hunter GC, Roux J, Wingfield BD, Crous PW, Wing-
195214. field MJ (2004) Mycosphaerella species causing
Crous PW, Wingfield MJ, Mansilla JP, Alfenas AC, leaf disease in South African Eucalyptus planta-
Groenewald JZ (2006) Phylogenetic reassessment tions. Mycological Research 108: 672681.
of Mycosphaerella spp. and their anamorphs oc- Hunter GC, Crous PW, Carnegie AJ, Wingfield MJ
curring on Eucalyptus II. Studies in Mycology 55: (2009) Teratosphaeria nubilosa, a serious leaf dis-
99131. ease pathogen of Eucalyptus spp. in native and
Crous PW, Braun U, Groenewald JZ (2007a) Myco- introduced areas. Molecular Plant Pathology 10:
sphaerella is polyphyletic. Studies in Mycology 114.
58: 132. IB (Indstria Brasileira de vores) (2015) Relatrio
Crous PW, Summerell BA, Carnegie AJ, Mohammed IB 2015. Disponvel em: http://iba.org/images/
C, Himaman W, Groenewald JZ (2007b) Foliico- shared/iba_2015.pdf. Acessado trs de maro de
lous Mycosphaerella spp. and their anamorphs 2016.
on Corymbia and Eucalyptus. Fungal Diversity Jackson SL, Maxwell A, Burgess TI, Hardy GE, Dell B
26(3): 143-185. (2008) Incidence and new records of Mycospha-
Freitas S de, Berti Filho E (1994) Efeito do desfolha- erella species within a Eucalyptus globulus plan-
mento no crescimento de Eucalyptus grandis Hill tation in western Australia. Forest Ecology and
ex Maiden (Myrtaceae). IPEF 47: 36-43. Management 255: 3931-3937.
Furtado EL, Santos CAG, Masson MV (2008) Impacto Jackson SL, Maxwell A, Neumeister-Kemp HG, Dell B,
potencial das mudanas climticas sobre a fer- Hardy GEStJ (2004) Infection, hyperparasitism
rugem do eucalipto no Estado de So Paulo. In: and conidiogenesis of Mycosphaerella latera-
Ghini R, Hamada E (Eds.) Mudanas climticas: lisonEucalyptus globulusin Western Australia.

RAPP - Volume 24, 2016 39


Martha Maria Passador e Edson Luiz Furtado (30-41)

Australasian Plant Pathology 33(1): 49-53. Park RF, Keane PJ (1982b)Leaf diseases of Eucalyptus
Johnson ED (1926) A comparison of the juvenile and associated with Mycosphaerella species. Transac-
adult leaves of Eucalyptus globulus. New Phytolo- tions of the British Mycological Society, London
gist 25(3): 202-212. 79(1): 101-115.
Jimu L, Wingfield MJ, Mwenje E, Roux J (2015) Dis- Park RF, Keane PJ (1987)Spore productions by My-
eases on Eucalyptus species in Zimbabwean plan- cosphaerella species causing leaf diseases of Eu-
tations and woodlots. Southern Forests77(3): calyptus. Transactions of the British Mycological
221-230. Society 89(4): 461-470.
Lorenzi H, Matos FJA (2002) Plantas medicinais do Park RF, Keane P.J, Crous PW, Wingfield MJ (2000)
Brasil: nativas e exticas. Nova Odessa, Brasil, In- Fungal diseases of Eucalypt foliage. In: Keane PJ,
stituto Plantarum, 2002. 512 p. Kile GA, Podger FD (Eds.) Diseases and pathogens
Lundquist JE, Purnell RC (1987) Effects of Myco- of eucalypts. Melbourne, Australia. CSIRO Pu-
sphaerella leaf spot on growth of Eucalyptus ni- blishing.
tens. Plant Disease 71(3): 10251029. Passador MM, Lima PR, Pieri CDe, Harakava R,Fur-
Mansilla P, Agun O, Pintos C, Otero L (2005) Ficha tado EL (2012) Teratosphaeria nubilosa em plan-
tcnica 37/05: Mycosphaerella nubilosa. Esta- taes comerciais de Eucalyptus globulus nas
cin Fitopatolxica do Areeiro. Servicio Agrario. regies Sul e Sudeste do Brasil. Summa Phyto-
Diputacin Provincial de Pontevedra. Disponvel pathologica 38(1): 11-16.
em: http://www.efa-dip.org/comun/publicacio- Passador MM, Lima PR, Pieri CDe, Sierra-Hayer JF,
nes/FTecnicas/Download/37ok%20mycosphae- Harakava R, Furtado EL (2013) Diversity of My-
rella.pdf. Acessado 17 de julho de 2008. cosphaerella spp. and Teratosphaeria spp. in Eu-
Maxwell A, Dell B, Neumeister-Keip HG, Hardy GESJ calyptus globulus plantations in Brazil. European
(2003) Mycosphaerella species associated with Journal of Plant Pathology 135: 1-13.
Eucalyptus in south-western Australia: new spe- Prez CA, Wingfield MJ, Altier NA, Blanchett RA
cies, new records and a key. Mycological research (2009a) Mycosphaerellaceae and Teratosphaeria-
107: 53-63. ceae associated with Eucalyptus leaf diseases and
Medrado MJS, Hoeflich VA, Castro AWV (2005)Em- stem cankers in Uruguay. Forest Pathology39(5):
brapa: evoluo do setor florestal no sculo XXI. 349-360.
Disponvel em: http://www.celuloseonline.com. Prez G, Hunter GC, Slippers B, Prez C, Wingfield,
br/Colunista/c olunista.asp?IDAssuntoMateria= BD, Wingfield MJ (2009b) Teratosphaeria (My-
271&iditem. Acessado 26 de janeiro de 2007. cosphaerella) nubilosa, the causal agent of My-
Milgate AW, Potts BM, Joyce K, Mohammed CL, cosphaerella leaf disease (MLD), recently intro-
Vaillancourt RE (2005) Genetic variation in Eu- duced into Uruguay. European Journal of Plant
calyptus globulus for susceptibility to Mycospha- Pathology 125: 109118.
erella nubilosa and its association with tree gro- Perez G, Slippers B, Wingfield BD, Finkenauer E,
wth. Australasian Plant Pathology 34(1): 1118. Wingfield MJ (2009c) Mycosphaerella leaf dis-
Mohammed C, Wardlaw T, Smith A, Pinkard E, ease (MLD) outbreak on Eucalyptus globulus in
Battaglia M, Glen M, Tommerup I, Potts BM, Brazil caused by Teratosphaeria (Mycosphaerella)
Vaillancourt R. Mycosphaerella leaf diseases of nubilosaPhytopathologia Mediterranea 48(2):
temperate eucalypts around the southern pa- 302-306.
cific rim. New Zealand Journal of Forest Scien- Prez G, Burgess TI, Slippers B, Carnegie AJ, Wing-
ce33: 362-372. field, BD, Wingfield MJ (2014) Teratosphaeria
Park R F (1988) Epidemiology of Mycosphaerella pseudonubilosa sp. nov., a serious Eucalyptus leaf
nubilosa and M. cryptica on Eucalyptus spp. in pathogen in the Teratosphaeria nubilosa species
south-western Australia. Transactions of the complex. Australasian Plant Pathology 43: 6777.
British Mycological Society 91(2): 261-266. Putzke J, Putzke MTL (1998) Os reinos dos fungos.
Park RF, Keane PJ (1982a)Three Mycosphaerella spe- Santa Cruz do Sul, Brasil. 1st. Ed. EDUNISC.
cies from leaf diseases of Eucalyptus. Transactions Ramos SO, Perez CA (2014). First report of Terato-
of the British Mycological Society79(1): 95-100. sphaeria pseudoeucalypti on Eucalyptus hybrids

40 RAPP - Volume 24, 2016


Martha Maria Passador e Edson Luiz Furtado (30-41)

in Argentina. Plant Disease 99:554-554. Pathology 37(6): 361-373.


Ramiro GA, Finkenauer E, Furtado EL, Rosa DD, Ohto Soria S, Alonso R, Bettucci L, Lupo S (2014) First
CT, Basseto MA, Souza HG. PROTEF 2007. Ocor- report of Teratosphaeria pseudoeucalypti in
rncia e epidemiologia de Mycosphaerella no sul Uruguay. Australasian Plant Dis. Notes 9:146.
do Brasil: estudo de caso. Disponvel em: http:// Teodoro MG, Ferreira MA, Guimares LMS, Ma-
www.ipef.br/eventos/2007/rtprotef11/pales- fia RG, Groenewald JZ, Crous PW, Alfenas AC
tra06.pdf. Acessado 15 de agosto de 2009. (2012) Mycosphaerella and Teratosphaeria spe-
Rocha MEN, Santos CL (2007) O uso comercial e cies associated with leaf diseases onEucalyptus
popular do eucalipto Eucalyptus globulus Labill- globulus in southern Brazil. Phytopathologia
Myrtaceae. Sade & Ambiente em Revista 2(2): Mediterranea 51:355-36.
23-34. Vitti AMS, Brito J (2003) O. leo essencial de euca-
SILVA LM, ALQUINI Y, CAVALLET V J (2005) Inter-rela- lipto. Documentos florestais17:1-26.
es entre a anatomia vegetal e a produo vege- Wingfield JW, Roux J, Slippers B, Hurley BP, Garnas
tal. Acta Botanica Brasilica 19(1): 183-194. J, Myburg A, Wingfield, BD (2013) Established
Silva M, Valente C, Neves L, Machado H (2008)Eva- and new technologies reduce increasing pest
luation of Mycosphaerella impact on eucalypts and pathogen threats to Eucalypt plantations.
plantations in Portugal.Revista de Cincias Agr- Forest Ecology and Management 301: 3542.
rias, Lisboa 31(2): 112-118. Xavier A, Otoni WC, Penchel RM (2007) Micropro-
Silva M, Machado H, Phillips AJL (2009) Mycosphae- pagao e enxertia in vitro de espcies florestais.
rella species occurring on Eucalyptus globulus In: Borm A (Ed.) Biotecnologia florestal. Viosa,
in Portugal. European Journal of Plant Pathol- Brasil. Suprema Grfica e Editora.
ogy125, 425433. Yang JL, Fife D (2000) Wood Properties Of Three Prov-
Smith AH, Pinkard EA, Hunter GC, Wingfield MJ, enances Of Plantation-Grown Eucalyptus globu-
Mohammed CL (2007) Anatomical and histo- lus Labill. Growth Strain. In: International Union
chemical defence responses induced in juvenile Of Forest Research Organizations, Abstracts Vi-
leaves of Eucalyptus globulus and Eucalyptus enna, Austria. p. 301-309.
nitens by Mycosphaerella infection. Forestry

RAPP - Volume 24, 2016 41


Edivnio R. Arajo e Daniel P. Alves (42-54)

MANEJO DO MLDIO DA CEBOLA:


AVANOS E BARREIRAS DA PESQUISA
CIENTFICA
Edivnio R. Arajo1 e Daniel P. Alves1

RESUMO
A cebola uma hortalia de grande importncia econmica e social no
Brasil e no mundo. Contudo, estudos mais recentes sobre agentes etiolgicos
que causam danos cultura so relativamente escassos. Entre esses agentes, o
causador do mldio, Peronospora destructor, um dos mais destrutivos, uma vez
que no existem cultivares resistentes disponveis no Brasil, o que leva ao uso
intensivo de defensivos. Pretende-se, nesta reviso, abordar a ocorrncia global
do patgeno, bem como relatar os principais grupos de pesquisa que trabalham
com o patossistema. Questes relacionadas ao manejo da doena sero trata-
das, destacando-se os sistemas de alerta j documentados ou ainda em fase de
validao. Os principais avanos e obstculos na busca de resistncia tambm
sero discutidos, abordando tpicos sobre: descoberta de genes de resistncia;
dificuldade de introgresso de genes de resistncia em materiais comerciais; e
utilizao de marcadores moleculares citoplasmticos e nucleares, que auxilia-
ro no desenvolvimento de hbridos. Espera-se, a partir dessas abordagens, es-
clarecer aspectos biolgicos, epidemiolgicos e de manejo do mldio da cebola,
contribuindo para o debate e avano das fronteiras do conhecimento sobre esse
patossistema.

SUMMARY
Onion is a vegetable of great economic and social importance in Brazil
and worldwide. However, there are few recent studies on etiological agents that
cause crop damages. Among these agents, the causal agent of onion downy mil-
dew, Peronospora destructor, is one of the most destructive, since there are no
resistant cultivars available in Brazil, leading to the intensive use of fungicides.
In this review, we intend to address the overall occurrence of the pathogen as
well as report the main research groups working with the pathosystem. Issues
related to disease management will be addressed, especially the forecasting sys-
tems already documented or still in the validation step. The main progress and
obstacles in resistance search will also be discussed, addressing topics: finding
resistance genes; difficulty of the resistance gene introgression into commercial
materials; and use of cytoplasmic and nuclear molecular markers that will assist
in the development of hybrids. We hope, from these approaches, to clarify to-
pics about biological, epidemiological and management of onion downy mildew,
contributing to the debate and advance the knowledge frontiers about this pa-
thosystem.

1
Epagri/Estao Experimental de Ituporanga, Estrada Geral Lageado guas Negras, 453, Ituporanga SC, 88400-000

42 RAPP - Volume 24, 2016


Edivnio R. Arajo e Daniel P. Alves (42-54)

Introduo cao foram apresentadas at o incio do sculo XX,


A cebola (Allium cepa L.) a terceira hortalia citando B. parasitica, P. schleideniana e P. alliorum
em importncia econmica no mbito nacional. Em (Yarwood, 1943). Porm, o nome P. destructor, pro-
2015, a rea estimada de plantio foi de aproximada- posto aps reviso realizada por Berkeley, em 1860,
mente 58 mil hectares, enquanto a produo brasi- o utilizado atualmente nos trabalhos e manuscritos
leira esteve prxima a 1,6 milhes de toneladas. A produzidos. Assim sendo, o agente causal do mldio
produo estimada da cultura se distribui da seguin- da cebola, Peronospora destructor (Berkeley) Caspa-
te maneira: regio Nordeste (18,3%), Sudeste (22%), ry ex Berkeley pertence famlia Peronosporaceae,
Sul (53,1%) e Centro-Oeste (6,6%). No h registros ordem Peronosporales, classe Oomicetos e subdivi-
significativos de produo de cebola na regio Norte so Mastigomicotina.
do pas (IBGE, 2015). Apesar da relevncia da cultu- O mldio da cebola tem ocorrncia global,
ra, estudos que abordam aspectos fitopatolgicos sendo relatado nos principais pases produtores
ainda so relativamente escassos quando compara- da hortalia. Estimativas de perdas mais atuais no
dos com os j existentes para outras hortalias, ci- esto relatadas, mas segundo Develash & Sugha
tando o tomate e a batata. (1997), em condies favorveis, a doena pode cau-
As doenas que acometem a cebola tm inci- sar uma reduo na produtividade de at 75%.
dncia e/ou severidade dependente de diversos fa- Os sintomas da doena podem ser observa-
tores, tais como tolerncia/resistncia dos cultivares dos em qualquer estdio de desenvolvimento da
utilizados, sistema de produo (mudas em canteiros cultura, tanto em folhas como em hastes florais. Ini-
ou semeadura direta); poca de semeadura; popula- cialmente observam-se manchas ovaladas de tonali-
o de plantas; condies climticas locais; presen- dade verde-claro no sentido longitudinal das folhas
a ou ausncia de outras plantas da mesma famlia; (Figura 1A). Um mofo violeta-acinzentado, corres-
prticas de manejo do solo e equilbrio nutricional; pondente s estruturas do patgeno, pode ser ob-
diversidade da populao do fitopatgeno; entre ou- servado em condies de alta umidade (Figura 1B),
tros. Dessa forma, possvel observar diferenas de nas primeiras horas da manh (Wordell Filho & Boff,
relevncia das doenas entre regies. Nota-se que, 2006). comum, aps a infeco por P. destructor e
enquanto em regies com clima tropical, a mancha a formao de eventuais leses necrticas, que estas
prpura (Alternaria porri) uma doena muito preo- sejam colonizadas por fungos saprfitas, em especial
cupante (Reis & Henz, 2009); na regio Sul, o mldio por espcies de Stemphylium, o que pode causar al-
est entre os principais fatores biticos limitantes da guma incerteza quanto diagnose. Por se tratar de
produo (Wordell Filho & Boff, 2006). um organismo biotrfico, dificilmente o patgeno
A seguir, sero abordados tpicos relaciona- causar a morte da planta, sendo o subdesenvol-
dos ao histrico, epidemiologia, manejo e resistn- vimento (Figura 1C), com consequente reduo de
cia gentica ao mldio da cebola, relatando os prin- produtividade, os principais danos causados pelo
cipais avanos e barreiras nas tentativas de reduo oomiceto.
de prejuzos causados pela doena. A vasta distribuio do patgeno (Figura 2)
pode ser explicada pela ampla faixa trmica na qual
Etiologia e histrico do mldio da cebola P. destructor consegue sobreviver e reproduzir. Por
O primeiro relato documentado de mldio em se tratar de um parasita obrigatrio, restos culturais
cebola ocorreu em 1841, na Inglaterra. Berkeley, ao e plantas invasoras podem ser fontes de inculo,
descrever as caractersticas morfolgicas do patge- como demonstrado parcialmente no ciclo de vida
no que causava a doena, o classificou em um primei- esquematizado do patgeno (Figura 3), contudo,
ro momento como Botrytis destructor. A ausncia ainda no existem estudos aprofundados que com-
de visualizao ou descrio ilustrativa de osporos provem a importncia epidemiolgica dessas fon-
(esporos sexuais) causaram controvrsias na aloca- tes, em especial, das plantas invasoras. Apesar da
o do patgeno dentro do gnero Peronospora nos adaptabilidade trmica, P. destructor possui tempe-
anos seguintes. Em 1847, Unger prope o nome P. raturas timas de desenvolvimento e esporulao.
schleideni, aceito entre taxonomistas da rea por Segundo Hildebrand & Sutton (1982), a esporulao
vrios anos. Algumas outras propostas de classifi- do patgeno ocorrer apenas em temperaturas in-

RAPP - Volume 24, 2016 43


Edivnio R. Arajo e Daniel P. Alves (42-54)

Figura 1. Sintomatologia do mldio em folhas da cebola, causado por Peronospora destructor. A manchas ovaladas
de tonalidade verde-claro em sentido longitudinal da folha; B sinais do patgeno sobre a folha, dando um aspecto de
mofo acinzentado; C plantas sob infeco da doena, apresentando subdesenvolvimento. A seta e o crculo indicam
sintoma da doena e sinais do patgeno, respectivamente.

feriores a 24C, associado a umidade relativa do ar (Thakur & Mathur, 2002) e o Brasil (Wordell Filho &
95%. Bashi & Aylor (1983) relataram que a tempe- Boff, 2006) classificam a doena como de alta rele-
ratura de 10C foi a ideal para esporulao do pat- vncia em virtude do seu potencial destrutivo e do
geno, sendo a esporulao reduzida em funo do valor comercial da cultura. Em pases onde a rea de
aumento da temperatura e de horas de exposio cultivo da cebola no to extensa ou o monocul-
luz solar. Por sua vez, Bulovien & Survilien (2006) tivo no to evidente, a doena pode no causar
constataram que uma alternncia na temperatura perdas elevadas, mesmo sendo endmica. Alm dis-
(15C por oito dias, seguido de cinco dias a 22C), so, as diferentes pocas de cultivo adotadas nos di-
sob elevada umidade, favoreceram a esporulao de versos pases tambm influenciam no surgimento de
P. destructor. O que se tem como consenso que a epidemias. Nota-se que os grupos atuais de pesquisa
doena favorecida por condies de alta umidade (publicaes de fcil acesso entre 2005-2016) esto
associada a temperaturas amenas. Isso explica, em localizados na Europa, sia e Amrica do Sul (Figura
parte, a razo de o mldio da cebola no ser uma 2). Centros de pesquisa com relevncia em estudos
doena to preocupante na regio central do Brasil, sobre cebola, como a Washington State University,
que caracterizada por umidade relativa mais baixa nos Estados Unidos, e o Agriculture and Agri-Food
e temperatura mais elevada quando comparada s Canada, no Canad, vem se dedicando nos ltimos
regies Sudeste e Sul. anos a estudos com bacterioses ps-colheita (com-
plexo de gneros e espcies) e queima das pontas da
Principais grupos e linhas de pesquisa sobre mldio cebola (Botrytis squamosa), respectivamente. Sendo
da cebola no mundo assim, no listam entre os centros de pesquisa que
Embora a doena tenha sido relatada em tm publicado trabalhos sobre mldio da cebola re-
mais de 40 pases (Farr & Rossman, 2016), o nmero centemente.
de grupos de pesquisa que trabalham com o patos- Outros fatores que podem estar associados a
sistema bem mais reduzido. Pases como a ndia uma limitada produo cientfica sobre o mldio da

44 RAPP - Volume 24, 2016


Edivnio R. Arajo e Daniel P. Alves (42-54)

Figura 2. Pases com relatos registrados de ocorrncia do mldio da cebola (Peronospora destructor) e centros de pes-
quisa com artigos tcnico-cientficos sobre o patossistema, publicados em peridicos especializados no perodo de
2005-2016. Pases com registro de ocorrncia de mldio Amrica: Argentina, Bolvia, Brasil, Canad, Costa Rica, Cuba,
El Salvador, Estados Unidos, Guatemala, Mxico, Panam, Uruguai e Venezuela. frica: frica do Sul, Ilhas Maurcio,
Lbia, Qunia, Tanznia e Zimbbue. Europa: Alemanha, ustria, Bulgria, Ilhas Canrias, Esccia, Espanha, Finlndia,
Inglaterra, Irlanda, Itlia, Grcia, Holanda, Litunia, Polnia, Portugal, Repblica Checa e Rssia. sia: China, Coria,
ndia, Japo, Paquisto, Tailndia e Taiwan. Oceania: Austrlia e Nova Zelndia (Farr e Rossman, 2016; Yarwood, 1943;
Moreno e Hernndez, 1992; Develash e Sugha, 1997).

cebola so: i) o patgeno um organismo biotrfi- anteriormente, a utilizao de molculas com ao


co, o que faz necessria a manuteno do inculo sistmica, em especial o metalaxyl, tem sido a for-
in planta; ii) a eficincia das molculas de controle, ma mais eficiente de controlar a doena at o pre-
em especial o metalaxyl, que at o presente tem sente momento (Develash & Sugha, 1997; Wordell
controlado de forma satisfatria a doena; iii) e a Filho et al., 2007). Molculas alternativas, tais como
dificuldade de obteno de cultivares com elevado fosfito de potssio, acibenzolar-s-metil e extrato de
nvel de resistncia. Na figura 2 apresentado um alga mostraram baixa eficincia de controle (Wordell
mapeamento com a ocorrncia relatada do mldio Filho et al., 2007). Sendo assim, o metalaxyl, asso-
da cebola no mundo, alm dos principais grupos que ciado a algumas molculas de efeito protetor, tais
realizam pesquisas sobre a doena, com respectivas como clorotalonil e mancozeb, vem sendo utilizadas
reas de estudo. O mapeamento foi realizado com no Brasil h pelo menos 20 anos. intrigante notar,
base nas produes tcnico-cientficas publicadas que apesar do monocultivo da cebola nas princi-
em peridicos especializados no perodo de 2005- pais regies produtoras do sul do pas e da aplica-
2016. o frequente da mesma molcula, ainda no foram
constatadas populaes insensveis do patgeno aos
Manejo e racionalizao no uso de defensivos qu- produtos aplicados, em especial o metalaxyl. Uma hi-
micos ptese para a explicao desse fato seria a perda de
O manejo do mldio da cebola baseia-se, prin- fitness ou competitividade j relatada para outros
cipalmente, no controle qumico. Como mencionado oomicetos. Essa alterao na competitividade pode

RAPP - Volume 24, 2016 45


Edivnio R. Arajo e Daniel P. Alves (42-54)

Figura 3. Esquema simplificado do ciclo de vida de Peronospora destructor, agente causal do mldio da cebola. Adaptado
de Bayer CropScience (http://wwwbayercropscience.com.mx).

ser distinta conforme o patossistema. Em estudo re- micos utilizados no controle do mldio. A reduo
alizado com Plasmopara viticola, causador do mldio ou o uso de forma mais racional de agrotxicos vai
da videira, no municpio de Holambra, Brasil, Gisi ao encontro de demandas da sociedade e polticas
& Sierotzki (2008) relatam que isolados resistentes pblicas, que exigem ambiente e alimentos menos
azoxistrobina tendem a desaparecer quando no contaminados pelo homem.
submetidos aplicao do produto. Essa prevalncia No final da dcada de 1950, na Holanda, fo-
de isolados sensveis azoxistrobina na ausncia do ram realizados os primeiros trabalhos que visavam
fungicida indica uma perda de competitividade da- estabelecer um sistema de previso para o mldio da
queles que j adquiriram resistncia. Por outro lado, cebola (Figura 4), baseados em parmetros clim-
isolados de espcies de Phytophthora resistentes ticos (Palti, 1989). Contudo, o primeiro sistema de
mefenoxam j foram caracterizados como sendo previso a ser nomeado foi desenvolvido por Jesper-
igualmente ou at mais agressivos que isolados sen- son & Sutton (1987) e foi chamado de DOWNCAST
sveis (Caf-Filho & Ristaino, 2008; Chapara et al., (acrnimo de downy mildew forecaster). O siste-
2011). Ainda no existem dados publicados nessa ma foi desenvolvido no Canad e baseia-se em tem-
linha de pesquisa para o mldio da cebola. peratura, umidade relativa do ar e precipitao para
Outras estratgias vm sendo desenvolvidas prever esporulao e infeco do patgeno. Os au-
no intuito de racionalizar o uso dos defensivos qu- tores testaram fungicidas com ao sistmica e pro-

46 RAPP - Volume 24, 2016


Edivnio R. Arajo e Daniel P. Alves (42-54)

tetora dentro do sistema. Concluiu-se que, apesar perodo j passado, ou seja, possvel que o proces-
do DOWNCAST ter uma boa preciso na previso so infeccioso tenha iniciado. Esse fato ressaltado
da doena, a aplicao prtica do sistema ainda no pelos autores do modelo ZWIPERO, os quais afir-
poderia ser efetuada pela dificuldade de previso do mam que este se trata de um verdadeiro sistema de
primeiro ciclo de infeco, o qual seria decisivo para previso. Friedrich et al., (2003), ao desenvolverem
uma maior ou menor intensidade da doena. Apro- o ZWIPERO (acrnimo de ZwiebelPeronospora
ximadamente 10 anos mais tarde, Visser (1998) re- forecast), modelo alemo baseado em variveis cli-
latou um aprimoramento do modelo DOWNCAST, mticas (temperatura, umidade, molhamento foliar
utilizando mais parmetros, como a quantificao do e precipitao), afirmavam que o modelo matemti-
molhamento foliar. Mesmo com esse avano, o autor co ZWIPERO, por considerar dados previstos, e no
recomenda mais esforos para que o sistema funcio- apenas dados j coletados, possuia a capacidade de
ne plenamente e possa ser aplicado na prtica. predizer os riscos de esporulao e infeco de P.
Entre o primeiro modelo nomeado e seu apri- destructor, e consequentemente, realizar o manejo
moramento, Battilani et al., (1996), na Itlia, props com fungicidas protetores, e no apenas com sist-
um modelo tambm baseado em parmetros clim- micos, como ocorrido nos modelos anteriores.
ticos (temperatura, umidade relativa e molhamento Outro sistema, elaborado no Reino Unido,
foliar), o qual foi nomeado como ONIMIL (acrnimo e que considera temperatura e umidade relativa
de onion downy mildew). Segundo os autores, o para previso do mldio da cebola, foi desenvolvi-
modelo, que utiliza regras empricas e matemticas, do por Gilles et al., (2004). J dispondo dos dados
seria capaz de determinar, diariamente, a probabili- anteriores, os autores compararam o sistema que
dade de ocorrncia do primeiro ciclo infeccioso, que elaboraram, denominado MILIONCAST (acrnimo
seria o momento mais adequado para o incio das de mildew on onion forecast), com aqueles rela-
pulverizaes com fungicidas. Nesse caso tambm tados na literatura. Segundo os autores, sob condi-
foi sugerido maiores ajustes para que ocorra aplica- o controlada, esporngios foram produzidos mais
o prtica a nvel de campo. rapidamente entre 8 a 12 C, aps cinco horas de
Os modelos supracitados so melhor clas- alta umidade, durante perodos escuros. O modelo
sificados como sistemas de aviso ou sistemas MILIONCAST teve predies de esporulao mais
de alerta. O termo sistema de previso induz a precisas que os sistemas DOWNCAST e ONIMIL
pensar que as medidas de controle sero tomadas nos diferentes ensaios avaliados.
antes mesmo do processo de infeco e/ou esporu- Nota-se que apesar do desenvolvimento de
lao do patgeno. No entanto, para tais modelos, modelos matemticos e/ou empricos cada vez mais
os dados climticos utilizados correspondem a um precisos com relao previso dos processos de

Figura 4. Histrico em ordem cronolgica dos sistemas de aviso/previso para o mldio da cebola (Peronospora destruc-
tor), com respectivos avanos e aprimoramentos.

RAPP - Volume 24, 2016 47


Edivnio R. Arajo e Daniel P. Alves (42-54)

esporulao e infeco de P. destructor, poucos so para impedir a invaso dos patgenos e o processo
os dados sobre a aplicao prtica desses modelos. de doena (Dalio et al., 2014). Essa a mesma ao
O objetivo primordial dos sistemas de aviso ou sis- observada quando uma planta de cebola submeti-
temas de previso racionalizar a aplicao de de- da ao ataque de P. destructor. Entender esta intera-
fensivos qumicos, preferencialmente por meio de o indispensvel para que se tenha um eficiente
um racionamento do produto. Contudo, regies com sistema de manejo.
condies ambientais altamente favorveis ocor- Atualmente, o nmero de cultivares de cebo-
rncia da doena, associado a alta concentrao de la com genes de resistncia ao mldio disponvel no
inculo podem dificultar esse racionamento. Logo, mercado limitado, logo a presso de seleo sobre
um sistema de previso de doena deve ser validado populaes de P. destructor baixa. Essa uma das
para determinada regio, antes da adoo do mes- possveis explicaes para a inexistncia de classifi-
mo naquele local. Mais recentemente, Arajo et al., cao subespecfica, em nvel de raa, para o pat-
(2015) avaliaram a campo, na regio Sul do Brasil, geno. Outra possvel razo para esse fato seria uma
um sistema de aviso do mldio da cebola, baseado reduzida diversidade gentica inerente espcie.
em uma modificao da tabela de Wallin, proposta Contudo, estudos mais aprofundados nessas reas
para requeima da batata, a qual considera diferentes ainda precisam ser realizados.
combinaes de temperatura e umidade relativa do A resistncia de plantas a patgenos consi-
ar. Nesse ensaio inicial foi possvel reduzir considera- derada o mtodo de controle mais eficaz e economi-
velmente o nmero de aplicaes de metalaxyl-m/ camente vivel para o controle de doenas de plan-
clorotalonil, sem afetar significativamente a produ- tas, uma vez que a tecnologia j est disponvel na
tividade. Repeties do ensaio sero realizadas para semente, no onerando o custo de produo. Adi-
validao do sistema. A correlao entre a quantida- cionalmente, o uso de resistncia gentica o m-
de de esporngios de P. destructor no ar e a seve- todo de controle que menos agride ao ecossistema,
ridade do mldio, realizada por Marcuzzo & Duffeck pois dispensa ou reduz significativamente a necessi-
(2015) na regio Sul do Brasil, poder ser mais uma dade de utilizao de defensivos qumicos.
ferramenta e/ou indicador a compor o sistema de No Brasil, se faz necessrio um grande nme-
aviso em desenvolvimento. ro de pesquisas com o patossistema, principalmente
importante salientar que os sistemas de avi- para grupos alocados no sul do pas. A regio sul do
so ou previso no so imutveis. Ao contrrio dis- Brasil concentra mais de 50% da produo nacional,
so, eles precisam sempre sofrer atualizaes, tanto sendo o mldio um dos principais fatores biticos res-
no que diz respeito ao uso de produtos com elevada ponsvel pela queda de produo. Alm das perdas
eficincia de controle, como a fatores relacionados diretas, existe tambm um elevado custo despendi-
a histrico da rea e da cultura nas regies onde se do para controle da doena, uma vez que no raro
pretende adot-los. Nos tpicos seguintes sero tra- encontrar produtores que utilizam o controle qumi-
tados aspectos relacionados a uma das principais, co uma a duas vezes por semana. A doena tambm
se no a principal forma de manejo de doenas de causa considervel dano durante a fase de produo
plantas: resistncia gentica. de sementes, com relatos de perdas entre 30 a 70%
no Brasil (Verona et al., 1996).
Genes de resistncia e a dificuldade de introgresso Os primeiros registros de busca por resistn-
A interao entre plantas e patgenos com- cia ao mldio da cebola datam do incio da dcada
plexa e envolve constantes mudanas, em mbito de 1950 (Figura 5), com trabalhos que visavam iden-
gentico, para que os organismos envolvidos consi- tificar e estudar a herana da resistncia. Em 1952,
gam atingir o objetivo frente ao processo de infec- Warid & Tims (citados por Cramer & Havey, 1999)
o. A essas constantes mudanas adaptativas que propuseram que a resistncia ao mldio encontrada
ocorrem decorrentes da interao planta-patgeno no cultivar Calread era determinada por dois locus
d-se o nome de coevoluo. Enquanto os patge- denominados s1 e s2. A resistncia ao patgeno foi
nos buscam superar as barreiras de defesa das plan- determinada como sendo recessiva, expressando-se
tas e iniciar a colonizao nos tecidos, as plantas por em maior magnitude quando ambos os genes esti-
sua vez apresentam um complexo sistema de defesa vessem em homozigose, s1s1s2s2. No entanto, segun-

48 RAPP - Volume 24, 2016


Edivnio R. Arajo e Daniel P. Alves (42-54)

Figura 5. Esquema resumindo e ordenando de forma cronolgica dos principais trabalhos envolvendo identificao e
estudo do gene de resistncia ao mldio da cebola.

do Scholten et al., (2007), essa resistncia era res- de hipersensibilidade, devido ao acumulo de subs-
trita s hastes florais, no havendo resistncia nas tncias de defesa, como fitoalexinas.
folhas. Wordell Filho & Boff (2006) citam uma fonte Posteriormente, de Vries et al., (1992b), anali-
de resistncia ao mldio em germoplasma brasileiro, sando a gerao filial da autofecundao de um hbri-
o cultivar Conquista, que teria apresentado boa to- do interespecfico de A. roylei x A. cepa observaram
lerncia ao mldio no escapo floral durante a produ- uma taxa de segregao diferente da esperada (3 re-
o de semente. sistente: 1 suscetvel), sugerindo a existncia de um
Em 1990, van der Meer & de Vries relataram segundo gene, Pd2, envolvido na resistncia. Segun-
uma resistncia completa ao mldio encontrada em do os autores esse segundo gene estaria fracamente
Allium roylei, e mostraram que essa espcie poderia ligado ao locus Pd (r=0,32). Contudo, trabalhos pos-
ser cruzada com A. cepa gerando hbridos parcial- teriores com marcadores moleculares demonstra-
mente frteis. Allium roylei uma espcie silvestre ram que a resistncia ao mldio derivada de A. roylei
originada do subcontinente Indiano. A espcie tam- era realmente devido a um nico gene (Scholten et
bm pode ser fonte de resistncia queima das pon- al., 2007). Shiguo & Kik (2008) relatam que so co-
tas, causada por Botrytis squamosa, e antracnose muns os casos de distoro na segregao em popu-
causada por Colletotrichum gloeosporioides (Galvan laes originrias de cruzamentos interespecficos.
et al., 1997; Scholten et al., 2007; Kohli & Gohil, Scholten et al. (2007) consideram tambm que a
2009). porcentagem do genoma de A. roylei nos indivduos
Kofoet et al., (1990) realizaram o retrocruza- F2 poderia causar a distoro nas segregaes espe-
mento do hbrido interespecfico (A. roylei x A. cepa) radas. Van Heusden et al., (2000b) mostraram que
com cebola (A. cepa) e obtiveram uma proporo em populaes F2, a mdia de alelos provenientes
de plantas resistentes e suscetveis que suportou a de A. roylei eram de 56%, contudo, entre indivduos
hiptese de que a resistncia originria de A. roylei isolados essa porcentagem poderia variar de 32% a
era devida a um gene dominante, denominado Pd. 85%. Todas essas situaes contriburam para a con-
Segundo Thakur & Mathur (2002), quando plantas fuso inicial quanto ao nmero de genes envolvidos
de cebola portadoras de gene de resistncia so con- na resistncia ao mldio. Entretanto, essa questo se
frontadas com P. destructor ocorre uma tpica reao elucidou por completo com o trabalho de Scholten

RAPP - Volume 24, 2016 49


Edivnio R. Arajo e Daniel P. Alves (42-54)

et al., (2007), o qual demonstrou a presena de um


gene recessivo letal proximamente ligado ao gene de
resistncia introgredido de A. roylei. A presena des-
se gene letal o principal fator daquela distoro na
segregao, observada nas populaes F2.
A partir da dcada de 1990, diversos traba-
lhos com marcadores moleculares foram conduzidos
no intuito de mapear o gene de resistncia. De Vries
et al., (1992a) encontraram marcadores RAPD (Ran- Figura 6. Produtos da amplificao de uma reao de PCR
utilizando o marcador DMR1, ligado ao gene de resis-
dom Amplified Polymorphism DNA) a 2,6 cM do gene tncia (Pd) ao mldio da cebola. Sendo 1: linha de duplo
de resistncia. Posteriormente foram desenvolvidos haploide; 2: linha avanada de melhoramento; 3: cultivar
marcadores SCAR (Sequence Characterized Amplified Santero F1, resistente ao mldio; 4: acesso de Allium roy-
Region) para amplificar uma regio de 20 pb proxi- lei. Fonte: Retirado de Kim et al., 2015.
mamente ligada ao locus Pd. No entanto, medida
que prosseguiam os retrocruzamentos, esses mar- dos por marcadores de diversas naturezas possibili-
cadores comeavam a perder o poder de identificar tou localizar o gene de resistncia ao mldio. O locus
plantas com o gene de resistncia (Brewster, 2008; Pd estaria localizado na extremidade do cromosso-
van Heusden et al., 2000b; Kik et al., 1997). Tentan- mo 2 em A. roylei (Brewster, 2008). O posterior ma-
do aumentar a eficincia da seleo de indivduos peamento de hbridos interespecficos de A. roylei
resistentes por meio de marcadores moleculares, x A. cepa mostrou que este gene est localizado na
Scholten et al., (2007) desenvolveram quatro mar- parte distal do cromossomo 3 em cebola (Scholten
cadores AFLP (Amplied Fragment Length Polymor- et al., 2007; Van Heusden et al., 2000ab).
phism) para selecionar a introgresso proveniente Sabe-se que o processo de melhoramento
de A. roylei. demorado, sendo necessrio muitos anos at a ob-
Recentemente, Kim et al., (2015) desenvolve- teno de um cultivar comercial. O melhoramento
ram um marcador para o gene de A. roylei que con- de cebola ainda apresenta uma peculiaridade pois
fere resistncia ao mldio da cebola. Esses autores so necessrios dois anos para completar o ciclo
buscavam por marcadores capazes de discriminar reprodutivo na cultura. No caso do melhoramento
plantas resistentes e suscetveis em retrocruzamen- visando resistncia ao mldio, o processo foi ainda
tos com cebola, facilitando o desenvolvimento de mais moroso que o normal, sendo necessrios cerca
linhas resistentes ao mldio. Baseado em PCR (Poly- de 20 anos desde a identificao da resistncia em
merase Chain Reaction), eles obtiveram o DMR1 A. roylei at o lanamento de um cultivar comercial
(Tabela 1), um marcador codominante, confivel e com resistncia (Scholten et al., 2007). Diversos fato-
de fcil utilizao, que ancora o gene de resistncia. res contriburam para esse extenso perodo de tem-
Com esse marcador os autores conseguiram identifi- po, dentre esses fatores pode-se destacar a existn-
car exatamente as plantas com o gene de resistncia cia de um gene recessivo letal prximo ao locus Pd.
proveniente de A. roylei (Figura 6). Os autores afir-
mam ainda que esse marcador til para diferen- Gene letal e a resistncia ao mldio da cebola
tes germoplasmas de cebola, tendo sido testado em Desde a descoberta do gene de resistncia ao
mais de 120 acessos oriundos de diversos pases, e mldio em A. roylei e a obteno de cultivares hbri-
sendo eficaz na discriminao de plantas resistentes dos com o gene, muitos anos se passaram, haja visto
e suscetveis em todos os casos. que essas primeiras descobertas foram anteriores
A construo de mapas moleculares satura- dcada de 1990.

Tabela 1. Sequncia do primer DMR1 ligado ao gene de resistncia ao mldio.


Marcador Nome do Primer Sequncia do primer (5-3)
DMR1-F1 TGAGGCTCAAGTTGACATGC
DMR1
DMR1-R1 TTCGTAGCAGCATCAAGGTG
Fonte: Retirado de Kim et al., (2015).

50 RAPP - Volume 24, 2016


Edivnio R. Arajo e Daniel P. Alves (42-54)

Tabela 2. Possveis gentipos e cruzamentos envolvendo o sistema de macho esterilidade gentico citoplasmtico S
(CMS-S).
Macho-estril Macho-frtil* Gentipo da prognie F1 Plantas frteis na prognie F1 (%)
Linha A
Smsms NMsMs 100% SMsms 100
Smsms NMsms 50% SMsms e 50% Smsms 50
Smsms Nmsms (Linha B)** 100% Smsms 0
Smsms SMsMs 100% SMsms 100
Smsms SMsms 50% SMsms e 50% Smsms 50
*Linhas macho frteis so utilizadas para a polinizao das linhas A. Todos os gentipos das linhas macho frteis podem
ser uma linha C. **As plantas que so da linha B, mantenedoras da macho esterilidade, devem obrigatoriamente ter
esse gentipo, para que 100% da prognie seja macho estril.

Anos aps a descoberta do gene de resistn- que a planta apresente citoplasma estril (S) e gene
cia, Scholten et al. (2007) demonstraram a existncia nuclear em homozigose recessiva, ou seja, gentipo
de uma regio no genoma de A. roylei que quando Smsms (Tabela 2).
em homozigose letal em A. cepa, sendo esta regio Para a produo de hbridos de cebola so
proximamente ligada ao locus Pd. No entanto, foi necessrios: i) genitores femininos macho estreis,
obtido um indivduo contendo um evento de cros- denominados linhas A; ii) genitores masculinos man-
sing over entre o gene de resistncia ao mldio e o tenedores de macho esterilidade, denominados li-
gene recessivo letal. Logo, a planta possua o gene nhas B e iii) linhas C (linhas endogmicas), genitoras
de resistncia, mas no tinha o gene letal comple- masculinas doadoras de plen (Tabela 2). As linhas
to (Scholten et al., 2007). Dessa forma, tornou-se B so essenciais para a manuteno do programa e
possvel a obteno de indivduos homozigotos seu genoma precisa ser especfico de tal forma que
para o gene de resistncia ao mldio, permitin- aps fertilizar a linha A a gerao filial seja toda ma-
do que 100% da prognie dessas plantas fossem cho estril.
resistentes, independendo do genoma do outro Em geral programas de melhoramento que
genitor, questo essa fundamental no desenvol- visam a obteno de cultivares de cebola de polini-
vimento de hbridos F1. A obteno dessas linhas zao livre demoram de 10 a 12 anos. Um programa
homozigotas possibilitou o recente lanamento, na de melhoramento de hbridos no pode ser planeja-
Europa, de cultivares de cebola resistentes ao mldio do para menos de 15 a 18 anos, pois demanda um
(Kim et al., 2015). tempo considervel at a identificao das linhas A
e B, alm das etapas posteriores de testes de com-
Desenvolvimento de hbridos assistido por marca- binaes hbridas e o lanamento do cultivar. A se-
dores moleculares leo de linhas A e B assistida por marcadores pode
Hbridos so obtidos aps o cruzamento de acelerar esse processo, que normalmente duraria de
duas ou mais prognies endogmicas. A produo quatro a oito anos (Havey, 2013), possibilitando a se-
de sementes hbridas pode ocorrer por meio de cru- leo das linhas no segundo ano.
zamentos manuais para muitas culturas hortcolas, Diversos marcadores tm sido disponibiliza-
entretanto, essa estratgia para a cultura da cebola dos para a seleo assistida de linhas A e B. Enquanto
economicamente invivel. Dessa forma, a produo os marcadores de citoplasma disponveis so bastan-
de hbridos comerciais de cebola somente se tornou te confiveis, os marcadores ligados ao locus Ms/ms
possvel aps a descoberta do sistema de macho es- no tm se mostrado totalmente seguros, podendo
terilidade na cultura (Jones & Emsweller, 1936; Jones haver erro na identificao (Kim, 2014; Yang et al.,
& Emsweller, 1933). A macho esterilidade na cebola 2013; Bang et al., 2011). Todavia, recentemente Huo
do tipo gentica-citoplasmtica (CMS), ou seja, en- et al., (2015) desenvolveram um marcador, denomi-
volve interao entre genes do ncleo (Ms) e fatores nado AcSKP1, que est em completo desequilbrio
citoplasmticos (S) (Jones & Clark, 1943). Para que de ligao com o locus Ms apresentando alta acu-
a macho-esterilidade ocorra, portanto, necessrio rcia na predio gentipos portadores de alelo res-

RAPP - Volume 24, 2016 51


Edivnio R. Arajo e Daniel P. Alves (42-54)

taurador da macho-fertilidade. Breton MC, Pichi S, Pascholati SF, Machado MA


Consideraes finais (2014) Efetores nas interaes planta patgeno.
Apesar de ser uma cultura milenar e de gran- Reviso Anual de Patologia de Plantas 22:1-44.
de importncia econmica e social, os avanos no de Vries JN, Jongerius R, Sandbrink H, Lindhout P
mbito molecular de estudos com cebola tm sido (1992a) RAPD markers assist in resistance breed-
bastante recentes e em pequeno nmero quando ing. Prophyta 2:5051.
comparado com outras culturas tradicionais. Mc- de Vries JN, Wietsma WA, Jongerius MC (1992b)
Callum (2007) atribui esse cenrio a algumas pecu- Linkage of downy mildew resistance genes Pd1
liaridades da cultura, tais como: ciclo de vida bienal; and Pd2 from Allium roylei Stearn in progeny of
ser algama com alta depresso em cruzamentos its interspecic hybrid with onion (A. cepa L.).
consanguneos; comunidade cientifica que estuda a Euphytica 64:131137.
cultura relativamente pequena; e ao grande tama- Develash RK, Sugha SK (1997) Incidence of onion
nho do genoma. downy mildew and its impact on yield. Indian
Phytopathology 50:127-129.
Referncias Farr DF, Rossman AY (2016) Fungal Databases, Sys-
Arajo ER, Alves DP, Knoth JR (2015) Manejo do ml- tematic Mycology and Microbiology Labora-
dio da cebola em funo da temperatura e umi- tory. ARS, USDA. Disponvel em: http://nt.ars-
dade relativa do ar. Biolgico, So Paulo 77:98. -grin.gov/fungaldatabases/. Acessado em
Bang H, Cho DY, Yoo K, Yoon M, Patil BS, Kim S 26/02/2016.
(2011) Development of simple PCR-based mark- Friedrich S, Leinhos GME, Lpmeier F-J (2003)
ers linked to the Ms locus, a restorer-of-fertility Development of ZWIPERO, a model forecast-
gene in onion (Allium cepa L.). Euphytica 179: ing sporulation and infection periods of onion
439-449. downy mildew based on meteorological data.
Bashi E, Aylor DE (1983) Survival of detached spo- European Journal of Plant Pathology 109:35-45.
rangia of Peronospora destructor and Peronos- Galvan GA, Wietsma WA, Putrasemedja S, Per-
pora tabacina. Phytopathology 73:1135-1139. madi AH, Kik C (1997) Screening for resistance
Battilani P, Rossi V, Racca P, Giosu S (1996) ONIMIL, to anthracnose (Colletotrichum gloeosporioides
a forecaster for primary infection of downy mil- Penz.) in Allium cepa and its relatives. Euphytica
dew of onion. Bulletin OEPP/EPPO 26: 567576. 95:173178.
Brewster JL (2008) Onions and other vegetable Al- Gilles T, Phelps K, Clarkson JP, Kennedy R (2004) De-
liums. CAB International, 2 edio, Wallingford, velopment of MILIONCAST, an improved model
431 p. for predicting downy mildew sporulation on on-
Bulovien V, Survilien E (2006) Effect of environ- ions. Plant Disease 88:695-702.
mental conditions and inoculum concentra- Gisi U, Sierotzki H (2008) Fungicide modes of ac-
tion on sporulation of Peronospora destructor. tion and resistance in downy mildews. European
Agronomy Research 4:147-150. Journal of Plant Pathology 122:157-167.
Caf-Filho AC, Ristaino JB (2008) Fitness of isolates Havey MJ (2013) Single nucleotide polymorphisms
of Phytophthora capsici resistant to mefenoxam in linkage disequilibrium with the male-fertility
from squash and pepper fields in North Carolina. restoration (Ms) locus in open-pollinated and in-
Plant Disease 92:1439-1443. bred populations of onion. Journal of the Ameri-
Chapara V, Taylor RJ, Pasche JS, Gudmestad NC can Society for Horticultural Science 138:306
(2011) Competitive parasitic fitness of mefenox- 309.
am-sensitive and -resistant isolates of Phytoph- Hildebrand PD, Sutton JC (1982) Weather variables
thora erythroseptica under fungicide selection in relation to an epidemic of onion downy mil-
pressure. Plant Disease 95:691-696. dew. Phytopathology 72:219-224.
Cramer CS, Havey MJ (1999) Morphological, bio- Huo YM, Liu BJ, Yang YY, Miao J, Gao LM, Kong SP,
chemical, and molecular markers in onion. Wang ZB, Kitano H, Wu X (2015) AcSKP1, a mul-
HortScience 34:589-593. tiplex PCR-based co-dominant marker in com-
Dalio RJD, Magalhes DM, Atlio LB, Rodrigues CM, plete linkage disequilibrium with the male-fertil-

52 RAPP - Volume 24, 2016


Edivnio R. Arajo e Daniel P. Alves (42-54)

ity restoration (Ms) locus, and its application in L.) in Irapuato, Gto. Revista Mexicana de Fitopa-
open-pollinated populations of onion. Euphytica tologia 10:29-34.
204:711-722. Palti J (1989) Epidemiology, prediction and control of
IBGE (2015) Levantamento Sistemtico da Produ- onion downy mildew caused by Peronospora de-
o Agrcola. Rio de Janeiro, novembro, 29:1-85. structor. Phytoparasitica 17:31-48.
Jesperson GD, Sutton JC (1987) Evaluation of a fore- Reis A, Henz GP (2009) Mancha-prpura do alho e
caster for downy mildew of onion (Allium cepa da cebola: doena difcil de controlar. Comunica-
L.). Crop Protection 6:95-103. do Tcnico 71, Embrapa Hortalias 6 pp.
Jones HA, Clarke, A (1943) Inheritance of male ste- Scholten OE, van Heusden AW, Khrustaleva LI, Burg-
rility in the onion and the production of hybrid er-Meijer K, Mank RA, Antonise RGC, Harrewijn
seed. Proceedings of the American Society for JL, Van Haecke W, Oost EH, Peters RJ, Kik C (2007)
Horticultural Science 43:189-194. The long and winding road leading to the success-
Jones HA, Emsweller SL (1933). Methods of breed- ful introgression of downy mildew resistance into
ing onions. Hilgaria 7: 625-642. onion. Euphytica 156:345353.
Jones HA, Emsweller SL (1936) A male sterile onion. Shigyo M, Kik C (2008) Onion. In: Prohens J, Nuez F.
Proceedings of the American Society for Horti- (eds). Vegetables II: A handbook of plant breed-
cultural Science 34: 582- 585. ing. Springer p. 121-159.
Kik C, Buiteveld J, Verbeek WHJ (1997) Biotechno- Thakur RP, Mathur K (2002) Downy mildews of India.
logical aspects of Allium breeding. Acta Horticul- Crop Protection 21:333-345.
turae 433:291297. van der Meer QP, de Vries JN (1990) An interspecic
Kim S, Kim CW, Choi MS, Kim S (2015) Development cross between Allium roylei Stearn and Allium
of a simple PCR marker tagging the Allium roylei cepa L., and its backcross to A. cepa. Euphytica
fragment harboring resistance to downy mildew 47:2931.
(Peronospora destructor) in onion (Allium cepa van Heusden AW, Shigyo M, Tashiro Y, Vrielink-van-
L.). Euphytica 208:561-569. Ginkel R, Kik C (2000a) AFLP linkage group assign-
Kim S. (2014) A codominant molecular marker in ment to the chromosomes of Allium cepa L. via
linkage disequilibrium with a restorer-of-fertility monosomic addition lines. Theoretical and Ap-
gene (Ms) and its application in reevaluation of plied Genetics 100:480486.
inheritance of fertility restoration in onions. Mo- van Heusden AW, Van Ooijen JW, Vrielink-van-Ginkel
lecular Breeding 34:769778. R, Verbeek WHJ, Wietsma WA, Kik C (2000b) A ge-
Kofoet A, Kik C, Wietsma WA, de Vries JN (1990) netic map of an interspecic cross in Allium based
Inheritance of resistance to downy mildew (Pero- on amplied fragment length polymorphism
nospora destructor [Berk.] Casp.) from Allium ro- (AFLPTM) markers. Theoretical and Applied Ge-
ylei Stearn in the backcross Allium cepa L. x (A. netics 100:118126.
roylei x A. cepa). Plant Breeding 105:144149. Verona LAF, Pacheco AC, Zanini Neto JA, Gandin CL,
Kohli B, Gohil RN (2009) Need to conserve Allium Thomazelli LF (1996) Qualidade e produtividade
roylei Stearn: a potential gene reservoir. Genetic de sementes de cebola na regio Oeste Catari-
Resources and Crop Evolution 56:891893. nense safra 1994/95. Agropecuria Catarinense
Marcuzzo LL, Duffeck MR (2015) Flutuao popula- 9:2932.
cional de esporngios de Peronospora destructor Visser CLM (1998) Development of a downy mildew
no ar e sua relao com severidade do mldio da advisory model based on downcast. European
cebola. Summa Phytopathologica. 41:68-70. Journal of Plant Pathology 104:933-943.
McCallum J (2007) Onion. In: C. Kole (ed.), Genome Wordell Filho JA, Boff P (2006) Doenas de origem
Mapping and Molecular Breeding in Plants 5: parasitria. In: Wordell Filho JA, Rowe E, Gon-
331342. alves PAS, Debarba JF, Boff P, Thomazelli LF (Eds.)
Moreno LP, Hernndez LFC (1992) Genotype and Manejo Fitossanitrio na Cultura da Cebola. Flo-
fungicide evaluation for control of purple spot rianpolis: Epagri. pp. 19-162.
(Alternaria porri) and downy mildew (Peronospo- Wordell Filho JA, Martins DA, Stadnik MJ (2007) Apli-
ra destructor (Berk) Caps) of onion (Allium cepa cao foliar de tratamentos para o controle do

RAPP - Volume 24, 2016 53


Edivnio R. Arajo e Daniel P. Alves (42-54)

mldio e da podrido-de-escamas de bulbos de Identification of two SCAR markers co-segregated


cebola. Horticultura Brasileira 25:544-549. with the dominant Ms and recessive ms alleles in
Yang YY, Huo YM, Miao J, Liu BJ, Kong SP, Gao LM, onion (Allium cepa L.). Euphytica 190:267277.
Liu C, Wang ZB, Tahara Y, Kitano H, Wu X (2013) Yarwood CE (1943) Onion downy mildew. Hilgardia
14:595-691.

54 RAPP - Volume 24, 2016


Peter Soares Medeiros, et. al (55-69)

FUNGOS DARK SEPTATE E SUA RELAO


COM AS PLANTAS E FITOPATGENOS
Peter Soares Medeiros1, Carlos Vergara Torres Jnior1,
Claudia Maria Xavier Faria2, Kerly Martnez Andrade2,
Jerri dson Zilli3, Carlos Antonio Incio2.

RESUMO
Os fungos dark septate (DSE - dark septate endophytes) so microrga-
nismos endofticos de ampla distribuio englobando dezenas de ordens e pou-
co investigados nos trpicos. Possuem potencial de aplicabilidade na agricultura,
seja como promotores de crescimento vegetal ou no biocontrole. Estudos tm
demonstrado que os DSE podem contribuir para o crescimento vegetal atravs
da acumulao de nutrientes como o nitrognio (N) e o fsforo (P), incrementar
a biomassa vegetal, a capacidade fotossinttica das plantas e, promover o per-
filhamento de plantas de arroz. Adicionalmente, os DSE tambm tm sido estu-
dados visando o biocontrole de fitopatgenos. No caso de fungos, os DSE pare-
cem atuar de forma direta, colonizando abundantemente a superfcie das razes,
ocupando o stio de infeco e por competio impedindo o crescimento do pa-
tgeno e, ainda produzindo siderforos capazes de complexar ons de ferro (Fe),
restringindo sua disponibilidade ao patgeno. De forma indireta os DSE induzem
a resistncia sistmica na planta auxiliando-a na manuteno do equilbrio entre
as formas reativas de oxignio e os antioxidantes e/ou produzindo metablitos
secundrios que possuem ao antifngica. O presente captulo visa apresentar
as pesquisas que vm sendo conduzidas com este grupo de microrganismos que
possui potencial de aplicabilidade na agricultura com nfase em fitopatologia.

Introduo tceos (EC) e no clavicipitceos (ENC) (Rodriguez et


Plantas so hospedeiros potenciais de bact- al., 2009; Andrades-Linares & Franken, 2013). Os ECs
rias e fungos que colonizam sua superfcie associa- pertencem famlia Clavicipitaceae (Hypocreales,
dos epifiticamente ou no interior dos seus tecidos Ascomycota) (Kirk et al., 2008; Hibbet et al., 2007;
como endofticos, podendo desenvolver relaes Sung et al., 2007), conhecidos como simbiontes mu-
mutualsticas (Andrades-Linares & Franken, 2013). tualsticos que crescem nos espaos intercelulares
Acredita-se que a relao entre plantas e microrga- da parte area e raiz de um grupo restrito de vege-
nismos endofticos tenha surgido cerca de 400 mi- tais em ambientes tanto de clima frio quanto quen-
lhes de anos, atravs de membros da diviso Glo- te e so transmitidos via sementes (Clay & Schardl,
meromycota, que formam associaes micorrzicas 2002; Schardl et al., 2004; Kuldau & Bacon, 2008).
com a maioria das plantas (Mohanta & Bae, 2015). Distintamente, os ENC so filogeneticamente diver-
Os fungos endofticos (FE) tm sido agrupa- sos e a maioria deles pertence ao filo Ascomycota;
dos em dois grandes grupos: os endofticos clavicipi- muitos deles so capazes de crescer em meio de cul-
1
Departamento de Solos, Instituto de Agronomia. Universidade Federal Rural do Rio de Janeiro, BR 465, Km 07, Seropdica, RJ, CEP
23890-000. Rio de Janeiro. 2Departamento de Entomologia e Fitopatologia, DENF/ Universidade Federal Rural do Rio de Janeiro,
Rodovia BR-465, Km 7, CEP 23.897-000, Seropdica, Rio de Janeiro. 3Embrapa Agrobiologia. Rodovia BR-465, Km 7, CEP 23891-
000, Seropdica, Rio de Janeiro.

RAPP - Volume 24, 2016 55


Peter Soares Medeiros, et al. (55-69)

tura, devido sua versatilidade metablica (Andrades- man, 2011; Sharma & Jha, 2012). Muitas espcies
-Linares & Franken, 2013). Os ENC se subdividem em so capazes de colonizar inter e intracelularmente
diferentes grupos funcionais de acordo com a faixa a epiderme e crtex radicular de plantas saudveis,
de hospedeiros associados, a sua biodiversidade, o especialmente em razes finas, sem causar efeitos
seu padro de colonizao e os tecidos que coloni- negativos ou desorganizao dos tecidos vegetais
zam na planta (Rodriguez et al., 2009). Um destes (Jumpponen & Trappe, 1998; Barrow & Aaltonen,
grupos dos ENC representado principalmente pe- 2001; Yu et al., 2001; Addy et al., 2005; Mandyam &
los fungos dark septate (DSE, do ingls dark septate Jumponnen, 2008; Peterson et al., 2008; Vohnk et
endophytes), distribudos em diferentes grupos de al., 2015).
Ascomycota (Jumpponen & Trappe, 1998; Weiss et O objetivo deste trabalho reunir as princi-
al., 2004) e membros da ordem Sebacinales (Agari- pais pesquisas com dark-septate, citando suas ca-
comycetes, Basidiomycota), que apenas colonizam ractersticas morfo-fisiolgicas, demonstrando sua
o sistema radicular (Andrades-Linares & Franken, relao com os hospedeiros e os possveis mecanis-
2013). Nota: Cabe lembrar que, o termo dark sep- mos de promoo de crescimento vegetal e biocon-
tate endophytes foi eventualmente introduzido por trole de fitopatgenos.
Stoyke & Currah (1991).
Os DSE comearam a ser estudados no incio Ecologia
do sculo passado, quando Melin (1922) observou Embora haja um crescente interesse sobre
um fungo de pigmentao escura associado s razes os DSE, o conhecimento a respeito da diversidade,
de plantas terrestres enquanto estudava e isolava ecologia e funes destes fungos continua limitado
fungos ectomicorrzicos, o qual denominou Myce- quando comparado a outros, exemplo os micorr-
lium radicis-atrovirens (MRA), pois colonizava as zicos. Sua abundncia em diferentes habitats e sua
razes de conferas inter e intracelularmente, distin- ocorrncia em diferentes plantas hospedeiras ain-
guindo-se das ectomicorrizas que apenas colonizam da em grande parte desconhecida. Alm de ampla-
os espaos entre as clulas (Melin, 1922, 1923; Ri- mente distribudos na natureza colonizando razes
chard & Fortin, 1973). Este fungo foi encontrado co- de plantas, tambm so isolados frequentemente
existindo com fungos micorrzicos e declarado como a partir de ambientes com forte estresse abitico e
pseudomicorrzico por Melin (1922). Em curto sua presena em vrios nichos ecolgicos sugere no
espao de tempo foram relatadas 135 espcies de s a presena ubqua e falta de especificidade em
angiospermas associadas com fungos de pigmento relao aos hospedeiros, como tambm um papel de
negro nos tecidos das razes (Peyronel, 1924). importncia em ecossistemas naturais (Jumpponen
Ao longo do sculo passado, o estudo com es- & Trappe, 1998).
tes fungos foi reduzido e apenas mais recentemen-
te foi mostrada a capacidade dos DSE colonizarem
as razes de uma ampla variedade de hospedeiros,
biomas e ecossistemas (Jumpponen & Trappe, 1998;
Kovacs & Szigetvari, 2002; Knapp et al., 2015; Man-
dyam & Jumpponen, 2005; Kageyama et al., 2008;
Pereira et al., 2011).
De forma geral, os DSE podem ser definidos
como ascomicetos conidiais (anamrficos) ou est-
reis (mycelia sterilia) caracterizados pela formao
de miclio de hifas septadas (apocticas) e microes-
clercios (microesclerdios) melanizados (Figura 1,
2). Estes fungos, geralmente vivem de forma sapro-
ftica e habitam frequentemente solos oligotrficos Figura 1. Microesclerdios no interior da raiz de arroz sil-
em todas as regies climticas (Kovcs & Szigetvri, vestre (Oryza glumaepatula S.). (M) Microesclerdios
2002; Mandyam & Jumponnen, 2005; Rodriguez et (Barra = 0,5 mm). Adaptado de Perreira et al., (2011).
Com autorizao da revista Pesquisa Agropecuria Brasi-
al., 2009; Khidir et al. 2010; Porras-Alfaro & Bay- leira e dos autores.

56 RAPP - Volume 24, 2016


Peter Soares Medeiros, et. al (55-69)

A B C
Figura 2. Fungo DSE cultivado em meio BDA (A). Detalhe da placa mostrando a colorao escura da colnia (B). Detalhes
das hifas escuras e septadas (C) (Barra = 20 mm).

A associao fungo DSE/raiz tem sido repor- do sua funo como um tampo redox extracelular
tada como uma interao benfica, evidenciando que pode neutralizar oxidantes formando complexos
uma alta taxa de colonizao, o que possivelmente com radicais de oxignio gerados por tais ambientes
favorece uma melhor resistncia a doenas, indi- (Redman et al., 2002; Diene et al., 2014). Estudos de-
cando um papel ecolgico importante (Jumpponen, monstram que a melanina pode estar envolvida no
2001; Linares et al., 2011; Ribeiro et al., 2011). aumento da tolerncia aos metais pesados presen-
Fungos DSE j foram observados em mais de tes no solo. Por exemplo, a espcie DSE Exophiala
600 espcies vegetais representando cerca de 320 pisciphila McGinnis & Ajello (anamorfo de Capronia
gneros e ultrapassando 100 famlias. Estas famlias Sacc., Chaeothyriales, Chaetothyriomycetidae) (Kirk
incluem plantas com estratgias de vida bem dife- et al., 2008; Index Fungorum, 2016) aumentou a sn-
rentes denotando pouca ou nenhuma especificida- tese de melanina na presena de Cdmio - Cd (II) em
de em relao ao hospedeiro. Relatos mostram que condies de laboratrio (Zhan et al., 2011). Por ou-
fungos DSE colonizam razes de plantas em pratica- tro lado, as espcies Veronaeopsis simplex (Papen-
mente todos os ecossistemas naturais e apresentam dorf) Arzanlou & Crous (Venturiaceae, Pleosporales,
a capacidade de colonizar simultaneamente plantas Pleosporomycetidae) e Pseudosigmoidea ibarakien-
com diferentes preferncias micorrzicas, tais como: sis O. Diene & K. Narisawa (Pezizomycotina, Pezi-
arbusculares, ericides, orqudides, ectomicorrzi- zales, Pezizomycetidae) diminuram o acmulo de
cas, e no micorrzicas (Jumpponen & Trappe, 1998). csio (Cs) em plantas de tomate possivelmente em
Alm disso, so encontrados em habitats rticos, resposta a um maior acmulo de melanina em suas
antrticos, subalpinos, alpinos, temperados e tropi- hifas (Diene et al., 2014). Neste caso, a melanina
cais (Read & Haselwandter, 1981; Jumpponen & Tra- funcionaria como uma barreira impedindo a entra-
ppe, 1998; Grnig et al., 2008). No Brasil, estudos da dos elementos txicos nas clulas vegetais, pro-
mostraram que a colonizao de razes pelos DSE porcionando um melhor desenvolvimento planta
em plantas de arroz silvestre Oryza glumaepatula hospedeira e favorecendo a sobrevivncia do fungo
Steud., significativa e independente da condio (Redman et al., 2002; Zhan et al., 2011; Diene et al.,
de desenvolvimento da planta em reas alagadas ou 2014).
no, porm a tendncia a ocorrncia de uma maior Phialocephala fortinii C.J.K. Wang & H.E. Wil-
colonizao em plantas mais velhas (Pereira et al., cox (Vibrisseaceae, Helotiales, Leotiomycetidae)
2011; Ribeiro et al., 2011). um dos DSE mais conhecidos e parece dominar a mi-
A sobrevivncia dos fungos DSE em ambien- cobiota endoftica em razes de conferas, membros
tes inspitos como rtico e alpino, por exemplo, tem da famlia Ericaceae, florestas e ecossistemas alpinos
sido relacionada presena de melanina nas clu- (Wang & Wincox, 1985; Stoyke et al., 1992; O Dell
las da parede, uma das principais caractersticas de et al., 1993). Ecologicamente e filogeneticamente
identificao desse grupo de fungos. A produo de prxima a esta espcie, temos Acephala aplanata
melanina pelo DSE provavelmente torna-os mais re- Grnig & T.N. Sieber (Vibrisseaceae, Helotiales, Leo-
sistentes a condies extremas, principalmente devi- tiomycetidae), que outra espcie de DSE presente

RAPP - Volume 24, 2016 57


Peter Soares Medeiros, et al. (55-69)

em razes de conferas. Este grupo de fungos dema- da raiz formando um manto fngico, o qual tambm
ticeos designado de P. fortinii A. aplanata spe- penetra entre as clulas da epiderme (Figura 3). Da
cies complex (PAC) (Grnig et al., 2005; 2008). Alm mesma forma, Su et al. (2013) observaram que a
de sua presena no solo associado a razes saudveis colonizao de Oryza sativa por Harpophora oryzae
de espcies hospedeiras que pertencem a diferentes Z.L. Yan, Chu L. Zhang & F.C. Lin se inicia na superfcie
famlias de plantas, membros do PAC tambm foram das razes pelo fungo, o qual invade o seu interior
encontrados em razes deterioradas, caules, cascas e aumentada com a maturidade das razes. Neste
de troncos de rvores e madeiras velhas (O Dell et caso a maior colonizao observada em razes mais
al., 1993; Menkis et al., 2004; Hou & Guo, 2008; Gr- velhas e menor nas razes mais jovens e meristemas
nig et al., 2008). (coifa), sugerindo que a colonizao fngica tem um
De modo geral, o habitat preferido dos fun- aumento gradual de acordo com a maturidade radi-
gos DSE na planta o crtex de razes finas e a peri- cular (Figura 2A, Figura 4A-F).
derme de razes lignificadas (Grnig et al., 2008). Os Por outro lado, alguns DSE tm sido documen-
mecanismos que regulam os processos de infeco tados como formadores de estruturas intra-radicula-
pelos fungos DSE ainda no foram elucidados. Entre- res que lembram aquelas formadas em micorrizas e
tanto, nveis de atividade de enzimas pcticas como que poderiam ser a interface de transferncia de nu-
poligalacturonase e pectinesterase facilitam a pene- trientes dos fungos s plantas. Por exemplo, Acepha-
trao nas paredes das clulas da planta hospedeira la macrosclerotiorum Mnzenb. & Bubner (2009),
e so consideradas como o fator primrio no pro- foi observada formando estruturas ectomicorrzicas
cesso de infeco (Haselwandter, 1983; Mandyam & em pinheiro (Pinus sp.) e abeto (Picea sp.) (Lukeov
Jumpponen, 2005). et al., 2015), Heteroconium chaetospira Munzenb. &
O padro de colonizao de razes por DSE Bubne (Vibrisseaceae) forma um lao de hifa intrace-
tem se mostrado diferente dependendo do hospe- lular solta em Rhododendron obtusum (Lindl.) Plan-
deiro, do DSE e do sistema/ambiente de cultivo. O ch., morfologicamente lembrando micorriza ericide
padro mais comumente observado representado (Usuki & Narisawa, 2005). Contudo, o papel destas
pela colonizao das razes das plantas por Phialo- hifas intra-radiculares permanece ainda em nvel de
cephala fortinii (Currah & Van Dyk, 1986), que tem hiptese e a maioria dos DSE aparentemente no
incio com a formao de uma rede de hifas soltas formam estruturas especializadas no interior das ra-
sobre a superfcie da raiz e, estas hifas penetram iso- zes ou ainda no foram definidos uma categorizao
ladamente as razes colonizando paralelamente ao dos padres de colonizao.
seu eixo principal, ou entre as clulas da epiderme e
do crtex (ODell et al., 1993; Peterson et al., 2008).
A colonizao tambm pode ser intracelular sem
causar nenhuma distoro s razes formando aglo-
merados de clulas de paredes espessas dentro das
clulas corticais denominados como massa espessa
pseudoparenquimatosa, esclerdios, microescler-
dios ou corpos esclerticos (Wang & Wilcox, 1985;
Jumpponen & Trappe, 1998; Peterson et al., 2008).
Alm disso, alguns DSE formam uma rede tipo Har-
tig e/ou tecido labirntico, e s vezes, a colonizao
da camada cortical da raiz resulta na formao de
clulas arredondadas dentro das clulas corticais se-
melhante a clamidsporos (ODell et al., 1993). Em
estudo conduzido por Diene et al. (2010) foi verifi-
cado atravs de tcnicas de microscopia de luz com Figura 3. Interaes entre razes de sorgo-sacarino e Hel-
sees finas da raiz e colorao das hifas, que um minthosporium velutinum. Hifa do fungo pode ser vista na
superfcie da raiz (setas), e entre as clulas da epiderme
isolado do fungo Helminthosporium velutinum Link (EP). Adaptado de Diene et al. 2010 com permisso dos
(1809), cresce abundantemente sobre a superfcie autores e da revista Microbes Environment.

58 RAPP - Volume 24, 2016


Peter Soares Medeiros, et. al (55-69)

Figura 4. Padro de colonizao de Harpophora oryzae em razes de arroz. (a)- Em seces transversais da raiz, hifas
marcadas com eGFP (Protena Fluorescente Verde Melhorada) estendo-se gradualmente da epiderme para o cortex
sem penetrar os feixes vasculares (Barra = 200 mm); (c)- Incremento gradual de colonizao fngica associada com a
maturao da raiz; (d)- Colonizao fngica mostrando uma forte colonizao na zona de diferenciao; (e)- Leve colo-
nizao na zona de elongao, e no colonizao na zona meristemtica (Barras = 500 mm); (b, f)- Representaes es-
quemticas da colonizao da raiz por H. oryzae. (b)- Padro de colonizao como visto em seo transversal; (f)- Seo
longitudinal mostrando a associao da colonizao fngica com a maturao da raiz (obs. Azul e verde indicam clulas
vivas e mortas respectivamente; Linhas e pontos vermelhos: hifas; pontos negros: clamidsporos; manchas prpuras:
microesclerdios). Adaptado de Su et al. (2013). Com autorizao dos autores e da revista PLoS ONE.

RAPP - Volume 24, 2016 59


Peter Soares Medeiros, et al. (55-69)

O mais provvel que a transmisso dos DSE deiros, 2015). Entretanto, o cultivo dos DSE desde o
ocorra horizontalmente, visto sua presena no solo e isolamento at a identificao taxonmica de dife-
nas razes das plantas, mas nas condies laborato- rentes isolados ainda so muito incipientes, sobre-
riais os meios de transmisso parecem ser fragmen- tudo no Brasil. E, resultados negativos na tentativa
tao micelial e disperso de condios (Jumpponen de induo esporulao so comuns, dificultando
& Trappe, 1998). Embora as conexes entre ana- desta forma uma melhor caracterizao morfolgica
morfo e teleomorfo no tenham sido identificadas, e elucidao dos diferentes txons (Medeiros, 2015;
a possibilidade de reproduo sexual no deve ser Knapp et al., 2015).
descartada. As estruturas assexuadas de reproduo
e a morfologia das razes colonizadas por DSE foram Taxonomia
descritas como semelhantes aos das ectomicorrizas Em termos taxonmicos os DSE constituem
e endomicorrizas (Wang & Wilcox, 1985). um grupo polifiltico (Yuan et al., 2011) classifica-
do dentro dos fungos endofticos, e avanos recen-
Caracterstica de dse in vitro tes, sobretudo com base em tcnicas moleculares,
Pesquisas com fungos DSE mostram que a es- tm permitido um melhor entendimento da sua
porulao de muitas estirpes extremamente difcil, taxonomia. Atualmente os fungos endofticos so
como ocorre para muitos isolados de ascomicetos de agrupados pelas distintas histrias evolutivas, taxo-
uma forma geral (Knapp et al., 2015). No existem nomia, plantas hospedeiras e funes ecolgicas.
ainda descries morfolgicas de sua fase sexuada, e Os endofticos clavicipitceos (EC), que colonizam
at mesmo a conidiognese incomum para muitas algumas gramneas, e os endofticos no clavicipi-
espcies. A fase assexuada de estirpes conhecidas tceos (ENC), que podem ser isolados de tecidos
somente foi alcanada atravs da induo do proces- assintomticos de brifitas, pteridfitas, gimnos-
so conidiognico em condies especficas de labo- permas e angiospermas (Rodriguez et al., 2009). Os
ratrio, utilizando-se diferentes meios de cultura e EC, denominados classe 1, so representados pelos
em diferentes condies ambientes como tempera- integrantes da famlia Clavicipitaceae (Hypocreales;
tura, umidade e luz (Wang & Wilcox, 1985; Jumppo- Ascomycota) que inclui representantes de vida li-
nen & Trappe, 1998; Grnig et al., 2008). vre e simbiontes associados insetos e fungos (por
A induo da esporulao de isolados DSE exemplo, Cordyceps spp.) ou gramneas, juncos e ci-
teve um grande avano com estudos de Wang & Wil- perceas (por exemplo, Balansia spp., Epichlo spp.
cox (1985) ao utilizar o meio de cultura gar Melin e Claviceps spp.) (Bacon & White, 2000). Esta famlia
Norkrans Modificado (MMN). Segundo os autores derivada de Hipocreales, com fungos patgenos de
a esporulao pode ocorrer em longos perodos de plantas, saprofticos e endofticos, sendo que alguns
incubao podendo levar de seis meses a um ano. produzem compostos bioativos.
Su et al. (2013) estudando duas linhagens de Har- Os ENC tm sido tratados como um nico
pophora oryzae Z.L. Yuan, Chu L. Zhang & F.C. Lin grupo funcional, mas h evidncias que estes fun-
(2010), R5-6-1 e RC-3-1, isoladas de razes de arroz gos podem ser classificados em pelo menos trs gru-
selvagem, obtiveram resultados positivos ao cultivar pos classe 2, classe 3 e classe 4 devido s suas
em meio gar Completo (CM) a 25oC no escuro. Die- diferenas na biologia, nas interaes ecolgicas e
ne et al., (2010) conseguiram induzir a esporulao em critrios simbiticos, tais como: tipo de tecido
do isolado Helminthosporium velutinum, aps um vegetal colonizado e a abundncia na colonizao
perodo de incubao de um ms a temperatura de (Rodriguez et al., 2009). Os ENC classe 2 so compre-
23 C utilizando o meio Aveia gar. endidos por uma diversidade de espcies includas
Estudos realizados no Brasil demonstram que em Ascomycota (Pezizomycotina) na sua maioria e,
estirpes de DSE isoladas a partir de arroz silvestre com alguns representantes de Basidiomycota (Aga-
crescem com extrema facilidade em temperaturas ricomycotina e Pucciniomycotina). Da mesma forma,
de 28 a 30 C e umidade de 45% quando inocula- a maioria dos endfitos da Classe 3 Ascomycota,
das em meios de cultura como: Batata Dextrose mas tambm Basidiomycota, sendo representados
gar, gar Malte, Extrato de Arroz modo, Extrato de por Pezizomycotina. Contudo, so relatados end-
Aveia, Extrato de Mandioca (Ribeiro et al., 2011; Me- fitos em Saccaromycotina (Higgins et al., 2007). Os

60 RAPP - Volume 24, 2016


Peter Soares Medeiros, et. al (55-69)

endofticos Classe 3 ocorrem em todos os principais de uma abordagem multilocos com regies alvo ITS,
clados no liquenizados, sendo comuns em Pezi- -tubulina, TEF1, actina, calmodulina, entre outras,
zomycetes, Leotiomycetes e Eurotiomycetes e mais proporcionaram uma melhor resoluo e distino
abundantes em Sordariomycetes e Dothideomycetes entre txons relacionados (Schubert et al., 2007;
(Arnold et al., 2007; Higgins et al., 2007; Arnold et Crous et al., 2007; Bensch et al., 2012; Maharachchi-
al., 2009). Os ENC classe 4 (DSE) distinguem-se como kumbura et al., 2014).
um grupo funcional pela presena de septos mela- O principal critrio atual para classificar um
nizados e por sua restrio colonizao nas razes fungo como DSE ele ser endfito de razes de plan-
das plantas. A diversidade de espcies de DSE e suas tas, septado e melanizado (Figura 2). Entretanto,
plantas hospedeiras permanecem no definidas at fungos endofticos de outras classes com pigmento
que seja realizado um estudo abrangente desta inte- escuro tm sido erroneamente identificados como
rao em todas as partes do mundo. DSE. Como exemplo, a Curvularia protuberata R.R.
De forma geral, os DSE distribuem-se em deze- Nelson & Hodges (1965), endoftico Classe 2 que
nas de famlias e centenas de gneros de Ascomyco- simbioticamente confere tolerncia temperatura
ta dentro das ordens Capnodiales, Chaetothyriales, para a planta Dicanthelium lanuginosum (Ell.) Gould,
Eurotiales, Helotiales, Hypocreales, Microascales, um fungo com pigmento escuro, assexual e septa-
Pleosporales, Sordariales e Xylariales (Jumpponen do que coloniza razes de planta. Entretanto, no
& Trappe, 1998; Addy et al., 2005; Newsham, 2011; um verdadeiro DSE, pois capaz de colonizar todas
Knapp et al., 2012, 2015; Andrade-Linares & Franken, as partes da planta (razes, coroa, caule, folhas e cas-
2013). Entretanto, o estudo filogentico taxonmico ca da semente). Para evitar classificaes errneas
de DSE ainda muito limitado, sobretudo pelas difi- necessrio analisar todas as partes das plantas e,
culdades de muitos isolados esporularem em meio usar corante especfico para avaliao dos septos
de cultivo, o que restringe o uso de muitas chaves ta- (Ormsby et al., 2007).
xonmicas (Medeiros, 2015). Estudos recentes tm
revelado que a ordem Pleosporales abrange muitos Promoo do crescimento de plantas
dos DSE (Zhang et al., 2009), sendo considerada a DSE so abundantes no ambiente e hbeis
ordem mais representativa deste grupo de fungos para viverem em nichos e habitats variados, o que
para regies semiridas (PorrasAlfaro et al., 2008). tem atrado ateno pela possibilidade de serem
Cabe mencionar que baseado em anlise multilocos explorados como promotores de crescimento de
e dados morfolgicos, trs novos gneros represen- plantas (Newshan, 2011; Mandyam & Jumpponen,
tantes dos DSE provenientes de regio semirida fo- 2005). O fato de no serem biotrficos obrigatrios
ram recentemente propostos na ordem Pleosporales uma caracterstica que chama ateno, pois faci-
denominados: Aquilomyces pertencendo a famlia litaria o desenvolvimento de bioprocessos para a
Morosphaeriaceae, Flavomyces representando um produo de inoculantes, o que tem sido uma gran-
grupo incertae sedis de Massarinaceae e Darksidea de limitao, para a maioria dos fungos micorrzicos
com seis novas espcies da famlia Lentitheciaceae (Jumpponen & Trappe, 1998; Pereira et al., 2011).
(Knapp et al., 2015). Entretanto, generalizaes so complicadas, pois es-
A anlise molecular baseada na amplificao tes fungos so muito diversos e, se conhece muito
e sequenciamento de regies alvos especficas no pouco sobre a filogenia, a fisiologia e o comporta-
DNA uma ferramenta til para diferenciar grupos mento dos mesmos quando inoculados em plantas
estreitamente relacionados e espcies morfologica- domesticadas de uso comercial (Mayerhofer et al.,
mente semelhantes. Entretanto, dados fornecidos a 2013; Mandyam & Jumpponen, 2015; Knapp et al.,
partir de marcadores moleculares como ITS muitas 2015).
vezes no so suficientes para discriminar espcies, Ao longo dos ltimos anos, diversas pesqui-
gneros ou mesmo famlias, ou seja, a resoluo sas tm demostrado que os efeitos da inoculao
geralmente muito pobre, resultando em rvores filo- dos DSE no crescimento de plantas variam desde
genticas com estruturas politmicas (Bensch et al., negativas, neutras positivas e os mecanismos que
2012). Muitas pesquisas buscando solucionar a ta- levam a esta variabilidade parecem ser contexto-
xonomia de vrios txons tm mostrado que a partir -dependentes, a exemplo do que ocorre com as sim-

RAPP - Volume 24, 2016 61


Peter Soares Medeiros, et al. (55-69)

biontes micorrizas arbusculares e ecto-micorrzicas pira (Grove) Crous & Arzanlou (2007)], na qual o fun-
(Mandyam & Jumpponen, 2005; Grnig et al., 2008; go facilita a absoro de N para a planta e a mesma
Alberton et al., 2010; Newsham, 2011; Mayerhofer fornece carbono ao fungo, incrementando significa-
et al., 2013; Torres-Jnior et al., 2014). Neste con- tivamente a biomassa da planta (Usuki & Narisawa,
texto, uma meta-anlise realizada por Newsham 2007), quanto indireta, tais como: a mitigao de
(2011) sobre a resposta de plantas colonizao estresses ambientais como seca, salinidade, defici-
por fungos dark septate, baseado em dados publi- ncia nutricional, alta concentrao de metais pesa-
cados oriundos de 18 artigos cientficos nos ltimos dos, reduo de compostos txicos s plantas, como
40 anos, revelou que esses fungos em sua maioria os super-perxidos, competio direta com patge-
promoveram o crescimento da parte area e razes nos e pela produo de reguladores de crescimen-
vegetais, podendo os ganhos de biomassa chega- to e/ou substncias anlogas (Schulz & Boyle, 2005;
rem a 100%, quando comparado testemunha no Usuki & Narisawa, 2007; Newsham, 2011; Mandyam
inoculada. Alm disso, o estudo mostrou que os DSE & Jumpponen, 2015; Wei et al., 2016).
contribuem de forma significativa para o aumento As melhores respostas de promoo de cres-
do contedo de fsforo e nitrognio nos tecidos ve- cimento de plantas por DSE foram inicialmente ob-
getais, indicando melhoria na eficincia do uso des- servadas quando eram utilizadas fontes orgnicas
tes nutrientes. Portanto, em uma outra meta-anlise de N (Usuki & Narisawa, 2007; Upson et al., 2009;
(Mayerhofer et al., 2013) a qual incluiu o estudo de Newsham, 2011; Mahmoud & Narisawa, 2013).
fungos endofticos (no clavicipitceos), entre eles Contudo, devido ocorrncia generalizada dos DSE
os dark septate, baseada em 34 artigos cientficos nos mais diversos ambientes (Sharma & Jha, 2012;
foi mostrado que os efeitos da inoculao de fungos Gardes & Dahlberg, 1996), provvel que ocorram
vo de negativos a neutros quanto ao acmulo de fungos DSE tambm capazes de auxiliar o vegetal na
biomassa e nitrognio da planta, sendo as respos- absoro de nutrientes de fontes inorgnicas (Usuki
tas variveis de acordo com os vegetais e as espcies & Narisawa, 2007). Ao se avaliar a capacidade do
dos fungos. Disso, deduz-se que existem diferentes DSE Heteroconium chaetospira utilizar diferentes
respostas quando da inoculao por dark septate e aminocidos e fontes inorgnicas de N observou-se
que as mesmas precisam ser melhor estudadas. tambm, um aumento significativo na massa seca
No Brasil, estudos recentes mostraram ocor- do fungo nos meios modificados com fontes orgni-
rncia de fungos dark septate em razes saudveis cas de N, comparativamente ao meio suplementado
de Oryza glumaepatula em ambiente natural, sen- com nitrato de amnio ou sem N (Usuki & Narisa-
do que os isolados obtidos demonstraram capaci- wa, 2007). Os mesmos autores, ao inocularem este
dade para colonizar tambm razes de Oryza sativa fungo em plantas de repolho chins suplementadas
L. sem causar sintomas de doenas e contribuindo com as mesmas fontes de N, observaram que a ino-
para desenvolvimento do sistema radicular (Pereira culao promoveu a utilizao de todos os aminoci-
et al., 2011; Ribeiro et al., 2011; Ribeiro, 2011). De dos e, tambm nitrato de sdio (NaNO3), com efeitos
forma semelhante, na China foi identificada uma es- significativos no crescimento da planta (Diene et al.,
pcie de DSE (Harpophora oryzae) em razes saud- 2013; Mamoud & Narisawa, 2013). Alm disso, em
veis de Oryza granulata Nees & Arn. Ex. Hook. F, que plantas de arroz e tomate inoculadas com DSE, cul-
tambm se mostrou capaz de aumentar a biomassa tivadas em condies controladas e suplementadas
de O. sativa sem desencadear sintomas de doenas com nitrato de amnio foram observados incremen-
(Yuan et al., 2010). tos significativos na matria seca da planta, N-ami-
A forma como os DSE estabelecem associa- no, acares solveis, nmero de perfilhos (plantas
o com seu hospedeiro ainda no foi compreendida de arroz) e alterao dos parmetros cinticos (KM e
com profundidade, mas estudos indicam que a pro- Vmx) da absoro de NO3- (Torres-Jnior, 2014). Os
moo do crescimento pode se dar tanto de forma autores deduziram que os acmulos de acares so-
direta pela facilitao de absoro de nutrientes - lveis relatados podem estar relacionados com au-
em Brassica campestris L., foi constatado uma asso- mento do contedo de clorofila e eficincia quntica
ciao mutualstica com Heteroconium chaetospira do fotossistema II em plantas inoculadas com DSE,
(Grove) M.B. Ellis 1976 [=Cladophialophora chaetos- indicando que estes fungos podem tambm melho-

62 RAPP - Volume 24, 2016


Peter Soares Medeiros, et. al (55-69)

rar a eficincia da atividade fotossinttica do seu razes (Narisawa et al., 2004). Tais resultados mos-
hospedeiro (Zhang et al., 2012). tram claramente que embora os DSE desempenhem
papel benfico no controle de outros fungos, porm
Biocontrole as interaes que ocorrem entre eles carecem de in-
Fungos endofticos so um grande grupo de vestigaes contundentes no sentido de evitar riscos
microrganismos pouco investigados que represen- de patogenicidade. De fato, at onde se conhece re-
tam uma fonte potencial para explorao por sua sultados negativos envolvendo interao entre esp-
ampla variedade de aplicaes na agricultura. Estu- cies de P. fortinni e razes de plantas hospedeiras so
dos vm demonstrando que a associao simbitica extremamente raros e considerados pouco expressi-
de DSE com as razes das plantas hospedeiras vo vos (Wang & Wilcox, 1985).
alm da aquisio de nutrientes e estmulo ao ac- Testes de inoculao de DSE tm demonstra-
mulo de biomassa, podendo atuar no biocontrole de do que os mecanismos de controle biolgico podem
doenas (Diene et al., 2014). atuar em vrios alvos sobre um agente patognico e
Um exemplo recente de sucesso foi obtido que respostas de defesa da planta envolvem, como
com uma estirpe de Veronaeopsis simplex, um mem- mencionado anteriormente, interaes diretas e in-
bro DSE, a qual reduziu em 71% a doena da murcha diretas no interior ou superfcie das razes, podendo
causada pelo patgeno Fusarium oxysporum Schl- estar associadas com modificaes da parede celular
tdl. (1824) quando inoculado em mudas de repo- das clulas da epiderme e do crtex.
lho, Brassica campestris L. (Khastini et al., 2012). Em Um mecanismo primrio direto de biocon-
outro estudo com o mesmo hospedeiro vegetal em trole contra possveis fitopatgenos parece ser a
condies de campo, um txon DSE no identificado habilidade dos DSE formarem uma barreira criada
denominado LtVB3 reduziu em mais de 80% os sin- por uma densa rede de hifas na superfcie das razes
tomas da Murcha-de-verticlio amarelo causada por colonizadas por DSE que impediriam fisicamente a
Verticillium longisporum (C. Stark) Karapapa, Bainbr. entrada de outro patgeno (Narisawa et al., 2004).
& Heale (1997), enquanto a espcie Heteroconium Esta intensa colonizao foi recentemente observa-
chaetospira reduziu cerca de 50% esta infeco, da em estudo realizado no Brasil (Figura 5) (Torres
mostrando diferentes nveis de biocontrole de doen- Jnior, 2014).
as entre os DSE (Narisawa et al., 2004). Ainda, neste Outro fator envolvido diretamente no contro-
estudo, entretanto, duas estirpes de Phialocephala le biolgico de doenas de planta a produo de
fortinii - um dos principais representantes do grupo siderforos por microrganismos presentes no solo,
de fungos DSE - inoculadas na mesma planta hospe- os quais normalmente competem por nutrientes de
deira e nas mesmas condies de campo causaram baixa disponibilidade. Devido ao seu baixo peso mo-
danos severos nas mudas, sugerindo haver um siner- lecular, siderforos so substncias capazes de com-
gismo entre P. fortinni e o patgeno ao parasitar as plexar Fe3+ com grande especificidade e afinidade

A B C
Figura 5. Detalhes da interao do arroz (Oryza sativa) e fungo DSE. (A) Razes de arroz do tratamento controle sem ino-
culao de DSE (Barra = 20 mm). (B) Razes de plantas de arroz com a presena de abundante massa fngica. (C) Razes
de arroz colonizadas por DSE em experimento de inoculao (Barra = 100 mm).. Fotos: Torres Jr., C.V.

RAPP - Volume 24, 2016 63


Peter Soares Medeiros, et al. (55-69)

tornando-o indisponvel para potenciais microrga- o de antioxidantes leva a reduo de ROS evitando
nismos patognicos, limitando assim seu crescimen- danos s clulas ntegras (Zhao et al., 2015). Neste
to. A espcie P. fortinii capaz de biosintetizar como sentido, acredita-se que a colonizao por DSE au-
principal agente quelante a ferricrocina, seguindo a xilie o vegetal na regulao e equilbrio dos sinais e
ferrirubina e ferricromo C em baixo pH e concentra- defesas contra os patgenos, possibilitando o desen-
o de ferro (Barthold et al., 2001). Da mesma for- volvimento de resistncia sistmica do vegetal.
ma, a estirpe Y34 Veronaeopsis simplex (Papendorf) Estudos avaliando a capacidade biocontro-
Arzanlou & Crous (2007) inibiu o crescimento do ladora do fungo DSE Harpophora oryzae contra o
patgeno F. oxysporum indisponibilizando ferro por patgeno Pyricularia oryzae Cavara (=Magnaporthe
uma ao antagnica em meio de cultura (Khastini oryzae B.C. Couch.) agente patolgico da brusone,
et al., 2012). Os efeitos da produo de siderforos considerada uma das mais severas doenas da cul-
por DSE sobre agentes fitopatognicos, entretanto, tura do arroz, mostraram que a colonizao por H.
ainda so desconhecidos em condies de cultivo oryzae foi capaz de controlar a infeco pelo pa-
vegetal fora de laboratrios. tgeno (Figura 6). Este controle ocorreu seguido
Mecanismos indiretos de interao da plan- do aumento dos nveis e da atividade enzimtica
ta com o microrganismo surgem quando as plantas de antioxidantes como superxido desmutase,
so inoculadas com DSE. Um desses mecanismos catalase, peroxidase, dehidroascorbato redutase,
observados o espessamento nos tecidos radicula- glutationa redutase e glutationa, alm de elevar
res colonizados e uma colorao marrom escuro nas os nveis de cido ascrbico. Tais antioxidantes
clulas quando da presena do fungo, indicando que so uma importante linha de defesa da planta,
as clulas vegetais recebem sinais, provavelmente os capazes de neutralizar radicais livres produzidos
quais a induzem proteger-se atravs da produo durante o processo de infeco por um patge-
de substncias antifngicas (Narisawa et al., 2004). no. Uma acumulao abundante de perxido de
A produo de metablitos fenlicos desencadeada hidrognio (H2O2) (Figura 6) observada nas clu-
na planta quando inoculada com DSE pode ser uma las externas da epiderme e corticais parece ser
resposta contra o patgeno e, neste caso, estes com- proporcional ao tempo de infeco e do volume de
postos antimicrobianos promoveriam uma resistn- hifas fngica. O acumulo de H2O2 um processo de
cia induzida, que inibiria o crescimento do patgeno defesa da planta na tentativa de matar o patgeno
e protegeria indiretamente os tecidos epidermais e ou restringi-lo apenas nas clulas j infectadas (Su
corticais subjacentes s reas invadidas, agindo et al., 2013).
como uma barreira capaz de restringir a entrada
do patgeno (Schulz et al., 1999; Benhamou &
Garand, 2001).
Alm disso, no somente o aumento da
concentrao de metablitos de defesa, mas ou-
tros padres de resposta incluindo a produo de
antioxidantes e espcies reativas de oxignio (ROS)
e a manuteno do equilbrio destes compostos so
respostas expressas pelo vegetal quando na presen-
a de DSE. De fato, a produo de ROS e, consequen-
temente, antioxidantes representam uma resposta
geral que ocorre no vegetal quando do ataque de
patgenos e, tambm, em situaes de estresses
abiticos. ROS agem de forma crucial sobre a morte
programada de clulas, sinalizao celular e defesas
da planta e, adicionalmente, acredita-se que possam Figura 6. Reduo dos sintomas devastadores da brusone
nas folhas de arroz mediante a proteo sistmica pro-
exercer papel importante nas interaes simbiticas, movida pela inoculao de Harpophora oryzae. Adptado
especialmente na sinalizao (Su et al., 2013; Wang de Su et al. (2013) (esta figura no tem escala no trabalho
et al., 2016). Por outro lado, o aumento da produ- original). Com autorizao dos autores e da revista PLoS
ONE.

64 RAPP - Volume 24, 2016


Peter Soares Medeiros, et. al (55-69)

Figura 7. Acmulo de Perxido de Hidrognio (H2O2) por Harpophora. oryzae. Microscopia de luz e fluorescncia de
razes de arroz da testemunha e infectadas com H. oryzae em diferentes perodos aps a inoculao. Os pontos marrons
indicam o acmulo de H2O2 (Barras na extremidade direita = 100 m e outras 30 m). Adaptado de Su et al. (2013). Com
autorizao dos autores e da revista PLoS ONE.

Consideraes para futuras pesquisas que englobariam diferentes famlias contendo g-


Como discutido anteriormente, as pesquisas neros e espcies de fungos DSE, uma que chama a
com fungos dark septate tm sido globalmente de- ateno no Brasil a Pleosporales que predominou
senvolvidas, porm no Brasil ainda so restritas. Pelo em estudos realizados com arroz silvestre realizado
fato dos DSE, em sua grande maioria no serem bio- na Amaznia (Ribeiro, 2011). Portanto, a partir do
trficos obrigatrios, um caminho importante para a tpico aqui abordado, verifica-se que existe um vas-
produo de inoculante existe, pois possibilita o cul- to campo de pesquisa e potencialmente significativo
tivo em laboratrio. A partir desta caracterstica, es- a ser explorado na agricultura, particularmente den-
tudos tm mostrado que muitos destes fungos esta- tro da fitopatologia, o que abrange desde a pesquisa
belecem uma associao benfica ao vegetal, porm bsica at testes com as culturas em condies de
a simbiose mutualista foi provada em poucos casos. campo.
De forma geral, pode-se dizer que nos casos
onde os DSE mostraram benefcios, os mesmos con- Referncias
triburam para o crescimento vegetal atravs do ac- Addy HD, Piercey MM, Currah RS (2005) Microfungal
mulo de nutrientes como o N e o P, incrementaram a endophytes in roots. Canadian Journal of Botany
produo de biomassa vegetal e a capacidade fotos- 83:1-13.
sinttica das plantas e, aumentaram o perfilhamento Alberton O, Kuyper TW, Summerbell MC (2010) Dark
de plantas de arroz. Adicionalmente, os DSE tambm septate root endophytic fungi increase growth of
tm sido estudados quanto capacidade de atua- Scots pine seedlings under elevated CO2 throu-
rem como biocontrole de patgenos, especialmente gh enhanced nitrogen use efficiency. Plant Soil
fungos. Neste caso, os DSE parecem estabelecer bio- 328:459470.
controle de forma direta por colonizarem abundan- Andrades-Linares DR, Franken P (2013) Fungal endo-
temente a superfcie das razes, ocupando o stio de phytes in plant Roots: taxonomy, colonization pat-
infeco e impedindo o crescimento do patgeno e, terns and functions. In: Aroca R. (ed). Simbiotic
ainda produzindo siderforos capazes de complexar Endophytes. Noida: Springer, pp. 348.
ons de Fe, diminuindo a disponibilidade ao patge- Arnold AE, Miadlikowska J, Higgins KL, Sarvate SD,
no. De forma indireta, os DSE induzem a resistncia Gugger P, Way A, Hofstetter V, Kauff F, Lutzoni F
sistmica na planta especialmente por auxiliariam a (2009) Hyperdiverse fungal endophytes and en-
planta a manter o equilbrio entre formas reativas de dolichenic fungi elucidate the evolution of major
oxignio e antioxidantes e/ou produzir metablitos ecological modes in the Ascomycota.Systematic
secundrios, que possuem ao antifngica. Biology58: 283-297.
Acima de tudo, importante destacar que Arnold AE, Henk DA, Eells RA, Lutzoni F, Vilgalys R
muito pouco se conhece sobre os dark septate, seja (2007) Diversity and phylogenetic affinities of
em relao a taxonomia e filogenia, seja sobre a for- foliar fungal endophytes in loblolly pine inferred
ma como os estes fungos colonizam o tecido vegetal, by culturing and environmental pcr. Mycologia
como transferem nutrientes para a planta, ou como 99:185206.
estimulam o seu crescimento. O pouco conhecimen- Bacon CW, White JFJ (2000) Physiological adaptations
to que se possui decorre principalmente de pesqui- in the evolution of endophytism in the Clavicipita-
sas com o gnero Phialocephala que parece ser mais ceae. In: Bacon CW, White JFJ, eds. Microbial en-
abundante em conferas. Dentre as diversas ordens dophytes. New York, NY, USA: Marcel Dekker Inc.,

RAPP - Volume 24, 2016 65


Peter Soares Medeiros, et al. (55-69)

237263. tion biology, and ecology. Botany 86:13551369.


Barrow JR, Aaltonen RE (2001) A method of evalu- Grnig CR, Sieber TN (2005) Molecular and pheno-
ating internal colonization of Atriplex canescens typic description of the widespread root symbi-
(Pursh) Nutt. Roots by dark septate fungi and how ont Acephala applanata gen. et sp. nov., formerly
they are influenced by host physiological activity. known as dark-septate endophyte Type 1. Myco-
Mycorrhiza 11:199-205. logia 97(3):628640.
Bartholdy BA, Berreck M, Haselwandter K (2001) Haselwandter K (1983) Pectic Enzymes Produced by
Hydroxamate siderophore synthesis by Phialoce- Fungal Root Associates of Alpine Plants. Phyton
phala fortinii, a typical dark septate fungal root 23(1):55-64.
endophyte. BioMetals 14:3342. Hibbet et al. (2007) A higher-level phylogenetic
Benhamou N, Garand C (2001) Cytological analysis classification of the Fungi. Mycological Research
of defense-related mechanisms induced in pea 111:509-547.
root tissues in response to colonization by nonpa- Higgins KL, Arnold AE, Miadlikowska J, Sarvate SD,
thogenic Fusarium oxysporum fo47. Phytopatolo- Lutzoni F. (2007) Phylogenetic relationships, host
gy 91(8):730-740. affinity, and geographic structure of boreal and
Bensch K, Braun U, Groenewald JZ, Crous PW (2012) arctic endophytes from three major plant lin-
The genus Cladosporium. Studies in Mycology eages. Molecular Phylogenetics and Evolution
72(1):1-401. 42:543555.
Clay K, Schardl CL (2002) Evolutionary origins and Huo XQ, Guo SX (2008) Interaction between a dark
ecological consequences of endophyte symbiosis septate endophytic isolate from Dendrobium sp.
with grasses. American Naturalist 160:S99S127. and roots of D. nobile seedlings. Journal of Inte-
Crous PW, Braun U, Schubert K, Groenewald JZ (2007) grative Plant Biology. 51(4):374-81.
Delimiting Cladosporium from morphologically si- Index Fungorum (2016) http://www.indexfungorum.
milar genera. Studies in Mycology 58:33-56. org/names/Names.asp (Acessado em: 15 Maio
Currah RS, Van Dyk M (1986) A survey of some pe- 2016).
rennial vascular plant species native to Alberta for Jumpponen A (2001) Dark septate endophytes are
occurrence of myccorhizal fungi. Canadian Field- they mycorrhizal? Mycorrhiza 11:207211.
-Naturalist 100:330342. Jumpponen A, Trappe JM (1998) Dark septate en-
Diene O, Sakagami N, Narisawa K (2014) The role of dophytes: a review of facultative biotrophic root-
dark septate endophytic fungal isolates in the ac- colonizing fungi. New Phytologist 140:295-310.
cumulation of cesium by chinese cabbage and to- Kageyama SA, Posavatz NR, Waterstrip KE, Jones SJ,
mato plants under contaminated environments. Bottomley PJ, Cromack Jr K, Myrold DD (2008)
PLoS ONE 9(10):e109233. Fungal and bacterial communities across mead-
Diene O, Takahashi T, Yonekura A, Nitta Y, Narisawa K owforest ecotones in the western Cascades
(2010) A New Fungal Endophyte, Helminthospo- of Oregon. Canadian Journal of Forest Research
rium velutinum, Promoting Growth of a Bioalco- 38(5):1053-1060.
hol Plant, Sweet Sorghum. Microbes Environment Khastini RO, Ohta H, Narisawa K (2012) The role of
25(3):216219. a dark septate endophytic fungus, Veronaeopsis
Diene O, Wang W, Narisawa K (2013) Pseudosig- simplex Y34, in Fusarium disease suppression in
moidea ibarakiensis sp. nov., a dark septate en- Chinese cabbage. The Journal of Microbiology
dophytic fungus from a Cedar Forest in Ibaraki, 50(4):618624.
Japan. Microbes and Environments 28:381387. Khidir HH, Eudy DM, Porras-Alfaro A (2010) A gener-
Gardes M, Dahlberg A (1996) Mycorrhizal diversity in al suite of fungal endophytes dominate the roots
Arctic and Alpine tundra: an open question. New of two dominant grasses in a semiarid grassland.
Phytologist 133:147157. Journal of Arid Environments 74:3542.
Grnig CR, Queloz V, Sieber TN, Holdenrieder O Kirk PM, Cannon, PF, Stalpers A (2008). Dictionary of
(2008) Dark septate endophytes (DSE) of the Phi- the Fungi,10th ed. Wallingford, UK. CABI, pp. 368.
alocephala fortinii s.l. Acephala applanata spe- Knapp DG, Kovcs GM, Zajta E, Groenewald JZ, Crous
cies complex in tree roots: classification, popula- PW (2015) Dark septate endophytic pleosporale

66 RAPP - Volume 24, 2016


Peter Soares Medeiros, et. al (55-69)

an genera from semiarid areas. Persoonia 35:87 dark septate provenientes de Roraima, RR. Dis-
100. sertao, Universidade Federal Rural do Estado
Knapp DG, Pintye A, Kovcs GM (2012) The dark side do Rio de Janeiro. Seropdica, RJ.
is not fastidious Dark septate endophytic fungi Melin E (1922) On the mycorrhizas of Pinus sylvestris
of native and invasive plants of semiarid sandy ar- L. and Picea abies Karst. A preliminary note. Jour-
eas. PLoS ONE 7(2):e32570. nal of Ecology 9:254257.
Kovcs GM, Szigetvri C (2002) Mycorrhizae and oth- Melin E (1923) Experimentelle Untersuchungen ber
er root-associated fungal structures of the plants die Konstitution und kologie der Mykorrhizen
of a sandy grassland on the Great Hungarian Plain. von Pinus sylvestris L. und Picea abies (L.) Karst.
Phyton 42:211223. In: Falck R. ed. Mykologische Untersuchungen
Kuldau G, Bacon C (2008) Clavicipitaceous endo- und Berichte 2. Kassel: Druck und Verlag G. Got-
phytes: their ability to enhance resistance of theilt. pp. 73334.
grasses to multiple stresses. Biological Control, 46 Menkis A, Allmer J, Vasiliauskas R, Lygis V, Stenlid
(1):57-71. J, Finlay R (2004) Ecology and molecular charac-
Linares DRA, Grosch R, Restrepo S, Krumbein A, terization of dark septate fungi from roots, living
Franken P (2011) Effects of dark septate endo- stems, coarse and fine woody debris. Mycological
phytes on tomato plant performance. Mycorrhiza Research 108(8):965973.
21:413422. Mohanta TK, Bae H (2015) The diversity of fungal ge-
Lukeov T, Kohout P, Vtrovsk T, Vohnk M (2015) nome. Biological Procedures Online 17:8.
The potential of dark septate endophytes to form Narisawa K, Usuki F, Hashiba T (2004) Control of Ver-
root symbioses with ectomycorrhizal and ericoid ticillium Yellows in Chinese Cabbage by the Dark
mycorrhizal middle european forest plants. PLoS Septate Endophytic Fungus LtVB3. Phytopathol-
ONE 10(4):e0124752. ogy 94:412-418.
Maharachchikumbura SSN, Hyde KD, Groenewald Newsham KK (2011) A meta-analysis of plant re-
JZ, Xu J, Crous PW (2014) Pestalotiopsis revisited. sponses to dark septate root endophytes. New
Studies in Mycology 79:121-86. Phytologist 190:783-793.
Mahmoud RS, Narisawa K (2013) A new fungal endo- ODell TE, Massicotte HB, Trappe JM (1993) Root col-
phyte, Scolecobasidium humicola, promotes to- onization of Lupinus latifolius Agardh. and Pinus
mato growth under organic nitrogen conditions. contorta Dougl. by Phialocephala fortinii Wang &
PLoS ONE 8(11):e78746. Wilcox. New Phytologist 124:93-100.
Mandyam KG, Jumpponen A (2005) Abundance and Ormsby A, Hodson E, Li Y, Basinger J, Kaminskyj S
possible functions of the root-colonizing dark (2007) Arbuscular mycorrhizae associated with
septate endophytic fungi. Studies in Mycology Asteraceae in the Canadian high arctic: the value
53:173-190. of herbarium archives. Canadian Journal of Bo-
Mandyam KG, Jumpponen A (2008) Seasonal and tany 85:599606.
temporal dynamics of arbuscular mycorrhizal and Pereira GMD, Ribeiro KG, Fernandes Junior PI, Vital
dark septate endophytic fungi in a tallgrass prairie MJS, Kasuya MCM, Zilli JE (2011) Ocorrncia de
ecosystem are minimally affected by nitrogen en- fungos endofticos dark septate em razes de
richment. Mycorrhiza 18:145155. Oryza glumaepatula na Amaznia. Pesquisa Agro-
Mandyam KG, Jumpponen A (2015) Mutualism pecuria Brasileira 46(3):331-334.
parasitism paradigm synthesized from results of Peterson RL, Wagg C, Pautler M (2008) Associations
root-endophyte models. Frontiers in Microbiol- between microfungal endophytes and roots:
ogy 5(776):1-13. do structural features indicate function? Botany
Mayerhofer MS, Kernaghan G, Harper KA (2013) 86:445456.
The effects of fungal root endophytes on plant Peyronel B (1924) Prime ricerche sulla micorizae en-
growth: a meta-analysis. Mycorrhiza 23:119128. dotrofiche e sulla microflora radicola normalle
Medeiros PS (2015) Caracterizao de fungos asso- della fanerograme. Revista Biologia 6:1753.
ciados vegetao de Mata Atlntica do Estado Porras-Alfaro A, Herrera J, Sinsabaugh RL, Odenback
do Rio de Janeiro e alguns fungos endofticos KJ, Lowrey T, Natvig DO (2008) Novel root fungal

RAPP - Volume 24, 2016 67


Peter Soares Medeiros, et al. (55-69)

consortium associated with a dominant desert ology and Biotechnology Research 2:212- 222.
grass. Applied and Environmental Microbiology Stoyke G, Egger KN, Currah RS (1992) Characteriza-
74(9):28052813. tion of sterile endophytic fungi from the mycor-
Porras-Alfaro A, Bayman P (2011) Hidden fungi, rhizae of subalpine plants. Canadian Journal of
emergent properties: Endophytes and microbi- Botany 70:2009-2016.
omes. Annual Review of Phytopathology 49:291 Stoyke G, Currah RS(1991) Endophytic fun-
315. gi from the mycorrhizae of alpine ericoid plant.
Read DJ, Haselwandter K (1981) Observations on the Canadian Journal of Botany-Revue Cana-
mycorrhizal status of some alpine plant communi- dienneDeBotanique69(2):347352.
ties. New Phytologist 88:341-352. Su ZZ, Mao LJ, Li N, Feng XX, Yuan ZL, Wang LW, Lin
Redman RS, Sheeran KB, Stout RG, Rodriguez RJ, FC, Zhang CL (2013) Evidence for biotrophic life-
Henson JM (2002) Thermotolerance generated by style and biocontrol potential of dark septate en-
plant/fungal symbiosis. Science 298(5598):1581. dophyte Harpophora oryzae to rice blast disease.
Ribeiro KG (2011) Fungos endofticos dark septates PLoS ONE 8(4):e61332.
em arroz silvestre Oryza glumaepatula Steund. Sung, GH, Sung JM, Hywel-Jones, NL, Spatafora, JW
Dissertao, Universidade Federal de Roraima. (2007) A multi-gene phylogeny of Clavicipitaceae
Boa Vista, RR. (Ascomycota, Fungi): Identification of localized
Ribeiro KG, Pereira GMD, Mosqueira CA, Barana AC, incongruence using a combinational bootstrap
Vital MJS, Silva K, Zilli JE (2011) Isolamento, arma- approach. Molecular Phylogenetics and Evolution
zenamento e determinao da colonizao por 44:12041223.
fungos dark septate a partir de plantas de arroz. Torres-Jnior CV (2014) Influncia dos fungos dark
Revista Agro@mbiente On-line 5(2):97-105. septate sobre absoro de nutrientes e cresci-
Richard C, Fortin JA (1973) The Identification of mento de plantas de arroz e tomate. Dissertao,
Mycelium Radicis Atrovirens (Phialocephala Universidade Federal Rural do Rio de Janeiro. Se-
Dimorphospora). Canadian Journal of Botany ropdica, RJ.
51(11):2247-48. Upson R, Read D, Newsham K (2009) Nitrogen form
Rodriguez RJ, White JR, Arnold A, Redman R (2009) influences the response of Deschampsia antarc-
Fungal endophytes: diversity and functional roles. tica to dark septate root endophytes. Mycorrhiza
New Phytologist 182:314330. 20:1-11.
Schardl CL, Leuchtmann A, Spiering MJ (2004) Sym- Usuki F, Narisawa K (2005) Formation of structures
bioses of grasses with seed borne fungal endo- resembling ericoid mycorrhizas by the root endo-
phytes. Annual Review of Plant Biology 55:315 phytic fungus Heteroconium chaetospira within
340. roots of Rhododendron obtusum var. kaempferi.
Schulz B, Boyle C (2005) The endophytic continuum. Mycorrhiza 15:6164.
Mycological Research 109:661686. Usuki F, Narisawa K (2007) A mutualistic symbiosis
Schulz B, Rmmert AK, Dammann U, Aust HJ, between a dark septate endophytic fungus, Het-
Strack D (1999) The endophyte-host interaction eroconium Chaetospira, and a nonmycorrhizal
: a balanced antagonism? Mycological Research plant, Chinese cabbage. Mycologia 99:175184.
103(10):1275-1283. Vohnk M, Borovec O, Zupan I, Vondrasek D, Petrtyl
Schubert K, Groenewald JZ, Braun U, Dijksterhuis M, Sudov R (2015) Anatomically and morpholog-
J, Starink M, Hill CF, Zalar P, de Hoog GS, Crous ically unique dark septate endophytic association
PW (2007) Biodiversity in the Cladosporium her- in the roots of the Mediterranean endemic sea-
barum complex (Davidiellaceae, Capnodiales), grass Posidonia oceanica. Mycorrhiza 25(8):663-
with standardisation of methods for Cladospori- 672.
um taxonomy and diagnostics. Studies in Mycol- Wang CJK, Wilcox HE (1985) New species of ecten-
ogy 58:105156. domycorrhizal and pseudomicorrhyzal fungi: Phi-
Sharma BB, Jha DK (2012) Arbuscular mycorrhiza and alophora finlandia, Chloridium paucisporum and
dark septate fungal associations in medicinal and Phialocephala fortinii. Mycologia 76(3):951-958.
aromatic plants of Guwahati. Journal of Microbi- Wang JL, Li T, Liu GY, Smith JM, Zhao ZW (2016) Un-

68 RAPP - Volume 24, 2016


Peter Soares Medeiros, et. al (55-69)

raveling the role of dark septate endophyte (DSE) species of Harpophora (Magnaporthaceae) re-
colonizing maize (Zea mays) under cadmium covered from healthy wild rice (Oryza granulata)
stress: physiological, cytological and genic as- roots, representing a novel member of a benefi-
pects. Scientific Reports 6:22028. cial dark septate endophyte. Federation of Euro-
Wei YF, Li T, Li LF, Wang JL, Cao GH, Zhao ZW (2016) pean Microbiological Societies. Microbiological
Functional and transcript analysis of a novel met- Letters 307:94101.
al transporter gene EpNramp from a dark sep- Zhan F, He Y, Zu Y, Li T, Zhao Z (2011) Characterization
tate endophyte (Exophiala pisciphila). Ecotoxi- of melanin isolated from a dark septate endo-
cology and Environmental Safety 124:363368. phyte (DSE), Exophiala pisciphila. World Journal
Weiss M, Selosse MA, Rexer KH, Urban A, Oberwin- of Microbiology and Biotechnology 27:2483
kler F (2004) Sebacinales: a hitherto overlooked 2489.
cosm of heterobasidiomycetes with a broad Zhang Y, Schoch CL, Fournier J, Crous PW, de Gruyter
mycorrhizal potential. Mycological Research J, Woudenberg JH, Hirayama K, Tanaka K, Point-
108:1003-1010. ing SB, Spatafora JW, Hyde KD (2009) Multi-locus
Yu T, Nassuth A, Peterson RL (2001) Characteriza- phylogeny of Pleosporales: a taxonomic, ecologi-
tion of the interaction between the dark septate cal and evolutionary re-evaluation. Studies in
fungusPhialocephala fortiniiandAsparagus of- Mycology 64:85102.
ficinalis roots. Canadian Journal of Microbiol- Zhang HH, Tang M, Chen H, Ya-Jun W (2012) Effects
ogy47:741753. of a Dark-Septate Endophytic Isolate LBF- 2 on
Yuan Z L, Su ZZ, Mao LJ, PengYQ, Yan GGM, Lin FC, the Medicinal Plant Lycium barbarum L. Journal
Zhang CL (2011) Distinctive endophytic fungal of Microbiology 50:9196.
assemblage in stems of wild rice (Oryza granu- Zhao D, Li T, Shen M, Wang J, Zhao Z (2015) Diverse
lata) in China with special reference to two spe- strategies conferring extreme cadmium (Cd) tol-
cies of Muscodor (Xylariaceae). The Journal of erance in the dark septate endophyte (DSE), Ex-
Microbiology 49(1):15- 23. ophiala pisciphila: Evidence from RNA-seq data.
Yuan ZL, Llin FC, Zhang CL, Kubicek CP (2010) A new Microbiological Research 170:2735.

RAPP - Volume 24, 2016 69


Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)

NEMATOIDES QUARENTENRIOS PARA


O BRASIL - DIAGNOSE, CONTROLE E
PERSPECTIVAS
Paulo Sergio Torres Brioso1 e Ricardo Moreira de Souza2

RESUMO
Esta reviso aborda tpicos relacionados ao risco de introduo de ne-
matoides quarentenrios no Brasil, apresentando informaes de cada uma das
espcies de nematoides constantes na Lista de Pragas Quarentenrias Ausentes
do Brasil; relaciona aspectos relativos diagnose e controle; e discorre sobre as
tendncias futuras quanto ao risco de introduo dessas pragas.

SUMMARY
This review deals with topics related with the risk of introducing exotic
nematodes in the country; presents information on all species of nematodes on
the List of Quarantine Species Absent to Brazil; discuss aspects concerning diag-
nosis and control; and the trends regarding the risk of introducing these pests
into Brazil.

Introduo https://www.ippc.int/index.php?id=draft_ispms
A Norma Internacional de Medidas Fitos- &no_cache=1&L=0). A atualizao dessas listas
sanitrias n 19: Diretriz sobre listas de pragas re- necessria quando a categoria das pragas lista-
gulamentadas descreve os procedimentos para se das alterada, ou quando as informaes para as
preparar, manter e disponibilizar as Listas de Pragas pragas listadas so modificadas, por mudana da
Regulamentadas pelas Organizaes Nacionais de taxonomia, por exemplo, devendo ser feita a atua-
Proteo Fitossanitria (ONPF). A ONPF brasileira lizao assim que a necessidade de modificao for
representada pelo Departamento de Sanidade identificada atravs de levantamentos, notificaes
Vegetal (DSV) Ministrio da Agricultura, Pecuria de ocorrncia e realizao de Anlises de Risco de
e Abastecimento (MAPA), que responsvel pelos Pragas.
procedimentos para estabelecer a lista de pragas As diversas Instrues Normativas (IN) e Por-
regulamentadas, bem como pela sua manuteno, tarias publicadas pelo MAPA e citadas nesse texto
atualizao, registro apropriado e pelo fornecimen- podem ser visualizadas, na ntegra, no Sistema de
to dessas listas s partes contratantes, se requisita- Consulta Legislao do MAPA, no endereo eletr-
das. Tais listas auxiliam na preveno da introduo nico http://www.agricultura.gov.br/legislacao.
e/ou disseminao de pragas e tambm facilitam o A Lista de Pragas Quarentenrias Ausentes
comrcio seguro, garantindo a transparncia. (A1) e a Lista de Pragas Quarentenrias Presentes
A Lista de Pragas Regulamentadas de um (A2) do Brasil, revisadas e atualizadas, constam dos
pas no fixa ou permanente (disponvel no site Anexos I e II, respectivamente, da Instruo Norma-

1
Universidade Federal Rural do Rio de Janeiro, Instituto de Cincias Biolgicas e da Sade, Laboratrio Oficial de Diagnstico Fitossa-
nitrio, Caixa Postal 74585, 23897-970 - Seropdica, RJ, brioso@bighost.com.br; 2Universidade Estadual do Norte Fluminense Darcy
Ribeiro, CCTA/ Laboratrio de Entomologia e Fitopatologia, 28015-620 - Campos dos Goytacazes, RJ, ricmsouza@censanet.com.br

70 RAPP - Volume 24, 2016


Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)

tiva (IN) 41/2008 e retificao [publicada no Dirio tra praga extica dever ser notificada ao MAPA,
Oficial da Unio (D.O.U.) n 125, de02/07/2008,Se- de acordo com a legislao vigente, bem como de
o 1, p.8-10 e a retificao no D.O.U. n131, uma Praga Quarentenria Presente fora da rea de
de10/07/2008,Seo1,p.4],da IN 59/2013 e retifica- controle oficial. Em funo da distribuio da pra-
o [publicada no D.O.U. n 249, de24/12/2013,Se- ga no territrio nacional, a ONPF adotar as provi-
o1,p.4-5,e no D.O.U. n 252, de30/12/2013,Se- dncias necessrias para notificao Conveno
o1,p.81] e da IN 21/2015 (publicada no D.O.U. n Internacional de Proteo dos Vegetais (CPIV), para
126, de06/07/2015,Seo1,p.4). a alterao da Lista de Pragas Quarentenrias e a
Como j ocorreram alteraes taxonmicas autorizao da divulgao da informao (Portaria
aps revises publicadas sobre vrus, virides e fi- Interministerial 290/1996). As normas para noti-
toplasmas quarentenrios (Brioso & Pozzer, 2013; ficao de ocorrncia de pragas exticas no pas
2014), o mesmo poder ocorrer em relao aos ne- esto estabelecidas na IN 02/2002. Havendo inte-
matoides quarentenrios. Esta reviso, que trata dos resse em realizar pesquisa com praga quarenten-
nematoides considerados como Pragas Quarenten- ria, necessria a autorizao prvia do MAPA. Se
rias Ausentes (A1) para o Brasil at o momento, ser a pesquisa for com Pragas Quarentenrias Ausen-
mantida e atualizada pelos autores dessa reviso nos tes, o pedido de autorizao dever ser protocola-
endereos eletrnicos http://www.fito2009.com/fi- do contendo o plano de trabalho, a justificativa da
top/fitoplablistanemat.htm e http://www.fito2009. necessidade de realizao da pesquisa e o termo de
com/fitop/fitoplabnematquar.html. responsabilidade da instituio qual pertence o
A seguir, sero repassadas algumas informa- pesquisador; se a pesquisa for com Praga Quaren-
es bsicas sobre cada uma dessas pragas. Des- tenria Presente, a solicitao dever ser realizada
taca-se que as informaes, principalmente quanto conforme legislao especfica relacionada essa
distribuio geogrfica, so muito dinmicas em praga.
funo de novos registros, retificao de relatos e No caso especfico de nematoides, diversos
at de erradicao da praga na rea geogrfica em sites nacionais e internacionais trazem informaes
considerao. dos mesmos, seja como fitoparasita ou como vetor
de vrus e doenas correlacionadas, por exemplo
Divulgao e pesquisa de pragas quarentenrias nos endereos eletrnicos: http://www.apsnet.org/
Em 1996 foi publicada a Portaria Interministe- edcenter/intropp/PathogenGroups/Pages/IntroNe-
rial n 290, assinada pelo MAPA, Ministrio da Educa- matodes.aspx, http://nematologia.com.br/about-
o (MEC) e Ministrio da Cincia e Tecnologia (MCT) -sbn/revisoes-rapp/.
(D.O.U. n 75, de 18/04/1996, Seo 1, p.6575). A
mesma considera que a divulgao da ocorrncia de Nematoides fitoparasitas como vetores de vrus
qualquer praga, supostamente inexistente no ter- Reviso sobre nematoides vetores de esp-
ritrio nacional, de forma precipitada e sem o em- cies virais dos gneros Cheravirus, Nepovirus, To-
basamento cientfico adequado, poder ocasionar bravirus (http://www.fito2009.com/fitop/fitoplab-
restries s exportaes brasileiras, com srios virtaxon.html) foram publicados por Costa (1999),
prejuzos economia nacional. Em funo disso, a Brown et al. (2004) e Almeida & Drecaemer (2005).
lei determina que a deteco ou a caracterizao Essas revises, disponveis no endereo eletrnico
de qualquer praga inexistente no territrio nacio- http://nematologia.com.br/about-sbn/revisoes-
nal deve imediatamente ser notificada ao MAPA, -rapp/, abordam aspectos relevantes inerentes
antes de qualquer divulgao. Uma vez notificada a aos nematoides dos gneros Longidorus, Paralon-
ocorrncia da nova praga, caber ao MAPA efetuar gidorus (Subfamlia Longidorinae, Famlia Longido-
levantamento de sua distribuio geogrfica no ter- ridae), Xiphinema (Subfamlia Xiphinematinae, Fa-
ritrio nacional e de suas possibilidades de controle mlia Longidoridae); Trichodorus, Paratrichodorus
e erradicao. (Subfamlia Trichodorinae, Famlia Trichodoridae)
A IN 52/2007 (D.O.U. n 223, de 21/11/ e suas espcies correlatas. Nesses gneros temos
2007, Seo 1, p.31-34) reitera que a deteco como espcies vetoras de vrus e quarentenrias
de qualquer Praga Quarentenria Ausente ou ou- para o Brasil Xiphinema diversicaudatum e X. rivesi.

RAPP - Volume 24, 2016 71


Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)

Sintomas ciamento de nucleotdeos) devido rapidez, sensibi-


A ao dos nematoides quarentenrios nas lidade e especificidade.
diversas hospedeiras, dependendo da espcie de ne- Atualmente, os pases tm padronizado a n-
matoide e de sua hospedeira, pode ou no gerar sin- vel internacional a metodologia de deteco e de
tomas como amarelecimento, murcha, leses necr- diagnose destes nematoides quarentenrios, bem
ticas, podrido, tombamento, senescncia precoce, como de outros fitopatgenos e pragas. O objetivo
deformaes foliares, galhas, nanismo, reduo da que todos os pases adotem o mesmo protocolo de
lmina foliar, inflorescncias deformadas, sementes deteco com o intuito de evitar resultados contradi-
manchadas, queda da produo e do nmero de flo- trios, em funo da metodologia utilizada.
res, bem como do peso de tubrculos, vagens, gros Essas adequaes so referendadas e publi-
e sementes. E, em certos casos, pode levar a planta cadas no endereo eletrnico (https://www.ippc.
morte. int/es/core-activities/standards-setting/ispms) sen-
Sintomas especficos e associados aos nema- do, posteriormente, divulgadas atravs das INs do
toides quarentenrios podem ser visualizados con- MAPA para aplicao nos ensaios de deteco e de
sultando-se as referncias citadas no texto e associa- diagnose de pragas da Rede Nacional de Laborat-
da espcie de nematoide quarentenrio. rios Agropecurios do Sistema Unificado de Ateno
Sanidade Agropecuria (SUASA/ MAPA) (http://
Detecco de nematoides quarentenrios para o www.fito2009.com/fitop/labmapa.html).
brasil No que se refere nematoides, at 2016, fo-
Na deteco de nematoides, podem ser uti- ram editados os protocolos padres para deteco
lizadas anlises baseadas nas caractersticas morfo- de Ditylenchus dipsaci e D. destructor (IPPC, 2015),
lgicas e morfomtricas, sorolgicas, fsico-qumicas Bursaphelenchus xylophilus (IPPC, 2016a) e Xiphine-
e moleculares, por meio de Testes Biolgicos ob- ma americanum sensu lato (IPPC, 2016b), estando
servao direta de sintomas, iscas biolgicas; Testes em fase de edio pela IPPC o referente Anguina
Fsico-qumicos - teste de triturao, peneiramento e spp..
flutuao; eletroforese em gel (agarose ou poliacrila-
mida) para isoenzima, microscopia tica, microsco- Taxonomia
pia eletrnica de varredura; Testes Sorolgicos - ELI- A identificao taxonmica de nematoides se
SA (Enzyme-Linked Immunosorbent Assay), Western d por via morfolgica e morfomtrica, associada ou
Blot; Testes Moleculares - Polymerase Chain Reaction no informao molecular.
(PCR) com primers especficos ou degenerados, AFLP Chaves taxonmicas baseadas em caracteres
(Amplified Fragment Length Polymorphism)-PCR, morfolgicos e morfomtricos, para os principais
LAMP (Loop-mediated Isothermal Amplification) gneros e espcies existentes no Brasil, podem ser
PCR, Multiplex PCR, PCR-RFLP (Polymerase Chain Re- encontradas em Charchar (1997), Cares & Huang
action - Restriction Fragment Length Polymorphism), (2000), Cares & Huang (2001), Cares & Andrade
RAPD (RandomAmplification ofPolymorphicDNA)- (2006), Cares & Tenente (2007) e Cares et al. (2008).
-PCR, Real Time PCR, SCAR (Sequence Characterized Nestas chaves, os nematoides esto inseridos dentro
Amplified Region)-PCR, sequenciamento de nucleo- do Reino Animalia, Subreino Metazoa, Filo Nemato-
tdeos (Charchar, 1997; Perry et al., 2009; Oliveira et da que se subdivide em Classes, Subclasses, Ordens,
al., 2011; Subbotin et al., 2013; Brioso &Dias, 2015). Subordens, Superfamlia, Famlia, Subfamlia, Gne-
No entanto, em termos de rotina de labora- ros e espcies, conforme exemplificado no endereo
trio para a deteco e diagnose de nematoides, em eletrnico http://plpnemweb.ucdavis.edu/nema-
especial os quarentenrios para o Brasil, se utiliza plex/Taxadata/Nemata.htm.
principalmente a observao de sintomas associa- Quanto s categorias mais elevadas da clas-
dos s caractersticas morfolgicas e morfomtricas sificao, que sofreram alteraes nos ltimos anos
do nematoide via microscopia (tica e/ou eletrni- a partir da anlise da menor subunidade do compo-
ca) e/ou associado aos testes moleculares (PCR com nente 16S do DNA ribossomal (SSU 16SrDNA) passou
primers especficos, LAMP PCR, multiplex PCR, PCR- a inserir os nematoides dentro do Domnio Eukarya,
-RAPD, PCR-RFLP, Real Time PCR, SCAR-PCR, Sequen- Superreino Opisthokonta, Reino Animalia, Subreino

72 RAPP - Volume 24, 2016


Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)

Metazoa, Ramo Bilateralia, Subramo Protostomia, media/files/publication/en/2016/02/2013-0033A_


Superfilo Ecdysozoa,Filo Nematoda que se subdi- Draft_Annex_to_ISPM_27__Anguina_spp._4.doc.
vide em Classes, Subclasses, Ordens, Subordens, Distribuio geogrfica: frica do Sul, Alema-
Superfamlia, Famlia, Subfamlia, Gneros e diver- nha, Austrlia, Canad, China, Eslovquia, Estnia,
sas espcies, conforme exemplificado no endereo Estados Unidos, Finlndia, Gergia, Holanda, Norue-
eletrnico http://plpnemweb.ucdavis.edu/nema- ga, Nova Zelndia, Polnia, Quirguisto, Reino Uni-
plex/Taxadata/Classes.htm#Molecular_Phylogeny_ do, Repblica Tcheca, Rssia, Sucia, Ucrnia.
Menu. Informaes relativas s sequncias gen- Hospedeiros: Agrostis canina, A. capillaris, A.
micas ou de genes mitocondriais de nematoides castellana, A. exarata, A. gigantea, A. polymorpha,
quarentenrios para o Brasil esto disponveis no Q- A. stolonifera, A. sylvatica, A. tenuis, Apera sp., Arc-
-bank Nematodes database (http://www.q-bank.eu/ tagrostis latifolia, Bromus erecta, Buchloe dactyloi-
Nematodes/) e NCBI - National Center for Biotech- des, Calamagrostis canadensis, Dactylis sp., Eragros-
nology Information (http://www.ncbi.nlm.nih.gov/). tis sp., Festuca sp., Hordeum sp., Koeleria glauca, K.
gracilis, K. macrantha, K. talievi, Leymus chinensis,
Nematoides quarentenrios para o Brasil Lolium multiflorum, Lolium rigidum, Phalaris arundi-
Na Tabela 1 est indicada a posio taxonmi- nacea, Phleum sp., Poa sp. Puccinellia sp., Sporobo-
ca dos gneros de nematoides quarentenrios para o lus brockmanii, Trisetum sp..
Brasil, de acordo com o sistema de classificao que Deteco: Teste de triturao, peneiramento
adota dados morfolgicos, morfomtricos e molecu- e flutuao (OEPP/EPPO, 2013); Teste de PCR e Se-
lares (http://plpnemweb.ucdavis.edu/nemaplex/Ta- quenciamento (Subbotin etal., 2004); Teste de PCR-
xadata/Classes.htm#Molecular_Phylogeny_Menu). -RFLP (Powers etal., 2001); Teste de Real Time PCR
Os nematoides quarentenrios para o Brasil (Ma etal., 2011; Li etal., 2015). Conforme o DOC
podem ser transmitidos por sementes ou gros, ele- SAC/CGAL n 06 Escopo da rea de Diagnstico Fi-
mentos de propagao vegetativa (bulbos, estacas, tossanitrio - Rev. 02 - 10.12.2015, e baseado no ato
mudas, tubrculos, rizomas), plantas, solo, substra- legal que demanda o ensaio relativo s IN 06/2005,
to, fardos e embalagens de madeira, inseto-vetor, IN 52/2007, IN 41/2008, IN 27/2011, IN 59/2013,
dependendo do gnero, conforme descrito nas infor- obrigatria a anlise para A. agrostis em importao
maes de cada um dos nematoides quarentenrios. de gros ou sementes de Lolium multiflorum.

Segue, abaixo, informaes das espcies de Anguina pacificae Vera & Maggenti, 1984
nematoides quarentenrios para o Brasil relaciona- Aspectos Gerais e Identificao Taxonmi-
dos aos gneros citados na Tabela 1. ca: Trata-se de um ectoparasita migratrio, sen-
do o J2 a fase infectante. Informaes gerais esto
Anguina agrostis (Steinbuch, 1799) Filipjev, 1936 disponveis nas publicaes de Vera & Maggenti
Aspectos Gerais e Identificao Taxonmica: (1984), Cares et al. (2008) e no endereo eletrni-
Trata-se de um ectoparasita migratrio tendo como co https://www.ippc.int/static/media/files/publi-
fase infectante o segundo estdio juvenil (J2). Infor- cation/en/2016/02/2013-0033A_Draft_Annex_to_
maes gerais esto disponveis nas publicaes de ISPM_27__Anguina_spp._4.doc e http://nematode.
Krall (1991), Brzeski (1998), Cares et al. (2008) e nos unl.edu/anguipac.htm.
endereos eletrnicos https://www.ippc.int/static/ Chave para a identificao de espcies de
media/files/publication/en/2016/02/2013-0033A_ Anguina associadas s informaes morfolgicas e
Draft_Annex_to_ISPM_27__Anguina_spp._4.doc, morfomtricas que permitem a identificao de An-
http://nematode.unl.edu/aagrost.htm. guina pacificae: Disponveis na publicao de Vera &
Chave para a identificao de espcies de Maggenti (1984), Cares et al. (2008) e no endereo
Anguina associadas s informaes morfolgicas eletrnico https://www.ippc.int/static/media/files/
e morfomtricas que permitem a identificao de publication/en/2016/02/2013-0033A_Draft_Annex_
Anguina agrostis: Disponveis nas publicaes de to_ISPM_27__Anguina_spp._4.doc.
Krall (1991), Brzeski (1998), Cares et al. (2008) e no Distribuio geogrfica: Estados Unidos, Ir-
endereo eletrnico https://www.ippc.int/static/ landa.

RAPP - Volume 24, 2016 73


74
Tabela 1. Posio taxonmica dos gneros de nematoides quarentenrios para o Brasil, de acordo com o sistema de classificao que adota dados morfolgicos, mor-
fomtricos e moleculares a partir do Filo Nematoda*.
Filo Classe Sub classe Ordem Sub ordem Super familia Familia Sub familia Gnero
Chromadorea Chromadoria Tylenchina Aphelenchoidea Aphelenchoididae Bursaphelenchinae Bursaphelenchus
Tylenchina Sphaerularioidea Anguinidae Anguininae Anguina
Tylenchina Sphaerularioidea Anguinidae Anguininae Ditylenchus
Tylenchina Sphaerularioidea Anguinidae Anguininae Subanguina
Tylenchina Criconematoidea Criconematidae Criconematinae Criconema
Tylenchoidea Belonolaimidae Belonolaiminae Belonolaimus
Rhabditida Tylenchoidea Heteroderidae Heteroderinae Globodera
Nematoda
Tylenchoidea Heteroderidae Heteroderinae Heterodera
Tylenchoidea Heteroderidae Meloidogyninae Meloidogyne
Tylenchoidea Pratylenchidae Nacobbinae Nacobbus
Tylenchoidea Pratylenchidae Pratylenchinae Pratylenchus
Tylenchoidea Heteroderidae Punctoderinae Punctodera
Tylenchoidea Pratylenchidae Pratylenchinae Radopholus

RAPP - Volume 24, 2016


Tylenchoidea Hoplolaimidae Rotylenchulinae Rotylenchulus
Enoplea Dorylaimia Dorylaimida Dorylaimina Dorylaimoidea Longidoridae Xiphinematinae Xiphinema
*Adaptado de http://plpnemweb.ucdavis.edu/nemaplex/Taxadata/Classes.htm#Molecular_Phylogeny_Menu
Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)
Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)

Hospedeiros: Agrostis canina, Paspalum va- -RFLP (Powers etal., 2001); Teste de Real Time PCR
ginatum, Poa annua. (Ma etal., 2011; Li etal., 2015). Conforme o DOC
Deteco: Teste de triturao, peneiramento SAC/CGAL n 06 Escopo da rea de Diagnstico Fi-
e flutuao (OEPP/EPPO, 2013); Teste de PCR e Se- tossanitrio - Rev. 02 - 10.12.2015, e baseado no ato
quenciamento (Subbotin etal., 2004); Teste de PCR- legal que demanda o ensaio relativo s IN 12/2000,
-RFLP (Powers etal., 2001); Teste de Real Time PCR IN 04/2001, IN 42/2003, IN 6/2005, IN 44/2005, IN
(Ma etal., 2011; Li etal., 2015). Conforme o DOC 52/2007, IN 41/2008, IN 59/2013, obrigatria a
SAC/CGAL n 06 Escopo da rea de Diagnstico Fi- anlise para A. tritici em importao de gros ou se-
tossanitrio - Rev. 02 - 10.12.2015, e baseado no ato mentes de Avena sativa, Triticum aestivum, Triticum
legal que demanda o ensaio relativo s IN 04/2007, spp..
IN 52/2007, IN 41/2008, IN 59/2013, obrigatria a
anlise para A. pacificae em importao de mudas Belonolaimus longicaudatus Rau, 1958
de Paspalum vaginatum. Aspectos Gerais e Identificao Taxonmica:
Trata-se de um ectoparasita migratrio, sendo o J2 a
Anguina tritici (Steinbuch, 1799) Chitwood, 1935 fase infectante. Informaes gerais esto disponveis
Aspectos Gerais e Identificao Taxonmi- na publicao de Rau (1958) e no endereo eletrni-
ca: Trata-se de um ectoparasita migratrio, sen- co http://entnemdept.ufl.edu/creatures/nematode/
do o J2 a fase infectante. Informaes gerais esto sting_nematode.htm.
disponveis nas publicaes de Krall (1991), Brzeski Chave para a identificao de espcies de
(1998), Cares et al. (2008) e no endereo eletrni- Belonolaimus associadas s informaes morfol-
co https://www.ippc.int/static/media/files/publi- gicas e morfomtricas que permitem a identifica-
cation/en/2016/02/2013-0033A_Draft_Annex_to_ o de Belonolaimus longicaudatus: Disponvel na
ISPM_27__Anguina_spp._4.doc e http://nematode. publicao de Vera & Subbotin (2012).
unl.edu/angutrit.htm. Distribuio geogrfica: Arbia Saudita, Cos-
Chave para a identificao de espcies de ta Rica, Estados Unidos, Mxico, Paquisto, Porto
Anguina associadas s informaes morfolgicas Rico, Turquia.
e morfomtricas que permitem a identificao de Hospedeiros: Acer rubrum, Aeschynome-
Anguina tritici: Disponveis nas publicaes de Krall ne americana, Alysicarpus ovalifolius, A. vaginalis,
(1991), Brzeski (1998), Cares et al. (2008) e no ende- Apium graveolens, Arachis hypogaea, Brassica olera-
reo eletrnico https://www.ippc.int/static/media/ cea var. capitata, Brassica rapa, Capsicum annuum,
files/publication/en/2016/02/2013-0033A_Draft_ Capsicum frutescens, Chrysanthemum morifolium,
Annex_to_ISPM_27__Anguina_spp._4.doc. Chrysanthemum spp.,Citrus spp., Cornus florida,
Distribuio geogrfica: Afeganisto, Ale- Cucumis melo, Cucurbita maxima, Cucurbita pepo,
manha, Arbia Saudita, Austrlia, ustria, Azerbai- Cynodon dactylon, Cyperus rotundus, Desmodium
jo, Bulgria, China, Crocia, Chipre, Coria, Egito, tortuosum, Eremochloa ophiuroides, Festuca elatior,
Espanha, Estados Unidos, Etipia, Frana, Grcia, Fragaria spp., Gerbera spp.,Glycine hispida, G. max,
Holanda, Hungria, India, Inglaterra, Ir, Iraque, Irlan- Gossypium hirsutum, Ipomoea pes-caprae, Lactuca
da, Israel, Itlia, Iugoslvia, Nova Zelndia, Paquis- sativa, Liquidambar styraciflua, Lolium multiflorum,
to, Polnia, Romnia, Rssia, Sria, Sucia, Sua, L. perenne, Magnolia virginiana, Mentha spicata,
Taiwan, Turquia, Ucrnia. Embora haja um relato de Ocimum basilicum, Panicum ramosum, Paspalum
1959 desse nematoide no Brasil, considera-se que o vaginatum, Pennisetum glaucum, P. purpureum,
mesmo no ocorre no pas (Tenente et al., 2007). Phaseolus vulgaris, Pinus cubensis, Pisum sativum,
Hospedeiros: Avena sativa, Avena sp., Hor- Pittosporum tobira, Platanus occidentalis, Prunus
deum vulgare, Phalaris minor, Secale cereale Triti- persica, Raphanus sativus, Ricinus communis, Sac-
cum aestivum, T. dicoccum, T. durum, T. monococ- charum sp., Sambucus canadensis, Secale cereale,
cum, T. spelta, T. ventricosum, T. vulgare. Solanum lycopersicum, S. melongena, S. tuberosum,
Deteco: Teste de triturao, peneiramento Sorghum bicolor, S. bicolor x S. sudanense, S. vulgare,
e flutuao (OEPP/EPPO, 2013); Teste de PCR e Se- Stenotaphrum secundatum, Tagetes patula, Uniola
quenciamento (Subbotin etal., 2004); Teste de PCR- paniculata, Vaccinium corymbosum, Vaccinium spp.,

RAPP - Volume 24, 2016 75


Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)

Vicia villosa, Vigna unguiculata, Vitis sp., Zea mays, forme o DOC SAC/CGAL n 06 Escopo da rea de
Zoysia matrella. Diagnstico Fitossanitrio - Rev. 02 - 10.12.2015, e
Deteco: Teste de triturao, peneiramento baseado no ato legal que demanda o ensaio relativo
e flutuao (OEPP/EPPO, 2013); Teste de PCR e Se- s IN 05/2005, IN 06/2005, IN 52/2007, IN 41/2008,
quenciamento (Vera & Subbotin, 2012; Kutsuwa et IN 59/2013, obrigatria a anlise para B. mucro-
al., 2015; Kanan et al., 2015); Teste de Real Time PCR natus em importao de embalagens de madeira de
(Kanan et al., 2015). Conforme o DOC SAC/CGAL n todas as espcies vegetais que produzem madeira.
06 Escopo da rea de Diagnstico Fitossanitrio -
Rev. 02 - 10.12.2015, e baseado no ato legal que de- Bursaphelenchus xylophilus (Steiner and Buhrer,
manda o ensaio relativo s IN 25/2001, IN 14/2002, 1934) Nickle, 1970
IN 06/2005, IN 04/2007, IN 52/2007, IN 41/2008, IN Aspectos Gerais e Identificao Taxonmica:
59/2013, obrigatria a anlise para B. longicauda- Trata-se de um endoparasita migratrio transmitido
tus em importao de mudas de Chrysanthemum pelo inseto vetor Monochamus spp., sendo o J4 a fase
spp., Cynodon dactylon, Fragaria ananassa, Gerbe- infectante. Informaes gerais esto disponveis nas
ra jamesonii, Gerbera spp., Paspalum vaginatum, publicaes de Nickle (1970), Auer & Santos (2012),
Vaccinium corymbosum, Vaccinium spp.; plantas de IPPC (2016a) e no endereo eletrnico http://nema-
Gerbera jamesonii, Gerbera spp., Vaccinium corym- tode.unl.edu/bxyloph.htm.
bosum, Vaccinium spp.; sementes de Capsicum an- Chave para a identificao de espcies de
nuum, Capsicum frutescens. Bursaphelenchus associadas s informaes morfo-
lgicas e morfomtricas que permitem a identifica-
Bursaphelenchus mucronatus Mamya & Endo, 1979 o de Bursaphelenchus xylophilus: Disponvel nas
Aspectos Gerais e Identificao Taxonmica: publicaes de Yinet al. (1988), Pereira et al. (2013),
Trata-se de um endoparasita migratrio transmitido Braasch & Schnfeld (2015) e IPPC (2016a).
pelo inseto vetor Monochamus spp., sendo o J4 a fase Distribuio geogrfica: frica do Sul, Cana-
infectante. Informaes gerais esto disponveis na d, China, Coria do Sul, Espanha, Estados Unidos,
publicao de Mamya & Endo (1979) e no endereo Hong Kong, Japo, Mxico, Portugal, Taiwan.
eletrnico http://nematode.unl.edu/pest2.htm. Hospedeiros: As espcies mais suscetveis es-
Chave para a identificao de espcies de to no gnero Pinus, incluindo P. densiflora, P. echina-
Bursaphelenchus associadas s informaes mor- ta, P. elliottii, P. estevesii, P. halepensis, P.koraiensis,
folgicas e morfomtricas que permitem a identi- P. leiophylla, P. luchuensis, P. luchuensis, P. massonia-
ficao de Bursaphelenchus mucronatus: Dispon- na, P. mugo, P. muricata, P. nigra, P. pinaster, P. pnea,
vel nas publicaes de Yinet al. (1988), Pereira et al. P. radiata, P. resinosa, P. silvestres, P. strobus, P. syl-
(2013), Braasch & Schnfeld (2015) e IPPC (2016a). vestris, P. thunbergiana, P. thunbergii. Tambm tm
Distribuio geogrfica: Alemanha, Armnia, sido relatadas espcies dos gneros Abies, Chama-
ustria, Azerbaijo, Belarus, Canad, China, Coria, ecyparis, Cedrus, Larix, Picea e Pseudotsuga como
Cazaquisto, Eslovnia, Espanha, Estnia, Finlndia, hospedeiros.
Frana, Gergia, Grcia, Itlia, Japo, Letnia, Litu- Deteco: Teste de triturao, peneiramen-
nia, Moldova, Noruega, Polnia, Portugal, Rssia, Su- to e flutuao (OEPP/EPPO, 2013); Teste de PCR e
cia, Sua, Ucrnia, Taiwan, Tailndia, Turquia. Sequenciamento (Matsunaga and Togashi, 2004;
Hospedeiros: Larix olgen, L. sibirica, Picea Pereira et al., 2013; IPPC, 2016a); PCR-RFLP (Bur-
spp., Pinus densiflora, P. halepensis, P. nigra, P. pi- germeister etal., 2005; Burgermeister etal., 2009;
naster, P. silvestris, P. thunbergiana, Quercus robur. IPPC, 2016a); Teste de Real Time PCR (Franois etal.,
Deteco: Teste de triturao, peneiramento 2007; IPPC, 2016a); LAMP-PCR (Kikuchi etal., 2009;
e flutuao (OEPP/EPPO, 2013); Teste de PCR e Se- Aikawa et al., 2012; IPPC, 2016a). Conforme o DOC
quenciamento (Matsunaga & Togashi, 2004; Pereira SAC/CGAL n 06 Escopo da rea de Diagnstico Fi-
et al., 2013; IPPC, 2016a); PCR-RFLP (Burgermeister tossanitrio - Rev. 02 - 10.12.2015, e baseado no ato
etal., 2005; Burgermeister etal., 2009; IPPC, 2016a); legal que demanda o ensaio relativo s IN 05/2005,
Teste de Real Time PCR (Ye& Giblin-Davis, 2013; Fili- IN 06/2005, IN 52/2007, IN 41/2008, IN 59/2013,
piak & Hasiw-Jaroszewska, 2016; IPPC, 2016a). Con- obrigatria a anlise para B. xylophilus em importa-

76 RAPP - Volume 24, 2016


Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)

o de embalagens de madeira de todas as espcies 63/2004, obrigatria a anlise para C. mutabile em


vegetais que produzem madeira; de estacas e plan- importao de alporques de Litchi chinensis.
tas de Pinus spp..
Ditylenchus africanus Wendt, Swart, Vrain & Webs-
Criconema mutabile (Taylor) Raski & Luc, 1985 ter, 1995
Aspectos Gerais e Identificao Taxonmica: Aspectos Gerais e Identificao Taxonmica:
Trata-se de um ectoparasita sedentrio, sendo o J2 a Trata-se de um ectoparasita migratrio, sendo o J3 a
fase infectante. Informaes gerais esto disponveis fase infectante. Informaes gerais esto disponveis
nas publicaes de Raski (1952), Edward & Misra nas publicaes de Wendt et al. (1995), IPPC (2015),
(1964), Raski & Luc (1987) e no endereo eletrnico Steenkamp et al. (2016) e no endereo eletrnico
http://keys.lucidcentral.org/keys/nematodes/html/ http://nematode.unl.edu/pest3.htm.
Criconema%20note.htm. Chave para a identificao de espcies de Di-
Chave para a identificao de espcies de tylenchus associadas s informaes morfolgicas
Criconema associadas s informaes morfolgicas e morfomtricas que permitem a identificao de
e morfomtricas que permitem a identificao de D. africanus: Disponveis nas publicaes de Wendt
Criconema mutabile: Disponveis nas publicaes de et al. (1995) e IPPC (2015).
Yeates et al. (1997) e Hunt et al. (2005). Distribuio geogrfica: frica do Sul, Mo-
Distribuio Geogrfica: frica do Sul, Aus- ambique.
trlia, Costa Rica, Estados Unidos, Peru. No Brasil, Hospedeiros: Arachis hypogaea, Chenopo-
segundo Sharma & Loof (1977) e Ferraz (1980), tal dium album, Datura stramonium, Eleusine indica,
espcie ocorre no pas. No entanto, tal informao Glycine max, Gossypium hirsutum, Helianthus an-
merece posterior confirmao visando confirma- nuus, Lupinus albus, Medicago sativa, Nicotiana ta-
o da presena desta espcie no pas, uma vez que bacum, Phaseolus vulgaris, Pisum sativum, Solanum
em 1987 houve a publicao de Raski & Luc. tuberosum, Sorghum bicolor, Tagetes minuta, Triti-
Hospedeiros: Acanthus sp., Acer sp., Aralia cum aestivum, Vigna unguiculata, Xanthium struma-
sp., Arctium lappa, Arrhenatherum sp., Avena sati- rium, Zea mays.
va, Axonopus sp., Baccharis sp., Bambusa sp., Beta Deteco: Teste de triturao, peneiramento
vulgaris, B. vulgaris cicla, Billbergia sp., Bougainvil- e flutuao (OEPP/EPPO, 2013); Teste de PCR e Se-
lea sp., Camellia sp., Citrus sp., Cynodon dactylon, quenciamento (Wendt et al., 1995; IPPC, 2015); Tes-
Dahlia sp., Dichondra sp., Dioscorea sp., Echinochloa te de PCR-RFLP (Wendt et al., 1995; IPPC, 2015); Tes-
sp., Fragaria chiloensis, Gossypium hirsutum, Hor- te de RAPD-PCR (Qiao et al., 2016). Conforme o DOC
deum vulgare, Ilex sp., Ipomoea batatas, Juglans hin- SAC/CGAL n 06 Escopo da rea de Diagnstico Fi-
dsii, Litchi chinensis, Ligustrum sp., Liquidambar sp., tossanitrio - Rev. 02 - 10.12.2015, e baseado no ato
Malus sylvestris, Medicago sativa, Morus sp., Musa legal que demanda o ensaio relativo s IN 06/2005,
sp., Nicotiana sp., Persea americana, Philodendron IN 52/2007, IN 41/2008, IN 59/2013, obrigatria a
sp., Pinus sp., Prunus domestica, P. dulcis, P. persica, anlise para D. africanus em importao de semen-
Pyracantha sp., Pyrus communis, Rhododendron sp., tes de Arachis hypogaea.
Rosa sp., Solanum lycopersicum, Sorghum bicolor,
Syringa sp., Tagetes sp., Trifolium repens, Typha sp., Ditylenchus angustus (Butler, 1913) Filipjev, 1936
Vigna unguiculata var. sesquipedalis, Vitis vinifera, Aspectos Gerais e Identificao Taxonmica:
Yucca sp., Zea mays, Zingiber sp., Zoysia sp. Tambm Trata-se de um ectoparasita migratrio, sendo o J3 a
inclui algumas espcies de Bromeliaceae, Cactaceae fase infectante. Informaes gerais esto disponveis
e de Palmaceae. nas publicaes de Wendt et al. (1995), Das & Bajaj
Deteco: Teste de triturao, peneiramen- (2008), Oliveira et al. (2013) e IPPC (2015).
to e flutuao (OEPP/EPPO, 2013); Teste de PCR e Chave para a identificao de espcies de Di-
Sequenciamento (Cordero et al., 2012). Conforme tylenchus associadas s informaes morfolgicas
o DOC SAC/CGAL n 06 Escopo da rea de Diag- e morfomtricas que permitem a identificao de
nstico Fitossanitrio - Rev. 02 - 10.12.2015, e base- D. angustus: Disponveis nas publicaes de Wendt
ado no ato legal que demanda o ensaio relativo IN et al. (1995), Das & Bajaj (2008) e IPPC (2015).

RAPP - Volume 24, 2016 77


Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)

Distribuio geogrfica: Bangladesh, Filipi- mala, Humulus lupulus, Ipomoea batatas, Iris sp.,
nas, India, Indonsia, Malsia, Myanmar, Tailndia, Liatris spicata callilepis, Lilium spp., Linaria vulga-
Vietn. ris, Lupinus albus, Medicago sativa, Mentha arven-
Hospedeiros: Echinochloa colona, Leersia he- sis, Nicotiana tabacum, Panax ginseng, Pastinaca
xandra, Medicago sativa, Oryza sativa, Sacciolepsis sativa, Phaseolus vulgaris, Pinus ponderosa, Pisum
interrupta. sativum, Plantago major, Raphanus sativus, Rumex
Deteco: Teste de triturao, peneiramento obtusifolius, Sisyrinchium angustifolium, Solanum
e flutuao (OEPP/EPPO, 2013); Teste de PCR e Se- tuberosum, Solidago graminifolia, Sonchus arvensis,
quenciamento (Ibrahim et al., 1994; Wendt et al., S. asper, Sorghum bicolor, Stachys palustris, Syringa
1995; IPPC, 2015); Teste de PCR-RFLP (Ibrahim et vulgaris, Tagetes minuta, Taraxacum officinale, Tigri-
al., 1994; Wendt et al., 1995; IPPC, 2015); Teste de dia pavonia, Tigridia sp., Trifolium hybridum, T. pra-
RAPD-PCR (Qiao et al., 2016). Conforme o DOC SAC/ tense, Tropaeolum polyphyllum, Tulipa australis, T.
CGAL n 06 Escopo da rea de Diagnstico Fitos- fosterana, T. gesneriana,T. hageri, T. linifolia, T. pra-
sanitrio - Rev. 02 - 10.12.2015, e baseado no ato estans, T. pulchella, T. saxatilis, T. tarda, T. violacea,
legal que demanda o ensaio relativo s IN 06/2005, Tussilago farfara, Vicia sativa, Vigna unguiculata,
IN 52/2007, IN 41/2008, IN 59/2013, obrigatria a Xanthium spp., Zantedeschia spp., Zea mays.
anlise para D. angustus em importao de gros e Deteco: Teste de triturao, peneiramento
sementes de Oryza sativa. e flutuao (OEPP/EPPO, 2013); Teste de PCR e Se-
quenciamento (Wendt et al., 1995; IPPC, 2015); Tes-
Ditylenchus destructor Thorne, 1945 te de PCR-RFLP (Wendt et al., 1995; IPPC, 2015); Tes-
Aspectos Gerais e Identificao Taxonmica: te de RAPD-PCR (Qiao et al., 2016). Conforme o DOC
Trata-se de um ectoparasita migratrio, sendo o J3 a SAC/CGAL n 06 Escopo da rea de Diagnstico Fi-
fase infectante. Informaes gerais esto disponveis tossanitrio - Rev. 02 - 10.12.2015, e baseado no ato
nas publicaes de Wendt et al. (1995) e IPPC (2015). legal que demanda o ensaio relativo s IN 04/2001,
Chave para a identificao de espcies de Di- IN 20/2003, IN 06/2005, IN 06/2006, IN 03/2007,
tylenchus associadas s informaes morfolgicas IN 52/2007, IN 41/2008, IN 59/2013, obrigatria
e morfomtricas que permitem a identificao de a anlise para D. destructor em importao de bul-
D. destructor: Disponveis nas publicaes de Wendt bos de Allium sativum, Dahlia spp., Gladiolus spp.,
et al. (1995) e IPPC (2015). Hyacinthus spp., Lilium spp., Tigridia pavonia, Tuli-
Distribuio geogrfica: Albnia, Alemanha, pa fosterana, Tulipa gesneriana, Tulipa spp., Zan-
Arbia Saudita, ustria, Azerbaijo, Blgica, Bulgria, tedeschia aethiopica, Zantedeschia spp.; mudas de
Canad, China, Coria, Eslovquia, Estados Unidos, Begonia elatior, B. semperflorens, B. tuberhybrida,
Estnia, Frana, Grcia, Holanda, Hungria, Ir, Japo, Begonia x hiemalis, Chrysanthemum spp., Dahlia
Letnia, Luxemburgo, Mxico, Moldova, Noruega, spp., Fragaria ananassa, Hydrangea acuminata, H.
Paquisto, Polnia, Quirguisto, Reino Unido, Re- altissima, H. anomala, estacas com raiz de Begonia
pblica Tcheca, Romnia, Sucia, Sua, Tajiquisto, elatior, B. semperflorens, B. tuberhybrida, Begonia x
Turquia, Ucrnia, Uzbequisto. hiemalis, Chrysanthemum spp., Dahlia spp.; semen-
Hospedeiros: Allium sativum, Arachis hypo- tes de Allium sativum, Arachis hypogaea, tubrculos
gaea, Allium cepa, Apium graveolens, Babiana nana, de Solanum tuberosum; plantas de Begonia elatior,
Begonia elatior, B. semperflorens, B. tuberhybrida, B. semperflorens, B. tuberhybrida, Begonia x hiema-
Begonia x hiemalis, Bellis perennis, Beta vulgaris, lis; rizoma de Calathea spp..
Calathea spp., Canna indica, Chenopodium album,
Chloris virgata, Chrysanthemum spp., Cimicifuga Ditylenchus dipsaci (Khn, 1857) Filipjev, 1936
racemosa, Colchicum giganteum, C. speciosum, Cro- Aspectos Gerais e Identificao Taxonmica:
cus sp., Cyperus rotundus, Dahlia spp., Datura stra- Trata-se de um ectoparasita migratrio, sendo o J3 a
monium, Daucus carota, Eleusine indica, Gladiolus fase infectante. Informaes gerais esto disponveis
hybridus, G. colvillei, Gladiolus spp., Glycine max, nas publicaes de Wendt et al. (1995) e IPPC (2015).
Gossypium hirsutum, Helianthus annuus, Hyacinthus Chave para a identificao de espcies de Di-
spp., Hydrangea acuminata, H. altssima, H. ano- tylenchus associadas s informaes morfolgicas e

78 RAPP - Volume 24, 2016


Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)

morfomtricas que permitem a identificao de D. Ceratochloa sp.,Chaetochloa sp.,Cheiranthus cheiri,


dipsaci: Disponveis nas publicaes de Wendt et al. C. mutabilis, Chelone glabra, Chenopodium album,
(1995) e IPPC (2015). C. polyspermum, Chionodoxa luciliae, C. sardensis,
Distribuio geogrfica: Albnia, Alemanha, Chrysanthemum spp., Cicer arietinum, Cichorium in-
Arglia, Argentina, Armnia, Austrlia, ustria, Azer- tybus, Cirsium spp., Colchicum spp., Coleus blumei,
baijo, Belarus, Blgica, Bsnia-Herzegovina, Bolvia, Collomia coccinea, C. grandiflora, Consolida orien-
Bulgria, Canad, Cazaquisto, Chile, China, Chipre, talis, Convallaria majalis, Convolvulus arvensis, Co-
Colmbia, Coria, Crocia, Costa Rica, Dinamarca, ronopus squamatus, Crepis spp., Cucumis sativus,
Equador, Eslovquia, Eslovnia, Espanha, Estados Cyclamen persicum,Cynara cardunculus, Cynosurus
Unidos, Estnia, Finlndia, Frana, Gergia, Grcia, cristatus, Dactylis glomerata, Daucus carota, Del-
Haiti, Holanda, Hungria, Ir, Iraque, Israel, Itlia, Ja- phinium trolliifolium, Dianthus spp.,Digitalis spp.,
po, Jordnia, Letnia, Litunia, Macednia, Malta, Digitaria sanguinalis, Dipsacus spp., Disa uniflora,
Marrocos, Mxico, Moldova, Noruega, Nova Zeln- Duchesnea indica, Echinochloa crus-galli, Endymion
dia, Oman, Paquisto, Paraguai, Peru, Polnia, Por- hispanicus, E. non-scriptus, Equisetum arvense, Ere-
tugal, Qunia, Quirguisto, Reino Unido, Repblica chtites praealta, Eremurus stenophyllus X E. olgae,
Domenicana, Repblica Tcheca, Rssia, Srvia & Erigeron annuus, E. canadensis, Erodium cicutarium,
Montenegro, Sria, Sucia, Sua, Tunsia, Turquia, Erysimum allionii, Eucharis sp., Fagopyrum escu-
Ucrnia, Uruguai, Uzbequisto, Venezuela, Yemen. lentum, Festuca spp., Ficus elastica, Fragaria spp.,
No Brasil ocorre somente a raa do alho, que even- Fumaria officinalis, Galanthus hybridus, G. nivalis,
tualmente parasita a cebola (Tenente et al., 2000). Galinsoga parviflora, Galium aparine, G. tricorne,
Hospedeiros: o nmero de plantas hospe- Galtonia candicans, Geranium dissectum, G. molle,
deiras ultrapassa a 450 espcies, incluindo Aethusa Gilia achilleifolia, G. minima, Gladiolus spp., Gerbera
cynapium, Agropyron repens, Agrostemma githa- spp., Glycine hispida, G. max, Gossypium sp., Gyp-
go, Allium spp., Alopecurus geniculatu, Alstroeme- sophila spp., Helenium sp., Helianthus annuus, H.
ria spp., Aster spp., Amaryllis sp., Ambrosia elatior, tuberosus, Helichrysum orientale, Helleborus orien-
Ammi majus, Amsinckia intermdia, Anagallis ar- talis, Hepatica americana, Heuchera spp., Hibiscus
vensis, Anemone coronaria, A. hupehensis, Stearn spp., Hieracium pilosella, Holcus lanatus, H. mollis,
japonica, Angelica archangelica, Anthoxanthum Hordeum vulgare, Hyacinthus spp, Hydrangea ma-
odoratum, Anthriscus sylvestris, Anthyllis vulneraria, crophylla, Hymenocallis calathin, Hyoscyamus niger,
Apera spica-venti, Apium graveolens, Arabidopsis Hypochaeris radicata, Ipomoea batatas, Ipomopsis
thaliana, Arabis alpina, A. aubrietioides, Arenaria rubra, Iris sp., Isatis tinctoria, Juncus bufonius, Kick-
serpyllifolia, Armoracia rusticana, Arnoseris minima, xia spuria, Knautia arvensis, Kniphofia sp., Koeleria
Arrhenatherum elatius, Asparagus setaceus, Aspho- pyramidata, Lactuca canadensis, Lamium spp., La-
deline lutea, Aster squamatus, Atriplex sp., Aubrieta thyrus odoratus, L. sativus,Lavandula angustifolia,
deltoidea, Aucuba japonica, Avena spp., Baccharis Leontodon spp., Lepidium sativum, L. virginicum,
subpingraea, Begonia spp., Beta vulgaris, Bouvar- Leucojum sp., Liatris spicata, Lilium spp., Linaria ca-
dia humboldtii, Brachypodium pinnatum, Brassica nadensis, L. vulgaris, Linum usitatissimum, Lolium
campestris var. pekinensis, Brassica napus, B. nigra, multiflorum, L. perenne, Lupinus angustifolius, L.
Brassica oleracea var. acephala, Brassica oleracea luteus, Lotus corniculatus,Lycopsis arvensis, Lycoris
var. botrytis, B. oleracea var. bullata, Brassica olera- radiata, Lysimachia sp., Manihot esculenta, Medi-
cea var. capitata, Brassica oleracea var. gemmifera, cago spp., Melampyrum arvense, Melilotus Alba,
Brassica oleracea var. gongylodes, Brassica oleracea Mentha arvensis, Mercurialis annua, Mollugo ver-
var. italica, Brassica rapa, Bromus inermis, Calathe- ticillata, Monarda spp., Muscari botryoides, M. ne-
alindbergii, Calceolaria spp.,Callistephus chinensis, glectum, Myosotis spp., Myriophyllum verticillatum,
Camelina sativa, Campanula medium, C. persicifo- Narcissus spp., Nicotiana tabacum,Odontites verna,
lia, Cannabis sativa, Capsella bursa-pastoris, Cap- Oenothera spp., Onobrychis viciifolia, Ornithogalum
sicum annuum, Cardamine pratensis, Cardaria dra- spp., Oxalis sp., Paeonia officinalis, Panicum milia-
ba, Carduus acanthoide, Carex sp., Carlina vulgaris, ceum, Papaver rhoeas, P. somniferum, Pastinaca
Centaurea spp., Cerastium arvense, C. vulgatum, sativa, Penstemon barbatus, Penstemon spp., Pe-

RAPP - Volume 24, 2016 79


Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)

troselinum crispum, Phacelia heterophylla, P. tana- macrophylla, Philodendron spp., Rhododendron sim-
cetifolia, Phaseolus spp., Philodendron spp., Phleum sii; estacas de Begonia elatior, B. semperflorens, B.
pratense, Phlox spp., Physalis pubescens, Pisum sa- tuberhybrida, Begonia x hiemalis, Chrysanthemum
tivum, Plantago spp., Poa spp., Polianthes tuberosa, spp., Coleus blumei, Fardos de Medicago sativa;
Polygonum spp., Potamogeton mucronatus, Poten- plantas de Alstroemeria spp., Begonia semperflo-
tilla anserina, Primula spp., Prunus sp., Puschkinia rens, Chrysanthemum spp., Coleus blumei, Cyclamen
scilloides, Ranunculus spp., Raphanus raphanistrum, persicum, Fragaria ananassa, Gerbera jamesonii,
Raphanus sativus, Rheum rhaponticum, Rhododen- Gerbera spp.; sementes de Allium cepa, Allium sa-
dron simsii, Rosa sp., Rumex sp., Saccharum offici- tivum, Aster spp., Begonia elatior, B. semperflorens,
narum, Saponaria officinalis, Saxifraga cotyledon, B. tuberhybrida, Begonia x hiemalis, Brassica cam-
Schizanthus retusus, S. wisetonensis, Scilla bifolia, S. pestris var. pekinensis, Brassica napus, Brassica ole-
siberica, Scleranthus annuus, Scorzonera tau-saghyz, racea var. acephala, Brassica oleracea var. botrytis,
Secale cereale, Senecio vulgaris, Sherardia arvensis, Brassica oleracea var. capitata, Brassica oleracea var.
Silene noctiflora, S. schafta, Simethis planifolia, Si- gemmifera, Brassica oleracea var. gongylodes, Bras-
napis alba, Solanum spp., Sorghum spp., Spergula sica oleracea var. italica, Calceolaria spp., Campanu-
arvensis, Spinacia oleracea, Sprekelia formosissima, la medium, Capsicum annuum, Cheiranthus cheiri,
Stachys arvensis, S. palustris, Stellaria media, Stern- Gypsophila spp., Helianthus annuus, Heuchera spp.,
bergia lutea, Tagetes patula, Taraxacum spp., Thlas- Lolium multiflorum, Lotus corniculatus, Lysimachia
pi arvense, Tigridia pavonia, Tragopogon porrifolius, congestiflora, Medicago sativa, Monarda spp., Nico-
Trifolium spp., Tripleurospermum maritimum, Triti- tiana tabacum, Ornithogalum spp., Penstemon spp.,
cum aestivum, Tuberaria guttata, Tulipa spp., Urti- Phaseolus vulgaris, Pisum sativum, Primula spp., Ra-
ca urens, Valerianella spp., Veronica spp., Vicia spp., phanus sativus, Sorghum spp., Trifolium alexandri-
Viola spp., Vitis vinifera, Yucca flaccida, Zantedes- num, Trifolium spp., Vicia spp., Zea mays; tubrculos
chia spp., Zea mays. de Solanum tuberosum.
Deteco: Teste de triturao, peneiramen-
to e flutuao (OEPP/EPPO, 2013); Teste de PCR e Globodera pallida (Stone, 1973) Behrens, 1975
Sequenciamento (Wendt et al., 1995; IPPC, 2015); Aspectos Gerais e Identificao Taxonmi-
Teste de PCR-RFLP (Wendt et al., 1995; IPPC, 2015); ca: Trata-se de um endoparasita sedentrio, sen-
Teste de RAPD-PCR (Qiao et al., 2016). Conforme do o J2 a fase infectante. Informaes gerais esto
oDOC SAC/CGAL n 06 Escopo da rea de Diag- disponveis nas publicaes de Stone et al. (1973),
nstico Fitossanitrio - Rev. 02 - 10.12.2015, e base- Behrens (1975), Cotton et al. (2014)e, nos endere-
ado no ato legal que demanda o ensaio relativo s os eletrnicos http://nematode.unl.edu/pest5.htm
Port. 129/1997, IN 04/2001, IN 62/2004, IN 6/2005, e http://plpnemweb.ucdavis.edu/nemaplex/Taxada-
IN 06/2006, IN 52/2007, IN 41/2008, IN 74/2009 ta/G053S1.HTM.
(Mercosul), IN 11/2010, IN 13/2010, IN 05/2011, Chave para a identificao de espcies de
IN 27/2011, IN 05/2013, IN 59/2013, IN 23/2015, Globodera associadas s informaes morfolgicas
obrigatria a anlise para D. dipsaci (no caso de to- e morfomtricas que permitem a identificao cor-
das as raas, exceto as do alho) em importao de reta de G. pallida: Disponveis nas publicaes de
bulbos de Allium sativum, Gladiolus spp., Hyacin- Stone et al. (1973), Behrens (1975), Subbotin et al.
thus spp, Lilium spp., Narcissus spp., Ornithogalum (2010) e Subbotin et al. (2011).
spp., Tulipa fosterana, T. gesneriana, Tulipa spp., Distribuio geogrfica: Alemanha, Arglia,
Zantedeschia aethiopica, Zantedeschia spp.; mudas Argentina, ustria, Blgica, Bolvia, Bulgria, Bsnia-
de Alstroemeria spp., Begonia elatior, B. semperflo- -Herzegovina, Canad, Chile, Colmbia, Costa Rica,
rens, B. tuberhybrida, Begonia x hiemalis, Calceola- Crocia, Chipre, Dinamarca, Equador, Eslovnia, Es-
ria integriflia, Chrysanthemum spp., Coleus blumei, tados Unidos, Espanha, Finlndia, Frana, Grcia,
Cyclamen persicum, Dianthus barbatus, Dianthus Holanda, Hungria, ndia, Ir, Itlia, Luxemburgo,
caryophyllus, Dianthus chinensis, Dianthus purpu- Malta, Nova Zelndia, Noruega, Panam, Paquisto,
rea, Fragaria ananassa, Gerbera jamesonii, Gerbe- Peru, Polnia, Portugal, Reino Unido, Romnia, Su-
ra spp., Gypsophila spp., Hibiscus spp., Hydrangea cia, Sua, Tunsia, Turquia, Venezuela.

80 RAPP - Volume 24, 2016


Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)

Hospedeiros: Datura spp., Solanum acaule, S. nezuela.


americanum, S. aviculare, S. cardiophyllum, S. dulca- Hospedeiros: Atropa belladonna, Chenopo-
mara, S. ehrenbergii, S. gilo, S. indicum, S. lycopersi- dium spp., Cyphomandra betacea, Datura ferox, D.
cum, S. marginatum, S. mauritianum, S. melongena, stramonium, Hyoscyamus niger, Nicotiana acumi-
S. multidissectum, S. muricatum, S. nigrum, S. oplo- nata, Oxalis tuberosa, Physalis philadelphica, Phy-
cense, S. quitoense, S. sarrachoides, S. scabrum, S. sochlaina orientalis, Salpiglossis sinuata, Solanum
spegazzinii, S. triflorum, S. tuberosum, S. vernei. andigenum, S. anomalocalyx, S. antipoviczii, S. ar-
Deteco: Teste de triturao, peneiramento matum, S. ascasabii, S. asperum, S. polyacanthos, S.
e flutuao (OEPP/EPPO, 2013); Teste de PCR e Se- polyadenium, S. pyriforme, S. racemigerum, S. tube-
quenciamento (Skantaret al., 2007; Hockland et al., rosum, Ullucus tuberosus.
2012; Tirchet al., 2016); Teste de PCR-RFLP (Sirca et Deteco: Teste de triturao, peneiramento
al., 2010; Tirchet al., 2016); Teste de Multiplex Real e flutuao (OEPP/EPPO, 2013); Teste de PCR e Se-
Time PCR (Nakhla et al., 2010). Conforme o DOC SAC/ quenciamento (Skantaret al., 2007; Hockland et al.,
CGAL n 06 Escopo da rea de Diagnstico Fitossa- 2012; Tirchet al., 2016); Teste de PCR-RFLP (Tirchet
nitrio - Rev. 02 - 10.12.2015, e baseado no ato legal al., 2016); Teste de Multiplex Real Time PCR (Nakhla
que demanda o ensaio relativo s Port. 129/1997, et al., 2010). Conforme o DOC SAC/CGAL n 06 Es-
IN 20/2003, IN 27/2004, IN 06/2005, IN 52/2007, IN copo da rea de Diagnstico Fitossanitrio - Rev. 02
41/2008, IN 59/2013, obrigatria a anlise para G. - 10.12.2015, e baseado no ato legal que demanda
pallida em importao de mudas de Rosa spp.; plan- o ensaio relativo s Port. 129/1997, IN 20/2003, IN
tas de Fragaria spp., Rosa spp.; tubrculos de Sola- 27/2004, IN 06/2005, IN 06/2006, IN 52/2007, IN
num tuberosum. 41/2008, IN 59/2013, obrigatria a anlise para
G. rostochiensis em importao de bulbos de Lilium
Globodera rostochiensis (Wollenweber, 1923), spp.; mudas de Rosa spp.; plantas de Fragaria spp.,
Skarbilovich, 1959 Prunus cerasus, Rhododendron indicum, Rosa spp.,
Aspectos Gerais e Identificao Taxonmica: Salvia spp.; tubrculos de Solanum tuberosum.
Trata-se de um endoparasita sedentrio, sendo o J2
a fase infectante. Informaes gerais esto dispon- Heterodera avenae Wollenweber, 1924
veis na publicao de Salinas-Castro et al. (2016) e, Aspectos Gerais e Identificao Taxonmica:
nos endereos eletrnicos http://download.ceris. Trata-se de um endoparasita sedentrio, sendo o J2 a
purdue.edu/file/2334 e http://nematode.unl.edu/ fase infectante. Informaes gerais esto disponveis
pest6.htm. na publicao de Handoo (2002) e nos endereos
Chave para a identificao de espcies de eletrnicos http://nematode.unl.edu/hetaven.htm
Globodera associadas s informaes morfolgi- e https://gd.eppo.int/taxon/HETDMA.
cas e morfomtricas que permitem a identificao Chave para a identificao de espcies de
de G. rostochiensis: Disponveis nas publicaes de Heterodera associadas s informaes morfolgi-
Subbotin et al. (2010) e Subbotin et al. (2011). cas e morfomtricas que permitem a identificao
Distribuio geogrfica: frica do Sul, Alb- de H. avenae: Disponveis nas publicaes de Shar-
nia, Alemanha, Arglia, Armnia, ustria, Austrlia, ma (1998), de Subbotin et al. (2010) e no endereo
Belarus, Blgica, Bolvia, Bsnia-Herzegovina, Bul- eletrnicohttp://nematode.unl.edu/heteds.htm.
gria, Canad, Chile, Colmbia, Crocia, Chipre, Di- Distribuio geogrfica: frica do Sul, Ale-
namarca, Equador, Eslovquia, Eslovnia, Espanha, manha, Arbia Saudita, Arglia, Austrlia, Blgica,
Estados Unidos, Estnia, Filipinas, Finlndia, Frana, Bulgria, Canad, China, Dinamarca, Eslovquia, Es-
Grcia, Holanda, Hungria, India, Indonsia, Ir, It- panha, Estados Unidos, Estnia, Frana, Grcia, Ho-
lia, Japo, Letnia, Lbano, Lbia, Liechtenstein, Li- landa, ndia, Ir, Israel, Itlia, Iugoslvia, Japo, Let-
tunia, Luxemburgo, Malta, Mxico, Noruega, Nova nia, Lbia, Malta, Marrocos, Nova Zelndia, Noruega,
Zelndia, Oman, Panam, Paquisto, Peru, Polnia, Paquisto, Peru, Polnia, Portugal, Reino Unido, Re-
Portugal, Qunia, Reino Unido, Repblica Tcheca, pblica Tcheca, Rssia, Sria, Sucia, Sua, Tunsia,
Romnia, Rssia, Serra Leoa, Srvia, Sri Lanka, Su- Turquia, Ucrnia.
cia, Sua, Tajiquisto, Tunsia, Turquia, Ucrnia, Ve- Hospedeiros: Agropyron repens, Agrostis

RAPP - Volume 24, 2016 81


Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)

spp., Alopecurus pratensis., Anisantha spp., Apera sanitrio - Rev. 02 - 10.12.2015, e baseado no ato
spica-venti, Arrhenatherum elatius, Avena spp., Bra- legal que demanda o ensaio relativo s IN 06/2005,
chypodium ponticum, B. sylvaticum, Bromus spp., IN 52/2007, IN 41/2008, IN 59/2013, obrigatria a
Dactylis glomerata, Digitaria sanguinalis, Elymus anlise para H. cajani em importao de sementes
caninus, Festuca spp., Hordeum spp., Triticum aes- de Phaseolus vulgaris, Pisum sativum com partculas
tivum, Koeleria spp., Lolium spp., Phalaris spp., Ph- de solo.
leum pratense, Poa spp., Polypogon monspeliensis,
Secale cereale, Setaria viridis, Sorghum vulgare, Sti- Heterodera ciceri Volvas, Greco & Di Vito, 1985
pa lagascae, Trisetum flavescens, Triticum spp., Vul- Aspectos Gerais e Identificao Taxonmica:
pia ciliata, V. muralis,V. myuro, Zea mays. Trata-se de um endoparasita sedentrio, sendo o J2 a
Deteco: Teste de triturao, peneiramento fase infectante. Informaes gerais esto disponveis
e flutuao (OEPP/EPPO, 2013); Teste de PCR e Se- na publicao de Vovlas et al. (1985) e nos endere-
quenciamento (Yan et al., 2013); Teste de PCR-RFLP os eletrnicos https://www.google.com.br/url?sa=
(Subbotin et al., 1999). Conforme o DOC SAC/CGAL t&rct=j&q=&esrc=s&source=web&cd=3&cad=rja&u
n 06 Escopo da rea de Diagnstico Fitossanitrio act=8&ved=0ahUKEwjx2v6O8uPNAhUIH5AKHWFQ
- Rev. 02 - 10.12.2015, e baseado no ato legal que de- AN4QFgg2MAI&url=http%3A%2F%2Fdownload.ce-
manda o ensaio relativo s IN 06/2005, IN 44/2005, ris.purdue.edu%2Ffile%2F2456&usg=AFQjCNEmzG_
IN 52/2007, IN 41/2008, IN 59/2013, obrigatria a 4KnCtVcNT_bXtsaTNk1Xxhw e https://gd.eppo.int/
anlise para H. avenae em importao de gros de taxon/HETDCI e
Triticum aestivum, Triticum spp.; sementes de Triti- Chave para a identificao de espcies de
cum spp. Heterodera associadas s informaes morfolgi-
cas e morfomtricas que permitem a identificao
Heterodera cajani Koshi, 1967 de H. ciceri: Disponveis nas publicaes de Sharma
Aspectos Gerais e Identificao Taxonmica: (1998), de Subbotin et al. (2010) e no endereo ele-
Trata-se de um endoparasita sedentrio, sendo o J2 trnico http://nematode.unl.edu/heteds.htm.
a fase infectante. Informaes gerais esto dispon- Distribuio geogrfica: Espanha, Itlia, Jor-
veis na publicao de Rao et al. (2011) e nos endere- dnia, Lbano, Sria, Turquia.
os eletrnicos http://download.ceris.purdue.edu/ Hospedeiros: Cicer spp., Dianthus caryo-
file/2455 e https://gd.eppo.int/taxon/HETDCJ. phillus, Lathyrus sativus, Lens culinaris, Lupinus al-
Chave para a identificao de espcies de bus, Medicago rigidula, M. sativa, Phaseolus vulga-
Heterodera associadas s informaes morfolgi- ris, Pisum sativum, Trifolium incarnatum, T. pratense,
cas e morfomtricas que permitem a identificao Vicia faba, V. sativa, Vigna unguiculata.
de H. cajani: Disponveis nas publicaes de Sharma Deteco: Teste de Triturao, peneiramento
(1998), de Subbotin et al. (2010) e no endereo ele- e flutuao (OEPP/EPPO, 2013); Teste de PCR e Se-
trnicohttp://nematode.unl.edu/heteds.htm. quenciamento (Mandani et al., 2004); Teste de PCR-
Distribuio geogrfica: Egito, India, Myan- -RFLP (Mandani et al., 2004). Conforme o DOC SAC/
mar, Paquisto. CGAL n 06 Escopo da rea de Diagnstico Fitos-
Hospedeiros: Cajanus cajan, C. platycarpus, sanitrio - Rev. 02 - 10.12.2015, e baseado no ato
Cicer arietinum, Crotalaria juncea, Cyamopsis tetra- legal que demanda o ensaio relativo s IN 06/2005,
gonolobus, Dolichos spp., Glycine max, Lablab pur- IN 52/2007, IN 41/2008, IN 59/2013, obrigatria a
pureus, Phaseolus vulgaris, Phyllanthus maderaspa- anlise para H. ciceri em importao de mudas ou
tensis, Pisum sativum, Sesamum indicum, Sesbania plantas de Dianthus caryophyllus.
spp., Vicia narbonensis, V. sativa, Vigna aconitifolia,
Vigna mungo, V. radiata, V. unguiculata. Heterodera goettingiana Liebscher, 1892
Deteco: Teste de triturao, peneiramento Aspectos Gerais e Identificao Taxonmica:
e flutuao (OEPP/EPPO, 2013); Teste de PCR e Se- Trata-se de um endoparasita sedentrio, sendo o J2 a
quenciamento (Rao et al., 2011); Teste de Real Time fase infectante. Informaes gerais esto disponveis
PCR (Katsuta et al., 2016). Conforme o DOC SAC/ na publicao de Mulvey et al. (1979) e nos endere-
CGAL n 06 Escopo da rea de Diagnstico Fitos- os eletrnicos http://nematode.unl.edu/hgoettin.

82 RAPP - Volume 24, 2016


Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)

htm e https://gd.eppo.int/taxon/HETDGO. -RFLP (Mandani et al., 2004). Conforme o DOC SAC/


Chave para a identificao de espcies de CGAL n 06 Escopo da rea de Diagnstico Fitos-
Heterodera associadas s informaes morfolgi- sanitrio - Rev. 02 - 10.12.2015, e baseado no ato
cas e morfomtricas que permitem a identificao legal que demanda o ensaio relativo s IN 06/2005,
de H. goettingiana: Disponveis nas publicaes de IN 52/2007, IN 41/2008, IN 59/2013, obrigatria a
Sharma (1998), de Subbotin et al. (2010) e no en- anlise para H. mediterranea em importao de es-
dereo eletrnico http://nematode.unl.edu/heteds. tacas com raiz, mudas ou plantas de Olea europaea.
htm.
Distribuio geogrfica: Alemanha, Arglia, Heterodera oryzae Luc & Berdon-Brizuela, 1961
Blgica, Bulgria, China, Espanha, Estados Unidos, Aspectos Gerais e Identificao Taxonmica:
Frana, Holanda, Israel, Itlia, Japo, Jordnia, Mal- Trata-se de um endoparasita sedentrio, sendo o J2
ta, Polnia, Portugal, Reino Unido, Rssia, Turquia, a fase infectante. Informaes gerais esto dispon-
Ucrnia. veis nas publicaes de Luc & Brizuela (1961), Nobbs
Hospedeiros: Asperula arvensis, Cicer arie- et al. (1992), Rathore & Tiwari (2015) e nos endere-
tinum, Glycine hispida, G. max, Lathyrus spp., Lens os eletrnicos https://gd.eppo.int/taxon/HETDOR e
culinaris, Lupinus spp., Medicago sativa, Pisum spp., http://nematode.unl.edu/pest13.htm.
Vicia spp.. Chave para a identificao de espcies de
Deteco: Teste de triturao, peneiramento Heterodera associadas s informaes morfolgi-
e flutuao (OEPP/EPPO, 2013); Teste de PCR e Se- cas e morfomtricas que permitem a identificao
quenciamento (Mandani et al., 2004); Teste de PCR- de H. oryzae: Disponveis nas publicaes de Sharma
-RFLP (Szalanski et al., 1997; Mandani et al., 2004). (1998), Subbotin et al. (2010) e no endereo eletr-
Conforme o DOC SAC/CGAL n 06 Escopo da rea nico http://nematode.unl.edu/heteds.htm.
de Diagnstico Fitossanitrio - Rev. 02 - 10.12.2015, Distribuio geogrfica: Bangladesh, Costa
e baseado no ato legal que demanda o ensaio re- do Marfim, Ghana, ndia, Ir, Libria, Paquisto, Se-
lativo s IN 06/2005, IN 52/2007, IN 41/2008, IN negal.
59/2013, obrigatria a anlise para H. goettingiana Hospedeiros: Cyperus umbellatus, Musa acu-
em importao de sementes de Glycine max e Pisum minata, Oryza sativa, Pennisetum purpureum, Zea
sativum com partculas de solo. mays.
Deteco: Teste de triturao, peneiramento
Heterodera mediterranea Vovlas, Inserra, Stone, e flutuao (OEPP/EPPO, 2013); Teste de PCR-RFLP
19810 (Subbotin et al., 2000). Conforme o DOC SAC/CGAL
Aspectos Gerais e Identificao Taxonmica: n 06 Escopo da rea de Diagnstico Fitossanitrio
Trata-se de um endoparasita sedentrio, sendo o J2 a - Rev. 02 - 10.12.2015, e baseado no ato legal que de-
fase infectante. Informaes gerais esto disponveis manda o ensaio relativo s IN 06/2005, IN 52/2007,
na publicao de Vovlas et al. (1981) e no endereo IN 41/2008, IN 59/2013, obrigatria a anlise para
eletrnico https://gd.eppo.int/taxon/HETDMD. H. oryzae em importao de sementes com partcu-
Chave para a identificao de espcies de las de solo de Oryza sativa.
Heterodera associadas s informaes morfolgi-
cas e morfomtricas que permitem a identificao Heterodera oryzicola Rao&Jayaprakash, 1978
de H. mediterranea: Disponveis nas publicaes de Aspectos Gerais e Identificao Taxonmica:
Sharma (1998), de Subbotin et al. (2010) e no en- Trata-se de um endoparasita sedentrio, sendo o J2
dereo eletrnico http://nematode.unl.edu/heteds. a fase infectante. Informaes gerais esto dispon-
htm. veis nas publicaes de Rao & Jayaprakash (1978),
Distribuio geogrfica: Espanha, Itlia. Nobbs et al. (1992) e no endereo eletrnico https://
Hospedeiros: Olea europaea, Pistacia lentis- gd.eppo.int/taxon/HETDOC.
cus, P. vera. Chave para a identificao de espcies de
Deteco: Teste de triturao, peneiramento Heterodera associadas s informaes morfolgi-
e flutuao (OEPP/EPPO, 2013); Teste de PCR e Se- cas e morfomtricas que permitem a identificao
quenciamento (Mandani et al., 2004); Teste de PCR- de H. oryzicola: Disponveis nas publicaes de Shar-

RAPP - Volume 24, 2016 83


Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)

ma (1998), Subbotin et al. (2010) e no endereo ele- tum, Saccharum officinarum.


trnico http://nematode.unl.edu/heteds.htm.
Distribuio geogrfica: ndia. Heterodera schachtii Schmidt, 1871
Gama de Hospedeiros: Brachiaria decum- Aspectos Gerais e Identificao Taxonmica:
bens, Cynodon dactylon, Musa paradisiaca, Oryza Trata-se de um endoparasita sedentrio, sendo o J2 a
sativa. fase infectante. Informaes gerais esto disponveis
Deteco: Teste de triturao, peneiramen- nas publicaes de Fosu-Nyarko et al. (2016) nos en-
to e flutuao (OEPP/EPPO, 2013); Teste de PCR e dereos eletrnicos http://nematode.unl.edu/hets-
Sequenciamento (Subbotin et al., 2001). Conforme chach.htm e https://gd.eppo.int/taxon/HETDSC.
o DOC SAC/CGAL n 06 Escopo da rea de Diag- Chave para a identificao de espcies de
nstico Fitossanitrio - Rev. 02 - 10.12.2015, e base- Heterodera associadas s informaes morfolgi-
ado no ato legal que demanda o ensaio relativo s cas e morfomtricas que permitem a identificao
IN 06/2005, IN 52/2007, IN 41/2008, IN 59/2013, de H. schachtii: Disponveis nas publicaes de Shar-
obrigatria a anlise para H. oryzicola em importa- ma (1998), Subbotin et al. (2010) e no endereo ele-
o de sementes de Oryza sativa com partculas de trnico http://nematode.unl.edu/heteds.htm.
solo. Distribuio geogrfica: frica do Sul, Alb-
nia, Alemanha, Arglia, Austrlia, ustria, Azerbai-
Heterodera sacchari Luc & Merni, 1963 jo, Blgica, Bulgria, Canad, Cazaquisto, Cabo
Aspectos Gerais e Identificao Taxonmica: Verde, Chile, China, Crocia, Dinamarca, Eslovquia,
Trata-se de um endoparasita sedentrio, sendo o J2 a Espanha, Estados Unidos, Estnia, Finlndia, Frana,
fase infectante. Informaes gerais esto disponveis Gmbia, Grcia, Holanda, Hungria, Ir, Iraque, Israel,
nas publicaes de Audebert et al. (2000) nos ende- Itlia, Iuguslvia, Jordnia, Letnia, Lbia, Marrocos,
reos eletrnicos https://gd.eppo.int/taxon/HETDSA Mxico, Moldova, Paquisto, Peru, Polnia, Portugal,
e http://nematode.unl.edu/pest14.htm. Quirquisto, Reino Unido, Repblica Tcheca, Rom-
Chave para a identificao de espcies de nia, Rssia, Senegal, Srvia, Sria, Sua, Tunsia, Tur-
Heterodera associadas s informaes morfolgi- quia, Ucrnia, Uruguai, Nova Zelndia.
cas e morfomtricas que permitem a identificao Hospedeiros: Agrostemma githago, Alliaria
de H. sacchari: Disponveis nas publicaes de Shar- petiolata, Allium sativum, Alyssum argenteum, A.
ma (1998), Subbotin et al. (2010) e no endereo ele- borzaeanum, A. maritimum, A. spinosum, Amaran-
trnico http://nematode.unl.edu/heteds.htm. thus spp., Ammophila arenaria, Ananas comosus,
Distribuio geogrfica: Benin, Burkina Faso, Anchusa officinalis, Anethum graveolens, Apium
Chade, Congo, Costa do Marfim, Gmbia, Ghana, In- graveolen, Arabidopsis thaliana, Arabis alpina, A.
dia, Jamaica, Libria, Nigria, Paquisto, Tailndia, arenosa, A. bellidifolia, A. caucasica, A. hirsuta, A.
Senegal. muralis, A. perfoliata, A. turrita, A. verna, Arachis
Hospedeiros: Oryza sativa e Saccharum offi- hypogea, Armoracia rusticana, Atriplex confertifolia,
cinarum so os hospedeiros principais, outros hos- A. hastata, A. hortensis, A. littoralis, A. patula, A. ro-
pedeiros incluem Axonopus compressus, Brachiaria sea, Aubrieta columnae, Aurinia saxatilis, Barbarea
brizantha, Cynodon dactylon, Echinochloa colona, longirostris, B. verna, B. vulgaris, Berteroa incana,
Eleusine indica, Paspalum conjugatum, Saccharum Beta spp., Beta vulgaris var. conditiva, Biscutella au-
sp., Urochloa brizantha. riculata, B. laevigata, Brassica acephala,B. cernua,
Deteco: Teste de triturao, peneiramento B.juncea, B. napus, B. nigra, B. oleracea, B. oleracea
e flutuao (OEPP/EPPO, 2013); Teste de PCR e Se- var. botrytis, B. oleracea var. capitata, B. oleracea var.
quenciamento (Maafi et al., 2007). Conforme o DOC gemmifera, B. oleracea var. gongyloides, B. oleracea
SAC/CGAL n 06 Escopo da rea de Diagnstico Fi- var. acephala, B. oleracea var. italica, B. oleracea var.
tossanitrio - Rev. 02 - 10.12.2015, e baseado no ato sabauda, B. rapa, B. sinapis, Bunias orientalis, Calepi-
legal que demanda o ensaio relativo s IN 06/2005, na corvini, Camelina sativa, Capsella bursa-pastoris,
IN 52/2007, IN 41/2008, IN 59/2013, obrigatria a Cardamine impatiens, C. pratensis, Cardaria draba,
anlise para H. sacchari em importao de mudas de Chaenorrhinum minus, Cheiranthus spp., Chenopo-
Cynodon dactylon, Oryza sativa, Paspalum conjuga- dium spp., Chorispora tenella, Cicer arietinum, Ci-

84 RAPP - Volume 24, 2016


Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)

chorium intybus, Cochlearia glastifolia, C. officinalis, Heterodera trifolii Goffart, 1932


Consolida orientalis, Crambe abyssinica, Descurainia Aspectos Gerais e Identificao Taxonmica:
sophia, Dianthus spp., Diplotaxis erucoides, D. tenui- Trata-se de um endoparasita sedentrio, sendo o J2 a
folia, Erodium cicutarium, Erysimum spp., Euphor- fase infectante. Informaes gerais esto disponveis
bia peplus, Galeopsis spp., Galium aparine, Glycine nas publicaes de Wouts & Sturhan (1978), Inserra
hispida, Gypsophila acutifolia, G. elegans, Hablitzia et al. (1993) e nos endereos eletrnicos http://plp-
tamnoides, Halimione portulacoides, Helianthus nemweb.ucdavis.edu/nemaplex/Taxadata/G060S8.
annuus, H. tuberosus, Holosteum umbellatum, Hor- HTM e https://gd.eppo.int/taxon/HETDTR.
deum vulgare, Iberis spp., Isatis tinctoria, Lactuca Chave para a identificao de espcies de
sativa, Lamium spp., Lathyrus spp., Lens culinaris, Heterodera associadas s informaes morfolgi-
Lepidium sativum, Linaria vulgaris, Lobularia mar- cas e morfomtricas que permitem a identificao
tima, Lopezia coronata, Lunaria annua, L. redeviva, de H. trifolii: Disponveis nas publicaes de Sharma
Lupinus mutabilis, Lupinus nanus, Lycopsis arvensis, (1998), de Subbotin et al. (2010) e no endereo ele-
Malcolmia martima, Matricaria sp., Medicago lu- trnicohttp://nematode.unl.edu/heteds.htm.
pulina, M. sativa, Mentha arvensis, Moricandia son- Distribuio geogrfica: Austrlia, Canad,
chifolia, Myagrum perfoliatum, Myosotis sylvatica, Costa do Marfim, Cuba, Espanha, Estados Unidos,
Myosurus minimus, Nasturtium microphyllum, N. Frana, Hava, India, Israel, Itlia, Nova Zelndia, Por-
officinale, Neslia paniculata, Papaver rhoeas, Pasti- to Rico, Repblica Dominicana, Guiana.
naca sativa, Peltaria alliacea, Petroselinum crispum, Hospedeiros: Ataca 86 espcies em nove fa-
Phaseolus spp., Phleum pratense, Phytolacca acino- mlias botnicas, incluindo Agrostemma githago,
sa, Pisum sativum, Plantago lanceolata, Polygonum Beta corolliflora, B. lomatogona, B. macrocarpa, B.
spp., Portulaca grandiflora, P. oleracea, Raphanus martima, B. ptula, B. vulgaris, B. vulgaris x procum-
spp., Rapistrum perenne, R. rugosum, Reseda ltea, bens, B. juncea, B. napus, B. oleracea var. sabauda, B.
R. odorata, Rheum rhabarbarum, R. rhaponticum, oleracea var. gongyloides, B. oleracea var. capitata,
Rhynchosinapis erucastrum, Rorippa amphibia, R. B. oleracea var. gemmifera, B. oleracea var. botrytis,
islandica, Rumex spp., Saccharum officinarum, Sa- B. rapa, Cerastium arvense, C. perfoliatum, Chenopo-
ponaria ocymoide, S. officinalis, Senecio vernalis, dium glaucum, Cicer arietinum, C. songaricum, Cucu-
S. vulgaris, Sesbania exaltata, S. macrocarpa,Silene mis sativus, Cucurbita maxima, C. pepo, Desmodium
spp., Sinapis spp., Sisymbrium spp., Solanum lyco- canum, D. uncinatum, Dianthus spp., Galeopsis spp.,
persicum, S. nigrum, S. peruvianum, S. pimpinellifo- Glycine hispida, Gypsophila acutifolia, G. elegans,
lium, S. sarrachoides, S. tuberosum, Sonchus asper, Hebe X andersonii, Isatis tinctoria, Lamium molle,
S. oleraceus, Spinacia glabra, S. oleracea, Stellaria Lathyrus spp., Lens spp., Lespedeza stipulacea, L.
media, Taraxacum officinale, Teesdalia nudicaulis, striata, Lilium spp., Lotus corniculatus, Lupinus spp.,
Tetragonia tetragonioides, Thlaspi arvense, Trifolium Lychnis chalcedonica, L. coronria, L. floscuculi, Me-
spp., Tropaeolum majus, T. peregrinum, U. dioica, U. dicago sativa, M. truncatula, Melandrium rubrum,
uren, Vaccaria pyramidata, Veronica officina, Vicia Melilotus alba, M. officinalis, Phaseolus vulgaris,
benghalensis, V. faba, V. hirsuta, Vigna angularis, V. Pisum sativum, Polygonum persicaria, Raphanus sa-
unguiculata, Viola tricolor, Vitis sp. Zea mays. tivus, Rheum rhabarbarum, R. rhaponticum, Rumex
Deteco: Teste de triturao, peneiramento spp., Saponaria spp., Scleranthus annuus, Sesbania
e flutuao (OEPP/EPPO, 2013); Teste de PCR e Se- grandiflora, S. macrocarpa, Silene spp., Sinapis alba,
quenciamento (Mandani et al., 2004); Teste de PCR- Sinningia speciosa, Solanum lycopersicum, S. peru-
-RFLP (Szalanski et al., 1997; Mandani et al., 2004). vianum, S. pimpinellifolium, S. tuberosum, Spergula
Conforme o DOC SAC/CGAL n 06 Escopo da rea arvensis, Spinacia oleracea, Stellaria media, Trifo-
de Diagnstico Fitossanitrio - Rev. 02 - 10.12.2015, e lium spp., Vaccaria pyramidata, Veronica persica,
baseado no ato legal que demanda o ensaio relativo Vicia spp..
s IN 20/2007, IN 52/2007, IN 41/2008, IN 59/2013, Deteco: Teste de triturao, peneiramen-
obrigatria a anlise para H. schachtiiem importa- to e flutuao (OEPP/EPPO, 2013); Teste de PCR e
o de sementes de Beta vulgaris var. conditiva. Sequenciamento (Amiri et al., 2002); Teste de PCR-
-RFLP (Szalanski et al., 1997; Amiri et al., 2002). Con-

RAPP - Volume 24, 2016 85


Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)

forme o DOC SAC/CGAL n 06 Escopo da rea de Oryza sativa, Triticum aestivum, Triticum spp., Zea
Diagnstico Fitossanitrio - Rev. 02 - 10.12.2015, e mays.
baseado no ato legal que demanda o ensaio relativo
s IN 06/2005, IN 52/2007, IN 41/2008, IN 59/2013, Meloidogyne chitwoodi Golden, OBannon, Santo
obrigatria a anlise para H. trifolii em importao & Finley, 1980
de bulbos de Lilium spp.; mudas com raiz ou plantas Aspectos Gerais e Identificao Taxonmica:
de Dianthus spp. Trata-se de um endoparasita sedentrio, sendo o J2
a fase infectante. Informaes gerais esto dispon-
Heterodera zeae Koshy, Swarup, and Sethi, 1970 veis nas publicaes de Golden et al. (1980), Perry
Aspectos Gerais e Identificao Taxonmica: et al. (2009) e nos endereos eletrnicos http://plp-
Trata-se de um endoparasita sedentrio, sendo o J2 a nemweb.ucdavis.edu/nemaplex/Taxadata/G076S8.
fase infectante. Informaes gerais esto disponveis htm e http://www.inspection.gc.ca/plants/plant-
nas publicaes de Koshyet al. (1970)e, nos ende- -pests-invasive-species/nematodes-other/columbia-
reos eletrnicos http://nematode.unl.edu/pest15. -root-knot-nematode/fact-sheet/eng/13273369998
htm, http://plpnemweb.ucdavis.edu/nemaplex/Ta- 15/1327337651479.
xadata/G060S57.HTM e https://gd.eppo.int/taxon/ Chave para a identificao de espcies de
HETDZE. Meloidogyne associadas s informaes morfol-
Chave para a identificao de espcies de gicas e morfomtricas que permitem a identifica-
Heterodera associadas s informaes morfolgi- o de M. chitwoodi: Disponveis nas publicaes
cas e morfomtricas que permitem a identificao de Perry et al. (2009), Humphreys-Pereira& Elling
de H. zeae: Disponveis nas publicaes de Sharma (2014) e no endereo eletrnico http://nematode.
(1998), de Subbotin et al. (2010) e no endereo ele- unl.edu/melchit.htm.
trnicohttp://nematode.unl.edu/hzeae.htm. Distribuio geogrfica: frica do Sul, Ale-
Distribuio geogrfica: Afeganisto, Egito, manha, Argentina, Blgica, Estados Unidos, Frana,
Estados Unidos, Grcia, India, Paquisto, Portugal, Holanda, Itlia, Mxico, Moambique, Portugal, Tur-
Tailndia. quia.
Gama de Hospedeiros: Agropyron smithii, Hospedeiros: Acer spp., Adiantum sp., Aegi-
Alopecurus pratensis, Avena sativa, Bambusa sp., lops squarrosa, Agropyron spp., Allium cepa, A. moly,
Bouteloua curtipendula, Brachiaria platyphylla, Ca- Apium graveolens, Arrhenatherum elatius, Astraga-
lamagrostis epigeios, Capsicum annuum, Citrus sp., lus spp., Avena sativa, Beta vulgaris, Betula spp.,
Coix lachryma-jobi, Corchorus capsularis, Echino- Borago officinalis, Brassica campestris, B. napus, B.
chloa spp., Festuca elatior, F. rubra, Hordeum vulga- oleracea var. botritys, B. oleracea var. italica, Bromus
re, Leptochloa dubia, Lolium perenne, Muhlenbergia spp., Canavalia ensiformis, Capsella bursa-pastoris,
montana, Oryza sativa, Panicum capillare, Pennise- Capsicum annuum, Cichorium endivia, Cichorium
tum setaceum, Phalaris arundinacea, Phleum pra- intybus, Cirsium arvense, C. vulgare, Clematis sp.,
tense, Phragmites australis, Poa spp., Prunus dulcis, Coronilla varia, Cotoneaster dielsianus, Dactylis glo-
Pyrus communis, Raphanus sativus, Saccharum spp., merata, Dahlia sp., Delphinium sp., Dicentra spp.,
Setaria indica, S. italica, Sorghum bicolor, Solanum Erica cinerea, Fagopyrum spp., Festuca spp., Fra-
lycopersicon, Stipa viridula, Tripsacum dactyloides, garia ananassa, Galinsoga parviflora, Gladiolus sp.,
Triticum aestivum, Zea mays, Zea mexicana. Helianthus annuus, Hordeum spp., Iris sp., Laburnum
Deteco: Teste de triturao, peneiramento anagyroides, Leymus cinereus, Lilium sp., Lonicera
e flutuao (OEPP/EPPO, 2013); Teste de PCR-RFLP spp., Lotus corniculatus, Lupinus albus, Medicago
(Szalanski et al., 1997; Skantar et al., 2012). Con- spp., Melilotus officinalis, Mucuna deeringiana, Nar-
forme o DOC SAC/CGAL n 06 Escopo da rea de cissus sp., Oenothera speciosa, Panicum capillare,
Diagnstico Fitossanitrio - Rev. 02 - 10.12.2015, e Pascopyrum smithii, Paspalum vaginatum, Petroseli-
baseado no ato legal que demanda o ensaio relativo num crispum, Phaseolus vulgaris, Pisum sativum, Po-
s IN 06/2005, IN 52/2007, IN 41/2008, IN 59/2013, tentilla fruticosa, Psathyrostachys spp., Pseudoroeg-
obrigatria a anlise para H. zeae em importao neria spp., Raphanus sativus, Scilla siberica, Secale
de sementes com partculas de solo de Avena sativa, cereale, Senecio vulgaris, Sinapis alba, Solanum spp.,

86 RAPP - Volume 24, 2016


Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)

Sonchus asper, Sorghum bicolor, S. vulgare, Tagetes erythrosepala, O. speciosa, Petroselinum crispum,
spp., Thinopyrum bessarabicum, Triticum spp., Tuli- Phacelia tanacetifolia, Phaseolus vulgaris, Potentilla
pa spp., Valeriana officinalis, Vitis spp., Zea mays. fruticosa, Prunus avium, Raphanus sativus, Scilla si-
Deteco: Teste de triturao, peneiramento berica, Scorzonera hispanica, Secale cereale, Sinapis
e flutuao (OEPP/EPPO, 2013); Teste de PCR e Se- alba, Solanum spp., Solanum tuberosum, Tagetes
quenciamento (Petersen &Vrain, 1996; Wishart et spp., Triticum spp., Tulipa sp., Zea mays.
al., 2002; Adam et al., 2007); Teste de Multiplex Real Deteco: Teste de triturao, peneiramento
Time PCR (Zijlstra & Van Hoof, 2006); Teste de SCAR- e flutuao (OEPP/EPPO, 2013); Teste de PCR e Se-
-PCR (Adam et al., 2007). Conforme o DOC SAC/CGAL quenciamento (Petersen &Vrain, 1996; Wishart et
n 06 Escopo da rea de Diagnstico Fitossanitrio al., 2002; Adam et al., 2007); Teste de Multiplex Real
- Rev. 02 - 10.12.2015, e baseado no ato legal que de- Time PCR (Zijlstra & Van Hoof, 2006); Teste de SCAR-
manda o ensaio relativo s IN 18/2004, IN 06/2005, -PCR (Adam et al., 2007). Conforme o DOC SAC/CGAL
IN 06/2006, IN 04/2007, IN 52/2007, IN 41/2008, IN n 06 Escopo da rea de Diagnstico Fitossanitrio
59/2013, obrigatria a anlise para M. chitwoodi - Rev. 02 - 10.12.2015, e baseado no ato legal que de-
em importao de estacas com raiz de Vitis vinifera; manda o ensaio relativo s IN 06/2005, IN 52/2007,
mudas de Dahlia spp., Paspalum vaginatum, Vitis vi- IN 41/2008, IN 59/2013, obrigatria a anlise para
nifera; tubrculos de Solanum tuberosum. M. fallax em importao de mudas ou plantas de Fra-
garia ananassa; de substrato e meio de crescimento
Meloidogyne fallax Karssen, 1996 que acompanham plantas; de tubrculos de Sola-
Aspectos Gerais e Identificao Taxonmica: num tuberosum.
Trata-se de um endoparasita sedentrio, sendo o J2
a fase infectante. Informaes gerais esto dispon- Nacobbus aberrans (Thorne, 1935) Thorne & Allen,
veis nas publicaes de Karssen (1996), de Perry et 1944
al. (2009), nos endereos eletrnicos http://nema- Aspectos Gerais e Identificao Taxonmica:
tode.unl.edu/pest39.htm e http://download.ceris. Trata-se de um endoparasita sedentrio, sendo o J2 a
purdue.edu/file/2284. fase infectante. Informaes gerais esto disponveis
Chave para a identificao de espcies de nas publicaes de Stone & Burrows (1985), Souza
Meloidogyne (endoparasita sedentrio) associadas (2001), Harveson (2014) e nos endereos eletrnicos
s informaes morfolgicas e morfomtricas que http://nematode.unl.edu/naberrans.htm e https://
permitem a identificao de M. fallax: Disponveis gd.eppo.int/taxon/NACOBA.
na publicao de Perry et al. (2009) e no endereo Chave para a identificao de espcies de
eletrnico http://nematode.unl.edu/melfallax.htm Nacobbus associadas s informaes morfolgicas
Distribuio geogrfica: Alemanha, Austrlia, e morfomtricas que permitem a identificao de
Blgica, Frana, Holanda, Nova Zelndia, Reino Uni- N. aberrans: Disponveis nas publicaes de Man-
do, Sua. zanilla-Lpezet al. (2002), de Laxet al. (2006) e no
Hospedeiros: Acer palmatum, Aconitum na- endereo eletrnico http://nematode.unl.edu/na-
pellus, Adiantum sp., Allium moly, Apium graveolens, cobbsp.htm.
Asparagus officinalis, Astilbe sp., Avena ludoviciana, Distribuio geogrfica: Argentina, Bolvia,
Beta vulgaris, Betula pendula, Borago officinalis, Chile, Equador, Estados Unidos, Mxico, Peru, Reino
Capsicum annuum, Caragana arborescens, Chiono- Unido, Rssia.
doxa luciliae, Cichorium endivia, Cichorium intybus, Hospedeiros: Atriplex confertifolia, Beta vul-
Clematis sp., Convallaria majalis, Cornus sanguinea, garis, Brassica napus, B. nigra, B. oleracea acephala,
Crocus sp., Dahlia sp., Daucus carota, Delphinium B. oleracea var. gemmifera, B. oleracea var. botrytis,
sp., Dicentra spp., Fagopyrum sp., Foeniculum vulga- B. oleracea var. capitata, B. oleracea var. gongyloides,
re, Fragaria ananassa, Galanthus nivalis, Gladiolus B. rapa, Capsicum, Chenopodium album, Coryphan-
sp., Hemerocallis sp., Hordeum vulgare, Hyacinthus tha vivpara, Cucumis sativus, Cucurbita pepo, Dau-
sp., Iris sp., Laburnum anagyroides, Lilium sp., Lo- cus carota, Gaillardia pulchella, Kochia scoparia,
lium multiflorum, Lonicera xylosteum, Medicago sa- Lactuca sativa, Matthiola sp., Opuntia fragilis, O.
tiva, Muscari armeniacum, Narcissus sp., Oenothera macorrhiza, Pisum sativum, Raphanus sativus, Sal-

RAPP - Volume 24, 2016 87


Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)

sola kali, Spinacia oleracea, Solanum esculentum, Pratylenchus crenatus Loof, 1960
S. melongena, S. peruvianum, S. pimpinellifolium, S. Aspectos Gerais e Identificao Taxonmica:
sparsipilum, S. tuberosum, Stellaria media, Tragopo- Trata-se de um endoparasita migratrio, sendo o J2 a
gon porrifolius, Tribulus terrestres. fase infectante. Informaes gerais esto disponveis
Deteco: Teste de triturao, peneiramento nas publicaes de Castillo& Vovlas (2007), Kuma-
e flutuao (OEPP/EPPO, 2013); Teste de PCR e Se- ri (2015), Chaaska et al. (2016) e, nos endereos
quenciamento (Anthoine & Mugniry, 2005; Atkin- eletrnicos http://plant-clinic.bpp.oregonstate.edu/
set al., 2005; Vovlaset al., 2007; Lax et al., 2014); nematodes-pratylenchus e http://nematode.unl.
Teste de PCR-RFLP (Vovlaset al., 2007). Conforme o edu/pcrenat.htm.
DOC SAC/CGAL n 06 Escopo da rea de Diagns- Chave para a identificao de espcies de
tico Fitossanitrio - Rev. 02 - 10.12.2015, e baseado Pratylenchus associadas s informaes morfolgi-
no ato legal que demanda o ensaio relativo s Port. cas e morfomtricas que permitem a identificao
129/1997, IN 74/2003, IN 18/2004, IN 27/2004, IN de P. crenatus: Disponveis nas publicaes de Cas-
06/2005, IN 06/2006, IN 52/2007, IN 41/2008, IN tillo& Vovlas (2007) e Kumari (2015).
59/2013, obrigatria a anlise para N. aberrans em Distribuio geogrfica: Alemanha, Argenti-
importao de raiz de Beta vulgaris; sementes de na, Austrlia, Blgica, Canad, Chile, Chipre, Eslov-
Cucurbita pepo; tubrculos de Solanum tuberosum. nia, Estados Unidos, Estnia, Holanda, Itlia, Japo,
Noruega, Polnia, Repblica Tcheca, Sucia, Ucrnia.
Nacobbus dorsalis Thorne & Allen, 1944 Hospedeiros: Abies sp., Acer sp., Aira caryo-
Aspectos Gerais e Identificao Taxonmica: phyllea, Alnus sp., Anthurium andreanum, Anthu-
Trata-se de um endoparasita sedentrio, sendo o J2 rium scherzerianum, Anthurium spp., Asparagus
a fase infectante. Informaes gerais esto dispon- officinalis, Aster sp., Astilbe spp., Avena sativa, Be-
vis na publicao de Thorne & Allen (1944) e nos gonia elatior, Begonia semperflorens, Begonia tu-
endereos eletrnicos http://plpnemweb.ucdavis. berhybrida, Begonia x hiemalis, Begonia sp., Beta
edu/nemaplex/Taxamnus/G085mnu.htm e https:// vulgaris, Betula sp., Chrysanthemum coccineum, C.
gd.eppo.int/taxon/NACODO/documents. leucanthemum, C. maximum, Cichorium endvia, C.
Chave para a identificao de espcies de intybus, Cimicifuga sp., Convallaria majalis, Corylus
Nacobbus (endoparasita sedentrio) associadas sp., Crataegus sp., Cucumis melo, Cynara scolymus,
s informaes morfolgicas e morfomtricas que Dahlia spp., Daucus carota, Fragaria chiloensis, Fra-
permitem a identificao de N. dorsalis: Disponveis garia spp., Fuchsia spp., Helleborus niger, Hordeum
na publicao de Manzanilla-Lpezet al. (2002) e no distichum, H. vulgare, Humulus lupulus, Hydrangea
endereo eletrnico http://nematode.unl.edu/na- spp., Iris sp., Jasminum sp., Laburnum anagyroi-
cobbsp.htm. des, Lactuca sativa, Lilium spp., Lotus corniculatus,
Distribuio geogrfica: Estados Unidos. Malus sylvestris, Miscanthus giganteus, Musa sp.,
Hospedeiros: Amsinckia sp., Citrullus lanatus, Narcissus sp., Nolana sp., Olea europaea, Panicum
Erodium cicutarium, Hordeum vulgare, Olea europa- virga, Papaver somniferum, Pernettya sp., Petunia
ea, Prunus spp., Salsola kali, Salvia sp., Solanum tu- spp., Phlox sp., Picea sp., Pinus spp., Pisum sativum,
berosum, Zea mays. Poa annua, Polypodiaceae sp., Populus sp., Prunus
Deteco: Teste de triturao, peneiramento armeniaca, P. avium, P. dulcis, P. persica, Pseudotsu-
e flutuao (OEPP/EPPO, 2013); Teste de PCR e Se- ga menziesii, P. communis,Prunus spp., Pyrus com-
quenciamento (Atkinset al., 2005). Conforme o DOC munis, Raphanus raphanistrum, Rhododendron sp.,
SAC/CGAL n 06 Escopo da rea de Diagnstico Fi- Rosa spp., Rubus sp., Scabiosa caucasica, Scorzonera
tossanitrio - Rev. 02 - 10.12.2015, e baseado no ato hispanica, Secale cereale, Sequoia sp., Solanum lyco-
legal que demanda o ensaio relativo s IN 06/2005, persicum, S. tuberosum, Sorbus aucuparia, Spergula
IN 06/2006, IN 52/2007, IN 41/2008, IN 59/2013, arvensis, Stellaria media, Trifolium pratense, T. re-
obrigatria a anlise para N. dorsalis em importao pen, Vaccinium sp., Vicia sp., Vitis vinifera, Wisteria
de mudas de Olea europaea; tubrculos de Solanum sp., Zea mays.
tuberosum. Deteco: Teste de triturao, peneiramento
e flutuao (OEPP/EPPO, 2013); Teste de PCR e Se-

88 RAPP - Volume 24, 2016


Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)

quenciamento (Kumari, 2015); Teste de Multiplex Trifolium sp.,Triticum aestivum, Zea mays.
PCR (Mekete et al., 2011). Conforme o DOC SAC/ Deteco: Teste de triturao, peneiramen-
CGAL n 06 Escopo da rea de Diagnstico Fitos- to e flutuao (OEPP/EPPO, 2013); Teste de PCR e
sanitrio - Rev. 02 - 10.12.2015, e baseado no ato Sequenciamento (Handoo et al., 2001). Conforme
legal que demanda o ensaio relativo s IN 06/2005, o DOC SAC/CGAL n 06 Escopo da rea de Diag-
IN 52/2007, IN 41/2008, IN 59/2013, obrigatria a nstico Fitossanitrio - Rev. 02 - 10.12.2015 e base-
anlise para P. crenatus em importao de estacas ado no ato legal que demanda o ensaio relativo s
com raiz de Fragaria spp., Fuchsia spp., Hydrangea IN 06/2005, IN 52/2007, IN 41/2008, IN 59/2013,
spp., Olea europaea, Petunia spp., Pinus spp., Pru- obrigatria a anlise para P. fallax em importao de
nus spp., Pyrus communis, Rhododendron spp., Rosa estacas com raiz, mudas ou plantas de Chrysanthe-
spp.; mudas de Anthurium andreanum, Anthurium mum spp., Malus domestica, Rosa spp.
scherzerianum, Anthurium spp., Aster spp., Astilbe
spp., Begonia elatior, Begonia semperflorens, Be- Pratylenchus goodeyi Sher & Allen, 1953
gonia tuberhybrida, Begonia x hiemalis, Chrysanthe- Aspectos Gerais e Identificao Taxonmica:
mum coccineum, Chrysanthemum leucanthemum, Trata-se de um endoparasita migratrio, sendo o J2 a
Chrysanthemum maximum, Dahlia spp., Fragaria fase infectante. Informaes gerais esto disponveis
spp., Fuchsia spp., Hydrangea spp., Olea europaea, nas publicaes de Castillo& Vovlas (2007), Zhang et
Petunia spp., Pinus spp., Prunus spp., Pyrus com- al. (2015) e nos endereos eletrnicos http://www.
munis, Rhododendron spp., Rosa spp.; plantas de promusa.org/Pratylenchus+goodeyi e http://plpne-
Anthurium andreanum, Anthurium scherzerianum, mweb.ucdavis.edu/nemaplex/Taxadata/G105s11.
Anthurium spp., Aster spp., Astilbe spp., Begonia HTM.
elatior, Begonia semperflorens, Begonia tuberhybri- Chave para a identificao de espcies de
da, Begonia x hiemalis, Chrysanthemum coccineum, Pratylenchus associadas s informaes morfolgi-
Chrysanthemum leucanthemum, Chrysanthemum cas e morfomtricas que permitem a identificao
maximum, Fragaria spp., Fuchsia spp., Hydrangea de P. goodeyi: Disponveis nas publicaes de Cas-
spp., Olea europaea, Petunia spp., Pinus spp., Pru- tillo& Vovlas (2007), Handoo et al. (2008) e Zhang
nus spp., Pyrus communis, Rhododendron spp., Rosa et al. (2015).
spp.; rizomas de Anthurium andreanum, Anthurium Distribuio geogrfica: Austrlia, Burundi,
scherzerianum, Anthurium spp.; tubrculos de Sola- Camares, China, Egito, Etipia, Espanha, Grcia,
num tuberosum. Portugal, Qunia, Ruanda, Tanznia, Uganda.
Hospedeiros: Ananas comosus, Ensete ven-
Pratylenchus fallax Seinhorst 1968 tricosum, Heliconia sp., Huechera sp., Musa acumi-
Aspectos Gerais e Identificao Taxonmica: nata, Musa ornata, Musa x paradisaca, Phaseolus
Trata-se de um endoparasita migratrio, sendo o J2 vulgaris, Strelitzia sp..
a fase infectante. Informaes gerais esto dispon- Deteco: Teste de triturao, peneiramento
veis na publicao de Castillo& Vovlas (2007) e nos e flutuao (OEPP/EPPO, 2013); Teste de PCR e Se-
endereos eletrnicos http://nematode.unl.edu/ quenciamento (Zhang et al., 2015). Conforme o DOC
pest65.htm e http://nematode.unl.edu/pfallax.htm. SAC/CGAL n 06 Escopo da rea de Diagnstico Fi-
Chave para a identificao de espcies de tossanitrio - Rev. 02 - 10.12.2015, e baseado no ato
Pratylenchus associadas s informaes morfolgi- legal que demanda o ensaio relativo s IN 06/2005,
cas e morfomtricas que permitem a identificao IN 52/2007, IN 41/2008, IN 59/2013, obrigatria
de P. fallax: Disponveis nas publicaes de Handoo a anlise para P. goodeyi em importao de mudas
et al. (2001) e Castillo& Vovlas (2007). com raiz ou rizomas de Heliconia spp., Musa spp..
Distribuio geogrfica: Blgica, Canad, Rei-
no Unido, Frana, Holanda, Itlia, Japo. Pratylenchus scribneri Steiner, 1943
Hospedeiros: Avena sativa, Beta vulgaris, Aspectos Gerais e Identificao Taxonmica:
Brassica napus var. oleifera, Chrysanthemum sp., Trata-se de um endoparasita migratrio, sendo o J2 a
Convallaria majalis, Hordeum vulgare, Malus do- fase infectante. Informaes gerais esto disponveis
mestica, Medicago sativa, Poa pratensis, Rosa sp., nas publicaes de Castillo & Vovlas (2007), Yan et

RAPP - Volume 24, 2016 89


Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)

al. (2016) e no endereo eletrnico http://nemato- a fase infectante. Informaes gerais esto dispo-
de.unl.edu/pscrib.htm. nveis nas publicaes de Castillo & Vovlas (2007),
Chave para a identificao de espcies de Chaaskaet al. (2016) e no endereo eletrnico
Pratylenchus associadas s informaes morfolgi- https://grdc.com.au/Research-and-Development/
cas e morfomtricas que permitem a identificao GRDC-Update-Papers/2016/02/how-long-does-it-
de P. scribneri: Disponveis nas publicaes de Cas- -take-to-reduce-Pratylenchus-thornei-populations-
tillo& Vovlas (2007) e Yan et al. (2016). -in-the-soil.
Distribuio geogrfica: frica do Sul, Ale- Chave para a identificao de espcies de
manha, Argentina, Bulgria, Canad, Chile, Crocia, Pratylenchus associadas s informaes morfolgi-
Egito, Eslovnia, Estados Unidos, Holanda, ndia, Ir, cas e morfomtricas que permitem a identificao
Israel, Itlia, Japo, Jordnia, Oman, Mxico, Sua, de P. thornei: Disponveis nas publicaes de Cas-
Turquia. tillo& Vovlas (2007) e Troccoli et al. (2008).
Hospedeiros: Allium cepa, Amaranthus sp., Distribuio geogrfica: frica do Sul, Ale-
Amaryllis sp., Anthurium sp., Beta vulgaris, Brassi- manha, Arbia Saudita, Arglia, Argentina, Austr-
ca oleracea var. botrytis, Brassica oleracea var. ca- lia, Blgica, Bulgria, Canad, Chile, Coria, Crocia,
pitata, Capsicum frutescens, Carpinus caroliniana, Chipre, Dinamarca, Egito, Eslovquia, Eslovnia, Es-
Celtis laevigata, Chenopodium sp., Chrysanthemum panha, Estados Unidos, Grcia, Holanda, India, In-
morifolium, Cymbidium sp., Cypripedium sp., Dahlia glaterra, Ir, Israel, Itlia, Japo, Jordnia, Lbia, Mar-
sp., Daucus carota, Digitaria sanguinalis, Fragaria rocos, Mxico, Paquisto, Polnia, Portugal, Qunia,
chiloensis, F. ananassa, Glycine max, Hordeum vul- Romnia, Sria, Sudo, Tajiquisto, Turquia, Tunsia,
gare, Malus spp., Medicago sativa, Mentha spicata, Uruguai, Venezuela.
Miscanthus giganteus, Musa sp., Nicotiana taba- Hospedeiros: Aegilops spp., Agropyron spp.,
cum, Ocimum basilicum, Panicum virgatum, Phase- Agrostis sp., Allium cepa, A. sativum, Amaranthus
olus limensis, P. lunatus, P. vulgaris, Prunus persica, palmeri, A. retroflexus, Ammi visnaga, Anethum
Raphanus sativus, Rosa sp., Saccharum officinarum, graveolens, Apium graveolens, Araucaria sp., Ara-
Solanum lycopersicum, Sorghum bicolor, S. vulgare, chis hypogaea, Asparagus officinalis, Avena fatua,
Tribulus terrestris, Trifolium pratense, Triticum aesti- A. sativa, Bassia scoparia, Beta vulgaris, Brassica
vum, Uniola sp., Vitis sp., Zea mays, Zoysia matrella. campestris, B. juncea, B. napus, B. oleracea, Bromus
Deteco: Teste de triturao, peneiramento spp., Camelina sativa, Capsicum frutescens, Cartha-
e flutuao (OEPP/EPPO, 2013); Teste de PCR e Se- mus tinctorius, Carya illinoinensis, Casuarina sp., Ce-
quenciamento (Yan et al., 2016). Conforme a DOC drus deodara, Cedrus sp., Chenopodium album, Cicer
SAC/CGAL n 06 Escopo da rea de Diagnstico arietinum, Cichorium intybus, Citrus sinensis, Conyza
Fitossanitrio - Rev. 02 - 10.12.2015, e baseado no canadensis, Coriandrum sativum, Crotalaria juncea,
ato legal que demanda o ensaio relativo s Port. Cucumis melo,Cupressus sp., Cynara scolymus, Cy-
129/1997, IN 06/2005, IN 06/2006, IN 52/2007, IN nodon dactylon, Dahlia sp., Daucus carota, Dichon-
41/2008, IN 59/2013, obrigatria a anlise para P. dra sp., Digitaria sanguinalis, Dystaenia ibukiensis,
scribneri em importao de bulbos de Amaryllis spp., Elymus spp., Elytrigia spp., Eucalyptus sp., Euphor-
Dahlia spp.; estacas com raiz de Chrysanthemum bia humistrata, Festuca sp., Ficus carica, Foenicu-
spp., Dahlia spp., Fragaria ananassa, Malus spp., lum vulgare, Fragaria ananassa, Fragaria chiloensis,
Prunus persica, Rosa spp., Vitis vinifera; mudas ou Fraxinus sp., Gleditsia sp., Glycine max, Gossypium
plantas de Anthurium andreanum, Anthurium scher- hirsutum, Helianthus annuus, Helichrysum bracte-
zerianum, Anthurium spp., Chrysanthemum spp., atum, Hordeum murinum, H. vulgare, Hydrangea
Dahlia spp., Fragaria ananassa, Malus spp., Prunus sp., Hyoscyamus spp., H. niger, Hypericum sp., Iberis
persica, Rosa spp., Vitis vinifera, rizomas de Anthu- sp., Iris sp., Juglans sp., Juncus sp., Lactuca sativa,
rium spp.; tubrculos de Solanum tuberosum. Lens culinaris, Ligustrum sp., Lilium sp., Linum sp.,
Lippia sp., Lotus purshianus, Lupinus sp., Magnolia
Pratylenchus thornei Sher & Allen, 1953 sp., Malus domestica, M. sylvestris, Malva rotundi-
Aspectos Gerais e Identificao Taxonmica: folia, M. sylvestris, Matricaria chamomilla, Medica-
Trata-se de um endoparasita migratrio, sendo o J2 go spp., Mentha piperita, Mesembryanthemum sp.,

90 RAPP - Volume 24, 2016


Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)

Musa ornata, Olea europaea, Oryza sativa, Panicum cas e morfomtricas que permitem a identificao
virgatum, Pascopyrum smithii, Paspalum dilatatum, de P. chalcoensis: Disponveis nas publicaes de
Pennisetum clandestinum, Peperomia sp., Persea Stone et al. (1976), Mulvey & Golden (1983) e Sub-
americana, Phaseolus spp., Philodendron spp., Pinus botin et al. (2010).
radiata, Pisum sativum, Plantago ovata, Platanus sp., Distribuio geogrfica: Mxico
Poa annua, P. secunda, Prunus armeniaca, P. avium, Gama de Hospedeiros: Zea mays, Zea mexi-
P. cerasifera, P. cerasus, P. domestica, P. dulcis, P. per- cana.
sica, Prunus spp., Pyrus communis, Pseudoroegneria Deteco: Teste de triturao, peneiramento
spicata, Quercus sp., Raphanus sativus, Rosa spp., e flutuao (OEPP/EPPO, 2013), Teste de PCR e Se-
Rubus sp., Rumex sp., Salix sp., Salsola tragus, Scin- quenciamento (Sabo et al., 2002; Gibson et al., 2011;
dapsus sp., Secale cereale, Solanum tuberosum, Sor- De Luca et al., 2013; Doboszet al., 2013). Conforme
ghum bicolor, S. halepense, S. drummondii, Spinacia o DOC SAC/CGAL n 06 Escopo da rea de Diag-
oleracea, Sequoiadendron giganteum, Setaria viri- nstico Fitossanitrio - Rev. 02 - 10.12.2015, e base-
dis, Sinapis alba, Sisymbrium altissimum, Solanum ado no ato legal que demanda o ensaio relativo s
lycopersicum, S. tuberosum, Taraxacum officinale, IN 06/2005, IN 52/2007, IN 41/2008, IN 59/2013, IN
Thuja sp., Trachyspermum ammi, Trifolium repens, 23/2015, obrigatria a anlise para P. chalcoensis
T. resupinatum, T. subterraneum, Trigonella foenum- em importao de sementes com partculas de solo
-graecum, Tripsacum dactyloides, Triticosecale sp., de Zea mays.
Triticum aestivum, T. durum,T. turgidum, T. vulgare,
Typha sp., Ulmus sp., Vicia benghalensis, V. faba, V. Punctodera punctata (Thorne, 1928) Mulvey & Sto-
sativa, V. villosa, Vigna unguiculata, Vitis vinifera, ne, 1976 (syn. Heterodera punctata Thorne, 1928)
Vulpia myuros, Zea mays, Zingiber sp.. Aspectos Gerais e Identificao Taxonmica:
Deteco: Teste de triturao, peneiramento Trata-se de um endoparasita sedentrio, sendo o J2 a
e flutuao (OEPP/EPPO, 2013); Teste de PCR e Se- fase infectante. Informaes gerais esto disponveis
quenciamento (Mokriniet al., 2016); Teste de Real nas publicaes de Sharma (1998), Mulvey & Stone
Time PCR (Yan et al., 2012). Conforme o DOC SAC/ (1976) e nos endereos eletrnicos https://gd.eppo.
CGAL n 06 Escopo da rea de Diagnstico Fitos- int/taxon/HETDPU e http://plpnemweb.ucdavis.
sanitrio - Rev. 02 - 10.12.2015, e baseado no ato edu/nemaplex/Taxadata/G109s1.HTM.
legal que demanda o ensaio relativo s IN 72/2004, Chave para a identificao de espcies de
IN 06/2005, IN 27/2006, IN 03/2007, IN 52/2007, Punctodera associadas s informaes morfolgi-
IN 41/2008, IN 59/2013, IN 23/2015, obrigatria cas e morfomtricas que permitem a identificao
a anlise para P. thornei em importao de estacas de Punctodera punctata: Disponveis nas publica-
com raiz de Rosa spp. Vitis vinifera; mudas ou plan- es de Sharma (1998), Sabo et al. (2002), Subbotin
tas de Helichrysum bracteatum, Hydrangea spp., et al. (2010) e no endereo eletrnico http://nema-
Olea europaea, Philodendron spp., Prunus spp., Rosa tode.unl.edu/heteds.htm.
spp., Vitis vinifera, Fragaria ananassa; sementes de Distribuio geogrfica: Alemanha, Canad,
Arachis hypogaea; tubrculos de Solanum tubero- Estados Unidos, Holanda, Hungria, Inglaterra, Mxi-
sum. co, Polnia, Rssia.
Hospedeiros: Agrostis capillaris, A. stolonife-
Punctodera chalcoensis Stone, Sosa Moss & ra, A. stolonifera var. palustris, Avena sativa, Festuca
Mulvey, 1976 rubra, Hordeum vulgare, Lolium perenne, Poa an-
Aspectos Gerais e Identificao Taxonmica: nua, P. pratensis, Triticum sp., Zea mays.
Trata-se de um endoparasita sedentrio, sendo o J2 a Deteco: Teste de triturao, peneiramento
fase infectante. Informaes gerais esto disponveis e flutuao (OEPP/EPPO, 2013); Teste de PCR e Se-
na publicao de Stone et al. (1976) e nos endereos quenciamento (Sabo et al., 2002). Conforme o DOC
eletrnicos http://nematode.unl.edu/puncds.htm e SAC/CGAL n 06 Escopo da rea de Diagnstico Fi-
http://nematode.unl.edu/pest29.htm. tossanitrio - Rev. 02 - 10.12.2015, e baseado no ato
Chave para a identificao de espcies de legal que demanda o ensaio relativo s IN 06/2005,
Punctodera associadas s informaes morfolgi- IN 52/2007, IN 41/2008, IN 59/2013, obrigatria a

RAPP - Volume 24, 2016 91


Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)

anlise para H. punctata em importao de semen- A. scherzerianum, Anthurium spp., Musa spp., Stre-
tes com partculas de solo de Zea mays. litzia spp..

Radopholus citrophilus Huettel, Dickson and Ka- Rotylenchulus parvus Sher, 1961
plan, 1984 (anteriormente denominado como Ra- Aspectos Gerais e Identificao Taxonmica:
dopholus similis raa citri) Trata-se de um semi-endoparasita sedentrio, sen-
Aspectos Gerais e Identificao Taxonmica: do o J2 a fase infectante. Informaes gerais esto
Trata-se de um endoparasita migratrio, sendo o J2 a disponveis nas publicaes de Robson et al. (1997),
fase infectante. Informaes gerais esto disponveis Van Den Berg et al. (2016) e no endereo eletrnico
nas publicaes de Huettel et al. (1984), Huettel & http://www.plantwise.org/KnowledgeBank/Data-
Yaegashi (1988) e no endereo eletrnico http://ne- sheet.aspx?dsid=47891.
matode.unl.edu/rcitrop.htm. Chave para a identificao de espcies de
Chave para a identificao de espcies de Rotylenchulus associadas s informaes morfol-
Radopholusassociadas s informaes morfolgi- gicas e morfomtricas que permitem a identifica-
cas e morfomtricas que permitem a identificao o de R. parvus: Disponvel na publicao de Rob-
de R. citrophilus: Disponiveis nas publicaes de Ca- son et al. (1997).
res & Andrade (2006), Huettel et al. (1984) e Huettel Distribuio Geogrfica: frica do Sul, Austr-
& Yaegashi (1988). lia, Chipre, Costa do Marfim, Egito, Estados Unidos,
Distribuio geogrfica: Costa do Marfim, Ilhas Virgens, Ilhas Maurcio, ndia, Ir, Malawi, Mo-
Cuba, Estados Unidos, Porto Rico, Repblica Domi- ambique, Paquisto, Qunia, Repblica Dominica-
nicana, Guiana. na, Somlia, Tanznia, Uganda, Zmbia, Zimbabwe.
Hospedeiros: Anthurium spp., Calathea spp., Hospedeiros: Arachis hypogaea, Carica pa-
Citrofortunella microcarpa, Citrus limon, Citrus para- paya, Crotalaria juncea, Cynodon dactylon, Gos-
disi, Citrus sinensis x Poncirus trifoliata, Daucus ca- sypium hirsutum, Hordeum vulgare, Nicotiana
rota, Rotylenchulus parvus, Bougainvillea sp., Carica tabacum, Olea europaea, Pennisetum glaucum, Sac-
papaya, Carissa sp., Crotalaria juncea, Cupressus charum officinarum, Vigna unguiculata, Zea mays.
sp., Cynodon dactylon, Cyperus sp., Fortunella spp., Deteco: Teste de triturao, peneiramen-
Glycine max, Gossypium hirsutum, Hordeum vulga- to e flutuao (OEPP/EPPO, 2013); Teste de PCR e
re, Lactuca sativa, Macadamia sp., Medicago sati- Sequenciamento (Van Den Berg et al., 2016). Con-
va, Musa spp., Nicotiana tabacum, Olea europaea, forme o DOC SAC/CGAL n 06 Escopo da rea de
Pennisetum americanum,Persea americana, Phase- Diagnstico Fitossanitrio - Rev. 02 - 10.12.2015, e
olus vulgaris, Philodendron spp., Pittosporum sp., baseado no ato legal que demanda o ensaio relativo
Poncirus trifoliata, Saccharum officinalis, Saccharum s IN 6/2005, IN 03/2007, IN 52/2007, IN 41/2008,
officinarum, Solanum lycopersicum, S. tuberosum, IN 59/2013, obrigatria a anlise para R. parvus em
Sorghum bicolor, Strelitzia spp., Thymus sp., Vigna importao de estacas com raiz ou mudas de Olea
unguiculata, Zea mays. europaea; sementes de Arachis hypogaea.
Deteco: Teste de triturao, peneiramento
e flutuao (OEPP/EPPO, 2013); Teste de PCR -RFLP Subanguina radicicola (Greeff, 1872) Para-
(Fallas et al., 1996; Elbadri et al., 2002); Teste de monov, 1968
SCAR-PCR (Kaplan et al., 1996). Conforme o DOC Aspectos Gerais e Identificao Taxonmica:
SAC/CGAL n 06 Escopo da rea de Diagnstico Fi- Trata-se de um ectoparasita migratrio, sendo o J2
tossanitrio - Rev. 02 - 10.12.2015, e baseado no ato a fase infectante. Informaes gerais esto dispon-
legal que demanda o ensaio relativo s IN 6/2005, veis nas publicaes de Mitkowski (2007), Singh et
IN 52/2007, IN 41/2008, IN 59/2013, obrigatria a al. (2013) e nos endereos eletrnicos http://plp-
anlise para R. citrophilus em importao de estacas nemweb.ucdavis.edu/Nemaplex/Taxadata/G124S1.
com raiz de Philodendron spp.; mudas ou plantas de HTM e http://nematode.unl.edu/tylench/anguin/
Anthurium andreanum, Anthurium scherzerianum, subangui/subads.htm.
Anthurium spp., Calathea spp., Musa spp., Philoden- Chave para a identificao de espcies de Su-
dron spp., Strelitzia spp.; rizomas de A. andreanum, banguina associadas s informaes morfolgicas

92 RAPP - Volume 24, 2016


Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)

e morfomtricas que permitem a identificao de ca, P. persica, Pyrus communis, Ribes nigrum, Rosa
S. radicicola: Disponveis nas publicaes de Brzeski canina, R. chinensis, R. multiflora, Rubus idaeus, Sac-
(1981), Siddiqi (2000) e Hons (2008). charum officinarum, Sambucus nigra, Solanum lyco-
Distribuio geogrfica: Alemanha, Arbia persicum, Triticum spelta, Vitis sp..
Saudita, Argentina, Bulgria, Canad, China, Equa- Deteco: Teste de triturao, peneiramen-
dor, Estados Unidos, Estnia, Holanda, Inglaterra, to e flutuao (OEPP/EPPO, 2013); Teste de PCR e
India, Nova Zelndia, Noruega, Polnia, Romnia, Sequenciamento (Wang et al., 2002; Mokrini et al.,
Srvia, Ucrnia. 2014); Teste de Real Time PCR (Van Ghelder et al.,
Hospedeiros: Poa annua, P. pratensis, P. tri- 2015). Conforme o DOC SAC/CGAL n 06 Esco-
vialis, Triticum spp.. po da rea de Diagnstico Fitossanitrio - Rev. 02 -
Deteco: Teste de triturao, peneiramento 10.12.2015, e baseado no ato legal que demanda o
e flutuao (OEPP/EPPO, 2013); Teste de PCR e Se- ensaio relativo s IN 6/2005, IN 52/2007, IN 41/2008,
quenciamento (Mitkowski, 2007; Hons, 2008). Con- IN 59/2013, IN 8/2015, IN 23/2015, obrigatria a
forme o DOC SAC/CGAL n 06 Escopo da rea de anlise para X. diversicaudatum em importao de
Diagnstico Fitossanitrio - Rev. 02 - 10.12.2015, e bulbos de Lilium spp.; mudas de Chrysanthemum
baseado no ato legal que demanda o ensaio relativo spp., Fragaria ananassa, Pyrus communis, Rosa spp.,
s IN 6/2005, IN 52/2007, IN 41/2008, IN 59/2013, Vitis vinifera; mudas de raiz nua de Vitis vinifera;
obrigatria a anlise para S. radicicola em importa- plantas de Chrysanthemum spp., Fragaria ananassa,
o de mudas de grama. Pyrus communis, Rosa spp., Vitis vinifera.

Xiphinema diversicaudatum (Micoletzky, 1927) Xiphinema italiae Meyl, 1953


Thorne, 1939 Aspectos Gerais e Identificao Taxonmica:
Aspectos Gerais e Identificao Taxonmica: Trata-se de um ectoparasita migratrio, sendo o J2
Trata-se de um ectoparasita migratrio, sendo o J2 a a fase infectante. Informaes gerais esto dispon-
fase infectante. Informaes gerais esto disponveis veis nas publicaes de Mitkowski (2007), Singh et
nas publicaes de Brown & Topham (1985), Perry & al. (2013) e nos endereos eletrnicos http://plp-
Moens (2013) e no endereo eletrnico http://ent- nemweb.ucdavis.edu/Nemaplex/Taxadata/G124S1.
nemdept.ufl.edu/creatures/nematode/dagger_ne- HTM e http://nematode.unl.edu/pest34.htm.
matode.htm. Chave para a identificao de espcies de Xi-
Chave para a identificao de espcies de phinema (ectoparasita migratrio) associadas s in-
Xiphinema associadas s informaes morfolgicas formaes morfolgicas e morfomtricas que per-
e morfomtricas que permitem a identificao de mitem a identificao de X. italiae: Disponveis nas
X. diversicaudatum: Disponveis nas publicaes de publicaes de Coomans et al. (2001) e Hons (2008).
Coomans et al. (2001), Siddiqi (2000) e Hons (2008). Distribuio geogrfica: frica do Sul, Arg-
Distribuio geogrfica: frica do Sul, Ale- lia, Bulgria, Camares, Chipre, Egito, Espanha, Fran-
manha, ustria, Blgica, Bulgria, Crocia, Dinamar- a, Grcia, Israel, Itlia, Lbia, Nigria, Portugal, Ro-
ca, Eslovquia, Eslovnia, Espanha, Estados Unidos, mnia, Tunsia, Turquia.
Frana, Holanda, India, Itlia, Iuguslvia, Marrocos, Hospedeiros: Cicer arietinum, Citrus auran-
Moldvia, Nova Zelndia, Noruega, Polnia, Portu- tium, Cocos nucifera, Eucaliptus sp., Euphorbia sp.,
gal, Reino Unido, Repblica Tcheca, Rssia, Sucia, Ficus carica, Morus sp., Olea europaea, Opuntia fi-
Sua, Turquia, Ucrnia. cus-indica, Prunus spp., Vitis sp..
Hospedeiro: Abelmoschus esculentus, Apium Deteco: Teste de triturao, peneiramento
graveolens, Arabidopsis thaliana, Arachis hypogaea, e flutuao (OEPP/EPPO, 2013); Teste de PCR e Se-
Chamaecyparis lawsoniana, Chrysanthemum spp., quenciamento (Kumari & Liskov, 2009); Real Time
Citrus sp., Cucumis sativus, Dianthus caryophyllus, PCR (Van Ghelder et al., 2015). Conforme o DOC
Ficus sp., Rosa sp., Fragaria sp., Glycine hispida, Gly- SAC/CGAL n 06 Escopo da rea de Diagnstico Fi-
cine max, Impatiens balsamina, Juniperus commu- tossanitrio - Rev. 02 - 10.12.2015, e baseado no ato
nis, Lilium spp., Lolium perenne, Mercurialis perenni, legal que demanda o ensaio relativo s IN 6/2005, IN
Persea americana, Petunia hybrida, Prunus armenia- 52/2007, IN 41/2008, IN 59/2013, IN 8/2015, obri-

RAPP - Volume 24, 2016 93


Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)

gatria a anlise para X. italiae em importao de biolgico das pragas. Esses trs tipos de incertezas
estacas com raiz, mudas ou plantas de Prunus spp., continuaro a existir independentemente de desen-
Vitis vinifera; mudas de raiz nua de V. vinifera. volvimentos futuros e sempre devem ser considera-
dos quando se objetiva reduzir a incerteza o mximo
Xiphinema rivesi Dalmasso, 1969 possvel em cada um desses grupos para que haja
Aspectos Gerais e Identificao Taxonmica: trocas comerciais seguras, a serem estabelecidas em
Trata-se de um ectoparasita migratrio, sendo o J2 a marcos regulatrios, mantendo-se dessa forma a sa-
fase infectante. Informaes gerais esto disponveis nidade vegetal e, com isso, ganhando mercados para
nas publicaes de Ebsaryet al. (1984), Handooet al. a exportao, alm de reduzir os custos econmicos
(2015), IPPC (2016b) e no endereo eletrnico ht- e sociais da produo nacional.
tps://gd.eppo.int/taxon/XIPHRI. Inerente a todos os problemas e dificuldades
Chave para a identificao de espcies de existentes, responsabilidade de toda a sociedade
Xiphinema associadas s informaes morfolgicas brasileira preservar a sanidade vegetal, seja atravs
e morfomtricas que permitem a identificao de da importao de material vegetal de forma legal,
X.rivesi: Disponveis nas publicaes de Coomans com os devidos trmites, que garantam que o pro-
et al. (2001), Archidona-Yuste et al. (2016) e IPPC duto esteja livre de pragas e fitopatgenos, do in-
(2016b). centivo e desenvolvimento pesquisa de tcnicas
Distribuio geogrfica: Alemanha, Argenti- de diagnose mais rpidas, prticas e sensveis das
na, Australia, Canad, Chile, Egito, Eslovnia, Espa- pragas e fitopatgenos, das garantias legais para que
nha, Estados Unidos, Frana, Ir, Itlia, Paquisto, seja exercida a fiscalizao de forma eficiente e du-
Portugal, Peru, Samoa, Tonga. radoura no pas.
Hospedeiros: Acer negundo, Allium sativum,
Celtis spp., Citrus sp., Cucumis sativus, Eucalyptus Referncias
sp., Fragaria ananassa, Juglans regia, Juniperus sp., Adam MAM, Phillips MS, Blok VC (2007) Molecular
Malus spp., Mangifera indica, Medicago sativa, Po- diagnostic key for identification of single juveniles
pulus sp., Prunus spp., Quercus spp., Rubus idaeus, of seven common and economically important
Rubus spp., Solanum tuberosum, Sorghum bicolor, species of root-knot nematode (Meloidogyne
Vaccinium spp., Vitis vinifera, Zea mays. spp.). Plant Pathology 56(1):190-197.
Deteco: Teste de triturao, peneiramen- Aikawa T, Kikuchi T, Kanzaki N (2012) DNA extrac-
to e flutuao (OEPP/EPPO, 2013); Teste de PCR e tion method for Bursaphelenchus xylophilus from
Sequenciamento (Akinbadeet al., 2014; Archidona- wood chips, lamp primer set for Bursaphelen-
-Yuste et al., 2016). Conforme o DOC SAC/CGAL n chus xylophilus, and detection method for Bursa-
06 Escopo da rea de Diagnstico Fitossanitrio phelenchus xylophilus from wood chips. U.S. Pat-
- Rev. 02 - 10.12.2015, e baseado no ato legal que ent n. 8.318.435.
demanda o ensaio relativo s IN 6/2005, IN 52/2007, Akinbade SA, Mojtahedi H, Guerra L, Eastwell K, Vil-
IN 41/2008, IN 70/2009, IN 05/2011, IN 59/2013, IN lamor DEV, Handoo ZA, Skantar AM (2014) First
8/2015, IN 23/2015, obrigatria a anlise para X. report of Xiphinema rivesi (Nematoda, Longidori-
rivesi em importao de estacas com raiz de Vacci- dae) in Washington State. Plant Disease 98:1018.
nium corymbosum, Vaccinium spp.; mudas de raiz Almeida MTSCM, Decraemer W (2005) Trichodori-
nua de Vitis vinifera; mudas ou plantas de Fragaria dae, famlia de nematoides vetores de vrus. Re-
ananassa, Vaccinium spp.. viso Anual de Patologia de Plantas 13:115-190.
Amiri S, Subbotin SA, Moens M (2002) Identification
Perspectivas futuras of the beet cyst nematode Heterodera schachtii
Segundo Brioso & Pozzer (2013), apesar de by PCR.European Journal of Plant Pathology
contarmos com tcnicas, ferramentas e processos 108:497506.
para identificao de pragas quarentenrias nas tro- Anthoine G, Mugniery D (2005) Variability of the ITS
cas comerciais, estamos sempre lidando com a in- rDNA and identification of Nacobbus aberrans
certeza. Ela pode ser caracterizada pela metodologia (Thorne, 1935) Thorne and Allen, 1944 (Nemato-
do processo, falha humana e o desconhecimento da: Pratylenchidae) by rDNA amplification. Nema-

94 RAPP - Volume 24, 2016


Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)

tology 7:503-516. 22:69-115.


Archidona-Yuste A, Navas-Corts JA, Cantalapie- Brown DJF, MacFarlane SA, Furlanetto C, Oliveira
dra-Navarrete, C, Palomares-Rius JE, Castillo P CMG, Ferraz LCCB (2004) Transmisso de vrus
(2016) Cryptic diversity and species delimitation por nematoides parasitos de plantas. Reviso
in the Xiphinema americanum-group complex Anual de Patologia de Plantas 12:201-242.
(Nematoda: Longidoridae) as inferred from mor- Brown DJF, Topham PB (1985) Morphometric vari-
phometrics and molecular markers. Zoological ability between populations of Xiphinema diver-
Journal of the Linnean Society 176:231265. sicaudaturn (Nematoda: Dorylaimoidea). Revue
Atkins, SD, Manzanilla-Lpez, RH, Franco J, Peteira B, Nmatologie 8:15-26.
Kerry, BR (2005) A molecular diagnostic method Brzeski MW (1981) The genera of Anguinidae (Ne-
for detecting Nacobbus in soil and in potato tu- matoda, Tylenchida). Revue Nmatologie 4:23-
bers. Nematology 7:193202. 34.
Audebert A, Coyne DL, Dingkuhn M, Plowright RA Brzeski MW (1998) Nematodes of Tylenchina in Po-
(2000) The influence of cyst nematodes (Het- land and temperate Europe. Muzeum i Instytut
erodera sacchari) and drought on water relations Zoologii Polska Akademia Nauk, Warsaw, Poland.
and growth of upland rice in Cte dIvoire. Plant 397 pp.
and Soil 220:235-242. Burgermeister W, Braasch H, Metge K, Gu J, Schrder
Auer CG, Santos AF (2012) Patgenos florestais de T, Woldt E (2009) ITS-RFLP analysis, an efficient
importncia quarentenria para o Brasil. Braslia, tool for identification of Bursaphelenchus species.
DF. Embrapa. Nematology 11:649668.
Auger J, Leal G, Magunacelaya JC, Esterio M (2009) Burgermeister W, Metge K, Braasch H, Bu-
Xiphinema rivesi from Chile transmits Tomato chbach E (2005) ITS-RFLP patterns for
ringspot virus to Cucumber. Plant Disease 93:971- differentiation of 26 Bursaphelenchus spe-
971. cies (Nematoda: Parasitaphelenchidae) and
Behrens E (1975) Globodera Skarbilovich, 1959 an in- observations on their distribution. Russian Jour-
dependent genus in the subfamily Heteroderinae nal of Nematology 13:29-42.
Skarbilovich, 1949 (Nematoda: Heteroderidae). CABI (2011) Datasheet. Belonolaimus longicaudatus
Vortragstagungzu Aktuellen Problemen der Phy- (sting nematode). Available at: http://www.cabi.
tonematologie 1:12-26. org/isc/datasheet/8892. Accessed on may 30,
Bekker S (2008) Assessment of the identity, distri- 2016.
bution and control options for seed and leaf-gall CABI (2014) Datasheet for Anguina agrostis. CABI
nematodes in grass in South Africa. Thesis (M.Sc. Crop Protection Compendium. Wallingford, UK.
Zoology)-North-West University. 84p. CABI (2015) Datasheet. Ditylenchus africanus (pe-
Braasch H, Schnfeld U (2015) Improved morpho- anut pod nematode). Available at: http://www.
logical key to the species of theXylophilusgroup cabi.org/isc/datasheet/19284. Accessed on may
of the genus Bursaphelenchus Fuchs, 1937.OEPP/ 30, 2016.
EPPO Bulletin 45:7380. CABI/EPPO (1999) Nacobbus aberrans. Distribution
Brioso PST, Dias JACS (2015) Deteco e diagnose de maps of plant diseases n 779. Wallingford, UK.
fitopatgenos quarentenrios (A1 e A2). In: Veiga CAB International.
RFA, Queirz MA (Org.). Recursos Fitogenticos: a CABI/EPPO (2000) Pratylenchus goodeyi. Distribu-
base da agricultura sustentvel no Brasil. Braslia, tion maps of plant diseases n 806. Wallingford,
DF. pp. 228-240. UK. CAB International.
Brioso PST, Pozzer L (2013) Vrus e virides quaren- CABI/EPPO (2001) Ditylenchus africanus. Distribu-
tenrios para o Brasil - reviso, diagnose e pers- tion maps of plant diseases n 836. Wallingford,
pectivas futuras. Reviso Anual de Patologia de UK. CAB International.
Plantas 21:226-286. CABI/EPPO (2001) Heterodera avenae. Distribution
Brioso PST, Pozzer L (2014) Fitoplasmas quarenten- maps of plant diseases n 823. Wallingford, UK.
rios para o Brasil - reviso, diagnose e perspecti- CAB International.
vas futuras. Reviso Anual de Patologia de Plantas CABI/EPPO (2002) Anguina tritici. Distribution maps

RAPP - Volume 24, 2016 95


Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)

of plant diseases n 848. Wallingford, UK. CAB In- so Anual de Patologia de Plantas 15:69-98.
ternational. CastilloP, Vovlas N (2007) Pratylenchus (Nematoda:
CABI/EPPO (2003) Heterodera ciceri. Distribution Pratylenchidae): Diagnosis, biology, pathogenicity
maps of plant diseases n 895. Wallingford, UK. and management. Nematology Monographs and
CAB International. Perspectives Series 6. Brill.
CABI/EPPO (2003). Belonolaimus longicaudatus. Dis- Chaaska A, abanowski G, Sas D (2016) Root-lesion
tribution maps of plant diseases n 879. Walling- nematodes (Pratylenchus spp.) in ornamental
ford, UK. CAB International. plant nurseries influence of soil texture, acidity,
CABI/EPPO (2004) Anguina agrostis. Distribution salinity and organic matter content. Communica-
maps of plant diseases n 923. Wallingford, UK. tions in Biometry and Crop Science 11:98-104.
CAB International. Charchar JM (1997) Novos enfoques na sistemtica
CABI/EPPO (2004) Xiphinema rivesi Distribution de nematoides. Reviso Anual de Patologia de
maps of plant diseases n 940.Wallingford, UK. Plantas 5:133-155.
CAB International. Charles JSK, Venkitesan TS (1995) Biology of banana
CABI/EPPO (2008) Heterodera oryzae. Distribution population of Heterodera oryzicola (Nemata: Ty-
maps of plant diseases n 1021.Wallingford, UK. lenchina). Fundamental and Applied Nematol-
CAB International. ogy18:493-496.
CABI/EPPO (2009) Bursaphelenchus mucronatus. Chaves EJ, Mondino EA (2013) Description of some
Distribution maps of plant diseases n 1059.Wall- Xiphinema species populations (nematoda) from
ingford, UK. CAB International. Argentina. Nematropica 43:68-77.
CABI/EPPO (2012) Pratylenchus thornei. Distribution Coomans A, Huys R, Heyns J, Luc M (2001) Charac-
maps of plant diseases n 1124. Wallingford, UK. ter analysis, phylogeny and biogeography of the
CAB International. genus Xiphinema Cobb, 1913 (Nematoda: Lon-
CABI/EPPO (2013) Subanguina radicicola. Distribu- gidoridae). Tervuren, Belgium, Muse Royal de
tion maps of plant diseases n 1143. Wallingford, LAfrique Centrale. Annales Sciences Zoologiques
UK. CAB International. 287:1239.
CABI/EPPO (2015) Bursaphelenchus xylophilus. Dis- Cordero MA, Robbins RT, Szalanskial AL (2012) Taxo-
tribution maps of plant diseases n 789.Wallin- nomic and molecular identification of Bakerne-
gford, UK. CAB International. ma, Criconema, Hemicriconemoides, Ogma and
Cares JE, Andrade EP (2006) Taxonomia do gnero Xenocriconemella species (Nematoda: Cricone-
Radopholus. Reviso Anual de Patologia de Plan- matidae). Journal of Nematology 44:427446.
tas 14:113-149. Costa CL (1999) Vetores de vrus de plantas: II. Fun-
Cares JE, Baldwin JG (1995). Nematoides formadores gos, nematoides e caros. Reviso Anual de Pato-
de cistos do gnero Heterodera. Reviso Anual de logia de Plantas 7:213-258.
Patologia de Plantas 3:29-84. Cotton JA, Lilley CJ, Jones LM, Kikuchi T, Reid AJ,
Cares JE, Huang SP (2000) Taxonomia de fitonema- Thorpe P, Tsai IJ, Beasley H, Blok V, Cock PJA, Eves-
toides: chave sistemtica simplificada para gne- -van den Akker S, Holroyd N, Hunt M, Mantelin
ros - Parte I. Reviso Anual de Patologia de Plan- S, Naghra H, Pain A, Palomares-Rius JE, Zarowie-
tas 8:185-223. cki M, Berriman M, Jones JT, Urwin PE (2014) The
Cares JE, Huang SP (2001) Taxonomia de fitonema- genome and life-stage specific transcriptomes of
toides: chave sistemtica simplificada para gne- Globodera pallida elucidate key aspects of plant
ros - Parte II. Reviso Anual de Patologia de Plan- parasitism by a cyst nematode. Genome Biology
tas 9:177-235. 15:R43.
Cares JE, Santos JRP, Tenente RCV (2008) Taxonomia Dahnasso A (1969) Etude anatomique et taxono-
de nematoides de sementes, bulbos e caules: Par- mique tis genres: Xiphinema. Longidorus et
te II. Reviso Anual de Patologia de Plantas 16:39- laralongidorus (Nemata: Dorylaimida). Memoi-
84. res Du Museum dHistoire Naturelle Nonv. Serie
Cares JE, Tenente RCV (2007) Taxonomia de nema- A. Zoologie 61:33-82.
toides de sementes, bulbos e caules: Parte I. Revi- Das D, Bajaj HK (2008) Redescription of Ditylenchus

96 RAPP - Volume 24, 2016


Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)

angustus (Butler, 1913) Filipjev, 1936. Annals of Patologia de Plantas 7:157-195.


Plant Protection Sciences 16:195-197. Ferraz S (1980) Reconhecimento das espcies de fi-
De Luca F, Vovlas N, Lucarelli G, Troccoli A, Radicci V, tonematoides presentes nos solos do estado de
Fanelli E, Cantalapiedra-Navarrete, C, Palomares- Minas Gerais. Experientiae 26:255-328.
Rius JE, Castillo P (2013) Heterodera elachista Filipiak A, Hasiw-Jaroszewska B (2016) The use of
the Japanese cyst nematode parasitizing corn in real-time polymerase chain reaction with high
Northern Italy: Integrative diagnosis and bionom- resolution melting (real-time PCR-HRM) analysis
ics. European Journal of Plant Pathology 136:857- for the detection and discrimination of nema-
872. todes Bursaphelenchus xylophilus and Bursa-
Debanand DAS, Bajaj HK (2008) Redescription of phelenchus mucronatus. Molecular and Cellular
Ditylenchus angustus (Butler, 1913) Filipjev, 1936. Probes 30:113-117.
Annals of Plant Protection Sciences 16:195-197. Fleming TR, Maule, AG, Martin T, Hainon-McDowell
Dobosz R, Winiszewska G, Malewski T, Rybarczyk- M, Entwistle K, McClure MA, Fleming CC (2015) A
Mydowska K, Tereba A, Kowalewska K, Gawlak first report of Anguina pacificae in Ireland. Jour-
M, Bogdanowicz W (2013) Morphological and nal of Nematolology 47: 97-104.
molecular features of Punctoderastonei Brzeski, Fosu-Nyarko J, Nicol P, Naz F, Gill R, Jones MGK
1998 (Nematoda:Heteroderidae) - species asso- (2016) Analysis of the transcriptome of the infec-
ciated with roots of grasses. Annales Zoologici tive stage of the beet cyst nematode, H. schachtii.
63:157-162. PLoS ONE 11: http://dx.doi.org/10.1371/journal.
Ebsary BA, Potter JW, Allen WR (1984) Redescription pone.0147511.
and distribution of Xiphinema rivesi Dalmasso, Franois C, Castagnone C, Boonham N, Tom-
1969 and Xiphinema americanumCobb, 1913 in linson J, Lawson R, Hockland S, QuillJ, Viei-
Canada with a description of Xiphinema occidu- ra P, Mota M, Castagnone-Sereno P (2007)
um n.sp. (Nematoda: Longidoridae). Canadian Satellite DNA as a target for TaqMan
Journal of Zoology 62:1696-1702. real-time PCR detection of the pinewood nema-
Edward JC, Misra SL (1964) Criconemoides magno- tode, Bursaphelenchus xylophilus. Molecular
liaen.sp. andC. juniperin. sp. (Nematoda: Crico- Plant Pathology 8:803-809.
nematidae) from Kumaon region, Uttar Pradesh, Gibson T, Farrugia D, Barrett J, Chitwood DJ, Rowe J,
India.Nematologica 10:95100. Subbotin S, Dowton M (2011) The mitochondrial
Elbadri GAA, De Ley P, Wayenberge L, Vierstraete genome of the soybean cyst nematode, Hetero-
A, Moens M, Vanfleteren J (2002). Intraspecific dera glycines. Genome 54:565-574.
variation in Radopholus similis isolates assessed Golden AM, OBannon JH, Santo GS, Finley AM
with restriction fragment length polymorphism (1980) Description and SEM observations of Me-
and DNA sequencing of the internal transcribed loidogyne chitwoodi n. sp. (Meloidogynidae), a
spacer region of the ribosomal RNA cistron.Inter- root knot nematode on potato in the Pacific Nor-
national Journal for Parasitology32:199205. thwest. Journal of Nematology 12:319-327.
EPPO (2013) Bursaphelenchus xylophilus. Bulletin Handoo ZA (2002) A key and compendium to species
43:105118. of the Heterodera avenae group (Nematoda: He-
EPPO (2013) Nematode extraction. EPPO Bulletin teroderidae). Journal of Nematology 34:250-262.
43:471495. Handoo ZA, Carta LK, Skantar A (2008) Taxonomy,
EPPO (2014) PQR - EPPO database on quarantine morphology and Pphylogenetics of coffee-asso-
pests. Available at: https://www.eppo.int/DATA- ciated root-lesion nematodes, Pratylenchus spp.
BASES/pqr/pqr.htm. Accessed on may 30, 2016. In: Souza RM (Ed.). Plant Parasitic Nematodes of
Fallas GA, Hahn ML, Fargette M, Burrows PR, Sarah JL(1996)Mo- Coffee. Dordrecht: Springer Netherlands. pp 29-
lecular and biochemical diversity among isolates 50.
of Radopholus spp. from different areas of the Handoo ZA, Carta LK, Skantar AM (2001) Morpholo-
world.Journal of Nematology28:422-430. gical and molecular characterisation of Pratylen-
Ferraz LCCB (1999) Gnero Pratylenchus: os nema- chus arlingtoni n. sp., P. convallariae and P. fallax
toides das leses radiculares. Reviso Anual de (Nematoda: Pratylenchidae). Nematology 3:607-

RAPP - Volume 24, 2016 97


Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)

618. Aphelenchoides and of Ditylenchus angustus


Handoo ZA, Ibrahim IKA, Chitwood DJ, Mokbel AA using a fragment of ribosomal DNA. Journal of
(2015) First report of Xiphinema rivesi Dalmasso, Nematology 26:412-421.
1969 on citrus in northern Egypt. Pakistan Journal Inserra RN, Vovlas N, Walker S, Dunn RA (1993) The
of Nematology 33:161-165. clover cyst nematode, Heterodera trifolii, a po-
Harveson RM (2014) The false root-knot nematode: tential pest of clover and vegetable crops in Flori-
A unique plant pathogen native to the Western da. Nematology Circular 204. 4pp
Hemisphere. APS Features. IPPC (2015) ISPM 27 - Diagnostic protocols for regu-
Hockland S, Niere B, Grenier E, Blok V, Phillips M, den lated pests. DP 8: Ditylenchus dipsaci and Ditylen-
Nijs L, Anthoine G, Pickup J, Viaene V (2012) An chus destructor. 34p.
evaluation of the implications of virulence in non- IPPC (2016a) ISPM 27 - Diagnostic protocols for re-
-European populations of Globodera pallida and gulated pests. DP 10: Bursaphelenchus xylophilus.
G. rostochiensis for potato cultivation in Europe. 40p.
Nematology 14:113. IPPC (2016b) ISPM 27 - Diagnostic protocols for regu-
Hons SB (2008) Assessment of the identity, dis- lated pests. DP 11: Xiphinema americanum sensu
tribution and control options for seedand lato. 26p.
leaf-gall nematodes in grass in South Afri- KananK, Dickson DW, Brito JA, Jeyaprakash A, Drew A
ca. Dissertation. Potchefstroom Campus of (2015) Belonolaimus longicaudatus: an emerging
the North-West University. 99pp. pathogen of peanut in Florida. Journal of Nema-
Huettel RN, Yaegashi T (1988) Mor- tology 47:87-96.
phological differences between Kaplan DT, Vanderspool MC, Garrett C, Chang S, Op-
Radopholus citrophilus and R. similis. Journal of perman CH (1996) Molecular polymorphisms as-
Nematology 20:150-157. sociated with host range in the highly conserved
Huettel, RN, Dickson DW, Kaplan DT (1983) Chromo- genomes of burrowing nematodes, Radopholus
some number of populations of Radopholus simi- spp. Molecular Plant Microbe Interactions 9:32-
lis from North, Central and South America, Hawaii 38.
and Indonesia. Revue de Nmatologie 7:113-116. Katsuta A,Toyota K, Min YY, Maung TT (2016) Devel-
Huettel, RN, Dickson DW, Kaplan DT (1984) Radopho- opment of real-time PCR primers for the quanti-
lus citrophilus sp. n. (Nematoda), a sibling species fication ofMeloidogyne graminicola, Hirschman-
of Radopholus similis. Proceedings of the Helmin- niella oryzae and Heteroderacajani, pests of the
thological Society of Washington 51:3235. major crops in Myanmar.Nematology 18:257-263.
Huettel, RN, Dickson DW, Kaplan, DT. (1983) Bioche- Kikuchi T, Aikawa T, Oeda Y, Karim N, Kanzaki N (2009)
mical identification of the two races of Radopho- A rapid and precise diagnostic method for detect-
lus similis by polyacrylamide gel electrophoresis. ing the pinewood nematode Bursaphelenchus xy-
Journal of Nematology 15:345-348. lophilus by loop-mediated isothermal amplifica-
Humphreys-Pereira DA, Elling AA (2014) Mitochon- tion. Phytopathology 99:13651369.
drial genomes of Meloidogyne chitwoodi and Krall EL (1991) Wheat and grass nematodes: An-
M. incognita (Nematoda: Tylenchina): compara- guina, Subanguina, and related genera. In: Nickle
tive analysis, gene order and phylogenetic rela- W (Ed.). Manual of Agricultural Nematology. CRC
tionships with other nematodes. Molecular Bio- Press. New York, NY. 721-760 pp.
chemical Parasitology 194:20-32. Lax P, Doucet ME, Braga R, Gioria R (2006) Response
Hunt DJ, Luc M, Manzanilla-Lpez RH (2005) Identifi- of different pepper varieties to the attack by two
cation, morphology and biology of plant parasitic populations of Nacobbus aberrans. Nematololo-
nematodes. In: Luc M, Sikora RA, Bridge J (Eds.) gia Brasileira 30:259-265.
Plant parasitic nematodes in subtropical and tro- Lax P,Dueas JCR, GardenalCN, Doucet ME (2014)
pical agriculture. Wallingford, UK. CAB Internatio- Phylogenetic relationships among populations of
nal. pp. 11-52. the Nacobbus aberrans (Nematoda, Pratylenchi-
Ibrahim SK, Perry RN, Burrows PR, Hooper DJ (1994) dae) complex reveal the existence of cryptic spe-
Differentiation of species and populations of cies. Zoologica Scripta 43:184192.

98 RAPP - Volume 24, 2016


Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)

Perry RN, Moens M, Starr JL (2009) Root-knot nema- Marais M, Swart A, Knoetze R, Pofu K (2015) Plant
todes. Wallingford. CABI. 520 pp. umari S (2015) nematodes in South Africa. 13. A checklist of
Characterization of Pratylenchus crenatus and P. nematodes associated with potatoes. Avail-
neglectus (Nematoda: Pratylenchidae) associated able at: https://www.researchgate.net/publica-
with wheat crop. Helminthologia 52:280-286. tion/297574121. Accessed on may 30, 2016.
Koshy PK, Swarup G, Sethi CL (1970) Heterodera Matsunaga K, Togashi K (2004) A simple method for
zeae n. sp. (Nematoda: Heteroderidae). A cyst discriminating Bursaphelenchus xylophilus and B.
forming nematode on Zea mays. Nematologica mucronatus by species-specific polymerase chain
16:511-516. reaction primer pairs. Nematology 6:273277.
Kumari S, Likov M (2009) Molecular confirmation McKenry MV, Vineros M, Teviotdale B (1990) Crico-
of Xiphinema italiae Meyl, 1953 (Nematoda: nema mutabile associated with bacterial canker
Longidoridae) from the Slovak Republic. Hel- and nemaguard rootstock. Plant Disease 74:394.
minthologia 46:131-134. Mekete T, Reynolds K, Lopez-Nicora HD, Gray ME, Ni-
Kutsuwa K, Dickson DW, Brito JA, Jeyaprakash A, black TL (2011) Distribution and diversity of root-
Drew A (2015) Belonolaimus longicaudatus: an lession nematode (Pratylenchus spp.) associated
emerging pathogen of peanut in Florida. Journal with Miscanthus giganteus and Panicum virga-
of Nematology 47:8796. tum used for biofuels, and species identification
Li W, Yan Z, Nakhla MK, Skantar AM (2015) Real-time in a multiplex polymerase chain reaction. Nema-
PCR for detection and identification of Anguina tology 13:673-686.
funesta, A. agrostis, A. tritici, and A. pacificae. Mitkowski NA (2007) First report of Subanguina
Plant Disease 99:1584-1589. radicicola, the root-gall nematode infecting Poa
Luc M, Aubert V (1985) On the distribution of Xiphi- annua putting greens in Washington State. Plant
nema itallae Mek, 1953 and X. saviwzcola Luc & Disease 91:905.
Southey, 1980 (Nematoda: Longidoridae). Revue Mojtahedi SA, Guerra H, Eastwell L, Villamor K, Han-
Nematologie 8:85-92. doo DEV, Skantar ZA, Skantar AM (2015) First Re-
Luc M, Berdon-Brizuela R (1961) Heterodera oryzae port of Xiphinema rivesi (Nematoda, Longidori-
n. sp. (Nematoda-Tylenchoidea) parasite du riz en dae) in Washington State. Plant Disease 99:1188.
Cote dIvoire. Nematologica 6:272-279. Mokrini F, Waeyenberge L, Viaene N, Andaloussi FA,
Ma Y, Xie H, Wang J, Liu C(2011). Detection of sec- Moens M (2016) Diversity of root-lesion nema-
ond-stage juveniles of Anguina agrostis using todes (Pratylenchusspp.) associated with wheat
TaqMan Real-time PCR. Russian Journal of Nema- (Triticum aestivumandT. durum) in Morocco.
tology 19:151158. Nematology 18:1-21.
Madani M, Vovlas N, Castillo P, Subbotin SA, Moens Mokrini F, Andaloussi A, Waeyenberge L, Viaene
M (2004) Molecular characterization of cyst nem- N, Moens M (2014) First report of the dagger
atode species (Heterodera spp.) from the medi- nematode Xiphinema diversicaudatum in citrus
terranean basin using RFLPs and sequences of orchards in Morocco. Plant Disease 98:575.
ITS-rDNA Journal Phytopathology 152, 229234. Moura RM (1996) O gnero Meloidogyne e a Meloi-
Mamiya Y, Enda N (1979) Bursaphelenchus mucro- doginose: Parte 1. Reviso Anual de Patologia de
natus n.sp. (Nematoda: Aphelenchoididae) from Plantas 4:209-244.
pine wood and its biology and pathogenicity to Moura RM (1997). O gnero Meloidogyne e a Meloi-
pine trees. Nematologica25:353-361. doginose: Parte 2. Reviso Anual de Patologia de
Manso EC, Tenente RCV (1994) Extrao e identifica- Plantas 5:281-315.
o de fitonematoides. Reviso Anual de Patolo- Mulvey RH (1979) Heterodera canadensis n. sp.
gia de Plantas 2:265-291. (Nematoda: Heteroderidae) from spike-rush (El-
Manzanilla-Lpez R, Costilla MA, Douc M, Franco eocharis acicularis (L.) R. & S.) in Quebec, Canada.
J, Inserra JRN, Lehman PS, Prado ICD, Souza R, Journal of Nematology 11:363-371.
Evans K. 2002. Nacobbus species: Systematic, dis- Mulvey RH, Golden AM (1983) Illustrated key to the
tribution, biology and management. Nematropica cyst-forming genera and species of Heteroderidae
32:149-227. in the western hemisphere with species morpho-

RAPP - Volume 24, 2016 99


Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)

metrics and distribution. Journal of Nematology chus xylophilus and Bursaphelenchus mucrona-
15:1-59. tus. PLoS ONE 8: http://dx.doi.org/10.1371/jour-
Mulvey RH, Stone AR (1976). Description of Punc- nal.pone.0056288.
todera matadorensis n. gen., n. sp. (Nematoda: Perry RN, Moens M (2013) Plant Nematology. 2nd Ed.
Heteroderidae) from Saskatchewan with lists Wallingford, UK. CAB International. 536 pp.
of species and generic diagnoses of Globodera Peterson DJ, Vrain TC (1996) Rapid identification of
(n.rank), Heterodera, and Sarisodera. Canadian Meloidogyne chitwoodi, M. hapla and M. fallax
Journal of Zoology 54:772-785. using PCR primers to amplify their ribosomal in-
Nakhla MK, Owens KJ, Li W, Wei G (2010) Multiplex tergenic spacer. Fundamental and applied Nema-
real-time PCR assays for the identification of the tology 19, 601-605.
potato cyst and tobacco cyst nematodes. Plant Powers TO, Szalansky AL, Mullin PG, Harris TS, Ber-
Disease 94: 959965. tozzi T, Griesberg JA (2001) Identification of seed
Nickle WR (1970) A taxonomic review of the gen- gall nematodes of agronomic and regulatory con-
era of the Aphelenchoidae (Fuchs, 1937) Thorne, cern with PCR-RFLP of ITS1.Journal of Nematol-
1949 (Nematoda: Tylenchida). Journal of Nema- ogy 33:191194.
tology 2: 375392. Qiao Y, Yu Q, Badiss A, Zaidi MA, Ponomareva E, Hu
Nobbs JM, Ibrahim SK, Rowe J. (1992) A morpho- Y, Ye W (2016) Paraphyletic genus Ditylenchus Fil-
logical and biochemical comparison of the four ipjev (Nematoda, Tylenchida), corresponding to
cyst nematode species, Heterodera elachista, H. the D. triformis-group and the D. dipsaci-group
oryzicola, H. oryzae and H. sacchari (Nematoda: scheme. ZooKeys 568:112.
Heteroderidae) known to attack rice (Oryza sati- Rao U, Rao S, Rathi A, Gothalwal R, Atkinson H (2011)
va) Fundamental and Applid Nematology 15:551- A comparison of the variation in Indian popula-
562. tions of pigeon pea cyst nematode, Heterodera
OEPP/EPPO (2013) PM 7/119 (1) Nematode extrac- cajanirevealed by morphometric and AFLP analy-
tion. EPPO Bulletin 43:471495. sis. ZooKeys 135:1-19.
Oliveira CMG, Inomoto MM, Bessi R, DO Tomazini Rao YS, Jayaprakash A (1978) Heterodera oryzicola
M, Block VC (2011) Tcnicas moleculares e taxo- n.sp. (Nematoda: Heteroderidae) a cyst nema-
nomia clssica na diagnose de nematoides para- tode on rice (Oryza sativa L.) from Kerala State,
sitos de plantas. Reviso Anual de Patologia de India. Nematologica 24:341346.
Plantas 19:309-336. Raski D (1952) On the morphology of Criconemoi-
Oliveira RDL, Santin AM, Seni DJ, Dietrich A, Salazar desTaylor, 1936, with descriptions of six new spe-
LA, Subbotin AS, Mundo-Ocampo M, Goldenberg cies.Proceedings of the Helminthological Society
R, Barreto RW (2013) Ditylenchus gallaeformans 19:8599.
sp. n. (Tylenchida: Anguinidae) a neotropical ne- Raski D, Luc M (1987) A reappraisal of tylenchina
matode with biocontrol potential against weedy (Nemata) 10. The superfamily Criconematoidea
Melastomataceae. Nematology 15:179-196. Taylor, 1936.Revue de Nmatologie 10:409444.
Parkinson N (2015) Rapid Pest Risk Analysis (PRA) Rathore YS, Tiwari SN (2015) Relationship of differ-
for Pratylenchus scribneri. Available at: https:// ent species of Heterodera with taxonomic group-
secure.fera.defra.gov.uk/phiw/riskRegister/plant- ing of host plants. International Journal of Science
health/documents/pra-pratylenchus-scribne- and Research 7: 2269-2276.
ri-2016.pdf. Accessed on may 30, 2016.. Rau GJ (1958) A new species of sting nematode. Pro-
PerazaPadilla W, Powers T, Hernndez AE (2015) Re- ceedings of the Helminthological 25:95-98.
cords of fifteen ring nematodes (Nematoda: Cri- Robinson AF, Inserra RN, Caswell-Chen EP, Vovlas N,
conematidae) reported for the first time in Costa Troccoli A (1997) Review: Rotylenchulus species:
Rica. 47th ONTA. p.75. identification, distribution, host ranges, and crop
Pereira F, Moreira C, Fonseca L, van Asch B, Mota M, plant resistance. Nematropica 27:127-180.
Abrantes I, Amorim A (2013) New insights into Sabo A, Reis LGL, Krall E, Mundo-Ocampo, M, Fer-
the phylogeny and worldwide dispersion of two ris VR (2002) Phylogenetic relationships of a
closely related nematode species, Bursaphelen- distinct species of Globodera from Portugal and

100 RAPP - Volume 24, 2016


Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)

two Punctodera species. Journal of Nematology Stone AR, Burrows PR (1985) Nacobbus aberrans.
34:263-266. CIH Descriptions of Plant Parasitic Nematodes n
Salinas-Castro A, Nava-Daz C, Luna-Rodrguez M, 119. Wallingford, UK. CAB International.
San Martn-Romero E, Rivera-Fernndez A (2016) Stynes BA, Bird AF (1980) Anguina agrostis, the vec-
Antagonistic bactria affecting the golden cyst tor of annual rye grass toxicity in Australia. Nema-
potato nematode (Globodera rostochiensis Woll.) tologica 26:475-490.
in the region of Perote, Veracruz, Mxico. Trigos Subbotin SA, Krall EL, Riley IT, Chizhov VN, Stael-
A2 Global Advanced Research Journal of Microbi- ens A, De Loose M, Moens M (2004) Evolution
ology 5:16-22. of the gall-forming plant parasitic nematodes
Sharma RD, Loof, PAA (1977) Nematodes associated (Tylenchida:Anguinidae) and their relationships
with different plants at Passo Fundo, Brazil. In: 4 with hosts as inferred from Internal Transcribed
Congresso Brasileiro de Entomologia, Resumos Spacer sequences of nuclear ribosomal DNA.Mo-
Goinia, GO. Sociedade Entomolgica do Brasil. p. lecular Phylogenetics and Evolution 30:226235.
68-69. Subbotin SA, Mundo-Ocampo M, Baldwin JG (2010)
Sharma SB (1998). The cyst nematodes. Kluwer Aca- Systematics of cyst nematodes (Nematoda: Het-
demic Publishers, The Netherlands. 452p eroderinae). Nematology Monograps and Per-
Siddiqi MR (2000) Tylenchida parasites of plants and spectives 8A. Brill, Leiden-Boston. 351 pp.
insects. 2nd Ed. Wallingford, UK.CAB Internation- Subbotin SA, Vera ICDPV, Mundo-Ocampo M, Bald-
al. 833 pp. win JG (2011) Identification, phylogeny and phy-
Singh SK, Hodda M, Ash GJ (2013) Plant-parasitic logeography of circumfenestrate cyst nematodes
nematodes of potential phytosanitary impor- (Nematoda: Heteroderidae) as inferred from
tance, their main hosts and reported yield losses. analysis of ITS-rDNA. Nematology 13:805-824.
EPPO Bulletin 43:334374. Subbotin SA, Vierstraete A, De Ley P, Rowe J, Waey-
Sirca S, Geric Stare B, Strajnar P, Urek G (2010) PCR- enberge L, Moens M, Vanfleteren JR (2001) Phy-
RFLP diagnostic method for identifying Globodera logenetic relationships within the cyst-forming
species in Slovenia. Phytopathologia Mediterra- nematodes (Nematoda, Heteroderidae) based on
nea 49:361-369. analysis of sequences from the ITS regions of ri-
Skantar AM, Handoo ZA, Caria LK, Cuttwood DJ bosomal DNA. Molecular Phylogenetic and Evolu-
(2007) Morphological and molecular identifica- tion 21:1-16.
tion of Globodera pallida associated with potato Subbotin SA, Waeyenberge L, Moens M (2000) Iden-
in Idaho. Journal of Nematology 39:133-144. tification of cyst forming nematodes of the genus
Skantar AM, Handoo ZA, Zanakis, GN, Tzortzakakis Heterodera (Nematoda: Heteroderidae) based on
EA (2012) Molecular and Morphological Charac- the ribosomal DNA-RFLP. Nematology 2:153164.
terization of the Corn Cyst Nematode, Heterodera Subbotin SA, Waeyenberge L, Moens M (2013) Mo-
zeae, from Greece. Journal of Nematology 44:58 lecular Systematics. In: Perry RN, Moens M (Eds).
66. Plant Nematology. UK. CABI. pp. 41-72.
Souza RM (2001) O falso nematoide-das-galhas. Re- Subbotin SA, Waeyenberge L, Molokanova IA,
viso Anual de Patologia de Plantas 9:237-266. Moens M (1999) Identification of Heterodera av-
Steenkamps S, De Waele D, McDonald A (2016). enae group species by morphometrics and rDNA-
Reproduction and damage potential of five geo- RFLPs. Nematology 1:195-207.
graphical Ditylenchus africanus populations on Sullivan M, Mackesy D (2012). CPHST PestDatasheet
peanut. Journal of Nematology 48:7278. for Punctodera chalcoensis. USDA-APHIS-PPQ-
Stone AR (1973) Heterodera pallida n. sp. (Nemato- CPHST.
da: Heteroderidae), a second species of potato Sullivan M, Mackesy D, Molet T (2014) CPHST Pest-
cyst nematode. Nematologica 18:591-606. Datasheet for Heterodera sacchari. USDA-APHIS-
Stone AR, Sosa Moss C, Mulvey RH (1976) Punctode- PPQ-CPHST.
ra chalcoensis n.sp. (Nematoda: Heteroderidae) Szalanski AL, Sui DD, Harris S, Powers TO (1997) Iden-
a cyst nematode from Mexico parasitising Zea tification of cyst nematodes ofa and regulatory
mays. Nematologica 22:381-389. concern with PCR-RFLP of ITS1. Journal of Nema-

RAPP - Volume 24, 2016 101


Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)

tology 29:255-267. numbers. Plant Pathology 64:489500.


Tanha Maafi Z, Sturhan D, Handoo Z, Mor M, Moens Vera ICDP, Maggenti AR (1984) A new gall-form-
M, Subbotin SA (2007) Morphological and mo- ing species of Anguina Scopoli, 1777 (Nemata:
lecular studies on Heterodera sacchari, H. golden Anguinidae) on bluegrass, Poa annua L., from
and H. leuceilyma (Nematoda: Heteroderidae). the Coast of California. Journal of Nematology
Nematology 9:483-497. 16:386-392.
Tenente RCV, Abrantes IMO, Tenente GSMV (2002) Vera ICDP, Subbotin SA (2012) Belonolaimus malu-
Nematoide: o gnero Xiphinema. Reviso Anual ceroi sp. n. (Tylenchida: Belonolaimidae) from a
de Patologia de Plantas 10:111-153. tropical forest in Mexico and key to the species of
Tenente RCV, Oliveira MRV, Melo, LAMP (2007) Belonolaimus. Nematropica 42:201-210.
Subsdios ao processo de elaborao de plano Vovlas N, Greco N, Di Vito M (1985) Heterodera ciceri
de contigncia de Anguina tritici (Steinbuch, n. sp. (Nematoda: Heteroderidae) on Cicer arieti-
1799) Chitwood, 1935. Embrapa. Documento num L. from Northern Syria. Nematologia Medi-
219. 36 p. terranea 13:239-252.
Tenente RCV, Vianello RP, Pinheiro FP (2000) Re- Vovlas N, Inserra RN, Stone AR (1981) Heterodera
produo de Ditylenchus dipsaci (Kuhn, 1857) mediterraneasp. n. (Nematoda: Heteroderidae)
Filipjev, 1936 em diferentes plantas hospedeiras on Pistacia lentiscus in Southern Italy. Nemato-
no Brasil. Nematologia Brasileira 24:87-90. logica 27:129-138.
Tirchi N, Troccoli A, Fanelli E, Mokabli A,Mouhouche Wang X, Bosselut N, Reynal B, Castagnone C, Voisin
F, DeLuca F (2016) Morphological and molecu- R, Abad P, Esmenjaud D (2002) Morphometric
lar identification of potato and cereal cyst nem- variability between populations of Xiphinema
atode isolates from Algeria and their phyloge- diversicaudaturn (Nematoda: Dorylaimoidea).
netic relationships with other populations from Nematology 4:627.
distant their geographical areas. European Jour- Wendt KR, Swart A, Vrain TC, Webster JM (1995)
nal of Plant Pathology. Available at: http://dx.doi. Ditylenchus africanus sp. n. from South Africa; a
org/10.1007/s10658-016-0965-z. Accessed on morphological and molecular characterization.
may 30, 2016. Fundamental and Applied Nematology 18:241-
Troccoli A, De Luca F, Handoo ZA, Di Vito M (2008) 250.
Morphological and molecular characterization of Wishart J, Phillips MS, Blok VC (2002) Ribosomal
Pratylenchus lentisn. sp. (Nematoda: Pratylenchi- intergenic spacer: a polymerase chain reaction
dae) from Sicily. Journal of Nematology 40:190- diagnostic for Meloidogyne chitwoodi, M. fallax
196. and M. hapla. Phytopathology 92:884892.
Van Den Berg E, Palomares-Rius JE, Vovlas N, Tiedt Wouts WM, Sturhan D (1978) The identify of Het-
LR, Castillo P, Subbotin SA (2016) Morphological erodera trifolii GofTart, 1932 and the description
and molecular characterisation of one new and of H. daverti n. sp. Nematologica 24:121-128.
several known species of the reniform nematode, Yan GP, Plaisance A, Huang D, Gudmestad NC (2016)
Rotylenchulus Linford & Oliveira, 1940 (Hoplo- First report of the root-lesion nematode Prat-
laimidae: Rotylenchulinae), and a phylogeny of ylenchus scribneri infecting potato in North Da-
the genus. Nematology 18:67-107. kota. Plant Disease 100:1023.
Van Ghelder C, Reid A, Kenyon DM, Esmenjaud D Yan GP, Smiley RW, Okubara PA (2012) Detection
(2015) Detection of nepovirus vector and nonvec- and quantification of Pratylenchus thornei in DNA
tor Xiphinema species in grapevine. In: Plant Pa- extracted from soil using real time PCR. Phytopa-
thology: Techniques and Protocols. Springer. New thology 102:14-22.
York. pp.149-159. Yan, GP, Smiley RW, Okubara PA, Skantar AM (2013)
Van Ghelder C., Reid A, Kenyon D, Esmenjaud D Species-specific PCR assays for differentiating
(2015) Development of a real-time PCR method Heterodera filipjevi and H. avenae. Plant Disease
for the detection of the dagger nematodes Xiphi- 97:1611-1619.
nema index, X.diversicaudatum, X.vuittenezi and Ye W, Giblin-Davis RM (2013) Molecular character-
X.italiae, and for the quantification of X.index ization and development of real-time PCR assay

102 RAPP - Volume 24, 2016


Paulo Sergio Torres Brioso e Ricardo Moreira de Souza (70-103)

for pinewood nematode Bursaphelenchus xyloph- Aphelenchoididae) found in pine wood in Hunan
ilus (Nematoda: Parasitaphelenchidae). PLoS ONE Province, China. Proceedings of the Helmintho-
8:11. logical Society of Washington 55:1-11.
Yeates GW, Loof PAA, Wouts WM (1997) Cricone- Zhang F, Yan S, Zhou Y, Guo G, Guo S, Jin Z, Zeng H,
matidae (Nematoda: Tylenchida) from the New Peng D, Ruan L, Sun M (2015) First Report of Pra-
Zealand region: analysis of and key to Criconema tylenchus goodeyi on banana in Hainan Province,
(Nothocriconemella) species. New Zealand Jour- China. Plant Disease 99:731.
nal of Zoology 24:153-162. Zijlstra C, van Hoof RA (2006) A multiplex real-time
Yin K, Fang Y, Tarjan AC (1988) A key to species in Polymerase Chain Reaction (Taqman) assay for the
the Bursaphelenchus with a description of Bur- simultaneous detection of Meloidogyne chitwoodi
saphelenchum hunanensis sp. n. (Nematoda: and M. fallax. Phytopathology 96:12551262.

RAPP - Volume 24, 2016 103


Celso Garcia Auer e lvaro Figueredo dos Santos (104-114)

RISCOS POTENCIAIS DE PATGENOS


FLORESTAIS EXTICOS PARA O SETOR
FLORESTAL BRASILEIRO
Celso Garcia Auer1 e lvaro Figueredo dos Santos1

RESUMO
Listas de pragas exticas so elaboradas visando proteger as culturas
agrcolas e florestais dos pases e blocos continentais. Essas pragas so avalia-
das por sistemas de vigilncia sanitria vegetal, a partir de anlises de risco e
aquelas de maior impacto e potencial de entrada e de estabelecimento podem
ser classificadas como pragas quarentenrias. No caso dos patgenos florestais
existem fungos, bactrias, nematoides e vrus que podem representar riscos po-
tenciais. Alm dos patgenos quarentenrios colocados na lista A1 de pragas
quarentenrias para o Brasil, outros patgenos exticos no quarentenrios po-
dem tambm representar riscos aos cultivos florestais. Essa reviso aborda as
principais espcies florestais plantadas no Brasil: eucalipto, pnus, accia-negra,
teca e lamo, seus patgenos presentes mais importantes, os patgenos con-
siderados quarentenrios e patgenos exticos no quarentenrios. nfase foi
dada s possveis formas de introduo de patgenos, a necessidade de cons-
tante atualizao das listas de pragas quarentenrias e capacitao de tcnicos
em relao ao tema patgenos quarentenrios e exticos.

SUMMARY
Lists of exotic pests are designed to protect agricultural and forest cul-
tures of countries and continental blocks. These pests are evaluated by plant
health surveillance systems, from risk analysis and those of greater impact and
potential entry and establishment may be classified as quarantine pests. In the
case of forest pathogens are fungi, bacteria, nematodes, and viruses that can
pose potential risks. In addition to the quarantine pathogens placed in the A1 list
of quarantine pests for Brazil, other non-quarantine exotic pathogens can also
pose risks to forest crops. This review addresses the main tree species plant-
ed in Brazil: eucalyptus, pine, black wattle, teak and poplar, its most important
pathogens present, pathogens considered quarantine and non-quarantine ex-
otic pathogens. Emphasis was given to possible ways of introducing pathogens,
the need for constant updating of the lists of quarantine pests and training of
technicians on topics of quarantine and exotic pathogens.

Introduo pido crescimento, tais como eucalipto (Eucalyptus


O Setor Florestal Brasileiro constitudo, em spp.) e pnus (Pinus spp.) que fornecem matria-
sua maioria, por espcies florestais exticas de r- -prima para vrios setores industriais (IB, 2015). A

1
Laboratrio de Patologia Florestal, Embrapa Florestas, Estrada da Ribeira, Km 111, 83411-000, Colombo, PR. celso.auer@embra-
pa.br, alvaro.santos@embrapa.br.

104 RAPP - Volume 24, 2016


Celso Garcia Auer e lvaro Figueredo dos Santos (104-114)

madeira produzida se constitui em fonte de fibras nrios constantes nas listas A1 e A2 do MAPA, para
celulsicas destinada produo de papel e chapas, cada uma das espcies florestais eucalipto, pnus,
bem como produtos mais nobres destacando-se a accia negra, teca e lamo - e a incluso de pat-
produo de laminados e madeira serrada, para os genos exticos, ainda no normatizados pelo MAPA,
mais diversos usos. Na gerao de energia, a biomas- mas que podero representar riscos potenciais para
sa pode ser utilizada in natura na forma de cavacos, a rea florestal. A anlise dos patgenos quarente-
lenha, carvo e at como substrato para produo nrios foi baseada na lista A1 publicada na Instruo
de lcool de segunda gerao. A madeira tambm Normativa n. 41 de 2008 (BRASIL, 2008) e que foi
serve para outros usos como mobilirio, construo no alterada pela Instruo Normativa n. 59 de 2013
civil e uso residencial. Em 2014, as reas com flores- (BRASIL, 2013).
tas plantadas representaram 7,74 milhes de hecta-
res, correspondendo a 0,9 % do territrio brasileiro Eucalipto
(IB, 2015). Desse total, o eucalipto respondeu pela Patgenos existentes no Brasil
maior rea plantada com 5,56 milhes de hectares, O eucalipto plantado em quase todo o terri-
seguido pelo pnus com 1,59 milho, accia negra trio nacional, especialmente nos estados de Minas
e accia mangium com 160 mil, teca com 87 mil, e Gerais, So Paulo e Mato Grosso do Sul (IB, 2015)
outras espcies florestais para a indstria fosforeira com a maioria dos plantios constituda por clones de
como o caso do lamo com 4 mil (IB, 2015). Neste Eucalyptus grandis x Eucalyptus urophylla denomi-
ano, o setor florestal brasileiro gerou 610.000 em- nado de urograndis (Alfenas et al. 2009). O eucalipto
pregos diretos e indiretos, em vrias regies brasilei- possui vrios patgenos registrados no Brasil (Tabela
ras, com uma participao no produto interno bruto 1). Os principais patgenos so Puccinia psidii (fer-
(PIB) de 1,1 % (IB, 2015). rugem), Ceratocystis fimbriata e Ralstonia solana-
A importncia socioeconmica da rea flo- cearum (murcha vascular), Chrysoporthe cubensis e
restal brasileira e o risco de entrada de patgenos Botryosphaeria spp. (cancros), Cylindrocladium spp.
exticos tem sido uma preocupao constante do Mycosphaerella/Teratosphaeria, Xanthomonas axo-
setor florestal. Os impactos potenciais podem ser es- nopodis e Erwinia psidii (cancro e murcha) em plan-
perados na reduo da produtividade das florestas, tios comerciais.
da qualidade da matria-prima (madeira) produzida
e, em casos mais graves, o impedimento do uso de Patgenos oficialmente listados como qua-
determinadas espcies ou de materiais genticos al- rentenrios
tamente suscetveis aos patgenos exticos. Vrias A atual lista A1 de pragas quarentenrias
introdues foram constatadas nos ltimos 20 anos: para o Brasil apresenta oito patgenos fngicos, des-
Teratosphaeria nubilosa e Teratosphaeria pseudoeu- tacando-se como patgenos radiculares Armillaria
calypti em eucaliptos (Perez et al., 2009; Candido et luteobubalina (importante em eucaliptos na Austr-
al., 2014) e Olivea neotectonae (Olivea tectonae) em lia), Armillaria tabescens e Heterobasidion annosum
teca (Cabral et al., 2010; Bonaldo et al., 2011, Pieri (polfagos) e para patgenos de tronco, somente foi
et al., 2011). relacionado Chondrostereum purpureum (Tabela 2).
No Ministrio de Agricultura, Pecuria e Abas-
tecimento (MAPA), o tema pragas quarentenrias (o Patgenos exticos no quarentenrios
conceito de forma abrangente inclui doenas, inse- Os patgenos que podem ser destacados
tos e plantas daninhas) tratado no Departamen- como importantes para a cultura do eucalipto e que
to de Sanidade Vegetal (DSV). Nas listas elaboradas ainda no foram normatizados como pragas quaren-
pelo MAPA h uma diferenciao entre patgenos tenrias so patgenos foliares como Teratosphaeria
quarentenrios ainda no encontrados no territrio spp., e Quambalaria pitereka (Tabela 2). Esses fun-
brasileiro, chamados de pragas A1, e aqueles que gos causam desfolha, declnio e morte das rvores,
foram introduzidos, mas se encontram localizados, com impactos significativos na produtividade das
chamados de pragas A2. florestas de eucalipto na Austrlia (Carnegie, 2007).
Neste trabalho, a sistemtica adotada para De acordo com este autor, Teratosphaeria eucalyp-
o tema ser a abordagem de patgenos quarente- ti causou severa desfolha (> 95 %) em Eucalyptus

RAPP - Volume 24, 2016 105


Celso Garcia Auer e lvaro Figueredo dos Santos (104-114)

Tabela 1. Lista de patgenos registrados para a cultura do eucalipto no Brasil.


Patgeno Doena Danos ou Sintomas
Alternaria tenuissima Mancha foliar de Leso foliar em mudas.
Alternaria
Aulographina eucalypti Mancha de Leses necrticas sobre nervuras, pecolo, galhos e
Aulographina ramos mais finos.
Botryosphaeria ribis (= Neofusicoccum ribis) Cancro de Leses em casca, em vrias partes do caule, com
Botryosphaeria dothidea (= Fusicoccum aesculi) Botryosphaeria quebra no ponto de infeco, exsudao de goma,
Botryosphaeria rhodina (= Lasiodiplodia theobromae) estrangulamento de rvores jovens.
Botrytis cinerea (= Botryotinia fuckeliana) Mofo cinzento; Queima e seca de ponteiros de mudas e rvores
Podrido de Botrytis jovens; morte de miniestacas.
Ceratocystis fimbriata Murcha de Declnio, cancro, escurecimento radial do lenho;
Ceratocystis murcha e morte de minicepas, miniestacas e rvores
jovens.
Cercospora eucalypti Mancha de Cercospora Manchas foliares que podem tomar todo o limbo.
Colletotrichum gloesporioides Antracnose Mancha foliar, desfolha e secamento descendente da
haste de mudas.
Cryptosporiopsis eucalypti Mancha de Manchas foliares com ou sem desfolha.
Cryptosporiopsis
Crysoporthe cubensis (= Cryphonectria cubensis) Cancro Leses na casca de rvores jovens e adultas;
estrangulamento e morte de rvores.
Coniothyrium sp. Cancro de Leses necrticas pequenas ou longas, deprimidas no
Coniothyrium caule, gomose, declnio e reduo no crescimento da
rvore.
Cylindrocladium spp. Mancha foliar de Manchas e secamento de folhas e ramos em mudas
Cylindrocladium candelabrum (= Calonectria scoparia) Cylindrocladium; e rvores jovens; secamento da haste de mudas;
Cylindrocladium clavatum Canela preta; Tombamento de plntulas; Morte de estacas e
Cylindrocladium ovatum Tombamento de miniestacas.
Cylindrocladium parasiticum (= Calonectria ilicilola) mudas;
Cylindrocladium pteridis Morte de miniestacas
Cylindrocladium scoparium (= Calonectria morganii)
Cylindrocladium ilicicola (= Calonectria pyrochroa)
Cylindrocladium floridanum
Cylindrocladium quinqueseptatum (= Calonectria quinqueseptata)
Cytospora eucalypticola (= Valsa certosperma) Cancro de Cytospora Leses na casca e cancro em tronco.
Erwinia psidii Cancro e murcha Seca de ramos e ponteiros, murcha.
Erythricium salmonicolor (= Corticium salmonicolor) Enfermidade rosada Leses na casca e anelamento de hastes e galhos de
ou rubelose rvores jovens, formao de cancros, quebra do caule.
Inocutis jamaicensis Cancro e podrido de Leso em tronco, trincamento da casca, cancro e
Inocutis apodrecimento de lenho e quebra de caule.
Hainesia lythri Mancha de Hainesia Leso foliar em mudas; anelamento da haste e morte
apical de mudas.
Harknessia sp. Mancha de Harknessia Manchas foliares
Mycosphaerella/Teratosphaeria Mancha foliar de Manchas foliares de vrios tipos, com ou sem desfolha.
Mycospharella parkii (= Stenella parkii) Mycosphaerella /
Mycosphaerella marksii Teratosphaeria
Teratosphaeria suberosa
Teratosphaeria suttonii (= Kirramyces epicoccoides)
Teratosphaeria molleriana (= Colletogloeopsis molleriana)
Teratosphaeria nubilosa
Oidium eucalypti; Erysiphe cichoracearum; Sphaerotheca pannosa Odio Queima, seca e queda de folhas em mudas e rvores
jovens.
Pestalotiopsis spp. Mancha foliar e Leses necrticas em folhas e hastes de estacas e
anelamento da haste miniestacas.
Phytophthora sp. Podrido de raiz Tombamento e morte de plntulas em viveiro.
Pilidiella eucalyptorum (= Coniella fragariae) Mancha foliar de Manchas foliares extensas com ou sem desfolha em
Pilidiella rvores.
Puccinia psidii Ferrugem Queima de folhas e brotaes de mudas e rvores
jovens.
Quambalaria eucalypti (= Sporothrix eucalypti) Mancha foliar e Estrangulamento da haste de mudas; leso foliar
anelamento da haste de mudas, minicepas, miniestacas e rvores jovens;
anelamento de hastes e ramos, leses na casca e
cancros no caule de rvores jovens.
Ralstonia solanacearum biovar I Murcha bacteriana Necrose foliar, murcha e morte de minicepas; murcha
vascular e morte de rvores jovens.
Rhizoctonia solani (AG1-1B); espcies binucleadas de Rhizoctonia; Mela e mancha de Crescimento epiftico sobre folhas, miniestacas, mudas
Thanatephorus cucumeris Rhizoctonia e rvores jovens, causando secamento e morte.
Trimmatostroma excentricum Mancha de Manchas foliares pequenas.
Trimmatostroma
Xanthomonas axonopodis Mancha foliar Manchas foliares necrticas em mudas e rvores
bacteriana jovens.
Fonte: Ferreira (1989), Alfenas et al. (2009), Krugner & Auer (2005a).

106 RAPP - Volume 24, 2016


Celso Garcia Auer e lvaro Figueredo dos Santos (104-114)

Tabela 2. Listagem de patgenos exticos quarentenrios ou no considerados importantes para a cultura do eucalipto.
Patgeno Doena Danos Status Referncias
quarentenrio*
Armillaria luteobubalina Podrido de Apodrecimento de razes e morte PQ BRASIL (2008)
Armillaria tabescens razes de rvores.
Chondrostereum purpureum Podrido do Infeco em rvores vivas, declnio PQ BRASIL (2008)
tronco e apodrecimento da madeira Farr & Rossman (2016)**
Hetereobasidion annosum (= Podrido de Apodrecimento de razes e morte PQ BRASIL (2008)
Spiniger meineckellus) razes de rvores. Farr & Rossman (2016)**
Teratosphaeria destructans (= Mancha foliar Manchas foliares e desfolha. - Andjic et al. (2011)
Kirramyces destructans)
Kirramyces eucalypti Mancha foliar Manchas foliares e desfolha. - Alfenas et al. (2009)
Pilidiella destruens Seca de Declnio de rvores. - Alfenas et al. (2009)
ponteiros
Quambalaria pitereka Mancha foliar Manchas foliares e deformao de - Roux et al. (2006)
rgos.
*PQ praga quarentenria, de acordo com lista A1 de pragas quarentenrias para o Brasil. **Base de dados utilizada
para busca de espcies de eucalipto hospedeiras aos patgenos florestais listados como quarentenrios.

nitens provocando a morte de ponteiros e rvores Patgenos oficialmente listados como qua-
enquanto que Quambalaria pitereka levou a danos rentenrios
significativos na copa (25 % de severidade) e queima A lista A1 apresenta 10 fungos e 2 nemati-
de ponteiros, principalmente em plantios jovens de des quarentenrios que podem representar riscos
Corymbia spp. para a cultura de pnus (Tabela 4). Destacam-se os
patgenos radiculares dos gneros Armillaria e He-
Pinus terobasidion, os nematides vasculares do gnero
Patgenos existentes no Brasil Bursaphelenchus, as ferrugens dos gneros Cronar-
O pnus plantado principalmente nos esta- tium e Endocronartium, de cancro de Gibberella
dos do Paran, Santa Catarina e Rio Grande do Sul circinata e de acculas e copa dos gneros Mycos-
(IB, 2015) e as principais espcies plantadas so Pi- phaerella. Todos so patgenos importantes e com
nus taeda e Pinus elliottii var. elliottii (subtropicais) e grandes danos e prejuzos relatados em vrias partes
Pinus caribaea var. hondurensis (tropical) (Shimizu & do mundo.
Sebben, 2008).
Os principais patgenos que ocorrem no p- Patgenos exticos no quarentenrios
nus so os fungos Armillaria sp. (podrido de razes) O patgeno que pode ser destacado para
e Diplodia pinea (seca de ponteiros) (Tabela 3). At o a cultura do pnus ainda no registrado no Brasil
momento, desconhece-se qual a espcie de Armilla- Phytophthora pinifolia, restrito ao Chile (Santos et
ria que ataca o pnus no Brasil. al., 2013). Os impactos desse oomiceto so rele-

Tabela 3. Lista de patgenos registrados para a cultura do pnus no Brasil.


Patgeno Doena Danos
Armillaria sp. Podrido de razes Apodrecimento de razes e morte de rvores.
Cylindrocladium clavatum Podrido de razes Podrido de razes de mudas e rvores, morte de plantas.
Cylindrocladium pteridis Queima de acculas Leses em acculas com estrangulamento e morte;
desfolha em mudas e rvores jovens.
Diplodia pinea (= Sphaeropsis sapinea) Seca de ponteiros Queima de brotos de mudas, seca de ponteiros de rvores
jovens, cancros em caule, manchamento da madeira.
Dothistroma septospora (= Queima de acculas Leses em acculas com estrangulamento e morte;
Mycosphaerella pini) desfolha em mudas e rvores jovens.
Fusarium sp. Podrido de razes Podrido de razes de mudas.
Lophodermium sp. Mancha de Lophodermium Leses em acculas com estrangulamento e morte;
desfolha em mudas e rvores jovens.
Rhizoctonia solani (= Thanathephorus Podrido de razes Apodrecimento de razes e da base de estacas e
cucumeris) miniestacas de mudas.
Fonte: Ferreira (1989), Krugner & Auer (2005b).

RAPP - Volume 24, 2016 107


Celso Garcia Auer e lvaro Figueredo dos Santos (104-114)

Tabela 4. Listagem de patgenos exticos considerados importantes para a cultura do pnus no exterior.
Patgeno Doena Danos Status quarentenrio* Referncias
Armillaria luteobubalina Podrido de razes Apodrecimento de razes e PQ BRASIL (2008)
Armillaria ostoyae morte de rvores.
Armillaria tabescens
Bursaphelenchus xylophilus Murcha vascular Colonizao dos traquedeos PQ BRASIL (2008)
Bursaphelenchus mucronatus da rvore; murcha da copa e
morte de rvores
Cronartium fusiforme Ferrugem Formao de galhas, PQ BRASIL (2008)
Cronartium quercuum deformao do tronco, morte
da planta.
Endocronartium harknessii Ferrugem Formao de galhas, PQ BRASIL (2008)
deformao do tronco, morte
da planta.
Gibberella circinata Cancro resinoso do Tombamento de mudas; PQ BRASIL (2008)
(= Fusarium circinatum) pnus Infeces sistmicas em ramos
e tronco, cancro, declnio e
morte.
Hetereobasidion annosum Podrido de razes Apodrecimento de razes e PQ BRASIL (2008)
morte de rvores.
Mycosphaerella dearnessii Queima de acculas Leses em acculas, desfolha e PQ BRASIL (2008)
(= Lecanosticta acicola) morte de rvores jovens.
Mycosphaerella gibsonii
(= Pseudocercospora
pini-densiflorae)
Phytophthora pinifolia Dano foliar do pnus Leses em acculas e - Santos et al.
secamento, leses necrticas (2013)
no caule e morte de plantas
*PQ praga quarentenria, de acordo com lista A1 de pragas quarentenrias para o Brasil.

vantes atacando acculas e a copa das rvores e de obubalina que pode ser danoso para a acacicultura
acordo com Ahumada et al. (2013) cerca de 54 mil (Tabela 6).
hectares foram atacados em surto ocorrido durante
2004 a 2006. Patgenos exticos no quarentenrios
Para a accia negra podem ser destacados
Accia-negra Uromycladium notabile e Uromycladium bisporum
Patgenos existentes no Brasil (Tabela 6), que causam ferrugem e desfolha em plan-
A accia-negra plantada no estado do Rio tios comerciais no exterior.
Grande do Sul em mais de 100.000 hectares (ABRAF,
2013). A accia negra possui algumas doenas regis- Teca
tradas no Brasil (Tabela 5) e os principais patgenos Patgenos existentes no Brasil
so Phytophthora nicotianae e Phytophthora boeh- A teca plantada principalmente nos esta-
meriae, causando a gomose em plantios comerciais. dos de Mato Grosso, Par e Roraima (ABRAF, 2013) e
possui algumas doenas registradas no Brasil (Tabela
Patgenos oficialmente listados como qua- 7). O principal patgeno Olivea neotectonae (= Oli-
rentenrios vea tectonae) causador da ferrugem em plantios co-
A lista A1 apresenta somente Armillaria lute- merciais, reduzindo a produtividade (Caldeira et al.,

Tabela 5. Lista de patgenos registrados para a cultura da accia-negra no Brasil.


Patgeno Doena Danos
Ceratocystis fimbriata Murcha de Ceratocystis Declnio, cancro, escurecimento radial do lenho; murcha de
ponteiro em rvores jovens.
Phytophthora boehmeriae Gomose de tronco Leses na casca, exsudao de goma, reduo na produo de
casca
Phytophthora nicotianae Gomose basal Leses na casca, exsudao de goma, reduo na produo de
casca
Uromycladium alpinum Ferrugem Amarelecimento e queda de fololos.
Fonte: Santos et al. (2007).

108 RAPP - Volume 24, 2016


Celso Garcia Auer e lvaro Figueredo dos Santos (104-114)

Tabela 6. Lista de patgenos exticos considerados importantes para a cultura da accia-negra no exterior.
Patgeno Doena Danos Status quarentenrio* Referncias
Armillaria Podrido de Apodrecimento de razes e PQ BRASIL (2008)
luteobubalina razes morte de rvores
Ceratocystis albifundus Murcha de Declnio, cancro, - Roux et al. (2005)
Ceratocystis escurecimento radial do
lenho; murcha de ponteiro em
rvores jovens
Uromycladium notabile Ferrugem Amarelecimento e - Santos et al. (2007)
queda de fololos
Uromycladium Ferrugem Amarelecimento e - Santos et al. (2007)
bisporum queda de fololos
*PQ praga quarentenria, de acordo com lista A1 de pragas quarentenrias para o Brasil.

Tabela 7. Lista de patgenos registrados para a cultura da teca no Brasil.


Patgeno Doena Danos
Agrobacterium tumefaciens Galha-da-coroa Deformao basal e presena de galhas.
Alternaria sp. Mancha de Alternaria Leses necrticas em folhas.
Ceratocystis fimbriata Murcha de Ceratocystis Declnio, cancro, escurecimento radial do lenho; murcha de
ponteiro em rvores jovens.
Colletotrichum gloesporioides Antracnose Manchas foliares e desfolha.
Cylindrocladium parasiticum Mancha de Cylindrocladium Manchas foliares e desfolha.
Lasiodiplodia theobromae Cancro no tronco Leses no tronco, manchamento e podrido do cerne e
morte de rvores.
Olivea tectonae Ferrugem Desfolha prematura em mudas e rvores jovens e adultas.
Meloidogyne javanica Galhas das razes Formao de galhas em razes.
Rhizoctonia solani Queima de folhas Leses foliares e crescimento epiftico.
Fonte: Caldeira et al. (2014), Borges et al. (2015).

2014). Destaca-se, tambm, a murcha de Ceratocys- (Tabela 9). Os principais patgenos so Melampso-
tis afetando a produtividade decorrente da morte de ra medusae (ferrugem) e Septoria musiva (manchas
rvores e a qualidade da madeira pela colonizao e foliares e cancros) em plantios comerciais (May-de
manchamento interno. Mio & Amorim, 2005).

Patgenos oficialmente listados como qua- Patgenos oficialmente listados como qua-
rentenrios rentenrios
A lista A1 no apresenta patgenos quarente- Para o lamo, a lista A1 apresenta 10 fungos
nrios para Tectona grandis. e um vrus (Tabela 10). A lista relaciona os patgenos
Patgenos exticos no quarentenrios radiculares Armillaria ostoyae e Heterobasidion an-
Os patgenos Phellinus noxius (podrido de nosum, patgenos de tronco como Chondrostereum
raiz), Phomopsis tectonae e Pseudoepicoccum tecto- purpureum, Neonectria ditssima e Valsa nivea e os
nae (manchas foliares) e Dothiorella sp e Nectria spp. patgenos foliares do gnero Drepanopeziza, Taphri-
(cancros) podem ser destacados como importantes na populina, Venturia populina e vrus do mosaico
(Tabela 8). Alm destes, os patgenos Erythricium do Populus.
salmonicolor (rubelose) e Ralstonia solanacearum
(murcha vascular) que causam doenas em eucalipto Patgenos exticos no quarentenrios
no Brasil (Alfenas et al., 2009). A princpio, os patgenos que podem ser des-
tacados como importantes para a cultura do lamo
lamo foram listadas como quarentenrios (Tabela 10).
Patgenos existentes no Brasil
A cultura do lamo est concentrada nos esta- Doenas causadas por patgenos quarente-
dos do Paran e de Santa Catarina (ABRAF, 2013). O nrios
lamo possui algumas doenas registradas no Brasil Com relao s doenas causadas pelos pa-

RAPP - Volume 24, 2016 109


Celso Garcia Auer e lvaro Figueredo dos Santos (104-114)

Tabela 8. Lista de patgenos exticos considerados importantes para a cultura da teca no exterior.
Patgeno Doena Danos Status Referncias
quarentenrio*
Erythricium salmonicolor Enfermidade Leses na casca e anelamento - Caldeira et al. (2014)
(= Corticium salmonicolor) rosada ou rubelose de hastes e galhos de rvores
jovens, formao de cancros,
quebra do caule
Dothiorella sp. Cancro de Cancros em caule - Caldeira et al. (2014)
Dothiorella
Nectria spp. Cancro de Nectria Cancros em caule - Caldeira et al. (2014)
Phellinus noxius Podrido de raiz Apodrecimento de razes e CROP (2016b)
caule
Phomopsis tectonae Mancha de Manchas foliares, desfolha e - Caldeira et al. (2014)
Phomopsis morte de plntulas
Pseudoepicoccum tectonae Mancha de Manchas foliares, desfolha. - Caldeira et al. (2014)
Pseudoepicoccum
Ralstonia solanacearum Murcha bacteriana Murcha vascular e morte de - Caldeira et al. (2014)
rvores jovens
*PQ praga quarentenria, de acordo com lista A1 de pragas quarentenrias para o Brasil.

Tabela 9. Lista de patgenos registrados para a cultura do lamo no Brasil.


Patgeno Doena Danos
Melampsora medusae Ferrugem Desfolha prematura em mudas e rvores jovens e adultas.
Rosellinia bunodes Podrido de razes Apodrecimento de razes e morte de rvores.
Septoria musiva Mancha foliar e cancro de Septoria Leses necrticas em folhas; Cancros em tronco.
Fonte: Santos et al. (2010), Santos et al. (2015), May-de-Mio & Amorim (2005).

Tabela 10. Lista de patgenos exticos considerados importantes para a cultura do lamo no exterior.
Patgeno Doena Danos Status Referncias
quarentenrio*
Armillaria ostoyae Podrido de razes Apodrecimento de razes e PQ BRASIL (2008)
morte de rvores.
Chondrostereum purpureum Podrido do tronco Infeco em rvores vivas, PQ BRASIL (2008)
declnio e apodrecimento da
madeira
Drepanopeziza populi-albae Mancha foliar Leses foliares, queima de PQ BRASIL (2008)
(= Marssonina castagnei) ponteiros, desfolha prematura
Drepanopeziza populorum da copa.
(= Marssonina populi)
Drepanopeziza punctiformis
(= Marssonina brunnea )
Hetereobasidion annosum Podrido de razes Apodrecimento de razes e PQ BRASIL (2008)
morte de rvores.
Neonectria ditissima Cancro Formao de cancros em PQ BRASIL (2008)
(= Neonectria galligena) ramos e troncos, secamento de
ponteiros.
Taphrina populina Galhas foliares Enrolamento do limbo foliar e PQ BRASIL (2008)
formao de galhas.
Valsa nivea Cancros Formao de cancros em PQ BRASIL (2008)
ramos e troncos, secamento de
ponteiros.
Venturia populina Mancha foliar Manchas foliares e queima de PQ BRASIL (2008)
ponteiros em rvores.
Poplar mosaic vrus - Popmv Mancha foliar Manchas foliares PQ BRASIL (2008)
*PQ praga quarentenria, de acordo com lista A1 de pragas quarentenrias para o Brasil.

tgenos quarentenrios, os impactos podem ser vasculares, patgenos de caule e patgenos de parte
agrupados em funo do tipo de parasitismo nas area (Auer & Santos, 2012).
espcies florestais: patgenos de razes, patgenos Os patgenos de razes pertencem aos gne-

110 RAPP - Volume 24, 2016


Celso Garcia Auer e lvaro Figueredo dos Santos (104-114)

ros Armillaria (Armillaria tabescens, Armillaria os- Consideraes finais


toyae e Armillaria luteobubalina) e Heterobasidion Os impactos da ao de patgenos exticos
(Heterobasidion annosum). O principal stio de florestais, quarentenrios ou no, so relatados nos
ataque so as razes e o colo da rvore, colonizan- plantios nativos ou comerciais estabelecidos nos
do a casca, o cmbio e o lenho. As plantas doentes pases de origem das espcies florestais exticas ou
apresentam declnio e morte por falta de gua e em outros pases onde tenham sido introduzidos. A
nutrientes, em consequncia da destruio das ra- preocupao constante do setor florestal a possi-
zes. A incidncia de rvores mortas varia em fun- bilidade que ocorram com a mesma magnitude de
o do potencial de inculo presente no solo do danos ou maior em plantios brasileiros. Os impactos
talho e leva reduo do estande, e consequente potenciais podem ser esperados na reduo da pro-
queda na produtividade de madeira por rea. dutividade das florestas, da qualidade da matria-
Os patgenos vasculares pertencem aos g- -prima (madeira) produzida e, em casos mais graves,
neros Bursaphelenchus (Bursaphelenchus mucro- o impedimento do uso de determinadas espcies ou
natus e Bursaphelenchus xylophilus). O principal de materiais genticos altamente produtivos, devido
stio de ataque o sistema vascular da planta, que a sua suscetibilidade aos patgenos exticos. Outro
colonizado pelo patgeno impedindo a passa- tipo de impacto negativo o caso de patgenos ex-
gem de gua e de nutrientes entre as razes (gua ticos parasitarem espcies florestais nativas promo-
e nutrientes) e a copa (fotossintetizados). Como vendo a mortalidade e reduo de florestas e biomas
resultado, tambm ocorre o declnio das plantas e (Garbelotto & Pautasso, 2012). Em qualquer um dos
sua morte em casos de intensa colonizao dos va- tipos de impactos apontados, esperam-se impactos
sos condutores. A paralisao no desenvolvimento sociais negativos tanto pela reduo de postos de
das plantas e sua morte concorrem para a reduo empregos como pela falta de produtos madeireiros
na produtividade de madeira por rea. ou no oriundos das florestas nativas.
Os patgenos de tronco pertencem aos g- Os patgenos florestais exticos podem ter
neros fngicos Giberella (Fusarium circinatum), sido introduzidos no Brasil, pela forma tradicional
Cronartium (Cronartium fusiforme) e Endocronar- mais conhecida, que atravs de material gentico
tium (Endocronartium harknessii). Estes fungos (sementes, mudas e estacas) durante as introdues
afetam a casca da rvore, podendo causar sua de espcies florestais, em diferentes perodos de ex-
morte, tendo como consequncia principal a que- panso do setor florestal. Como exemplo, podemos
bra do tronco e a reduo da qualidade da madei- mencionar os fungos Diplodia pinea e Mycosphae-
ra de rvores doentes. rella pini, em Pinus (Ferreira, 1989; Krugner & Auer,
Os patgenos da parte area pertencem 2005a e b), que provavelmente foram introduzidos
aos gneros fngicos Drepanopeziza (Drepano- nas dcadas de 1940 e 1960. Outra forma a disse-
peziza populi-albae, Drepanopeziza populorum minao de propgulos de patgenos por meio de
e Drepanopeziza punctiformis), Mycosphaerella eventos meteorolgicos que podem levar esporos
(Mycosphaerella dearnessii e Mycosphaerella de fungos e de bactrias a longas distncias, como
gibsonii), Neonectria (Neonectria galligena), Ta- foram os casos de ferrugens e manchas foliares em
phrina (Taphrina populina) e Venturia (Venturia culturas agrcolas (Brown & Hovmller, 2002).
populina), alm do Poplar Mosaic Virus (vrus). Os Nos ltimos 20 anos, com o forte intercm-
principais stios de ataque so: as folhas e a copa bio comercial, especialmente de produtos agrcolas
das rvores, impedindo a fotossntese e o desen- e florestais entre os pases e regies, aumentam os
volvimento total da planta e, em casos mais seve- riscos (Wingfield et al. 2002; Cushman & Meente-
ros, a queima e queda das folhas. Como resultado, meyer, 2008; Andjic et al. 2011) e vias alternativas de
tambm h ocorrncia do declnio das plantas e introduo podem estar ocorrendo. Uma dessas for-
sua morte em casos de intensa colonizao. A pa- mas seria a presena de esporos e estruturas vege-
ralisao no crescimento das plantas e sua morte tativas e de resistncia em manufaturados de origem
concorrem para a reduo na produtividade de ma- florestal, como artesanatos em madeira, que passam
deira por rea. por vias que no passam pelo crivo da fiscalizao de
portos e aeroportos. Outra possibilidade a aquisi-

RAPP - Volume 24, 2016 111


Celso Garcia Auer e lvaro Figueredo dos Santos (104-114)

o de sementes e produtos naturais do exterior e nacional o eucalipto presente em todo o territrio


que so despachados pelo correio, sem fiscalizao nacional em profuso de espcies e clones (deriva-
sanitria. Tambm, pode ser comentada a presen- dos ou no de hbridos artificialmente produzidos),
a de patgenos em material utilizados nas deco- em variados biomas. Tal situao deve favorecer o
raes de festas (arranjos de plantas ornamentais) estabelecimento de ciclo de vida de diferentes tipos
em navios transatlnticos de turismo que percorrem de patgenos exticos. Tais aspectos criam preocu-
o mundo e que so descartados comumente nas pao quanto possibilidade de patgenos exticos
praias ou nos portos. O uso de embalagens e madei- se desenvolverem muito melhor do que no pas de
ra de suporte nos transportes areos, normalmente origem pela presena de ambientes favorveis no
de origem desconhecida, podem abrigar patgenos Brasil, de hospedeiros suscetveis e a ausncia de ini-
e sua introduo facilitada principalmente pela migos naturais (controle biolgico natural), a exem-
dificuldade de constatao da presena durante os plo do que ocorre com novos insetos introduzidos
trabalhos de fiscalizao sanitria. No entanto, estas (Alfenas et al., 2009).
formas de introduo no tm sido documentadas. A atualizao da lista A1 pela incluso de al-
Um aspecto a ser salientado a dificuldade guns patgenos exticos como por exemplo Phyto-
de levantamento bibliogrfico de patgenos existen- phthora pinifolia (em pnus) e Teratosphaeria spp.
tes devido s constantes mudanas na classificao (em eucalipto), impactantes ao cultivo de seus
taxonmica. Tal reordenamento do nome cientfico hospedeiros no exterior, seria plenamente justifica-
dificulta, s vezes, pela falta de especialistas, a busca da pelo risco que podem representar silvicultura
de informaes sobre patgenos considerados ex- nacional. Uma maior discusso sobre estes e outros
ticos. patgenos poderia ser estabelecida com o envolvi-
A atual listagem A1 de pragas quarentenrias mento das universidades, institutos de pesquisa e o
para o Brasil (BRASIL, 2008) no especifica a qual setor privado .
cultura um dado patgeno est associado. Desse A identificao e diagnose das doenas de
modo, um dado patgeno considerado quarenten- patgenos de plantas requer treinamento especfico
rio poder ser importante tanto para culturas agr- quanto s caractersticas dos patgenos, dos sinto-
colas como culturas florestais ou somente para uma mas e sinais produzidos nas plantas hospedeiras. A
dessas. Outro aspecto a ser levantado a presena diagnose rpida feita a olho nu ou com o auxlio de
de patgenos que no atacam as espcies florestais uma lupa, no garante a sua qualidade, tornando-se
plantadas no Brasil. Um exemplo o caso de Brenne- necessrio o uso de ferramentas laboratoriais, alm
ria salicis (= Erwinia salicis). Segundo CROP (2016a), dos mtodos moleculares. No entanto, faltam proto-
esta bactria est presente somente em salicceas colos especficos rotineiros e, ainda, alta a relao
do gnero Salix, o qual no plantado comercial- custo-benefcio.
mente no Brasil e assim pode ser questionada sua A capacitao dos futuros tcnicos nos cur-
colocao na lista A1. Esta bactria poder causar ris- sos de graduao e ps-graduao sobre os patge-
cos ambientais se for patognica s espcies nativas nos exticos quarentenrios deveria ser estimulada
de salicceas como Salix humboldtiana. Dois exem- (Auer & Santos, 2013), alm dos cursos de capacita-
plos de riscos ambientais em espcies florestais na- o tcnica em Sanidade Florestal para os profissio-
tivas so a introduo de Phytophthora cinnamomi nais do sistema de defesa vegetal sobre taxonomia,
na Austrlia (Shearer at al. 2004) e o surgimento de morfologia, hospedeiros, biologia e ecologia, meios
Phytophthora ramorum nos Estados Unidos e Gr- de disperso, impactos, sintomas, mtodos de de-
-Bretanha (Grnwald et al., 2012), ambos afetando teco e inspeo e medidas de controle.
a ecologia das florestas nativas e causando danos
irreversveis nas populaes de espcies suscetveis. Referncias
A lista de patgenos quarentenrios para flo- ABRAF (2013) Anurio Estatstico ABRAF 2013 Ano
restas poderia ser maior, caso houvesse um estudo Base 2012. Braslia, ABRAF. 148p.
especfico para patgenos em espcies florestais, Andjic V, Dell B, Barber P, Hardy G, Wingfield M, Bur-
como foi apontado para cada um dos gneros flores- gess T (2011) Plants for planting; indirect evidence
tais estudados. Uma das culturas de maior expresso of movement of a serious pathogen, Teratosphae-

112 RAPP - Volume 24, 2016


Celso Garcia Auer e lvaro Figueredo dos Santos (104-114)

ria destructans, in Asia. European Journal Of Plant teak leaf rust disease caused by Olivea tectonae
Pathology 131:49-58. in Brazil. Australasian Plant Disease Notes 5:113-
Ahumada R, Rotella A, Slippers B, Wingfield MJ 114.
(2013) Pathogenicity and sporulation of Phytoph- Caldeira SF, Santos AF, Auer CG (2014) Doenas de
thora pinifolia on Pinus radiata in Chile. Australa- teca. In: Gasparotto L, Bentes JLS, Pereira JCR
sian Plant Pathology 42:413-420. (Ed.). Doenas de espcies florestais arbreas na-
Alfenas AC, Zauza EAV, Mafia RG, Assis TF (2009) Clo- tivas e exticas na Amaznia. Braslia, DF: Embra-
nagem e doenas em eucalipto. 2th Ed. Viosa, pa. pp. 171-194.
UFV. 500p. Cndido TS, Silva AC, Guimares LMS, Ferraz HGM,
Auer CG, Santos AF (2012) Impactos causados por Borges Jnior N, Alfenas AC (2014). Teratosphae-
patgenos introduzidos em espcies florestais no ria pseudoeucalypti on eucalyptus in Brazil. Tropi-
Brasil e riscos de introduo de novas espcies. cal Plant Pathology, 39:407-412.
In: Seminrio Internacional sobre Pragas Quaren- Carnegie AJ (2007) Forest health condition in New
tenrias Florestais, 2012, Curitiba. Documentos. South Wales, Australia, 19962005. II. Fungal
Colombo: Embrapa Florestas, 2012. v. 244. p. 1-3. damage recorded in eucalypt plantations dur-
Auer CG, Santos AF (2013) Doenas fngicas qua- ing forest health surveys and their management.
rentenrias de arbreas para o Brasil e medidas Australasian Plant Pathology 36:225239
preventivas. In: NEFIT Ncleo de Estudos em CROP PROTECTION COMPENDIUM (2016a) Datash-
Fitopatologia (Ed.) Patologia Florestal: desafios et: Brenneria salicis. Wallingford UK. CAB Inter-
e perspectivas. So Carlos, SP. Suprema Grfica e national. Available at: http://www.cabi.org/cpc/
Editora. pp. 335-350. datasheet/21936. Accessed on April 12, 2016.
Borges, RCF, Santos, MDM, Macedo, MA, Martins, I, CROP PROTECTION COMPENDIUM (2016b) Datash-
Nascimento, AG, Cafe-Filho, AC, Boiteux, LS, Fon- et: Phellinus noxius. Wallingford UK. CAB Inter-
seca, MEN, Inacio, CA, Mello, SCM (2015). A trunk national. Available at: http://www.cabi.org/cpc/
canker disease of Tectona grandis induced by datasheet/40154. Accessed on April 22, 2016.
Lasiodiplodia theobromae in Brazil. New Disease Cushman JH, Meentemeyer RK (2008) Multi-scale
Reports 31: 26. patterns of human activity and the incidence
Bonaldo SM, Barceli AC, Trento RA, Gasparotto F, Ta- of an exotic forest pathogen. Journal of Ecology
ffarel C (2011) Relato oficial da ocorrncia de Oli- 96:766-776.
vea tectonae em teca (Tectona grandis) no Brasil. Farr DF, Rossman AY (2016) Fungal Databases, Sys-
Summa Phytopathologica 38:153. tematic Mycology and Microbiology Laboratory,
BRASIL. Ministrio da Agricultura, Pecuria e Abaste- ARS, USDA. Available at: http://nt.ars-grin.gov/
cimento (2008) Anexo 1 - Lista de Pragas Quaren- fungaldatabases/.Accessed on April 12, 2016.
tenrias Ausentes (A1). In: Instruo normativa Ferreira FA (1989) Patologia florestal. Viosa, SIF.
n 41, de 1 de julho de 2008. Dirio Oficial da 570p.
Unio: Seo 1, Braslia, DF, ano 145, n. 125, p. Garbelotto M, Pautasso M (2012) Impacts of exotic
8-10, 02 jul. 2008. forest pathogens on Mediterranean ecosystems.
BRASIL. Ministrio da Agricultura, Pecuria e Abas- European Journal of Plant Pathology 133:101-
tecimento (2013) Anexo II - Lista de Pragas Qua- 116.
rentenrias Presentes. In: Instruo normativa n Grnwald NJ, Garbelotto M, Goss EM, Heungens K,
59, de 18 de dezembro de 2013. Dirio Oficial da Prospero S (2012) Emergence of the sudden oak
Unio: Seo 1, Braslia, DF, ano 150, n. 246, p. death pathogen Phytophthora ramorum. Trends
91-92, 19 dez. 2013. im Microbiology 20:131-138.
Brown JKM, Hovmller MS (2002) Aerial Dispersal of Krugner TL. Auer CG (2005a) Doenas dos eucaliptos.
Pathogens on the Global and Continental Scales In: Kimati H, Amorim L, Rezende JAM, Bergamin
and Its Impact on Plant Disease. Science 297:537- Filho A, Camargo LEA (Eds.) Manual de Fitopato-
541. logia. So Paulo, SP. Ceres. Vol. 2. pp. 319-332.
Cabral PGC, Capucho AS, Pereira OL, Maciel-Zambo- Krugner TL. Auer CG (2005b) Doenas dos pinheiros.
lim E, Freitas RL, Zambolim L (2010) First report of In: Kimati H, Amorim L, Rezende JAM, Bergamin

RAPP - Volume 24, 2016 113


Celso Garcia Auer e lvaro Figueredo dos Santos (104-114)

Filho A, Camargo LEA (Eds.) Manual de Fitopato- desafios e perspectivas. So Carlos, SP. Suprema
logia. So Paulo, SP. Ceres. Vol. 2. pp. 517-522. Grfica e Editora. pp. 157-167.
IB. Relatrio Ib 2015 (2015). Braslia, Indstria Santos AF, Luz EDMN, Bezerra J L (2007) Etiologia e
Brasileira de rvores. 77p. manejo das principais doenas da accia-negra
May-de Mio LL, Amorim L (2005) Doenas do la- que ocorrem no Brasil. In: LUZ WC (Ed.). Reviso
mo. In: Kimati H, Amorim L, Rezende JAM, Ber- anual de patologia de plantas. Passo Fundo: RAPP.
gamin Filho A, Camargo LEA (Eds.) Manual de v. 15. p. 335-359.
Fitopatologia. So Paulo, SP. Ceres. Vol. 2. pp. Santos AF, Machado EB, Tessmann DJ, Thomazi H
19-23. (2015) Patogenicidade de Rosellinia bunodes ao
Perez G, Slippers B, Wingfield BD, Finkenauer E, lamo. In: Summa Phytopathologica 41, Suple-
Wingfield MJ (2009) Mycosphaerella Leaf Dise- mento. Resumo 042.
ase (MLD) outbreak on Eucalyptus globulus in Santos AF, Machado EB, Stanosz, GR, Smith, DR
Brazil caused by Teratosphaeria (Mycosphae- (2010) Primeiro relato da ocorrncia de Septoria
rella) nubilosa. Phytopathologia Mediterranea musiva em lamo no Brasil. Tropical Plant Patho-
48:302306. logy 35:52-53.
Pieri C, Passador MM, Furtado, EL, Carvalho Junior Schneider PR, Fortes FO, Souza LHS, Lucio AD, Finger
AA (2011). Ferrugem da teca (Olivea neotec- CAG, Schneider PSP (2005) Anlise da mortalida-
tonae): novas ocorrncias no Brasil e reviso de de Acacia mearnsii De Wild. Cincia Florestal
do nome especfico. Summa Phytopathologica 15:137-143.
37:199-201. Shearer BL, Crane CE, Cochrane A (2004) Quantifica-
Roux J, Mthalane ZL, de Beer ZW, Eisenberg B, tion of the susceptibility of the native flora of the
Wingfield MJ (2006) Quambalaria leaf and South-West Botanical Province, Western Austra-
shoot blight on Eucalyptus nitens in South Af- lia, to Phytophthora cinnamomi. Australian Jour-
rica. Australasian Plant Parthology 35:427-433. nal of Botany 52:435-443.
Roux J., Meke G, Kanyi B, Mwangi L, Mbaga A, Shimizu JY, Sebben, AM (2008) Espcies de Pinus na
Hunter GC, Nakabonge G, Heath RN, Wingfield Silvicultura Brasileira. In: Shimizu JY (Ed.). Colom-
MJ (2005) Diseases of plantation forestry trees bo, Embrapa Florestas.pp. 49-74.
in eastern and southern Africa. South African Wingfield MJ, Coutinho TA, Roux J, Wingfield BD
Journal of Science 101: 409-413. (2002) The future of exotic plantation forestry in
Santos AF, Luz EDMN, Auer CG (2013) Phytophthora the tropics and Southern Hemisphere: lessons
em espcies florestais. In: NEFIT Ncleo de Es- from pitc canker. Southern African Forestry Jour-
tudos em Fitopatologia (Ed.) Patologia Florestal: nal 195:79-82

114 RAPP - Volume 24, 2016


Bruna Canabarro Pozzebon e Juliano dos Santos (115-129)

BACTRIAS ENDOFTICAS: PASSADO,


PRESENTE E PERSPECTIVAS VISANDO UM
FUTURO SUSTENTVEL
Bruna Canabarro Pozzebon1 e Juliano dos Santos2

RESUMO
Bactrias endofticas so conhecidas por colonizar os tecidos internos
das plantas sem desencadear sintomas de doenas. Estudos moleculares re-
centes sobre a diversidade de bactrias endofticas revelaram que existe uma
grande riqueza de espcies, e que estas podem advir de sementes, da rizosfera,
do filoplano de material propagativo, e penetrar na planta via estmatos, feri-
mentos e microferimentos causados pela emergncia das razes laterais. Muitos
estudos tm demonstrado que esses micro-organismos podem ser uma alterna-
tiva aos mtodos de controle de pragas e doenas praticados atualmente, pois
so capazes de prevenir ou reduzir efeitos deletrios causados por patgenos a
partir da multiplicao e ao de mecanismos de biocontrole, desempenhados
pela sntese de siderforos, volteis, substncias antimicrobianas, competio
por espao e nutrientes e resistncia sistmica. Bactrias endofticas tambm
podem promover o crescimento de plantas, atravs da solubilizao de nutrien-
tes, sntese de fitohormnios e fornecimento de vitaminas, bem como promo-
ver efeitos benficos adicionais planta, conduzindo para a resistncia contra o
estresse abitico, ataque de insetos e fitorremediao. Desta forma, explorar o
uso de bactrias endofticas pode colaborar para a agricultura sustentvel, por
reduzir os custos de produo com agrotxicos e insumos qumicos, alm de
reduzir os riscos ao meio ambiente e sade humana.

Introduo do mecanismos de adaptao ao meio ambiente e


A teoria de que bactrias no patognicas muitos deles so possveis devido s interaes en-
habitam os tecidos internos de plantas iniciou com tre os micro-organismos e a planta (Peixoto Neto et
Perrotti em 1926, porm somente a partir de 1940, al., 2004). As bactrias so habitantes comuns dos
comearam a ser divulgadas pesquisas relatando tecidos internos e externos de plantas, e so consi-
a presena de bactrias endofticas em rgos dis- deradas endofticas quando colonizam internamen-
tintos da planta, como flores, frutos, folhas, caules, te os tecidos vegetais sem mostrar qualquer sinal
razes, e sementes (Hallmann et al., 1997; Sturz et externo de infeco ou efeito negativo no hospe-
al., 2000; Thomas et al., 2007; Melnick et al,. 2008; deiro (Holliday, 1989; Schulz e Boyle, 2006). Esses
Barretti et al., 2009; Piccolo et al., 2010; Qin et al., micro-organismos se estabelecem nos espaos in-
2011). ter- e intracelulares, dentre os quais destacam-se
Evolutivamente, as plantas tm desenvolvi- o parnquima, epiderme, bainha do feixe vascular,

1
Departamento de Fitopatologia, Universidade Federal de Lavras. Av. Doutor Sylvio Menicucci, 1001 - Kennedy, Lavras - MG, 37200-
000. 2Departamento de Biologia, Universidade Federal do Maranho. Av. dos Portugueses, 1966 - Bacanga, So Luis - MA, 65080-805.

RAPP - Volume 24, 2016 115


Bruna Canabarro Pozzebon e Juliano dos Santos (115-129)

xilema e floema (Elbeltagy et al., 2001; Yonezawa as bactrias endofticas podem trazer benefcios por
et al., 2004; Franke-Whittle et al., 2005; Almeida et fornecer vitaminas essenciais planta, aumentar a
al., 2009; Esposito-Polesi, 2010; Piccolo et al., 2010). captao e solubilizao de minerais, regular o ajus-
Alm disso, podem mover-se do solo para as plan- te osmtico e a abertura e fechamento dos estma-
tas, principalmente atravs de fissuras que surgem tos, alm de modificar a morfologia radicular (Ryan
devido emergncia de razes laterais, ou penetrar et al., 2008). No tocante ao biocontrole, esses mi-
no hospedeiro pelas folhas, flores e frutos atravs do cro-organismos so capazes de prevenir ou reduzir
sistema vascular do hospedeiro, tirando proveito de efeitos deletrios causados por patgenos a partir
uma grande disponibilidade de nutrientes (Hardoim de mltiplos mecanismos de ao, desempenha-
et al., 2008; Compant et al., 2011). dos pela sntese de siderforos, compostos volteis,
Os micro-organismos endofticos podem ser substncias antimicrobianas, competio por espa-
classificados em obrigatrios, quando so estrita- o e nutrientes, resistncia sistmica (Rosenblueth e
mente dependentes da planta hospedeira, ou facul- Martnez-Romero, 2006; Compant et al., 2010).
tativos, quando possuem uma fase do ciclo de vida O uso de bactrias endofticas na agricultu-
dentro da planta hospedeira e outra fase do ciclo de ra se apresenta como uma alternativa de manejo
vida livre (Hardoim et al., 2008). As associaes dos ao controle de doenas e promoo de crescimen-
endofticos com seus hospedeiros geralmente so to de plantas, devido relao custo/benefcio que
simbiticas e/ou mutualsticas (Guo et al., 2008; Me- apresentam para o produtor. Com a utilizao de
lnick et al., 2008). Outro fator importante a relao produtos de base biolgica, possvel reduzir o uso
da planta hospedeira com a comunidade endoftica, excessivo de agrotxicos e insumos qumicos, o que
que envolve um processo co-evolutivo que conduz consequentemente colabora para a reduo dos cus-
a mudanas nas relaes em nvel celular e molecu- tos de produo. Contudo, esses micro-organismos
lar, contribuindo de diferentes formas na sanidade ainda precisam ser estudados minuciosamente, para
e desenvolvimento da planta (Aravind et al., 2010). que se possa conhecer e elucidar os mecanismos
Notadamente, esses micro-organismos apresentam que esto envolvidos nos processos de controle bio-
vantagem adicional em comparao a outros, pois lgico e/ou promoo de crescimento. Assim, a pre-
so protegidos contra flutuaes bruscas de tempe- sente reviso aborda o uso de bactrias endofticas
ratura, dessecao, radiaes solares e competio na agricultura, englobando o passado, presente e as
microbiana, por habitarem o interior do hospedeiro perspectivas do uso desses micro-organismos visan-
(Francis et al., 2010). do um futuro sustentvel para a produo agrcola, e
A maioria das pesquisas sobre bactrias asso- principalmente para o produtor.
ciadas a plantas se concentram principalmente em
trabalhos cientficos que utilizam rizobactrias no Bactrias endofticas um breve histrico
biocontrole de patgenos (Malfanova et al., 2011). O termo endoftico ou endfito (do grego en-
Entretanto, pesquisas sobre a diversidade, interao don = dentro e phyton = planta) foi atribudo por De
e o papel das bactrias endofticas, tem se tornado Bary, em meados de 1866, ao estudar a colonizao
objeto de estudo em todo o mundo, visando eluci- de tecidos internos de plantas por micro-organismos
dar os mecanismos de proteo e crescimento por (Baldani et al., 2002; Saikkonen et al., 2004). Entre-
elas promovidos (Rosemblueth e Martnez-Romero, tanto, existem autores que atribuem a Perotti, em
2006; Ryan et al., 2008). Fundamentado nisso, vrios 1926, a descrio dessa relao natural de bact-
trabalhos tm sido desenvolvidos com essas duas te- rias endofticas e seus hospedeiros (Hallmann et al.,
mticas, haja vista que a demanda pelo consumo dos 1997). Os primeiros relatos consideraram as bac-
produtos orgnicos est em ascenso, principalmen- trias endofticas como contaminantes resultantes
te devido busca por alimentos saudveis e a pre- da desinfestao superficial incompleta dos tecidos
ocupao com a sade (Alves e Cunha, 2012), bem vegetais, ou como patgenos fracamente virulentos
como a preservao do meio ambiente e a constante (Hollis, 1951). Por mais de meio sculo, esses micro-
busca dos produtores rurais por menores custos de -organismos permaneceram ignorados e conside-
produo no manejo da lavoura. rados de pouca importncia no meio cientifico, e
Como promotoras de crescimento de plantas, s ento, depois de muitos anos, o papel biolgico

116 RAPP - Volume 24, 2016


Bruna Canabarro Pozzebon e Juliano dos Santos (115-129)

exercido por esses agentes microbiolgicos come- o da diversidade de bactrias endofticas que po-
ou a ser estudado. dem levar descoberta de novos agentes potenciais
Evolutivamente, os micro-organismos endof- de biocontrole e/ou promotores de crescimento e
ticos foram mencionados pela primeira vez no incio estudos de fitorremediao.
do sculo XIX, mas foi apenas no final dos anos 70 do
sculo XX que eles passaram a ter maior nfase em
trabalhos cientficos (Santos e Varavallo, 2011). Um
dos primeiros estudos com bactrias endofticas foi
realizado por Colombo (1978), que sugeriu a ocor-
rncia de um equilbrio fisiolgico entre bactrias
e algas, pois em seu estudo relatou a ocorrncia de
bactrias endofticas entre sifes e dentro dos fila-
mentos cenocticos das algas. Entretanto, a partir dos
anos 80, os trabalhos com agentes endofticos pas-
saram a ser mais frequentes, principalmente aque-
les relacionados com a ocorrncia e diversidade de
bactrias endofticas em plantas. Jacobs et al. (1985)
enumeraram, localizaram e caracterizaram bactrias
endofticas nas razes de beterraba aucareira (Beta
vulgaris altissima) utilizando tcnicas imunolgicas e
microscopia eletrnica de varredura. Nesse estudo,
os autores verificaram que a maior ocorrncia das
bactrias endofticas foi nas regies centrais e peri-
fricas da raiz, ocorrendo principalmente as espcies
Bacillus subtilis, Pseudomonas aeruginosa, Coryne- Figura 1. Etapas do isolamento de bactrias endofticas
de diferentes tecidos vegetais de arroz. (A) Isolamento de
bacterium sp, e Erwinia herbicola. J nos anos 90, bactrias endofticas de colmos de plantas sadias de ar-
surgiram estudos que demonstraram que esses mi- roz. (B) Isolamento de bactrias endofticas de razes de
cro-organismos possuem funes importantes para plantas sadias de arroz. (C) Macerao dos tecidos para
seus hospedeiros, como a proteo de plantas ao liberao das bactrias do interior para o exterior do teci-
do vegetal. (D) Plaqueamento da suspenso previamente
ataque de insetos, proteo contra a infestao de macerada. (E-F) Colnias de bactrias endofticas aps 24
doenas causadas por fitopatgenos e proteo do h em cmara de crescimento tipo BOD. Foto: Pozzebon,
ataque de mamferos herbvoros por meio da produ- 2013.
o de toxinas (Azevedo, 1998; Azevedo, 1999; Aze-
vedo et al., 2000; Peixoto Neto et al., 2002). Bactrias endofticas e o controle biolgico
Atualmente, a interao de bactrias endof- medida que a agricultura aumenta, cresce
ticas e seus hospedeiros tem sido objeto de estudo tambm o uso desordenado de produtos qumicos
em todo mundo (Sun et al., 2008). Bactrias endof- para assegurar a produtividade das culturas, porm
ticas tm sido isoladas de diferentes culturas, como, causando efeitos negativos para o meio ambiente
batata-doce (Ipomoea batatas) (Khan e Doty, 2009), e consequentemente aos alimentos e microbiota
algodo (Populus deltoides) (Xin et al., 2009), videi- benfica e natural das plantas. Nesse contexto, o
ra (Vitis vinifera) (West et al., 2010), soja (Glycine controle biolgico por bactrias endofticas tem sido
max) (Hung et al., 2007), tomateiro (Solanum lyco- amplamente estudado e surge como uma forma al-
persicum) (Marquez-Santacruz et al., 2010), batata ternativa de controle para uma agricultura mais sus-
(Solanum tuberosum) (Andreote et al., 2009; Manter tentvel.
et al., 2010), arroz (Oryza sativa) (Rangjaroen et al., Resumidamente, os princpios de controle
2015) (Figura 1). Esses estudos tem sido importan- biolgico se baseiam principalmente na relao an-
tes para a compreenso das interaes ecolgicas e tagnica entre micro-organismos, como a antibiose
para o desenvolvimento de aplicaes biotecnolgi- (Figura 2), competio, parasitismo, hipovirulncia,
cas (Ryan et al., 2008), bem como para a identifica- predao e induo de defesas do hospedeiro (Fi-

RAPP - Volume 24, 2016 117


Bruna Canabarro Pozzebon e Juliano dos Santos (115-129)

gura 3) (Bettiol e Ghini, 1995). Desta forma, poderia


se utilizar no controle de uma determinada doena,
um micro-organismo no patognico que apresenta
necessidades nutricionais semelhantes as do pat-
geno, visando promover a competio por espao e
nutrientes, que consequentemente reduziria a dis-
seminao da doena, ou ainda usufruir da capaci-
dade que determinados micro-organismos possuem
de produzir substncias com ao antibitica ou an- Figura 2. Antibiose desencadeada em teste in vitro contra
tifngica (Santos e Varavallo, 2011). o fungo Bipolaris oryzae. Setas pretas indicam a presena
Com relao ao biocontrole de doenas, h da bactria endoftica e a formao de halo de antibiose
inmeros trabalhos tanto in vitro quanto in vivo re- no meio de cultura. Foto: Pozzebon, 2014.
portando o sucesso do uso de bactrias endofticas
contra diversos patgenos, principalmente porque et al., 2009; Lin et al., 2013; Purnawati et al., 2014)
essas bactrias possuem capacidade de reduzir ou (Tabela 1).
prevenir os efeitos deletrios de patgenos (Barretti Silva et al. (2008), mostraram que o isolado

Tabela 1. Bactrias endofticas com atividade fngica, bactericida, nematicida e inseticida sobre diferentes patgenos
e pragas.
Endfito Patgeno Atividade Referncia
Bacillus subtilis Macrophomina phaseolina Fungicida Singh et al. (2008)
Botrytis cinerea Fungicida Trotel-Aziz et al. (2008)
B. amyloliquefaciens Lasiodiplodia crassispora Fungicida Yuan et al. (2012)
L. rubropurpurea Fungicida Yuan et al. (2012)
L. theobromae Fungicida Yuan et al. (2012)
Ralstonia solanacearum Bactericida Nawangsih et al. (2011)
B. vallismortis Fusarium graminearum, Fungicida Zhao et al. (2010)
Alternaria alternata, Fungicida Zhao et al. (2010)
Rhizoctonia solani, Fungicida Zhao et al. (2010)
Cryphonectria parasitica, Fungicida Zhao et al. (2010)
Phytophthora capsici Fungicida Zhao et al. (2010)
Melnick et al. (2008)
B. thuringiensis Acromyrmexsp. Inseticida Pinto et al. (2003)
Nasutitermes ehrhardti Inseticida Castilhos-Fortes et al. (2002)
Meloidogyne javanica Nematicida Khan et al. (2010)
M. incognita Nematicida Mohammed et al. (2008)
Brevibacillus choshinensis Hemileia vastatrix Fungicida Silva et al. (2008)
Pseudomonas fluorescens Botrytis cinerea Fungicida Trotel-Aziz et al. (2008)
Pseudomonas sp. Pectobacterium atrosepticum Bactericida Ardanovet al. (2011)
Streptomyces spp. R. solanacearum Bactericida Tanet al. (2006)
Acinetobacter lwoffii Botrytis cinerea Fungicida Trotel-Aziz et al. (2008)
Pantoea agglomerans Botrytis cinerea Fungicida Trotel-Aziz et al. (2008)
Ochrobactrum sp. F. semitectum Fungicida Assumpo et al. (2009)

F. oxysporum Fungicida Assumpo et al. (2009)


Cercospora kikuchii Fungicida Assumpo et al. (2009)
Cedecea davisae Hemileia vastatrix Fungicida Silva et al. (2008)
Staphylococcus epidermidis Ralstonia solanacearum Bactericida Nawangsih et al. (2011)

118 RAPP - Volume 24, 2016


Bruna Canabarro Pozzebon e Juliano dos Santos (115-129)

endoftico 119G reduziu significativamente a severi- cas pode ser feito atravs do uso direto de bact-
dade da ferrugem do cafeeiro em nveis de controle rias que apresentam atividade entomopatognica
acima de 60% em mudas previamente tratadas com natural, ou atravs do uso desses micro-organismos
essa bactria. Da mesma forma, Nawangsih et al. como hospedeiros para expressarem genes oriundos
(2011), estudaram dois isolados de bactrias endo- de outros micro-organismos do solo, ou mesmo ge-
fticas para o biocontrole da murcha bacteriana do nes sintticos (Pleban et al., 1995). Um dos princi-
tomateiro, em que os isolados BC4 e BL10 reduziram pais e mais estudados agentes de controle biolgico
significativamente a intensidade da doena em 33% a bactria Bacillus thuringiensis, que responsvel
e 43%, respectivamente. Assumpo et al. (2009), por 95% do mercado mundial de biopesticidas, prin-
avaliaram o potencial biotecnolgico da comunidade cipalmente devido produo de corpos de incluso
bacteriana endoftica de sementes de soja e detecta- cristalinos, que so ingeridos por lagartas e resultam
ram que 18% dos isolados controlaram o crescimen- na morte das mesmas (Polli et al., 2012).
to de fungos fitopatognicos, 100% produziram ci- B. thuringiensis pode ser encontrado em
do indol actico (AIA), e 39% solubilizaram fosfato. diferentes substratos, principalmente no solo, e se
Kuss et al. (2006) avaliaram a fixao de nitrognio e caracteriza por produzir incluses proteicas com
produo de AIA in vitro por bactrias diazotrficas propriedades inseticidas, acaricidas e nematicidas
endofticas associadas a razes de arroz (Oryza sati- (Crickmore, 2005). Sua especificidade em razo da
va) e obtiveram resultados promissores. presena de genes cry que codificam as protenas
Alm de atuarem no controle biolgico de txicas ou protenas Cry (delta-endotoxinas) (Hfte
doenas de plantas, as bactrias endofticas tam- e Whiteley 1989; Crickmore et al. 1998; Pinto e Fiu-
bm so capazes de proteger as plantas contra o za 2002), as quais apresentam atividade inseticida
ataque de insetos praga. Inseticidas microbiolgicos, em diferentes ordens de insetos, como Lepidopte-
especialmente base de bactrias, tem sido desen- ra, Coleoptera, Diptera, Hymenoptera, Hemiptera,
volvidos desde a dcada de 70 como alternativa de Isoptera, Orthopera, Siphonaptera e Thisanoptera
controle biolgico, e atualmente, muitos produtos (Feitelson et al., 1992; Aranda et al., 1996; Cavados
esto disponveis no mercado para controlar uma et al., 2001; Castilhos-Fortes et al., 2002; De Maagd
ampla gama de pragas (Federici et al., 2010), sendo et al., 2003; Pinto et al., 2003), alm de apresentar
considerados uma das mais importantes tticas de efeito nematicida (Khyami-Horani e Al-Banna 2006;
controle, devido crescente preocupao com a re- Mohammed et al., 2008; Khan et al., 2010).
duo do uso de produtos qumicos e principalmen- Outro tipo de protena produzida por B. thu-
te, para o desenvolvimento de uma agricultura mais ringiensis so as protenas Cyt, que apresentam ativi-
sustentvel e produtiva (Moreira e Siqueira, 2006). dade txica moderada para dpteros e para algumas
O controle de pragas por bactrias endofti- espcies de colepteros, ocorrendo tipicamente em
subespcies de B. thuringiensis com atividade mos-
quitocida (Federici et al., 2010). Trabalhos com o
uso dessa bactria endoftica visando o controle de
insetos praga vem sendo desenvolvidos em todo o
mundo. Por exemplo, no estudo publicado por Via-
na et al. (2009), os autores constataram que dos 58
isolados de B. thuringiensis testados em lagartas de
Plutella xylostella, 12 causaram 100% de mortalida-
de num intervalo de tempo entre 24-48 h. Em outro
estudo, conduzido por Macedo et al. (2012), os au-
tores selecionaram e caracterizaram estirpes nativas
de B. thuringiensis, entre as quais observaram que
trs isolados causaram mais de 75% de mortalidade
Figura 3. Induo de resistncia sistmica (ISR) em plan- de Diatraea saccharalis (Lepidoptera: Crambidae).
tas de arroz com 21 dias aps a inoculao de B. oryzae. Zhang et al. (2010), isolaram bactrias endo-
(A) Tratamento Controle (gua). (B) Tratamento com o fticas de razes, caules, folhas e sementes de menta
isolado endoftico 76. Foto: Pozzebon, 2014.

RAPP - Volume 24, 2016 119


Bruna Canabarro Pozzebon e Juliano dos Santos (115-129)

do Turquisto (Achnatherum inebrians), em que o


isolado Streptomyces rochei aumentou 85% a taxa
de mortalidade do pulgo do algodoeiro (Aphis gos-
sypii). Rampelotti-Ferreira et al. (2010) avaliaram a
colonizao de bactrias endofticas em plntulas
e em larvas de Spodoptera frugiperda. Nesse estu-
do, o isolado Methylobacterium mesophilicum cepa
SR1.6/6 foi marcado com gfp (protena verde fluores-
cente), que foi encontrado nas larvas que se alimen-
Figura 4. Promoo de crescimento de plantas de arroz
taram das plntulas inoculadas com essa bactria, com cinco dias de idade, em meio de cultura pobre. (A)
por meio de anlises de microscopia fluorescente. Tratamento controle (gua) apresentando reduo no
Desta forma, pode-se afirmar que as bac- crescimento de plntulas de arroz. (B) Tratamento com o
trias endofticas atuam como agentes de controle isolado endoftico 209, demonstrando o potencial da bac-
tria em promover o crescimento de plntulas de arroz.
biolgico, e so capazes de proteger o hospedeiro Foto: Pozzebon, 2014.
pela sntese de molculas antimicrobianas, produ-
o de siderforos para captao de ferro, compe-
tio de nutrientes com patgenos e produzindo mos qumicos utilizados em grande escala em lavou-
outras molculas que so capazes de induzir resis- ras agrcolas.
tncia sistmica induzida (ISR) na planta colonizada Micro-organismos capazes de solubilizar fos-
(Compant et al., 2010). Alm disso, podem agir atra- fato podem ser uma alternativa economicamente vi-
vs da produo de toxinas que atuam no controle vel para o produtor, pois reduzem os custos com in-
de insetos, podendo se tornar uma tima alternativa sumos na lavoura. O principal mecanismo envolvido
para os produtores, no manejo de diversas culturas, na solubilizao de fsforo a produo e liberao
corroborando a reduo do uso de agroqumicos e de cidos pelas bactrias, como o cido lctico, ita-
consequentemente, reduo da contaminao am- cnico, isovalrico, isobutrico e actico (Vazquez et
biental, humana e animal por esses produtos. al., 2000; Dias et al., 2009). Gneros como Bacillus,
Pseudomonas, Enterobacter, Erwinia e Ochrobac-
Bactrias endofticas e a promoo de crescimento trum, podem solubilizar complexos de fosfato pela
de plantas secreo de cidos orgnicos. Uma vez na forma
Estudos sugerem que alm de exercer me- solvel, esses fosfatos podem ser absorvidos pela
canismos de biocontrole, as bactrias endofticas bactria ou pela planta (Costa, 2012) e atuar na
tambm so capazes de promover o crescimento de promoo do crescimento vegetal (Babalola, 2010).
plantas (Figura 4) (Bandara et al., 2006; Ting et al., Bacillus pumilus e Acinetobacter calcoaceticus so
2008; Silva et al., 2012; Hidayati et al., 2014; Ran- bactrias endofticas capazes de solubilizar fosfato
gjaroen et al., 2015), que em grande parte se d e promover o crescimento de plantas (Kang et al.,
pela produo de fitohormnios como o cido indol 2009; Prez-Garca et al., 2011). Estudos in vitro com
actico (Piromyou et al., 2011; Arun et al., 2012.), plantas de ervilha (Pisum sativum L.), realizados por
cido abscsico, cido giberlico, citocininas (Feng Tariq et al. (2014) demonstraram o potencial de bac-
et al., 2006), fixao de nitrognio, solubilizao de trias endofticas em promover o crescimento de
fosfato, produo de ons de amnio (Nigris et al., plantas, onde seis isolados foram capazes de produ-
2013), mineralizao de fosfato orgnico (Jha e Ku- zir cido indol actico, dois foram capazes de fixar
mar, 2007), fornecimento de vitaminas essenciais, nitrognio e nove solubilizaram fsforo inorgnico.
aumento da captao e solubilizao de minerais, Gneros Acinetobacter, Azospirillum, Azo-
ajuste osmtico, regulao dos estmatos e modifi- tobacter, Pseudomonas e Bacillus, produzem fito-
cao da morfologia radicular, induo da produo hormnios como o cido indol actico, cido indol
de cido actico e produo de siderforos (Ryan et butrico, giberelinas, citocininas, octadecanides, e
al., 2008), o que torna esses agentes agronomica- compostos que mimetizam a ao dos jasmonatos
mente relevantes para fins de desenvolvimento de (Forchetti et al., 2007; Kang et al., 2009; Prez-Garca
biofertilizantes, sendo eles uma alternativa aos insu- et al., 2011). Ji et al. (2014) estudaram a promoo

120 RAPP - Volume 24, 2016


Bruna Canabarro Pozzebon e Juliano dos Santos (115-129)

de crescimento vegetal induzido por bactrias en- es (Esposito-Polesi, 2011), sendo que o uso de
dofticas e observaram que alguns de seus isolados plantas para a recuperao de ambientes poludos,
foram capazes de produzir auxina, siderforos e so- processo chamado de fitorremediao, pode ser um
lubilizar fosfato. Alm disso, esses autores demons- modo eficiente e de baixo custo, alm de no causar
traram que bactrias endofticas diazotrficas autc- danos adicionais ao ambiente (Gerhardt et al., 2009;
tones de arroz, proporcionaram maior crescimento Marques et al., 2011; Phillips et al., 2012).
das plantas e acrscimo no peso seco, bem como Embora as plantas disponveis para a fitorre-
promoveram efeitos antagnicos contra fungos pa- mediao tenham se adaptado a locais poludos, a
tognicos. Quecine et al. (2012) tambm verificaram presena de poluentes orgnicos no solo geralmen-
acumulao de biomassa em plantas de cana-de- te reduzem o desenvolvimento normal da planta e,
-acar tratadas com a endoftica Pantoea agglome- eventualmente, a eficcia da fitorremediao. A in-
rans, tanto da parte area quanto da raiz. terao das plantas com bactrias endofticas pode
Bactrias promotoras de crescimento vege- superar essas limitaes quando estas bactrias fo-
tal, como as dos gneros Pseudomonas, Bacillus, Ar- rem capazes de degradar os poluentes, promover o
throbacter, Enterobacter e Agrobacterium (Yuan et crescimento da planta, ou ambos (Peng et al., 2013;
al., 2010), produzem compostos indlicos, como ci- Glick, 2010; Khan et al., 2013). Assim, uma das for-
do indol actico, que quando sintetizado e secretado mas estudadas para as plantas superarem as condi-
pela bactria, age como hormnio de crescimento es adversas do solo so as associaes simbiticas
vegetal e induz o aumento das razes e folhas das com micro-organismos, sendo um mtodo menos
plantas (Babalola, 2010; Hayat et al., 2010). Burkhol- oneroso e ecologicamente correto (Newman e Rey-
deria vietnamiensis foi uma das primeiras espcies nolds, 2005; Postma et al., 2007; Zhang et al., 2011).
desse gnero, relatada como fixadora de nitrognio. Sob o ponto de vista da fitorremediao, nos ltimos
Entretanto, outras espcies, como Burkholderia bal- anos, tem havido grande interesse em comunidades
dani e Burkholderia unamae tambm so capazes endofticas, principalmente na interao de micro-
de desempenhar a funo de promotoras de cres- -organismos da parte area com as razes e com o
cimento de plantas atravs da fixao de nitrognio solo (Mengoni et al., 2009; Li et al., 2011).
(Govindarajan et al., 2006). Gluconacetobacter, Ace- Genes que codificam enzimas envolvidas na
tobacter, Azoarcus, Herbaspirillum e Methylobac- degradao de hidrocarbonetos tm sido descritos
terium so conhecidas como bactrias endofticas em uma ampla gama de bactrias endofticas per-
capazes de fixar biologicamente o nitrognio em tencentes aos gneros Arthrobacter, Bacillus, Ente-
plantas (Donato et al., 2005; Balachandar et al., robacter, Pantoea e Pseudomonas. Alm disso, tem
2006). sido observado que plantas que crescem em solos
contaminados por petrleo podem recrutar bact-
Bactrias endofticas e a fitorremediao rias endofticas que possuem genes capazes de de-
Compostos orgnicos, liberados no ambiente gradar hidrocarbonetos (Andria et al., 2009; Khan et
por diversas atividades humanas, podem causar s- al., 2013).
rios danos ao meio ambiente devido a sua toxicida- A importncia do sinergismo planta-endfito
de, natureza hidrofbica e persistncia por um longo na remoo dos poluentes orgnicos do solo e da
perodo de tempo. A presena de compostos org- gua ainda subestimada. Como muitas bactrias
nicos, tais como hidrocarbonetos poliaromticos, endofticas tem se mostrado eficazes na degradao
fenis, clorofenis, benzeno, herbicidas e pesticidas, de poluentes, em atividades de promoo de cres-
inibem o crescimento e as atividades metablicas cimento ou em ambos, um melhor conhecimento
de micro-organismos no solo, mesmo em pequenas dos mecanismos que regulam estas atividades deve
concentraes (Kukla et al., 2014). ser explorado a fim de melhorar a fitorremediao
Mtodos fsicos e qumicos tradicionais para de poluentes orgnicos presentes no solo e na gua
a recuperao do solo e gua contaminados por (Afzal et al., 2014).
poluentes orgnicos so geralmente caros e destru- Por outro lado, o papel das bactrias endof-
tivos ao ambiente. Neste sentido, existem muitos ticas para melhorar a fitorremediao de metais pe-
agentes biolgicos que remediam tais contamina- sados em solos contaminados tem sido revisado em

RAPP - Volume 24, 2016 121


Bruna Canabarro Pozzebon e Juliano dos Santos (115-129)

vrios artigos. A contaminao de metais pesados Bactrias endofticas, portanto, tem se cons-
em solos um dos maiores problemas ambientais titudo em uma fonte mais confivel de biocenose
devido ao antropognica, sendo que excessivas natural do que rizobactrias na degradao de me-
concentraes de cobre (Cu) possuem significante tais pesados, devido sua ntima associao com as
risco a sade pblica e ao ecossistema (Rajkumar et plantas. A explorao das interaes bactria-plan-
al., 2009a; Ma et al., 2011a; Sessitsch et al., 2013). ta-metal pode resultar na promoo do estabeleci-
As associaes entre plantas e micro-orga- mento, crescimento e desenvolvimento da planta
nismos metal tolerantes aumentam a absoro de e alm disso, desempenham um papel significativo
metais e o crescimento das plantas, alm do uso si- nas aplicaes sustentveis de baixo custo de fitor-
nrgico de plantas e micro-organismos ser favorvel remediao de metais em solos contaminados. No
para a descontaminao de solos metlicos (Jing et entanto, uma compreenso dos mecanismos que
al., 2007; Glick, 2010; Ma, 2011b). Estes micro-orga- permitem que bactrias endofticas interajam com
nismos contribuem para a reduo da fitotoxicidade as plantas hospedeiras em solos contaminados com
atravs de mecanismos de biossoro e bioacumu- metais pesados so essenciais para otimizar as apli-
lao, haja vista que as clulas bacterianas apresen- caes biotecnolgicas das eficientes relaes plan-
tam elevada superfcie de contato e desta forma, so ta-bactria (Ma et al., 2016).
capazes de absorver maior quantidade de metais pe-
sados do que os componentes inorgnicos do solo Bactrias endofticas perspectivas para o futuro
(Ma et al., 2011b). Evidencia-se que o uso de bactrias endofti-
Estudos realizados por Zaidi et al. (2006), cas na agricultura e em outras atividades econmi-
Madhayian et al. (2007) e Kumar et al. (2009), re- cas pode ser melhorado pela compreenso desses
portaram que mecanismos de biossoro e/ou bio- micro-organismos com seus hospedeiros. fato que
acumulao bacterianos, associados aos fatores re- as possibilidades de aplicaes de agentes endofti-
lacionados promoo de crescimento de plantas cos tem crescido cada vez mais, pois estudos com
(incluindo a atividade de ACC deaminase e fitohor- essa temtica tem se intensificado nos ltimos anos.
mnios) foram responsveis por um melhor cresci- Inicialmente o grande interesse com relao ao po-
mento das plantas em solos contaminados por me- tencial de bactrias endofticas no controle biolgico
tais, comprovando essa teoria. Dessa forma, o uso e/ou promoo de crescimento de plantas alavancou
de micro-organismos associados s espcies vege- os estudos, pois desde o princpio vislumbrava-se al-
tais, ajudam a promover a utilizao mais eficiente ternativas ecologicamente corretas, principalmente
das plantas nas prticas de fitorremediao, atravs com potencial para a reduo da demanda contnua
do aproveitamento da sua flora bacteriana natural de insumos qumicos e agrotxicos necessrios atu-
(Mengoni et al., 2009). almente para manter a produtividade das lavouras,
Diversos estudos revelam que as plantas hi- reduzindo assim, os custos de produo para o pro-
peracumuladoras de metais so colonizadas simul- dutor rural.
taneamente por um elevado nmero de diferentes Este aumento na gama de possibilidades de
bactrias endofticas, dentre as quais pode-se citar utilizao das bactrias endofticas se deve muito ao
as do gnero Methylobacterium, que so tolerantes desenvolvimento de tcnicas modernas de estudo,
aos metais Nquel (Ni), Cdmio (Cd), Cobalto (Co), principalmente as tcnicas de deteco e identifica-
Zinco (Zn) e Cromo (Cr) (Idris et al., 2006; Mengo- o de micro-organismos independentes de cultivo,
ni et al., 2009), e as dos gneros Bacillus, Acineto- com base no contedo gentico contido no DNA
bacter e Pantoea tolerantes a Cu (Sun et al., 2010; ou RNA dos mesmos. Como muitos procariotos de
Zhang et al., 2011). Alm disso, gneros como Ba- amostras ambientais so recalcitrantes, ou seja, no
cillus, Brevibacillus, Burkholderia, Curtobacterium, podem ser isolados ou cultivados em condies de
Herbaspirillum, Klebsiella, Leifsonia, Methylobacte- laboratrio, os mtodos moleculares independen-
rium, Microbacterium, Micrococcus, Paenibacillus, tes de cultivo tm sido amplamente utilizados para
Pseudomonas, Serratia e Staphylococcus tambm caracterizar comunidades microbianas in situ. Para
apresentaram genes responsveis pela resistncia a a identificao de bactrias, geralmente se tem utili-
metais pesados (Rajkumar et al., 2009a; 2009b). zado a sequncia do gene que codifica a poro 16S

122 RAPP - Volume 24, 2016


Bruna Canabarro Pozzebon e Juliano dos Santos (115-129)

do rRNA; porm para estudos de caracterizao de luo genmica juntamente com o desenvolvimento
comunidades microbianas com capacidades fisiol- constante de tcnicas analticas certamente vai ace-
gicas especializadas, se tem utilizado a comparao lerar a descoberta destes metablitos e possibilitar
de sequncias de uma srie de genes que codificam a deteco destes em circunstncias especficas sob
protenas especficas (Ikeda, 2010; Reinhold-Hurek, condies naturais (Brader et al., 2014). Alm disso,
2011). estudos sobre os mecanismos pelos quais as bact-
Alm do controle biolgico e promoo de rias endofticas se estabelecem em tecidos vegetais
crescimento de plantas, outras possibilidades de em nmero elevado, e como eles contornam as res-
utilizao das bactrias endofticas tem ganhado im- postas de defesa do hospedeiro tambm esto pro-
portncia nos ltimos anos. Muitas delas possuem gredindo. Combinaes de estudos sobre a comuni-
metabolismo capaz de degradar as mais variadas dade bacteriana, anlises mutacionais de bactrias
substncias, sendo que seu uso na remediao de e de plantas hospedeiras, anlises comparativas do
ambientes contaminados merece uma ateno es- genoma e metagenoma facilitaro a evoluo neste
pecial, devido importncia para a recuperao de fascinante campo de pesquisa.
solos degradados, como foi enfatizado anteriormen-
te nesta reviso. Em um planeta saturado onde sus- Referncias
tentabilidade a palavra-chave para um desenvol- Afzal M, Khan QM, Sessitsch A (2014) Endophytic
vimento que no comprometa os recursos naturais, bacteria: Prospects and applications for the phy-
principalmente gua e solo, as bactrias endofticas toremediation of organic pollutants. Chemo-
surgem, portanto, como interessante alternativa. sphere 117:232242.
No campo da biotecnologia, podemos sa- Almeida CV, Andreote FD, Yara R, Tanaka FAO, Azeve-
lientar que as bactrias, juntamente com os fungos, do JL, Almeida M (2009) Bacteriosomes in axenic
tm sido bastante utilizadas como produtoras de plants: endophytes as stable endosymbionts.
diferentes substncias de interesse econmico, tais World Journal of Microbiology and Biotechnology
como enzimas, antibiticos, vitaminas, aminocidos 25:1757-1764.
e esteroides (Santos e Varavallo, 2011), que podem Alves EM, Cunha WL (2012) A importncia da agri-
ser explorados na agricultura, na medicina e na in- cultura orgnica na viso social e ecolgica. Re-
dstria (Tejesvi et al., 2007). Um exemplo disto o vista F@pcincia 9:01-07.
trabalho desenvolvido por Carrim et al. (2006), que Andreote FD, Arau WLD, Azevedo JLD, Elsas JDV, Ro-
selecionaram enzimas de interesse biotecnolgico a cha UND, Overbeek LSV (2009) Endophytic colo-
partir de bactrias endofticas isoladas de Jacaran- nization of potato (Solanum tuberosum L.) by a
da decurrens Cham. Dez espcies de bactrias foram novel competent bacterial endophyte, Pseudo-
isoladas e identificadas; todas apresentaram ativida- monas putida Strain P9, and its effect on associ-
de enzimtica, com maior predominncia de ativida- ated bacterial communities. Applied and Environ-
de proteoltica e amiloltica, seguidas das atividades mental Microbiology 75:3396-3406.
lipoltica e estersica. Essas enzimas, produzidas por Andria V, Reichenauer TG, Sessitsch A (2009) Expres-
diversos microrganismos, apresentam potencial de sion of alkane monooxygenase (alkB) genes by
aplicabilidade em diversos campos, como no pro- plant-associated bacteria in the rhizosphere and
cessamento de alimentos, na fabricao de deter- endosphere of Italian ryegrass (Lolium multiflo-
gentes, tecidos, produtos farmacuticos, na terapia rum L.) grown in diesel contaminated soil. Envi-
mdica e na biologia molecular (Carrim et al., 2006). ronmental Pollution 157:33473350.
Portanto, esta apenas a ponta do grande Aranda E, Peferoen M, Guureca L, Bravo A (1996)
iceberg, que representa os estudos a respeito das Interactions of Bacillus thuringiensis crystal pro-
bactrias endofticas. Evidncias sugerem que bact- teins with the midgut epithelial cell of Spodop-
rias endofticas tem um elevado potencial na produ- tera frugiperda (Lepidoptera: Noctuidae). Journal
o de uma vasta gama de metablitos, muitos deles of Invertebrate Pathology 68:203-212.
ainda no descritos. No entanto, a concentrao e as Aravind R, Eapen SJ, Kumar A, Dinu A, Ramana KV
circunstncias em que estes metablitos so produ- (2010) Screening of endophytic bacteria and eval-
zidos ainda no so bem compreendidas, mas a revo- uation of selected isolates for suppression of bur-

RAPP - Volume 24, 2016 123


Bruna Canabarro Pozzebon e Juliano dos Santos (115-129)

rowing nematode (Radopholus similis Thorne) us- de promoo de crescimento. Cincia e Agrotec-
ing three varieties of black pepper (Piper nigrum nologia 33:2038-2044.
L.). Crop Protection 29:318-324. Bettiol W, Ghini R (1995) Controle biolgico. In: Ber-
Ardanov P, Ovcharenko L, Zaets I, Kozyrovska N, Pirt- gamin Filho A, Kimati H, Amorin L (Eds.) Manual
til AM (2011) Endophytic bacteria enhancing de Fitopatologia. Volume 1: Princpios e concei-
growth and disease resistance of potato (Sola- tos. So Paulo, SP. pp. 717-728.
num tuberosum L.). Biological Control 56:43-49. Brader, G, Compant, S, Mitter, B, Trognitz, F, & Ses-
Arun B, Gopinath B, Sharma S (2012) Plant growth sitsch, A (2014) Metabolic potential of endo-
promoting potential of bacteria isolated on N free phytic bacteria. Current Opinion in Biotechnology
media from rhizosphere of Cassia occidentalis. 27:3037.
World Journal of Microbiology and Biotechnology Carrim AJI, Barbosa EC, Vieira JDG (2006) Enzymatic
28:28492857. activity of endophytic bacterial isolates of Jaca-
Assumpo LC, Laava PT, Dias ACF, Azevedo JL, Men- randa decurrens Cham. (Carobinha-do-campo).
ten JOM (2009) Diversidade e potencial biotecno- Brazilian Archives of Biology and Technology
lgico da comunidade bacteriana endoftica de 49:353-359.
sementes de soja. Pesquisa Agropecuria Brasi- Castilhos-Fortes R, Matsumura ATS, Diehl E, Fiuza LM
leira 44:503-510. (2002) Susceptibility of Nasutitermes ehrhardti
Azevedo JL (1998) Microrganismos endofticos. In: (Isoptera: Termitidae) to Bacillus thuringiensis
Melo IS, Azevedo JL (Ed.) Ecologia microbiana. Ja- subspecies. Brazilian Journal of Microbiology
guarina. EMBRAPA. p. 117-137. 33:219-222.
Azevedo JL (1999) Botnica: uma cincia bsica ou Cavados CFG, Fonseca RN, Chaves JQ, Abinovitch L,
aplicada? Revista brasileira de Botnica 22:225- Arajo-Coutinho CJPC (2001) Identification of en-
229. tomopathogenic Bacillus isolated from Simulium
Azevedo JL, Maccheroni Junior W, Pereira JO, Arajo (Diptera, Simuliidae) larvae and adults. Memrias
WL (2000) Endophytic microorganisms: a review do Instituto Oswaldo Cruz 96:1017-1021.
on insect control and recent advances on tropical Colombo PM (1978) Occurrence of endophytic bac-
plants. Electronic Journal of Biotechnology 3:40- teria in Siphonous algae. Phycologia 17:148-151.
65. Compant S, Clment C, Sessitsch A (2010) Plant
Babalola OO (2010) Beneficial bacteria of agricultural growth-promoting bacteria in the rhizo and endo-
importance. Biotechnology letters 32:1559-1570. sphere of plants: their role, colonization, mecha-
Balachandar D, Sandhiya GS, Sugitha TCK, Kumar K nisms involved and prospects for utilization. Soil
(2006) Flavonoids and growth hormones influ- Biology and Biochemistry 42:669-678.
ence endophytic colonization and in planta nitro- Compant S, Mitter B, Colli-Mull JG, Gangl H, Sess-
gen fixation by a diazotrophic Serratia sp. in rice. itsch A (2011) Endophytes of grapevine flowers,
World Journal of Microbiology and Biotechnology berries, and seeds: identification of cultivable
22:707-712. bacteria, comparison with other plant parts, and
Baldani JI, Salles JF, Olivares FL (2002) Bactrias visualization of niches of colonization. Microbial
endofticas como vetores de genes de resis- Ecology 62:188197.
tncia a insetos. In: Melo S, Valadaresinglis M, Costa PB (2012) Isolamento e caracterizao de bac-
Nass L, Valois A (Eds.) Recursos genticos e trias promotoras de crescimento vegetal em
melhoramento:microrganismos. Jaguarina, SP. lavouras experimentais de arroz sob diferentes
EMBRAPA Meio Ambiente. pp. 590-601. nveis de fertilizao. Dissertao de mestrado,
Bandara WMMS, Seneviratne G, Kulasooriya SA Universidade Federal do Rio Grande do Sul
(2006) Interactions among endophytic bacteria UFRGS. Porto Alegre, RS, Brasil.
and fungi: effects and potentials. Journal of Bios- Crickmore N (2005) Using worms to better under-
ciences 31:645-650. stand how Bacillus thuringiensis kills insects.
Barretti PB, Romeiro RS, Mizubuti ESG, Souza JT Trends in Microbiology 13:347-350.
(2009) Seleo de bactrias endofticas de toma- Crickmore N, Zeigler DR, Feitelson J, Schnepf E, Van
teiro como potenciais agentes de biocontrole e Rie J, Lereclus D, Baum J, Dean DH (1998) Revision

124 RAPP - Volume 24, 2016


Bruna Canabarro Pozzebon e Juliano dos Santos (115-129)

of the nomenclature for the Bacillus thuringiensis Francis I, Holsters M, Vereecke D (2010) The Gram-
pesticidal crystal protein. Microbiology Molecular -positive side of plantmicrobe interactions. Envi-
Biology Review 62:807-813. ronmental Microbiology 12:112.
De Maagd RA, Bravo A, Berry C, Crickmore N, Franke-Whittle IH, Oshea MG, Leonard GJ, Webb R,
Schnepf HE (2003) Structure, diversity and evolu- Sly LI (2005) Investigation into the ability of Glu-
tion of protein toxins from spore-forming ento- conacetobacter sacchari to live as an endophyte
mopathogenic bacteria. Annual Review of Genet- in sugarcane. Plant and Soil 271:285-295.
ics 37:409-433. Gerhardt KE, Huang XD, Glick BR, Greenberg BM
Dias ACF, Costa FEC, Andreote FD, Lacava PT, Teixeira (2009) Phytoremediation and rhizoremediation
MA, Assumpo LC, Arajo WL, Azevedo JL, Melo of organic soil contaminants: potential and chal-
IS (2009) Isolation of micropropagated strawberry lenges. Plant Science 176:2030.
endophytic bacteria and assessment of their po- Glick BR (2010) Using soil bacteria to facilitate phyto-
tential for plant growth promotion. World Journal remediation. Biotechnology Advances 28:367
of Microbiology and Biotechnology 25:189-195. 374.
Donato VMTS, Andrade AG, Takaki GMC, Mariano Govindarajan M, Balandreau J, Muthukumarasamy
RLR, Maciel GA (2005) Plantas de cana-de-a- R, Revathi G, Lakshminarasimhan C (2006) Impro-
car cultivadas in vitro com antibiticos. Cincia e ved yield of micropropagated sugarcane following
Agrotecnologia 29:134-141. inoculation by endophytic Burkholderia vietna-
Elbeltagy A, Nishioka K, Sato T, Suzuki H, Ye B, Hama- miensis. Plant Soil 280:239-252.
da T, Isawa T, Mitsui H, Minamisawa K (2001) En- Guo B, Wang Y, Sun X, Tang K (2008) Bioactive natural
dophytic colonization and in planta nitrogen fixa- products from endophytes: a review. Applied Bio-
tion by a Herbaspirillum sp. isolated from wild rice chemistry and Microbiology 44:136-142.
species. Applied and Environmental Microbiology Hallmann J, Quadt-Hallmann A, Mahaffee WF, Klo-
67:5285-5293. epper JW (1997) Bacterial endophytes in agri-
Esposito-Polesi NP (2010) Investigao da microbio- cultural crops. Canadian Journal of Microbiology
ta endoftica onipresente em microplantas ax- 43:895-914.
nicas. Dissertao de mestrado, Universidade de Hardoim PR, Van Overbeek LS, Elsas JD (2008) Pro-
So Paulo - ESALQ-USP, Piracicaba, SP, Brasil. perties of bacterial endophytes and their propo-
Esposito-Polesi NP (2011) Microrganismos endofti- sed role in plant growth. Trends in Microbiology
cos e a cultura de tecidos vegetais: quebrando pa- 16:463471.
radigmas. Revista Brasileira de Biocincias 9:533- Hayat R, Ali S, Amara U, Khalid R, Ahmed I (2010)
541. Soil beneficial bacteria and their role in plant gro-
Federici BA, Park HW, Bideshi DK (2010) Overview wth promotion: a review. Annals of Microbiology
of the basic biology of Bacillus thuringiensis with 60:579-598.
emphasis on genetic engineering of bacterial lar- Hidayati U, Chaniago IA, Munif A, Siswanto, Santosa
vicides for mosquito control. The Open Toxinolo- DA (2014) Potency of plant growth promoting en-
gy Journal 3:83-100. dophytic bacteria from rubber plants (Hevea bra-
Feitelson JS, Payne J, Kim L (1992) Bacillus thuringien- siliensis Mull. Arg.). Journal of Agronomy 13:147-
sis: insects and beyond. Biotecnology 10:271-275. 152.
Feng Y, Shen D, Song W (2006) Rice endophyte Panto- Hfte H, Whitheley HR (1989) Inseticidal crystal pro-
ea agglomerans YS19 promotes host plant growth teins of Bacillus thuringiensis. Microbiology Re-
and affects allocations of host photosynthates. view 53:242-255.
Journal of Applied Microbiology 100:938945. Holliday P (1989) A dictionary of plant pathology.
Forchetti G, Masciarelli O, Alemano S, Alvarez D, Ab- Cambridge, University Press, Cambridge.
dala G (2007) Endophytic bacteria in sunflower Hollis JP (1951) Bacteria in healthy potato tissue.
(Helianthus annuus L.): isolation, characteriza- Phytopathology 41:350-367.
tion, and production of jasmonates and abscisic Hung PQ, Kumar SM, Govindsamy V, Annapurna K
acid in culture medium. Applied Microbiology (2007) Isolation and characterization of endo-
and Biotechnology 76:1145- 1152. phytic bacteria from wild and cultivated soybean

RAPP - Volume 24, 2016 125


Bruna Canabarro Pozzebon e Juliano dos Santos (115-129)

varieties. Biology and Fertility of Soils 44:155-162. javanica infecting tomato. Phytopathologia Medi-
Idris R, Kuffner M, Bodrossy L, Puschenreiter M, terranea 45:153-157.
Monchy S, Wenzel WW, Sessitsch, A (2006) Cha- Kukla M, Pociniczak T, Piotrowska-Seget Z (2014)
racterization of Ni-tolerant methylobacteria asso- Diversity of endophytic bacteria in Lolium pe-
ciated with the hyperaccumulating plant Thlaspi renne and their potential to degrade petroleum
goesingense and description of Methylobacte- hydrocarbons and promote plant growth. Chemo-
rium goesingense sp. nov. Systematic and Applied sphere 117:4046.
Microbiology 29:634-644. Kumar KV, Srivastava S, Singh N, Behl HM (2009)
Ikeda S, Okubo T, Anda M, Nakashita H, Yasuda M, Role of metal resistant plant growth promoting
Sato S, Kaneko T, Tabata S, Eda S, Momiyama A bacteria in ameliorating fly ash to the growth of
(2010) Community and genome-based views of Brassica juncea. Journal of Hazardous Materials
plant-associated bacteria: plantbacterial interac- 170:51-57.
tions in soybean and rice. Plant and Cell Physiolo- Kuss AV (2006) Fixao de nitrognio por bactrias
gy 51:1398-1410. diazotrficas em cultivares de arroz irrigado. Tese
Jacobs MJ, Bugbee WM, Gabrielson DA (1985) Enu- de doutorado, Universidade Federal de Santa Ma-
meration, location, and characterization of endo- ria UFSM. Santa Maria, RS, Brasil.
phytic bacteria within sugar beet roots. Canadian Li T, Liu MJ, Zhang XT, Zhang HB, Sha T, Zhao ZW
Journal of Botany 63:1262-1265. (2011) Improved tolerance of maize (Zea mays L.)
Jha PN, Kumar A (2007) Endophytic colonization of to heavy metals by colonization of a dark septate
Typha australis by a plant growth-promoting bac- endophyte (DSE) Exophiala pisciphila. Science of
terium Klebsiella oxytoca strain GR-3. Journal of the Total Environment 409:1069-1074.
Applied Microbiology 103:13111320. Lin T, Zhao L, Yang Y, Guan Q, Gong M (2013) Poten-
Ji SH, Gururani MA, Chun SC (2014) Isolation and tial of endophytic bacteria from Sophora alope-
characterization of plant growth promoting en- curoides nodule in biological control against Ver-
dophytic diazotrophic bacteria from Korean rice ticillium wilt disease. Australian Journal of Crop
cultivars. Microbiological Research 169:83 98. Science 7:139-146.
Jing Y, He Z, Yang X (2007) Role of soil rhizobacte- Ma Y, Prasad MNV, Rajkumar M, Freitas H (2011a)
ria in phytoremediation of heavy metal contami- Plant growth promoting rhizobacteria and endo-
nated soils. Journal of Zhejiang University Science phytes accelerate phytoremediation of metallifer-
8:192207. ous soils. Biotechnology Advances 29:248-258.
Kang SM, Joo GJ, Hamayun M, Na CI, Shin DH, Kim HY, Ma Y, Rajkumar M, Luo Y, Freitas H (2011b) Inocula-
Hong JK, Lee IJ (2009) Gibberellin production and tion of endophytic bacteria on host and non-host
phosphate solubilization by newly isolated strain plants: effects on plant growth and Ni uptake.
of Acinetobacter calcoaceticus and its effect on Journal of Hazardous Materials 195:230-237.
plant growth. Biotechnology Letters 31:277- 281. Ma Y, Rajkumar M, Zhang C, Freitas H (2016) Benefi-
Khan MQ, Waseem MA, Zaki MJ, Khan SA (2010) cial role of bacterial endophytes in heavy metal
Evaluation of Bacillus thuringiensis isolates phytoremediation. Journal of Environmental
against rootknot nematodes following seed appli- Management 174:14-25.
cation in okra and mungbean. Pakistan Journal of Macedo CL, Martins ES, Macedo LLP, Santos AC,
Botany 42:2903-2910. Praa LB, Gis LAB, Monnerat RG (2012) Selec-
Khan S, Afzal M, Iqbal S, Khan QM (2013) Plant tion and characterization of Bacillus thuringien-
bacteria partnerships for the remediation of hy- sis strains effective against Diatraea saccharalis
drocarbon contaminated soils. Chemosphere (Lepidoptera: Crambidae). Pesquisa Agropecuria
90:13171332. Brasileira 47:1759-1765.
Khan Z, Doty SL (2009) Characterization of bacterial Madhayian M, Poonguzhali S, Sa T (2007) Metal tol-
endophytes of sweet potato. Plant Soil 322:197- erating methylotrophic bacteria reduces nickel
207. and cadmium toxicity and promotes plant growth
Khyami-Horani H, Al-Banna L (2006) Efficacy of Bacil- of tomato (Lycopersicon esculentum L.). Chemo-
lus thuringiensis jordanica against Meloidogyne sphere 69:220-228.

126 RAPP - Volume 24, 2016


Bruna Canabarro Pozzebon e Juliano dos Santos (115-129)

Malfanova N, Kamilova F, Validov S, Shcherbakov A, trol? In: Schneider C, Leifert C, Feldmann F (Eds.)
Chebotar V, Tikhonovich I, Lugtenberg B (2011) Endophytes for plant protection: the state of the
Characterization of Bacillus subtilis HC8, a novel art. Deutsche Phytomedizinische Gesellschaft,
plantbeneficial endophytic strain from giant hog- Braunschweig. pp. 12-16.
weed. Microbial Biotechnology 4:523532. Peixoto Neto PAS, Azevedo JL, Arajo WL (2002) Mi-
Manter DK, Delgado JA, Holm DG, Stong RA (2010) crorganismos endofticos. Biotecnologia Cincia
Pyrosequencing reveals a highly diverse and culti- & Desenvolvimento 29:62-77.
var specific bacterial community in potato roots. Peixoto Neto PAS, Azevedo JL, Caetano LC (2004) Mi-
Microbial Ecology 60:157-166. crorganismos endofticos em plantas: status atual
Marques APGC, Rangel AOSS, Castro PML (2011) Re- e perspectivas. Boletin Latinoamericano y del Ca-
mediation of heavy metal contaminated soils: an ribe de Plantas Medicinales y Aromticas 3:69-72.
overview of site remediation techniques. Critical Peng A, Liu J, Gao Y, Chen Z (2013) Distribution of
Reviews in Environmental Science and Technol- endophytic bacteria in Alopecurus aequalis Sobol
ogy 41:879914. and Oxalis corniculata L. from soils contaminated
Marquez-Santacruz HA, Hernandez-Leon R, Orozco- by polycyclic aromatic hydrocarbons. PLoS ONE
Mosqueda MC, Velazquez-Sepulveda I, Santoyo G 8:e83054.
(2010) Diversity of bacterial endophytes in roots Prez-Garca A, Romero D, Vicente A (2011) Plant
of Mexican husk tomato plants (Physalis ixocarpa) protection and growth stimulation by microor-
and their detection in the rhizosphere. Genetics ganisms: biotechnological applications of Bacilli
and Molecular Research 9:2372-2380. in agriculture. Current Opinion in Biotechnology
Melnick RL, Zidack NK, Bailey BA, Maximova SN, 22:187-193.
Guiltinan M, Backman PA (2008) Bacterial endo- Phillips LA, Greer CW, Farrell RE, Germida JJ (2012)
phytes: Bacillus spp. from annual crops as poten- Plant root exudates impact the hydrocarbon deg-
tial biological control agents of black pod rot of radation potential of a weathered-hydrocarbon
cacao. Biological Control 46: 46-56. contaminated soil. Applied Soil Ecology 52:5664.
Mengoni A, Pini F, Huang LN, Shu WS, Bazzicalupo M Piccolo SL, Ferraro V, Alfonzo A, Settanni L, Ercolini
(2009) Plant-by-plant variations of bacterial com- D, Burruano S, Moschetti G (2010). Presence of
munities associated with leaves of the nickel hy- endophytic bacteria in Vitis vinifera leaves as de-
peraccumulator Alyssum bertolonii. Desv. Micro- tected by fluorescence in situ hybridization. An-
bial Ecology 58:660-667. nual Microbiology 60:161-167.
Mohammed SH, Anwer M, Saedy E, Mohamed R, Pinto LMN, Azambuja AO, Dihel E, Fiuza LM (2003)
Enan N, Ibrahim E, Ghareeb A, Salah AM (2008) Pathogenicity of Bacillus thuringiensis isolates
Biocontrol efficiency of Bacillus thuringiensis tox- from two species of Acromirmex (Hymenoptera:
ins against root-knot nematode, Meloidogyne Formicidae). Brazilian Journal of Biology 63:301-
incognita. Journal of Cell and Molecular Biology 306.
7:57-66. Pinto LMN, Fiuza LM (2002) Genes Cry de Bacillus
Moreira FMS, Siqueira JO (2006) Microbiology and thuringiensis: uma alternativa biotecnolgica
Biochemistry of soil. 2. ed. Lavras, UFLA. aplicada ao manejo de insetos. Acta Biolgica
Nawangsih AA, Damayanti I, Wiyono S, Kartika JG Leopoldense 10:3-13.
(2011) Selection and characterization of endo- Piromyou P, Buranabanyat B, Tantasawat P, Titta-
phytic bacteria as biocontrol agents of tomato butr P, Boonkerd N, Teaumroong N (2011) Effect
bacterial wilt disease. HAYATI Journal of Biosci- of plant growth promoting rhizobacteria (PGPR)
ences 18:66-70. inoculation on microbial community structure in
Newman L, Reynolds C (2005) Bacteria and phyto- rhizosphere of forage corn cultivated in Thailand.
remediation: new uses for endophytic bacteria in European Journal of Soil Biology 47:4454.
plants. Trends in Biotechnology 23:6-8. Pleban S, Ingel F, Chat I (1995) Control of Rhizoctonia
Nigris S, Baldan E, Zottini M, Squartini A, Baldan Bet solani and Sclerotium rolfsii in the greenhouse us-
(2013) Is the bacterial endophyte community, liv- ing endophytic Bacillus spp. European Journal of
ing in Glera (Vitis vinifera) plants, active in biocon- Plant Pathology 101:665-672.

RAPP - Volume 24, 2016 127


Bruna Canabarro Pozzebon e Juliano dos Santos (115-129)

Polli A, Neves AF, Galo FR, Gazarini J, Rhoden AS, Molecular Plant-Microbe Interactions 19:827-
Pamphile JA (2012) Aspectos da interao dos 837.
microrganismos endofticos com plantas hospe- Ryan RP, Germaine K, Franks A, Ryan DJ, Dowling
deiras e sua aplicao no controle biolgico de DN (2008) Bacterial endophytes: recent develop-
pragas na agricultura. SaBios-Revista de Sade e ments and applications. FEMS microbiology let-
Biologia 7:82-89. ters 278:1-9.
Postma JWM, Olsson PA, Falkengren-Grerup U Saikkonen K, Wli P, Helander M, Faeth SH (2004)
(2007) Root colonization by arbuscular mycorrhi- Evolution of endophyte-plant symbioses. Trends
zal, fine endophytic and dark septate fungi across in Plant Science 9:275280.
a pH gradient in acid beech forests. Soil Biology & Santos TT, Varavallo MA (2011) Aplicao de micror-
Biochemistry 39:400-408. ganismos endofticos na agricultura e na produ-
Purnawati A, Sastrahidayat IR, Abadi AL, Hadiastono o de substncias de interesse econmico. Se-
T (2014) Endophytic bacteria as biocontrol agents mina: Cincias Biolgicas e da Sade 32:199-212.
of tomato bacterial wilt disease. The Journal of Schulz B, Boyle C (2006) What are endophytes? In:
Tropical Life Science 4:33-36 , January. Schulz BJE, Boyle CJC & Sieber TN (Eds.) Microbial
Qin S, Xing K, Jiang JH, Xu LH, Li WJ (2011) Biodiver- root endophytes. Springer-Verlag, Berlin. pp.113
sity, bioactive natural products and biotechno- Sessitsch A, Kuffner M, Kidd P, Vangronsveld J, Wen-
logical potential of plant-associated endophytic zel W, Fallmann K, Puschenreiter M (2013) The
actinobacteria. Applied Microbiology Biotechnol- role of plant-associated bacteria in the mobili-
ogy 89:457-473. zation and phytoextraction of trace elements in
Quecine MC, Arajo WL, Rossetto PB, Ferreira A, Tsui contaminated soils. Soil Biology & Biochemistry
S, Lacava PT, Mondin M, Azevedo JL, Pizzirani- 60:182194.
Kleinera AA (2012) Sugarcane growth promotion Silva HSA, Terrasan CRF, Tozzi JPL, Melo IS, Bettiol W
by the endophytic bacterium Pantoea agglomer- (2008) Bactrias endofticas do cafeeiro e a indu-
ans 33.1. Applied and Environmental Microbiol- o de enzimas relacionadas com o controle da
ogy 78:75117518. ferrugem (Hemileia vastatrix). Tropical Plant Pa-
Rajkumar M, Freitas H (2009a) Endophytic bacteria thology 33:049-054.
and their potential to enhance heavy metal phy- Silva HSA, Tozzi JPL, Terrasan CRF, Bettiol W (2012)
toextraction. Chemosphere 77:153-160. Endophytic microorganisms from coffee tissues
Rajkumar M, Prasad MNV, Freitas H, Ae N (2009b) as plant growth promoters and biocontrol agents
Biotechnological applications of serpentine bac- of coffee leaf rust. Biological Control 63:6267.
teria for phytoremediation of heavy metals. Criti- Singh N, Pandey P, Dubey RC, Maheshwari DK (2008)
cal Reviews in Biotechnology 29:120-130. Biological control of root rot fungus Macrophom-
Rampelotti-Ferreira FT, Ferreira A, Vendramim JD, ina phaseolina and growth enhancement of Pinus
Lacava PT, Azevedo JL, Arajo WL (2010) Coloniza- roxburghii (Sarg.) by rhizosphere competent Ba-
tion of rice and Spodoptera frugiperda J.E. Smith cillus subtilis BN1. World Journal of Microbiology
(Lepidoptera: Noctuidae) larvae by genetically and Biotechnology 24:1669-1679.
modified endophytic Methylobacterium meso- Sturz AV, Christie HR, Nowak J (2000) Bacterial en-
philicum. Neotropical Entomology 39:308- 310. dophytes: Potential role in developing sustainable
Rangjaroen C, Rerkasem B, Teaumroong N, Noisan- systems of crop production. Critical Reviews in
giam R, Lumyong S (2015) Promoting plant growth Plant Sciences 19:1-30.
in a commercial rice cultivar by endophytic diazo- Sun L, Qiu F, Zhang X, Dai X, Dong X, Song W (2008)
trophic bacteria isolated from rice landraces. An- Endophytic bacterial diversity in rice (Oryza sativa
nals of Microbiology 65:253266. L.) roots estimated by 16S rDNA sequence analy-
Reinhold-Hurek B, Hurek T (2011) Living inside sis. Microbial Ecology 55:415-24.
plants: bacterial endophytes. Current Opinion in Sun LN, Zhang YF, He LY, Chen ZJ, Wang QY, Qian M,
Plant Biology 14:435443. Sheng XF (2010) Genetic diversity and characte-
Rosemblueth M, Martnez-Romero E (2006) Bacte- rization of heavy metal-resistant-endophytic bac-
rial endophytes and their interactions with hosts. teria from two copper-tolerant plant species on

128 RAPP - Volume 24, 2016


Bruna Canabarro Pozzebon e Juliano dos Santos (115-129)

copper mine wasteland. Bioresource Technology characterization and diversity of bacterial endo-
101:501- 509. phytes of grapevine. Canadian Journal of Micro-
Tan HM, Cao LX, He ZF, Su GJ, Lin B, Zhou SN (2006) biology 56:209-216.
Isolation of endophytic actinomycetes from diffe- Xin G, Zhang G, Kang JW, Staley JT, Doty SL (2009) A
rent cultivars of tomato and their activities against diazotropic, indole 3-acetic acid-producing endo-
Ralstonia solanacearum in vitro. World Journal of phyte from cottonwood. Biology and Fertility of
Microbiology and Biotechnology 22:1275-1280. Soils 45:669-674.
Tariq M, Hameed S, Yasmeen T, Zahid M, Zafar M Yonezawa M, Usuki F, Narisawa K, Takahashi J, Hashi-
(2014) Molecular characterization and identifica- ba T (2004) Anatomical study on the interaction
tion of plant growth promoting endophytic bacte- between the root endophytic fungus Heteroco-
ria isolated from the root nodules of pea (Pisum nium chaetospira and Chinese cabbage. Mycos-
sativum L.). World Journal of Microbiology and cience 45:367-371.
Biotechnology 30:719725. Yuan CL, Mou CX, Wu WL, Guo YB (2010) Effect of
Tejesvi MV, Nalini MS, Mahesh B, Prakash HS, Kini different fertilization treatments on indole-3-ace-
KR, Shetty HS, Subbiah V (2007) New hopes from tic acid producing bacteria in soil. Journal of Soils
endophytic fungal secondary metabolites. Boletn and Sediments 11:322-329.
de la Sociedad Qumica de Mxico 1:19-26. Yuan B, Wang Z, Qin S, Zhao GH, Feng YJ, Wei LH,
Thomas P, Kumari S, Swarna GK, Prakash DP, Dinesh Jiang JH (2012) Study of the anti-sapstain fun-
MR (2007) Ubiquitous presence of fastidious en- gus activity of Bacillus amyloliquefaciens CGMCC
dophytic bacteria in field shoots and index-negati- 5569 associated with Ginkgo biloba and identifi-
ve apparently clean shoot-tip cultures of papaya. cation of its active components. Bioresource Te-
Plant Cell Reports 26:1491-1499. chnology 114:536541.
Ting ASY, Meon S, Kadir J, Radu S, Singh G (2008) Zaidi S, Usmani S, Singh BR, Musarrat J (2006) Signi-
Endophytic microorganisms as potential growth ficance of Bacillus subtilis strain SJ-101 as a bioi-
promoters of banana. BioControl 53:541-553. noculant for concurrent plant growth promotion
Trotel-Aziz P, Couderchet M, Biagianti S, Aziz A and nickel accumulation in Brassica juncea. Che-
(2008) Characterization of new bacterial biocon- mosphere 64:991-997.
trol agents Acinetobacter, Bacillus, Pantoea and Zhang L, He D, Chen J, Liu Y (2010) Biodegradation
Pseudomonas spp. mediating grapevine resistan- of 2-chloroaniline, 3-chloroaniline, and 4-chloro-
ce against Botrytis cinerea. Environmental and Ex- aniline by a novel strain Delftia tsuruhatensis H1.
perimental Botany 64:21-32. Journal of Hazardous Materials 179:875-882.
Vazquez P, Holguin G, Puente M, Lopez E, Cortes A, Zhang YF, He LY, Chen ZJ, Wang QY, Qian M, Sheng XF
Bashan Y (2000) Phosphate solubilizing microor- (2011) Characterization of ACC deaminase-pro-
ganisms associated with the rhizosphere of man- ducing endophytic bacteria isolated from copper-
groves in a semiarid coastal lagoon. Biology and -tolerant plants and their potential in promoting
Fertility of Soils 30:460-468. the growth and copper accumulation of Brassica
Viana CLTP, Bortolo AS, Thuler RT, Goulart RM, Le- napus. Chemosphere 83:57-62.
mos MVF, Ferraudo AS (2009) Effect of new iso- Zhao Z, Wang Q, Wang K, Brian K, Liu C, Gu Y (2010)
lates of Bacillus thuringiensis Berliner on Plutella Study of the antifungal activity of Bacillus vallis-
xylostella (Linnaeus, 1758) (Lepidoptera: Plutelli- mortis ZZ185 in vitro and identification of its an-
dae). Cientfica 37:22-31. tifungal components. Bioresource Technology
West ER, Cother EJ, Steel CC, Ash GJ (2010) The 101:292-297.

RAPP - Volume 24, 2016 129


Mathias Ferrari Rockenbach, et al. 130-144)

EFEITO DAS MUDANAS CLIMTICAS NO


SISTEMA DE DEFESA DAS PLANTAS
Mathias Ferrari Rockenbach1; Mateus Brusco de Freitas1
e Marciel Joo Stadnik1

RESUMO
As mudanas climticas previstas para este sculo, relacionadas direta-
mente com o aquecimento atmosfrico global, consistem em um dos maiores
desafios na histria da agricultura. Nesse contexto, incrementos nos nveis de
gases de efeito estufa tais como o dixido de carbono (CO2) e oznio (O3), so
capazes de provocar aumentos significativos na temperatura global e na radia-
o solar, que podem afetar os sistemas de defesa das plantas tornando-as mais
suscetveis ao ataque por patgenos. Neste captulo, abordam-se os principais
sistemas de defesa das plantas e como eles so afetados pela exposio a nveis
elevados de CO2, O3 e radiao ultravioleta, assim como por altas temperaturas.
Por fim, discute-se tambm o efeito direto que as mudanas climticas podem
ter sobre os patgenos e as perspectivas futuras dentro dos cenrios ambientais
previstos para as prximas dcadas.

Introduo condies ambientais. Um advento inesperado na


Durante a sua evoluo, as plantas vm se evoluo das espcies aquele relacionado inter-
adaptando gradativamente a novos ambientes e ferncia do homem no meio ambiente. Neste con-
foram desenvolvendo sistemas de defesa contra di- texto, o clima vem sofrendo mudanas significativas
ferentes tipos de estresses biticos e abiticos. Isso desde os tempos pr-industriais, devido principal-
tem permitido a sua sobrevivncia aos constantes mente s atividades antrpicas que geram aumen-
desafios impostos por patgenos das mais variadas tos dos chamados gases de efeito estufa (dixido de
naturezas, bem como a oscilaes dos fatores am- carbono CO2 e oznio O3). Estas mudanas vm
bientais ao longo dos ltimos 450 - 500 milhes de contribuindo diretamente para o aumento da tem-
anos (Raven & Edwards, 2001; Bennici, 2008; Rubins- peratura global, causando diversos impactos climti-
tein et al., 2010). Neste cenrio, as plantas terrestres cos sobre os oceanos e continentes. De fato, as pre-
tiveram que desenvolver diversas adaptaes mor- dies para o futuro no so alentadoras na medida
folgicas/estruturais, assim como mecanismos fisio- em que todos os modelos preveem para os prximos
lgicos, que as tm possibilitado enfrentar constan- cem anos, aumentos nos nveis dos gases de efeito
temente a espcies patognicas (Thaler et al., 2012). estufa e da temperatura global (Araujo et al., 2005;
Em conjunto, estas estratgias conformam sistemas Pachauri & Reisinger, 2007). Assim, caso no sejam
de defesa bem especializados capazes de atuar fren- tomadas as medidas necessrias, estas mudanas
te ao ataque por patgenos. podero trazer futuramente consequncias drsti-
Os sistemas de defesa das plantas podem, cas para a produo agrcola mundial (Howden et al.,
contudo, ser afetados por alteraes drsticas nas 2007).
1
Laboratrio de Fitopatologia, Centro de Cincias Agrrias, Universidade Federal de Santa Catarina, Rodovia Admar Gonzaga 1346,
CEP 88034-001, Itacorubi, Florianpolis, Brasil.

130 RAPP - Volume 24, 2016


Mathias Ferrari Rockenbach, et al. 130-144)

Este captulo descreve os principais siste- immunity) (Ingle et al., 2006). O segundo sistema de
mas de defesa das plantas e como os incrementos defesa definido como sistema de defesa gene a
na concentrao ambiental dos principais gases de gene ou mediado por genes de resistncia (R), e
efeito estufa, CO2 e O3, podem afetar as respostas ativado pelo reconhecimento especfico entre efeto-
dos hospedeiros ao ataque por patgenos. Tambm res de avirulncia liberados pelos patgenos e pro-
sero expostos os principais resultados associados tenas do hospedeiro conhecidas como protenas R
s interferncias que a temperatura e radiao UV (codificadas pelos genes R). As respostas mediadas
podem exercer sobre tais sistemas de defesa. pelas interaes entre efetores de avirulncia e as
protenas R induzem no hospedeiro um estado de
Sistema de defesa das plantas resistncia conhecido como imunidade disparada
A ativao dos sistemas de defesa nas plan- por efetores (ETI Effector-triggered immunity) (In-
tas em resposta ao ataque patognico determina- gle et al.,2006; Jones & Dangl, 2006) (Figura 1).
da pela especificidade da interao patgeno-hos- Vrios mecanismos e componentes molecu-
pedeiro. De forma geral, existem classificados dois lares envolvidos no disparo da PTI e ETI tm sido es-
tipos de sistema de defesa em plantas. O primeiro, clarecidos nos ltimos anos. Os receptores proteicos
denominado sistema de defesa basal ou inato, de reconhecimento de PAMPs/MAMPs so classifi-
ativado pela interao entre protenas receptoras cados como protenas transmembrana do tipo qui-
(PRRs) expressadas pelo hospedeiro, e padres mo- nase (RLKs- receptors-like kinases). Estas protenas
leculares associados aos patgenos ou micrbios esto constitudas por um domnio extracelular de
(PAMPs ou MAMPs, respectivamente) (Jones & Dan- reconhecimento aos PAMPs/MAMPs, um domnio
gl, 2006). As interaes PAMPs/MAMPs PRRs in- transmembrana, e um domnio quinase intracelular
duzem uma srie de reaes a nvel molecular nas (Greef et al., 2012). Um exemplo bem estudado des-
clulas do hospedeiro que levam rapidamente a um te tipo de receptores o receptor de flagelina (flg22)
estado de resistncia basal, conhecida como imuni- FLS2 (Flagellin sensing2) (Ali & Reddy, 2008). FLS2
dade disparada por PAMPs (PTI PAMPS-triggered capaz de interagir com vrias protenas quinases da

Figura 1. Sistemas de defesa disparados pelo ataque de patgenos em plantas. A interao PAMPs/MAMPs-protenas
RLKs promove a expresso de genes e protenas relacionadas patogenicidade (PRs), induzindo um estado de resis-
tncia basal denominada imunidade disparada por PAMPs (PTI) (1). Efetores liberados pelos patgenos durante a PTI
podem atuar sobre alvos especficos do hospedeiro, induzindo um estado de suscetibilidade disparada por efetores
(ETS) (2). O reconhecimento especfico dos efetores patognicos por parte das protenas R, expressas no hospedeiro,
capaz de reverter a ETS e induzir resistncia sistmica denominada imunidade disparada por efetores (ETI) (3). A ETI
est geralmente associada reao de hipersensibilidade (RH), morte celular programada (MCP) e resistncia sistmica
adquirida (SAR).

RAPP - Volume 24, 2016 131


Mathias Ferrari Rockenbach, et al. 130-144)

famlia SERK (Somatic embriogenesis receptor kina- 2006). O AS, um composto fenlico, atua na expres-
se) tais como SERK1, SERK2, SERK5, BKK e SERK3/ so de vrias protenas relacionadas patogenici-
BAK1 (BR1-associated kinase 1) (Ali & Reddy, 2008). dade (protenas PR), tais como enzimas detoxifican-
O complexo FLS2-BAK1 capaz de fosforilar vrias tes e antioxidantes como a glutationa-S-transferase
protenas quinases, tais como BIK1, BIR1 e KAPP, in- (GST) e a glicosil-transferases (GTs) (Nawrath & Me-
duzindo uma cascata de fosforilaes intracelulares traux, 1999; Edwards et al., 2000; Wang et al., 2002).
que promovem a expresso de genes e protenas A RH e o estabelecimento de estados de resistncia
associados PTI (Lu et al., 2010; Roux et al., 2011). a nvel sistmico tambm envolvem acmulos de AS,
Outros exemplos so os receptores EFR (EF-Tu re- tanto a nvel local quanto a nvel distal ao stio de
ceptor), PEPR1 (Pep1 receptor 1), CERK1 (Chitin eli- infeco (Heath, 2000). O AS tambm possui funes
citor receptor kinase 1, protena receptora da famlia regulatrias relacionadas com a induo ou inibio
LysM), e Xa21 (Wan et al., 2008; Lee et al., 2009; Pos- da sntese de outros compostos, como por exemplo,
tel et al., 2010; Roux et al., 2011). Entretanto, vrios promovendo a sntese de ET e inibindo a sntese do
componentes moleculares das vias de sinalizao AJ (Vlot et al., 2009).
aparentam atuar em vias comuns a diferentes Vrias das sinalizaes moleculares associa-
receptores de reconhecimento de PAMPs/MAMPs das PTI parecem ser comuns ETI, o que demons-
(Greef et al., 2012). Estas interaes entre diferentes tra a existncia de uma regulao mutua entre o
vias de sinalizaes determinam, em ltima instn- sistema de defesa inato e o mediado por genes R.
cia, a especificidade das respostas a patgenos bio- Mesmo assim, a ETI disparada posteriormente
trficos ou necrotficos (Roux et al., 2011). PTI devido a um reconhecimento especfico entre as
Os eventos iniciais da PTI esto associados a protenas R e efetores patognicos especficos, sen-
vrias respostas celulares e moleculares no hospe- do estes liberados pelos patgenos durante a colo-
deiro. Estas respostas incluem variaes na permea- nizao do hospedeiro (Howden & Huitema, 2012).
bilidade inica da membrana plasmtica, a produo Existem identificados e classificados vrios tipos de
de espcies reativas de oxignio (EROs), a produo efetores patognicos, sendo um dos mais conheci-
de xido ntrico (ON), a sntese de etileno (ET), ci- dos o sistema de secreo do tipo III (TTSS). Os efe-
do saliclico (AS) e/ou cido jasmnico (AJ), e a ex- tores patognicos so capazes de atuar sobre alvos
presso de genes e protenas R (Ingle et al., 2006). (protenas) especficos do hospedeiro de forma dire-
Incrementos na permeabilidade da membrana plas- ta ou indireta, interferindo em vias de sinalizaes
mtica e dos nveis intracelulares do on Ca2+ tm (p. ex. MAPKs) e induzindo modificaes sobre esses
sido associados ativao das vias de sinalizaes alvos que promovem um estado de suscetibilidade
mediadas pelas MAPKs (Mitogen-activated protein disparada por efetores (ETS) (Figura 1). No caso em
kinases), produo de EROs dependentes de Ca2+ que certos efetores sejam especificamente reco-
e s reorganizaes do citoesqueleto durante o nhecidos por protenas R, estas induzem a nvel no
disparo da Morte Celular Programada (MCP), (Ku- hospedeiro um estado de imunidade disparado por
rusuet al., 2005, 2011; Higaki et al., 2011). A pro- efetores (ETI) (Howden & Huitema, 2012).
duo apoplstica de EROs (superxido e perxido Os principais fatores moleculares envolvidos
de hidrognio) produzido pelas NADPH-oxidases da no disparo da ETI, tais como os genes e as protenas
membrana plasmtica (NOX1) e peroxidases do tipo R, vm sendo amplamente estudados nas plantas. Os
III da parede celular (PRX33 e PRX34), assim como genes R so classificados segundo as caractersticas
o EROs produzido por outras organelas (mitocn- estruturais das protenas R para os quais codificam
drias, cloroplastos e peroxissomos) so essenciais (Richter & Ronald, 2000; Lehman, 2002). Em geral,
para o disparo da reao de hipersensibilidade (RH) as protenas R atuam a nvel citoplasmtico e so
e da resistncia sistmica adquirida (SAR) (Nanda et constitudas basicamente por um domnio N-termi-
al., 2010; Torres, 2010; OBrien et al., 2012). PAMPs nal NBS (Nucleotide binding site) de unio a trifos-
constitudos por lipopolissacardeos (LPS) so capa- fato de adenosina (ATP) ou trifosfato de guanosina
zes de induzir a produo e acmulo de ON, o qual (GTP) e, um domnio C-terminal LRR (Leucine rich re-
tambm tm sido associado ao disparo da RH e ex- peats) rico em leucinas. Sua classificao baseada
presso de genes R (Zeidler et al., 2004; Ingle et al., pela homologia estrutural do domnio NBS com pro-

132 RAPP - Volume 24, 2016


Mathias Ferrari Rockenbach, et al. 130-144)

tenas do sistema imune de vertebrado, tais como especficas ou at mesmo txicas aos patgenos
protenas do tipo Toll e Interleucina-1. Desta forma, (Bowles, 1990). Enzimas quitinases e glucanases, so
o domnio NBS pode ser classificado como do tipo protenas PR expressas especificamente pelas plan-
TIR (pelo domnio tipo Toll e IL-1), ou CC (Coiled coil tas aps o ataque por patgenos. As quitinases so
ou espiral enrolada) (Tameling & Takken, 2008) (Fi- enzimas hidrolticas capazes de degradar ligaes gli-
gura 1). O domnio N-terminal das protenas R possui cosdicas da molcula de quitina, o principal compo-
funes de reconhecimento de efetores patognicos nente da parede celular fngica. As glucanases so
ou protenas do hospedeiro sujeitas ao ataque por enzimas hidrolticas de polmeros de glicose unidos
tais efetores. Em outros casos este domnio possui por ligaes alfa ou beta (e. ex. celulose), as quais
motivos de unio ao DNA, atuando como regulado- so degradadas pelas enzimas alfa e beta-glucana-
res da transcrio gnica. ses, respectivamente. Os produtos hidrolisados por
Durante a ETI frequente observar o estabe- ambas as enzimas podem atuar como elicitores da
lecimento de um estado de resistncia a nvel sist- PTI e RH (Agrios, 2005). Alguns compostos relacio-
mico no hospedeiro conhecido como SAR. Este tipo nados resistncia podem ser sintetizados constitu-
de resistncia opera mais tardiamente em relao tivamente pelas plantas (p. ex. compostos fenlicos,
PTI, podendo estar associada RH e MCP (Coll et al., alcaloides, lectinas e inibidores proticos) ou ainda
2011; Higaki et al., 2011). Estas respostas envolvem a terem sua produo elevada aps o ataque por pat-
morte celular no stio de infeco poucas horas aps genos (p. ex. ET, AS e AJ) (Collinge et al., 1993; Knud-
o contato com o patgeno (durante a PTI), poden- sen et al., 1993; Pichersky et al., 2002; Chehab et al.,
do ocorrer desde uma nica clula a extensas reas 2008; Taiz & Sieger, 2009).
necrticas que limitam a colonizao dos patgenos
(Holub et al., 1994; Lam et al., 2001). Este fato faz Efeito do CO2 na defesa das plantas
com que este tipo de defesa seja efetivo principal- A elevao na concentrao atmosfrica de
mente contra patgenos biotrficos ou hemibiotr- CO2 pode induzir alteraes metablicas nas plantas
ficos, mas no tanto para os necrotrficos (Belkhadir capazes de interferir nas respostas ao ataque por pa-
et al., 2004; Glazebrook, 2005; Jones & Dangl, 2006). tgenos (Ainsworth et al., 2002; Chakraborty & Dat-
A resistncia sistmica tambm pode ser induzida ta, 2003; Kobayashi et al., 2006, Yez-Lpez et al.,
por indutores qumicos ou at mesmo por espcies 2012). Em geral, os incrementos na concentrao de
simbiontes, sendo conhecida nestes casos como re- CO2 aumentam a resistncia de vrios hospedeiros
sistncia sistmica induzida (ISR). vegetais a diversos patgenos, reduzindo a incidn-
Em consequncia da ativao das complexas cia ou severidade de certas doenas (Hibberd et al.,
vias de sinalizao dos sistemas de defesa das plan- 1996; Chakraborty et al., 2000; Jwa & Walling, 2001;
tas, so disparados vrios mecanismos que, quando Karnosky et al., 2002; Chakraborty & Datta, 2003;
eficientes, conferem planta resistncia completa Runion, 2003; Pangga et al., 2004; McElrone et al.,
a determinados patgenos. Apesar de estarem inti- 2005; Kobayashi et al., 2006; Strengborn & Reich,
mamente relacionados, os mecanismos de defesa de 2006; McElrone et al., 2010; Runion et al., 2010; Shin
plantas podem ser classificados para fins didticos & Yun, 2010; Ghini et al., 2014; Li et al., 2015) (Tabela
como estruturais ou bioqumicos (Agrios, 2005). Os 1).
mecanismos de defesa estruturais podem ser obser- Por exemplo, plantas de bordo vermelho
vados a nvel histolgico ou celular e envolvem es- (Acer rubrum) expostas a uma concentrao de 200
truturas que podem estar presentes nas plantas at ppm maior que as concentraes atmosfricas atu-
mesmo antes do ataque por patgenos (p. ex. plos, ais de CO2 (340-350 ppm), apresentaram menor inci-
tricomas, espinhos e cutcula), ou serem induzidas dncia e severidade de mancha foliar causadas por
por ocasio do ataque (p. ex. papilas, caloses, tilo- Phyllosticta minima. Nessas condies, a incidncia e
ses, halos, lignificaes, camadas de cortia e cama- severidade da mancha foliar foram reduzidas aproxi-
das de absciso) (Agrios, 2005; Taiz & Sieger, 2009). madamente em 15% e 27%, respectivamente. Alm
Por outro lado, os mecanismos de defesa bioqumi- disso, ocorreu uma reduo na condutncia estoma-
cos envolvem protenas e molculas do metabolis- tal na ordem de 21% a 36%. Desta forma, a reduo
mo primrio e secundrio com atividades biolgicas da doena poderia estar associada com a reduo

RAPP - Volume 24, 2016 133


Mathias Ferrari Rockenbach, et al. 130-144)

na condutncia estomatal e alteraes na compo- nartium quercum e Fusarium circinatum aumentou


sio qumica das folhas provocadas pelo aumento em mudas de carvalho expostas a 700 ppm de CO2
na concentrao ambiental de CO2. destacvel que (Runion et al., 2010).
essas plantas tambm tiveram um aumento de 15% Vrios trabalhos vm fornecendo evidncias
nos compostos fenlicos totais, 14% nos nveis de ta- de variaes bioqumicas que podem ocorrer em
ninos e 20% da proporo C:N (carbono:nitrognio) plantas expostas a concentraes de CO2 superiores
(McElrone et al., 2005). Curiosamente, a reduo da s ambientais (McElrone et al., 2005; Plessl et al.,
abertura e condutncia estomatal tambm foram 2005; Matros et al., 2006; Li et al., 2008). Em folhas
observadas em plantas de tomate (Solanum lycoper- e razes de plantas de fumo expostas a 1000 ppm de
sicum) cultivadas em ambiente com 800 ppm de CO2. CO2 foram observados acmulos de fenilpropani-
Nessas condies, essas plantas mostraram-se mais des e incrementos na atividade da enzima fenilala-
resistentes infeco por Pseudomonas syringae pv. nina amnia-liase (FAL) (Matros et al., 2006). No en-
tomato (Li et al., 2015). Plantas de Solidago rigida tanto, no foram detectadas diferenas nos nveis de
expostas a concentraes de aproximadamente 900 AS e protenas PR nessas mesmas condies. Estas
ppm de CO2 tiveram redues de at 57% na incidn- plantas apresentaram maior resistncia ao virus Y da
cia de manchas foliares provocadas por espcies de batata, que foi relacionado com o incremento nos
Cercospora e Septoria (Strengborn & Reich, 2006). nveis de fenilpropanides induzido por essas con-
Plantas de pinheiro (Pinus taeda) e carvalho (Quercus dies ambientais (Matros et al., 2006). Por outro
robur) expostas a 700 ppm de CO2, inoculadas com lado, plantas de cevada cultivadas em 700 ppm de
Fusarium circinatum e Cronartium quercum, apre- CO2 mostraram incrementos na proporo C:N e nos
sentaram redues na incidncia de cancro e ferru- teores de amido, assim como maior resistncia ao
gem, respectivamente (Runion et al., 2010). Plantas patgeno Drechslera teres (Sacc.) Shoemaker (Pless-
de eucalipto cultivadas em concentraes elevadas let al., 2005).
de CO2 (508 a 700 ppm) e inoculadas com Puccinia Experimentos realizados em OTC (Open-top
psidii, apresentaram redues no nmero de pstu- chamber) e FACE (Free-air CO2 enrichment) combi-
las de ferrugem por folha, uredsporos por pstula nando concentraes de CO2 e O3 tm permitido es-
e rea abaixo da curva de progresso da doena (AA- tudar os efeitos simultneos destes dois principais
CPD) (Ghini et al., 2014). Alm disso, o crescimento gases de efeito estufa. Por exemplo, plantas de trigo
destas plantas foi 23% maior em comparao ao das crescidas a 550 ppm de CO2 e 80 ppb de O3 sinteti-
plantas em concentraes de CO2 atuais. zaram mais flavonas e compostos fenlicos totais na
Incrementos nas concentraes de CO2 tam- sua maturao. Por outro lado, durante estgios fe-
bm podem afetar a fisiologia, germinao dos es- nolgicos iniciais essas plantas apresentaram nveis
poros ou a esporulao dos patgenos, reduzindo a menores de flavonas em relao s plantas cultiva-
incidncia de doena em determinados hospedei- das sob concentrao ambiental de CO2 e O3 (Li et
ros. Por exemplo, em plantas de cevada submetidas al., 2008). Em outro experimento, observou-se que
a 350 e 700 ppm de CO2 no foram observadas dife- plantas de soja submetidas a 550 ppm de CO2 e 66
renas na germinao de condios de Blumeria gra- ppb de O3 apresentaram redues entre 33% e 66%
minis. Contudo, o nmero de condios que progrediu na severidade de doena provocada por mldio. Con-
a formar colnias foi menor a 700 ppm do que 350 tudo, essas plantas tiveram um aumento na severi-
ppm de CO2 (Hibberd et al., 1996). A exposio de dade de septoriose (Septoria glycines) quando foram
plantas de Stylosanthes scabra a 700 ppm de CO2 re- sometidas s mesmas concentraes de CO2 e O3
duziu a severidade de antracnose causada por Colle- (Eastburn et al., 2010). Plantas de batata (Solanum
totrichum gloeosporioides. Tal reduo parece estar tuberosum) expostas a 700 ppm de CO2 e duas vezes
associada inibio da germinao conidial, assim a concentrao ambiental de O3 exibiram maior re-
como o aumento do perodo de incubao e redu- sistncia requeima (Phytophtora infestans). Nessas
o da agressividade do patgeno (Chakraborty et plantas as atividades de enzimas -1,3 glucanases e
al., 2000). Em outro trabalho, o perodo de latncia o contedo de acares solveis foram significativa-
(tempo de esporulao) dos patgenos fngicos Cro- mente maiores (Plessl et al., 2007) (Tabela 1).

134 RAPP - Volume 24, 2016


Tabela 1. Resumo dos efeitos metablicos em diferentes patossistemas e hospedeiros vegetais em resposta ao aumento da temperatura ambiental, dos principais gases
de efeito estufa (CO2 e O3) e da radiao ultravioleta.

Estresse Patossistema ou Hospedeiro Efeitos no hospedeiro Referncia


Acer rubrum / Hphyllosticta minima Reduo da abertura dos estmatos, aumentos nos nveis de compostos MacElrone et al., 2005.
fenlicos, taninos e fitoalexinas. Aumento da resistncia.
Solidago rigida / Cercospora sp. Reduo nos nveis de nitrognio nos tecidos. Aumento da resistncia. Strengborn & Reich, 2006.
Nicotiana tabacum / Vrus Y da batata (PVY) Aumento nos nveis de fenilpropanides. Aumento da resistncia. Matros et al., 2005.
Hordeum vulgare / Drechslera teres Aumento dos teores de amido e diminuio dos nveis de protenas. Plessl et al., 2005.
CO2 Aumento da resistncia.
Solanum tuberosum / Phytophtora infestans Aumento na atividade de -1,3-glucanase e dos nveis foliares de Plessel et al., 2007.
acares solveis. Aumento da resistncia.
Eucalyptus sp. / Puccinia psidii Reduo no nmero de pstulas por folha, esporos por pstula e Ghini et al., 2014.
AACPD. Aumento da resistncia.
Solanum lycopersicum / Pseudomonas syringae pv. tomato Reduo da abertura e condutncia estomatal. Aumento da resistncia. Li et al., 2015.
Solanum lycopersicum / Botrytis cinerea Inibio da expresso de genes PR e de genes relacionados com a Tzortzakis et a., 2011.
transduo de sinais. Aumento da resistncia.
Triticum aestivum / Puccinia recondita Aumento de injrias provocadas por O3. Aumento da resistncia. von Tiedeman & Firsching, 2000.
Triticum aestivum / Erysiphae graminis
Senescncia foliar prematura, diminuio dos nveis de clorofila e
Triticum aestivum / Septoria nodarum von Tiedeman et al., 1991.
carotenoides. Aumento da suscetibilidade.
Triticum aestivum/ Bipolaris sorokiniana
O3 Picea abies / Rhizosphaera kalkhoffi Induo da expresso de enzimas envolvidas na sntese da lignina. Galliano et al., 1993.
Induo da expresso de enzimas -1,3-glucanses e quitinase. Ernst et al., 1992.
Nicotiana tabacum Induo da expresso de enzimas envolvidas na sntese de composto Pasqualini et al., 2003.
fenlicos. Deposio de calose.

RAPP - Volume 24, 2016


Induo da expresso de genes R. Eckey-Kaltenbach et al., 1997.
Petroselinum crispum
Aumento nos nveis de compostos fenlicos. Eckey-Kaltenbach et al., 1994.
Lens culinaris Induo da expresso de enzimas lipoxigenase. Maccarone et al., 1997.
Mathias Ferrari Rockenbach, et al. 130-144)

Hordeum vulgare / Blumeria graminis Aumento da resistncia. Mikkelsen et al., 2015.


Hordeum vulgare / Bipolaris sorokiniana Aumento da suscetibilidade. Mikkelsen et al., 2015.
Reduo da resistncia mediada por genes R Wang et al., 2009.
Arabidopsis thaliana / Pseudomonas syringae
Temperatura Aumento da resistncia em plantas mutantes no gene SNC1 Zhu et al., 2010.
Solanum lycopersicum / Cladosporium fulvum Inibio da expresso de genes associados reao de de Jong et al., 2002.
hipersensibilidade.
Nicotiana tabacum / TMV Inibio da expresso de genes R e do acmulo de cido saliclico. Zhu et al., 2010
Brassica oleracea Induo da expresso de genes PR e sntese de fitoalexinas, Mewis et al., 2012.
flavonides e terpenides.
Radiao UV Arabidopsis thaliana / Hyaloperonospora parasitica Aumento da resistncia. Kunz et al., 2008.
Arabidopsis thaliana / Botrytis cinerea Aumento da resistncia. Demkura & Ballar, 2012.

135
Mathias Ferrari Rockenbach, et al. 130-144)

Efeito do O3 maior atividade da enzima estilbeno-sintase (Rose-


Plantas podem responder de modo dife- mann et al.,1991). Neste caso, enzimas que catali-
rente ao ataque por patgenos quando so expos- zam mesmos substratos que a estilbeno-sintase, tais
tas a concentraes elevadas de O3 de forma isola- como a FAL (envolvida na biossntese de compostos
da, ou em conjunto com CO2. Vrios trabalhos tm fenlicos) e chalcona-sintase (CHS - envolvida na bio-
demonstrado que a exposio a nveis de O3 superio- sntesse de flavonoides), apresentaram incrementos
res aos atuais (oscilantes entre 20 60 ppb) pode afe- de at duas vezes em suas atividades enzimticas
tar a fisiologia e os mecanismos de defesa ativados (Rosemann et al.,1991). Plantas de fumo sensveis a
pelas plantas em resposta ao ataque por patgenos O3 (Nicotina tabacum L. cv. Bel W3) expostas a 150
(Rosemann et al., 1991; Ernst et al., 1992; Eckey-Kal- ppb desse gs durante 5 horas, apresentaram um
tenbach et al., 1994; Ernst et al., 1996; Sanderman, pico nos nveis de compostos fenlicos s 10 horas
1996; Eckey-Kaltenbach et al., 1997; Pell et al., 1997; aps o tratamento, bem como maior expresso dos
Sharma et al., 1997; Sanderman, 1998; Zinser et al., genes codificantes para as enzimas FAL-a e FAL-b,
1998; Tiedemann & Firsching, 2000; Mikkelsen et al., associado a maior atividadede FAL (Pasqualini et al.,
2015). 2003). Estas plantas desencadearam uma exploso
Por exemplo, plantas de trigo (Triticum aesti- oxidativa com uma acumulao mxima de perxido
vum L cv. Turbo) expostas a concentraes entre 61- de hidrognio (H2O2) s 12 horas e desenvolveram
62 ppb de O3 durante uma hora diria por 4 meses injrias visveis semelhantes quelas desenvolvidas
e logo inoculadas com Puccinia recondita f.sp. tritici, durante a RH, entre 48 e 72 horas aps o tratamento
apresentaram uma forte inibio da ferrugem foliar com 150 ppb de O3 (Pasqualini et al., 2003).
provocada por esse patgeno (Tiedemann & Firs- Em plantas de salsa (Petroselinum crispum
ching, 2000). Essas plantas apresentaram, contudo, L.) expostas a uma concentrao de 200 ppb de O3
leses necrticas de maneira antecipada (entre 2 a durante 10 horas, foram encontrados maiores nveis
4 semanas) em relao a plantas expostas a O3, mas de glucosdeos flavona e furanocumarinas aps 12
no inoculadas. A formao de biomassa, nmero e 24 horas aps a exposio ao O3, respectivamente
de gros por plantas e a produo de gros tambm (Eckey-Kaltenbach et al., 1994). O acmulo mximo
foram reduzidos nas plantas tratadas com O3 e inocu- dos transcritos codificantes para as enzimas FAL, CH,
ladas com P. recondita (Von Tiedemann & Firsching, e XMT (S-adenosil-metionina:xantotoxol-O-metil-
2000). Por outro lado, o cultivo de plantas de ceva- transferase envolvida na biossntese de furanocu-
da (Hordeum vulgare) em concentraes elevadas marinas) ocorreu 3 horas aps a exposio a O3, en-
de O3 (60-90 ppb) reduziu em 50% a infeco pelo quanto que os picos na atividade enzimtica destas
odio (Blumeria graminis) porm, incrementou em enzimas foram detectados aps 12 horas de exposi-
130% os sintomas da mancha marrom causados por o ao gs. Em casos como este, onde so induzidas
Bipolaris sorokiniana (Mikkelsenen et al., 2015). Em duas vias independentes relacionadas defesa, o O3
frutos de tomate (S. lycopersicum) expostos durante tem sido denominado como um indutor cruzado
6 dias a 50 ppb de O3 e posteriormente inoculados (Eckey-Kaltenbach et al., 1994). Em plantas de es-
com Botrytis cinerea, houve reduo no desenvolvi- pruce-da-Noruega (Picea abies L.) tratadas com 600
mento de leses provocadas por esse patgeno. Os ppb durante 8 horas, foram detectados incrementos
mesmos frutos apresentaram inibio da expresso de at 3 vezes nos nveis de transcritos codificantes
de genes PR codificantes para defensinas, enzimas para a enzima cinamil-lcool desidrogenase (CAD -
quitinases e -glucanases, associados resistncia envolvida na biossntese da lignina), em relao a
(Tzortzakis et al., 2011). plantas expostas a concentraes ambientais de O3
Vrias molculas de fitoalexinas tm sido de- (Galliano et al., 1993). Neste caso, os nveis mximos
tectada em hospedeiros vegetais aps a exposio a de transcritos e atividade enzimtica para a enzima
elevadas concentraes ambientais de O3. Por exem- CAD foram atingidos aos 17 dias aps o tratamento
plo, plantas de pinheiro (Pinus sylvestris L.) submeti- com O3 (Galliano et al., 1993).
das a 200 ppb de O3 durante 4 horas apresentaram Outra resposta tpica observada em plantas
uma maior sntese de estilbenos (pinosilvina- PS e expostas a elevadas concentraes de O3 a o au-
pinosilvina 3-metil ter PSM) e concomitante, mento da sntese de protenas PR. Plantas de fumo

136 RAPP - Volume 24, 2016


Mathias Ferrari Rockenbach, et al. 130-144)

sensveis (Nicotiana tabacum cv. Bel W3) e tolerantes envolvidas em vrias vias de sinalizaes relaciona-
(Nicotiana tabacum cv. Bel B) ao O3, tm sido utiliza- das com o disparo de estados de resistncia a nvel
das como biomonitores para o estudo das respostas sistmico, como por exemplo, AS, AJ e ET (Yalpani
associadas ao estresse com O3 (Schraudner et al., et al., 1994; Sharma et al., 1996; Pell et al., 1997).
1992; Sandermann, 1996). Por exemplo, em plantas Tem sido proposto que ET e AS poderiam atuar como
de fumo cv. Bel W3 e cv. Bel B expostas 150 ppb de mensageiros secundrios ou tercirios na ativao
O3 durante 5 horas, foram detectados incrementos das respostas do tipo SAR induzidas por O3 (San-
nos nveis dos transcritos codificantes para as enzi- derman et al., 1998). Por exemplo, tecido foliar de
mas quitinase e -1,3glucanase (Schraudner et al., plantas de fumo (Nicotiana tabacum L. cv. Xanthi-nc)
1992). Neste caso, plantas da cv. Bel W3 apresenta- expostas a 200 ppb de O3 durante 6 horas, por 4 dias,
ram incrementos entre 40 e 75 vezes na atividade mostraram induo da expresso das protenas PR1-
-1,3glucanase e de 4 vezes na atividade quitinase, -a e PR1-b ao quinto dias aps o tratamento com O3
entre as 5 e 10 horas aps a exposio com O3. Estas (Yalpani et al., 1994). A induo da expresso dessas
plantas tambm desenvolveram injrias necrticas protenas foi acompanhada pelo aumento nos nveis
com deposio de caloses em clulas adjacentes s de AS, a partir do primeiro dia aps o tratamento
reas necrticas (Schraudner et al., 1992). Resulta- com O3, o que parece ser a causa do disparo de res-
dos semelhantes foram obtidos em outro trabalho, postas tipo RH e SAR em plantas submetidas a con-
onde plantas de fumo cv. Bel W3 e cv. Bel B expostas centraes elevadas de O3 (Yalpani et al., 1994). Em
a 150 ppb de O3 durante dois dias exibiram maio- plantas de Arabidopsis thaliana expostas a 300 ppb
res nveis de transcritos codificantes para as enzimas de O3 durante 6 horas, foram detectados incremen-
-1,3glucanase, quitinase bsica, quitinase cida, e tos nos nveis de transcritos codificantes para PR-1
PR-1b (Ernst et al., 1992). Por outro lado, em folhas s 12 horas aps a exposio com O3. Estes incre-
de fumo cv. Bel W3 expostas a 150 ppb durante 5 mentos foram acompanhados por maiores nveis de
horas foi detectado um pico nos nveis de transcritos AS os quais atingiram um pico s 6 horas aps a ex-
codificantes para PR-1a (protena marcadora da RH) posio a elevadas concentraes de O3 (Sharma et
24 horas aps a exposio ao O3 (Pasqualini et al., al.,1996). Aparentemente, a induo de AS poderia
2003). Alm disso, observaram-se tambm maiores ser induzida pela produo de EROs e protenas PR
nveis de compostos fenlicos, perxido de hidrog- e, a expresso conjunta destas vias seria necessria
nio e de deposio de caloses aps 24 horas do tra- para o disparo da RH e SAR, induzidas pelo estresse
tamento com O3. Estas respostas consideradas em a O3. Plantas de lentilha (Lens culinaris) tratadas com
conjunto, indicam que os mecanismos envolvidos um fluxo de 5 ml/min de O3, tiveram uma maior ex-
durante a RH disparada pelo estresse a O3, so se- presso dos genes e atividade das enzimas LOX1 e
melhantes queles disparados durante a RH e MCP LOX2 3 horas aps o tratamento com O3 (Maccarro-
induzidos pelo ataque por patgenos (Pasqualini et ne et al.,1997).
al., 2003). Plantas jovens de espruce-da-Noruega (Pi- A ativao de sistemas antioxidantes em
cea abies L.) expostas a 150 ppb durante 7 horas por plantas induzidos aps o tratamento com O3, tem
dia, at 8 dias, apresentaram maior expresso endo- sido demonstrado atravs da deteco de EROs
-quitinase e -1,3glucanase a partir do segundo produzidas pela exposio de plantas ao O3 (San-
dia (Karenlampi et al.,1994). Ambas estas protenas derman, 1996; Pell et al., 1997; Sharma et al., 1997;
so sintetizadas geralmente em resposta ao ataque Langerbartels et al., 2002; Mahalingam et al., 2006).
por patgenos fngicos, sendo que neste caso o O3 O O3 capaz de induzir a produo de EROs, uma vez
estaria atuando de maneira anloga a os elicitore que ingressa nas plantas via estmatos e se translo-
fngicos patognicos. Plantas de salsa (P. crispum L.) ca atravs do apoplasto, reagindo e produzindo pe-
expostas primeiro a 200 ppb de O3durante 10 horas rxido de hidrognio, on superxido, xido ntrico,
e depois por 8 horas ao ar livre, exibiram maior ex- etc. (Langebartels et al., 2002; Sharma et al., 1997).
presso dos genes codificantes das protenas PR1-3 Esses EROs esto associados s vias metablicas que
e PR1-4 (Eckey-Katlenbach et al., 1997). induzem RH e SAR, o que demonstra a capacidade
Em geral, a induo da expresso de prote- do O3 em atuar como um interlocutor entre vias me-
nas PR ocorre junto produo de outras molculas tablicas disparadas tanto em resposta ao estresse

RAPP - Volume 24, 2016 137


Mathias Ferrari Rockenbach, et al. 130-144)

por O3 como pelo ataque por patgenos. Por exem- entanto, interessante destacar que respostas autoi-
plo, plantas de Arabidopsis thaliana expostas a 300 munes mediadas pelos genes R em plantas hbridas
ppb de O3 durante 6 horas, por 14 dias, mostraram de Arabidopsis podem ser atenuadas mediante um
incrementos nos nveis de transcritos codificantes incremento moderado na temperatura (Bomblies et
para as enzimas FAL, SOD (superxido dismutase), al., 2007), indicando que at mesmo alteraes me-
POX (Peroxidase) e GST (Glutationa-S-transferase), nores na temperatura global podem afetar os siste-
aps 6 horas de exposio diria de O3 (Sharma et mas de defesa das plantas.
al.,1994). Por outro lado, tem-se observado que o O3 Em plantas de Arabidopsis e fumo (Nicotiana
tambm capaz de induzir reaes de defesa que benthamiana), a resistncia basal e a resistncia me-
so normalmente induzidas por outros estresses diada pelos genes R frente a Pseudomonas syringae
sem ser o ataque por patgenos, como por exemplo, so inibidas pelo aumento da temperatura (Wang
estresses relacionados superexposio radiao et al., 2009). Alm disso, foi constatado que em am-
UV (Langebartels et al., 2002; Yalpani et al., 1994). bos os hospedeiros as respostas de defesa sensveis
temperatura no dependem do AS nem AJ, nem
Efeito da temperatura tampouco dos fatores EDS1 e PAD4. Isto tem levado
A temperatura um dos principais fatores a pensar que certas respostas de defesa devem estar
ambientais que regula o desenvolvimento e o cresci- mediadas por outros componentes sinalizadores, ou
mento das plantas. O aumento na temperatura glo- mesmo, por uma combinao de mltiplos fatores
bal no decorrer das prximas dcadas poder afetar ainda desconhecidos (Wang et al., 2009). Trabalhos
diretamente a durao dos invernos, a distribuio com Arabidopsis permitiram isolar um mutante re-
geogrfica dos hospedeiros e patgenos e, as taxas sistente a doenas em condies de elevadas tempe-
de crescimento e reproduo dos mesmos. Desta raturas (Zhu et al., 2010). Este mutante possui uma
forma, as variaes na temperatura em escala global mutao no gene snc1, o qual codificante para
tambm podem afetar a disperso de doenas infec- uma protena R portadora de um domnio NBS-LRR,
ciosas e a sobrevivncia dos patgenos entre as es- com funes de reconhecimento a elicitores pato-
taes (Yez-Lpez et al., 2012). Alm disso, a tem- gnicos. Temperaturas elevadas parecem modular a
peratura capaz de afetar o desenvolvimento dos conformao destes receptores a ponto de torn-los
patgenos devido a alteraes na acumulao de funcionalmente ativos na conferncia de resistncia
fitoalexinas, e/ou pigmentos protetores nos tecidos a doena nessas condies de estresse (Zhu et al.,
hospedeiros (Newman et al., 2003; Newman, 2004; 2010). Mutaes similares no gene N em plantas
Memmot et al., 2007; Ladanyi & Horvath, 2010). de fumo tambm foram capazes de conferir resis-
Plantas submetidas a temperaturas elevadas tncia doena sob temperaturas elevadas (Zhu et
tm demonstrado geralmente maior suscetibilidade al., 2010). Em plantas de tabaco foi constatado que
ao ataque por patgenos e pr-disposio ao desen- ocorre inibio da expresso dos genes R e do ac-
volvimento de doenas. O aumento da temperatura mulo de AS sob elevadas temperaturas. Contudo, a
pode afetar tanto as respostas de defesa associadas aplicao exgena de AS capaz de reverter essa ini-
PTI, quanto ETI. Neste sentido, vrios genes re- bio da expresso dos genes R, mas no de impedir
lacionados com a defesa contra patgenos so re- a ocorrncia de RH (Malamy et al., 1992) (Tabela 1).
primidos em certos hospedeiros expostos a altas O efeito de incrementos na temperatura am-
temperaturas (Xiao et al., 2003, 2005; de Jong et al., biental nas respostas de defesa de plantas contra pa-
2002). Por exemplo, a RH disparada pelo gene RPW8 tgenos pode variar de acordo com o gentipo do
em Arabidopsis, que confere resistncia ao odio, hospedeiro, ou conforme os modos de colonizao
reprimido em plantas submetidas a temperaturas do patgeno. Assim, por exemplo, plantas de A. tha-
acima de 30C (Xiao et al., 2003). A resistncia e RH liana ecotipo Col-0 possuem resistncia a P. syringae
disparada pelos genes Cf4 e Cf9 em tomate (codifi- via ETI, sob condies de temperatura alta (30C)
cantes para duas protenas do tipo RLKs), frente ao (Menna et al., 2015). Por outro lado, os ecotipos
fungo patognico Cladosporium fulvum, tambm CIBC-5, Tsu-1 e Wei-0, resistentes a P. syringae em
podem ser suprimidas em plantas expostas a tempe- temperaturas de at 24C, tm sua resistncia via
raturas superiores a 33C (de Jong et al., 2002). No ETI suprimida, tornando-se suscetveis ao patgeno

138 RAPP - Volume 24, 2016


Mathias Ferrari Rockenbach, et al. 130-144)

a 30C (Menna et al., 2015). Em plantas de cevada de resistncia a UV (uvr8, UV Resistance locus 8) o
(H. vulgare), o incremento da temperatura ambiente receptor primrio da radiao UV-B em plantas. Este
em 5C suficiente para reduzir a infeco por odio receptor controla a expresso de vrios genes rela-
(B. graminis) em aproximadamente 75% (Mikkelsen cionados com a aclimatao e proteo de plantas
et al., 2015). Porm, esta elevao na temperatura contra a radiao UV-B (Demkura & Ballar, 2012).
favorece a infeco por B. sorokiniana resultando As plantas esto adaptadas e, possivelmen-
em um aumento de cerca de 150% nos sintomas da te, utilizam os nveis atuais de radiao UV-B para
mancha marrom (Mikkelsen et al., 2015). o estabelecimento de certos graus de resistncia a
patgenos. Desta forma, quando a quantidade de ra-
Efeito da radiao ultravioleta diao UV-B incidente reduzida, a suscetibilidade
Alm da radiao fotossinteticamente ati- vegetal ao ataque de patgenos pode ser aumenta-
va (PAR, Photosynthetically Active Radiation, 400 da. Neste sentido, a reduo na incidncia de radia-
-700 nm), as plantas esto expostas radiao ul- o UV-B em cerca de 80% aumenta a severidade de
travioleta (UV). Esta radiao composta pelas fai- Exobasidium vexans em plantas de ch (Camellia si-
xas UV-C (abaixo de 280 nm), UV-B (280 320 nm) nensis) (Gunasekera et al., 1997).
e UV-A (320 390 nm). Vrios trabalhos mostram
que o aumento na incidncia de radiao UV devido Perspectivas futuras
a nveis reduzidos de O3 estratosfrico, afeta o perfil O incremento na concentrao dos principais
metablico de plantas, especialmente os metabli- gases de efeito estufa, da temperatura ambiental,
tos secundrios (Gunasekera et al., 1997; Kunz et al., bem como da radiao ultravioleta um problema
2008; Mewis et al., 2012; Nawkar et al., 2013; Balla- potencial que poder afetar diretamente os siste-
r, 2014; Bornman et al., 2015). mas de defesa das plantas nas prximas dcadas.
Por exemplo, a pr-exposio de plantas de Mesmo considerando os cenrios com menor po-
Arabidopsis thaliana a radiao UV (254 nm, 0,2 kj/ tencial de riscos preditos pelos modelos para os
m2) reduz o nmero de conidiforos de Hyalopero- prximos cinquenta e cem anos, as concentraes
nospora parasytica por folha em cerca de 80% (Kunz que se atingiriam seriam suficientes para afetar os
et al., 2008). Estes efeitos persistem por at 7 dias sistemas de defesa em vrias espcies de importn-
aps a exposio radiao UV. Aparentemente, o cia econmica (Pachauri & Reisinger, 2007). Como
disparo de respostas de defesa aps a exposio demonstram os trabalhos citados nesta reviso, v-
radiao UV relacionado com os danos causados rios hospedeiros respondem mediante os mesmos
por ela ao DNA vegetal. Alm disso, trabalhos recen- mecanismos fisiolgicos que ocorrem durante as
tes mostram que mitocndrias e cloroplastos podem respostas ao ataque por patgenos, o que sugere que
produzir EROs em resposta radiao UV que por os receptores envolvidos no reconhecimento aos
sua vez, podem, eventualmente, iniciar uma casca- incrementos de CO2 e O3 so os mesmos envolvidos
ta de eventos que culminar na MCP (Nawkar et al., no reconhecimento dos patgenos, ou existe uma
2013). grande sobreposio das rotas fisiolgicas entre
Alm de poder disparar a MCP, a exposio ambas as respostas.
radiao UV altera profundamente o metabolismo A aplicao de engenharia gentica com fins
vegetal. Assim, por exemplo, a irradiao de plantas de produzir plantas mutantes poderia ser uma fer-
de brcolis (Brassica oleracea) com radiao UV-B ramenta no futuro para o desenvolvimento de cul-
(0,6 kj/m) aumenta a expresso de genes relacio- tivares resistentes aos incrementos na temperatura
nados com a defesa vegetal incluindo a sntese de e nvel dos gases de efeito estufa. A resistncia a
fitoalexinas, flavonides, terpenides e protenas PR doenas observada em plantas modelos tais como
(PR-1, PR-2 e PR-4). A exposio de plantas de Ara- Arabidopsis e fumo, poderia ser aproveitada para o
bidopsis thaliana a 5,5 kj/m de radiao UV-B reduz desenvolvimento de cultivares resistentes (Zhu et
em cerca de 50% a severidade de Botrytis cinerea al., 2010). De qualquer maneira, os trabalhos reali-
(Demkura & Ballar, 2012). Alm disso, a ativao zados em laboratrio so parciais e o xito a campo
de respostas de defesa e, consequentemente, o con- ainda dever de ser constatado, mesmo porque os
trole do patgeno, parece estar associado ao locus cenrios ambientais propostos para o futuro deri-

RAPP - Volume 24, 2016 139


Mathias Ferrari Rockenbach, et al. 130-144)

vam apenas de modelos matemticos e critrios a plants. Annual Reviews of Biochemistry 59:873-
priori mais ou menos rigorosos. No possvel afir- 907.
mar que as plantas respondero em nvel de campo Chakraborty S, Pangga IB, Lupton J, Hart L, Room PM,
da mesma forma que o fazem no laboratrio, j que Yates D (2000) Production and dispersal of Colle-
no se consideram outros fatores e suas inmeras totrichum gloeosporioides spores on Stylosanthes
interaes, que podem ser alterados pelas mudan- scabra under elevated CO2. Environmental Pollu-
as climticas e possveis adaptaes evolutivas por tion 108:381-387. 2000.
parte dos patgenos e hospedeiros. Portanto, mais Chakraborty S, Datta S (2003) How will plant patho-
estudos so extremamente necessrios para enten- gens adapt to host plant resistance at elevated
der melhor e tentar predizer quais sero os efeitos CO2 under a changing climate? New Phytologist
das mudanas climticas no sistema de defesa das 159(3):733-742.
plantas. Chehab EW, Raspi R, Savcenko T, Rowe H, Negre-
-Zakharov F, Kliebenstein D, Dehesh K (2008) Dis-
Referncias tinct roles of jasmonates and aldehydes in plant-
Agrios GN (2005) Plant Pathology. 5th Ed. Amster- defense responses. PloS ONE 4:e1904.
dam, The Netherlands. Elsevier Academic Press. Coll NS, Epple P, Dangl JL (2011) Programmed cell de-
Ainsworth E, Davey P, Bernacchi C, Dermody O, He- ath in the plant immune system. Cell Death and
aton EA, Moore DJ, Morgan PB, Naidu SL, Ra Y, Differentiation 18:1247-1256.
Zhu X, Curtis P, Long SP (2002) A meta-analysis of Collinge DB, Kragh KM, Mikkelsen JD, Nielsen KK,
elevated [CO2] effects on soybean (Glycine max) Rasmussen U, Vad K (1993) Plant chitinases. The
physiology, growth and yield. Global Change Bio- Plant Journal 3(1):31-40.
logy 8(8):695709. de Jong CF, Takken FL, Cai X, De Wit PJ, Josten MH
Ali GS, Reddy ASN (2008) PAMP-triggered immunity. (2002) Attenuation of Cf-mediated defense res-
Early events in the activation of Flagellin Sensiti- ponse at elevated temperatures correlates with a
ve2. Plant Signalling & Behavior 3(6):423-426. decrease in elicitor-binding site. Molecular Plant
Araujo MB, Pearson RG, Thuiller W, Erhard M (2005) Microbe Interactions 15:1040-1049.
Validation of species-climate impact models Demkura PV, Ballar CL (2012) UVR8 mediates UV-B-
under climate change. Global Change Biology -induced Arabidopsis defense responses against
11:15041513. Botrytis cinerea by controlling sinapate accumu-
Ballar CL (2014) Light regulation of plant defense. lation. Molecular Plant 5(3):642-652.
Annual Reviews of Plant Biology 65:335-363. Eastburn DM, Degennaro MM, Delucia EH, Dermody
Belkhadir Y, Subramaniam R, Dangl JL (2004) Plant O, Mcelrone AJ (2010) Elevated atmospheric car-
disease resistance protein signaling, NBS-LRR pro- bon dioxide and ozone alter soybean diseases at
teins and their partners. Current Opinion in Plant SoyFACE. Global Change Biology 16:320-330.
Biology 7:391-399. Eckey-Kaltenbach H, Ernst D, Heller W, Sandermann
Bennici A (2008) Origin and early evolution of land H (1994) Biochemical plant responses to ozone
plants. Communicative & Integrative Biology (IV. Cross-induction of defensive pathways in par-
1(2):212-218. sley (Petroselinum crispumL.) plants). Plant Phy-
Bomblies K, Lempe J, Epple P, Warthmann N, Lanz siology 104:67-74.
C, Dangl JL, Weigel D (2007) Autoimmune respon- Eckey-Kaltenbach H, Kiefer E, Grosskopf E, Ernst D,
se as a mechanism for Dobzhansky-Muller-type Sandermann H (1997) Differential transcript in-
incompatibility syndrome in plants. PloS Biology duction of parsley pathogenesis-related proteins
5:e236. and of a small heat shock protein by ozone and
Bornmann JF, Barnes PW, Robinson SA, Ballar CL, heat shock. Plant Molecular Biology 33(2):343-
Flint SD, Caldwell MM (2015) Solar ultraviolet ra- 350.
diation and ozone depletion-driven climate chan- Edwards R, Dixon DP, Walbot V (2000) Plant gluta-
ge: effects on terrestrial ecosystems. Photoche- thione S-transferase: enzymes with multiple func-
mical & Photobiological Sciences 14:88-107. tions in sickness and in health. Trends in Plant
Bowles DJ (1990) Defense-related proteins in higher Science 5(5):193-198.

140 RAPP - Volume 24, 2016


Mathias Ferrari Rockenbach, et al. 130-144)

Ernst D, Schraudner M, Langebartels C, Sandermann Howden SM, Soussana JF, Tublello FN, Chhetrl N,
H (1992) Ozone-induced changes of mRNA levels Dunlop M, Melnke H (2007) Adapting agricultu-
of b-1,3-glucanase, chitinase and pathogenesis- re to climate change. Proceedings of the National
-related protein 1b in tobacco plants. Plant Mo- Academy Science 104(50):19691-19696.
lecular Biology 20:673-682. Howden AJM, Huitema E (2012) Effector-triggered
Ernst D, Bodemann A, Schmelzer E, Langebartels C, post-translational modifications and their role in
Sandermann Jr H (1996) -1,3-glucanase mRNA is suppression of plant immunity. Plant Proteomics
locally, but not systemically induced in Nicotiana 3:1-6.
tabacum L. cv. Bel W3 after ozone fumigation. Ingle RA, Carstens M, Denby KJ (2006) PAMP recog-
Journal of Plant Physiology 148:215-221. nition and the plant-pathogen arms race. Bioes-
Galliano H, Cabane M, Eckerskorn C, Lottspeich F, says 28(9):880-889.
Sandermann H, Ernst D (1993) Molecular cloning, Jones JDG, Dangl JL (2006) The plant immune sys-
sequence analysis and elicitor- / ozone-induced tem. Nature 444:323-329.
accumulation of cinnamyl alcohol dehydrogenase Jwa NS, Walling LL (2001) Influence of elevated CO2
from Norway spruce (Picea abis L.). Plant Molecu- concentration on disease development in toma-
lar Biology 23(1):145-156. to. New Phytologist 149:509-518.
Ghini R, Mac Leod REO, Torres Neto A, Cardoso DC, Karenlampi SO, Airaksinen K, Miettinen ATE, Kokko
Bettiol W, de Morais LAS, Vique B (2014) Increased HI, Holopainen JK, Karenlampi LV, Karjalainen RO
atmospheric carbon dioxide concentration: ef- (1994) Pathogenesis-related proteins in ozone-
fects on eucalypt rust (Puccinia psidii), C:N ratio -exposed Norway spruce [Picea abis L. (Karst)].
and essential oils in eucalypt clonal plantlets. For- New Phytologist 126:81-89.
est Pathology 44:409-416. Karnosky DF, Percy KE, Xiang BX (2002) Interacting
Glazebrook J (2005) Contrasting mechanisms of de- elevated CO2 and tropospheric O3 predisposes
fense against biotrophic and necrotrophic patho- aspen (Populus tremuloides Michx.) to infection
gens. Annual Review of Phytopathology 43:205 by rust (Melampsora medusae f. sp tremuloidae).
227. Global Change Biology 8:329-338.
Greef C, Roux M, Mundy J, Petersen M (2012) Re- Knudsen JT, Tollsten L, Bergstrom G (1993) Floral
ceptor-like kinase complexes in plant innate im- scents a checklist of volatile compounds isola-
munity. Plant Proteomics 3:1-7. ted by head-space techniques. Phytochemistry
Gunasekera TS, Paul ND, Ayres PG (1997) The effect 33:253-280.
of ultraviolet-B (UV-B: 290-320nm) radiation on Kobayashi T, Ishiguro K, Nakajima T, Kim HY, Okada M,
blister blight disease of tea (Camellia sinensis). Kobayashi K (2006) Effects of elevated atmosphe-
Plant Pathology 46:179-185. ric CO2 concentration on the infection of rice blast
Heath MC (2000) Hypersensitive response-related and sheath blight. Phytopathology 96(4):425-431.
death. Plant Molecular Biology 44:321-334. Kunz BA, Dando PK, Grice DM, Mohr PG, Schenl PM,
Hibberd JM, Whitbread R, Farrar JF (1996) Effect of Cahill DM (2008) UV-induced DNA damage pro-
elevated concentrations of CO2 on infection of motes resistance to the biotrophic pathogen Hya-
barley by Erysiphe graminis. Physiological and loperonospora parasitica in Arabidopsis. Plant
Molecular Plant Pathology 48:37-53. Physiology 148:1021-1031.
Higaki T, Kurusu T, Hasezawa S, Kuchitsu K (2011) Kurusu T, Yagala T, Miyao A, Hirochika H, Kuchitsu K
Dynamic intracellular reorganization of cytoskel- (2005) Identification of a putative voltage-gated
etons and the vacuole in defense responses and Ca2+ channel as a key regulator of elicitor-induced
hypersensitive cell death in plants. Journal of hypersensitive cell death and mithogen-activated
Plant Research 124:315-324. protein kinase activation in rice. Plant Journal
Holub EB, Beynon JL, Crute IR (1994) Phenotypic 42:798-809.
and genotypic characterization of interactions be- Kurusu T, Hamada H, Sugiyama Y, Yagala T, Kadota
tween isolates of Peronospora parasitica and ac- Y, Furuichi T, Hayashi T, Umemura K, Komatsu S,
cessions of Arabidopsis thaliana. Molecular Plant- Miyao A, Hirochika H, Kuchitsu K (2011) Negative
Microbe Interactions 7(2):223- 239. feedback regulation of microbe-associated mole-

RAPP - Volume 24, 2016 141


Mathias Ferrari Rockenbach, et al. 130-144)

cular pattern-induced cytosolic Ca2+ transients by CO2 concentrations leads to modified profiles of
protein phosphorilation. Journal of Plant Resear- secondary metabolites in tobacco cv. Samsun and
ch 124(3):415-424. to increased resistance against infection with po-
Ladanyi M, Horvat L (2010) A review of the potential tato virus Y. Plant Cell & Environment 29:126-137.
climate change impact on insect populations Mcelrone AJ, Hamilton JG, Krafnick AJ, Aldea M, Kne-
general and agricultural aspects. Applied Ecology pp RG, De Lucia EH (2010) Combined effects of
and Environmental Research 8(2):143-152. elevated CO2 and natural climatic variation on leaf
Lam E, Kato N, Lawton M (2001) Programmed cell spot diseases of red bud and sweetgun trees. En-
death, mitochondria and the plant hypersensitive vironmental Pollution 158:108-114.
response. Nature 411:848-853. Mcelrone AJ, Reid CD, Hoye KA, Hart E, Jackson RB
Langebartels C, Wohlgemuth H, Kschieschan S, Grun (2005) Elevated CO2 reduces disease incidence
S, Sandermann H (2002) Oxidative burst and cell and severity of a red maple fungal pathogen via
death in ozone-exposed plants. Plant Physiology changes in host physiology and leaf chemistry.
and Biochemistry 40(6-8):567-575. Global Change Biology 11:1828-1836.
Lee SW, Han, SW, Sririyanum M, Park CJ, Seo YS, Ro- Memmott J, Craze PG, Waser NM, Price MV (2007)
nald PC (2009) A type I-secreted, sulftated pep- Global warming and the disruption of plant-polli-
tide triggers Xa21-mediated innate immunity. nator interactions. Ecology Letters 10:710-717.
Science 326:850-853. Menna A, Nguyen D, Guttman DS, Desveaux D (2015)
Lehmann P (2002) Structure and evolution of plant Elevated temperature differentially influences
disease resistance genes. Journal of Applied Ge- effector-triggered immunity outputs in Arabidop-
netics 43(4):403-414. sis. Frontiers in Plant Science 6:995.
Li GM, Shi Y, Chen X (2008) Effects of elevated car- Mewis I, Schreiner M, Nguyen CN, Krumbein A, Ul-
bon dioxide and ozone on the growth and se- richs C, Lohse M, Zrenner R (2012) UV-B irradia-
condary metabolism of spring wheat. Ying Yong tion changes specifically the secondary metabo-
Sheng Tai Xue Bao 19(6):1283-1288. lite profile in broccoli sprouts: induced signaling
Li X, Sun Z, Shao S, Zhang S, Ahammed GJ, Zhang G, overlaps with defense responses to biotic stres-
Jiang Y, Zhou J, Xia X, Zhou Y, Yu J, Shi K (2015) To- sors. Plant and Cell Physiology 52(9):1546-1560.
mato-Pseudomonas syringae interactions under Mikkelsen BL, Jorgensen RB, Lingkjaer MF (2015)
elevated CO2 concentration: the role of stomata. Complex interplay of future climate levels of
Journal of Experimental Botany 66(1):307-316. CO2, ozone and temperature on susceptibili-
Lu D, Wu S, Gao X, Zhang Y, Shan L, He P (2010) A ty to fungal diseases in barley. Plant Pathology
receptor-like cytoplasmic kinase, BIK1, associa- 64(2):319-327.
tes with a flagellin receptor complex to initiate Nanda AK, Andrio E, Marino D, Pauly N, Dunand C
plant innate immunity. Proceedings of the Natio- (2010) Reactive oxygen species during plant-mi-
nal Academy of Science 107:496-501. croorganism early interactions. Journal of Inte-
Maccarrone M, Veldnik GA,Vliegenthart JFG, Agro grative Plant Biology 52(2):195-204.
AF (1997) Ozone stress modulates amine oxidase Nawkar GN, Maibam P, Park JH, Sahi VP, Lee SY,
and lipoxygenase expression in lentil (Lens culi- Kang CH (2013) UV-induced cell death in plants.
naris) seedlings. FEBS Letters 408(2):241-244. International Journal of Molecular Sciences
Mahalingam R, Jmbunathan N, Gunjan SK, Faustin 14(1):1608-1628.
E, Weng H, Ayoubi P (2006) Analysis of oxidative Nawrath C, Metraux JP (1999) Salicylic acid induc-
signalling induced by ozone in Arabidopsis thalia- tion-deficient mutants of Arabidopsis express
na. Plant Cell & Environment 29:1357-1371. PR-2 and PR-5 and accumulate high levels of
Malamy J, Hennig J, Klessig DF (1992) Temperature- camalexin after pathogen inoculation. Plant Cell
-dependent induction of salicylic acid and its con- 11:1393-1404.
jugates during the resistance response to tobacco Newman JA, Gibson DJ, Parsons AJ, Thornley JHM
mosaic virus infection. The Plant Cell 4:359-366. (2003) How predictable are aphid populations
Matros A, Amme S, Kettig B, Buck-Sorlin GH, Son- responses to elevated CO2? Journal of Animal
newald U, Mock HP (2006) Growth at elevated Ecology 72:556-566.

142 RAPP - Volume 24, 2016


Mathias Ferrari Rockenbach, et al. 130-144)

Newman J (2004) Climate change and cereal aphi- Experimental Botany 52:381-401.
ds: the relative effects of increasing CO2 and tem- Richter T, Ronald P (2000) The evolution of dise-
perature on aphid population dynamics. Global ase resistance genes. Plant Molecular Biology.
Change Biology 10:5-15. 42:195-204.
OBrien JA, Daudi A, Finch P, Butt VS, Whitelegge P, Rosemann D, Heller W, Sandermann H (1991) Bio-
Souda P, Ausubel FM, Bolwell GP (2012) A pero- chemical plant responses to ozone: induction of
xidase-dependent apoplastic oxidative burst in stilbene biosynthesis in Scot pine (Pinus sylves-
cultured Arabidopsis cells functions in MAMP-eli- trisL.) seedlings. Plant Physiology 97:1280-1286.
cited defense. Plant Physiology 158:2013-2027. Roux M, Schwessinger B, Albrecht C, Chinchilla D, Jo-
Pachauri RK, Reisinger A, (Eds.) (2007) Climate chan- nes A, Holton M, Malinovsky FG, Tor M, De Vries
ge 2007: Synthesis report. Contribution of working S, Zipfel C (2011) The Arabidopsis leucine-reach
group I, II and III to the fourth assessment report repeat receptor-like kinase BAK1/SERK3 and
of the Intergovernmental Panel of Climate Chan- BKK1/SERK4 are required for innate immunity to
ge. IPCC, Geneva, Switzerland. hemibiotrophic and biotrophic pathogens. Plant
Pangga IB, Chakraborty S, Yates D (2004) Canopy size Cell 23:2440-2455.
and induced resistance in Stylosanthes scabra de- Rubinstein CV, Gerrienne P, De La Puente GS, Asti-
termine anthracnose severity at high CO2. Phyto- ni RA, Steemans P (2010) Early middle ordovician
pathology 94:221-227. evidence for land plants in Argentina (eastern
Pasqualini S, Piccioni C, Reale L, Ederli L, Della Torre Gondwana). New Phytologist 188(2):365-369.
G, Ferranti F (2003) Ozone-induced cell death in Runion GB (2003) Climate change and plant pa-
tobacco cultivar Bel W3 plants. The role of pro- thosystems: future disease prevention starts
grammed cell death in lesion formation. Plant here. New Phytologist 159(3):531-533.
Physiology 133:1122-1134. Runion GB, Prior SA, Rogers HH, Mitchell RJ (2010)
Pell EJ, Achlagnhaufer CD, Arteca RN (1997) Ozone- Effects of elevated atmospheric CO2 on two south-
-induced oxidative stress: mechanism of action ern forest diseases. New Forests 39:275-285.
and reaction. Physiologia Plantarum 100:264-273. 2010.
Pichersky E, Gershenzon J (2002) The formation and Sandermann H (1996) Ozone and plant health. An-
function of plants volatiles: perfumes for polli- nual Review of Phytopathology 34:347-366.
nator attraction and defense. Current Opinion in Sandermann H, Ernst D, Heller W, Langebartels C
Plant Biology 5:237-243. (1998) Ozone: an abiotic elicitor of plant defence
Plessl M, Heller W, Payer HD, Elstner EF, Habermeyer reactions. Trends Plant Science 3(2):47-50.
J, Heiser I (2005) Growth parameters and resis- Schraudner M, Ernst D, Langebartels C, Sandermann
tance against Drechslera teres of spring barley H (1992) Biochemical plant responses to ozono:
(Hordeum vulgare L. cv. Scarlett) grown at ele- activation of the defense-related proteins -1,3-
vated ozone and carbon dioxide concentrations. glucanase and chitinase in tobacco. Plant Physiol-
Plant Biology 7(6):694-705. ogy 99:1321-1328.
Plessl M, Elstner EF, Rennenberg H, Habermeyer J, Sharma YK, Davis KR (1997) The effects of ozone and
Heiser I (2007) Influence of elevated CO2 and ozo- antioxidant responses in plants. Free Radical Biol-
ne concentrations on late blight resistance and ogy and Medicine 23:480-488.
growth of potato plants. Environmental and Ex- Shin JW, Yun SC (2010) CO2 and temperature effects
perimental Botany 60(3):447-457. on the incidence of four major chili pepper dis-
Postel S, Kufner I, Beuter C, Mazzotta S, Schwedt A, eases. Plant Pathology Journal 26(2):178-184.
Borlotti A, Halter T, Kemmerling B, Nurnberger T Strengborn J, Reich PB (2006) Elevated [CO2] and in-
(2010) The multifunctional leucine-reach repeat creased N supply reduce leaf disease and related
receptor kinase BAK1 is implicated in Arabidop- photosynthetic impacts on Solidago rigida. Ecolo-
sis development and immunity. European Journal gia 149:519-525.
Cell Biology 89:169-174. Taiz L, Seiger E (2009) Fisiologia Vegetal. 4a Ed. Porto
Raven JA, Edwards D (2001) Roots: evolutionary ori- Alegre, Brasil. Artmed.
gins and biogeochemical significance. Journal of Tameling WIL, Takken FLW (2008) Resistance pro-

RAPP - Volume 24, 2016 143


Mathias Ferrari Rockenbach, et al. 130-144)

teins: scouts of the plant innate immune system. Wang K, Li H, Ecker JR (2002) Ethylene biosynthesis
European Journal of Plant Pathology, 121:243- and signaling networks. Plant Cell S131-S151.
255. Wang Y, Bao Z, Zhu Y, Hua J (2009) Analysis of tem-
Thaler JS, Humphrey PT, Whiteman NK (2012) Evolu- perature modulation of plant defense against
tion of jasmonate and salicylate signal crosstalk. biotrophic microbes. Molecular Plant-Microbe
Trends in plant Science 17(5):260-270. Interactions 22(5):498-506.
Tiedemann A,Weigel HJ, Jager HJ (1991) Effects of Xiao S, Charoenwattana P, Holcombe L, Turner
open-top chamber fumigations with ozone on JG (2003) The Arabidopsis genes RPW8.1 and
three fungal leaf diseases of wheat and the my- RPW8.2 confer induced resistance to powdery
coflora of the phyllosphere. Environmental Pollu- mildew diseases in tobacco. Molecular Plant-
tion 72(3):205-224. Microbe Interactions 16:289-294.
Tiedemann A, Firsching KH (2000) Interactive effects Xiao S, Calis O, Patrick E, Zhang G, Charoenwattana
of elevated ozone and carbon dioxide on growth P, Muskett P, Parker JE, Turner JG (2005) The atyp-
and yield of leaf rust-infected versus non-infect- ical resistance gene, RPW8, recruits components
ed wheat. Environmental Pollution 108:357-363. of basal defence for powdery mildew resistance
Torres MA (2010) ROS in biotic interactions. Physio- in Arabidopsis. Plant Journal 42(1):95-110.
logia Plantarum 138:414-429. Yalpani N, Enyedi AJ, Leon J, Raskin I (1994) Ultra-
Tzortzakis N, Taybi T, Roberts R, Singleton I, Borland violet light and ozone stimulate accumulation of
A, Barnes J (2011) Low level atmospheric ozone salicylic acid, pathogens-related proteins and vi-
exposure induces protection against Botrytis ci- rus resistance in tobacco. Planta 193(3):372-376.
nerea with down-regulation of ethylene-jasmo- Yaez-Lopez R, Torres-Pacheco I, Guevara-Gonzalez
nate and pathogenesis-related genes in tomato RG, Hernandez-Zul MI, Quijano-Carranza JA, Ri-
fruit. Postharvest Biology and Technology 61(2- co-Garcia E (2012) The effect of climate change
3):152-159. on plants diseases. African Journal of Biotech-
Vlot AC, Dempsey DA, Klessig DF (2009) Salicylic nology 11(10):2417-2428.
acid, a multifaceted hormone to combat disease. Zhu Y, Qian W, Hua J (2010) Temperature modu-
Annual Reviews of Phytopathology 47:177-206. lates plant defense responses through NB-LRR
Wan J, Zhang XC, Neece D, Ramonell KM, Clough poteins. PloS Pathogens 6(4):e1000844.
S, Kim SY, Stacey MG, Stacey G (2008) A LysM Zinser C, Ernst D, Sandermann H (1998) Induction
receptor-like kinase plays a critical role in chitin of stilbene synthase and cinnamyl alcohol dehy-
signaling and fungal resistance in Arabidopsis. drogenase mRNAs in Scots pine (Pinus sylvestris
Plant Cell 20:471-481. L.) seedlings. Planta 204:169-176.

144 RAPP - Volume 24, 2016


Paulo dos Santos Faria Lichtemberg, et al. (145-173)

RESISTNCIA DE MONILINIA SPP.


AOS FUNGICIDAS DOS GRUPOS DOS
INIBIDORES DA DESMETILAO (IDM),
DOS INIBIDORES DA QUINONA EXTERNA
(IQE) E DOS METILO BENZIMIDAZOL
CARBAMATOS (MBC)
Paulo dos Santos Faria Lichtemberg1, Isabela Vescove Primiano2,
Juliana Muehlmann Fischer3, Chirley Glienke3, Lilian Amorim2
e Louise Larissa May De Mio1*

RESUMO
Esta reviso aborda o desenvolvimento de resistncia de espcies de
Monilinia causadoras de podrido parda em frutferas de caroo a fungicidas em
todo o mundo, discutindo o modo de ao, mecanismos da resistncia, mtodos
para deteco e fatores que afetam a seleo para resistncia aos fungicidas dos
grupos dos inibidores da desmetilao (IDM), dos inibidores da quinona externa
(IQe) e dos Metilo benzimidazol carbamatos (MBC). Alm disso, foi discutida
a adaptabilidade dos isolados com resistncia ou mudana de sensibilidade e
sua relao com as estratgias antirresistncia, especialmente nas condies de
cultivo em reas subtropicais brasileiras. No Brasil, foram realizados monitora-
mentos da sensibilidade das populaes de isolados de Monilinia fructicola, co-
letados entre os anos 2002 e 2014, aos trs grupos relacionados. Os isolados da
coleo so representantes de toda regio produtora do Brasil.

1. Introduo ferramenta no controle dos fungos fitopatognicos


A podrido parda, causada por espcies de em diversas culturas (Linhares & Ghini, 2001; Brent
Monilinia, tem seu controle baseado na aplicao de & Hollomon, 2007; Oliver & Hewitt, 2014). Entre
fungicidas desde a florao at a colheita. Dentre os as cinco classes de fungicidas IBEs, destacam-se os
fungicidas que vem sendo utilizados para o controle inibidores da desmetilao IDM (do ingls deme-
desta doena, os fungicidas sistmicos, os IDMs, os thylation inhibitors - DMI), com ampla utilizao no
IQes e os MBCs podem ter sua eficincia reduzida controle dos principais ascomicetos e basidiomice-
pela alterao na sensibilidade ou at perda de efici- tos causadores de doenas em plantas (Reis et al.,
ncia devido ocorrncia de resistncia. 2010; Oliver & Hewitt, 2014). Tais caractersticas fa-
Caractersticas como o amplo espectro de zem dos IDMs lderes de venda de fungicidas com
ao, diversidade qumica e a possibilidade do uso 29,2% de participao no mercado mundial (Oliver
protetor, curativo e erradicante fazem dos fungicidas & Hewitt, 2014).
inibidores da biossntese do esterol IBE (do ingls Na cultura do pessegueiro, dentre os fungi-
sterol biosynthesis inhibitors SBI) uma importante cidas IBEs os azis (triazis e imidazis) desempe-

1
Universidade Federal do Paran, Depto de Fitotecnia e Fitossanitarismo. Curitiba, Brasil; 2 Universidade Estadual de So Paulo,
Escola Superior de Agricultura Luiz de Queiroz, Piracicaba, Brasil; 3 Universidade Federal do Paran, Depto de Gentica. Curitiba,
Brasil. * Autor para correspondncia: maydemio@ufpr.br

RAPP - Volume 24, 2016 145


Paulo dos Santos Faria Lichtemberg, et al. (145-173)

nham um papel importante no controle da podrido ingredientes ativos azoxistrobina e piraclostrobina


parda (Monilinia spp.), ferrugem (Tranzschelia dis- (pertencentes classe dos IQe) para o controle da
color), furo-de-bala (Wilsonomyces carpophilus) e ferrugem (Tranzschelia discolor) e na preveno da
sarna (Cladosporium carpophilum) (Bleicher, 1997; podrido parda (Monilinia fructicola). Apesar de di-
Ma et al., 2001; May De Mio et al., 2004; Adaska- versos ingredientes ativos estarem registrados para
veg et al., 2015). Os fungicidas azis representam o o controle da podrido parda do pessegueiro, os
grupo quimicamente mais diverso entre os fungici- nicos fungicidas sistmicos registrados no Minist-
das IDM, tendo seu modo de ao dado pela inibi- rio da Agricultura, Pecuria e Abastecimento (MAPA)
o da remoo do grupo C14-metilo do eburicol, o para o seu controle pertencem ao grupo dos triazis
qual impede o processo de formao do ergosterol (AGROFIT, 2016). No entanto, o ingrediente ativo
em fungos filamentosos. A ausncia ou diminuio azoxistrobina est na lista de agrotxicos permitidos
de ergosterol e o acmulo de esteris txicos levam na Produo Integrada de Pssego (INMETRO, 2003).
ao rompimento da membrana e extravasamento do Com o aumento do uso da azoxistrobina pe-
contedo celular, causando a morte do organismo los produtores de pssego e da maior presso de
(JosephHorne & Hollomon, 1997; Sanglard et al., seleo que eles representam sobre a populao
1998b; Oliver & Hewitt, 2014). Casos de resistncia patognica, isolados resistentes podero vir a ser se-
a este grupo so mais raros; entretanto, redues de lecionados com maior frequncia. No Estado de So
sensibilidade em isolados de diversas regies produ- Paulo, inclusive, j foi observada uma mudana nos
toras, j foram relatados. valores de CE50 (concentrao efetiva capaz de inibir
Os inibidores da quinona externa IQe (do 50 % do crescimento ou germinao da populao
ingls quinone outside inhibitors - QoI) tm gran- patognica) de M. fructicola azoxistrobina, aumen-
de importncia no manejo integrado de doenas de tando de 0,05 g.ml-1 em 2002 para 0,44 g.ml-1 em
plantas por serem derivados de produtos naturais, 2008 (May De Mio et al., 2011).
apresentar amplo espectro de ao, alta fungitoxici- Alm dos IDMs e dos IQes, espcies de Moni-
dade inerente, longo perodo residual, alm de baixa linia foram por muito tempo controladas pelos fun-
toxicidade ambiental (Sauter et al., 1999; Sierotzki, gicidas metilo benzimidazol carbamatos MBCs (em
2015). Esse grupo de fungicidas, logo aps seu lan- ingls como Methyl Benzimidazole Carbamates). Os
amento, foi amplamente empregado no controle MBCs so fungicidas orgnicos, sistmicos e de alta
de doenas de cucurbitceas no Japo (Ishii et al., seletividade em que o mecanismo de ao baseia-se
2001) e de macieiras na Europa (Zheng et al., 2000). no comprometimento da integridade das tubulinas.
No entanto foram relatados casos de resistncia dois Neste grupo, esto includos os fungicidas tiofana-
anos aps sua introduo (Zheng et al., 2000; Ghini tos (tiofanato e tiofanato-metlico) e benzimidazis
& Kimati, 2000; Ishii et al., 2001; Sierotzki, 2015). (benomil, carbendazim, fuberidazol e tiabendazol)
Desde ento, h relatos de resistncia de campo em (FRAC, 2016). Os tiofanatos tm como base a tiureia,
mais de 42 patgenos em diversas culturas e pases, derivado do cido tialofnico, e ao contrrio dos
como em Pyricularia grisea, Botrytis cinerea e Cer- benzimidazis, no apresentam um anel heteroccli-
cospora sojina nos Estados Unidos (Kim et al., 2003; co (Picinini, 1994; Chauhan & Bhattacharya, 2012).
FRAC, 2012a; Amiri et al., 2014; Zeng et al., 2015), Uma vez que so convertidos em carbendazim, os
Venturia inaequalis na Sua (Farber et al., 2002) e tiofanatos so classificados por muitos autores como
Plasmopara viticola na Frana e na Itlia (Genet et benzimidazis (Picinini, 1994; Young, 2015). Alm da
al., 2006). aplicao na agricultura, como ferramenta de con-
Alm das caractersticas atrativas destes pro- trole de diversos fitopatgenos das mais variadas
dutos, mencionadas anteriormente, outro fator que culturas, alguns derivados do grupo dos benzimida-
contribuiu para a grande adeso dos produtores ao zis tm sido utilizados como antiparasitrios huma-
uso de IQes a disponibilidade dos produtos no mer- nos e veterinrios e tambm em terapia anticncer
cado. Esse fungicida est amplamente distribudo em (Navarrete-Vzquez et al., 2001; Andrzejewska et al.,
revendas e agropecurias, representando, em 2012, 2002).
28% do mercado de fungicidas (Sierotzki, 2015). No A caracterstica de fungitoxicidade dos tiofa-
Brasil, os produtores de pssego vm utilizando os natos correlacionada com a produo de Metilo

146 RAPP - Volume 24, 2016


Paulo dos Santos Faria Lichtemberg, et al. (145-173)

Benzimidazol Carbamato (Fuchs et al., 1972; Chau- cada classe de fungicidas distingue-se quanto aos s-
han & Bhattacharya, 2012). Os produtos de conver- tios especficos de ao (Linhares & Ghini, 2001; Oli-
so de tiofanatos em soluo aquosa so semelhan- ver & Hewitt, 2014). Particularmente, os inibidores
tes aos benzimidazis, em que o tiofanato-metlico da desmetilao listados no grupo G, classe IBE 1 do
convertido em metilo benzimidazol carbamato e Comit de Ao Resistncia de Fungicidas (FRAC),
o tiofanato no anlogo etil benzimidazol carbamato tem como stio especfico de ao a enzima C14
(EBC) (Chauhan & Bhattacharya, 2012). O benomil desmetilase (enzima Cyp51) do citocromo P450, que
rapidamente convertido em MBC por hidrlise, en- catalisa processos oxidativos necessrios na forma-
quanto o tiofanato-metlico necessita de uma srie o do ergosterol (Lupetti et al., 2002; Shapiro et al.,
de reaes intermedirias. Logo, esta transformao 2011; Oliver & Hewitt, 2014; FRAC, 2016). A reduo
mais lenta, faz com que possuam ao antifngica do ergosterol e acmulo de seus precursores foram
menor que o benomil (Picinini, 1994). observados em M. fructigena tratada com IBEs (Kato
A popularidade destes grupos de fungicidas e et al., 1974, 1975). Em M. fructicola, C14 desmeti-
seu uso contnuo no controle da podrido parda em lase codificada pelo gene Cyp51 (Schnabel & Dai,
rosceas (Penrose & Senn, 1995; May De Mio et al., 2004; Luo & Schnabel, 2008a) e desencadeia trs
2004; Schnabel & Dai, 2004; Silva et al., 2011; Chen oxidaes sucessivas a partir da remoo do grupo
et al., 2012) resultou na seleo de isolados resisten- metila (CH3) da molcula C14 do lanosterol (Kller,
tes de M. fructicola nas principais reas produtoras 1988; Sanglard et al., 1998b; Linhares & Ghini, 2001;
de pssego do mundo (Schnabel et al., 2004; May Reis et al., 2010) (Figura 1). Os fungicidas azis ini-
De Mio et al., 2011; Villani & Cox, 2011; Chen et al., bidores da C14 desmetilase, agem atravs de um
2012). O desenvolvimento de resistncia aos fungi- tomo livre de nitrognio localizado no anel hete-
cidas um dos maiores problemas no controle de rocclico N-2 (imidazol) ou N-3 (triazol) que se liga
doenas de plantas, causando perdas econmicas ao tomo de ferro-hmico da enzima do citocromo
aos produtores e colocando-os em difcil situao P450 inibindo o acesso aos substratos necessrios
(Dekker, 1987). O conhecimento sobre os fatores para sua funo (Sanglard et al., 1998a; Linhares &
genticos e a dinmica da evoluo de populaes Ghini, 2001; Mansfield et al., 2010; Shapiro et al.,
resistentes, representam um importante passo para 2011; Kelly & Kelly, 2013; Oliver & Hewitt, 2014). A
prolongar a eficcia dos fungicidas. partir desta inibio, ocorre um acmulo de esteris
Nesta reviso sero abordados estudos his- txicos do grupo 14-metilo (lanosterol e 14-metil-
tricos e recentes sobre os mecanismos e evoluo 3-6-diol), produzidos pela -5,6-desaturase, interfe-
da resistncia aos IDMs, IQes e MBCs em espcies rindo com as funes do ergosterol como compo-
de Monilinia, bem como estratgias antirresistncia nente predominante da membrana celular (Gadher
para o manejo da podrido parda. et al., 1983; Lupetti et al., 2002) (Figura 2). Sendo
assim, o estresse causado na membrana da clula
2. Modo de ao e alvo dos fungicidas IDMs, IQes resulta no aumento de sua permeabilidade, causan-
e MBCs do o extravasamento de contedos intracelulares e,
2.1 Fungicidas IDMs: Apesar de todos IBEs consequentemente, limitando o crescimento fngi-
utilizados na agricultura terem como modo de ao co (Gadher et al., 1983; Buchenauer, 1987; Lupetti et
a inibio da rota sinttica de esteris em fungos, al., 2002; Reis et al., 2010).

Figura 1. Esquema da sequncia normal da desmetilao do C14 do lanosterol mediada pelo citocromo P450. Adaptado
de Kller (1988).

RAPP - Volume 24, 2016 147


Paulo dos Santos Faria Lichtemberg, et al. (145-173)

Figura 2. Mecanismo de ao de compostos antifngicos afetando a rota Biosinttica do ergosterol. Enzimas alvo di-
reita das setas com genes codificadores entre parnteses. Compostos antifngicos esquerda das setas. Setas indicam
passos para a biossntese do ergosterol. Adaptado de Lupetti et al., 2002.

2.2. Fungicidas IQes: A classe dos inibido- Hollomon, 2007). Nesta poca, caractersticas como
res da quinona externa (IQe) engloba os seguintes a ocorrncia de pouca fitotoxicidade, amplo espec-
grupos qumicos: estrobilurinas, famoxadona, fena- tro de ao, eficincia em baixas concentraes, fa-
midona e pyribencarb (Leadbeater, 2012). O modo cilidade de absoro e translocao pelas plantas e
de ao desses produtos a interferncia na produ- ao ps-infeco, tornaram sua utilizao bastante
o de energia (ATP) em um passo do metabolismo comum, apresentando vantagens em relao aos
primrio comum s clulas fngicas. Por interferir outros produtos utilizados, como os derivados cpri-
no metabolismo primrio, essa classe de fungici- cos, captan e ditiocarbamatos. Em 1979, a mistura
das apresenta amplo espectro de ao sobre dife- Benomil-Dicloran era o tratamento padro para o
rentes filos do reino Fungi, como Basidiomycota e controle da podrido-parda e da podrido causada
Ascomycota (Sierotzki, 2015). Dentro do grupo das por Rhizopus em pessegueiros no Brasil (Feliciano &
estrobilurinas h diferentes princpios ativos pro- Assis, 1979). Em 1992, o benomil foi retirado do mer-
duzidos por diferentes fabricantes: azoxistrobina, cado no Brasil, sendo assim, os produtores passaram
piraclostrobina, trifloxistrobina e cresoxim-metlico. a utilizar o tiofanato-metlico como MBC alternativo
Essas molculas atuam em um processo especfico para o controle da podrido parda em frutos de ca-
da respirao fngica, pois ligam-se ao stio da qui- roo (May De Mio et al., 2011).
nona oxidase externa do citocromo b (complexo III) Poucos anos aps o incio da utilizao de
e inibem o transporte de eltrons na mitocndria, MBCs, em populaes de diversos fungos foram
impedindo a formao de ATP (Fernndez-Ortuo et descritos isolados resistentes a estes fungicidas. Em
al., 2010; Leadbeater, 2012). 1969, relata-se resistncia em Sphaerotheca fuligi-
2.3. Fungicidas MBCs: Os benzimidazis co- nea, (Schroeder & Provvidenti, 1969). Posteriormen-
mearam a ser utilizados entre as dcadas de 1960 te, a resistncia de M. fructicola a estes fungicidas
e 1970, no tratamento foliar, de sementes e no con- relatada em diversos pases. Em 1975, observou-se
trole ps-colheita, em aplicaes na forma de pul- resistncia na Austrlia, em Victoria (Whan, 1976) e
verizao e em tratamentos por imerso (Brent & em 1976 em New South Wales aps o uso extensivo

148 RAPP - Volume 24, 2016


Paulo dos Santos Faria Lichtemberg, et al. (145-173)

de benomil por um perodo superior a quatro anos o citoesqueleto, uma espcie de arcabouo intrace-
(Koffman & Penrose, 1976). A partir de 1976, ocor- lular responsvel pela manuteno da forma e orga-
rem relatos nos Estados Unidos, em Michigan (Jones nizao celular, das clulas eucariticas. Os micro-
& Ehret, 1976), na Carolina do Sul, na Califrnia tbulos esto diretamente envolvidos na formao
(Ogawa et al., 1980; Sonoda et al., 1983; Michailides do fuso mittico e consequentemente na segrega-
et al., 1987; Ma et al., 2003) e Nova Iorque (Szkolnik o de cromossomos durante a diviso celular em
& Gilpatrick, 1977). Lim et al. (2006), observaram re- eucariontes. Alm das tubulinas e , atualmente
sistncia na Coria. No sul do Brasil, em 1985, Fortes so conhecidas tambm outras famlias, como , ,
& Ferreira (1985), relatam isolados obtidos em diver- , e , com funes associadas ao centrolo e pro-
sos pomares resistentes ao benomil. May De Mio et vavelmente a outros aspectos basais (McKean et al.,
al. (2011) e Fischer (2015) observaram diferentes pa- 2001).
dres de resistncia a tiofanato-metlico em isolados Para a formao dos microtbulos ocorre a li-
de M. fructicola, em frutos provenientes de pomares gao entre GTP (guanosina trifosfato) e os dmeros
da regio Sul e estado de So Paulo, coletados no pe- de tubulina, estabilizando assim a forma polimrica.
rodo de 2000 a 2010. Em outras espcies do gne- Os microtbulos esto em constante reorganizao,
ro, como em M. laxa, h tambm relato de resistn- crescendo em uma extremidade devido polimeri-
cia em pases europeus, como na Grcia e tambm zao dos dmeros de tubulina e diminuindo na ou-
nos Estados Unidos, na Califrnia (Ma et al., 2005; tra extremidade em decorrncia da despolimeriza-
Thomidis et al., 2009; Malandrakis et al., 2012). o (Junqueira & Carneiro, 1997). O carbendazim
No geral a resistncia transmitida geneti- capaz de inibir a polimerizao das tubulinas, afetan-
camente e resulta de uma ou mais mutaes, que do tambm a ligao de GTP (guanosina trifosfato)
podem provocar alterao no stio alvo bioqumico, (Winder et al., 2001).
fazendo com que a ligao ao fungicida no acon-
tea (FRAC, 2012b). Devido ao especfica, existe 3. Mecanismos de resistncia aos fungicidas IDMs,
maior propenso resistncia para estes compostos IQes e MBCs
qumicos, ao contrrio do que ocorre em fungicidas 3.1. Fungicidas IDMs: A resistncia de fungos
que atuam em vrios pontos do metabolismo. Alm fitopatognicos aos fungicidas azis de natureza
deste aspecto, outros fatores esto associados re- quantitativa, apresentando uma distribuio unimo-
sistncia, como o uso intensivo destes produtos e a dal da sensibilidade que eventualmente muda devi-
existncia de estirpes resistentes na populao ori- do ao aumento da frequncia de fentipos/genti-
ginal (Delp, 1980). Em fungicidas stio-especficos, pos resistentes na populao (Dekker, 1987; Kller
como benzimidazis e tiofanatos, uma nica muta- & Scheinpflug, 1987; Linhares & Ghini, 2001; Brent
o pode levar a incapacidade do fungicida em se & Hollomon, 2007; Reis et al., 2010). Sua natureza
ligar ao ponto de ao nos fungos (McGrath, 2004). polignica, resultante de uma interao positiva
Mutaes no gene da beta-tubulina, que resultam de vrios genes, contribuindo para diferentes nveis
em sequncias alteradas de aminocidos nos stios de resistncia (Sanglard et al., 1998b; Lupetti et al.,
de ligao ao MBC, vm sendo associadas resistn- 2002). Tipicamente, o aumento da dose do fungicida
cia aos MBCs em diversos microrganismos, dentre ou sua substituio por produtos de maior ativida-
eles, fungos do gnero Monilinia (Ma et al., 2003; de intrnseca so muitas vezes suficientes para obter
Ma et al., 2005; Zhu et al., 2010; Malandrakis et al., novamente o controle em situaes de sensibilidade
2012; Chen et al., 2014). reduzida (Brannen & Schnabel, 2006; Holb & Schna-
Os fungicidas MBCs atuam como inibidores bel, 2007; Chen et al., 2012; Oliver & Hewitt, 2014).
especficos ligando-se s molculas de tubulina, in- Em M. fructicola, o mecanismo mais conheci-
terrompendo a diviso da clula (FRAC, 2012b). As do de resistncia aos triazis a superexpresso do
tubulinas so protenas globulares que compem os gene MfCyp51 que codifica a enzima C14 desme-
microtbulos, um heterodmero, que constitudo tilase, alvo deste fungicida. Estudos demonstraram
principalmente por duas cadeias polipeptdicas de que a presena de uma insero de 65-pb (elemento
estruturas semelhantes, a alfa () e a beta-tubulina Mona) na regio montante deste mesmo gene, pro-
(). Os microtbulos so filamentos que compem move o aumento do nmero de cpias da enzima

RAPP - Volume 24, 2016 149


Paulo dos Santos Faria Lichtemberg, et al. (145-173)

alvo para triazis (Luo et al., 2008; Luo & Schnabel, atravs das membranas, enquanto as protenas ABC
2008a). O elemento Mona foi encontrado em vrios incluem ambos os mecanismos de bombeamento,
isolados de M. fructicola em importantes regies influxo e efluxo (Theodoulou, 2000; de Waard et al.,
produtoras de pssegos nos Estados Unidos, sendo 2006; Shapiro et al., 2011). A resistncia a algumas
importante monitor-lo na genotipagem de isolados drogas podem ser associada com a regulao ascen-
resistentes para estas populaes (Burnett et al., dente de genes codificando o efluxo de substncias
2010; Villani & Cox, 2011; Chen et al., 2013b). Villani da clula (Lupetti et al., 2002). Este mecanismo foi
& Cox (2011) acreditam que o elemento Mona con- estudado nas leveduras Candida albicans, C. glabra-
tribua apenas com uma parte da resistncia quanti- ta, e Saccharomyces cerevisiae, e fungos Aspergillus
tativa em resposta ao uso de triazis. Os mesmos au- nidulants, Magnaphorte grisea, e Mycosphaerella
tores demonstraram que nem sempre a presena de graminicola, servindo de referncia para estudos em
Mona associada baixa sensibilidade observada in M. fructicola (Theodoulou, 2000; Lupetti et al., 2002;
vitro. No Brasil, o elemento Mona no est relacio- Schnabel et al., 2003; de Waard et al., 2006; Shapiro
nado aos fentipos resistentes de M. fructicola ao et al., 2011).
fungicida tebuconazol (Morales et al., 2013). Apesar Com a clonagem do gene MfABC1 (4380-pb)
disso, estudos mais recentes detectaram o aumento em M. fructicola, (Schnabel et al., 2003) demons-
da expresso do MfCyp51 em populaes do Brasil, traram que fentipos com sensibilidade reduzida
aps induo subletal de tebuconazol em miclio aos triazis miclobutanil e propiconazol apresentam
de M. fructicola (Lichtemberg et al., 2016b). Porm maiores nmeros de cpias deste gene do que isola-
as alteraes do gene (inseres) que regulam esta dos sensveis, ambos tratados com doses crescentes
expresso, assim como mutaes ainda esto sendo dos fungicidas. Alm disso, esse estudo revelou que
estudadas. o transporte de drogas em M. fructicola mediado
A alterao do alvo de ao ou superexpres- pela protena ABC do gene MfABC1, a partir da identi-
so gentica por mutao um poderoso mecanis- ficao de sequncias de aminocidos e sua similari-
mo de resistncia aos fungicidas (Oliver & Hewitt, dade com sequncias codificadas por gene similares
2014), mas nem sempre resultam em corresponden- em outros patgenos (Schnabel et al., 2003). Sendo
te troca de aminocidos ligados aos fentipos resis- assim, alm do gene MfCyp51, o gene MfABC1 pas-
tentes (Parker et al., 2006; Cox et al., 2007). Kelly & sou a ser considerado como um dos mecanismos de
Kelly (2013) em reviso sobre o citocromo P450, re- resistncia para M. fructicola (Schnabel et al., 2003;
latam que as mutaes do gene Cyp em diferentes Luo & Schnabel, 2008a). Em alguns isolados brasilei-
organismos, podem estar relacionadas perda da ros resistentes, o gene MfABC1 apresentou aumen-
afinidade e expresso deste gene, promovidas por to do nmero de cpias, aps a induo de 0,5 e 1
uma ou mais modificaes genticas. Na China, iso- g/ml de tebuconazol, porm com uma frequncia
lados de M. fructicola com fentipos resistentes ao inferior expresso obtida pelo gene MfCyp51, de-
fungicida IDM SYP-Z048 (derivado do oxazol) foram monstrando ter menor importncia na resistncia de
relacionados aos gentipos contendo a mutao M. fructicola ao fungicida triazol (Lichtemberg et al.,
Y136F da MfCyp51, causando a substituio do ami- 2016b).
nocido tirosina pela fenilalanina (Chen et al., 2012). Em isolados com resistncia mltipla a tria-
No mesmo estudo, outras duas substituies foram zis e benzimidazis, o sequenciamento do gene
observadas pela presena de serina nas posies MfCyp51 e o estudo da expresso do gene MfABC1
161 e 490 de isolados de fentipo resistente e sens- no evidenciaram nenhuma relao ao fentipo en-
vel respectivamente. contrado, sugerindo a existncia de outros meca-
As protenas do ABC (do ingls ATP-binding nismos afetando a sensibilidade de isolados de M.
cassete transporter) e maiores facilitadores (do in- fructicola aos fungicidas triazis (Chen et al., 2013a).
gls major facilitator - MF) representam as duas clas- Para isolados chineses de M. fructicola, Chen et al.
ses mais importantes de transportadores de drogas (2012) investigaram as mutaes pontuais nos genes
envolvidos na resistncia de fungos aos azis. Ape- Erg2 e Erg24, codificando as enzimas 8 7 este-
sar de essas classes utilizarem a energia do ATP para rol isomerase e C14 esterol redutase (EBI classe II), e
sua ativao, o MF age pelo efluxo de substncias Erg27, codificando enzima 3-keto redutase (EBI clas-

150 RAPP - Volume 24, 2016


Paulo dos Santos Faria Lichtemberg, et al. (145-173)

se III), como possveis mecanismos alternativos para dez-Ortuo et al., 2008). No Brasil. isolados de M.
os triazis, porm nenhuma alterao foi observada. fructicola apresentaram o ntron do tipo I aps o c-
O certo que diferentes eventos moleculares acon- don 143 (Primiano, 2015). Essa caracterstica parece
tecem em diferentes partes do mundo moldando o ser frequente na espcie M. fructicola, pois tambm
tipo de mecanismo presente. Dessa forma, novos es- foi descrita em isolados dos Estados Unidos, China,
tudos devero surgir para esclarecer os mecanismos Austrlia e Nova Zelndia (Luo et al., 2010; Miess-
determinantes na resistncia de espcies de Monili- ner & Stammler, 2010; Hily et al., 2011). Outros
nia aos triazis. Enquanto isso mtodos convencio- fungos tambm apresentaram esse mesmo ntron,
nais se mantm indispensveis no monitoramento como diferentes espcies de Puccinia (Grasso et al.,
da resistncia. 2006a), Phakopsora pachyrhizi (Grasso et al., 2006b)
3.2. Fungicidas IQes: O principal mecanismo e Phyllosticta spp. (Stammler et al., 2013; Hincapie
relacionado com resistncia de fungos a fungicidas et al., 2014). H raros casos em que a estrutura n-
de stio-especfico, como as estrobilurinas, a alte- tron-exon do cyt b do patgeno polimrfica, ou
rao (mutao) no stio de ao. A maior parte dos seja a populao pode conter indivduos que podem
relatos de isolados resistentes a estrobilurinas indica ou no apresentar esse ntron, como por exemplo
que a mutao monognica (Sierotzki et al., 2000; em Botrytis cinerea (Banno et al., 2009). Os isolados
Gisi et al., 2002; Bolton et al., 2013). As mutaes em com a introduo ntron perdem a capacidade de
um nico ponto no gene do citocromo b (cyt b) so desenvolver resistncia azoxistrobina baseada na
os mecanismos mais associados com a resistncia mutao do G143A (Yin et al., 2012).
s estrobilurinas. A mutao que resulta em maior 3.2. Fungicidas MBCs: No grupo dos fungi-
fator de resistncia (completa ou qualitativa), asso- cidas MBCs as mutaes que ocorrem no gene da
ciada total falta de controle da doena no campo, beta-tubulina levam a alteraes nas sequncias de
corresponde mudana de glicina para alanina no aminocidos modificando os stios de ligao das
cdon 143 (G143A). Essa mutao no produz efei- protenas. Essas mutaes reduzem ou impedem a
to negativo na atividade enzimtica e, consequen- ligao dos fungicidas benzimidazis e tiofanatos a
temente, na adaptabilidade dos isolados (Gisi et al., beta-tubulina.
2002; Leadbeater, 2012). Outras substituies, como Mutaes nos cdons 50, 167, 198, 200 e
a fenilalanina para leucina no cdon 129 (F129L) e 240 do gene da beta-tubulina j foram relatadas em
de glicina para arginina no cdon 137 (G137R), so diversos fitopatgenos como Sclerotinia sclerotio-
relatadas no cyt b, mas expressam moderada (par- rum (Lehner et al., 2015), Botrytis cinerea (Malan-
cial) resistncia, de tal forma que os patgenos com drakis et al., 2011), Neurospora crassa (Orbach et
este tipo de mutao so controlados com as do- al., 1986), Cladobotryum dendroides (McKay et al.,
ses recomendadas de estrobilurina (Sierotzki et al., 1998), Penicillium digitatum (Schmidt et al., 2006),
2007; Fernndez-Ortuo et al., 2008). P. expansum (Baraldi et al., 2003), Venturia inaequa-
Alm das mutaes h outros mecanismos lis, V. pirina (Koenraadt et al., 1992; Quello et al.,
associados reduo na sensibilidade dos patge- 2010), Tapesia acuformis, T. yallundae (Albertini et
nos s estrobilurinas (resistncia quantitativa), os al., 1999). Em Monilinia, mutaes no gene beta-
quais podem no conferir a condio de resistncia -tubulina esto correlacionadas resistncia aos
prtica (Kller et al., 2004), como a via alternativa de MBCs. Substituies de nucleotdeos nos cdons 6
respirao (via AOX) e o efluxo do fungicida, entre e 198 foram associadas com diferentes padres de
outros (Dowling, 2015). Esses mecanismos necessi- resistncia em M. fructicola (Ma et al., 2003). No c-
tam de mais estudos, principalmente em patgenos don 6, a substituio de uma de citosina por timi-
que possuem o ntron tipo I, imediatamente aps o na (CAT TAT) codifica o aminocido tirosina (TAT)
cdon 143 no cyt b. Nesses patgenos, a substitui- no lugar de histidina (CAT), conferindo o fentipo
o do nucleotdeo no cdon 143 impede que ocorra de baixa resistncia (Low resistance - LR). No cdon
o splicing para a formao do RNA mensageiro (Si- 198, a troca de adenina por citosina (GAA GCA)
erotzki, 2015). Como consequncia, ocorre deficin- resulta em alanina (GCA) ao invs de cido glutmi-
cia no processo de sntese de protena, a qual letal co (GAA), caracterizando o padro de alta resistncia
ao fungo e a resistncia no se desenvolve (Fernn- (High resistance HR). A partir destas observaes,

RAPP - Volume 24, 2016 151


Paulo dos Santos Faria Lichtemberg, et al. (145-173)

foi desenvolvida uma PCR especfica para diferenciar nhecida por concentrao mnima inibitria CMI)
os dois padres de resistncia. Fentipos sensveis que inibe 100 % do desenvolvimento dos isolados
apresentam os nucleotdeos CAT e GAA nos cdons 6 sensveis, discriminando-os dos isolados resistentes
e 198, respectivamente. Em LR, observa-se no cdon que apresentam crescimento (Angelini et al., 2015).
6 a sequnciaTAT enquanto que em HR, no cdon Com as curvas de dose-resposta, possvel estimar
198 existe a sequncia GCA. Na populao brasileira a concentrao efetiva capaz de inibir 50 % (CE50) do
foram identificados indivduos com padres de resis- dimetro micelial ou da germinao dos esporos do
tncia e mutaes j descritas nos cdon nos cdons fungo e, com os valores de CE50 de diferentes isola-
6 e 198, com maior frequncia de isolados com baixa dos e de diferentes anos, comparar se est ocorren-
resistncia (2,5% em HR e 35,9% LR) (May De Mio et do uma mudana na sensibilidade do patgeno ao
al., 2011). fungicida, como observado em isolados de M. fructi-
A mutao E198A no gene da beta-tubulina cola (Russell, 2004; May De Mio et al., 2011). Tanto
em M. fructicola foi descrita em isolados da Carolina o CE50 como o CMI podem ser obtidos por avaliaes
do Sul nos Estados Unidos (Zhu et al., 2010). A mes- de dimetro micelial ou de germinao de esporos.
ma mutao foi igualmente observada em isolados A definio de qual varivel (crescimento micelial ou
da China (Chen et al., 2014) e da Europa (Weger et germinao) utilizar depende do modo de ao do
al., 2011). Ma et al. (2005) em estudo com isolados fungicida (Olaya, 2011).
da Califrnia, relataram que uma mutao no cdon 4.1.1. IDMs: Mtodos convencionais so
240, em M. laxa, leva a substituio de uma leucina amplamente utilizados no monitoramento da sen-
por fenilalanina, conferindo baixa resistncia a be- sibilidade de espcies de Monilinia para diversos
nomil. Em M. laxa de pomares das regies central e fungicidas do grupo IDM nos Estados Unidos (Wil-
norte da Grcia, mutao no cdon 198, foi relacio- cox & Burr, 1994; Penrose & Senn, 1995; Zehr et al.,
nada a alta resistncia (Malandrakis et al., 2011). 1999; Schnabel et al., 2004), Brasil (May De Mio et
al., 2011; Lichtemberg et al., 2016a), China (Chen et
4. Mtodos de deteco de isolados resistentes ou al., 2012; Yuan et al., 2013) e Nova Zelndia (Elmer
com baixa sensibilidade aos fungicidas et al., 1992). Em M. fructicola a CE50 do crescimento
O monitoramento da resistncia funda- micelial utilizada para monitorar nveis de resis-
mental para o acompanhamento da eficincia dos tncia a diversos fungicidas pertencentes aos IDMs
fungicidas, revelando mudanas na sensibilidade de (Braithwaite et al., 1995; Zehr et al., 1999; Schnabel
patgenos antes que a falha de controle no campo et al., 2004; Yoshimura et al., 2004; May De Mio et
aparea (Brent & Hollomon, 2007; Yuan et al., 2013). al., 2011; Lichtemberg et al., 2016a).
Uma vez detectada a mudana de sensibilidade em O mtodo da dose discriminatria muito
populaes de patgeno, novas recomendaes e utilizado pela sua praticidade, reduz significante-
estratgias para o uso de fungicidas devem ser su- mente a quantidade de unidades experimentais, tor-
geridas. A sensibilidade inicial de uma populao de nando as avaliaes mais rpidas em comparao ao
patgenos, anterior ao uso de um determinado fun- mtodo anterior (para um mesmo nmero de isola-
gicida, chamada de linha-base (do ingls baseline), dos testados). Este mtodo inclui o uso de uma nica
sendo esta importante para o estabelecimento de dose que pode declarar se um isolado resistente ou
um programa de monitoramento da resistncia ao sensvel a um determinado produto (Russell, 2004).
longo do tempo (Russell, 2004). O mtodo consiste na transferncia de discos de mi-
clio para duas placas, uma contendo o fungicida na
4.1. Mtodos convencionais dose discriminatria e a outra sem fungicida (contro-
A reduo na sensibilidade a um fungicida le). Aps o perodo de incubao, deve-se calcular o
pode ser monitorada in vitro antes mesmo de ocorrer valor de crescimento relativo (CR), dado pela razo
falha no controle da doena (Ghini & Kimati, 2000). entre o dimetro da colnia na dose discriminatria
Para esse monitoramento, os nveis de resistncia e o dimetro da colnia na ausncia do fungicida,
podem ser quantificados por curvas de dose-res- multiplicando este valor por 100. Com o valor do CR
posta com diferentes concentraes do fungicida ou possvel determinar o fentipo dos isolados testa-
por uma concentrao discriminatria (tambm co- dos. Porm, pequenas modificaes deste mtodo

152 RAPP - Volume 24, 2016


Paulo dos Santos Faria Lichtemberg, et al. (145-173)

so comumente observadas em diferentes estudos espiral (do ingls spiral grade dilution, descrito 4.1.2
com M. fructicola. Russell (2004) recomenda que CR IQes) foi utilizado por Janisiewicz et al. (2013) para
maiores de 50% sirvam para determinar fentipos avaliar a sensibilidade de isolados de M. fructicola ao
resistentes, sendo esta referncia utilizada por Cox fungicida fenbuconazol, comprovando a efetividade
et al. (2007), Amiri et al. (2009), Zhu et al. (2012) e deste processo estabelecido h mais de uma dcada.
Lichtemberg et al. (2016a). Cox et al. (2009) e Villani 4.1.2. IQes: Para os IQes, a etapa de germi-
& Cox (2011) determinaram que valores de CR res- nao dos esporos (Figura 3) o estgio de desen-
pectivamente maiores a 75% e 30% seriam utilizados volvimento do fungo com maior sensibilidade, pois
para determinar fentipos resistentes, enquanto va- a fase altamente dependente de energia (produzida
lores respectivamente abaixo de 25% e 10% deter- na respirao) para o desenvolvimento do patge-
minariam fentipos sensveis. Os mesmos autores no (Oliver & Hewitt, 2014; Sierotzki, 2015). Apesar
ainda classificaram isolados com CR entre os inter- disso, h diversos trabalhos que utilizam o cresci-
valos de fentipos resistentes e sensveis como re- mento micelial como varivel de avaliao dos IQes,
sistncia alterada ou intermediaria. Existem diferen- como para Botrytis cinerea (Banno et al., 2009; Kim
tes razes pelas quais os limites de classificao dos & Xiao, 2011; Fernndez-Ortuo et al., 2014), Colle-
fentipos variam. Chen et al. (2013a) justificam que totrichum siamense, Sclerotinia sclerotiorum (Liang
a utilizao de CR>30% para fentipos resistentes et al., 2015) e M. fructicola (Schnabel et al., 2003).
foi determinado para compensar a instabilidade da Os experimentos de dose-resposta por ava-
sensibilidade causada pelo armazenamento e trans- liao de dimetro micelial ou germinao dos es-
ferncias sucessivas dos isolados. De acordo com Li- poros so geralmente realizados em diferentes pla-
chtemberg et al. (2016a) o uso do mtodo da dose cas de Petri contendo diferentes concentraes de
discriminatrias auxilia no processo de seleo fen- fungicidas difusos no meio de cultura. H variaes
tipos resistentes, mas devido natureza qualitativa das tcnicas, como a diluio em gradiente espiral
de resistncia dos IDMs este mtodo pode ocasio- (Figura 4A), na qual M. fructicola foi um dos patge-
nar pequenos erros de classificao. Outros fatores nos utilizados para validar o mtodo com diferentes
que devem ser considerados na utilizao da dose fungicidas: diclorana, fludioxonil, fenehexamida e
discriminatria so: a atividade intrnseca de cada tebuconazol (Frster et al., 2004). Para esse mto-
produto (Holb & Schnabel, 2007; Yuan et al., 2013) do, diferentes concentraes de fungicidas so dis-
e a especificidade da dose discriminatria para a po- tribudas em espiral numa mesma placa formando
pulao na qual est sendo estudada. um gradiente de concentraes, no qual no centro
Mtodos alternativos foram propostos para h as maiores concentraes e nos bordos as meno-
avaliao da sensibilidade de isolados de M. fructi- res (Figura 4B). Esporos do patgeno so incubados
cola (Frster et al., 2004; Amiri et al., 2008; Cox et em tiras de celofane ou em meio de cultura e, quan-
al., 2009). Entre estes, destacam-se os mtodos do do apresentarem crescimento micelial uniforme, es-
tubo de batom (lipbalm tube), cotonete (swab) e sas tiras so transferidas para as placas com e sem
tubo (tube), que foram desenvolvidos por Amiri et fungicida, de forma que o fungo esteja em contato
al. (2008) para aplicao em campo, evitando assim com todas as diferentes concentraes. Comparan-
a excessiva demanda de tempo e material dos mto- do com o crescimento do fungo a partir da tira no
dos convencionais. Destes mtodos citados, apenas meio sem fungicida, com esta tcnica possvel de-
o mtodo do tubo de batom mostrou resultados terminar a concentrao efetiva capaz de inibir 50 %
similares aos tradicionais no estudo da resistncia do dimetro micelial (Figura 4C) de uma forma mais
de M. fructicola para propiconazol, sendo posterior- rpida, econmica e precisa (Frster et al., 2004;
mente validado em campo (Amiri et al., 2009). O Amiri et al., 2014). Outro mtodo para quantificar
teste da resazurina utiliza um corante azul indicador a sensibilidade dos fungos aos fungicidas de forma
de xido-reduo em ensaios de viabilidade celular. rpida o da microtitulao com presena ou ausn-
Este mtodo foi utilizado por (Cox et al., 2009) re- cia do indicador de respirao resazurina (j descri-
sultando em alto e significante valor de correlao to no item anterior), no qual a avaliao realizada
com o mtodo da dose discriminatria para o triazol em espectrofotmetro (Cox et al., 2009; Vega et al.,
fenbuconazol. O mtodo do diluio em gradiente 2012). Em todos os mtodos, o meio de cultura, a

RAPP - Volume 24, 2016 153


Paulo dos Santos Faria Lichtemberg, et al. (145-173)

Figura 3. Avaliao da porcentagem de germinao de isolados Monilinia fructicola com alta (A e B) e baixa (C e D)
sensibilidade azoxistrobina. Placas de poliestireno contendo meio de cultura sem (A e C) e com (B e D) 0,8 g.mL-1 de
azoxistrobina e 100 g.mL-1 de cido salicilhidroxmico (SHAM).

densidade de esporos, o perodo de incubao e o o, ele no interfere diretamente na germinao


dia de avaliao devem ser otimizados para obter o de esporos ou crescimento micelial de M. fructicola
resultado mais coerente. Uma vez padronizado, esse (Schnabel et al., 2003).
protocolo dever ser mantido (Frster et al., 2004; Alm dos experimentos in vitro, a confirma-
Cox et al., 2009). o da resistncia prtica, ou seja, quando ocorre a
Como os IQes atuam em um processo espe- falha no controle da doena em condies de campo
cfico da respirao, para os experimentos in vitro (Ghini & Kimati, 2000), pode ser realizada em plan-
recomenda-se adicionar o cido salicilhidroxmico tas ou em frutos tratados com a concentrao reco-
(SHAM), a fim de suprimir o uso da via alternativa mendada para o produtor (Figura 5). Por exemplo,
de respirao (via AOX). A importncia da via AOX frutos com ferimento e tratados com azoxistrobina
in vivo desconhecida, mas h a hiptese de que inoculados com isolados resistentes de M. fructicola
os compostos antioxidantes das plantas liberados a esse fungicida apresentaram sintomas de podri-
durante o processo de infeco silenciam os genes do parda, enquanto que aqueles inoculados com
responsveis por essa via (Ma & Michailides, 2005; isolados sensveis no apresentaram frutos doentes
Fernndez-Ortuo et al., 2008). Para trabalhos rea- (Amiri et al., 2010; Chen et al., 2014).
lizados com M. fructicola, recomenda-se dissolver 4.1.3. MBCs: A avaliao da sensibilidade a
o SHAM em metanol e ajustar a concentrao para MBCs tradicionalmente realizada por meio da ava-
100 g. mL-1 de meio de cultura. Nesta concentra- liao de crescimento micelial em placas de Petri

154 RAPP - Volume 24, 2016


Paulo dos Santos Faria Lichtemberg, et al. (145-173)

Figura 4. Tcnica da diluio em gradiente espiral: equipamento spiral plater, em ingls (A), placa com meio de cultu-
ra e corante para observar a distribuio do produto em espiral (B) e placa com meio de cultura com fungicida e com
quatro tiras de meio de cultura contendo o patgeno. Para cada isolado, foram depositadas tiras opostas na placa (C).
Foto de J. S. Baggio.

brasileira ao tiofanato-metlico. Isolados com EC50 <1


g/mL, de 1 a 30 g/mL e 30 g/mL, foram consi-
derados S, LR e HR respectivamente.

4.2. Mtodos moleculares


4.2.1 IDMs: Quando relao entre fentipo e
gentipo conhecida, os mtodos moleculares po-
dem trazer resultados rpidos e precisos para ava-
A liar os riscos associados ao uso de um determinado
fungicida. Porm, a utilizao desta tecnologia de-
pende da identificao prvia dos mecanismos que
conferem resistncia ao patgeno estudado (Russell,
2004).
Nos Estados Unidos, a insero gentica
Mona, presente em isolados de M. fructicola com
fentipos resistentes a triazis, permitiu o desenvol-
vimento de um mtodo de PCR e de digesto por en-
B zimas de restrio para detectar sua presena (Luo
Figura 5. Resistncia prtica de isolados Monilinia fructi- et al., 2008). Para o mtodo de PCR, a amplificao
cola com alta (A) e baixa (B) sensibilidade azoxistrobi- da regio montante do gene MfCyp51, utilizando os
na. Frutos foram inoculados com suspenso de esporos primers INS65-F e INS65-R descritos por Luo et al.
e sem ferimento. Frutos do lado esquerdo foram imersos
somente em gua e frutos do lado direito foram imersos (2008), devem gerar bandas de 376-pb em isolados
na concentrao recomendada no Programa de Produo contendo Mona (triazol-resistente) ou 311-pb em
Integrado de Pssego (10 g do ingrediente ativo por 100 isolados sem o Mona (sensveis). Devido curta dis-
L de gua). tncia entre o tamanho das bandas (65-pb) geradas
em isolados resistentes e sensveis, sua diferencia-
com meio de cultura acrescido do ingrediente ativo o em gel de agarose pode ser comprometida. Para
a ser testado. Ma et al. (2003) utilizaram doses de 1 e melhor visualizao, pode-se utilizar a enzima de
500 g/mL de benomil, para diferenciar isolados de restrio BsrBI, que resulta em dois fragmentos que
Monilinia pouco resistentes, do termo ingls Low permitem melhor distino entre isolados.
Resistant (LR) e altamente resistentes, do termo em A mutao Y136F do gene MfCyp51 em M.
ingls High Resistant (HR). May De Mio et al. (2011) fructicola conferindo gentipos resistentes em iso-
utilizaram doses de 1g/mL para diferenciar isolados lados chineses, corresponde a um polimorfismo de
sensveis e resistentes de M. fructicola na populao nucleotdeo nico (do ingls single nucleotide poly-

RAPP - Volume 24, 2016 155


Paulo dos Santos Faria Lichtemberg, et al. (145-173)

morphism SNP) que permite o desenvolvimento de AACTCAACAATATCACCTCCAATTCAT 3) para am-


tcnicas de PCR de alelo-especfico (do ingls allele- plificar os cdons 137 e 143 e o ntron de 1166-pb
-specific AS-PCR) para sua rpida diagnose. Entre as (Hily et al., 2011; Primiano, 2015). A identificao da
aplicaes da AS-PCR destaca-se a diferenciao de mutao G143A em um determinado isolado , de
um segundo nucleotdeo (em ingls mismatch) que modo geral, altamente correlacionada com o fen-
aumenta a especificidade entre primer e gentipo de tipo resistente, no qual a resistncia considerada
interesse (Latorra et al., 2003). Avenot et al. (2008) qualitativa (Sierotzki, 2015). Para o caso de M. fructi-
utilizaram esta tcnica para desenvolver uma meto- cola, outras mutaes nos cdons 129 e 137 no fo-
dologia simples de identificao da mutao H277Y ram observadas nos isolados resistentes (nmero de
do gene AaSdhB em isolados de Alternaria alterna- acesso KM610207) (Primiano, 2015). Essas anlises
ta resistentes aos fungicidas inibidores da succinato moleculares complementam os resultados obtidos
desidrogenase (SDHI). Na ausncia de tcnicas rpi- por mtodos convencionais.
das para identificar mutaes pontuais, o sequencia- A digesto enzimtica, no qual a enzima de
mento destas regies contendo a mutao pode ser restrio reconhece o ponto de mutao relaciona-
realizado e comparado a sequencias cadastradas em do com a resistncia, recomendada como um novo
bancos de dados. mtodo, mais rpido e especfico para monitorar a
Adicionalmente, o PCR de tempo real permite resistncia aos IQes (Leroux et al., 2010; Patel et al.,
quantificar a expresso gnica a partir do isolamento 2011). Entretanto, deve-se sempre comparar os re-
de mRNA e sntese de cDNA para isolados onde os sultados com outros mtodos, pois os isolados po-
promotores dessa superexpresso no foram des- dem apresentar heteroplasmia (por exemplo Colle-
cobertos. Para quantificar a expresso gnica, deve- totrichum gloeosporioides) ou polimorfismo do cyt
-se aplicar o mtodo da curva padro, assim como b (por exemplo Botrytis cinerea) e tanto os produtos
utilizado por Ma et al. (2006) em Blumeriella jaapii, digeridos quanto os no digeridos aparecero no gel
ou o mtodo do Ct comparativo, estabelecido por de agarose (Ishii, 2015). Nesse caso, possvel sepa-
Schmittgen & Livak (2008) e aplicado em M. fructi- rar os isolados baseando-se no nmero de pares de
cola por Luo & Schnabel (2008a) e Lichtemberg et al. base observado em gel de agarose, mas h necessi-
(2016b). O mtodo da superexpresso gnica pode dade de conhecimento prvio para a interpretao
ser comparado entre amostras com e sem induo dos resultados. Isolados que apresentam o ntron
de doses subletais de fungicidas, ou comparando (no caso de Botrytis cinerea so 1205-pb) possuem
fentipos sensveis contra resistentes, assim como banda de 1765-pb e isolados que no possuem o n-
sugerido por Livak & Schmittgen (2001). tron podem no ter a mutao no cdon 143 (apre-
4.2.2. IQes: Com o avano das tcnicas mo- sentam banda de 560-pb) ou apresentar a mutao
leculares, a identificao e/ou quantificao da mu- (a digesto enzimtica resulta em duas bandas: uma
tao responsvel pela resistncia cada vez mais de 318-pb e outra de 242-pb (Leroux et al., 2010).
comum (Karaoglanidis et al., 2011; Michalecka et al., Apesar dessa tendncia e de diferentes tc-
2011; Finger et al., 2014). Para identificar a mutao nicas moleculares, para alguns fitopatgenos, como
no cyt b envolvida na resistncia aos IQes, h dife- para M. fructicola, no possvel o uso dessa tc-
rentes mtodos moleculares, como PCR, PCR quan- nica, pois at o momento no h conhecimento de
titativo, sequenciamento e digesto por enzimas de diferenas moleculares entre os isolados resistentes
restrio (Leroux et al., 2010; Karaoglanidis et al., e sensveis (Luo et al., 2001; Hily et al., 2011; Primi-
2011; Hincapie et al., 2014; Sierotzki, 2015). O par ano, 2015). Uma reduo na sensibilidade de forma
de primers utilizado pode no amplificar todos os c- quantitativa e com uma mudana gradual relacio-
dons alvos de estudo, por exemplo para amplificar a nada com resistncia polignica, devido a minor
regio do cytb de M. fructicola que contm o cdon genes e esses so difceis de serem detectados (An-
129 utiliza-se o par de primers cola0-fwd (5- AGAG- gelini et al., 2015). Assim, mtodos convencionais
CACCTAGAACATTAGTT- 3) com o primer cola1-rev de avaliao, apesar de trabalhosos e demorados
(5- AACCAAAGCTTGAACCCGCT 3), enquanto que quando comparados com os moleculares, so mais
o primer cola2-fwd (5 - CGCGACAGGCTGGGTCACT- recomendados para monitorar a sensibilidade des-
GA - 3) utilizado em par com colaexon4-rev (5- ses patgenos ao fungicida.

156 RAPP - Volume 24, 2016


Paulo dos Santos Faria Lichtemberg, et al. (145-173)

4.2.3. MBCs: Diversas metodologias conven- tm possibilitado correlacionar as mutaes existen-


cionais vm sendo substitudas por metodologias tes nos padres de resistncia em espcies de Moni-
moleculares para estudos de resistncia em espcies linia (Ma et al., 2003; Malandrakis et al., 2012; Chen
de Monilinia. Estas esto cada vez mais eficientes, et al., 2013a; Chen et al., 2014). Com esta tcnica
sensveis, simplificadas e acessveis, podendo ser possvel tambm verificar quais os aminocidos se-
inseridas na rotina laboratorial, otimizando tempo ro codificados por cada cdon, observando-se as-
e recursos para diagnsticos e monitoramentos na sim as diferenas existentes entre isolados sensveis
rea da fitopatologia. Uma vez que para MBCs subs- e resistentes. Em M. fructicola, isolados sensveis
tituies de nucleotdeos esto associadas resis- possuem as sequncias CAT e GAA nos cdons 6 e
tncia, as metodologias baseiam-se principalmente cdon 198, respectivamente. Substituies nestes
na observao dos polimorfismos que diferenciam cdons so responsveis por fentipos diferentes,
os fentipos de sensibilidade e resistncia. chamados de LR e HR. Em LR, observa-se no cdon
A PCR convencional tem sido eficaz para a 6 a sequncia TAT enquanto que em HR, no cdon
identificao de resistncia a MBC em espcies de 198 existe a sequncia GCA. Estas substituies re-
Monilinia em diversos trabalhos. Baseia-se na utili- sultam em aminocidos diferentes daqueles obser-
zao de pares de primers especficos que permitem vados nos isolados sensveis (Ma et al., 2003). Em M.
a amplificao das regies de mutaes no gene da laxa, a anlise da sequncia do gene beta-tubulina
beta-tubulina que conferem resistncia aos isolados, mostrou que a substituio de um par de base est
destacando-se as regies do cdon 6 e cdon 198. relacionada a baixa resistncia. A substituio resul-
Ma et al. (2003) desenvolveu PCR especfica para ta em uma mudana no cdon 240 de CTC (leucina)
diferenciar fentipos de baixa resistncia (low resis- em isolados sensveis, para TTC (fenilalanina) em iso-
tance-LR) e de alta resistncia (high resistance-HR). lados com baixa resistncia (Ma et al., 2005).
May De Mio et al. (2011) utilizaram protocolo pro- Outra tcnica, a PCR-RFLP (do ingls Restric-
posto por Ma et al. (2003) associado ao crescimento tion Fragment Length Polymorphism) tambm foi
micelial para identificao do padro de resistncia utilizada na identificao de resistncia. (Malan-
em isolados do Brasil. drakis et al., 2012) baseado no polimorfismo entre
Variaes das tcnicas de PCR, como PCR em gentipos, verificou que o stio de reconhecimento
tempo real, utilizando-se sondas TaqMan e SYBRGre- da endonuclease Eco31I (BsaI) inclui o cdon 198,
en vm sendo utilizadas para a deteco de resistn- e utilizou assim esta tcnica para a identificao da
cia aos MBC. Fan et al. (2014) desenvolveram reao mutao E198A em M. laxa obtidas em pomares
multiplex da PCR em tempo real utilizando sondas das regies norte e central da Grcia. O produto
MGB TaqMan marcadas com fluorforos HEX e FAM da amplificao do gene da beta-tubulina por PCR
para identificao simultnea das mutaes E198A convencional de tamanho de 356-pb foi submetido
e H6Y. Luo et al. (2007) utilizaram SYBRGreen para a digesto utilizando-se a enzima Eco31I (BsaI). Em
identificar isolados com mutao E198A, em popula- isolados sensveis, a digesto gerou dois fragmen-
es de M. fructicola obtidas de frutos mumificados tos, de 243- e 113-pb. J nos resistentes no houve
de pssegos, ameixas e nectarinas obtidos em dife- reconhecimento do stio da enzima, e o fragmento
rentes pomares na Califrnia. Segundo os autores, no foi separado. Os autores destacam que com esta
a utilizao desta metodologia de PCR eficaz em metodologia em algumas horas possvel verificar
substituir os mtodos convencionais para quantifica- a existncia da resistncia, enquanto que pelas me-
o da resistncia a benzimidazis nas populaes todologias de fungitoxicidade tradicionais so ne-
do patgeno. cessrios dias para obteno do resultado. Ma et al.
O sequenciamento do gene da beta-tubulina (2005) utilizaram a mesma metodologia, entretanto
tem sido uma ferramenta citada em diversos estu- estabeleceram protocolo com a enzima BSmAI. Esta
dos envolvendo resistncia aos MBCs em espcies endonuclease foi capaz de reconhecer a sequncia
de Monilinia. A obteno das sequncias de nucleo- GTCTCC no produto de PCR dos isolados sensveis,
tdeos do gene da beta-tubulina, em associao com mas no reconhece a sequncia GTTTCC no produto
experimentos in vitro, como crescimento micelial de PCR dos isolados LR. A digesto do produto de
em placa de Petri com doses conhecidas de fungicida PCR em 2 fragmentos, com tamanho de 111- e 265-

RAPP - Volume 24, 2016 157


Paulo dos Santos Faria Lichtemberg, et al. (145-173)

pb, identificou desta forma isolados sensveis, sem Outros estudos sobre o controle de M. fructicola in-
mutao no cdon 240, relacionada a isolados LR em dicam maior atividade fungitxica do ingrediente
M. laxa. ativo tebuconazol em comparao com outros tria-
zis incluindo o propiconazol (Schnabel & Dai, 2004;
5. Fatores afetando a seleo de isolados resisten- Holb & Schnabel, 2007). Portanto, essa afinidade
tes pode ser determinante para perda da sensibilidade
5.1. Intensidade de presso de fungicida de patgenos aos fungicidas. Enquanto a resistncia
A presso de seleo exercida pelo fungicida aos triazis se tornou comum em algumas localida-
um dos principais fatores para a elaborao de es- des, em outras reas diferentes populaes de Mo-
tratgias antirresistncia, compreendendo fatores nilinia se mantiveram predominantemente sensveis
genticos, biolgicos e operacionais. diretamente (Yoshimura et al., 2004; Stevic & Vuksa, 2006; Mar-
proporcional s doses e frequncia de aplicaes, ao tini et al., 2012). Outras caractersticas como a adap-
grau de cobertura obtido e persistncia na cultura tabilidade da populao do patgenos em diferentes
ou no solo (Ghini & Kimati, 2000). ambientes, devem ser consideradas.
Os IDMs so considerados de mdio ris- O risco de seleo de populaes resistentes
co para o desenvolvimento de resistncia, a qual est relacionado com caractersticas do fungicida,
quantitativa (Georgopoulos, 1985; FRAC, 2016). como, por exemplo, modo de ao especfico e alta
Mesmo quando isolados mutantes foram induzidos persistncia da atividade, e caractersticas do pat-
em laboratrio no foi observada a resistncia qua- geno, como alta variabilidade gentica, esporulao
litativa (Kller & Scheinpflug, 1987). A populao abundante, tempo de gerao curto e alta adapta-
do patgeno apresenta variaes na sensibilidade, bilidade dos isolados resistentes (Leadbeater, 2012).
as quais so inerentes espcie em questo. A re- Alm desses fatores, caractersticas da situao de
sistncia quantitativa difcil de ser confirmada em produo e do manejo das doenas, como pulveriza-
campo e mesmo em laboratrio, devido mudana es do mesmo ingrediente ativo ou grupo qumico
gradual que pode ocorrer na sensibilidade de isola- de forma frequente para o controle de patgenos
dos a um determinado fungicida. Assim, para detec- tambm aumentam esse risco. A elevada frequncia
tar a mudana do comportamento da populao do uso de IQes pode proporcionar uma mudana na
necessrio monitorar um grande nmero de isola- distribuio da sensibilidade do fungo ao fungicida,
dos em anos consecutivos de uma dada regio. No selecionando os resistentes, e pode gerar menor di-
caso de M. fructicola, nos Estados Unidos, isolados versidade gentica na populao (Grnwald et al.,
com sensibilidade reduzida ao propiconazol foram 2006). Em populaes de Plasmopara viticola expos-
observados aps trs anos de uso do fungicida, mas tas a frequente aplicao de metade da dose de azo-
a dificuldade no controle foi relatada apenas 5 anos xistrobina foi observada uma reduo na diversidade
mais tarde (Zehr et al., 1999; Schnabel et al., 2004; gentica (Matasci et al., 2008).
Brannen & Schnabel, 2006; Villani & Cox, 2011). No Experimentos para verificar a influncia de
estado da Califrnia, Estados Unidos, mesmo aps intensas pulverizaes de um mesmo fungicida na
cinco anos de uso de tebuconazol, a distribuio da populao patognica devem ser realizados em mais
sensibilidade de isolados de M. fructicola no foi al- de uma safra e em diversas localidades para abran-
terada (Yoshimura et al., 2004). No Brasil, observou- ger a ocorrncia dos processos evolutivos, como a
-se ampla distribuio da sensibilidade de isolados mutao nos cdons associados resistncia. Um
de M. fructicola para o tebuconazol, e esta foi direta- exemplo disso so isolados de Venturia inaequalis
mente proporcional ao nmero de aplicaes deste resistentes trifloxistrobina e ao cresoxim-metlico,
fungicida (May De Mio et al., 2011). no qual foi observado que a resistncia qualitativa
Estas diferenas observadas entre os triazis (governada por mutaes no cdon 143) foi precedi-
(tebuconazol e propiconazol) podem ser explicadas da pela quantitativa (Kller et al., 2004).
pelas variaes na afinidade entre o ingrediente ati- Os produtores, alm dos setores pblicos e
vo e o stio de ao no patgeno. Esta afinidade de- privados, devem seguir estratgias antirresistncia
termina a intensidade da atividade fungitxica entre (ver item 6 para mais detalhes) para evitar que a ele-
os fungicida e seus alvo de ao (Gadher et al., 1983). vada frequncia e a ampla rea tratada com os IQes

158 RAPP - Volume 24, 2016


Paulo dos Santos Faria Lichtemberg, et al. (145-173)

proporcione uma alta e contnua presso de seleo ainda no bem conhecido na ausncia da presso
na populao do fitopatgeno, levando seleo de seleo. J foi demonstrado que isolados de M.
de isolados resistentes (Sierotzki, 2015). O monito- fructicola com dupla-resistncia (IDM-propiconazol
ramento de M. fructicola em relao ao fungicida e SDHI-boscalida) no tiveram custo adaptativo nem
azoxistrobina deve ser contnuo e estratgias antir- reduo de sensibilidade ao IDM mesmo aps cinco
resistncia devem ser intensificadas, pois a reduo transferncias sucessivas na ausncia dos fungicidas
na sensibilidade vem sido observada e os isolados (Chen et al., 2013b). Por outro lado estudos com
com sensibilidade reduzida apresentaram a mesma comparao de variveis de crescimento vegetativo
adaptabilidade e habilidade competitiva que isola- e reprodutivo entre isolados de M. fructicola sens-
dos altamente sensveis (May De Mio et al., 2011; veis e resistentes a triazis evidenciaram vantagens
Primiano, 2015). adaptativas pelo primeiro grupo (Nuninger-Ney et
al., 1989; Elmer et al., 1992; Cox et al., 2007).
5.2 Adaptabilidade de isolados resistentes Alm da desvantagem demonstrada por iso-
O risco de aumento de uma populao de lados IDM-resistentes, quanto sua capacidade de
fungos resistentes a fungicidas frequentemente as- crescimento micelial e esporulao, populaes
sociado a sua capacidade de adaptao na ausncia mistas inoculadas em pssegos aps cinco gera-
da presso de seleo (Shaw, 1989; Reis et al., 2010). es, evidenciaram tambm baixa competitividade
A persistncia de populaes resistentes no campo dos isolados resistentes (Nuninger-Ney et al., 1989;
e sua implicao no controle de doena, esto rela- Lichtemberg, 2015). Como consequncia, a popu-
cionadas preservao e estabilidade da resistn- lao mantida na ausncia da presso de fungicida
cia, adaptabilidade in vitro e in vivo e habilidade tende a retomar a sensibilidade original, favorecen-
competitiva dos isolados na ausncia do fungicida. do o uso de estratgias antirresistncia (Cox et al.,
O conhecimento destas caractersticas essencial 2007). No Brasil, tambm se observou que isolados
para estabelecer estratgias antirresistncia, pois, de M. fructicola com baixa sensibilidade a tebuco-
o mecanismo de resistncia do fungo pode ou no nazol apresentaram desvantagens frente a isolados
ocasionar um custo adaptativo para o patgeno. A sensveis quanto a sua capacidade de esporulao,
adaptabilidade, referida como fitness em ingls, de tamanho de leso e perodo de incubao (Lichtem-
um isolado resistente sempre comparativa de berg, 2015). Fato relevante que esses dados foram
isolados selvagens e consiste na capacidade do pa- obtidos em condies controladas em laboratrio,
tgeno se desenvolver, reproduzir e sobreviver no assim estudos em campo devem ser realizados para
ambiente, na ausncia do fungicida (Ghini & Kimati, comprovar ou confirmar a relevncia prtica destes
2000). Caso os isolados resistentes possuam uma estudos.
menor adaptabilidade que os sensveis, a estabilida- 5.2.2. IQes: Isolados de M. fructicola com
de da resistncia e sua seleo em uma populao sensibilidade reduzida azoxistrobina apresentaram
sero reduzidas, facilitando o manejo da doena com resistncia estvel durante dez ciclos consecutivos,
estratgias antirresistncia (Cox et al., 2007; Lead- na ausncia do fungicida (Primiano, 2015), assim
beater, 2012). Por outro lado, se isolados resistentes como isolados resistentes de Magnaporthe grisea e
apresentarem alta adaptabilidade em relao aos de Didymella bryoniae azoxistrobina tambm apre-
sensveis, o uso do fungicida ameaado e diferen- sentaram resistncia estvel durante quatro ciclos
tes estratgias antirresistncia devem ser adotadas. consecutivos da doena, na ausncia do fungicida
5.2.1. IDMs: A caracterizao da adaptabilida- (Avila-Adame & Kller, 2003; Finger et al., 2013).
de de isolados resistentes de M. fructicola aos tria- Quando a resistncia s estrobilurinas go-
zis importante para determinar o comportamen- vernada por mutaes no cyt b, principalmente a
to dessa populao frente a estratgias de manejo. G143A, no esperada uma desvantagem adaptativa
A seleo de isolados de M. fructicola resistentes a nos isolados resistentes (Sierotzki, 2015). Na maioria
triazis em pomares de fruta de caroo favorecida dos casos, o rearranjo no genoma mitocondrial de
pela sua exposio prolongada a fungicidas perten- fungos resistentes s estrobilurinas, por causa da
centes a esse grupo. Porm, o comportamento de mutao, no afeta outros processos metablicos
isolados com reduo de sensibilidade ou resistentes (Gisi et al., 2002). O comportamento da estabilida-

RAPP - Volume 24, 2016 159


Paulo dos Santos Faria Lichtemberg, et al. (145-173)

de da resistncia azoxistrobina em isolados sem a casos, os isolados resistentes a um determinado fun-


mutao no cyt b foi pouco explorado na literatura e gicida so incapazes de competir com isolados sen-
o mecanismo responsvel pela resistncia a essa es- sveis se houver reduo ou ausncia da presso de
trobilurina pode ou no ser influenciado pelas con- seleo (Oliver & Hewitt, 2014). A menor habilida-
secutivas transferncias. de competitiva do fungo resistente, na ausncia do
A adaptabilidade de isolados resistentes em fungicida, j foi verificada em misturas de isolados
relao a sensveis pode ser avaliada por meio de resistentes com sensveis de Erysiphe graminis f. sp.
mtodos aplicados in vitro ou in vivo em cada isola- tritici a triadimefon (Almughrabi & Gray, 1995) e em
do separadamente. Um conjunto de diferentes vari- diferentes misturas entre um isolado resistente e um
veis pode ser utilizado para medir a adaptabilidade, isolado sensvel de M. fructicola dicarboximida, su-
como, por exemplo, a taxa do crescimento micelial, gerindo uma desvantagem associada com a resistn-
a esporulao, a germinao, a sensibilidade osm- cia (Almughrabi & Gray, 1995; Taeheon et al., 2001).
tica, o perodo de latncia, a incidncia da doena e Os estudos de habilidade competitiva entre
o dimetro da leso (Baraldi et al., 2003; Luo & Sch- isolados resistentes e sensveis ao longo do tempo,
nabel, 2008b; Karaoglanidis et al., 2011). Os estudos em diferentes geraes do patgeno, devem ser re-
in vivo so importantes, pois h casos em que os alizados em condies com a maior homogeneidade
isolados resistentes e sensveis apresentam a mes- possvel, por exemplo, ambiente com temperatura e
ma adaptabilidade in vitro, mas exibem diferenas umidade controladas, idade do inculo semelhante
in vivo, como isolados resistentes de Penicillium ex- e uso do mesmo cultivar. A mudana do cultivar en-
pansum a tiabendazol que apresentaram maior se- tre uma gerao e outra pode influenciar o resultado
veridade de infeco nos frutos do que os sensveis, da competio entre os isolados (Zhan & McDonald,
apesar de possurem o mesmo crescimento in vitro 2013). Ao utilizar o mesmo cultivar, o estado fisio-
(Baraldi et al., 2003). Essa diferena entre os estudos lgico da planta ou do fruto tambm pode influen-
in vivo e in vitro no foi observada nos isolados de M. ciar no resultado, assim, uma alternativa para testes
fructicola (Primiano, 2015) e de Alternaria alternata em ps-colheita a substituio de frutos in natura
(Karaoglanidis et al., 2011), no qual os isolados com por frutos processados, por exemplo pssego enla-
baixa sensibilidade azoxistrobina apresentaram a tado (Lim et al., 2001; Cox et al., 2007; Pariaud et
mesma adaptabilidade que os sensveis al., 2009). Do ponto de vista prtico, o uso de fru-
Outra forma de avaliar a adaptabilidade de tos processados vantajoso, pois permite que expe-
isolados com nveis diferentes de sensibilidade a rimentos sejam conduzidos em qualquer poca do
um determinado fungicida confront-los por uma ano, uma vez que a maioria das culturas frutferas
ou mais geraes na ausncia da presso de sele- tem sua safra limitada a apenas alguns meses.
o. Nesse caso, mede-se a habilidade competitiva Apesar dos experimentos de habilidade com-
dos isolados. Experimentalmente, promove-se uma petitiva fornecerem informaes que auxiliaro em
competio entre isolados resistentes e sensveis, estratgias antirresistncia, os mtodos de avalia-
misturando-os em propores conhecidas e avalian- o so limitados a um curto perodo de tempo e,
do o comportamento resultante ao longo do tempo de modo geral, obtidos em ambiente controlado.
(Pringle & Taylor, 2002; Ma & Uddin, 2009; Karao- A competio em condies de campo, apesar de
glanidis et al., 2011). Os testes de habilidade compe- relevante, pouco utilizada. H poucos estudos de
titiva entre isolados resistentes e sensveis fornecem anlise espao-temporal e de persistncia na safra e
outras informaes sobre adaptabilidade, pois os na entressafra dos isolados resistentes e h necessi-
fungos fitopatognicos podem apresentar estabili- dade de se desenvolverem avaliaes mais precisas
dade da resistncia na ausncia do fungicida quando (Elmer et al., 1998; Zhan & McDonald, 2013).
estudados isoladamente, por exemplo apresentam 5.2.3. MBCs: A resistncia aos MBCs con-
maior taxa de crescimento ou maior reproduo, siderada do tipo qualitativa, uma vez que est asso-
mas no serem competitivos quando misturados ciada a um nico gene. Neste caso, a adaptabilidade
com isolados sensveis, como visto em isolados de de isolados resistentes tem sido semelhante a de
Botrytis cinerea resistentes piraclostrobina (Kim isolados sensveis, Caractersticas como crescimento
& Xiao, 2011; Zhan & McDonald, 2013). Em muitos micelial, esporulao, sensibilidade a altas tempera-

160 RAPP - Volume 24, 2016


Paulo dos Santos Faria Lichtemberg, et al. (145-173)

turas e severidade so variveis avaliadas para quan- incio da dcada de oitenta e mais recentemente,
tificar ou estudar a adaptabilidade em fungos. Gilpatrick (1981) e Villani & Cox (2011) mostraram
Em M. fructicola, Ma et al. (2003) verificaram similar frequncia entre a sensibilidade de M. fruc-
que isolados LR e HR apresentaram diferentes fen- ticola para fenbuconazol e propiconazol, indicando
tipos de acordo com a temperatura de incubao em possvel correlao entre os fungicidas estudados.
meio de cultura com benomil. Em meio de cultura No estado da Carolina do Sul (Estados Unidos), Sch-
com 500 g do i.a./mL, isolados HR (Ec50 > 50 g/ nabel & Dai (2004) demonstraram que isolados de
mL) no cresceram quando incubados a 31C, mas M. fructicola com sensibilidade reduzida para miclo-
crescem a 10, 15 e 24C. Isolados LR (Ec50= 0,61 a butanil, apresentaram significante correlao com a
0.96 g /mL para benomil e Ec50= 2.34 a 6.42 g / sensibilidade para os fungicidas tebuconazol, pro-
mL para tiofanato metlico) no apresentaram cres- piconazol e fenbuconazol. Na China, tambm ficou
cimento quanto incubados a 10 e 15C em meio de demonstrada significante resistncia cruzada entre o
cultura acrescido de 1 g do i.a./mL. Entretanto, es- fungicida IDM SYP-Z048 e propiconazol testados em
ses mesmos isolados cresceram a 24 e 31C. Os au- populaes de M. fructicola (Chen et al., 2012). Na
tores concluram que isolados LR no apresentaram Nova Zelndia, a resistncia cruzada entre diversos
resistncia em baixas temperaturas (em torno de fungicidas IDMs foi observada em ensaios in vitro
15C). Desta forma, como a temperatura na regio para isolados de M. fructicola (Nuninger-Ney et al.,
do Vale Central na Califrnia de 6 a 15C durante 1989; Braithwaite et al., 1995).
a florao, o uso de MBCs poderia ser eficaz para o Quando a resistncia cruzada foi estudada
controle de M. fructicola. entre duas diferentes classes de fungicidas inibido-
Egen et al. (2015) observaram isolados de res da biossntese do esterol (IBEs), observou-se que
M. fructicola com diferentes fentipos de resistncia todos isolados resistentes para IDM foram sensveis
mltipla aos fungicidas tiofanato-metlico, iprodione para morfolinas (Nuninger-Ney et al., 1989), corro-
e ciproconazol. De acordo com resultados de testes borando as informaes descritas pelo (FRAC, 2016)
de competitividade, observou-se que indivduos com para fungicidas deste mesmo modo de ao. Estudos
alguma resistncia foram to competitivos quanto avaliando a sensibilidade de M. fructicola a diversos
aqueles sensveis aos trs fungicidas. No geral, iso- grupos qumicos, incluindo fungicidas com diferen-
lados com resistncia ao tiofanato-metlico eram tes modos de ao foram realizados em todo mundo
mais competitivos. O isolado resistente ao iprodione (Penrose & Senn, 1995; Yoshimura et al., 2004; Ste-
e sensvel aos demais e isolado triplamente sensvel vic & Vuksa, 2006; May De Mio et al., 2011; Martini
foram os menos competitivos. et al., 2012). Porm, apenas recentemente foram
realizados estudos de resistncia mltipla, incluindo
5.3. Resistncia cruzada e mltipla fungicidas de diferentes modos de ao utilizados
Um patgeno pode ser resistente a mais de no controle da podrido parda em frutas de caroo
uma molcula do mesmo ou de diferentes grupos (Chen et al., 2012; Chen et al., 2013b; Chen et al.,
qumicos. O primeiro caso denominado resistncia 2013a).
cruzada e o segundo, de resistncia mltipla (Ghini Enquanto na China nenhuma resistncia ml-
& Kimati, 2000). tipla foi encontrada entre IDMs e os fungicidas pro-
5.3.1. IDMs: A resistncia cruzada comu- cimidona, azoxystrobina, carbendazim e pirimetanil,
mente observada nos fungicidas IDMs (Buchenauer, para isolados de M. fructicola (Chen et al., 2012),
1987; Kller & Scheinpflug, 1987; FRAC, 2016), es- nos Estados Unidos novos fentipos de M. fructicola
tendendo-se para todos componentes deste grupo apresentando resistncia mltipla foram observados
qumico (Gisi et al., 2005). Devido emergente resis- em testes conduzidos com IDMs, metil benzimida-
tncia de M. fructicola aos IDMs e sua popularidade zol carbamato (MBC) e inibidores do succinato de-
entre os produtores de frutas de caroo, de grande sidrogenase (SDHI) (Chen et al., 2013b; Chen et al.,
importncia o conhecimento do grau de resistncia 2013a). No estudo da dupla resistncia entre IDM
cruzada de uma populao para o estabelecimen- e MBC, Chen et al. (2013a) observaram que o ele-
to de estratgias antirresistncia (Penrose & Senn, mento Mona estava presente em todos isolados co-
1995; Schnabel et al., 2004; Silva et al., 2011). No letados na Carolina do Sul, mas ausente em isolados

RAPP - Volume 24, 2016 161


Paulo dos Santos Faria Lichtemberg, et al. (145-173)

coletados em outros estados americanos, com a hi- uso concomitante de MBCs e outros fungicidas, bem
ptese de que um segundo mecanismo esteja tam- como a alta frequncia de aplicaes para o controle
bm relacionado a este novo fentipo. Segundo Oli- de podrido parda ou mesmo de outras doenas po-
ver & Hewitt (2014) os casos de resistncia mltipla dem contribuir para a ocorrncia de resistncia ml-
so principalmente ligados a alteraes no bombea- tipla. Alguns microrganismos tm apresentado esta
mento de efluxo, capazes de restringir a absoro de caracterstica, sendo um desafio para o manejo de
fungicidas de diferentes modos de ao. variadas doenas. Em testes realizados com M. laxa,
No Brasil, ainda no foram realizados estudos no foi observada resistncia mltipla entre MBCs
avaliando o grau de resistncia cruzada dentro do e outros fungicidas (Malandrakis et al., 2012). Em
grupo dos IDMs ou mesmo a possibilidade da exis- M. fructicola, Egen et al. (2015) encontraram em
tncia de fentipos com resistncia mltipla. Reco- isolados coletados de 2006 a 2010, com diferentes
menda-se que futuros estudos em populaes de M fentipos de resistncia a tiofanato-metlico, ipro-
fructicola do Brasil, alm dos IDMs, sejam estudados dione e ciproconazol, incluindo mltipla resistncia
outros fungicidas e tambm outras molculas com aos trs fungicidas. Chen et al. (2013a) observaram
potencial de futuro registro pelo Ministrio da Agri- a existncia de isolados de M. fructicola resistentes
cultura. a MBC e DMI em pomares comerciais de pssego na
5.3.2 IQes: Como todas as molculas do gru- costa leste dos Estados Unidos.
po dos IQes atuam no mesmo ponto da respirao
a resistncia cruzada a mais de uma molcula deste 6. Recomendao de Manejo e estratgia antirre-
grupo pode ocorrer. Por exemplo, isolados de Cer- sistncia para Monilinia fructicola em frutferas
cospora kikuchii resistentes azoxistrobina tambm Primeiramente a manuteno de boa fertili-
mostraram resistncia a piraclostrobina e a trifloxis- dade do solo, a poda de limpeza de inverno, a re-
trobina (Price et al., 2015). Pyricularia grisea (Olivei- moo de frutos mumificados do solo e das rvores
ra et al., 2015) e Alternaria alternata (Vega & Dewd- figuram entre as prticas culturais mais importantes
ney, 2014) resistentes azoxistrobina tambm foram na reduo do inculo de M. fructicola dentro dos
resistentes a piraclostrobina. pomares de frutas de caroo entre os diversos ciclos
Apesar da mistura e da rotao de grupos de cultivo (Harvey et al., 1972; Ogawa et al., 1995).
qumicos de fungicidas serem estratgias antirresis- Porm, necessrio garantir que as partes removi-
tncia, o nmero de pulverizaes deve ser limita- das da planta sejam devidamente destrudas, quei-
do, pois isolados com resistncia mltipla podem ser madas ou enterradas (Harvey et al., 1972; May De
selecionados, dificultando cada vez mais o uso de Mio et al., 2004), evitando-se assim, o desenvolvi-
fungicidas dentro do manejo (Fernndez-Ortuo et mento da fase perfeita do patgeno (formao de
al., 2015). Isolados de B. cinerea apresentaram resis- apotcios) em frutos cados no solo (Zehr, 1982) ou
tncia mltipla a boscalida e a piraclostrobina (Kim & ainda, a reativao das mmias nas rvores como
Xiao, 2011) ou ao tiofanato-metlico e a piraclostro- fontes de inculo primrio para infeces florais.
bina ou a mais de dois fungicidas (Fernndez-Ortu- Entretanto, estes procedimentos, isoladamente, no
o et al., 2014). Estudos envolvendo esse patgeno so suficientes para controlar a doena; por isso, re-
foram ampliados e detectou-se resistncia mltipla comenda-se, alm das prticas culturais, a realizao
em um mesmo isolado a sete grupos qumicos dife- de tratamento de inverno de natureza erradicante
rentes: anilopirimidina, dicarboximida, benzimida- com produtos base de enxofre ou cobre, os quais
zol, fenilpirrol, estrobilurina, hidroxianilida e inibidor tm ao multistio (Fortes & Martins, 1998). Duran-
da succinato desidrogenase (Fernndez-Ortuo et te o ciclo vegetativo da cultura so recomendadas
al., 2015). pulverizaes no perodo da florao e no perodo
5.3.3 MBCs: A partir do momento que ocorre da pr-colheita dos frutos, alternando ingredien-
a resistncia gentica para qualquer um dos produ- tes ativos de diferentes grupos qumicos e utilizan-
tos MBCs o uso dos demais tambm fica comprome- do produtos multistio no manejo, conforme reco-
tido, devido a resistncia cruzada, o que j foi ob- mendaes do Ministrio da Agricultura, Pecuria e
servado para espcies de Monilinia (Jones & Ehret, Abastecimento e/ou legislaes especficas como as
1976; Ma et al., 2005; Malandrakis et al., 2012). O do estado do Paran. O nmero de pulverizaes em

162 RAPP - Volume 24, 2016


Paulo dos Santos Faria Lichtemberg, et al. (145-173)

cada fase depender do inculo do ano anterior e do tiva que a mistura quando houver um custo adapta-
clima; variando tambm entre as diferentes regies tivo do isolado resistente a uma das molculas, pois
produtoras do Brasil. a populao desses isolados ser mais facilmente
Prticas de manejo de fungicida devem con- reduzida (Kller & Scheinpflug, 1987; Mikaberidze &
siderar a presso de seleo dos fungicidas sobre McDonald, 2015). No entanto, o uso preferencial de
a populao dos patgenos (Elmer & Gaunt, 1986; misturas contendo IDMs sugerido por Price et al.
Kller & Scheinpflug, 1987; May De Mio et al., 2004). (2015) no controle de M. fructicola, corroborando
O intenso uso de alguns fungicidas direcionados ao observaes realizadas por Holb & Schnabel (2008)
controle da podrido parda, e tambm ao controle que relatam problemas relacionados ao uso alterna-
das demais doenas no pessegueiro, nos diferentes do de fungicida no controle da podrido parda em
estados do Brasil, associado rpida reproduo e locais onde isolados resistentes de M. fructicola exis-
quantidade de propgulos que M. fructicola produz, tiam. Misturas de propiconazol com os fungicidas
eleva o risco para reduo da sensibilidade ou mes- benomil, captan, clorotalonil, ciprodinil e vinclozolin
mo resistncia deste patgeno aos fungicidas. Por- resultaram em baixo sinergismo entre os produtos
tanto, o manejo desta doena deve considerar es- testados em dois isolados de M. fructicola (Emery
tratgias antirresistncia para que a frequncia dos et al., 2002). O uso preventivo de misturas conten-
isolados resistentes no aumente no campo. do propiconazol e fungicida de enxofre resultou em
O Comit de Aes contra Resistncia a Fun- grande efeito sinergtico, aliando excelente controle
gicidas (FRAC - Fungicide Resistance Action Com- e custo reduzido, sendo uma opo para o uso em
mittee) composto por diferentes empresas priva- reas mais difceis de controlar a podrido parda
das de fungicidas e tem como objetivo fornecer as com IDM (Holb & Schnabel, 2008).
diretrizes para o manejo da resistncia a fungicidas Para garantir a melhor controle de doenas
(http://www.frac.info/working-group/qol-fungici- ainda deve ser considerado que ambos ingredientes
des/general-use-recommendations). Fungicidas dos na mistura utilizem doses que promovam eficincia
grupos IQes e MBCs so considerados de alto risco, similar (Oliver & Hewitt, 2014). Ainda assim, muita
enquanto as IDMs so considerados de risco mdio contradio encontrada quanto as vantagens de
para a seleo de resistncia. No entanto, para todos utilizar misturas ou aplicaes alternadas de fungici-
eles j houve relato de resistncia cruzada entre as das. Ambas estratgias devem atrasar mas no evi-
suas molculas para diferentes patgenos. tar o desenvolvimento da resistncia (Brent & Hollo-
No geral algumas diretrizes devem ser segui- mon, 2007). Apesar das distintas opinies, diversos
das para evitar a seleo de isolados resistentes: uti- autores concordam que o uso de misturas comer-
lizar misturas de fungicidas (por exemplo, misturar cializadas pela indstria qumica, garante que pro-
produtos de ao sistmica com produtos residuais); dutores de fruta de caroo estejam implementando
utilizar fungicidas mais especficos no incio da epi- estratgias que evitem o aumento da populao re-
demia (com o objetivo de reduzir a populao do sistente (Staub & Sozzi, 1984; Kller & Scheinpflug,
patgeno) e fungicidas multistio no final do ciclo da 1987; Brent & Hollomon, 2007).
cultura; utilizar a dose, a poca e o intervalo de apli- Ao contrrio dos Estados Unidos, produtos
cao recomendados no rtulo; utilizar diferentes registrados para o controle de M. fructicola na cul-
mtodos de controle de doenas (por exemplo, re- tura do pessegueiro no Brasil no incluem formula-
sistncia gentica, controle cultural, biolgico, entre es mistas (Tabela 1) podendo este fato resultar em
outros) quando disponveis e apropriados; evitar uso maiores dificuldades na implementao de estrat-
como erradicante e aumentar a diversidade de in- gias antirresistncia. Entretanto, Lichtemberg et al.
gredientes ativos, como a rotao de fungicidas com (2016a) relataram o aumento da sensibilidade de
mecanismo de ao distintos (Bartlett et al., 2002). isolados de M. fructicola ao fungicida tebuconazol
O uso de fungicidas especficos em mistura ou nas principais reas produtoras de pssego do Brasil
em alternncia com outros fungicidas sistmicos de comparando populaes mais antigas com as atuais.
diferentes modos de ao indicado como estrat- Os mesmos autores sugerem que estes resultados
gia antirresistncia (Leadbeater, 2012). A alternncia esto relacionadas s modificaes que ocorreram
de diferentes ingredientes ativos pode ser mais efe- nos programas de controle da podrido parda que

RAPP - Volume 24, 2016 163


Paulo dos Santos Faria Lichtemberg, et al. (145-173)

Tabela 1. Lista de fungicidas inibidores da biossntese do ergosterol (IBE) registrados para o controle de Monilinia fruc-
ticola na cultura do pessegueiroa.
Nome do Grupo Grupo Qumico Nome Comum Agrofitb SEAB-PRc California USAd
piperazina Triforina Sonet
Ciproconazol Inspire Super (l)e
Difenoconazol Score Score (l), Quadris Top (l)e
Fenbuconazol Indar (l)
Fungicidas
inibidores da Fluquinconazol Palisade Palisade (nl)
desmetilao Flutriafol Rhyme (rp)
(IDM) triazol
(SBI: Classe I) Metconazol Quash (l)
Miclobutanil Rally
Propiconazol Bumper (l), Tilt (l), Quilt Xcel (l)e
Tebuconazol Constant , Elite, Constant (nl), Elite (nl), Orius (l), Tebuzol (l), Elite (nl), Luna
Folicur, Triade Folicur (l), Triade (nl) Experience (rp)e
(SBI: Classe III) Hidroxianilidas Fenehexamida Elevate (l)
a
Classificao do Comit de Ao Resistncia de Fungicidas (FRAC, 2016). Liberado (l), registro pendente (rp), no
liberado (nl). bFungicidas registrados no Sistema de Agrotxicos Fitossanitrios (Agrofit) do Ministrio da Agricultura do
Brasil (AGROFIT, 2016). cFungicidas registrados na Secretaria da Agricultura e do Abastecimento do Paran (SEAB, 2016).
d
Fungicidas registrados no estado da California, US (Adaskaveg et al., 2015). eFungicidas formulados em misturas: Ins-
pire Super (+AP), Luna Experience (+SDHI), Quadris-Top e Quilt Xcel (+IQes). Informao acessada em Maro de 2016.

resultaram na diminuio do uso de triazis. no manejo de grupos e/ou ingredientes ativos pos-
No caso dos MBCs, vrios estudos indicam sam ser realizadas em tempo, preservando o produ-
que isolados resistentes persistem nos pomares, to de forma eficiente no mercado como alternativa
mesmo aps a interrupo da utilizao destes fun- segura para o produtor.
gicidas por vrios anos. Em pomares comerciais de
pssegos no estado da Carolina do Sul, Zehr et al. 7. Referncias
(1991) observaram isolados resistentes que persis- Adaskaveg JE, Gubler WD, Michailides TJ. Fungici-
tiram por pelo menos dois anos aps a desconti- des, bactericides, and biologicals for deciduous
nuidade da utilizao de benomil. Perodo maior tree fruit, nut, strawberry, and vine crops 2015.
relatado por Malandrakis et al. (2012) que encontra- Available at: www.ipm.ucdavis.edu. Accessed on
ram isolados de M. laxa altamente resistentes aos 1 de Maro, 2016.
MBCs em pomares que permaneceram por oito anos AGROFIT. Sistema de agrotxico fitossanitrio. Avai-
sem utilizao de fungicidas. No Brasil, May De Mio lable at: http://agrofit.agricultura.gov.br/agrofit_
et al. (2011) constataram aumento na porcentagem cons/principal_agrofit_cons. Accessed on 17 de
de isolados sensveis ao tiofanato-metlico de 2000 Maro, 2016.
a 2005, considerando isolados de diferentes regies Albertini C, Gredt M, Leroux P (1999) Mutations of
produtoras. Apesar de em muitos pases a utilizao the -tubulin gene associated with different phe-
de MBCs para controle da podrido parda j ser bem notypes of benzimidazole resistance in the cereal
reduzida, na China, segundo Chen et al. (2014) a re- eyespot fungi Tapesia yallundae and Tapesia acu-
sistncia a MBC emergente e deve ser considerada formis. Pesticide Biochemistry and Physiology 64:
na elaborao das estratgias de controle. 17-31.
Diante dos estudos apresentados para os Almughrabi K, Gray A (1995) Competition between
principais grupos de fungicidas de ao sistmica triadimefon-sensitive and triadimefon-resistant
para controle de podrido parda, se pode concluir isolates of Erysiphe graminis f.sp. tritici. Plant di-
que o monitoramento nos pomares das diferentes sease 79: 709-712.
regies produtoras do Brasil muito importante. O Amiri A, Brannen PM, Schnabel G (2009) Validation
acompanhamento da sensibilidade e adaptabilidade of the lipbalm tube assay for evaluation of fungi-
das populaes de patgenos ao longo do tempo, cide sensitivity in field isolates of Monilinia fruc-
tambm primordial para garantir que as alteraes ticola. Plant Health Progress doi: 10.1094/PHP-

164 RAPP - Volume 24, 2016


Paulo dos Santos Faria Lichtemberg, et al. (145-173)

2009-1118-01-RS. Bleicher J (1997) Doenas de rosceas de caroo. In:


Amiri A, Brannen P, Schnabel G (2010) Reduced sen- Kimati H, Amorim L, Bergamin Filho A, Camargo L,
sitivity in Monilinia fructicola field isolates from Rezende J, (Eds.) Manual de fitopatologia: Doen-
South Carolina and Georgia to respiration inhibi- as das plantas cultivadas. So Paulo, Brazil. Ce-
tor fungicides. Plant disease 94: 737-743. res. pp. 621-627.
Amiri A, Heath SM, Peres NA (2014) Resistance to Bolton MD, Rivera V, Secor G (2013) Identification of
fluopyram, fluxapyroxad, and penthiopyrad in Bo- the G143A mutation associated with QoI resistan-
trytis cinerea from strawberry. Plant disease 98: ce in Cercospora beticola field isolates from Mi-
532-539. chigan, United States. Pest management science
Amiri A, Scherm H, Brannen P, Schnabel G (2008) 69: 35-39.
Laboratory evaluation of three rapid, agar-based Braithwaite M, Elmer PAG, Saville DJ, Boyd-Wilson
assays to assess fungicide sensitivity in Monilinia KSH, Whelan HG (1995) Reduced sensitivity to
fructicola. Plant disease 92: 415-420. DMI fungicides in Monilinia fructicola and the effi-
Andrzejewska M, Ypez-Mulia L, Cedillo-Rivera R, cacy of DMI fungicides for blossom blight control.
Tapia A, Vilpo L, Vilpo J, Kazimierczuk Z (2002) In: Proceedings New Zealand Plant Protection
Synthesis, antiprotozoal and anticancer activity of Conference, 48th, Resumos. New Zealand 17-21.
substituted 2-trifluoromethyl-and 2-pentafluoro- Brannen PM, Schnabel G (2006) Survey of Monilinia
ethylbenzimidazoles. European journal of medici- fructicola populations with reduced sensitivity to
nal chemistry 37: 973-978. DMIs in Georgia and implications for brown rot
Angelini R, Pollastro S, Faretra F (2015) Genetics of control recommendations. In: 2006 APS Annual
Fungicide Resistance. In: Ishii H, Hollomon DW, Meeting, Resumos. Quebec, Canada S16.
(Eds.) Fungicide resistance in plant pathogens: Brent KJ, Hollomon DW (2007) Fungicide resistance
Principles and a guide to practical management. in crop pathogens: How can it be managed? Se-
Japan. Springer. pp. 13-34. cond Ed. Brussel, Belgium. Fungicide Resistance
Avenot H, Sellam A, Karaoglanidis G, Michailides T Action Committee.
(2008) Characterization of mutations in the iron- Buchenauer H (1987) Mechanism of action of tria-
-sulphur subunit of succinate dehydrogenase cor- zolyl fungicides and related compounds. In: Lyr
relating with boscalid resistance in Alternaria al- H, (Ed.) Modern selective fungicides. Propeties,
ternata from California pistachio. Phytopathology applications and mechanism of action. New York,
98: 736-742. US. Longman Scientific & Tecnical pp. 205-231.
Avila-Adame C, Kller W (2003) Characterization of Burnett A, Lalancette N, McFarland K (2010) First
spontaneous mutants of Magnaporthe grisea report of the peach brown rot fungus Monilinia
expressing stable resistance to the Qo-inhibiting fructicola resistant to demethylation inhibitor
fungicide azoxystrobin. Current genetics 42: 332- fungicides in New Jersey. Plant disease 94: 126.
338. Chauhan J, Bhattacharya G (2012) X-ray crystallogra-
Banno S, Yamashita K, Fukumori F, Okada K, Ueku- phic and ir studies of systemic fungicide thiopha-
sa H, Takagaki M, Kimura M, Fujimura M (2009) nate methyl. International Journal of Pharma and
Characterization of QoI resistance in Botrytis cine- Bio Sciences 3: 900-909.
rea and identification of two types of mitochon- Chen F, Liu X, Schnabel G (2013a) Field Strains of
drial cytochrome b gene. Plant Pathology 58: 120- Monilinia fructicola Resistant to Both MBC and
129. DMI Fungicides Isolated from Stone Fruit Orchar-
Baraldi E, Mari M, Chierici E, Pondrelli M, Bertolini ds in the Eastern United States. Plant disease 97:
P, Pratella G (2003) Studies on thiabendazole re- 1063-1068.
sistance of Penicillium expansum of pears: patho- Chen F, Liu X, Chen S, Schnabel E, Schnabel G
genic fitness and genetic characterization. Plant (2013b) Characterization of Monilinia fructicola
Pathology 52: 362-370. strains resistant to both propiconazole and bos-
Bartlett DW, Clough JM, Godwin JR, Hall AA, Hamer calid. Plant disease 97: 645-651.
M, ParrDobrzanski B (2002) The strobilurin fungi- Chen F, Fan J, Zhou T, Liu X, Liu J, Schnabel G (2012)
cides. Pest management science 58: 649-662. Baseline sensitivity of Monilinia fructicola from

RAPP - Volume 24, 2016 165


Paulo dos Santos Faria Lichtemberg, et al. (145-173)

China to the DMI fungicide SYP-Z048 and analysis sensitivity in Monilinia fructicola. In: Proceedings
of DMI-resistant mutants. Plant disease 96: 416- of the 39th New Zealand weed and pest control
422. conference., Resumos. New Zealand 166-169.
Chen S, Shang Y, Wang Y, Schnabel G, Lin Y, Yin Emery K, Scherm H, Savelle A (2002) Assessment of
L, Luo C (2014) Sensitivity of Monilinia fructicola interactions between components of fungicide
from Peach Farms in China to Four Fungicides and mixtures against Monilinia fructicola. Crop pro-
Characterization of Isolates Resistant to Carben- tection 21: 41-47.
dazim and Azoxystrobin. Plant disease 98: 1555- Fan J, Luo Y, Michailides TJ, Guo L (2014) Simulta-
1560. neous quantification of alleles E198A and H6Y
Cox K, Bryson P, Schnabel G (2007) Instability of in the -tubulin gene conferring benzimidazole
propiconazole resistance and fitness in Monilinia resistance in Monilinia fructicola using a duplex
fructicola. Phytopathology 97: 448-453. real-time (TaqMan) PCR. Pest management scien-
Cox KD, Quello K, Deford RJ, Beckerman JL (2009) ce 70: 245-251.
A rapid method to quantify fungicide sensitivity Farber R, Chin K, Leadbitter N (2002) Sensitivity of
in the brown rot pathogen Monilinia fructicola. Venturia inaequalis to trifloxystrobin. Pest mana-
Plant disease 93: 328-331. gement science 58: 261-267.
de Waard MA, Andrade AC, Hayashi K, Schoonbeek Feliciano A, Assis M (1979) Eficincia de diferentes
Hj, Stergiopoulos I, Zwiers LH (2006) Impact of fungicidas aplicados pr-colheita no controle da
fungal drug transporters on fungicide sensitivity, podrido parda e podrido de Rhizopus em pes-
multidrug resistance and virulence. Pest manage- segueiros. Fitopatologia brasileira: 106.
ment science 62: 195-207. Fernndez-Ortuo D, Tors JA, De Vicente A, Prez-
Dekker J (1987) Development of resistance to mo- -Garca A (2008) Mechanisms of resistance to QoI
dern fungicides and strategies for its avoidance. fungicides in phytopathogenic fungi. Internatio-
In: Lyr H, (Ed.) Modern selective fungicides. Pro- nal Microbiology 11: 1-9.
peties, applications and mechanism of action. Fernndez-Ortuo D, Tors J, De Vicente A, Prez-
New York, US. Longman Scientific & Tecnical pp. -Garca A (2010) The QoI fungicides, the rise and
39-52. fall of a successful class of agricultural fungicides.
Delp CJ (1980) Coping with resistance to plant disea- In: Carisse O, (Ed.) Fungicides. Rijeka, Croatia. In-
se. Plant disease 64: 652-657. Tech publisher. pp. 203-220.
Dowling ME (2015) Influence of Repeated Field Ap- Fernndez-Ortuo D, Grabke A, Li X, Schnabel G
plications of Azoxystrobin on Population Diversity (2015) Independent Emergence of Resistance to
of Monilinia fructicola. Clemson University. Clem- Seven Chemical Classes of Fungicides in Botrytis
son, SC, US. cinerea. Phytopathology 105: 424-432.
Egen B, Melgarejo P, De Cal A (2015) Sensitivity of Fernndez-Ortuo D, Grabke A, Bryson PK, Amiri
Monilinia fructicola from Spanish peach orchards A, Peres NA, Schnabel G (2014) Fungicide Resis-
to thiophanate-methyl, iprodione, and cyproco- tance Profiles in Botrytis cinerea from Strawberry
nazole: fitness analysis and competitiveness. Eu- Fields of Seven Southern US States. Plant disease
ropean journal of plant pathology 141: 789-801. 98: 825-833.
Elmer P, Braithwaite M, Saville D (1992) Changes in Finger MJ, Stevenson KL, Ji P (2013) Stability of
triforine sensitivity in populations of Monilinia azoxystrobin resistance and fitness of fungicide-
fructicola from Hawkes Bay orchards. In: Procee- -sensitive and-resistant field isolates of Didymella
dings of the New Zealand plant protection confe- bryoniae. In: 2013 APS Annual Meeting, Resumos.
rence, Resumos. 138-140. Austin, Texas, US S2.43-S42.44.
Elmer P, Gaunt R, Frampton C (1998) Spatial and Finger MJ, Parkunan V, Ji P, Stevenson KL (2014)
temporal characteristics of dicarboximide-resis- Allele-Specific PCR for the Detection of Azoxystro-
tant strains of Monilinia fructicola and brown rot bin Resistance in Didymella bryoniae. Plant disea-
incidence in stone fruit. Plant Pathology 47: 530- se 98: 1681-1684.
536. Fischer JMM (2015) Caracterizao de populaes
Elmer PAG, Gaunt RE (1986) A survey of fungicide in- de Monilinia fructicola e resistncia ao fungicida

166 RAPP - Volume 24, 2016


Paulo dos Santos Faria Lichtemberg, et al. (145-173)

tiofanato metlico. Universidade Federal do Para- plant pathology 87: 240.


n. Curitiba, PR, Brasil. Gisi U, Sierotzki H, Cook A, McCaffery A (2002) Me-
Frster H, Kanetis L, Adaskaveg JE (2004) Spiral gra- chanisms influencing the evolution of resistan-
dient dilution, a rapid method for determining ce to Qo inhibitor fungicides. Pest management
growth responses and 50% effective concen- science 58: 859-867.
tration values in fungus-fungicide interactions. Gisi U, Pavic L, Stanger C, Hugelshofer U, Sierotzki
Phytopathology 94: 163-170. H, Dehne HW, Kuck KH, Russell PE, Lyr H (2005)
Fortes J, Ferreira E (1985) Resistncia de Monilinia Dynamics of Mycosphaerella graminicola popula-
fructicola (Wint.) ao Benomil. Fitopatologia bra- tions in response to selection by different fungi-
sileira 10: 282. cides. In: Modern fungicides and antifungal com-
Fortes J, Martins O (1998) Sintomatologia e contro- pounds IV: 14th International Reinhardsbrunn
le das principais doenas. In: Medeiros C, Raseira Symposium, Resumos. Friedrichroda, Thuringia,
M, (Eds.) A cultura do pessegueiro. Pelotas, Brazil. Germany 89-101.
Embrapa. pp. 243-264. Grasso V, Sierotzki H, Garibaldi A, Gisi U (2006a)
FRAC. List of pathogens with field resistance to- Characterization of the cytochrome b gene frag-
wards QoI fungicides. Available at: http://www. ment of Puccinia species responsible for the bin-
frac.info/work/Species%20with%20QoI-resistan- ding site of QoI fungicides. Pesticide Biochemistry
ce%20(Status%20Dec.%202012)l.pdf. Accessed and Physiology 84: 72-82.
on 4 de Fevereiro 2015. Grasso V, Palermo S, Sierotzki H, Garibaldi A, Gisi U
FRAC. Resistncia a fungicidas: definies e concei- (2006b) Cytochrome b gene structure and conse-
tos. Available at: http://frac-brasil.org.br/frac/ quences for resistance to Qo inhibitor fungicides
secao.asp?i=10&c=52. Accessed on 1 de Maro, in plant pathogens. Pest management science 62:
2016. 465-472.
FRAC. Frac code list 2016: Fungicides sorted by Grnwald NJ, Sturbaum AK, Montes GR, Serrano
mode of action (including Frac code numbering). EG, Lozoya-Saldaa H, Fry WE (2006) Selection
Available at: http://www.frac.info/. Accessed on for fungicide resistance within a growing season
17 de Maro, 2016. in field populations of Phytophthora infestans at
Fuchs A, Van den Berg G, Davidse L (1972) A compa- the center of origin. Phytopathology 96: 1397-
rison of benomyl and thiophanates with respect 1403.
to some chemical and systemic fungitoxic charac- Harvey JM, Smith WL, Kaufman J (1972) Market di-
teristics. Pesticide Biochemistry and Physiology 2: seases of stone fruits: cherries, peaches, nectari-
191-205. nes, apricots, and plums. Washington, US. United
Gadher P, Mercer E, Baldwin B, Wiggins T (1983) States Department of Agriculture.
A comparison of the potency of some fungicides Hily JM, Singer SD, Villani SM, Cox KD (2011) Charac-
as inhibitors of sterol 14-demethylation. Pesticide terization of the cytochrome b (cyt b) gene from
Biochemistry and Physiology 19: 1-10. Monilinia species causing brown rot of stone and
Genet J, Jaworska G, Deparis F (2006) Effect of dose pome fruit and its significance in the develop-
rate and mixtures of fungicides on selection for ment of QoI resistance. Pest management science
Qol resistance in populations of Plasmopara viti- 67: 385-396.
cola. Pest management science 62: 188-194. Hincapie M, Wang N, Peres N, Dewdney M (2014)
Georgopoulos S (1985) The genetic basis of classifi- Baseline sensitivity of Guignardia citricarpa isola-
cation of fungicides according to resistance risk1. tes from Florida to azoxystrobin and pyraclostro-
EPPO Bulletin 15: 513-517. bin. Plant disease 98: 780-789.
Ghini R, Kimati H (2000) Resistncia de fungos a fun- Holb IJ, Schnabel G (2007) Differential effect of tria-
gicidas. Jaguariuna, Brasil. Embrapa Meio Am- zoles on mycelial growth and disease measure-
biente. ments of Monilinia fructicola isolates with redu-
Gilpatrick J (1981) Resistance to ergosterol biosyn- ced sensitivity to DMI fungicides. Crop protection
thesis-inhibiting fungicides in laboratory strains 26: 753-759.
of Monilinia fructicola. Netherlands journal of Holb IJ, Schnabel G (2008) The benefits of combining

RAPP - Volume 24, 2016 167


Paulo dos Santos Faria Lichtemberg, et al. (145-173)

elemental sulfur with a DMI fungicide to control Kim Y-S, Dixon EW, Vincelli P, Farman ML (2003)
Monilinia fructicola isolates resistant to propico- Field resistance to strobilurin (QoI) fungicides in
nazole. Pest management science 64: 156-164. Pyricularia grisea caused by mutations in the mi-
INMETRO. Produo Integrada de Pssego (PIP). tochondrial cytochrome b gene. Phytopathology
Grade de agroqumicos. Available at: http://www. 93: 891-900.
inmetro.gov.br/credenciamento/organismos/ Kim Y, Xiao C (2011) Stability and fitness of pyraclos-
pessego/gradeAgroquimicos.pdf. Accessed on 8 trobin-and boscalid-resistant phenotypes in field
de Agosto, 2003. isolates of Botrytis cinerea from apple. Phytopa-
Ishii H (2015) Stability of Resistance. In: Ishii H, Hollo- thology 101: 1385-1391.
mon DW, (Eds.) Fungicide resistance in plant pa- Koenraadt H, Somerville SC, Jones A (1992) Charac-
thogens: Principles and a guide to practical mana- terization of mutations in the beta-tubulin gene
gement. Japan. Springer. pp. 35-48. of benomyl-resistant field strains of Venturia ina-
Ishii H, Fraaije B, Sugiyama T, Noguchi K, Nishimura equalis and other plant pathogenic fungi. Phyto-
K, Takeda T, Amano T, Hollomon D (2001) Occur- pathology 82: 1348-1354.
rence and molecular characterization of strobilu- Koffman W, Penrose L (1976) Sclerotinia fructicola
rin resistance in cucumber powdery mildew and tolerant to benomyl detected in New South Wa-
downy mildew. Phytopathology 91: 1166-1171. les. Australasian Plant Pathology 5: 34-34.
Janisiewicz WJ, Biggs AR, Jurick WM, Vico I, Conway Kller W (1988) Sterol demethylation inhibitors: Me-
WS (2013) Biological characteristics of Monilinia chanisms of action and resistance. In: Delp CJ,
fructicola isolates from stone fruits in eastern (Ed.) Fungicide resistance in North America. St.
West Virginia. Canadian Journal of Plant Patholo- Paul, US. APS Press. pp. 79-88.
gy 35: 315-327. Kller W, Scheinpflug H (1987) Fungal Resistance to
Jones A, Ehret G (1976) Isolation and characteriza- Sterol Biosynthesis Inhibitors: A New challenge.
tion of benomyl-tolerant strains of Monilinia fruc- Plant disease 71: 1066-1074.
ticola. Plant Disease Report 60: 765-769. Kller W, Parker D, Turechek W, Avila-Adame C,
JosephHorne T, Hollomon DW (1997) Molecular Cronshaw K (2004) A two-phase resistance res-
mechanisms of azole resistance in fungi. FEMS ponse of Venturia inaequalis populations to the
microbiology letters 149: 141-149. QoI fungicides kresoxim-methyl and trifloxystro-
Junqueira LCU, Carneiro J (1997) Biologa celular e bin. Plant disease 88: 537-544.
molecular. 6o Ed. Rio de Janeiro, Brasil. Guanabara Latorra D, Campbell K, Wolter A, Hurley JM (2003)
Koogan. Enhanced allelespecific PCR discrimination in
Karaoglanidis G, Luo Y, Michailides TJ (2011) Com- SNP genotyping using 3 locked nucleic acid (LNA)
petitive ability and fitness of Alternaria alternata primers. Human mutation 22: 79-85.
isolates resistant to QoI fungicides. Plant disease Leadbeater A (2012) Resistance risk to QoI fungici-
95: 178-182. des and anti-resistance strategies. In: Thind TS,
Kato T, Tanaka S, Ueda M, Kawase Y (1974) Effects (Ed.) Fungicide resistance in crop protection: risk
of the Fungicide, S-1358, on General Metabolism and management. Oxfordshire. CAB Internatio-
and Lipid Biosynthesis in Monilina fructigena. nal. pp. 141-154.
Agricultural and Biological Chemistry 38: 2377- Lehner M, Paula Jnior T, Silva R, Vieira R, Car-
2384. neiro J, Schnabel G, Mizubuti E (2015) Fungicide
Kato T, Tanaka S, Ueda M, Kawase Y (1975) Inhibi- sensitivity of Sclerotinia sclerotiorum: A thorough
tion of sterol biosynthesis in Monilinia fructigena assessment asing discriminatory dose, EC50, high-
by the fungicide, S-1358. Agricultural and Biologi- -resolution melting analysis, and description of
cal Chemistry 39: 169-174. new point mutation associated with thiophanate-
Kelly S, Kelly D (2013) Microbial cytochromes P450: -methyl resistance. Plant disease 99: 1537-1543.
biodiversity and biotechnology. Where do cyto- Leroux P, Gredt M, Leroch M, Walker A-S (2010) Ex-
chromes P450 come from, what do they do and ploring Mechanisms of Resistance to Respiratory
what can they do for us. Philosophical transac- Inhibitors in Field Strains of Botrytis cinerea, the
tions of the royal society B 368: 20120476. Causal Agent of Gray Mold. Applied and environ-

168 RAPP - Volume 24, 2016


Paulo dos Santos Faria Lichtemberg, et al. (145-173)

mental microbiology 76: 6615-6630. -associated genetic element Mona in Monilinia


Liang H-J, Di Y-L, Li J-L, You H, Zhu F-X (2015) Ba- fructicola. Plant disease 92: 1099-1103.
seline Sensitivity of Pyraclostrobin and Toxicity of Luo CX, Hu MJ, Jin X, Yin LF, Bryson PK, Schnabel
SHAM to Sclerotinia sclerotiorum. Plant disease G (2010) An intron in the cytochrome b gene of
99: 267-273. Monilinia fructicola mitigates the risk of resistan-
Lichtemberg PSF (2015) Dynamics and stability of ce development to QoI fungicides. Pest manage-
resistance to tebuconazole in Monilinia fructicola ment science 66: 1308-1315.
populations from brazilian peach orchards. PhD Luo Y, Morgan D, Michailides TJ (2001) Risk analysis
Thesis, Universidade Federal do Paran. Curitiba, of brown rot blossom blight of prune caused by
PR, Brasil. Monilinia fructicola. Phytopathology 91: 759-768.
Lichtemberg PSF, Zeviani WM, Michailides TJ, May Luo Y, Ma Z, Michailides TJ (2007) Quantification of
De Mio LL (2016a) Comparison of the sensitivity allele E198A in betatubulin conferring benzimi-
of Monilinia fructicola isolates to tebuconazole in dazole resistance in Monilinia fructicola using real
Brazil using three methods. Canadian Journal of time PCR. Pest management science 63: 1178-
Plant Pathology 38: 55-63. 1184.
Lichtemberg PSF, Luo Y, Michailides TJ, May De Mio Lupetti A, Danesi R, Campa M, Tacca MD, Kelly S
LL (2016b) Induced overexpression of the gene (2002) Molecular basis of resistance to azole an-
MfCYP51 may reveal molecular mechanisms as- tifungals. Trends in molecular medicine 8: 76-81.
sociated to tebuconazole resistance of Monilinia Ma B, Uddin W (2009) Fitness and competitive abi-
fructicola in Brazil. In: 2016 APS annual meeting, lity of an azoxystrobin-resistant g143a mutant of
Resumos. Tampa, FL, US No Prelo 2016. Magnaporthe oryzae from perennial ryegrass.
Lim T, Yi J, Chang T, Byeongjin C (2001) Fitness of Plant disease 93: 1044-1049.
dicarboximide-resistant and sensitive Monili- Ma Z, Michailides TJ (2005) Advances in understan-
nia fructicola isolated from peach in Korea. The ding molecular mechanisms of fungicide resis-
Plant Pathology Journal 17: 205-209. tance and molecular detection of resistant geno-
Lim TH, Johnson I, Cha B (2006) Characterization types in phytopathogenic fungi. Crop protection
and Genetic Diversity of Benzimidazole-resistant 24: 853-863.
and-sensitive Monilinia fructicola Isolates in Ko- Ma Z, Yoshimura MA, Michailides TJ (2003) Identi-
rea. Plant Pathology Journal 22: 369. fication and characterization of benzimidazole
Linhares AI, Ghini R (2001) Resistncia de fungos fi- resistance in Monilinia fructicola from stone fruit
topatognicos a fungicidas inibidores da demeti- orchards in California. Applied and environmental
lao (DMI): uma reviso. 1o Ed. Jaguarina, Bra- microbiology 69: 7145-7152.
zil. Embrapa Meio Ambiente. Ma Z, Boehm EW, Luo Y, Michailides TJ (2001) Popu-
Livak KJ, Schmittgen TD (2001) Analysis of Relative lation structure of Botryosphaeria dothidea from
Gene Expression Data Using Real-Time Quantita- pistachio and other hosts in California. Phytopa-
tive PCR and the 2 CT Method. methods 25: 402- thology 91: 665-672.
408. Ma Z, Yoshimura MA, Holtz BA, Michailides TJ
Luo C-X, Schnabel G (2008a) The cytochrome P450 (2005) Characterization and PCRbased detection
lanosterol 14-demethylase gene is a demethyla- of benzimidazoleresistant isolates of Monilinia
tion inhibitor fungicide resistance determinant in laxa in California. Pest management science 61:
Monilinia fructicola field isolates from Georgia. 449-457.
Applied and environmental microbiology 74: 359- Ma Z, Proffer TJ, Jacobs JL, Sundin GW (2006) Ove-
366. rexpression of the 14-demethylase target gene
Luo C-X, Schnabel G (2008b) Adaptation to fungici- (CYP51) mediates fungicide resistance in Blume-
des in Monilinia fructicola isolates with different riella jaapii. Applied and environmental microbio-
fungicide resistance phenotypes. Phytopathology logy 72: 2581-2585.
98: 230-238. Malandrakis AA, Markoglou AN, Ziogas BN (2011)
Luo C-X, Cox KD, Amiri A, Schnabel G (2008) Oc- Molecular characterization of benzimidazole-
currence and detection of the DMI resistance- -resistant B. cinerea field isolates with reduced or

RAPP - Volume 24, 2016 169


Paulo dos Santos Faria Lichtemberg, et al. (145-173)

enhanced sensitivity to zoxamide and diethofen- SNPspecific Primers for the Detection of a G143A
carb. Pesticide Biochemistry and Physiology 99: Mutation Level in Venturia inaequalis Field Popu-
118-124. lations. Journal of Phytopathology 159: 569-578.
Malandrakis AA, Markoglou AN, Ziogas BN (2012) Miessner S, Stammler G (2010) Monilinia laxa, M.
PCR-RFLP detection of the E198A mutation con- fructigena and M. fructicola: Risk estimation of
ferring resistance to benzimidazoles in field iso- resistance to QoI fungicides and identification of
lates of Monilinia laxa from Greece. Crop protec- species with cytochrome b gene sequences. Jour-
tion 39: 11-17. nal of Plant Diseases and Protection 117: 162-167.
Mansfield BE, Oltean HN, Oliver BG, Hoot SJ, Leyde Mikaberidze A, McDonald BA (2015) Fitness cost of
SE, Hedstrom L, White TC (2010) Azole drugs are resistance: impact on management. In: Ishii H,
imported by facilitated diffusion in Candida albi- Hollomon DW, (Eds.) Fungicide resistance in plant
cans and other pathogenic fungi. PLoS pathogens pathogens: Principles and a guide to practical ma-
6: e1001126. nagement. Japan. Springer. pp. 77-89.
Martini C, Guidarelli M, Mari M (2012) Study of re- Morales R, May de Mio LL, Fiesher JM, Lichtemberg
sistance to tebuconazole and tiophanate methyl PSF (2013) Ocurrence of DMI resistance is not
on italian strains of Monilinia fructicola and M. associated to genetic element Mona in Brazilian
laxa. Journal of Plant Pathology 94: S4.57-S54.84. isolate of Monilinia fructicola. In: 46o Congresso
Matasci CL, Gobbin D, Schrer H-J, Tamm L, Gessler Brasileiro de Fitopatologia, Resumos. Ouro Preto,
C (2008) Selection for fungicide resistance throu- MG, Brasil 489-481.
ghout a growing season in populations of Plasmo- Navarrete-Vzquez G, Cedillo R, Hernndez-Campos
para viticola. European journal of plant pathology A, Ypez L, Hernndez-Luis F, Valdez J, Morales
120: 79-83. R, Corts R, Hernndez M, Castillo R (2001) Syn-
May De Mio LL, Garrido L, Ueno B (2004) Doenas thesis and antiparasitic activity of 2-(trifluorome-
de fruteiras de caroo. In: Monteiro LB, May De thyl) benzimidazole derivatives. Bioorganic and
Mio LL, Serrat BM, Motta AC, Cuquel FL, (Eds.) Medicinal Chemistry Letters 11: 187-190.
Fruteiras de caroo: Uma viso ecolgica. Curiti- Nuninger-Ney C, Schwinn F-J, Staub T (1989) In vitro
ba, Brasil. UFPR. pp. 169-222. selection of sterol-biosynthesis-inhibitor (SBI)-
May De Mio LL, Luo Y, Michailides TJ (2011) Sensi- -resistant mutants in Monilinia fructicola (Wint.)
tivity of Monilinia fructicola from Brazil to tebu- Honey. Netherlands journal of plant pathology
conazole, azoxystrobin, and thiophanate-methyl 95: 137-150.
and implications for disease management. Plant Ogawa JM, Manji BT, Rough D, Sonoda RM (1980)
disease 95: 821-827. Monitoring and control of benomyl-resistant Mo-
McGrath MT. What are fungicides? The plant health nilinia fructicola. In: 1980 APS annual meeting,
instructor. Available at: http://www.apsnet.org/ Resumos. Minneapolis, MN, US 246.
edcenter/intropp/topics/Pages/fungicides.aspx. Ogawa JM, Zehr EI, Bird GW, Ritchie DF, Uriu K,
Accessed on 1 de Maro, 2016. Uyemoto JK (1995) Compendium of stone fruit di-
McKay GJ, Egan D, Morris E, Brown AE (1998) Iden- seases. St. Paul, US. APS Press.
tification of benzimidazole resistance in Clado- Olaya G (2011) Laboratory methods for evaluating
botryum dendroides using a PCR-based method. resistance in vitro. In: 2011 APS-IPPC Joint Mee-
Mycological Research 102: 671-676. ting, Resumos. Honolulu, HI, US S2.28.
McKean PG, Vaughan S, Gull K (2001) The extended Oliveira SC, Castroagudn VL, Maciel JLN, Pereira
tubulin superfamily. Journal of Cell Science 114: DAS, Ceresini PC (2015) Cross-resistance to QoI
2723-2733. fungicides azoxystrobin and pyraclostrobin in the
Michailides T, Ogawa J, Opgenorth D (1987) Shift of wheat blast pathogen Pyricularia oryzae in Brazil.
Monilinia spp. and distribution of isolates sensi- Summa Phytopathologica 41: 298-304.
tive and resistant to benomyl in California prune Oliver RP, Hewitt HG (2014) Fungicides in crop pro-
and apricot orchards. Plant disease 71: 893-896. tection. Second Ed. Oxfordshire, UK. CAB Interna-
Michalecka M, Malinowski T, BroniarekNiemiec tional.
A, Bielenin A (2011) Realtime PCR Assay with Orbach MJ, Porro EB, Yanofsky C (1986) Cloning and

170 RAPP - Volume 24, 2016


Paulo dos Santos Faria Lichtemberg, et al. (145-173)

characterization of the gene for beta-tubulin from 253.


a benomyl-resistant mutant of Neurospora crassa Sanglard D, Ischer F, Calabrese D, Micheli Md, Bille J
and its use as a dominant selectable marker. Mo- (1998b) Multiple resistance mechanisms to azole
lecular and Cellular Biology 6: 2452-2461. antifungals in yeast clinical isolates. Drug Resis-
Pariaud B, Ravigne V, Halkett F, Goyeau H, Carlier tance Updates 1: 255-265.
J, Lannou C (2009) Aggressiveness and its role in Sauter H, Steglich W, Anke T (1999) Strobilurins:
the adaptation of plant pathogens. Plant Patholo- evolution of a new class of active substances. An-
gy 58: 409-424. gewandte Chemie International Edition 38: 1328-
Parker DM, Zhang N, D SC, Kller WD (2006) Poly- 1349.
morphism of 14 alpha-demethylase gene (CYP51) Schmidt LS, Ghosoph JM, Margosan DA, Smilanick JL
in brown rot pathogen Monilinia fructicola from a (2006) Mutation at -tubulin codon 200 indicated
resistant orchard in New York State. In: 2006 APS thiabendazole resistance in Penicillium digitatum
Annual Meeting, Resumos. Quebec, Canada S90. collected from California citrus packinghouses.
Patel JS, Meinhardt SW, Sierotzki H, Stammler G, Plant disease 90: 765-770.
Gudmestad NC, Adhikari TB (2011) A two-step Schmittgen TD, Livak KJ (2008) Analyzing real-time
molecular detection method for Pyrenophora tri- PCR data by the comparative CT method. Nature
tici-repentis isolates insensitive to QoI fungicides. protocols 3: 1101-1108.
Plant disease 95: 1558-1564. Schnabel G, Dai Q (2004) Heterologous expression of
Penrose L, Senn A (1995) Baseline sensitivities of the P450 sterol 14-demethylase gene from Mo-
preserved isolates of Sclerotinia fructicola from nilinia fructicola reduces sensitivity to some but
various host species to propiconazole and ipro- not all DMI fungicides. Pesticide Biochemistry and
dione. Australasian Plant Pathology 24: 9-14. Physiology 78: 31-38.
Picinini E (1994) Fungicidas benzimidazoles. Reviso Schnabel G, Dai Q, Paradkar M (2003) Cloning and
anual de patologia de plantas 2: 357-409. expression analysis of the ATP-binding cassette
Price PP, Purvis MA, Cai GH, Padgett GB, Robertson transporter gene MfABC1 and the alternative oxi-
CL, Schneider RW, Albu S (2015) Fungicide Resis- dase gene MfAOX1 from Monilinia fructicola. Pest
tance in Cercospora kikuchii, a Soybean Pathogen. management science 59: 1143-1151.
Plant disease 99: 1596-1603. Schnabel G, Bryson PK, Bridges WC, Brannen PM
Primiano I (2015) Fitness of Monilinia fructicola with (2004) Reduced sensitivity in Monilinia fructicola
different levels of sensitivity to azoxystrobin. Uni- to propiconazole in Georgia and implications for
versidade de So Paulo. Piracicaba, SP, Brasil. disease management. Plant disease 88: 1000-
Pringle A, Taylor JW (2002) The fitness of filamen- 1004.
tous fungi. Trends in microbiology 10: 474-481. Schroeder W, Provvidenti R (1969) Resistance to be-
Quello KL, Chapman KS, Beckerman JL (2010) In situ nomyl in powdery mildew of cucurbits. Plant Di-
detection of benzimidazole resistance in field iso- sease Report 53: 271-275.
lates of Venturia inaequalis in Indiana. Plant dise- SEAB. Produo agropecuria. Available at: http://
ase 94: 744-750. www.agricultura.pr.gov.br/. Accessed on 23 de
Reis EM, Reis AC, Carmona MA (2010) Manual de Maro, 2016.
fungicidas: guia para controle qumico de doen- Shapiro RS, Robbins N, Cowen LE (2011) Regulatory
as de plantas. 6o Ed. Passo Fundo, Brasil. UPF. circuitry governing fungal development, drug re-
Russell PE (2004) Sensitivity baselines in fungicide sistance, and disease. Microbiology and Molecu-
resistance research and management. Cambrid- lar Biology Reviews 75: 213-267.
ge, UK. Crop Life International. Shaw M (1989) A model of the evolution of polygeni-
Sanglard D, Ischer F, Koymans L, Bille J (1998a) Ami- cally controlled fungicide resistance. Plant Patho-
no acid substitutions in the cytochrome P-450 logy 38: 44-55.
lanosterol 14-demethylase (CYP51A1) from azo- Sierotzki H (2015) Respiration Inhibitors: Complex III.
le-resistant Candida albicans clinical isolates con- In: Ishii H, Hollomon DW, (Eds.) Fungicide resis-
tribute to resistance to azole antifungal agents. tance in plant pathogens: Principles and a guide
Antimicrobial Agents and Chemotherapy 42: 241- to practical management. Japan. Springer. pp.

RAPP - Volume 24, 2016 171


Paulo dos Santos Faria Lichtemberg, et al. (145-173)

119-143. components of Alternaria alternata from citrus.


Sierotzki H, Wullschleger J, Gisi U (2000) Point mu- Plant disease 98: 1371-1378.
tation in cytochrome b gene conferring resistan- Vega B, Liberti D, Harmon PF, Dewdney MM (2012)
ce to strobilurin fungicides in Erysiphe graminis f. A rapid resazurin-based microtiter assay to evalu-
sp tritici field isolates. Pesticide Biochemistry and ate QoI sensitivity for Alternaria alternata isolates
Physiology 68: 107-112. and their molecular characterization. Plant disea-
Sierotzki H, Frey R, Wullschleger J, Palermo S, Kar- se 96: 1262-1270.
lin S, Godwin J, Gisi U (2007) Cytochrome b gene Villani SM, Cox KD (2011) Characterizing Fenbuco-
sequence and structure of Pyrenophora teres and nazole and Propiconazole Sensitivity and Pre-
P. tritici-repentis and implications for QoI resistan- valence of Monain Isolates of Monilinia fructi-
ce. Pest management science 63: 225-233. cola from New York. Plant disease 95: 828-834.
Silva S, Kohls V, Manica-Berto R, Rigatto P, Rom- Weger J, Schanze M, Hilber-Bodmer M, Smits TH,
baldi C (2011) Apropriao tecnolgica da pro- Patocchi A (2011) First report of the -tubulin
duo integrada de pssego na regio de Pelotas E198A mutation conferring resistance to methyl
no estado do Rio Grande do Sul. Cincia Rural 41: benzimidazole carbamates in European isolates
1667-1673. of Monilinia fructicola. Plant disease 95: 497-497.
Sonoda R, Ogawa J, Manji B, Shabi E, Rough D (1983) Whan J (1976) Tolerance of Sclerotinia fructicola
Factors affecting control of blosson blight in a pe- to benomyl. Plant Disease Report 60: 200-201.
ach orchard with low level benomyl-resistant Mo- Wilcox WF, Burr JA (1994) Baseline sensitivity of
nilinia fructicola. Plant disease 67: 681-684. Monilinia fructicola to six DMI fungicides. In:
Stammler G, Schutte G, Speakman J, Miessner S, 1994 APS Annual Meeting, Resumos. Albu-
Crous P (2013) Phyllosticta species on citrus: Risk querque, NM, US 1078.
estimation of resistance to QoI fungicides and Winder B, Strandgaard C, Miller M (2001) The
identification of species with cytochrome b gene role of GTP binding and microtubule-associa-
sequences. Crop protection 48: 6-12. ted proteins in the inhibition of microtubule
Staub T, Sozzi D (1984) Fungicide resistance. Plant di- assembly by carbendazim. Toxicological scien-
sease 68: 1026-1031. ces 59: 138-146.
Stevic M, Vuksa P (2006) Sensitivity of Monilinia laxa Yin L-F, Hu M-J, Wang F, Kuang H, Zhang Y, Schna-
(ader. & ruhl.) to fungicides having different mo- bel G, Li G-Q, Luo C-X (2012) Frequent gain and
des of action. Pesticides and Phytomedicine 21: loss of introns in fungal cytochrome b genes. PloS
297-304. one 7: e49096.
Szkolnik M, Gilpatrick J (1977) Tolerance of Monilinia Yoshimura M, Luo Y, Ma Z, Michailides T (2004) Sen-
fructicola to benomyl in western New York State sitivity of Monilinia fructicola from stone fruit to
orchards. Plant Disease Report 61: 654-657. thiophanate-methyl, iprodione, and tebuconazo-
Taeheon L, Jaechoon Y, Taehyun C, Byeongjin C le. Plant disease 88: 373-378.
(2001) Fitness of dicarboximide-resistant and Young DH (2015) Anti-tubulin Agents. In: Ishii H,
sensitive Monilinia fructicola isolated from peach Hollomon DW, (Eds.) Fungicide resistance in plant
in Korea. Plant Pathology Journal 17: 205209. pathogens: Principles and a guide to practical ma-
Theodoulou FL (2000) Plant ABC transporters. Bio- nagement. Japan. Springer. pp. 93-103.
chimica et Biophysica Acta (BBA)-Biomembranes Yuan N-N, Chen S-N, Zhai L-X, Schnabel G, Yin L-F,
1465: 79-103. Luo C-X (2013) Baseline sensitivity of Monilia yun-
Thomidis T, Michailides T, Exadaktylou E (2009) Con- nanensis to the DMI fungicides tebuconazole and
tribution of pathogens to peach fruit rot in nor- triadimefon. European journal of plant pathology
thern greece and their sensitivity to iprodione, 136: 651-655.
carbendazim, thiophanatemethyl and tebucona- Zehr EI (1982) Control of brown rot in peach orchar-
zole fungicides. Journal of Phytopathology 157: ds. Plant disease 66: 1101-1105.
194-200. Zehr EI, Toler JE, Luszcz LA (1991) Spread and persis-
Vega B, Dewdney MM (2014) QoI-resistance stability tence of benomyl-resistant Monilinia fructicola in
in relation to pathogenic and saprophytic fitness South Carolina peach orchards. Plant disease 75:

172 RAPP - Volume 24, 2016


Paulo dos Santos Faria Lichtemberg, et al. (145-173)

590-593. nual Review of Phytopathology 51: 131-153.


Zehr EI, Luszcz LA, Olien WC, Newall W, Toler JE Zheng D, Olaya G, Kller W (2000) Characterization
(1999) Reduced sensitivity in Monilinia fructicola of laboratory mutants of Venturia inaequalis re-
to propiconazole following prolonged exposure in sistant to the strobilurin-related fungicide kreso-
peach orchards. Plant disease 83: 913-916. xim-methyl. Current genetics 38: 148-155.
Zeng F, Arnao E, Zhang G, Olaya G, Wullschleger J, Zhu F, Bryson PK, Schnabel G (2012) Influence of
Sierotzki H, Ming R, Bluhm B, Bond J, Fakhoury A storage approaches on instability of propiconazo-
(2015) Characterization of quinone outside inhibi- le resistance in Monilinia fructicola. Pest manage-
tor fungicide resistance in Cercospora sojina and ment science 68: 1003-1009.
development of diagnostic tools for its identifica- Zhu F, Bryson P, Amiri A, Schnabel G (2010) First
tion. Plant disease 99: 544-550. report of the -tubulin E198A allele for fungicide
Zhan J, McDonald B (2013) Experimental measures resistance in Monilinia fructicola from South Ca-
of pathogen competition and relative fitness. An- rolina. Plant disease 94: 1511-1511.

RAPP - Volume 24, 2016 173


Wei Wei and Steven J. Clough (174-189)

SCLEROTINIA SCLEROTIORUM:
MOLECULAR ASPECTS IN PLANT-
PATHOGENIC INTERACTIONS
Wei Wei1 and Steven J. Clough2

SUMMARY
This year, 2016, marks the 130th anniversary of Anton de Barys detai-
led reports summarizing his observations and thoughts on the plant pathogenic
fungus Sclerotinia sclerotiorum. As the most famous pioneer of plant pathology
across the globe, de Bary made many intelligent observations that still hold true
today, such as the secretion of enzymes and oxalic acid. As scientists advanced
the story of S. sclerotiorum pathology through the following decades, they con-
firmed the identity of numerous plant cell-wall-degrading enzymes and oxalic
acid, and they clearly demonstrated the importance of these virulence factors
in establishing disease, plus they added more details. This review summarizes
some of these findings that have occurred in the last 130 years on the molecular
aspects of S. sclerotiorum-host interactions.

1. Introduction macerate plant host tissue. Thus started the studies


Anton de Bary, the father of plant pathology, on the molecular interactions of S. sclerotiorum and
was an amazingly observant individual. His extraor- its hosts--over 130 years ago. Questions asked then,
dinary curiosity and attention to detail led to many are still being asked today. Why do the fungal hyphae
discoveries and understandings of multiple plant pa- release OA, and what is in the fungal ferment that
thogen life cycles and behaviors. He studied many could dissolve plant host cell walls? And similarly,
plant pathogens and wrote extensively on several, how is the plant responding to this aggressive, unin-
such as Sclerotinia sclerotiorum, much of which he vited visitor and these toxic substances to which it i
summarized in a series of weekly submissions to exposed? What other molecules are involved? How,
a journal he co-edited with L. Just, the Botanische and what, are the genes used by the pathogen and
Zeitung, in 1886 (de Bary, 1886; available for free host to create and control these molecular interac-
download at http://www.biodiversitylibrary.org/ tions?
item/ 105850# page/36/mode/1up) and in his com- Anton de Bary was far ahead of his contem-
prehensive treatise summarizing his many observa- poraries, and it would be several decades after his
tions of plant pathogens (de Bary, 1887). Although death in 1888 before scientists would make any fur-
he was light years away from the molecular revolu- ther substantial progress on the questions he expo-
tion that would blossom nearly 100 years after his sed. One of these reports of progress was a very nice
death, de Bary successfully identified the two main microscopic study by Boyle in 1921 (Boyle) where he
molecular factors affecting the ability of S. sclero- noted that the growing hyphae of S. libertiana (a sy-
tiorum to be a successful pathogen: the release of nonym of S. sclerotiorum) were coated with a thick
oxalic acid (OA) and ferments (enzymes) that could mucilaginous/gelatinous sheath which he described

1
University of Illinois Department of Crop Sciences, 238 National Soybean Research Center, 1101 West Peabody Drive, Urbana, IL
61801, USA. 2USDA-ARS, National Soybean Research Center, 1101 West Peabody Drive, Urbana, IL 61801, USA.

174 RAPP - Volume 24, 2016


Wei Wei and Steven J. Clough (174-189)

as a substance released by the fungus that aided in assumption that S. sclerotiorum produced the toxin
the attachment of the mycelia to the host surface. OA. In de Barys work, the fact that the liquid sur-
He also observed, in disagreement with de Bary, that rounding hyphae, or droplets released by sclerotia,
the fungal hyphae appeared to mechanically force was acidic and would precipitate with calcium, it
their way past the plant cuticle. He further obser- was assumed that this liquid had to be OA (de Bary,
ved that once the cuticle is broken the walls of the 1886). In 1952, when Overell (Overell, 1952) found
host cells near the point of penetration show signs that spent culture filtrates of S. sclerotiorum could
of being chemically altered. Interestingly, Boyle also macerate carrot slices, he wanted to determine the
noted that the cells adjacent to an infected cell could cause. He noticed that the maceration ability was pH
be negatively affected by the invading fungus as well, dependent and the macerating factor(s) was stable
presumably by fungal- or plant-released enzymes or after autoclaving. Through the use of paper chroma-
toxins: tography and similar calcium precipitation assays, he
Death of the cells extends some dis- identified OA as being present, at concentrations in
tance beyond the limits of the invading hypha, the 10s of mM in cultures that had grown up to 35
due either to enzymes secreted by the fungus days. Overell also found that similar maceration sho-
or to the products of disorganized cells. The le- wed up when carrot slices were soaked in pure OA in
thal substance or substances appear to diffuse a pH-dependent manner, with the best maceration
more rapidly along the palisade cells of the me- activities occurring at pH levels between 2.6 4.0 for
sophyll than into the spongy parenchyma, as his studies. Therefore, he hypothesized that OA was
the chloroplasts of the palisade cells for some the cause of the deterioration, and that the different
distance on either side of the point of infection ion forms of oxalate (Figure 1) were affecting the ma-
are swollen or disorganized, while those of the ceration, as OA would be mostly fully deprotonated
spongy parenchyma immediately underneath as the pH levels rose past 4, and it would be mostly
are still unaffected. This is evidently due to the in the mono-basic ion form at pH 2.6 to 4.0 (oxalic
fact that the palisade cells are in closer contact acid pKa1 1.2, and pKa2 4.2).
and hence allow a more rapid diffusion of the Interestingly, the levels of OA found by Ove-
lethal substance or substances than the cells of rell were fairly similar to the levels found in cultures
the spongy parenchyma, which are in contact of the close relative of S. sclerotiorum, Sclerotinia
at comparatively few points. rolfsii, by Higgins 25 years earlier (Higgins, 1927). Hi-
ggins identified large amounts of OA released from
Although both de Bary and Boyle stated that S. rolfsii, reporting 0.3 3x more grams of OA as gra-
their studies suggested the release of plant-cell-wall ms of mycelial dry when growing S. rolfsii in various
degrading ferments or enzymes, the actual identi- liquid media for 31 days, and estimated the oxalate
fication of these molecular weapons would not start concentrations at 5-70 mM. Higgins, like Overell, also
until the late 1950s and 1960s. In the meantime, used precipitation with known amounts of calcium
plant pathologists successfully confirmed de Barys as a means to calculate the approximate amount

Figure 1. The molecular form of oxalic acid at different pH levels. The pH of the apoplast of plant cells is estimated to be
about 5.6, so during initial S. sclerotiorum infection, most of the oxalic acid entering the plant tissue into the apoplost
would be fully depronated. After continued fungal growth and acid release, the acidity could build up to levels that
would overpower any buffering capacity of the apolplastic fluids, and the pH would lower. The pH of S. sclerotiorum
infected tissue is often measured to be somewhere between 2 and 4, meaning that the oxalic acid would be mostly in
the mono-basic (mono-protonated) form.

RAPP - Volume 24, 2016 175


Wei Wei and Steven J. Clough (174-189)

of OA in solution, as oxalate at pH levels above 1.2 ducer of OA than glucose). Researchers found that
readily binds calcium ions and precipitates from so- the activity of purified polygalacturonase was non-
lution (i.e., adding known amounts of calcium and functioning if the substrate was calcium pectate, the
weighing the dried precipitate to estimate oxalate form that is commonly found in plant cell walls, but
molarity). if OA was added to the assay, the pectate was degra-
ded, presumably due to the removal of calcium from
2. Investigations on S. sclerotiorum plant cell-wall- the calcium pectate by OAs proven ability to chelate
-degrading enzymes (PCWDEs) calcium. In addition, OA lowers the pH (estimated as
As mentioned previously, since at least the 2.8 in their cultures), and they found that the optimal
1800s, scientists have known that some cell-free ex- pH for the polygalacturonase activity was between 3
tracts, termed ferments and later enzymes, could and 4, a pH optimum similar to what Echandi and
stimulate chemical reactions to occur, but the link Walker (1957) noted (see the previous paragraph).
between enzymatic activities and actual protein mo- They also noted that pH values below 4 could kill
lecules was not made until the 1920s and 1930s, plant tissue, without the presence of PCWDEs, and
with the 1946 Noble Prize in Chemistry awarded to that fluids from diseased lesions was near 4.0. They
scientists who helped make this connection. There- therefore concluded that OA was most likely having
fore, in the 1950s enzymology was a popular resear- its negative effect on plant hosts due to both 1. bin-
ch focus for scientists, and many biologists, including ding and removal of calcium out of calcium pectate
plant pathologists, were looking for enzymes. By to allow the polygalacturonases to function at maxi-
the 1960s, the plant pathologists studying S. sclero- mal efficiency; and 2. to the general toxic effects of a
tiorum had clearly identified the release of peptidio- lowered pH.
lytic enzymes in cultures and in planta. The search for extracellular enzymes that
In 1957, Echandi and Walker (Echandi and could factor into molecular plant-pathogen interac-
Walker, 1957) were the first to report the identifi- tions, and their detailed characterizations, continued
cation of such PCWDEs from S. sclerotiorum. These to be popular in the 1960s and for decades beyond.
scientists identified both pectin methylesterase and Evidence for cellulose degrading enzymes was found
polygalacturonase activities from S. sclerotiorum using paper, cotton or carboxymethyl cellulose as
grown on wheat bran. These enzymatic activities growth substrates in the media (Hancock, 1967).
were destroyed by heating at 55C for 10 minutes. Marciano et al. (1983) detailed the roles of three
The activity of these pectolytic enzymes was highest types of PCWDEs, polygalacturonase, cellulose, and
at pH levels between 3 and 5, and the most optimal xylanase in virulence, together with the enhanced
at pH 4. Enzyme activities were reduced to 44% and effect of OA and its low pH. A survey of the ability
20% at pH 6 and pH 7, respectively. This work was of extracellular fluids of a S. sclerotiorum culture to
supported in planta, by analyzing S. sclerotiorum in- degrade cell-wall polysaccharides was conducted by
fected tissues (Hancock, 1966). Hancock documen- Riou et al. (1992) in which enzymatic activity was de-
ted pectin methylesterase and polygalacturonase tected for the degradation of cellulolytic, hemicellu-
activities in infected stem tissue, together with an lolytic, and pectinolytic polysaccharides. Gel analysis
increase in stem acidity, with the pH dropping from confirmed the presence of at least one pectinase,
about 6.2 to 4.5 during his infection studies. beta-xylosidase, and cellobiosidase. Subsequent stu-
A very interesting study came out in 1965 dies focused on characterizing the most effective
by Bateman and Beer (Bateman and Beer, 1965). class of plant-cell-macerating enzyme released by S.
Working on S. rolfsii, they noted the benefits of a pa- sclerotiorum: the endo-polygalacturonases (Fraissi-
thogen releasing both pectolytic enzymes and OA, net-Tachet, et al., 1995; Cotton, et al., 2002; Cotton
as they found that the effects of the enzyme func- et al., 2003). The work of Favaron et al. (2004) su-
tion and acid were synergistically enhanced in the ggested that there are at least two different endo-
presence of each other. They estimated that S. rolf- -polygalacturonases in S. sclerotiorum, each with a
sii culture filtrates contained up to 30 mM OA (80 different pH optimum for activity, with endo-PGa
mg/30 ml) after 6 days growth on carboxymethyl being more active at lower pH values (from 3.6-5.0),
cellulose (which they found to be a much better in- and endo-PGb more active at pH 4.5-5.0. In addition

176 RAPP - Volume 24, 2016


Wei Wei and Steven J. Clough (174-189)

to the endo-polygalacturonases, researchers also of PCWDEs, but also emphasized the importance of
conducted further detailed characterization of exo- the ability of OA to strongly chelate biologically im-
-polygalacturonases (Li et al., 2004). Other enzymes portant cations such as calcium, iron, manganese,
found to be released by S. sclerotiorum include at le- magnesium, nickel, aluminum, and copper, affecting
ast two endo-beta-1,4-glucanases (Waksman, 1991; their solubility and thus availability; also of impor-
Chahed et al., 2014), at least two beta-glucosidases tance is the effect of OA on destabilizing cytoplas-
(Issam et al., 2003) and at least one beta-galactosi- mic and chloroplastic membranes, which would aid
dase (Waksman, 1989; Riou, et al., 1992a). The se- in tissue maceration. For additional perspectives on
arch for cutinases had been elusive, and there were the molecular interactions between plants and S.
conflicting reports from microscopic studies as to sclerotiorum, readers should also refer to the very
whether or not the cuticle was being enzymatically recent mini review by Mbengue et al. (2016).
degraded. Although the microscopy work of Boyle
(1921) did not show any evidence for cuticle degra- 3.1. Phenotypes of various OA-deficient mu-
dation, de Bary reported that he had seen evidence tants
of cuticle degradation, and in 2012, a cutinase was Looking at the pathogen side of this host-
finally identified (Bashi et al., 2012). PCWDEs have -pathogen relationship, the reader can find several
complex roles and regulation, and Hegedus and Rim- very good papers on the effects of S. sclerotiorum-
mer (2005) wrote an excellent mini-review propo- produced OA on the fungus itself. As discussed be-
sing how activation and repression of PCWDEs, as low, S. sclerotiorum produces and metabolizes OA,
well as sclerotia development, might be controlled which affects various aspects of fungal vegetative
by a tri-phasic model for infection involving glucose, growth, sclerotia development and pathogenesis.
cAMP, and pH levels that change during infection. To investigate the critical role of OA throughout the
life cycle of S. sclerotiorum, mutagenesis was used.
3. Mechanisms of OA and plant-Sclerotinia interac- Mutants induced by ultraviolet light (UV) were scre-
tion ened for reduced OA production and these mutants
This present review focuses on the effects of were found to be non-pathogenic on common bean
S. sclerotiorum-released molecules, such as OA and (Godoy et al., 1990). These mutants also did not pro-
secreted enzymes (and their related genes), on the duce sclerotia, and had low expression of pectinases
plant host. Other reviews on S. sclerotiorum are also and cellulases, showing that sclerotia formation and
available to the reader. Two excellent reviews were some PCWDEs, all required OA. In addition, the OA
published in 1979 as part of an APS Symposium of deficient mutants provided some clues to the bio-
Sclerotinia. Purdy (1979) described the various, so- synthetic pathway for OA production, as the addition
mewhat confusing, nomenclatures used to name of succinate to culture media led to the production
S. sclerotiorum, and gave a superb summary of big of some OA, showing the pathway could include suc-
picture aspects of this disease such as histology, di- cinate (i.e., the mutation might have occurred in an
sease development and host range; Lumsden (1979) enzyme of the biosynthetic pathway upstream of
summarized details on the physiological and histo- succinate production).
logical changes that occur during S. sclerotiorum pa- An enzyme known to be involved in the syn-
thogenesis. Lumsden put an emphasis on the role thesis of OA is oxaloacetate acetylhydrolase (OAH,
of OA chelating important cations and producing a EC 3.7.1.1), which is the enzyme of S. sclerotiorum
gradient of lowering pH values, in conjunction with that converts oxaloacetate to OA and carbon dioxi-
the plant PCWDEs, and how these factors would de. OAH was knocked out by targeted gene replace-
make the cells at the infection front more permea- ment via homologous recombination, leading to a
ble, and how that would lead to greater leakage of genetically defined mutant that accumulated no OA,
nutrients for the fungus, thus weakening the host. even under highly inductive conditions (Liang et al.,
Another very good, comprehensive review (Dutton 2015). The radial growth rates of vegetative hyphae
and Evans, 1996) on the role of large quantities of of these mutants were observed to be almost equal
OA in plant diseases caused by numerous fungi, not to wild type (WT) on potato dextrose medium bu-
only explained how OA could enhance the efficiency ffered to pH 3.6, whereas growth was severely re-

RAPP - Volume 24, 2016 177


Wei Wei and Steven J. Clough (174-189)

duced when the medium was buffered pH 6.9. On if the plants were wounded first. It is not clear why
all media tested, the oah mutant, similar to the UV- these differences occurred, and how much of the-
induced OA-minus mutants of Godoy et al. (1990), se differences are strain specific, but it does suggest
could not form sclerotia, but mycelia were noted that there could be some unknown complexity in OA
to form some loose and unmelanized aggregates metabolism and perhaps in OA-regulated genes, and
as if some sort of futile effort was being made to that the various OA-minus mutants affect these fac-
produce sclerotia. Moreover, the oah mutant was tors in different manners.
also defective in compound appressorium forma- Another enzyme involved in OA metabolism
tion on artificial surfaces. Complementation using in S. sclerotiorum was also rece