Você está na página 1de 75

BRUNO GARCIA BOTARO

Variantes genticas de beta-lactoglobulina em vacas leiteiras e

caractersticas fsico-qumicas e de composio do leite

Pirassununga

2007
BRUNO GARCIA BOTARO

Variantes genticas de beta-lactoglobulina em vacas leiteiras e

caractersticas fsico-qumicas e de composio do leite

Dissertao apresentada ao Programa de Ps-


Graduao em Nutrio Animal da Faculdade de
Medicina Veterinria e Zootecnia da Universidade
de So Paulo para obteno do ttulo de Mestre em
Medicina Veterinria

Departamento:

Nutrio e Produo Animal

rea de concentrao:

Nutrio Animal

Orientador:

Prof. Dr. Marcos Veiga dos Santos

Pirassununga

2007
PARECER DA COMISSO DE BIOTICA
FOLHA DE AVALIAO

Nome: Botaro, Bruno Garcia


Ttulo:Variantes genticas de beta-lactoglobulina em vacas leiteiras e caractersticas fsico-
qumicas e de composio do leite

Dissertao apresentada ao Programa de Ps-


Graduao em Nutrio Animal da Faculdade de
Medicina Veterinria e Zootecnia da Universidade
de So Paulo para obteno do ttulo de Mestre em
Medicina Veterinria

Data:_____/_____/_____

Banca Examinadora

Prof. Dr.:___________________________ Instituio___________________________

Assinatura:_________________________ Julgamento: _________________________

Prof. Dr.:___________________________ Instituio___________________________

Assinatura:_________________________ Julgamento: _________________________

Prof. Dr.:___________________________ Instituio___________________________

Assinatura:_________________________ Julgamento: _________________________


Dedico aos meus pais, Carmen e Carlos, e meu irmo Guilherme, que com amor

incondicional, me conduzem por todos os caminhos que em minha vida empreito


ano sobre a estabilidade do leite, sendo que o leite mais instvel na raa Girolanda e na
estao seca, mas no se observou efeito do polimorfismo da -lactoglobulina sobre esta
caracterstica.

Palavras-chave: Vaca-leiteira, Composio do leite, Estabilidade do leite, Protena, -


lactoglobulina
ABSTRACT

BOTARO, B. G. Beta-lactoglobulin polymorphism in dairy cows and milk composition and


physico-chemical characteristics. [Variantes genticas de beta-lactoglobulina em vacas
leiteiras e caractersticas fsico-qumicas e de composio do leite]. 2007. 74 f. Dissertao
(Mestrado em Medicina Veterinria) Faculdade de Medicina Veterinria e Zootecnia,
Universidade de So Paulo, So Paulo, 2007.

The objective of this study was to evaluate the association between beta-lactogobulin
polymorphism and physico-chemical characteristics, composition (fat, total solids, urea, crude
protein, true protein, non protein nitrogen and casein), and stability of milk. For this aim, 11
dairy herds were selected, six of them composed of crossbred Holstein-Zebu (H-Z) cows and
five from Holstein cows. Milk samples were taken four times (twice in dry season and twice
in rainy season), from 164 Holstein and 74 crossbred Holstein-Zebu cows. Individual milk
samples were analyzed for milk composition and physico-chemical properties. For -
lactoglobulin polymorphism analysis, blood samples were collected from each cow and then
submitted to polymerase chain reaction (PCR) for genotype and allele frequencies
determination. Heat stability of milk was determined by the alcohol-induced precipitation test,
using the following ethanol concentrations 70, 76, 80 and 84GL. The genotype frequencies
were 0.28, 0.30 and 0.41 for AA, AB and BB, respectively. Allele B frequency was higher
than A, 0.52 and 0.47, for Holstein cows, 0.58 and 0.41, for Holstein-Zebu, respectively.
Genetic variants of -lactoglobulin (AA, AB and BB) had no effect on physico-chemical and
compositional characteristics, either among milk from Holstein cows, or from crossbred
Holstein-Zebu. Breed effect was observed (Holstein and H-Z, respectively) on titrable acidity
(16,16 and 17,07D), pH (6,78 and 6,75), fat (3,31 and 3,20%), milk urea nitrogen (16,62 and
14,45mg/dL) and crude protein (3,13 and 3,04%) was observed. Effect of seasonality (rainy
and dry season, respectively) was also observed on titrable acidity (16,62 and 16,34D), pH
(6,76 and 6,79) and freezing point (-0,5411 and -0,5376H), lactose (4,34 and 4,50%), total
solids (11,65 and 11,90%), LogCCS (2,44 and 2,34), crude protein (3,08 and 3,14%), true
protein (2,84 and 2,91%), casein content (2,01 and 2,13%) and casein:true protein ratio (0,70
and 0,72). Effect of breed and seasonality on milk ethanol stability test was observed. The
milk from Holstein-Zebu and from dry season was less stable than milk from Holstein cows
and from rainy season. No effect of -lactoglobulin polymorphism was observed on milk
stability.

Key words: Dairy cow. Milk composition. Milk stability. Protein. -lactoglobulin.
LISTA DE ABREVIATURAS

LG - lactoglobulina

CCS contagem de clulas somticas

DNA cido desoxirribonuclico

EPM erro padro da mdia

H graus hortvet

LOGCCS logartimo da contagem de clulas somticas

NNC nitrognio no-caseinoso

NNP nitrognio no-protico

NT nitrognio total

NUL nitrognio urico do leite

D graus dornic

GL graus gay lussac

PB protena bruta

PCR reao em cadeia de polimerase

PH potencial de hidrognio

PT protena total

PV protena verdadeira

RFLP restriction fragment length polymorphism


14

1 INTRODUO

O leite composto por gua, suspenso coloidal de protenas ligadas ao Ca e P,

emulso de glbulos de gordura, soluo de lactose, sais minerais e vitaminas. um alimento

altamente perecvel, cujas caractersticas fsicas, qumicas e microbiolgicas originais so

passveis de alteraes desde a fase de produo primria at o processamento industrial. Por

isso, o estudo dos fatores que alteram a composio e as caractersticas fsico-qumicas do

leite tem grande relevncia para a indstria de laticnios e para os produtores, pois esta a

matria-prima essencial para a fabricao de vrios derivados lcteos.

A identificao de genes polimrficos que codificam as principais protenas do leite,

dentre elas as casenas (s1- e s2-, e kappa), a -lactoglobulina e -lactalbumina, pode

permitir uma melhor compreenso do comportamento do leite durante o processamento pela

indstria. As variantes genticas das principais protenas, em particular as fraes -casena e

-lactoglobulina, influenciam em maior ou menor grau a composio e/ou o comportamento

tecnolgico do leite (PATERSON et al., 1999).

Devido ao padro autossmico de transmisso destes genes, a seleo de vacas de

gentipo especfico praticvel para a obteno de uma variante desejvel (DEBELJAK et

al., 2000), portanto, existe grande interesse no uso dos genes que codificam estas protenas do

leite como marcadores para a produo com vistas alterao da composio e melhoramento

de suas propriedades fsico-qumicas, vislumbrando a produo de derivados lcteos

especficos.

Entretanto, os resultados do grande nmero de estudos realizados acerca das relaes

existentes entre produo de leite e as variantes genticas para -lactoglobulina ainda so

inconsistentes por diversas razes que incluem o tamanho reduzido das populaes sob

estudo, raas dos animais, pequenas freqncias de algumas variantes genticas, e o mais
15

importante, o rigor da anlise estatstica para o ajuste dos fatores que contribuem para a

produo de leite (NG-KWAI-HANG, 1997).

Muitos estudos demonstraram que o leite de animais da variante A da -lactoglobulina

contm maiores concentraes de protena total e -lactoglobulina, porm menores de casena

e gordura. De acordo com Ng-Kwai-Hang (1998), a estabilidade das micelas de casena e a

estabilidade trmica da -lactoglobulina so influenciadas pelo polimorfismo gentico dessas

protenas. O gentipo B para -casena e -lactoglobulina est associado com melhores

propriedades de coagulao, como firmeza e tempo de formao do cogulo. Na fabricao de

queijos, prefervel a utilizao de leite proveniente de animais com gentipo B para -

casena e -lactoglobulina, j que a produo de queijos ser favorecida em termos de

qualidade quando comparada ao leite proveniente de animais com a variante A (NG-KWAI-

HANG et al., 2002).

Portanto, como os vrios fentipos de -lactoglobulina esto associados com

diferenas na composio do leite, o conhecimento das freqncias destes fentipos torna-se

especialmente importante (HILL et al., 1996). Alm disso, a habilidade do leite bovino em

resistir a temperaturas relativamente altas durante seu processamento industrial uma

caracterstica fortemente associada a uma srie de fatores de composio do leite, e o efeito

das variantes genticas da -lactoglobulina sobre tal habilidade ainda no apresenta resultados

conclusivos (HILL et al., 1997), o que justifica a investigao do polimorfismo gentico desta

protena e seus possveis efeitos sobre a estabilidade trmica do leite.

Dessa forma, a hiptese do presente estudo a de que a ocorrncia de polimorfismo da

-lactoglobulina esteja associada com alteraes na composio e na estabilidade do leite de

vacas Holandesa e Girolanda, e que essas alteraes tenham comportamentos diferentes entre

as estaes chuvosa e seca.


16

2 REVISO DE LITERATURA

2.1 Efeitos da nutrio sobre a composio do leite

As caractersticas de composio do leite do leite so de importncia considervel para


o produtor, para a indstria e o consumidor. De forma geral, existem trs alternativas
principais para alterar a composio do leite: por meio da nutrio e manejo da vaca,
explorando as variaes de raas e melhoramento gentico, e pela aplicao de processos
industriais de adio ou remoo de componentes (WALKER et al., 2004). As alteraes no
manejo alimentar e o balanceamento de dietas so responsveis principalmente por mudanas
nas concentraes de gordura e protena do leite, e que possibilitam o mais rpido efeito sobre
estes componentes ainda na propriedade leiteira, considerando animais de uma mesma raa e
potencial produtivo. Alm disso, o consumo de matria seca, qualidade e digestibilidade da
fibra e a relao energia/protena da dieta so os principais fatores nutricionais que afetam a
composio do leite (SANTOS e FONSECA, 2006) .
Como nas regies tropicais muito comum o uso de pastagens na alimentao de
ruminantes, a baixa densidade de nutrientes e a reduzida digestibilidade da fibra limitam
consideravelmente o consumo de matria seca durante a poca menos chuvosa (SANTOS
e FONSECA, 2006), levando a um balano energtico negativo, queda de produo e
incremento no contedo de gordura. Por outro lado, estas alteraes na frao dos
carboidratos estruturais da dieta reduzem a concentrao de protena no leite (PONCE et al.,
1999). J a ingesto de dietas com alto teor de concentrados, ou com fontes de carboidratos
mais fermentveis no rmen favorecem a produo de protena no leite (THEURER et al.,
1999).
Alm disso, fatores dietticos como nvel e tipo da fonte de nitrognio contribuem
para a variao na proporo de casena como parte da protena verdadeira do leite de bovino
(COULON et al., 1998). Em uma srie de experimentos realizados na Frana, Coulon et al.,
(2001) observaram que a suplementao de protenas com melhor balano de aminocidos
aumentaram significativamente a relao casena:protena total no leite de vacas das raas
Holandesa, Montbliarde e Tarentaise.
17

O sistema de manejo extensivo est associado menor produo de leite e, assim


como baixas concentraes de gordura e protena, desencadeadas pela menor disponibilidade
de matria-seca ao animal, em situaes sazonais nas quais o pasto no possui caractersticas
adequadas (BARGO et al., 2002). O'Brien et al., (1999) investigaram os efeitos das condies
e taxa de lotao do pasto durante o ano sobre a composio do leite, bem como suas
caractersticas de processamento, e concluram que, tais variveis so evidentemente afetadas.
Os autores verificaram que a adoo de suplementao com concentrado em animais sob
pastejo aumenta os teores de casena e protenas do soro na protena total, mas no altera de
forma significativa as caractersticas de processamento, exceto a prova de estabilidade ao
lcool. De acordo com Depeters e Cant (1992), o leite de vacas submetidas ao sistema de
pastagem ad libitum tem um acrscimo de contedo protico e de produo quando
comparado ao de animais submetidos ingesto restrita.
Naturalmente que alm das condies, o tipo de pastagem fornecido aos animais
influencia no somente os teores, mas a composio dos componentes do leite. Bugaud et al.,
(2001a) estudaram o perfil de cidos graxos do leite de vacas alimentadas em pastos de
leguminosas e verificaram que o leite produzido continha uma maior quantidade de cidos
graxos poli-insaturados de cadeia longa quando comparado ao leite de vacas submetidas
exclusivamente ao regime de pastagem em gramneas.
Em relao s fraes nitrogenadas do leite, Bugaud et al., (2001b), trabalhando com
diferentes tipos de pastagem e dois grupos de vacas com diferentes potenciais genticos para
teor de protena no leite, verificaram que ambos os grupos apresentaram aumento na produo
de leite e de protena, mas apresentaram diferenas significativas de apenas 0,5% na relao
casena:protena total. De acordo com Banks (2000), o contedo protico apresenta aumento
com a alterao da relao forragem:concentrado, mas o teor de casena uma caracterstica
de difcil manipulao por meio da dieta.
Ainda em relao s fraes nitrogenadas do leite, as modificaes na composio
podem ocorrer em funo do teor protico e de uria fornecidos na dieta, cuja utilizao
alternativa para diminuio de custos de produo na propriedade leiteira (AQUINO, 2005).
Santos et al., (1998) relataram que a substituio, parcial ou total da protena verdadeira da
rao por uria, em um total de 23 comparaes, no afetou a produo de leite em 20 destas
e aumentou o teor de protena em cinco, sem alteraes nas concentraes de nitrognio
urico do leite.
A concentrao de nitrognio urico no leite demonstra principalmente a adequao da
relao entre o nitrognio e a energia da dieta (BRODERICK e CLAYTON, 1997).
18

Entretanto, a alteraes na concentrao de uria do leite podem advir de fatores como:


produo leiteira, idade da vaca, estgio de lactao (CARLSSON et al., 1995), peso vivo
(JONKER et al., 1998) e sistema de pastejo (GIELEN et al., 1989). As percentagens de
protena (JONKER et al., 1999) e gordura do leite (JONKER et al., 1998) tambm tm sido
associadas concentrao de NUL.

2.2 Efeitos da sazonalidade sobre a composio protica do leite.

A variao sazonal da temperatura, luminosidade e precipitao pluviomtrica, exerce


importante efeito, direta ou indiretamente, sobre a produo de leite, gordura e protenas, as
quais tm sido descritas em diversos pases.
Sargeant et al., (1998) observaram efeitos da sazonabilidade sobre a produo de leite
e de seus componentes e sendo que as porcentagens de protena total e gordura foram
influenciadas pela sazonalidade, com menores porcentagens durante os meses de vero e
maiores durante os de inverno.
Banks (2000) aponta que a gordura e a casena apresentam tendncias sazonais
distintas de variao, fato este que leva, por exemplo, diferenas substanciais na produo
de queijo durante o ano. Tais tendncias so resultados de fatores fisiolgicos da prpria
lactao, disponibilidade e tipo de alimento, fatores ambientais e todos tm implicaes sobre
o contedo de gordura e as relaes proporcionais de casena sobre o nitrognio total.
Depeters e Cant (1992) e Depeters e Ferguson (1992), verificaram que altas
temperaturas ambientais reduziam o contedo de protena total e promoviam diminuio de
consistncia de cogulo do leite proveniente de rebanhos submetidos a tal condio. Os
autores citam ainda que a quantidade de protena bruta do leite, proveniente de quatro raas
leiteiras diferentes, foi menor no vero e maior no inverno.
Allore et al., (1997) evidenciaram diferenas na composio e qualidade do leite de
rebanhos norte-americanos durante as estaes do ano na regio nordeste dos E.U.A.,
ressaltando que a rea geogrfica tambm produziu efeitos sobre a produo, composio e
qualidade do leite.
Auldist e Hubble (1998), buscando avaliar os efeitos ocasionados pela estao do ano
e o estgio da lactao dos animais na composio do leite de rebanhos da Nova Zelndia,
verificaram que a poca do ano foi o principal efeito sobre os componentes do leite de
19

interesse industrial (propores de casena:protenas do soro, nitrognio caseinoso:nitrognio


total e protena:gordura).
Lacroix et al., (1996), objetivando determinar as variaes regionais e sazonais sobre
as fraes de nitrognio e seus efeitos na relao casena:protena total e protena verdadeira
em leite destinado a produo de queijo no Canad, encontraram diferenas pequenas, porm
significativas entre as regies consideradas e estaes do ano. De acordo com os autores, os
efeitos sazonais foram as maiores fontes de variao (10 vezes maior que os efeitos regionais
observados). Paquin e Lacroix (1994), tambm avaliando os efeitos das variaes regionais e
sazonais sobre as diferentes fraes de nitrognio no leite, observaram que estas sofreram
alteraes, porm no apresentaram um padro de variao definido.
Teixeira et al., (2003) estudaram os efeitos do ms do ano, estgio de lactao, idade
da vaca ao parto, poca de parto e grupo racial sobre a composio e a contagem de clulas
somticas do leite de vacas da raa Holandesa no Estado de Minas Gerais e constataram que a
produo aumentou da primeira para as demais lactaes, porm as porcentagens de protena
e gordura no variaram. Os efeitos do estgio de lactao e ms do ano sobre as porcentagens
de gordura e protena do leite foram significativos, sendo que flutuaes sazonais das
porcentagens de gordura e protena seguiram tendncias opostas observada para produo
de leite: maiores nos meses de inverno (poca seca) e mais baixas nos meses de vero (poca
chuvosa). As porcentagens de gordura e protena permaneceram relativamente constantes com
o aumento da idade ao parto.
20

2.3 Fatores genticos que influenciam a composio do leite

Aspectos associados variao na composio do leite podem ser atribudos s


diferentes variaes genticas observadas entre as espcies, raas, e mesmo entre indivduos
de uma mesma espcie. Estudos no campo da biologia molecular tm permitido mapear e
identificar os genes responsveis por essa variao no leite. At ento, os casos mais
intensamente investigados para compreender a variao de composio entre os leites se
referem aos genes que codificam as protenas do leite. Polimorfismos nestes genes causam
diferenas na composio e no teor de protena, ambos afetando a composio do leite e suas
propriedades tecnolgicas (Goddard, 2001).
Diversos relatos demonstram que as principais protenas do leite - -s1, -s2 (MAHE
et al., 1999), e casenas (ONER e ELMACI, 2006), a -lactoglobulina (MOLINA et al.,
2006) e -lactalbumina (BLECK e BREMEL, 1993) -, apresentam diferenas de composio
de aminocidos em funo dos polimorfismos observados entre os genes que as codificam,
mesmo entre indivduos de uma mesma raa. Existem aproximadamente 40 diferentes
variantes genticas j identificadas para os loci gnicos que codificam as principais protenas
do leite, e diferenas considerveis tambm foram observadas nas distribuies das
freqncias allicas, mesmo entre indivduos da mesma raa (DOVC, 2000).
No caso das raas bovinas europias Bos taurus e dos genes que codificam a protena
-lactoglobulina, por exemplo, as variantes genticas predominantes so a A e B, com a
variante C sendo encontrada em baixas freqncias na raa Jersey (HILL et al., 1997).
Dentre as raas zebunas Bos indicus estudadas no Brasil por Silva e Del Lama (1997),
observou-se a predominncia das variantes genticas A e B da beta-lactoglobulina de animais
Gir, Guzer e Nelore.
Esses genes e suas variantes tm sido associados s alteraes quantitativas e
qualitativas de outros componentes alm das protenas e de caractersticas fsico-qumicas,
tecnolgicas e de estabilidade do leite (NG-KWAI-HANG, 1997). Por exemplo, em reviso
acerca dos efeitos do polimorfismo das principais protenas do leite sobre produo,
composio e propriedades tecnolgicas do leite, Ng-Kwai-Hang (1998) observou que muitos
estudos demonstraram que o leite da variante A de -lactoglobulina contm maiores
concentraes de protena bruta e de -lactoglobulina, mas teores menores de casena e
gordura. As variantes C e B, da -s1 e casenas, respectivamente, de acordo com aquele
autor, esto associadas com maiores porcentagens de gordura, protena e casena, quando
21

comparadas com a variante A. Ainda, para o locus gnico da -casena, o leite da variante B
foi associado maiores concentraes de gordura, protena e -casena do que a variante A.
Alm disso, a estabilidade das micelas de casena e desnaturao pelo calor da -
lactoglobulina, e as propriedades de coagulao e firmeza de cogulo, caractersticas
importantes para a fabricao de queijos, so fatores fortemente influenciados pelo
polimorfismo destas protenas.
Entretanto, polimorfismos nos genes que codificam as protenas do leite tm sido
associados a outras variaes na composio do leite que no so conseqncias diretas das
diferenas estruturais e de concentrao destas protenas, mas ligadas aos mecanismos de
regulao da sntese lctea (GODDARD, 2001), fatores que no sero discutidos no presente
estudo.
Portanto, o mapeamento e identificao de genes responsveis por estas variaes tm
permitido a compreenso das diferenas existentes entre as caractersticas e os componentes
de maior importncia econmica e de processamento industrial do leite (ROTHSCHILD;
SOLLER, 1999).
Este campo de estudo permite, ainda, o desenvolvimento de estratgias para a seleo
assistida de animais por marcadores, possibilitando o aumento da produo de leite e melhoria
das caractersticas fsico-qumicas, com vistas industrializao de lcteos (DAVIS, 2005),
alm de aumentar a rapidez e dinamismo no processo decisrio quanto ao uso ou excluso de
um animal para reproduo (MEDRANO e AGUILARCORDOVA, 1990).

2.4 Beta-lactoglobulina

De acordo com Fox e Mc Sweenwey (1998), cerca de 20% da protena total do leite

bovino pertence um grupo de protenas genericamente chamado de soro, protenas do soro

ou nitrognio no-caseinoso. Quando o leite submetido a pH = 4,6 ou soluo saturada de

NaCl, estas protenas permanecem em soluo. Esta soluo protica, quando submetida

soluo saturada de MgSO4 gera um precipitado referido como lactoglobulina e uma soluo

protica, chamada lactalbumina.

A frao de lactoglobulina consiste principalmente de imunoglobulinas. A frao de


lactalbumina do leite bovino contm a -lactoglobulina, a -lactalbumina e a albumina srica.
22

A -lactoglobulina representa cerca de 50% da protena do soro e 12% da protena total no


leite bovino (FOX e MC SWEENWEY, 1998) e, desde sua cristalizao por Palmer1 (1934),
foi usada como modelo protico para compreenso dos mecanismos de desnaturao e ligao
entre protenas e ons (FORMAGGIONI et al., 1999). A -lactoglobulina no est presente na
secreo lctea de todos os mamferos: no leite humano e de roedores, por exemplo, esta
protena no encontrada. Alm disso, sua funo biolgica ainda no bem conhecida.
Acredita-se que a -lactoglobulina tenha um papel no metabolismo do fosfato na glndula
mamria, e no transporte da vitamina A e outros molculas hidrofbicas como os cidos
graxos no trato gastrintestinal de neonatos (KONTOPIDIS et al., 2004). Sua sntese ocorre
nas clulas epiteliais da glndula mamria sob regulao da prolactina (LARSON,
1979).
A -lactoglobulina consiste de uma seqncia de 162 resduos de aminocidos
(HAMBLING et al., 1992) com peso molecular de 18,4 kDa, sendo primeiramente
seqenciada por Braunitzer et al., (1972), e completamente genotipada por Alexander et al.,
(1993). A protena se apresenta em dmeros, mas se dissocia em monmeros quando ocorre
sua desnaturao (KONTOPIDIS et al., 2004). Os agentes desnaturantes da -lactoglobulina
podem ser lcalis, o calor, compostos orgnicos ou ons de metais pesados. Entretanto, ainda
no claro o mecanismo pelo qual esses agentes atuam sobre a protena, produzindo
agregados insolveis. Alm disso, a -lactoglobulina apresenta reatividade com outros
componentes do leite, como por exemplo, a -lactalbumina e a -casena (JOST, 1993).
Aschaffenburg e Drewry (1955) demonstraram pela primeira vez, por meio de
eletroforese em papel, em pH 8,6, a existncia de duas formas distintas de -lactglobulina
provenientes do leite de duas novilhas gmeas. De acordo com Formaggioni et al., (1999), 12
variantes genticas (de A a J, W e Dr) j foram identificadas em bovinos.
Entre as raas da espcie bovina de maior interesse na explorao leiteira, as variantes
A, B e C so predominantemente investigadas e caracterizadas at ento. As diferenas na
seqncia dos 162 aminocidos, nas posies 59, 64 e 118, que constituem as variantes A, B e
C da -lactoglobulina so ilustradas na figura 1.

1
PALMER, A. H. The preparation of crystalline globulin from the albumin fraction of cows milk. Journal of
Biological Chemistry, v. 104, p. 359-372, 1934.
23

- Posio dos aminocidos variveis


Lg 57 58 59 60 61 62 63 64 65 66... 116 117 118 119 120
A Leu Leu Gln Lis Trp Gln Asn Asp Glu Cis... Ser Leu Val Cis Gln
B Leu Leu Gln Lis Trp Gln Asn Gli Glu Cis... Ser Leu Ala Cis Gln
C Leu Leu His Lis Trp Gln Asn Gli Glu Cis... Ser Leu Ala Cis Gln

Figura 1 - Comparao entre as seqncias de aminocidos das variantes A, B e C da -


lactoglobulina, nas posies onde se verificam as diferenas

As diferenas entre os gentipos polimrficos de -lactoglobulina se expressam em


pequenas variaes, quanto estrutura primria das protenas que codificam. Contudo, essas
variaes estruturais podem estar associadas a propriedades fsico-qumicas
significativamente diferentes (HILL et al., 1996).

2.5 Efeitos do polimorfismo da -lactoglobulina sobre as caractersticas fsico-qumicas e


de composio do leite

Poucos trabalhos demonstraram associao entre os componentes do leite de menor


interesse econmico, como citrato, clcio e fosfato (ALEANDRI et al., 1990; DEVOLD et al.,
2000; CELIK, 2003), com as variantes genticas da -lactoglobulina. Em contrapartida, h
um maior nmero de estudos que identificaram associao entre a composio do leite,
principalmente a protena e gordura, e as diferentes variantes genticas para -lactoglobulina (
BOBE et al., 1999, 2004; CELIK, 2003; HILL et al., 1996; LODES et al., 1997; LUNDEN et
al., 1997; MOLINA et al., 2006; NG-KWAI-HANG, 1997,1998). Por exemplo, o leite de
vacas do gentipo AA de -lactoglobulina apresentou 28% mais protena do soro, 7% menos
casena, 11% mais gordura e 6% a menos de slidos totais que o leite das vacas do gentipo
BB (HILL, 1993). Robitaille et al. (2002) tambm observaram maior proporo (20,5%) de -
lactoglobulina no soro, menor de -lactalbumina (25%), e uma tendncia menor
concentrao de casena no leite de animais AA, em relao aos animais de gentipo BB para
-lactoglobulina. Por outro lado, Lunden et al., (1997) encontraram efeito aditivo positivo do
alelo B para -lactoglobulina sobre o contedo de casena e na relao casena:protena total.
24

Lodes et al., (1997) observaram que o gentipo BB estava associado com maiores
teores de casena e gordura no leite. Bobe et al., (1999) tambm verificaram que o leite de
vacas do gentipo BB de -lactoglobulina apresentou maior rendimento na produo de
queijos e estava associado a maiores concentraes de cidos graxos, os quais tm maiores
implicaes na textura e caracterizao sensorial de produtos lcteos (BOBE et al., 2004). Ng-
Kwai-Hang (1998), contudo, no encontrou diferenas significativas de rendimento de queijos
produzidos a partir de leites de animais com gentipos AA, AB e BB para -lactoglobulina, a
despeito de observar que a recuperao de gordura e protena no queijo ter sido superior para
leites de gentipo BB, uma vez que as perdas no soro foram menores.
Em reviso acerca da associao entre os diferentes gentipos das protenas do leite e
a capacidade de produo de queijos, Lawrence (1997) relatou uma correlao positiva entre
as concentraes de casena total e gordura, e a diminuio de freqncia de apario do alelo
A para -lactoglobulina. Ainda sobre este aspecto, o autor relata que a maior parte das
pesquisas na rea aponta que os gentipos B para -lactoglobulina esto associados a uma
maior concentrao de casena total e de gordura no leite.
A frao nitrogenada do leite uma caracterstica particularmente importante para a
fabricao de derivados lcteos, j que a casena a principal responsvel pelo rendimento de
fabricao de queijos (EMMONS et al., 2003). Hill et al. (1997) relatam que o rendimento em
base seca foi 6% maior nos queijos produzidos a partir de leites com fentipo BB em
comparao aos de fentipo AA e 3% maior do que os fabricados a partir de leite de tanque.
As perdas de casena durante o processamento tambm foram menores quando o leite possui
fentipo BB. Entretanto, Marziali e Ng-Kwai-Hang (1986) descreveram melhores tempos de
coagulao e firmeza de cogulo para gentipos AA da -lactoglobulina quando comparados
com BB e AB, devido principalmente s maiores concentraes daquela protena no leite.
Molina et al. (2006) verificaram interao entre as variantes genticas de -casena e
-lactoglobulina, com combinao mais favorvel entre a -casena A e -lactoglobulina AA,
e -casena B e -lactoglobulina AB para o contedo protico do leite de animais da raa
Holandesa.
Um nmero reduzido de trabalhos associa as diferentes expresses fenotpicas da
composio do leite dos gentipos da -lactoglobulina aos fatores ambientais aos quais os
animais esto submetidos. Mackle et al., (1999) investigando os efeitos de esquemas
nutricionais sobre a composio do leite de vacas com diferentes gentipos para -
lactoglobulina, verificaram que a interao entre estes dois fatores teve importante efeito
sobre as propriedades tecnolgicas do leite. Tais efeitos, de acordo com os autores, foram
25

dependentes do gentipo da -lactoglobulina em questo, que notadamente afetaram algumas


fraes proticas do leite. Os autores observaram diferenas de 5,4% e 11,9% de protena
bruta do leite entre os esquemas nutricionais adotados (ingesto restrita de pasto ou
suplementados com concentrado) para os animais -lactoglobulina AA e BB,
respectivamente. Verificaram tambm uma diferena de 19,2% na frao de casena no leite
dos animais AA, quando submetidos aos dois manejos nutricionais, e uma diferena de 45,0%
na frao de casena no leite dos animais BB.
Auldist et al. (2000), buscando determinar se as diferenas na composio do leite de
animais com diferentes gentipos para -lactoglobulina esto relacionadas com ingesto de
matria seca, submeteram 22 vacas Holandesas de gentipos AA e BB para -lactoglobulina
ingesto restrita de pasto ou ad libitum. Os autores observaram que, comparadas aos animais
submetidos ao pastoreio restrito, vacas submetidas ao pastoreio ad libitum produziram leite
com maiores concentraes de casenas e protenas do soro, independentemente do gentipo.
Entretanto, comparaes entre os diferentes gentipos, isolados os efeitos da ingesto de
matria seca, permitiram aos autores verificar maior concentrao de casena e
casena:protena do soro no leite de animais BB, comparado ao de vacas de gentipo AA.
Puderam concluir, portanto, que no h evidncias de interao entre os efeitos dos gentipos
de -lactoglobulina e a disponibilidade de pasto sobre a composio do leite, j que as
diferenas de composio entre os gentipos persistiram sob os dois regimes de pastoreio aos
quais os animais foram submetidos.
Reforando esta ausncia de relao entre alimentao e a expresso qualitativa dos
genes na composio do leite, Bobe et al., (1999) e Bobe et al. (2004) observaram que os
gentipos das variantes para -casena e -lactoglobulina contribuem com a maior varincia
fenotpica observada na composio protica e de gordura do leite, independentemente dos
manejos nutricionais adotados. De acordo com os pesquisadores, isolados os efeitos da
alimentao, os gentipos de -casena e -lactoglobulina contriburam com mais de 25% da
varincia fenotpica encontrada para as protenas -casena e -lactoglobulina,
respectivamente. Ainda, as variantes genticas de -casena justificaram 10,5% da diferena
nas propores de s1-casena na protena total e, as variantes de -lactoglobulina, 4,3% e 6%
das diferenas observadas entre as propores de s1- e -casenas, respectivamente, na
protena total. Os autores concluram que as diferentes dietas ministradas produziram efeitos
mnimos na composio protica do leite.
No que tange a composio de cidos graxos, os resultados obtidos por Bobe et al.,
(2004) sugerem que as variantes genticas com o alelo B, tanto para -casena quanto para -
26

lactoglobulina, esto associadas com maiores concentraes de cidos graxos de cadeias


curtas (14:0, 16:0 e 16:1), e menores de cidos graxos de cadeias longas (18:0 e 18:1), quando
comparados ao alelo A.
Anteriormente, Ojala et al., (1997), acompanhando a lactao de 916 vacas da raa
Holandesa e 116 da raa Jersey, observaram que as diferenas entre os gentipos de -
lactoglobulina no produziram efeitos significativos sobre a composio do leite de ambas as
raas. Entretanto, os autores observaram que a variao fenotpica verificada no leite dos
animais 4% a mais de produo de protena e 3% a mais de gordura - se justificaria pelo
efeito exercido pelos loci gnicos das kappa e -casenas, e no por influncia do gene da -
lactoglobulina.
A modificao do contedo protico do leite atravs de manipulao gentica
apresenta, de certa forma, resultados mais rpidos (LAWRENCE, 1997), mesmo a expensas
de um menor volume produzido, j que existe correlao gentica negativa entre composio
e produo de leite. Essa possibilidade de alterao da composio protica por meio da
explorao de genes especficos para uma determinada caracterstica fsico-qumica ou de
composio vem se tornando cada vez mais freqente dentre os programas de seleo.
Revisando acerca do assunto, Litwinczuk et al., (2006) relatou que a maioria dos estudos
indicam maiores teores de protena bruta e casena no leite de vacas BB para -lactoglobulina
e -casena. Entretanto, este gentipo de -casena tambm estava, de acordo com o autor,
associado a menores produes de leite e tempo de coagulao.
Kay et al., (2005), avaliando os efeitos do perodo de lactao e da seleo gentica
para produo de leite sobre a composio dos cidos graxos do leite de vacas Holandesa,
verificaram que, apesar da seleo gentica para produo no ter afetado os teores de
protena, lactose e gordura, alterou a composio das fraes da gordura lctea. Os autores
observaram que os animais selecionados produziram leite com menores teores de cido
graxos mono-insaturados, comparados ao grupo controle.

2.6 Estabilidade trmica do leite

Na indstria processadora, o leite submetido algum tipo de tratamento trmico


durante o processamento (FOX e MC SWEENWEY, 1998), cujo efeito sobre seus
componentes (protenas, lipdios, acar e minerais) de grande importncia para a
27

caracterizao do produto final. Tais componentes passam por modificaes que afetam a
qualidade sensorial e nutricional do leite (MORALES et al., 2000).
A estabilidade trmica do leite se refere habilidade do leite bovino resistir a
temperaturas altas de processamento sem apresentar coagulao ou geleificao visveis
(SINGH, 2004), sendo esta uma caracterstica especialmente importante para indstria lctea.
Esta estabilidade definida como sendo o tempo necessrio para o aparecimento de
coagulao visvel em pH e temperatura definidos.
As principais variveis que influenciam a estabilidade trmica do leite ou a
manuteno da estabilidade coloidal so: tempo de armazenamento, temperatura, pH,
equilbrio salino, teor de uria, estabilidade das micelas de casena, perodo de lactao,
manejo alimentar, e sanidade da glndula (SILVA e ALMEIDA, 1998; SINGH, 2004).
O mtodo atualmente mais utilizado para se determinar estabilidade trmica do leite
aquele, no qual amostras de leite so submetidas a provas de aquecimento controlado entre
130C e 140C, at a observao de coagulao (SINGH, 2004). O tempo de coagulao
trmica do leite aquele entre o aumento de temperatura das amostras e a observao da
coagulao, indicada por floculao, gelatinizao ou alteraes nas caractersticas fsicas de
sedimentao protica (FOX e MC SWEENEY, 1998). Outros mtodos utilizados para
estimar a estabilidade trmica incluem a prova de resistncia ao lcool, sedimentao de
protena e determinao da viscosidade da amostra. Entretanto, as correlaes entre os
diferentes mtodos so de forma geral insatisfatrias, e o tempo de estabilidade obtido nos
diferentes testes no corresponde s caractersticas observadas, quando da esterilizao
comercial do leite (SINGH, 2004). Dentre as protenas do leite, as protenas do soro so as
mais termolbeis e a ordem de instabilidade trmica inicia-se pelas imunoglobulinas, -
lactoglobulina e por fim a -lactalbumina.
De acordo com Hambling et al., (1992), os efeitos do calor sobre a -lactoglobulina na
presena de outros componentes do leite demonstraram que a lactose estabiliza a -
lactoglobulina contra a desnaturao trmica, enquanto que a interao entre a -casena e a -
lactoglobulina desestabiliza a mesma, provavelmente devido ao envolvimento do grupo tiol,
as pontes dissulfeto e o on Ca2+.
Entretanto, de acordo com Imafidon et al., (1991) e Fox e Mc Sweenwey (1998), a
explicao corrente para a maior ou menor estabilidade trmica do leite e a propenso
ocorrncia de coagulao recai essencialmente sobre a -casena. Esta protena dissocia-se das
micelas quando o leite aquecido; em pH abaixo de 6,7. A -lactoglobulina reduz a
dissociao da -casena, enquanto que em pH acima deste valor, a -lactglobulina acentua a
28

dissociao da -casena. De acordo com Singh (2004), o comportamento trmico das


protenas do soro ditado, principalmente, pelas propriedades da -lactoglobulina que, por
sua vez, so afetadas pelo pH do meio, concentrao de lactose, teor de cloretos, ons de
clcio e outros. Alm disso, de acordo com o autor, a formao do complexo -
lactoglobulina -casena na superfcie da micela de casena que altera as interaes
estericas e eletrostticas da superfcie micelar e previne a dissociao da casena.
Law et al., (1994) observaram que a extenso da desnaturao das protenas do soro
aumentaram com temperaturas que variavam entre 72C e 140C, com perodos de espera de
15 segundos 5 minutos. No primeiro minuto, as imunoglobulinas eram mais afetadas sob
temperaturas entre 72C e 90C, enquanto que a -lactoglobulina sofria alteraes entre 72C
e 120C, e a -lactalbumina entre 72C e 140C. Os autores observaram tambm que o pH tem
efeito sobre o nvel de desnaturao destas protenas (Law, Banks et al., 1994): quando
alterado o pH do leite e (6,5 at 9,1), e em seguida, submetido ao aquecimento 90C por 30
segundos, o nvel de desnaturao da -lactoglobulina, -lactalbumina e das outras protenas
do soro foi consideravelmente aumentado, medida que se aumentava o pH.

2.7 Efeitos do polimorfismo da -lactoglobulina sobre a estabilidade trmica do leite

Por conta da estabilidade trmica do leite ser dependente de inmeros fatores, os


efeitos das variantes de -lactoglobulina sobre tal propriedade ainda no permitem resultados
conclusivos.
Mclean et al., (1987) observaram que a mxima estabilidade do leite, na relao tempo
de coagulao sob calor versus pH, afetada pelo gentipo da -lactoglobulina, e seguem o
seguinte padro: AA>AB>BB. Robitaille (1995), trabalhando com animais da raa
Holandesa, verificou ainda que tal padro de coagulao s era observado quando o animal
detinha tambm o gentipo AA para -casena. Em contrapartida, Paterson et al., (1999),
utilizando vacas Jersey, Holandesa e o cruzamento entre as duas raas, relataram que a
combinao entre os gentipos AA para -lactoglobulina e para -casena, produziram leites
de menor estabilidade na curva tempo de coagulao sob calor versus pH, apesar de
produzirem leites mais estveis quando somente o tempo de coagulao sob calor era
considerado. Os autores citam que a combinao AABB para os gentipos de -
lactoglobulina e -casena, respectivamente, estava associado com maior estabilidade do leite.
29

Para o leite bovino, a maior estabilidade trmica obtida no pH fisiolgico do leite


notadamente como resultado da interao entre a -lactoglobulina e -casena na superfcie da
micela (MORGAN et al., 2001), e tal interao fundamental para compreender as
modificaes ocorridas pelo calor observadas nos produtos lcteos (CHO et al., 2003).
O'connell et al., (2001) demonstraram que a -lactoglobulina tem um efeito bastante
especfico sobre a estabilidade trmica do leite, j que a estabilidade aumentada e reduzida,
respectivamente, nos pH 6,7 e 6,9. Buscando verificar o efeito da -lactoglobulina e da
precipitao do fosfato de clcio sobre a estabilidade trmica do leite, os autores observaram
que o efeito especfico da -lactoglobulina sobre o pH no qual se observa a mxima
estabilidade parece estar relacionado capacidade desta protena em quelar o clcio. Portanto,
maiores concentraes da -lactoglobulina no leite esto relacionadas maior
termoestabilidade do leite, uma vez que o tempo de coagulao do leite sob o aquecimento
inversamente proporcional concentrao de ctions divalentes, como Ca2+ e Mg2+.
Imafidon et al. (1991), estudando o polimorfismo gentico das protenas lcteas sobre
a estabilidade trmica da -lactoglobulina e -casena em diferentes propores e de
diferentes fentipos, observaram que o gentipo BB da -lactoglobulina produzia uma
protena mais termoestvel que os outros gentipos, inclusive em diferentes relaes de
concentraes das protenas -lactoglobulina:-casena. Verificaram ainda que, a estabilidade
da -lactoglobulina era aumentada pela presena de protenas do fentipo AA para -casena,
e diminuda quando houvesse a expresso dos gentipos AB e BB para esta protena. Sendo a
termoestabilidade da -lactoglobulina tambm dependente das concentraes de clcio, os
autores, utilizando buffer de cloreto de clcio, observaram que as combinaes entre protenas
-lactoglobulina e -casena provenientes de gentipos BBAA, respectivamente, e ABAA,
produziram os sistemas mais termoestveis, enquanto que a combinao AAAA e AABB, os
de menor termoestabilidade.
Em reviso sobre o polimorfismo gentico das protenas do leite, Ng-Kwai-Hang
(1992) aponta que a estabilidade afetada pela variante da -lactoglobulina, bem como pelo
pH e pela temperatura. De acordo com o autor, em temperaturas abaixo de 90C o leite
proveniente de animais da variante A para -lactoglobulina so mais termoestveis, enquanto
o leite da variante B tolera temperaturas superiores 90C. Ng-Kwai-Hang (1992) relatou
ainda que, variando-se o pH entre 4 e 9, o gentipo A para -lactoglobulina possui leite
menos estvel que o B, e ressalta que em pH 6,8, o leite proveniente de vacas de gentipo BB
possui uma maior temperatura de desnaturao que aqueles de animais com a variante AB e
BB.
30

2.8 Estabilidade ao lcool

A estabilidade do leite prova do etanol foi definida como a concentrao mnima de


uma soluo aquosa de lcool adicionada ao leite capaz de gerar sua coagulao (CHAVEZ et
al., 2004). O etanol conhecido por sua habilidade em reduzir a estabilidade coloidal da
micela de casena e, portanto, provocar a coagulao desta frao protica (O'CONNELL et
al., 2001).
O princpio do teste do etanol baseia-se no mecanismo de desestabilizao das
casenas pelo efeito desnaturante do lcool, que promove a reduo da constante dieltrica da
mistura, tornando-a um solvente desfavorvel, podendo chegar a um limite crtico em que
ocorra a desestabilizao e precipitao. Os principais fatores que afetam a coagulao nesse
teste so as cargas e as interaes entre as micelas, pH, concentraes do lcool e composio
do leite (HORNE e MUIR, 1990).
A prova de estabilidade ao lcool importante, pois constitui uma medida simples,
barata, eficiente e que permite rpida deteco de leite instvel, que desclassificado devido
ao aparecimento de coagulao e precipitao. O teste do lcool utilizado pelas indstrias
para avaliar a qualidade do leite nas unidades de produo leiteira, sendo as amostras
positivas rejeitadas por serem consideradas inaptas aos processos de beneficiamento
(ZANELA et al., 2006a).
Segundo Barros et al. (2000), a prova do lcool foi inicialmente utilizada pela
indstria como uma medida indireta do pH natural do leite, j que o aumento da acidez resulta
em diminuio da instabilidade, podendo provocar a precipitao da casena. No entanto, de
acordo com Oliveira e Timm (2006), a acidez em funo da fermentao da lactose por
crescimento de microrganismos mesoflicos no leite no o nico fator que provoca a
instabilidade da protena. Processos inflamatrios na glndula mamria aumentam a
concentrao de plasmina no leite (SANTOS; FONSECA, 2006), cuja ao proteoltica sobre
a casena leva diminuio da estabilidade.
Oliveira e Timm (2006), buscando determinar a composio do leite no cido e no
masttico, com instabilidade da casena frente prova do lcool a 70%, observaram que o leite
com casena instvel apresentou maiores teores de gordura e menores de lactose que o leite
com casena estvel, e sugeriram que a relao observada entre instabilidade e alteraes na
composio do leite seja devida ao manejo alimentar.
31

Por outro lado, Zanela et al. (2006a), avaliando os efeitos da restrio em 40% das
exigncias nutricionais de matria seca, protena e energia na alimentao de vacas Jersey no
Rio Grande do Sul, sobre a ocorrncia de leite instvel no-cido (LINA) e sobre a
composio do leite, concluram que a restrio alimentar aumentou a ocorrncia de
instabilidade prova do lcool a 76%, entretanto observaram que a etiologia do LINA no se
encontra associada apenas a fatores nutricionais, mas pode estar associada tambm a fatores
genticos.
32

3 OBJETIVOS

Os objetivos gerais do presente estudo foram os de avaliar o efeito do polimorfismo

gentico da -lactoglobulina sobre as caractersticas fsico-qumicas e de composio do leite.

Os objetivos especficos foram:

a) Avaliar o efeito do polimorfismo gentico da -lactoglobulina sobre a acidez, pH e

crioscopia do leite produzido por animais da raa Holandesa e Girolanda.

b) Avaliar a associao entre a composio do leite (gordura, lactose, slidos totais,

contagem de clulas somticas, uria, protena bruta, protena verdadeira, casena e

relao casena/protena verdadeira) e os diferentes gentipos de -lactoglobulina.

c) Avaliar o efeito das raas Holandesa e Girolanda e da sazonalidade sobre as

caractersticas fsico-qumicas e de composio do leite.

d) Avaliar o efeito do polimorfismo gentico da -lactglobulina, raa e sazonalidade

sobre a estabilidade do leite.


33

4 MATERIAL E MTODOS

4.1 Seleo dos rebanhos para coleta

O presente experimento foi realizado, em sua fase de coletas de amostras, na regio de

Pirassununga-SP, onde foram selecionados 11 rebanhos bovinos leiteiros comerciais, entre os

quais cinco da raa Holandesa e seis da raa Girolanda. Em mdia foram amostradas 278

vacas Holandesa e 156 vacas Girolanda em lactao, totalizando 956 vacas amostradas em

quatro perodos.

4.2 Seleo das vacas

Para seleo das vacas para amostragem foram utilizados os seguintes critrios: vacas

de primeira, segunda ou terceira lactao e entre 30 e 250 dias em lactao. Para as vacas da

raa Girolanda, foram selecionados animais com graus de sangue entre 1/2, 3/4 e 3/8

Gir/Holands. Foram excludas as vacas com alteraes visuais do leite detectveis pelo teste

de caneca de fundo escuro (mastite clnica) ou que foram submetidas ao tratamento de mastite

nas duas semanas anteriores coleta.


34

4.3 Coleta de amostras de leite e sangue das vacas

Foram coletadas quatro amostras individuais de leite das vacas em lactao dos rebanhos
selecionados, nos seguintes perodos: coleta 1 (setembro e outubro de 2003), coleta 2 (junho e
julho de 2004), coleta 3 (novembro e dezembro de 2004) e coleta 4 (ja|Vyro e fevereiro de
2005).
Para efeitos de perodo de coleta de amostras, foi definido como estao chuvosa o
perodo compreendido entre de novembro e abril, e para estao seca, os meses entre maio e
outubro.
Adicionalmente, no momento da coleta foram registradas as seguintes informaes de
cada vaca leiteira selecionada: idade, dias em lactao e regime principal de alimentao das
vacas durante o perodo de coleta (pasto, pasto com suplementao ou confinado).
As amostras individuais de leite foram coletadas durante a ordenha da manh, sendo
representativas de toda a ordenha de cada animal. As amostras individuais foram coletadas em
lato nos sistemas de ordenha balde ao p, a partir do balo de medio durante a ordenha ou
pelo uso de dispositivos de medio por fluxo e armazenadas em tubos plsticos at a
realizao das anlises. Para as anlises fsico-qumicas do leite, as amostras foram mantidas
resfriadas em recipientes trmicos com gelo em escamas at a realizao das mesmas, em no
mximo 6 horas. Para as anlises de composio do leite, realizadas por absoro
infravermelha, as amostras foram enviadas para o Laboratrio de Fisiologia da Lactao da
ESALQ USP (Clnica do Leite) em no mximo 72 horas. Para as demais anlises, as
amostras de leite foram congeladas (-20 C) at sua realizao.
Para a coleta de sangue, foram colhidos aproximadamente 10 mL da circulao
perifrica em tubo de vidro heparinizado e estril de cada animal selecionado, os quais foram
congelados a -20 C at a realizao das anlises para a determinao do polimorfismo
gentico da -lactoglobulina. Essas anlises foram realizadas no Laboratrio de Biologia e
Bioqumica Molecular na Universidade Estadual Paulista-Campus de Araatuba.
36

4.5 Metodologias para anlises

4.5.1 Composio do leite e caractersticas fsico-qumicas do leite

A composio do leite foi analisada no Laboratrio de Fisiologia da Lactao da

ESALQ USP (Clnica do Leite), sendo as concentraes de gordura, lactose, slidos totais

analisadas por absoro infravermelha, utilizando-se equipamento Bentley 2000

(BENTLEY, 1995a) e o nitrognio urico no leite (mg/dL), pelo mtodo enzimtico

espectrofotomtrico de trans-reflectncia no equipamento ChemSpeck 150 (BENTLEY,

1995b).

As caractersticas fsico-qumicas do leite - pH, acidez titulvel (Dornic) e crioscopia

foram analisadas de acordo com a metodologia descrita por Pereira et al. (2001).

4.5.2 Contagem de clulas somticas do leite

As amostras de leite foram coletadas, acondicionadas em frascos de plstico contendo

o conservante bronopol e enviadas para o Laboratrio Clnica do Leite Departamento de

Produo Animal da ESALQ-USP (Piracicaba-SP), para a realizao da contagem eletrnica

de clulas somticas por citometria de fluxo com equipamento Somacount 300 (BENTLEY,

1995b).
37

4.5.3 Determinao de estabilidade do leite

A determinao da estabilidade do leite foi realizada pela prova de resistncia ao

lcool, onde partes iguais de leite (2 ml) e solues alcolicas (DAVIES e WHITE, 1958)

foram misturadas e homogeneizadas. Os resultados variaram entre leite coagulado e no

coagulado. As graduaes alcolicas utilizadas foram 68GL, 70GL, 76GL, 80GL e 84GL,

de acordo com (DAVIES e WHITE, 1958).

4.5.4 Nitrognio total (NT)

A determinao da concentrao de protena do leite foi baseada na mensurao do NT

pelo mtodo de Kjeldahl, conforme metodologia descrita pela American Association of

Official Analytical Chemists (AOAC, 1995); mtodo nmero 33.2.11; 991.20. O nitrognio

(N) foi ento multiplicado pelo fator 6,38, para que os resultados fossem expressos em

protena bruta (PB) (BARBANO et al., 1990).

4.5.5 Nitrognio no-caseinoso (NNC)

As fraes de NNC e de casena do leite foram determinadas no leite conforme

metodologia descrita por Lynch et al. (1998). A casena do leite foi precipitada em pH = 4,6

usando-se soluo de cido actico e acetato de sdio. Aps a precipitao, a casena foi

separada por filtrao e a concentrao de N do filtrado (NNC), determinada pelo mtodo de

Kjeldahl. A concentrao de casena do leite foi obtida pela subtrao entre NT e NNC.
38

4.5.6 Nitrognio no-protico (NNP)

As fraes de NNP e de protena verdadeira do leite foram determinadas atravs de


metodologia descrita por Lynch et al. (1998), na qual a protena verdadeira do leite
precipitada em soluo de cido tricloractico a 12%. Aps a precipitao, a protena
verdadeira do leite foi separada por filtrao e a concentrao de N do filtrado (NNP) foi
ento determinada pelo mtodo de Kjeldahl. A concentrao de protena verdadeira do leite
foi obtida pela subtrao da concentrao de NT e NNP.

4.5.7 Determinao do polimorfismo gentico da -lactoglobulina

O DNA da amostra de sangue foi extrado segundo o protocolo descrito por Ciulla et
al., (1988). As amostras de DNA extradas foram submetidas amplificao por PCR
(polymerase chain reaction), os oligonucleotdeos iniciadores (primers) utilizados para tal
amplificao foram sintetizados pela Invitrogen Custom Primers (Invitrogen Corp.,
Carlsbad, Califrnia, USA), conforme seqncia descrita por Faria et al., (2000):

5ACCTGGAGATCCTGCTGCAGAAATG3
5CATCGATCTTGAACACCGCAGGGAT3

Tais primers amplificam uma regio de 961 pares de base do xon II e III do gene da
-lactoglobulina bovina. A regio amplificada possui as substituies de nucleotdeos
responsveis pela diferenciao das variantes genticas A e B. Cada reao de amplificao
consistiu de tampo para PCR 1X (KCl 500 mM, Tris-Cl pH 8.3 100 mM), 0,1 L de cada
primer (Invitrogen), 2,0 L de dNTP 0,125 mM, 0,1 L Taq Polimerase (Cenbiot/RS,
PHN/MG), 0,75 L MgCl2 (Cenbiot/RS, PHN/MG), 5,0 L de DNA e gua mili-Q qsp 25
L. Em todas as reaes de amplificao utilizou-se um controle (branco/sem DNA) para
confirmar a ausncia de contaminao na execuo da anlise. As amplificaes foram
39

realizadas em termociclador PTC 100-MJ Research (MJ Research, Inc., Watertown,


Massachussets, USA). O programa utilizado para amplificao do gene da -lactoglobulina
segue descrito: desnaturao inicial a 95C por 5 minutos seguida por 35 ciclos de 95C por 1
minuto, 57C por 1 minuto e 72C por 3 minutos com extenso final a 72 C por 5 minutos
seguida de 4C por mais 5 minutos.
Aps confirmao da amplificao das amostras, correu-se eletroforese em gel de
agarose a 2%, em cuba horizontal de acrlico com tampo de corrida TBE 1X a 100 volts por
quarenta minutos. O produto da PCR (20,0L), passou ento pelo processo de RFLP
(restriction fragment length polymorphism), sendo digerido pela enzima de restrio Hph-I,
segundo o protocolo descrito por Wilkins e Kuys (1992). A Hph-I cliva o fragmento
amplificado em 741 e 220 pares de base (pb), relativos ao gentipo AA; e 741, 220, 166 e 54
pb, relativos ao gentipo BB; ou uma combinao dos dois fragmentos, 741, 220, 166 e 54 pb,
identificando os heterozigotos AB. As amostras foram amplificadas assim como digeridas em
placas prprias para PCR. Dessa forma, a presena de um de animal AB em cada placa
demonstrava que a reao de digesto do material havia ocorrido sendo desta forma o controle
do processo de digesto. Aps a identificao dos polimorfismos do gene da -lactoglobulina
bovina por meio da tcnica de PCR-RFLP, obtiveram-se as freqncias genotpicas e allicas
para o rebanho estudado.
40

5 RESULTADOS E DISCUSSO

5.1 Distribuio da freqncia genotpica e allica do gene da -lactoglobulina

A distribuio da freqncia genotpica e allica do gene da -lactoglobulina, em


funo das raas estudadas, est apresentada na Tabela 1.
O alelo B esteve presente em maior freqncia em relao ao A, independentemente
da raa (52,38% para a raa Holandesa e 58,85% para a Girolanda). No entanto, a freqncia
de aparecimento dos gentipos diferiu entre animais das raas Holandesa e Girolanda. Apesar
do gentipo BB ter sido o mais freqente (38,85% e 44,87%), qualquer que seja a raa
considerada, para a raa Holandesa, o gentipo AA foi o segundo maior em freqncia
(32,73%), seguido pelo AB (28,42%). Comportamento diferente foi observado para a raa
Girolanda, na qual o gentipo AB (33,97%) foi mais freqente que o AA (21,15%). A Figura
2 apresenta uma eletroforese com gel de agarose com genotipagem da -lactoglobulina
bovina.

AA AB BB

Figura 2 Eletroforese em gel de agarose para identificao das variantes genticas de -


lactoglobulina bovina (AA, AB, BB).
41

Tabela 1 - Distribuio das freqncias genotpica e allica da -lactoglobulina


para as raas estudadas
Raa Gentipo N observado N esperado 2 Freqncia allica (EPMa)
AA 91 61,25
AB 79 138,45 50,84* A = 0,47620,0211
Holandesa
BB 108 78,23 B= 0,52380,0211
Total 278

AA 33 22,69
AB 53 73,59 12,22* A= 0,41150,0278
Girolanda
BB 70 59,67 B= 0,58850,0278
Total 156
*
P<0,05, aDe acordo com Oner e Elmaci, (2006)

Considerando que as freqncias genotpicas observadas da -lactoglobulina foram


significativamente diferentes das freqncias esperadas, estimadas pelo teste de 2, as
populaes de vacas Holandesa e Girolanda estudadas no se encontram em equilbrio
gentico, de acordo com o postulado por Hardy-Weinberg (Louis e Dempster, 1987).
Os resultados referentes freqncia allica da -lactoglobulina entre os animais
estudados obedecem mesma tendncia observada por Faria et al. (2000) que, ao avaliarem o
polimorfismo gentico de animais da raa Nelore encontraram freqncias de 16 e 84% para
os genes A e B, respectivamente. Em relao freqncia genotpica obtida no presente
estudo, Faria et al. (2000) tambm observaram predominncia do gentipo BB. Resultados
semelhantes foram relatados por Silva e Del Lama (1997) ao avaliarem o polimorfismo
gentico para a -lactoglobulina em quatro raas zebunas. Estes autores concluram que para
todas as raas estudadas a freqncia do alelo B foi maior quando comparada ao alelo A
(66,9% x 33,1%, 70,3% x 29,7%, 61,4% x 38,6% e 82,4% x 17,6% para as raas Gir, Guzer,
Sindi e Nelore, respectivamente).
Neves et al. (1998) ao trabalharem com rebanhos Gir (com vacas selecionadas ou no
para produo de leite), verificaram freqncias maiores do alelo B para vacas selecionadas e
no selecionadas. Nos animais no selecionados para produo leiteira, a concentrao
genotpica dos alelos A e B so, respectivamente 44,87% e 55,13%. J nas vacas selecionadas
para produo de leite, h uma diferena maior na freqncia (35 e 65% para alelos A e B,
respectivamente), j que o alelo B est relacionado maior produo de slidos.
Ng-Kwai-Hang et al. (1986), Van Eenennaam e Medrano (1991) e Oner e Elmaci
(2006) tambm relataram maiores freqncias para o alelo B entre os animais da raa
42

Holandesa, enquanto Bovenhuis e Vanarendonk (1991) observaram maior freqncia deste


alelo entre cruzamentos de raas de interesse na pecuria leiteira da Holanda.
A freqncia genotpica nas raas europias tambm segue a mesma tendncia. Celik
(2003) tambm observou maiores freqncias do gentipo BB para o gene da -lactoglobulina
em animais da raa Holandesa (52,53%). Contudo, para vacas da raa Pardo-sua, a maior
freqncia observada foi do gentipo AB (53,79%). A freqncia do alelo B foi maior tanto
nos animais da raa Holandesa quanto nos da Pardo-sua, 73% e 56%, respectivamente,
predominantemente sob a forma dos fentipos AB e BB.
Oner e Elmaci (2006), utilizando eletroforese em gel de amido para determinar o
polimorfismo gentico de vacas Holandesas na Turquia, tambm observaram maiores
freqncias gentipicas para o gene heterozigoto AB (48,2%). Na Nova Zelndia, Paterson et
al. (1999) verificaram entre os animais da raa Jersey, que a freqncia do gentipo AB foi
maior, 43%, com predominncia do alelo B entre os gentipos estudados (53%) e, entre os
animais da raa Holandesa naquele pas, Hill et al. (1996) constataram que este gentipo
tambm se mostrou predominante (51%).
Tambm discordantes dos resultados obtidos no presente estudo, Ojala et al. (1997)
observaram em rebanhos de animais da raa Holandesa e Jersey na Califrnia, maiores
freqncias genotpicas para o gentipo AB em ambas as raas (51% e 58%), e Ng-Kwai-
Hang et al. (1990) verificaram freqncia de 49% deste gentipo entre animais da raa
Holandesa no Canad.

5.2 Efeito do polimorfismo da -lactoglobulina sobre as caractersticas fsico-qumicas e


de composio do leite
Os resultados de probabilidade dos efeitos do polimorfismo da -lactoglobulina, da
raa e da sazonalidade sobre as caractersticas fsico-qumicas e de composio do leite, bem
como as probabilidades de efeito das interaes, encontram-se na Tabela 2.
43

Tabela 2 - Probabilidade dos efeitos do polimorfismo da -lactoglobulina, da raa e da


sazonalidade sobre as caractersticas fsico-qumicas e de composio do leite e
interaes
Efeitos principais
Varivel -Lg Raa Estao do ano Estao*Raa Estao*-Lg Raa*-Lg
Dornic (D) 0,892 0,012 0,376 0,263 0,816 0,709
pH 0,287 0,001 0,008 0,487 0,076 0,737
Crioscopia(H) 0,451 0,012 0,001 0,134 0,677 0,117
Gordura (%) 0,912 0,074 0,002 0,042 0,523 0,715
Lactose (%) 0,929 0,967 0,001 0,302 0,523 0,418
Slidos totais (%) 0,609 0,193 0,001 0,351 0,435 0,448
LogCCS 0,365 0,391 0,049 0,432 0,494 0,044
Uria (mg/dL) 0,928 0,001 0,907 0,001 0,573 0,662
Protena Bruta (%) 0,166 0,537 0,039 0,589 0,221 0,181
PV (%) 0,266 0,363 0,01 0,655 0,043 0,846
Casena (%) 0,19 0,624 0,001 0,909 0,028 0,846
Relao casena/PV 0,135 0,006 0,001 0,324 0,04 0,714

No houve efeito do polimorfismo da -lactoglobulina sobre as caractersticas fsico-


qumicas e de composio do leite, em nenhuma das variveis estudadas. Foi verificado efeito
significativo da interao da estao do ano*-lactoglobulina para PV, casena e relao
casena:PV e para a interao raa*-lactoglobulina para a CCS. No houve efeito da
interao tripla para nenhuma das variveis estudadas.
A ausncia de efeito do polimorfismo da -lactoglobulina sobre a composio do leite
no presente estudo difere dos resultados obtidos por Ng-Kwai-Hang et al. (1986), Aleandri et
al. (1990), Bovenhuis et al. (1992), e Celik (2003). Celik (2003) observou diferenas
significativas na porcentagem de slidos totais (P<0,05) e gordura (P<0,01) do leite de
animais da raa Pardo-suia de gentipo BB para -lactoglobulina, comparados aos outros
dois gentipos (AB>AA). Bovenhuis et al (1992) e Aleandri et al. (1990) relataram aumento
na concentrao de gordura do leite associada -lactoglobulina B, assim como de Ng-Kwai-
Hang et al. (1986) que ao estudarem vacas da raa Holandesa observaram que animais com o
gentipo BB produziam leite com 3,76% de gordura, enquanto animais AA produziam 3,67%.
Seguindo a mesma tendncia, Hill (1993), estudando rebanhos da raa Holandesa na
Nova Zelndia, verificaram efeito das variantes genticas da -lactoglobulina sobre a
composio do leite, e observaram concentraes 11% menores de gordura e 6% menores de
slidos totais no leite proveniente de animais com gentipo AA. No presente experimento, a
despeito da ausncia de diferena estatstica, as menores mdias de gordura e slidos totais
foram observadas nos animais da raa Girolanda de gentipo AA para -lactoglobulina (3,143
44

e 11,594%, respectivamente), enquanto que os maiores valores para o gentipo BB foram


observados entre os animais da raa Holandesa (3,358 e 11,876%, respectivamente).
Em contrapartida, a variante AA foi associada por Hill (1993) a um aumento de 25 a
30% nas concentraes da protena -lactoglobulina no soro do leite, fato que justificaria o
acrscimo relativo nos teores de protena total e um decrscimo em relao frao de
casena. Observou-se no presente estudo, que as mdias para os teores de protena bruta e
casena dos animais de gentipo AA, foram para a raa Holandesa de 3,153 e 2,135%,
respectivamente e para a Girolanda de 3,178 e 2,160%, respectivamente.
Ng-Kwai-Hang et al. (1990), avaliando o efeito do polimorfismo gentico da -
lactoglobulina sobre as protenas do leite, gordura e produo durante trs lactaes, no
verificaram, de forma semelhante ao presente estudo, nenhuma relao entre a variante
gentica e estas caractersticas avaliadas.
As concentraes de protena bruta (%), protena verdadeira (%), casena (%), uria
(mg/dL), bem como a relao casena/protena verdadeira no sofreram influncia do
polimorfismo gentico para -lactoglobulina (Tabela 2). Estes resultados so similares aos
obtidos por Robitaille et al. (2002), que no encontraram diferenas significativas entre os
gentipos de -lactoglobulina e as concentraes de casena, mas apenas tendncia ao
aumento da concentrao para o leite de animais com gentipos BB. Por outro lado, Lunden
et al. (1997) relataram efeito positivo do alelo B do gene de -lactoglobulina sobre o contedo
de casena e na relao casena/protena bruta do leite de animais das raas suecas Vermelha e
Branca, e Holstein. Da mesma maneira, Coulon et al. (1998) relacionaram o aumento das
propores de casena com a variante B da -lactoglobulina. Molina et al. (2006), Bobe et al.
(1999) e Ng-Kwai-Hang et al. (1990) tambm observaram aumento nas concentraes de
protena bruta do leite quando o alelo B foi substitudo pelo alelo A. Bobe et al. (1999) e Ng-
Kwai-Hang et al. (1990) atriburam este aumento ao maior percentual de casena, e Molina et
al. (2006) ao teor de protenas do soro.
Por sua vez, Hill et al. (1996) relataram que o gentipo AA estava associado a
concentraes maiores de protena do soro (+28%) e menores de casena (-7%), quando
comparado com o gentipo BB. Nesse caso, o aumento nas concentraes de protena do soro
para o gentipo AA seria explicado pela maior concentrao de -lactoglobulina no leite de
animais que apresentavam esse gentipo, no havendo diferena nos teores de protena bruta
entre gentipos AA e BB. Bobe et al (1999) tambm verificaram maiores propores de -
lactoglobulina e menores das fraes de casena na protena total do leite de animais com o
gentipo AA para -lactoglobulina quando comparado ao de animais de gentipo BB.
45

No presente estudo, as mdias verificadas para a varivel casena:protena verdadeira


entre os animais de gentipo AA foram 0,724 para a raa Holandesa e 0,731 para a Girolanda.
De acordo com Karatzas e Turner (1997), e Fox e Mc Sweeney (1998), o teor maior de -
lactoglobulina na protena verdadeira uma caracterstica de importncia considervel, j que
essa protena, sob tratamento trmico tem forte interao com outras molculas do leite,
inclusive com a -casena.

5.3 Efeito da sazonalidade e raa sobre as caractersticas fsico-qumicas e de


composio do leite

Os resultados do efeito da sazonalidade sobre as caractersticas fsico-qumicas e de


composio do leite esto apresentados na Tabela 2 e 3. Houve efeito significativo (P<0,05)
da estao do ano sobre as caractersticas fsico-qumicas e de composio, com exceo da
gordura e uria (Tabela 3).
Os valores mdios de acidez titulvel (16,621 e 16,341D), pH (6,765 e 6,798) e
crioscopia (-0,5411 e -0,5376H) diferiram entre as estaes chuvosa e seca respectivamente,
embora se mantivessem dentro da faixa de valores normais de acordo com a Instruo
Normativa 51 (Brasil, 2002). Os valores mdios observados obedecem tendncia
semelhante verificada por Ponce e Hernndez (2001). Os autores associaram a poca seca
com a menor disponibilidade e qualidade dos alimentos fornecidos aos animais, o que limita o
fornecimento de energia ao tecido epitelial mamrio, acabando por afetar a secreo lctea,
diminuindo a acidez titulvel e incrementando o pH.
Lindmark-Mansson et al. (2003), avaliando a composio do leite de 9 produtores de
leite, geograficamente dispersos na Sucia, durante um ano, observaram efeito da
sazonalidade (P<0,001) sobre o pH (6,68 e 6,73) e crioscopia (-0,534 e -0,523C), no vero e
inverno, respectivamente. Schukken et al. (1992), buscando descrever a tendncia da variao
do ponto crioscpico do leite de tanque de aproximadamente 10.000 fazendas no Canad,
verificaram efeito significativo da sazonalidade neste parmetro. Os autores observaram ponto
crioscpico mdio maior durante o vero (junho e julho), e menor no inverno (dezembro e
janeiro).
46

Martins et al. (2006), avaliando a variao da produo e a qualidade do leite


produzido na bacia leiteira de Pelotas, RS, em diferentes meses do ano, verificaram diferenas
significativas (P<0,05) nos valores de crioscopia e acidez entre os meses avaliados. Durante
os meses mais quentes, os autores observaram valores mdios de acidez titulvel que variaram
de 16 a 17,5D, e de crioscopia que variavam de -0,536 a -0,544H.
No presente estudo, a partir dos valores observados na Tabela 3, pode-se verificar que
na estao seca o LogCCS (2,34) foi menor e o teor de lactose maior (4,50%) que os valores
observados no perodo chuvoso. Os valores mdios observados no perodo chuvoso para as
caractersticas de composio de lactose (4,34%), slidos totais (11,65%), LogCCS (2,44 - o
que representaria um valor absoluto de aproximadamente 275.000 clulas/mL), protena bruta
(3,08%), protena verdadeira (2,84%), casena (2,01%) e relao casena:protena verdadeira
(0,70) diferiram estatisticamente (P<0,05) das mdias obtidas durante o perodo de seca. No
Estado de Gois, Bueno et al. (2005) tambm observaram reduo da concentrao de lactose
quando a CCS aumentou (342.000 clulas/mL). Essa reduo provavelmente deve-se leso
tecidual e tambm passagem do carboidrato do lmen alveolar para a corrente sangunea
(BANSAL et al., 2005).
A ocorrncia aumentada de casos de mastite clnica neste perodo se d em razo da
maior precipitao pluviomtrica e temperatura ambiente, que aumentam a susceptibilidade
de infeco intramamria pelo aumento do nmero de patgenos aos quais estaria exposta
(SANTOS e FONSECA, 2006).
Martins et al. (2006), avaliando a produo e a qualidade de leite de nove unidades
produtoras na bacia leiteira de Pelotas, no observaram diferena significativa entre as mdias
de contagens de clulas somticas durante os onze meses avaliados, a despeito da precipitao
pluviomtrica recorrente. Observaram, entretanto, maiores valores (P<0,05) entre os teores de
protena bruta, casena e protena verdadeira durante os meses de primavera e vero,
diferentemente do que se observou no presente trabalho (2,10% e 2,84%, respectivamente).
Durante a estao seca do perodo experimental do presente estudo, foram observadas as
mdias 2,91% e 2,13% para casena e protena verdadeira, respectivamente.
48

Tabela 5 Efeito das raas estudadas sobre as caractersticas fsico-qumicas e de composio


do leite

Holandesa Girolanda
Varivel N Mdia EPM N Mdia EPM P
Dornic (D) 635 16,162 0,079 285 17,077 0,113 0,001
pH 581 6,789 0,004 293 6,756 0,006 0,001
Crioscopia (H) 597 -0,5402 0,0003 278 -0,5391 0,001 0,054
Gordura (%) 622 3,316 0,029 279 3,20 0,046 0,031
Lactose (%) 628 4,439 0,009 292 4,457 0,014 0,320
Slidos totais (%) 621 11,845 0,035 284 11,742 0,057 0,115
LogCCS 654 2,377 0,025 299 2,397 0,038 0,666
Uria (mg/dL) 643 16,628 0,157 289 14,452 0,279 0,001
Protena Bruta (%) 599 3,137 0,011 270 3,094 0,017 0,033
PV (%) 575 2,909 0,011 248 2,869 0,018 0,057
Casena (%) 535 2,11 0,012 226 2,079 0,020 0,192
Relao casena/PV 535 0,723 0,001 226 0,722 0,003 0,965
P: Probabilidade ao nvel de 5% de significncia.

As mdias dos teores de gordura apresentaram diferena (P<0,05) entre as raas


estudadas, sendo 3,316% para Holandesas e 3,20% para Girolandas. Tomando como
referncia os demais componentes do leite, as mdias dos resultados de composio do leite
obtidas para os animais da raa Holandesa por Zanela et al. (2006a), pouco diferiram
numericamente dos obtidos no presente estudo, com exceo dos valores de casena.
Por outro lado, as mdias obtidas para as variveis protena e gordura nos animais da
raa Holandesa foram superiores aos obtidos por Ribas (1998) - 3,11% e 3,23%,
respectivamente -, e inferiores aos valores obtidos por Teixeira et al. (2003), que foram 3,14%
e 3,57%, respectivamente.
Em dados compilados de controles leiteiros individuais de 24.299 animais da raa
Girolanda, Verneque et al. (2005) observaram teores mdios de gordura de 3,92% e desvio-
padro de 0,80. J a mdia de porcentagem de protena de 16.866 amostras foi de
3,31%0,39, de lactose de 4,64%0,33 e o teor mdio de slidos totais foi de 12,70%1,28.
Os resultados das variveis gordura, protena, lactose e slidos totais, observados entre os
animais da raa Girolanda no presente experimento foram, respectivamente, 3,20%, 3,09%,
4,45% e 11,74%.
49

Os teores de nitrognio urico no leite tambm diferiram entre as raas estudadas. De


acordo com Arunvipas et al. (2003), que estudaram os efeitos de fatores no-nutricionais,
como raa, estgio da lactao e prenhez da vaca, produo e composio do leite sobre as
concentraes de uria no leite, verificaram que tais fatores explicaram 13,3% nas variaes
de nitrognio urico no leite, e que havia uma relao quadrtica entre os teores de gordura e
esta varivel. Os autores observaram maiores concentraes de NUL em animais com maiores
porcentagens mdias de gordura no leite, situao similar observada no presente
experimento.
Em relao ao efeito das raas estudadas sobre as caractersticas fsico-qumicas do
leite, a acidez titulvel da raa Holandesa foi menor (P<0,05) que o de animais da raa
Girolanda (16,162 e 17,077D, respectivamente). Entretanto, observou-se tendncia contrria
em relao ao pH (6,789 e 6,756, para as raas Holandesa e Girolanda, respectivamente). De
acordo com Santos e Fonseca (2006), logo aps sua obteno, o leite apresenta reao
ligeiramente cida, devido a alguns de seus componentes. Essa acidez, chamada de natural ou
aparente, causada pela albumina (1D), pelos citratos (1D), pelo dixido de carbono (1D),
pelas casenas (5 a 6D) e pelos fosfatos (5D). Entretanto, no presente estudo no se observou
diferena significativa (P>0,05) entre os teores de casena das duas raas estudadas que
justificasse a maior mdia de acidez titulvel observada na raa Girolanda.

5.4 Efeito do polimorfismo da -lactoglobulina, raa e sazonalidade sobre a estabilidade


do leite

A distribuio das amostras de leite que apresentaram ou no coagulao, em relao


ao polimorfismo gentico da -lactoglobulina est apresentada na Tabela 5. Dentre as 953
amostras de leite avaliadas, 30,75% apresentaram coagulao frente prova de estabilidade
ao lcool, sendo que 72 amostras provinham de animais com gentipo AA para -
lactoglobulina, 106 de animais da variante AB, enquanto que 115 amostras pertencem ao
gentipo BB. Anlise estatstica pelo teste do 2 no identificou diferena significativa entre a
freqncia de amostras com e sem coagulao entre os gentipos estudados (P=0,093).
50

Tabela 5 Distribuio das amostras, coaguladas e no coaguladas em relao ao


polimorfismo gentico de -lactoglobulina

Gentipo Coagulao Sem coagulao Total


AA 72 (28,45%) 181 (71,55%) 253
AB 106 (35,57%) 192 (64,43%) 298
BB 115 (28,61%) 287 (71,39%) 402
Total 293 (30,75%) 660 (69,35%) 953
2= 4,74 (P=0,093)

No presente estudo, entre as amostras provenientes de gentipo AA (253), 28,45%


coagularam, enquanto 71,55% no apresentaram coagulao. Dentre as 298 amostras de leite
do gentipo AB, 35,57% coagularam e 64% se apresentaram mais estveis. Do total de
amostras BB, 71,39% no apresentaram coagulao, enquanto 28,61% apresentaram
instabilidade frente prova do lcool. Os resultados obtidos referentes aos efeitos do
polimorfismo da -lactoglobulina sobre a estabilidade do leite frente prova do lcool,
distribudas em funo da graduao alcolica utilizada entre as amostras coaguladas, esto
apresentados na tabela 6.

Tabela 6 - Efeito do polimorfismo gentico da -lactoglobulina sobre o nmero de amostras


coaguladas prova do lcool nas graduaes alcolicas 70, 76, 80 e 84GL

Gentipo GRADUAO ALCOLICA


Total
-Lg 70GL 76GL 80GL 84GL
AA 3 17 18 34 72
AB 19 20 26 41 106
BB 24 21 33 37 115
Total 46 58 77 112 293
2 10,0* 0,904NS 0,493 NS 4,367 NS 4,74 NS
NS: No significativo; * P<0,01

No presente estudo, observou-se efeito significativo (P<0,01) do polimorfismo da -


lactoglobulina sobre a estabilidade das amostras coaguladas, na graduao alcolica de
70GL. As mdias de graduao alcolica que ocasionaram coagulao nas amostras de leite
dos gentipos AA, AB, BB so diferentes estatisticamente (P<0,05) e foram, respectivamente,
80,5GL, 79GL e 78,4GL. Os resultados obtidos so similares aos observados por Feagan et
al. (1972) que, estudando os efeitos das variantes genticas de -lactoglobulina sobre a
51

estabilidade trmica do leite, verificaram que o tempo de coagulao seguiu a tendncia


AA>AB>BB.
Lima (2005), que avaliou a correlao entre as variantes genticas de -casena e a
ocorrncia de alteraes das caractersticas fsico-qumicas e de composio do leite,
encontrou, entre os animais da raa Holandesa, freqncias allicas de 83% e 17%, para os
alelos A e B, respectivamente, e de 80% e 20%, para os mesmos alelos, entre os animais da
raa Girolanda. Tal fato poderia justificar a maior estabilidade do leite observada entre os
gentipos AA para -lactoglobulina do presente estudo, j que, segundo Robitaille (1995), a
estabilidade trmica do leite de gentipo AA para -lactoglobulina s era maior que a do leite
de gentipo BB quando o gentipo para -casena fosse AA.
Imafidon et al. (1991) observaram que o gentipo BB da -lactoglobulina produziu
uma protena mais termoestvel que os outros gentipos, inclusive em diferentes relaes de
concentraes das protenas -lactoglobulina:-casena. Entretanto, de forma similar aos
trabalhos de Lima (2005) e Robitaille (1995), e Robitaille e Ayers (1995), verificaram que a
estabilidade da -lactoglobulina era aumentada pela presena de protenas do fentipo AA
para -casena, e diminuda quando houvesse a expresso dos gentipos AB e BB para esta
protena.
Hill et al. (1997) citam que a estabilidade trmica do leite de gentipo B menor
quando comparado ao gentipo A, sob aquecimento temperatura de 70 - 90C. Alm disso, a
forma da curva do tempo de coagulao em funo do pH do leite pode ser fortemente
influenciada pela variante gentica da -lactoglobulina (FEAGAN et al., 1972), sendo que
leites provenientes de animais de gentipos BB apresentam maior tempo de estabilidade sob
pH 7,0 enquanto que gentipos AA, sempre apresentam maior tempo de estabilidade trmica
sob pH entre 6,7 e 6,8, e comportamento intermedirio do gentipo AB, situao similar ao
que foi encontrada no presente experimento (pHAA=6,79, pHAB= 6,78 e pHBB= 6,78, para
os animais da raa Holandesa; e pHAA= 6,75, pHAB= 6,74 e pHBB= 6,76, para animais da
raa Girolanda).
Singh (2004) afirma que, apesar dos diferentes comportamentos do leite frente ao
aquecimento, observados entre os gentipos AA, AB, e BB, ainda no est claro se o efeito
est na dependncia da proporo da protena -lactoglobulina, j que a quantidade deste
componente maior em gentipos AA, ou em funo da reatividade trmica das diferentes
variantes genticas.
A distribuio das amostras de leite que apresentaram ou no coagulao, em relao
s raas estudadas, est apresentada na tabela 7. Dentre as 654 amostras de leite de animais da
52

raa Holandesa avaliadas, 76,15% no apresentaram coagulao frente prova de estabilidade


ao lcool, enquanto 23,85% (156 amostras) apresentaram coagulao. J entre as amostras de
leite provenientes de animais da raa Girolanda, 54,18% (162 amostras) se mostraram mais
estveis, enquanto que 45,82% (137 amostras) coagularam sob alguma das graduaes
alcolicas adotadas para a prova de estabilidade do leite.

Tabela 7 Distribuio das amostras, coaguladas e no coaguladas em relao s raas


estudadas

Raa Coagulao Sem coagulao Total


Holandesa 156 (23,85%) 498 (76,16%) 654
Girolanda 137 (45,82%) 162 (54,18%) 299
Total 293 (30,74%) 660 (69,25%) 953
2
= 46,499 (P<0,001)

O leite de vacas Holandesa apresentou maior porcentagem de amostras no coaguladas


indicando maior estabilidade do leite desta raa. Os resultados obtidos referentes aos efeitos
da raa sobre a estabilidade do leite frente prova do lcool esto apresentados na tabela 8.

Tabela 8 - Efeito da raa sobre estabilidade do leite frente prova do lcool nas graduaes
alcolicas 70, 76, 80 e 84GL

GRADUAO ALCOLICA
Raa Total
70GL 76GL 80GL 84GL
Holandesa 19 24 42 71 156
Girolanda 27 34 35 41 137
Total 46 58 77 112 293
2
16,75* 21,29* 7,71* 1,61 NS 46,49
NS: No significativo; * P<0,01

Os resultados obtidos no presente experimento permitem verificar que houve diferena


significativa (P<0,01) entre a estabilidade do leite proveniente de animais das raas
Holandesa e Girolanda, nas graduaes alcolicas de 70, 76, 80GL. Ainda, entre as amostras
coaguladas, o leite de vacas Holandesa desestabilizou, em mdia, sob maior graduao
alcolica (79,98GL), enquanto que o leite de animais Girolanda foi mais instvel
53

coagulando-se menor concentrao alcolica (78,23GL), sendo estatisticamente


diferentes (P<0,05).
No h relatos na literatura indexada que associem as diferentes raas leiteiras
estabilidade trmica do leite, porm, de acordo com Santos e Fonseca (2006), o equilbrio
salino influencia a estabilidade trmica do leite e, portanto, alteraes de permeabilidade
vascular ocasionadas pela mastite alteram este equilbrio, afetando a estabilidade do leite. No
presente estudo, apesar de no ter sido verificado efeito de raa sobre a varivel LogCCS, a
menor estabilidade do leite proveniente de vacas Girolanda pode estar associada a maior
incidncia de mastite nos animais daquela raa. Alm disso, Gencurova et al. (1993) tambm
observaram menores estabilidades, frente a prova do lcool, em amostras de leite de vacas
com pequenas variaes mdias entre CCS de animais da raa Red Holstein e Black Pied
Lowland (154.000 e 184.000 clulas/mL, respectivamente), o que poderia explicar o possvel
confundimento decorrente da anlise do fator raa sobre estabilidade do leite.
Segundo Horne e Muir (1990), a estabilidade do leite frente prova do lcool obedece
a um comportamento quadrtico em funo do pH normal do leite. Sendo assim, de acordo
com os autores, o leite tende a uma maior estabilidade medida que se aproxima do pH 6,8,
diminuindo sua estabilidade gradativamente aps o pH 7,0. No presente estudo, observou-se
efeito das raas avaliadas sobre o pH das amostras (mdia de pH = 6,789 no leite de
Holandesa e 6,756 no leite de Girolanda), o que tambm poderia explicar a maior estabilidade
do leite de vacas Holandesa e denotar confundimento entre o fator responsvel pelo efeito
sobre a estabilidade do leite.
Ainda, de acordo com Fox e McSweenwey (1998), a estabilidade trmica do leite
dependente das concentraes de clcio, fsforo, citrato e do NUL, sendo maior quanto
maiores os teores deste ltimo componente. Tendo havido efeito da raa sobre as
concentraes de NUL (16,628 mg/dL e 14,452 mg/dL, para Holandesa e Girolanda,
respectivamente), pode-se especular efeito desta varivel sobre a estabilidade do leite, j que
tal observao foi tambm verificada por Gencurova et al. (1993).
A distribuio das amostras de leite que apresentaram ou no coagulao, em relao
estao do ano est apresentada na Tabela 9. Dentre as 605 amostras de leite avaliadas na
estao seca, 33,55% (203 amostras) apresentaram coagulao, enquanto que 66,45% (402
amostras) no apresentaram instabilidade neste mesmo perodo, independentemente do teor de
lcool utilizado para a prova. J na estao de chuvas, das 348 amostras analisadas, 74,14%
no apresentaram coagulao em qualquer soluo alcolica adotada, enquanto que 25,86% se
mostraram menos estveis.
54

Tabela 9 Distribuio das amostras, coaguladas e no coaguladas, em relao estao do


ano em que se realizaram as coletas

Estao do ano Coagulao Sem coagulao Total


Seca 203 (33,55%) 402 (66,45%) 605
Chuva 90 (25,86%) 258 (74,14%) 348
Total 293 (30,75%) 660 (69,25%) 953
2
= 6,13 (P=0,013)

Houve efeito significativa (P=0,013) da sazonalidade sobre a estabilidade do leite,


sendo verificada maior estabilidade na estao chuvosa. Entre as amostras coaguladas, nas
diferentes graduaes alcolicas adotadas no presente experimento (Tabela 10) no se
verificaram diferenas estatsticas entre as estaes seca e chuvosa. Tal fato se evidencia pela
similaridade entre as mdias alcolicas sob as quais as amostras instveis coagularam
(79,04GL na estao chuvosa, e 79,22GL na seca).

Tabela 10 - Efeito do perodo de coleta sobre estabilidade do leite frente prova do lcool nas
graduaes alcolicas 70, 76, 80 e 84GL

Estao GRADUAO ALCOLICA


Total
do ano 70GL 76GL 80GL 84GL
Seca 31 42 50 80 156
Chuva 15 16 27 32 137
Total 46 58 77 112 293
2 0,318 NS 2,12 NS
0,076 NS 3,45 NS 6,13

Avaliando a composio do leite no-cido e no-masttico no Rio Grande do Sul,


entre os meses de abril de 2002 e maro de 2003, Oliveira e Timm (2006) verificaram que os
teores mdios de gordura foram maiores (3,30%) em amostras de leite instveis prova do
lcool do que no apresentaram coagulao (3,04%). Tambm observaram menores teores de
lactose em amostras instveis (4,16%) que em amostras estveis (4,33%). Entretanto, no
observaram diferenas (P<0,05) nos teores de protena e slidos totais entre os leites estveis
e instveis.