Você está na página 1de 156

Testes

ASA
Teste 1
10.º Ano de Escolaridade
Grupo I
Extinção dos dinossáurios

Existem diversas teorias que procuram explicar a extinção dos dinossáurios no final do Cretácico, no limite
K-Pl (Cretácico – Paleogénico). As principais teorias apontam para o vulcanismo intenso e/ou para a queda
de um meteorito, há cerca de 65 M.a.
Vulcanismo - No final do Cretácico ocorreu uma intensa atividade tectónica que originou vulcanismo
muito forte e prolongado. Destacam-se os mantos de lava basáltica que se acumularam no Decão, na atual
Índia e Paquistão. Em algumas regiões, os mantos de lava chegam a atingir 2400 m de espessura e o
volume de lava deve ter excedido os 2 milhões de km3. O vulcanismo ocorreu desde 69 há 65 M.a.
A datação das erupções mais fortes e intensas revela que estas ocorreram na proximidade do limite K-Pl.
Embora não possa ser eliminada a possibilidade de ocorrência de erupções muito violentas, a maioria das
lavas são basálticas, com uma composição semelhante às lavas emitidas na região do Havai.
Impacto meteorítico - Em 1980, Alvarez e a sua equipa propuseram que a queda de um asteroide, há
65 M.a., na região de Yucatan (México), originou alterações globais que levaram à extinção dos
dinossáurios e de outros organismos. As principais evidências são a existência de teores anormalmente
altos de irídio em diversas camadas de rochas encontradas em Itália, Dinamarca, Espanha e Nova
Zelândia. O irídio é um elemento muito raro nas rochas terrestres, mas mais abundante em meteoritos
ricos em ferro. A cratera descoberta no México encontra-se coberta por uma espessa camada de
sedimentos, mas os estudos de geofísica permitiram verificar que possui cerca de 170 km de diâmetro e é
resultante do choque de um corpo com cerca de 10 km de diâmetro, que se suspeita ter sido um asteroide.
Apesar das divergências e diferentes opiniões, a maioria dos cientistas concorda que as alterações
climáticas no limite K-Pl implicaram importantes variações no nível do mar (figura 1A), que resultaram na
extinção de muitas espécies (figura 1B).

Figura 1A – Distribuição das


áreas marinhas e terrestres nos
últimos 250 M.a.

Figura 1B – Sobrevivência de
diferentes espécies de vertebrados
no limite K-Pl.
n – número de espécies analisadas
Na resposta a cada um dos itens de 1. a 3., selecione a única opção que permite obter uma afirmação
correta.

1. É expectável que a libertação de elevadas quantidades de CO2 pelo vulcanismo tenha originado____, e
a libertação de aerossóis e outras partículas pelos vulcões possa ter provocado ____.
(A) arrefecimento global (…) aumento do efeito de estufa.
(B) aquecimento global (…) bloqueio da radiação solar
(C) aquecimento global (…) aumento do efeito de estufa.
(D) arrefecimento global (…) bloqueio da radiação solar

2. O irídio encontra-se numa camada de argila, que é uma rocha de origem…


(A) … metamórfica. (C) … magmática extrusiva.
(B) … magmática intrusiva. (D) … sedimentar.

3. Para além dos níveis de irídio, um outro argumento a favor da queda de um meteorito é a existência
de…
(A) … grandes mantos de lava basáltica.
(B) … um elevado teor de CO2 atmosférico na atualidade.
(C) … cristais de quartzo formados em condições de elevada pressão.
(D) … estratos formados por sedimentos ricos em quartzo.

4. Ordene as letras de A a E de modo a reconstituir uma possível sequência cronológica dos


acontecimentos relacionados com o impacto meteorítico descrito no texto.
A. Emissão de elevadas quantidades de material para a atmosfera e formação de uma nuvem de
poeiras ardentes que se espalhou pelo globo.
B. Entrada do asteroide na atmosfera e choque com a superfície terrestre.
C. Recuperação da biodiversidade ao longo de milhões de anos.
D. Extinção em massa dos seres vivos, mesmo aqueles que se encontravam afastados da zona de
impacto em resultado das alterações climáticas.
E. Arrefecimento global resultante do bloqueio da luz pelos aerossóis.

5. Classifique como verdadeira (V) ou falsa (F) cada uma das seguintes afirmações relativas às
consequências do impacto meteorítico que ocorreu há 65 M.a., tendo em conta os dados fornecidos.
A. O limite K-Pl coincide com a maior regressão marinha ocorrida no nosso planeta nos últimos
250 M.a.
B. Os organismos terrestres escavadores apresentaram uma maior taxa de sobrevivência do que os
organismos aquáticos de água doce.
C. A Terra pode ser classificada como um sistema aberto pois recebe matéria do exterior, como por
exemplo o irídio.
D. Quanto maior a dimensão dos organismos, maior será a suscetibilidade ao impacto meteorítico,
que ocorreu há 65 M.a.
E. O limite Triásico-Jurássico coincide com uma importante transgressão marinha.
F. A extinção em massa dos seres vivos em consequência de um impacto meteorítico está de acordo
com o princípio do Uniformitarismo.
G. Os vertebrados não placentários apresentaram uma taxa de sobrevivência de 61% no limite K-Pl.
H. A percentagem de extinção de espécies de seres vivos no limite K-Pl foi aproximadamente de
100%.

6. As afirmações seguintes dizem respeito a caraterísticas das rochas. Selecione a alternativa que as
classifica corretamente.
1. Os basaltos que se encontram na região do Decão correspondem a rochas sedimentares que
resultaram da solidificação de um magma basáltico.
2. As rochas sedimentares podem formar-se a partir de qualquer tipo de rocha pré-existente.
3. Os sedimentos necessitam de sofrer diagénese para se transformarem em rochas sedimentares
consolidadas.
(A) 1 é verdadeira; 2 e 3 são falsas (C) 3 é verdadeira; 1 e 2 são falsas
(B) 2 é falsa; 1 e 3 são verdadeiras (D) 1 é falsa; 2 e 3 são verdadeiras
7. Explique em que medida a deteção de níveis de irídio em rochas espalhadas pelo globo apoiam a
ocorrência de um evento catastrófico com origem extraterrestre.

8. Relacione as interações existentes entre os subsistemas atmosfera e geosfera com a extinção dos
dinossáurios, tendo como exemplo o vulcanismo intenso ocorrido na Terra há cerca de 65 M.a.

Grupo II
Datação das rochas e eventos geológicos

Os geólogos procuram estudar o passado da Terra e prever o seu futuro. Um dos principais aspetos deste
trabalho é a datação das rochas e dos fenómenos geológicos, de forma a reconstituir a História da Terra e
construir a Escala do Tempo Geológico.
A figura 2 representa um corte geológico contendo diversos estratos e corpos de origem magmática. Na
datação dos corpos magmáticos recorreu-se a uma técnica radiométrica.

Figura 2

Na resposta a cada um dos itens de 1. a 5., selecione a única opção que permite obter uma afirmação
correta.

1. De acordo com o Princípio da _____, o estrato B é mais antigo que o estrato_____.


(A) Horizontalidade (…) C (C) Horizontalidade (…) A
(B) Sobreposição (…) C (D) Sobreposição (…) A

2. Os depósitos de lava foram datados de forma _____ , recorrendo _____.


(A) relativa (…) a relações estratigráficas
(B) relativa (…) à quantificação de isótopos radioativos
(C) absoluta (…) à quantificação de isótopos radioativos
(D) absoluta (…) a relações estratigráficas
3. Numa coluna cronoestratigráfica, a formação do estrato B será representado…
(A) … por cima da formação dos diques com 36 e 57 M.a.
(B) … por baixo da formação dos diques com 57 M.a.
(C) … em simultâneo com a formação dos diques com 36 M.a.
(D) … em simultâneo com a formação dos diques com 57 M.a.

4. A datação relativa dos diques com base nos Princípios Estratigráficos não permite concluir que…
(A) … numa região onde só aflore o estrato B, o dique formado há 57 M.a. de anos seja mais antigo
que o formado há 36 M.a.
(B) … o dique no topo da sequência é o mais recente.
(C) … os diques são posteriores aos estratos A e B.
(D) … o dique que se instalou há 36 M.a. é mais recente do que o estrato C.

5. As rochas dos diques que se formaram há 36 M.a. possuem um ratio isótopo-pai/isótopo-filho …


(A) … igual às rochas dos diques formados há 57 M.a.
(B) … superior às rochas dos diques formados há 57 M.a.
(C) … inferior às rochas dos diques formados há 57 M.a.
(D) … inferior a todos os diques formados há menos de 57 M.a. e superior aos diques formados há
mais de 36 M.a.

6. Classifique como verdadeira (V) ou falsa (F) cada uma das afirmações seguintes, relativas ao bloco
diagrama esquematizado na figura 2.
A. As rochas do Oligocénico podem ser datadas de 30 a 20 M.a. atrás.
B. Os dois diques podem ter sido formados por fenómenos magmáticos.
C. As rochas do Paleocénico possuem idade inferior a 57 M.a.
D. Durante o Paleocénico solidificaram lavas com 20 M.a.
E. A datação absoluta das rochas do Eocénico poderia indicar idades inferiores a 35 M.a.
F. Os diques são mais antigos do que as rochas que intersetam.
G. As rochas do Eocénico são mais recentes do que as do Oligocénico mas mais antigas do que as do
Paleocénico.
H. A datação resultante da aplicação do princípio da sobreposição é do tipo relativo.

7. Explique de que modo conseguiria datar os estratos e outros corpos observados numa saída de campo
partindo do princípio que os únicos materiais que levaria consigo seriam: um caderno de campo, um
lápis, um martelo de geólogo e uma bússola.

Grupo III
Da deriva dos continentes à tectónica de placas

Em 1915, o cientista alemão Alfred Wegener propôs à comunidade científica a Hipótese da Deriva dos
Continentes, segundo a qual, no passado, os continentes já tinham estado todos unidos, formando uma
única massa continental denominada por Pangeia, que fraturou e originou a distribuição atual dos
continentes. Para defender a sua hipótese, Wegener recorreu a argumentos morfológicos, paleontológicos,
paleoclimáticos e litológicos. Contudo, a falta de explicação sobre o motor responsável pela deslocação das
massas continentais, assim como a incorreção dos dados matemáticos por si apresentados, foram
responsáveis pela refutação desta hipótese.
Posteriormente, com o desenvolvimento da ciência e da tecnologia, foi caracterizado o relevo dos fundos
oceânicos e comprovada a sua expansão, a base da Teoria da Tectónica de Placas. Esta teoria revolucionou
a Geologia.
Na figura 3 está esquematizado um bloco diagrama relativo à dinâmica das placas litosféricas.

Figura 3

Na resposta a cada um dos itens de 1. a 4., selecione a única opção que permite obter uma afirmação
correta.

1. O limite assinalado por B na figura 3 é do tipo _____, ocorrendo ____ da placa oceânica.
(A) convergente (…) subducção (C) divergente (…) subducção
(B) convergente (…) formação (D) divergente (…) formação

2. No limite A da figura 3, do tipo ____ , forma-se placa oceânica resultante da ____ .


(A) convergente (…) acumulação de sedimentos
(B) convergente (…) solidificação de material oriundo do manto
(C) divergente (…) acumulação de sedimentos
(D) divergente (…) solidificação de material oriundo do manto

3. A placa oceânica que sofre subducção ao longo de uma fossa oceânica tende a ser a mais ___, contendo
uma ___ espessura de sedimentos acumulados.
(A) antiga (…) menor (C) recente (…) maior
(B) antiga (…) maior (D) recente (…) menor

4. Segundo a Teoria da Tectónica de Placas, os fragmentos da litosfera deslocam-se sobre ____.


(A) … a crusta oceânica (C) … a astenosfera
(B) … o núcleo externo (D) … a crusta continental

5. Faça corresponder a cada uma das afirmações da coluna A um argumento da coluna B, usados por
Wegener para defender a sua teoria da Deriva dos Continentes. Utilize cada letra apenas uma vez.
Coluna A Coluna B

(a) Fósseis do feto Glossopteris foram encontrados em todos os


continentes do hemisfério sul. (1) Argumento
(b) A costa este na América do Sul e a costa oeste de África morfológico
apresentam uma complementaridade. (2) Argumento
(c) Vestígios glaciares foram encontrados na África do Sul e na paleoclimático
América do Sul, em terrenos que se encontram atualmente (3) Argumento
próximos do equador. litológico
(d) Rochas com a mesma idade foram encontradas na América do Sul (4) Argumento
e na África do Sul. paleontológico
(e) Foram encontrados fósseis de Cygnonathus, um réptil do
Triásico, na América do Sul e em África.
6. Mencione o motor responsável pela mobilidade das placas litosféricas.

7. As rochas da crusta oceânica mais antigas que se conhecem têm cerca de 200 M.a., ao passo que já
foram descobertas rochas com milhares de milhões de anos na crusta continental. Explique este facto,
tendo em conta a tectónica de placas e as propriedades da crusta oceânica.

Grupo IV
Formação do Sistema Solar

O Sistema Solar formou-se a partir de uma nuvem de gases e poeiras há mais de 4600 M.a. É constituído
por corpos celestes, em que se incluem o Sol, os planetas, os cometas, os asteroides e os meteoroides.
Na tabela I estão referenciadas algumas das caraterísticas dos planetas principais constituintes do Sistema
Solar.

Tabela I – Características dos planetas principais do Sistema Solar.

Mercúrio Vénus Terra Marte Júpiter Saturno Úrano Neptuno

Distância ao
58 108 150 227 778 1430 2870 4500
Sol (106 km)

Período de
translação 87,9 224,7 365,25 686,9 4332,6 10 759,2 30 685,4 60 189,0
(dias)

Tempo de
rotação (dias 58,6 d 243,0 d 23,9 h 24,6 h 9,8 h 10,2 h 17,2 h 17,8 h
terrestres)

Dimensões
(raio no equador 2439 6062 6378 3397 71 998 60 000 26 145 24 300
- km)
Massa (relativo
à massa 0,05 0,8 1,0 0,1 317,8 95,1 14,5 17,2
terrestre)

Densidade
5,4 5,2 5,5 3,9 1,3 0,6 1,1 1,7
média (g/cm3)

N.º de
satélites 0 0 1 2 64 62 27 13
conhecidos

Temperatura
167 464 15 -20 -110 -140 -195 -200
média (°C)

+430°C +50°C +40°C


Temperatura 462°C -145°C -170°C -233°C -193°C
-170°C -90°C 0°C
máxima (dia) e
mínima (noite) Junto ao solo Na parte superior da atmosfera

Na resposta a cada um dos itens de 1. a 3., selecione a única opção que permite obter uma afirmação
correta.

1. Na nuvem primitiva de gases e poeiras com rotação verificava-se…


(A) … uma distribuição uniforme de materiais.
(B) … um zonamento composicional e físico.
(C) … a concentração de materiais mais quentes e densos nas zonas mais externas da nuvem.
(D) … a formação de uma estrutura esférica e com materiais distribuídos de forma uniforme.
2. Após a formação dos planetas, ocorreu a migração dos materiais no interior dos planetas de acordo com
a sua ____, sendo a migração do material responsável pela ____.
(A) massa (… ) acreção (C) densidade (…) diferenciação
(B) densidade (…) acreção (D) massa (…) diferenciação

3. A Lua, ao contrário da Terra, possui crateras de impacto na sua superfície que se formaram nos seus
primórdios, tendo-se mantido preservadas até à atualidade. Este facto pode ser explicado pela…
(A) … ausência de mecanismos de geodinâmica interna e externa, neste caso associada a agentes
erosivos atmosféricos.
(B) … ausência de atmosfera, que facilita o choque dos meteoritos e a formação das crateras.
(C) … existência de uma atividade tectónica intensa.
(D) … existência de uma atmosfera densa que mantém as crateras de impacto estáveis.

4. Mencione a teoria atualmente mais aceite para explicar a formação do Sistema Solar.

5. Ordene as letras de A a E de modo a reconstituir uma possível sequência cronológica dos


acontecimentos relacionados com a formação do Sistema Solar.
A. Crescimento dos protoplanetas a partir dos planetesimais.
B. Formação de planetas rochosos nas zonas mais próximas do Sol e de planetas gasosos nas zonas
mais distantes.
C. Acreção dos primeiros planetesimais formados por fragmentos rochosos.
D. Formação da atmosfera terrestre.
E. Formação de uma nuvem de gases e poeiras que se contraiu sob o efeito da gravidade, originando
um disco.

6. Classifique como verdadeira (V) ou falsa (F) cada uma das seguintes afirmações relativas às
características dos planetas do Sistema Solar.
A. A temperatura à superfície dos planetas aumenta com a distância ao Sol.
B. Vénus é o planeta com maior amplitude térmica.
C. Os planetas gigantes apresentam o maior número de satélites.
D. Os planetas telúricos são mais densos do que os planetas gigantes.
E. Os planetas telúricos apresentam órbitas exteriores à cintura de asteroides.
F. Os planetas gigantes apresentam uma rotação mais lenta do que os planetas telúricos.
G. A densidade média dos planetas aumenta com a distância ao Sol.
H. A existência de atmosfera não garante a criação do efeito de estufa em todos os planetas.

7. Faça corresponder a cada uma das afirmações, de A a E, o respetivo corpo celeste, indicado na chave.
Utilize cada letra e cada número uma única vez.
Afirmações:
(a) Corpos rochosos que orbitam entre Marte e Júpiter.
(b) Corpos celestes que podem chocar com a Terra.
(c) Planetas que orbitam em torno de um planeta principal.
(d) Corpos constituídos por um núcleo de gelo e uma cauda de gases quando orbitam perto do Sol.
(e) Corpo celeste que atravessa a atmosfera terrestre.
Chave:
(1) Meteoritos (5) Estrelas
(2) Asteroides (6) Satélites
(3) Cometas (7) Meteoroides
(4) Meteoros (8) Terra

8. A origem de muitos meteoritos recolhidos na Terra ainda é desconhecida. No entanto, é sabido que
alguns podem ter sido formados a partir de fragmentos de asteroides, podendo ser incluídos no grupo
dos meteoritos sideritos ou siderólitos.
Explique de que modo a existência destes meteoritos apoia a hipótese de alguns asteroides de maiores
dimensões terem sofrido diferenciação após a sua formação.
Teste 2
10.º Ano de Escolaridade
Grupo I
A Terra e os planetas telúricos

A atividade vulcânica deve ter tido um papel importante nos primórdios da formação dos planetas
Mercúrio, Marte, Terra e da Lua. Na atualidade os cientistas defendem que a Terra deve tratar-se do único
planeta que apresenta atividade vulcânica e tectónica.
Embora Vénus aparente ter atividade vulcânica intensa, ainda existem dúvidas quanto à existência de
evidências tectónicas. No início de 1990 imagens obtidas pela sonda espacial Magellan mostraram a
existência de vulcões e vales profundos, com formas e tamanhos semelhantes às fossas oceânicas da Terra.
A atividade geológica dos planetas está dependente da existência de calor interno. Este acumulou-se
principalmente nos primórdios da formação dos diferentes planetas. A taxa de perda de calor ao longo de
milhares de milhões de anos está dependente da dimensão dos planetas, da existência de uma fonte
contínua de produção de calor e da composição das camadas internas da Terra, dado que um planeta
rochoso perde calor de forma mais lenta que um planeta contendo camadas internas no estado líquido.

Na resposta a cada um dos itens de 1. a 4., selecione a única opção que permite obter uma afirmação
correta.
1. Planetas contendo compostos que sofrem decaimento radioativo devem arrefecer de forma ___ que
planetas com a mesma dimensão mas mais ___ naqueles elementos.
(A) mais lenta (…) ricos (C) igual (…) ricos
(B) mais lenta (…) pobres (D) igual (…) pobres

2. São fontes de calor interno da Terra…


(A) … a acreção gravítica e o calor primitivo.
(B) … a acreção gravítica e a energia solar.
(C) … o calor primitivo e a energia solar.
(D) … o calor primitivo e as correntes de convecção.

3. A atividade vulcânica de um planeta depende da existência de…


(A) … energia solar.
(B) … material sólido.
(C) … material fundido.
(D) … camadas internas formadas por gases e líquidos a temperaturas muito reduzidas.

4. A Terra perdeu o calor primitivo de forma mais ____ que Marte ou Mercúrio, pois o nosso planeta
apresenta uma ____ dimensão.
(A) rápida (…) maior (C) lenta (…) menor
(B) rápida (…) menor (D) lenta (…) maior

5. Classifique como verdadeira (V) ou falsa (F) cada uma das seguintes afirmações relativas à formação e
características da Lua e dos planetas principais do Sistema Solar.
A. Os impactos meteoríticos foram o processo geológico dominante na história recente da Lua.
B. Os anortositos podem ser encontrados na parte mais escura da Lua, preenchendo as crateras de
impactos meteoríticos.
C. A Lua e Mercúrio são corpos celestes primitivos, cujas superfícies não foram alteradas por
processos geológicos ou tectónicos.
D. Marte é o único planeta que não apresenta vestígios de vulcanismo.
E. Os planetas telúricos são constituídos por materiais ricos em níquel e ferro.
F. Os planetas exteriores arrefeceram mais rapidamente que os planetas telúricos.
G. O facto de a face da Lua que está voltada para a Terra ser sempre a mesma deve-se à sua massa e
período de translação.
H. A Lua, tal como os planetas telúricos, apresenta uma estrutura interna diferenciada em camadas
concêntricas.

6. A Terra irá, eventualmente, perder a maioria do calor interno e deixar de ser um planeta com atividade
tectónica e vulcânica. Mencione um fenómeno que poderá atrasar este processo.
7. O veículo espacial Voyager descobriu plumas de enxofre abaixo da superfície de Io, uma das luas de
Júpiter, com tamanho semelhante ao satélite natural da Terra. Os cientistas especulam que existem
grandes reservatórios de enxofre líquido a reduzidas temperaturas, aquecido por forças resultantes da
atração gravítica entre Júpiter e Io. Ao aquecer, o enxofre é emitido sob a forma de plumas. A energia
calorífica deverá ser suficiente para produzir movimentos de convecção no interior de Io, embora não
sejam conhecidas características superficiais resultantes desta convecção interna.
Compare os processos que ocorrem em Io com os que são conhecidos na Terra.

Grupo II
Consequências da ocupação dos solos

O aumento da população humana tem levado à ocupação de áreas terrestres cada vez mais extensas,
alterando o equilíbrio natural dos ecossistemas. Para estudar alguns dos impactes associados à ocupação
humana do território, foi realizada uma experiência numa região montanhosa na qual se iria construir uma
urbanização, e que inclui duas situações:
• Situação A – corresponde à região antes da construção da urbanização. Após a ocorrência de
precipitação na região montanhosa foi medida a altura do rio ao longo do tempo numa localidade a
jusante (fig. 1).
• Situação B – corresponde à região já com a urbanização construída. Os investigadores também
mediram a variação da altura da água do rio na localidade a jusante após ocorrer precipitação na região
montanhosa (fig. 1). As medições no rio só foram efetuadas quando o valor de precipitação foi
semelhante ao ocorrido na situação A.

Figura 1

Para além das variações no caudal dos rios, os investigadores também verificaram que na situação A os rios
eram naturalmente pouco profundos e sinuosos, enquanto na situação B eram mais profundos e possuíam
um trajeto mais retilíneo.
Na resposta a cada um dos itens de 1. a 4., selecione a única opção que permite obter uma afirmação
correta.

1. Os investigadores só mediram a altura do rio na situação B quando a precipitação foi semelhante à


situação A, de forma a…
(A) … duplicarem os resultados obtidos, permitindo a sua generalização.
(B) … poderem excluir o controlo experimental.
(C) … relacionarem o número máximo de variáveis possível.
(D) … manterem apenas uma variável em estudo.

2. A variável experimental pode ser considerada…


(A) … a variação de altura de água no rio.
(B) … o tipo de ocupação dos solos na zona montanhosa.
(C) … a quantidade de árvores na urbanização principal.
(D) … o valor da precipitação.

3. De acordo com o Princípio do ___ as cheias são fenómenos ___ que ocorrem na Terra.
(A) Catastrofismo (…) lentos e graduais
(B) Catastrofismo (…) rápidos e violentos
(C) Uniformitarismo (…) rápidos e violentos
(D) Uniformitarismo (…) rápidos e graduais

4. As florestas tendem a ser consideradas recursos naturais…


(A) … não renováveis, pois não ocorre a regeneração dos recursos.
(B) … renováveis, se a sua taxa de reposição não compensar a taxa de consumo.
(C) … renováveis, se a sua taxa de reposição compensar a taxa de consumo.
(D) … minerais, pois podem ser usadas para produzir carvão.

5. Classifique como verdadeira (V) ou falsa (F) cada uma das seguintes afirmações relativas aos dados
apresentados neste estudo.
A. Nas regiões montanhosas cobertas por vegetação natural, após a precipitação, a água escorre de
uma forma mais lenta para os cursos de água.
B. As povoações a jusante da montanha, na situação B, estão menos sujeitas a cheias repentinas.
C. O rio possui capacidade de fornecer água para consumo de forma mais contínua e gradual na
situação B, quando comparada com a situação A.
D. As florestas reduzem o risco de cheias a jusante dos rios.
E. É expectável encontrar na urbanização principal sedimentos mais grosseiros transportados pelo rio
na situação B.
F. A maior profundidade do rio e a redução da sinuosidade do seu trajeto podem estar associados a um
escoamento mais lento da água, diminuindo os riscos geológicos nas proximidades do rio.
G. Se efetuarmos um corte geológico nos sedimentos fluviais do rio na situação B, é possível datá-los
de forma absoluta usando a sua posição estratigráfica.
H. Na região de montanha, o rio possui uma capacidade de transporte de sedimentos inferior.

6. Com base nos dados fornecidos, explique, em que medida, a ação humana pode afetar as interações
entre os subsistemas terrestres.
7. A água que escorre dos rios acaba, na sua maioria, nos oceanos, que armazenam cerca de 97% da água
existente no nosso planeta. Faça corresponder a cada uma das afirmações da coluna A a respetiva
estrutura do fundo oceânico da coluna B. Utilize cada letra e cada número apenas uma vez.

Coluna A Coluna B

(a) Zonas onde as placas oceânicas se encontram em subducção


ao longo de limites convergentes.
(1) Dorsais oceânicas
(b) Cadeias montanhosas submarinas resultantes da acumulação
(2) Plataforma continental
de material expelido nos riftes médio-oceânicos.
(3) Planícies abissais
(c) Regiões planas situadas a grandes profundidades e que se
(4) Ilha
apresentam cobertas por espessas camadas de sedimentos.
(5) Fossas oceânicas
(d)Zona com um declive muito acentuado, coberta por uma fina
(6) Talude continental
camada de sedimentos.
(7) Rifte
(e) Integra parte da crusta continental, apresentando reduzidas
(8) Cratões
inclinações, sendo coberta por uma camada de sedimentos
constituída, principalmente, por areias e lodos.

Grupo III
Paleomagnetismo e deriva aparente dos polos

Em 1950 foram feitos estudos sobre magnetismo em rochas, que levaram a descobertas muito importantes.
O alinhamento magnético dos minerais férreos de depósitos de lava com diferentes idades permitiu detetar
a posição dos polos magnéticos em função do registo magnético em cada rocha. A primeira evidência foi a
aparente existência de diferentes polos paleomagnéticos ao longo do tempo. O estudo da posição do polo
magnético relativamente ao continente europeu revelou que a sua localização, nos últimos 500 M.a., variou
gradualmente desde o Havai até à Sibéria, atingindo posteriormente a sua posição atual.
Duas hipóteses foram levantadas na época: os polos magnéticos migraram ao longo do tempo ou o
continente europeu sofreu movimentação, mantendo-se o polo magnético sempre próximo dos polos.
Apesar de os polos magnéticos se deslocarem em torno dos polos geográficos, têm uma correspondência
próxima com as posições dos polos geográficos.
As trajetórias definidas para a América do Norte e para a Eurásia são semelhantes, estando, contudo,
separadas cerca de 30° (longitude) (fig. 2A). Todavia, se aproximarmos a América do Norte e a Eurásia, e
imaginarmos um mapa sem o Atlântico Norte, as curvas de deriva polar sobrepõem-se, durante um
período compreendido entre os 400 e os 160 M.a. atrás (fig. 2B).

Figura 2 Curvas de derivas polares aparentes. (A) Deriva polar aparente considerando que a América do
Norte e a Eurásia mantiveram sempre a posição atual. (B) Curva de deriva aparente considerando que
aqueles continentes estiveram unidos no passado.
Na resposta a cada um dos itens de 1. a 4., selecione a única opção que permite obter uma afirmação
correta.

1. A explicação mais aceitável para a aparente deriva dos polos diz respeito à hipótese levantada por
Wegener, a Deriva dos Continentes.
Com base nos dados do paleomagnetismo da figura 2B, é possível concluir que a América do Norte e a
Eurásia estiveram…
(A) … separadas entre os 400 e os 160 M.a. atrás e que se moveram em relação aos polos, fazendo
parte de um único continente.
(B) … separadas entre os 400 e os 160 M.a. atrás e que se moveram em relação aos polos, constituindo
dois continentes separados por um oceano.
(C) … unidas entre os 400 e os 160 M.a. atrás, fazendo parte de um único continente, tendo havido
migração dos polos magnéticos ao longo do tempo.
(D) … unidas entre os 400 e os 160 M.a. atrás e que se moveram em relação aos polos, fazendo parte
de um único continente.

2. Com base apenas nos dados da figura 2A, seria possível concluir que na altura em que ocorreu a
cristalização dos minerais…
(A) … existiam dois polos magnéticos que migravam paralelamente um ao outro.
(B) ... existiam dois polos magnéticos, um dos quais fixo e o outro migrava.
(C) … existiam dois polos magnéticos que migravam perpendicularmente um ao outro.
(D) … apenas existia um polo magnético.

3. Com base nos estudos do paleomagnetismo é possível concluir que se os polos magnéticos se mantêm
_____ dos polos geográficos, então o seu aparente movimento é uma consequência da _____.
(A) próximos (…) migração dos polos magnéticos
(B) próximos (…) deriva continental
(C) distantes (…) deriva continental
(D) distantes (…) migração dos polos magnéticos

4. A existência de bandas rochosas simétricas no fundo dos oceanos apoia a teoria da tectónica de placas
pois permite constatar…
(A) … a subducção da placa oceânica sob a placa continental.
(B) … a deposição de sedimentos de ambos os lados do rifte oceânico.
(C) … o magnetismo como o motor responsável pela deslocação das placas.
(D) … a formação de nova crusta oceânica ao nível dos riftes oceânicos e para ambos os lados.

5. Mencione a razão pela qual, no estudo das inversões de polaridade, as rochas que geralmente se
utilizam são os basaltos.

6. Há cerca de 300 M.a., partes da Eurásia estavam cobertas por depósitos de carvão, que se formaram
em ambientes tropicais. Explique em que medida estes dados paleoclimáticos apoiam a deriva dos
continentes e não a aparente deriva dos polos magnéticos.

7. Classifique como verdadeira (V) ou falsa (F) cada uma das seguintes afirmações relativas aos métodos
de estudo do interior da Terra
A. Os estudos paleomagnéticos são um método direto de estudo do interior da Terra.
B. A propagação das ondas sísmicas em profundidade permite-nos inferir o estado físico dos materiais
aí existentes.
C. Quando ocorre uma anomalia magnética negativa, o norte magnético passa a estar próximo do
norte geográfico.
D. A recolha de materiais expelidos pelos vulcões permite-nos conhecer a composição e temperatura
de alguns magmas provenientes da crusta e do manto.
E. Os métodos diretos de estudo do interior da Terra permitem-nos obter dados referentes às camadas
mais profundas da Terra.
F. As anomalias gravimétricas positivas permitem-nos inferir a existência de um corpo rochoso
formado por materiais de densidade elevada.
G. Todas as rochas que evidenciam a mesma polaridade magnética formaram-se em simultâneo.
H. A geotermia é um método indireto de estudo da Geosfera.
8. Mencione, em que medida, as curvas de deriva polar da América do Norte e da Eurásia na figura 2B
corroboram a existência do supercontinente Pangeia, há cerca de 200 M.a.

Grupo IV
Vulcão de Santa Helena

O vulcão de Santa Helena é o vulcão mais ativo da costa oeste dos EUA. A sua atividade vulcânica está
associada ao contexto tectónico desta região (figura 3).

Acumulação do magma
na crusta

Placa Placa
Juan de Fuca Norte-Americana

Acumulação do magma
na base da crusta

Formação do magma
Figura 3

O vulcão de Santa Helena tem uma história rica e complexa, com mais de 275 000 anos, nos quais
ocorreram episódios violentos com libertação de material com composição dacítica, que alternaram com
erupções mais efusivas, em que grandes quantidades de lava com composição basáltica e andesítica foram
emitidas. O teor em sílica de cada uma das lavas referidas é o seguinte:
• lava basáltica: teor em sílica de aproximadamente 5o%;
• lava andesítica: teor em sílica de aproximadamente 60%;
• lava dacítica: teor em sílica de aproximadamente 63,5%.

A erupção recente mais violenta ocorreu no dia 18 de maio de 1980. Diversos indícios antecederam a
erupção, nomeadamente a libertação de “pequenas” plumas de cinzas, que chegavam a atingir os 3000 m
de altitude, o aumento da temperatura dos gases expelidos nas fumarolas e sismos mais intensos. Nestes
eventos não ocorreu a libertação de material líquido ou parcialmente fundido.
No dia 1 de abril de 1980, o registo sísmico mudou radicalmente: o número de sismos aumentou,
tornando-se estes mais frequentes, menos intensos e mais rápidos. Este registo não é típico de sismos com
origem tectónica e revelava que o magma estava a ascender na câmara magmática.
Em meados de abril verificou-se uma elevação no relevo do vulcão e a formação de um domo, a uma taxa
que chegou a superar os 1,5 m/dia. As explosões freáticas (causadas pela água que se infiltrava nas rochas
quentes do vulcão) tornaram-se menos fortes, convertendo-se em fumarolas no final do mês de abril.
No dia 18 de maio, o domo explodiu e deslizou a uma velocidade de 177 a 250 km/h. A perda deste material
expôs o magma, que explodiu de imediato para um dos lados, juntamente com os gases aquecidos e a
elevadas pressões (fig. 3A). As plumas de cinzas emitidas eram gigantescas e cobriram vastas áreas de
terrenos com camadas de cinzas.
Os geólogos Crandell e Mullineaux estudaram camadas de material emitido nesta erupção (fig. 3B) e
noutras que a antecederam para caracterizarem a atividade vulcânica do vulcão de Santa Helena.
Figura 4

Na resposta a cada um dos itens de 1. a 3., selecione a única opção que permite obter uma afirmação
correta.
1. O teor em sílica determina se o magma é fluido, formando rochas como o ___, ou viscoso, originando
rochas como o ___ .
(A) andesito (…) basalto (C) dacito (…) andesito
(B) basalto (…) andesito (D) dacito (…) basalto

2. Na erupção que ocorreu em 1980 no vulcão de Santa Helena foram expulsas grandes quantidades de
gases. Quanto maior o teor em gases de um magma…
(A) … menor o caráter explosivo da erupção.
(B) … maior o caráter explosivo da erupção, pois os gases mantêm-se dissolvidos no magma.
(C) … maior o caráter explosivo da erupção, pois os gases separam-se das frações sólida e liquida e
forçam a ascensão súbita e violenta da mistura.
(D) … menor o caráter explosivo da erupção, pois os gases mantêm-se dissolvidos no magma.

3. Os geólogos Crandell e Mullineux caraterizaram a atividade do vulcão de Santa Helena com base em
técnicas radiométricas, determinando a idade dos depósitos de materiais vulcânicos da figura 4B.
Das suas análises radiométricas, é possível afirmar que…
(A) … o ratio isótopo-pai/isótopo-filho se reduz do topo para a base da sequência.
(B) … o ratio isótopo-pai/isótopo-filho se mantém constante nas diferentes amostras.
(C) … só é possível datar os materiais vulcânicos de forma relativa.
(D) … o teor de isótopos-filho é sempre superior ao teor de isótopos-pai.
4. Mencione a importância de os riscos vulcânicos serem considerados nos planos de ordenamento do
território, nomeadamente na autorização de edificações próximas de um vulcão.

5. Classifique como verdadeira (V) ou falsa (F) cada uma das seguintes afirmações, relativas aos dados
apresentados.
A. Os materiais piroclásticos emitidos no evento eruptivo em 2004 poderiam encontrar-se no topo da
sequência da figura 4.
B. Os magmas expulsos nas erupções do vulcão de Santa Helena formaram-se todos a temperaturas
que superam os 1300ºC.
C. Na região representada na figura 4B não existem vestígios de erupções com emissão de lava.
D. A existência de um glaciar no topo do vulcão aumentou a probabilidade de se formar uma nuvem
ardente na erupção de 1980.
E. A diminuição da frequência sísmica é um indicador da ascensão de magma no aparelho vulcânico.
F. A redução das explosões freáticas levou a concluir que o vulcão Santa Helena estaria a acalmar.
G. O vulcão de Santa Helena deve a sua atividade à ocorrência da subducção da placa Juan de Fuca sob
a placa norte-americana.
H. Na erupção de 1980, o abatimento de um bloco do cone vulcânico expôs o magma a uma maior
pressão, levando a uma separação violenta da fração gasosa do magma.

6. Faça corresponder a cada uma das afirmações a respetiva estrutura ou material vulcânico, indicado por
um número da chave. Utilize cada letra e cada número apenas uma vez.

Afirmações
(a) Mistura constituída por material rochoso fundido e gases.
(b) Estrutura originada pelo colapso da parte superior do aparelho vulcânico e posterior
preenchimento da depressão por água.
(c) Emanação de gases a elevadas temperaturas através de fissuras existentes à superfície.
(d) Materiais vulcânicos com dimensão inferior a 2 mm.
(e) Estrutura por onde o magma ascende até atingir a superfície.

Chave
(1) Cone vulcânico
(2) Chaminé
(3) Cratera
(4) Caldeira
(5) Cinzas
(6) Câmara magmática
(7) Fumarola
(8) Magma

7. Ordene as letras de A a E de modo a reconstituir uma possível sequência cronológica dos


acontecimentos relacionados com a circulação da água hidrotermal no vulcão de Santa Helena.
A. A água infiltrada aquece e pode chegar mesmo a vaporizar ao chegar perto da câmara magmática.
B. Libertação à superfície de água e vapor de água a elevadas temperaturas.
C. A água infiltrou-se ao longo das fraturas existentes nas rochas que compõem o cone do vulcão de
Santa Helena.
D. A neve acumulada num glaciar no topo do vulcão começou a derreter em função do aumento da
temperatura das rochas que se encontram por baixo.
E. A água aquecida ascende ao longo das fraturas existentes no cone vulcânico.

8. Refira, no contexto do ciclo das rochas, o motivo pelo qual muitas das rochas e depósitos estudados
pelos geólogos Crandell e Mullineaux se encontravam altamente meteorizados.
Teste 3
10.º Ano de Escolaridade
Grupo I
Paleomagnetismo dos fundos oceânicos

Os desenvolvimentos tecnológicos verificados após a II Grande Guerra Mundial permitiram explorar de


uma forma mais eficaz os fundos oceânicos e obter novos dados sobre a deriva dos continentes. Os
principais avanços científicos foram a descoberta do um campo magnético terrestre, cujo polo norte
magnético varia ao longo do tempo geológico; a deteção e registo de sismos, em estações sismográficas
instaladas por todo o globo e a cartografia dos fundos oceânicos, com a datação absoluta das rochas.
A figura 1 representa o registo paleomagnético simplificado do fundo do oceano Atlântico, com indicação
da idade de algumas das rochas.

Figura 1

A taxa de expansão varia conforme os fundos oceânicos (tabela I).

Tabela I - Taxa média de expansão do fundo oceânico nos últimos milhões de anos.

Bacia oceânica Taxa de expansão (cm/ano)


Pacífico 4,5
Atlântico Norte 2
Atlântico Sul 1
Na resposta a cada um dos itens de 1. a 4., selecione a única opção que permite obter uma afirmação
correta.

1. Quando o polo norte magnético está perto do polo sul geográfico origina uma anomalia ____,
verificando-se na atualidade uma anomalia ____.
(A) negativa (…) negativa
(B) positiva (…) negativa
(C) negativa (…) positiva
(D) positiva (…) positiva

2. O fundo oceânico preserva o registo magnético pois os abundantes _____ possuem minerais
magnetizáveis que registam o campo magnético vigente _____ sua formação.
(A) granitos (…) anterior à
(B) basaltos (…) aquando da
(C) granitos (…) aquando da
(D) basaltos (…) anterior à

3. Os estratos sedimentares mais antigos presentes nas bacias oceânicas devem encontrar-se _____ das
sequências estratigráficas que se encontram mais próximas _____, onde também se encontram as
rochas mais antigas da crusta oceânica, que têm cerca de 180 a 200 M.a.
(A) na base (…) das fossas oceânicas
(B) no topo (…) das fossas oceânicas
(C) na base (…) do rifte
(D) no topo (…) do rifte

4. As placas tectónicas correspondem a fragmentos de _____ rígida que se deslocam por cima da _____.
(A) litosfera (…) crusta oceânica
(B) crusta continental (…) astenosfera
(C) crusta oceânica (…) astenosfera
(D) litosfera (…) astenosfera

5. Classifique como verdadeira (V) ou falsa (F) cada uma das seguintes afirmações.
A. Os riftes na região do Pacífico possuem maior atividade que o rifte da dorsal médio-atlântica.
B. A cartografia do paleomagnetismo nos fundos oceânicos permitiu verificar a alternância de
anomalias magnéticas sob a forma de bandas paralelas nas duas margens da dorsal médio-atlântica.
C. A expansão dos fundos oceânicos ocorre ao nível das fossas oceânicas.
D. A maioria dos sismos que ocorrem no fundo do oceano Atlântico podem ser cartografados na banda
magnética mais recente.
E. As rochas da crusta oceânica mais próximas de Portugal continental são mais recentes que as
rochas da crusta oceânica na região do arquipélago dos Açores.
F. Na região dos Açores, ao nível do rifte, o limite é do tipo divergente.
G. As bandas paleomagnéticas devem ser mais largas no fundo marinho do Atlântico Sul.
H. Nos riftes, a maioria dos sismos são gerados próximos da superfície.

6. Mencione como procederia para localizar na figura o rifte da crista médio-atlântica.

7. Uma vasta área dos fundos oceânicos encontra-se coberta com sedimentos, alguns contendo minerais
magnetizáveis, sendo, por isso, suscetíveis às inversões da polaridade do campo magnético terrestre.
Contudo, estes sedimentos não podem ser usados para datação das rochas da crusta oceânica.
Apresente uma explicação para este facto.
Grupo II
Sismos em Portugal

Os sismos são fenómenos com origem natural ou humana, que resultam da libertação súbita de energia
acumulada nas rochas.
A fraturação do material origina a libertação de energia em todas as direções, sob a forma de ondas
sísmicas que ao atingirem a superfície podem causar estragos avultados e perda de vidas humanas.
Em Portugal ocorrem sismos de forma regular, não sendo a maioria sentidos pelas populações. O sismo de
1755, e o tsunami associado, causou a maior destruição de que há registo em Portugal, tendo as vítimas
mortais ascendido a mais de 70 000, segundo estudos mais recentes. Foi um sismo muito forte, com uma
magnitude na ordem dos 8,7.
Em 1980 ocorreu um sismo nos Açores, com epicentro próximo do Faial, com uma magnitude de 7,2, que
causou 60 mortos e grandes prejuízos económicos.
Recentemente, ocorreu no dia 13 de fevereiro de 2013 um sismo com epicentro a NE de Valongo, com uma
magnitude de 3,1. A figura 2 resulta de centenas de inquéritos à população sobre as consequências deste
sismo. O Instituto Português do Mar e da Atmosfera determinou que o sismo foi originado a 7 km de
profundidade e que foi sentido com intensidade máxima III/IV (na escala de Mercalli Modificada) na
região epicentral.

Figura 2
Na resposta a cada um dos itens de 1. a 5., selecione a única opção que permite obter uma afirmação
correta.

1. Com base nos relatos é possível determinar a _____ dos sismos, indicador da _____.
(A) magnitude (…) energia libertada (C) magnitude (…) destruição causada
(B) intensidade (…) destruição causada (D) intensidade (…) energia libertada

2. Com base nos dados, é possível concluir que…


(A) … a intensidade diminui nas regiões mais próximas do epicentro.
(B) … a intensidade é constante, independentemente da distância ao epicentro.
(C) … nas regiões mais afastadas do epicentro, como por exemplo Bragança, o sismo não foi sentido.
(D) … o sismo foi pouco intenso pois ocorreu a profundidades reduzidas.

3. A intensidade sísmica é um valor que _____ com a distância ao epicentro, enquanto que a magnitude
é um valor _____ para um dado sismo.
(A) varia (…) variável (C) não varia (…) fixo
(B) não varia (…) variável (D) varia (…) fixo

4. O sismo de Valongo deverá estar associado…


(A) … à atividade vulcânica. (C) … à atividade tectónica.
(B) … ao abatimento de minas. (D) … ao enchimento de uma barragem.

5. As ondas P distinguem-se das ondas superficiais por…


(A) … a sua velocidade não ser constante.
(B) … serem de grande amplitude.
(C) … se propagarem apenas em meios sólidos.
(D) … a sua velocidade ser sempre constante.

6. Ordene as letras de A a E de modo a reconstituir a sequência cronológica dos acontecimentos


responsáveis pela ocorrência do sismo de Valongo.
A. Sismógrafos em Espanha registam as ondas.
B. As ondas sísmicas atingem o epicentro.
C. Perceção do sismo no Porto.
D. Rutura das rochas a 7 km de profundidade.
E. Propagação das ondas P e S a partir do hipocentro.

7. Faça corresponder a cada uma das afirmações da coluna A um dos números da coluna B.
Coluna A Coluna B

(a) Propagam-se através do interior da Terra.


(b) São ondas de compressão.
(c) Apresentam reduzida velocidade de propagação e grande
amplitude.
(d) São as que apresentam maior velocidade de propagação.
(1) Ondas superficiais
(e) Provocam vibração dos materiais apenas na superfície da
(2) Ondas P
Terra.
(3) Ondas P e S
(f) A sua velocidade de propagação é constante.
(g) A velocidade de propagação diminui no núcleo externo da
Terra.
(h) A descontinuidade de Moho é marcada por um aumento da
sua velocidade de propagação de 6,5 km/s para 8 km/s.

8. A distribuição dos sismos no globo e a sua profundidade não é uniforme. Explique por que motivo os
sismos mais profundos (até 600 km) ocorrem nas fossas oceânicas.
Grupo III
Modelo da estrutura interna da Terra

A partir do estudo da velocidade de propagação das ondas sísmicas é possível inferir sobre o estado físico
dos materiais em profundidade, a sua densidade e a sua rigidez. A sismologia também é essencial para
estudar a composição química dos materiais.
Admite-se que o manto superior seja essencialmente constituído por uma rocha ígnea ultrabásica – o
peridotito. Esta rocha é fundamentalmente composta por minerais ferromagnesianos como as olivinas,
piroxenas e anfíbolas.
Diversos estudos experimentais provam que a composição mineralógica do peridotito varia com a
profundidade, em função da pressão. Os cientistas admitem que, apesar de haver alterações mineralógicas,
não se verificam modificações importantes na composição química do manto superior para o inferior.
Várias décadas após a descoberta da expansão dos fundos oceânicos e da aceitação da Teoria da Tectónica
de Placas, permanece por esclarecer como se processa a convecção mantélica e de que forma este processo
é o motor responsável pela mobilidade litosférica e que, em última análise, é a causa da atividade tectónica.

Figura 3 (A) Variação da velocidade das ondas S até a profundidade de 900 km. (B) Modificações na
estrutura cristalina do mineral olivina com o aumento da profundidade.

Na resposta a cada um dos itens de 1. a 4., selecione a única opção que permite obter uma afirmação
correta.

1. Os dados apresentados na figura 3 enquadram-se nos métodos _____ do estudo do interior da Terra e
provam que ____.
(A) diretos (…) a litosfera assenta sobre uma camada muito rígida
(B) indiretos (…) a rigidez do manto é uniforme
(C) diretos (…) o manto inferior é mais rígido do que o manto superior
(D) indiretos (…) a partir dos 700 km de profundidade a rigidez dos materiais aumenta

2. Por volta dos 400 km de profundidade ocorre um aumento da velocidade das ondas S, em resultado…
(A) … da maior plasticidade das rochas.
(B) … de modificações químicas significativas.
(C) … da maior compactação dos minerais de olivina, que aumentam a rigidez das rochas.
(D) … de o material se encontrar fundido.
3. Para além da sismologia, o estudo dos meteoritos também permitiu inferir a composição química do
núcleo da Terra, tendo-se concluído que é composto essencialmente por ____, possuindo o núcleo
uma composição semelhante aos ____.
(A) ferro e níquel (…) siderólitos
(B) ferro e níquel (…) sideritos
(C) ferro e alumínio (…) sideritos
(D) níquel e alumínio (…) siderólitos

4. Observe os seguintes gráficos, respeitantes à composição de diferentes camadas internas da Terra.

(I) (II)

(III) (IV)

A composição química da crusta continental até aos 35 km de profundidade poderá ser representada
pelo gráfico ____; entre os 200 e os 900 km o gráfico que melhor traduz a composição do manto é o
____ .
(A) I (…) IV (C) III (…) II
(B) II (…) IV (D) II (…) III

5. Relacione a distribuição mundial dos sismos com a tectónica de placas.

6. Faça corresponder a cada uma das letras de (a) a (e), que identificam afirmações relativas ao
comportamento das ondas sísmicas no interior da geosfera, o número de (1) a (8) da chave que assinala
cada uma das suas camadas. Utilize cada letra apenas uma vez.

Afirmações:
(a) Entre os 100 e os 200 km existe uma zona de baixas velocidades.
(b) Camada limitada pela descontinuidade de Gutenberg e pela descontinuidade de Lehman.
(c) Zona limitada inferiormente pela descontinuidade de Mohorovicic.
(d) Camada responsável pela geração à superfície de uma zona de sombra sísmica das ondas P.
(e) Zona em que ocorre um aumento muito acentuado da velocidade de propagação das ondas P.

Chave:
(1) Núcleo interno (4) Crusta
(2) Núcleo externo (5) Astenosfera
(3) Manto (6) Litosfera

7. Mencione o local da crusta terrestre em que é possível estar mais perto da astenosfera, que se encontra
por vezes a apenas a 20 km de profundidade.

8. Muitos pressupostos da teoria da tectónica de placas assentam na ideia de que as placas litosféricas
flutuam sobre uma zona mais plástica do manto. Explique a importância da descoberta de uma zona de
baixas velocidades como dado fundamental para a aceitação da Teoria da Tectónica de Placas.
Grupo IV
Adaptações celulares ao frio

Os seres vivos são constantemente expostos às variações dos fatores ambientais, como por exemplo a
temperatura, tendo necessidade de adaptação permanente às variações térmicas.
Um dos principais mecanismos de adaptação ocorre no tecido adiposo, formado por células adiposas –os
adipócitos – que acumulam gorduras. O tecido adiposo sofre modificações ao longo do tempo, com
aumento ou diminuição de volume, permitindo a adaptação às variações ambientais.
Para estudar as adaptações de ratinhos ao frio, uma equipa de investigadores montou uma experiência com
dois grupos de 10 ratinhos:
• o grupo A foi exposto a temperaturas médias de 30 °C ao longo de 4 semanas, simulando as
condições habituais a que estes ratinhos se encontram expostos;
• o grupo B foi exposto a temperaturas médias de 4 °C ao longo das mesmas 4 semanas.

No final das 4 semanas foram recolhidas amostras de dois tipos de tecido adiposo em ambos os grupos de
ratinhos:
• WAT (White Adipose Tissue) – tecido adiposo subcutâneo, cujas células contêm apenas uma
gotícula de gordura que empurra o núcleo contra a periferia;
• BAT (Brown Adipose Tissue) – tecido adiposo de cor castanha e menos abundante que o anterior;
é particularmente abundante em recém-nascidos e animais que hibernam; as suas células contêm
várias gotículas de gordura.

As amostras foram analisadas ao microscópio de forma a quantificar e analisar a distribuição das


mitocôndrias.

Figura 4 (A) Concentração de mitocôndrias nos tecidos adiposos dos dois grupos de ratinhos. A
temperatura na barra corresponde à temperatura a que foram expostos os ratinhos ao longo de 4 semanas.
(B) Representação esquemática de células do tecido WAT.

Na resposta a cada um dos itens de 1. a 3., selecione a única opção que permite obter uma afirmação
correta.

1. As células adiposas possuem cor branca a castanha e possuem gotículas de gordura no seu citoplasma.
De acordo com a figura 4B, a área X incluirá, essencialmente…
(A) … gorduras.
(B) … sangue.
(C) … água.
(D) … fluido intersticial.
2. As gorduras são usadas como substâncias de reserva nos animais, pois…
(A) … possuem uma importante função hormonal.
(B) … podem ser usadas na produção de energia.
(C) … são insolúveis em água.
(D) … são biomoléculas complexas.

3. O corte ao longo da linha FG representado na figura 4B foi analisado ao microscópio ótico composto,
correspondendo à secção…

(A)

(B)

(C)

(D)

4. Classifique como verdadeira (V) ou falsa (F) cada uma das seguintes afirmações, tendo em conta os
dados fornecidos.
A. O WAT é o tecido adiposo que responde de forma mais eficaz às temperaturas mais baixas.
B. O tecido BAT de ratinhos expostos a 30 °C possui maior teor de mitocôndrias, quando comparado
com o tecido WAT dos ratinhos expostos a 4 °C.
C. A temperatura é a variável experimental da experiência cujos dados se encontram representados na
figura 4A.
D. O controlo experimental corresponde à exposição dos ratinhos a temperaturas na ordem dos 30 °C.
E. A experiência analisada permite analisar o efeito da ação de fatores bióticos sobre os organismos.
F. Se degradássemos as gotículas de gordura das células de tecido adiposo obteríamos uma elevada
concentração de aminoácidos.
G. Nas experiências a que se reportam os dados da figura 4A podiam usar-se as bactérias em vez dos
ratinhos.
H. É importante expor os dois grupos de ratinhos 4 semanas às condições descritas, de forma a
garantir que são observadas diferenças significativas no número de mitocôndrias presentes nos
tecidos.

5. Os termos seguintes identificam níveis de organização biológica e estão associados ao exemplo descrito
no texto. Ordene as letras de A a E de acordo com o grau de complexidade crescente.
A. Ratinho
B. Triglicerídeos presentes nas gotículas de gorduras
C. Tecido adiposo
D. Adipócito
E. Mitocôndrias

6. Relacione o aumento do número de mitocôndrias com a exposição ao frio.

7. Imagine que pretende identificar a presença de hidratos de carbono, lípidos e proteínas num adipócito.
Elabore uma breve descrição de um procedimento laboratorial para identificação das biomoléculas
mencionadas.
Teste 4
10.º Ano de Escolaridade
Grupo I
“Jardins do diabo”

Os “jardins do diabo” são amplas zonas da floresta amazónica, quase exclusivamente dominadas por uma
espécie de planta, a Duroia hirsuta. De acordo com as lendas dos nativos, estas regiões foram cultivadas
por espíritos malignos da floresta.
Uma equipa de investigação, liderada Deborah Gordon e Michael Greene, foi capaz de explicar a formação
dos “jardins do diabo”. Suspeitando que eram as formigas da espécie Myrmelachista schumanni, que usam
estas plantas para construir as suas colónias, implementaram uma experiência simples para estudar este
fenómeno numa região de selva no Peru.
Plantaram duas plantas da espécie Cedrela odorata em 20 “jardins do diabo”, sabendo que estas plantas
não são usadas pelas formigas para construir os seus ninhos. Numa das plantas de cada “jardim do diabo”
foi colocado um anel na base do caule contendo inseticida, enquanto a outra planta se encontrava
desprotegida (sem anel).
Foram plantadas mais duas plantas da espécie Cedrela odorata nas imediações de cada um dos “jardins do
diabo”, encontrando-se uma das plantas protegida dos insetos do solo com um anel de inseticida e a outra
planta desprotegida. A montagem experimental encontra-se representada na figura 1A.
Os investigadores observaram a atividade das formigas nas folhas das Cedrela odorata e mediram as áreas
foliares mortas, encontrando-se os resultados expressos na figura 1B.

Figura 1

Os investigadores analisaram os compostos químicos produzidos pelas formigas e verificaram que era
essencialmente ácido fórmico. Este composto é tóxico para as plantas logo ao fim de algumas horas após o
contacto com as células e tecidos.

Na resposta a cada um dos itens de 1. a 6., selecione a única opção que permite obter uma afirmação
correta.

1. A hipótese de trabalho dos investigadores era que…


(A) … as formigas que habitam a planta Duroia hirsuta produzem químicos que estimulam o
crescimento desta espécie de planta.
(B) … as formigas que habitam a planta Cedrela adorata produzem químicos que causam a morte de
outras espécies vegetais.
(C) …as formigas que habitam a planta Duroia hirsuta produzem químicos que causam a morte de
outras espécies vegetais.
(D) … as plantas da espécie Cedrela adorata não se desenvolvem em locais onde existam plantas da
espécie Duroia hirsuta.
2. Com base nos dados experimentais é possível afirmar que as plantas Duroia hirsuta…
(A) … e Cedrela odorata têm uma relação de competição.
(B) … produzem compostos que inibem o crescimento de outras plantas.
(C) … e as formigas têm uma relação de competição.
(D) … não produzem compostos que inibem o crescimento de outras plantas.

3. A principal conclusão do estudo é que…


(A) … as formigas que constroem os ninhos nas plantas Cedrela odorata envenenam plantas de outras
espécies vizinhas, impedindo a sua reprodução e assegurando que apenas as plantas que habitam
crescem.
(B) …as formigas que constroem os ninhos nas plantas Duroia hirsuta envenenam plantas de outras
espécies vizinhas, impedindo a sua reprodução e assegurando que apenas as plantas que habitam
crescem.
(C) … o ácido fórmico não atua como herbicida.
(D) … as plantas da espécie Duroia hirsuta são menos sensíveis ao ácido fórmico do que as da espécie
Cedrela odorata.

4. A experiência permite investigar os fatores ____ responsáveis pela ____ dos seres vivos.
(A) bióticos (…) distribuição
(B) abióticos (…) distribuição
(C) bióticos (…) aclimatação
(D) abióticos (…) aclimatação

5. O controlo experimental desta experiência corresponde à colocação de…


(A) ... uma planta Cedrela odorata dentro dos “jardins do diabo” sem o anel inseticida.
(B) ... um anel com inseticida numa planta Cedrela odorata dentro dos “jardins do diabo”.
(C) ... duas plantas Cedrela odorata, uma com anel inseticida e outra sem anel, dentro dos “jardins do
diabo”.
(D) ... duas plantas Cedrela odorata, uma com anel inseticida e outra sem anel, fora dos “jardins do
diabo”.

6. Imagine que era um investigador e que realizava uma outra experiência em que as plantas de Cedrela
odorata eram plantadas em “jardins do diabo” nos quais as formigas tinham sido todas eliminadas.
Seria expectável que…
(A) … as formigas usassem o seu veneno natural para matar as plantas de Duroia hirsuta.
(B) … não se tivessem verificado diferenças para as plantas de Cedrela odorata plantadas fora dos
jardins.
(C) … as plantas plantadas fora dos “jardins do diabo” tivessem uma taxa de necrose (morte) foliar
superior.
(D) … os “jardins do diabo” fossem compostos no final apenas por Cedrela odorata.

7. Classifique como verdadeira (V) ou falsa (F) cada uma das seguintes afirmações relativas à composição
e diversidade celular.
A. Ao contrário das células bacterianas e células animais, as células vegetais possuem parede celular.
B. O principal constituinte da parece celular de uma célula vegetal é a celulose.
C. Podemos encontrar mitocôndrias em qualquer tipo de célula.
D. Uma das características que distingue as células eucarióticas das procarióticas é a presença de
sistemas endomembranares.
E. Os principais constituintes das membranas plasmáticas são as proteínas e os glícidos.
F. Os lípidos mais abundantes nas paredes celulares das células bacterianas designam-se fosfolípidos.
G. Nas células bacterianas, o material genético encontra-se disperso pelo citoplasma.
H. As células vegetais possuem plastos.

8. Foi descoberta uma colónia de formigas com mais de 800 anos de idade, com milhares de formigas
rainhas e milhões de obreiras, ocupando cerca de 351 Duroia hirsuta.
Relacione estes dados com a estratégia das formigas descrita nos dados experimentais.
Grupo II
Transporte de glicose e a diabetes

Após uma refeição rica em hidratos de carbono, os níveis de glucose no sangue aumentam
significativamente. Todavia, estes níveis altos podem ser tóxicos, pelo que excesso de glucose é retirado da
circulação sanguínea, principalmente através das células do tecido cardíaco e do tecido muscular.
Estas células possuem um transportador transmembranar, o GLUT4, que está normalmente presente em
membranas de vesículas do sistema endomembranar. Quando os níveis de glucose no sangue aumentam, a
insulina libertada pelo pâncreas na corrente sanguínea atinge estas células, provocando a fusão dessas
vesículas que contêm o GLUT4 com a membrana celular. O transportador GLUT4 liga-se às moléculas de
glucose e transporta-as para o interior da célula, onde são convertidas num polissacarídeo. O transporte da
glucose para o interior da célula ocorre por difusão facilitada ou por transporte ativo, acoplado ao
transporte do ião sódio.
Quando entre as refeições os níveis de glucose no sangue regressam ao normal, o pâncreas reduz a
produção de insulina e os transportadores GLUT4 que se encontravam nas membranas plasmáticas são
sequestrados em vesículas, ficando retidas no citoplasma.
Em indivíduos com diabetes do tipo I, o pâncreas do organismo não liberta insulina suficiente para o
sistema sanguíneo.

Figura 2

Na resposta a cada um dos itens de 1. a 3., selecione a única opção que permite obter uma afirmação
correta.

1. O aumento da concentração de insulina no sangue…


(A) … estimula o transporte de glucose por exocitose.
(B) … inibe a fusão de vesículas contendo o transportador GLUT4.
(C) … estimula o transporte de glucose pela proteína GLUT4 para o interior da célula.
(D) … inibe o transporte de glucose por endocitose.
2. O transporte de glicose representado na figura 2 pode ser contra o seu gradiente de concentração,
sendo do tipo ____ e caracterizando-se por ____ de energia.
(A) ativo (…) um consumo
(B) passivo (…) produção
(C) ativo (…) produção
(D) passivo (…) um consumo

3. Em indivíduos com diabetes tipo I, o número de transportadores GLUT4 nas membranas das células
musculares é ____ o que provoca ____ da concentração de glucose no sangue.
(A) reduzido (…) um aumento
(B) reduzido (…) uma diminuição
(C) elevado (…) um aumento
(D) elevado (…) uma diminuição

4. Ordene as letras de A a E de modo a reconstituir a sequência cronológica de acontecimentos que dizem


respeito ao transporte por difusão facilitada da glucose para o interior de uma célula após a refeição.
A. Ligação da glucose ao transportador GLUT4.
B. Aumento da produção de insulina após o organismo detetar aumento do teor de glucose no sangue.
C. Digestão de um hidrato de carbono complexo.
D. Fusão de vesículas endocíticas com a membrana plasmática.
E. Absorção da glucose para a corrente sanguínea.

5. Classifique como verdadeira (V) ou falsa (F) cada uma das seguintes afirmações.
A. O transportador de glucose corresponde a uma proteína transmembranar.
B. Na maioria dos seres vivos heterotróficos multicelulares a digestão é intracelular.
C. A digestão extracelular ocorre no interior dos lisossomas.
D. A glucose é armazenada nas células animais sob a forma de amido, cuja composição é semelhante
ao glicogénio.
E. A glucose é um monómero que resulta da digestão de hidratos de carbono mais complexos.
F. No Homem a digestão ocorre ao longo de um tubo digestivo completo.
G. As vilosidades e as válvulas coniventes aumentam a eficácia de absorção do intestino humano.
H. A fagocitose permite a absorção de compostos por transporte ativo.

6. Com base nos dados, explique a necessidade de os diabéticos de tipo I controlarem de forma muito
rigorosa a quantidade de açúcar que consomem às refeições.

7. As afirmações seguintes dizem respeito ao transporte nos animais. Selecione a alternativa que as avalia
corretamente.
1. O Homem possui um sistema circulatório aberto, onde todo o percurso do sangue é feito dentro de
vasos, não se misturando com o fluido intersticial.
2. O sistema de transporte do Homem permite a distribuição de nutrientes e oxigénio e a remoção de
produtos de excreção.
3. Ao contrário dos répteis, o Homem possui uma circulação dupla e completa, não ocorrendo mistura
de sangue venoso com sangue arterial, o que potencia a taxa metabólica.

(A) 1 é verdadeira; 2 e 3 são falsas.


(B) 3 é falsa; 1 e 2 são verdadeiras.
(C) 2 é verdadeira; 1 e 3 são falsas.
(D) 1 é falsa; 2 e 3 são verdadeiras.
Grupo III
Transportes nas plantas

O transporte de água e de solutos no interior da planta, através de vasos condutores, foi uma condição
essencial para a colonização do meio terrestre.
O esquema da figura 3 ilustra uma secção de um corte transversal da raiz de uma planta, evidenciando os
potenciais eletroquímicos em diferentes regiões da raiz, para os iões cloro (Cl–) e potássio (K+),
determinados por Dunlop e Bowling (1971).
Quanto maior o potencial eletroquímico, maior a concentração do respetivo ião.

Figura 3

Na resposta a cada um dos itens de 1. a 4., selecione a única opção que permite obter uma afirmação
correta.

1. Na figura 3, a deslocação dos iões cloro e potássio do solo para o interior da raiz ocorre ____ gradiente
químico, ____ gasto de energia metabólica nesse processo.
(A) contra o (…) havendo
(B) a favor do (…) havendo
(C) contra o (…) não havendo
(D) a favor do (…) não havendo

2. De acordo com os resultados de Dunlop e Bowling, a entrada de iões cloro e potássio para o interior dos
vasos xilémicos a partir das células adjacentes deverá ocorrer por transporte _____. O movimento de
água para o xilema, em consequência da acumulação de iões nos elementos de vaso, origina uma
_____, responsável em parte pela ascensão da seiva bruta.
(A) passivo (…) tensão
(B) ativo (…) tensão
(C) passivo (…) pressão radicular
(D) ativo (…) pressão radicular

3. Na figura 3, ao nível da epiderme existem pelos radiculares que…


(A) … aumentam a superfície de absorção de sais minerais e água para o floema.
(B) … são estruturas formadas por várias células.
(C) … aumentam a superfície de absorção de sais minerais e água para o xilema.
(D) … aumentam a pressão radicular, favorecendo a translocação xilémica.
4. A existência de espessamentos de lenhina na endoderme força a passagem da água e de iões através
____, facto que ____ o livre-trânsito de algumas substâncias entre o córtex e o cilindro central.
(A) do interior das células (…) impede
(B) do interior das células (…) favorece
(C) das paredes celulares e dos espaços intercelulares (…) favorece
(D) das paredes celulares e dos espaços intercelulares (…) impede

5. As plantas, através da fotossíntese, produzem açúcares que são transportados para todos os tecidos do
organismo. Classifique como verdadeira (V) ou falsa (F) cada uma das afirmações seguintes, relativas à
fotossíntese.
A. A fase fotoquímica ocorre nos tilacoides dos cloroplastos.
B. A radiação luminosa é absorvida pelas clorofilas que se encontram nas membranas dos tilacoides.
C. O oxigénio libertado durante a fotossíntese tem origem no CO2 que é absorvido.
D. O ciclo de Calvin antecede a formação de compostos energéticos como o ATP e o NADPH.
E. A formação de hidratos de carbono durante o ciclo de Calvin ocorre no estroma dos cloroplastos.
F. Os hidratos de carbono sintetizados são armazenados sob a forma de glicogénio.
G. A fixação do CO2 atmosférico ocorre durante a fase fotoquímica.
H. Como produtos finais da fotossíntese formam-se polímeros como a glicose e a frutose.

6. Ordene as letras de A a E, de modo a reconstituir a sequência cronológica dos acontecimentos


associados à translocação da seiva no floema.
A – A água desloca-se por osmose para as células com elevado potencial de soluto.
B – As células dos tubos crivosos tornam-se hipertónicas.
C – A seiva é forçada a deslocar-se ao longo dos vasos floémicos.
D – Entrada da sacarose no floema por transporte ativo.
E – Aumenta a pressão de turgescência no interior dos tubos crivosos.

7. Refira, com base nos dados apresentados, a importância da presença de oxigénio no solo para a
manutenção da pressão radicular.

8. Com o objetivo de estudar os fatores que interferem na translocação da seiva, submeteu-se uma secção
de um tronco de uma árvore a uma temperatura de 100 °C. Ao fim de algum tempo verificou-se que,
relativamente à translocação da seiva xilémica, não houve alterações, tendo-se verificado, contudo, que
a translocação da seiva floémica foi interrompida.
Apresente uma explicação para os resultados obtidos tendo em conta as características das células do
floema e do xilema.
Grupo IV
Atividade sísmica nos Açores

O arquipélago dos Açores localiza-se no oceano Atlântico, a cerca de 1500 km do continente Europeu e a
3900 km do subcontinente Norte-Americano. Este arquipélago é constituído por 9 ilhas e diversos ilhéus.
As ilhas açorianas encontram-se no “planalto” dos Açores, uma zona espessa e irregular do fundo oceânico,
com profundidades médias de 2000 m. Os investigadores defendem que a formação deste planalto
submarino deve ter estado associada a um ponto quente próximo da junção tripla de três placas
litosféricas.
As principais estruturas tectónicas incluem o rifte oceânico, a zona de fratura Açores-Gibraltar, que inclui o
rifte da Terceira (RT) e a falha Glória. Já foram catalogados diversos vulcões submarinos ao longo destas
estruturas tectónicas. O rifte da Terceira possui uma pequena taxa de expansão anual.
Este enquadramento tectónico altamente complexo explica a sismicidade e vulcanismo intenso na região.
Desde o povoamento das ilhas, há centenas de anos, ocorreram mais de 30 sismos fortes resultando em
milhares de vítimas mortais e perdas materiais.
Em 1998, as ilhas do Faial e do Pico foram abaladas por um sismo de magnitude 5,8, que causou 8 mortos
e desalojou mais de 1500 pessoas.

Figura 4 (A) Enquadramento tectónico do arquipélago dos Açores. (B) Atividade sísmica nos Açores nos
últimos 30 anos (os pontos são epicentros dos sismos registados).

Na resposta a cada um dos itens de 1. a 4., selecione a única opção que permite obter uma afirmação
correta.

1. A zona de fratura Açores-Gibraltar é um limite do tipo ____ e corresponde ao limite entre a placa
____.
(A) divergente (…) africana e euroasiática
(B) conservativo (…) africana e euroasiática
(C) divergente (…) africana e americana
(D) convergente (…) africana e americana

2. As ilhas açorianas estão dispersas ao longo de um alinhamento ____ que coincide com um importante
limite ____ na região.
(A) SE-NW (…) divergente
(B) NE-SW (…) transformante
(C) NW-SE (…) divergente
(D) NW-SE (…) transformante
3. O registo do epicentro dos sismos nos últimos 30 anos nos Açores permite concluir que…
(A) … todos os sismos estão mais próximo do rifte da Terceira.
(B) … a maioria dos sismos está associada ao vulcanismo submarino muito comum na região.
(C) … a maioria da atividade sísmica ocorre ao longo do rifte da Terceira e do rifte da dorsal médio-
oceânica.
(D) … apenas ocorre atividade sísmica associada ao rifte da dorsal médio-oceânica.

4. A melhor explicação para o registo de ondas P e para a ausência de registo de ondas S numa estação
sismográfica distanciada do epicentro de um sismo gerado na região dos Açores será pelo facto de as
ondas S deixarem de se propagar ao atravessarem o limite…
(A) … crusta continental/manto.
(B) … núcleo externo/núcleo interno.
(C) … crusta continental/crusta oceânica.
(D) … manto/núcleo externo.

5. Faça corresponder cada uma das descrições expressas na coluna A à respetiva designação, que consta
na coluna B. Utilize cada letra e cada número apenas uma vez.

Coluna A Coluna B
(a) Permite a deteção e registo dos movimentos bruscos da
(1) Ondas P
litosfera.
(2) Ondas S
(b) Abalo sísmico de menor intensidade que pode ocorrer
(3) Ondas superficiais
depois do abalo sísmico principal.
(4)Isossista
(c) A vibração das partículas ocorre paralelamente à direção
(5) Réplica
de propagação da onda.
(6)Sismograma
(d) A vibração das partículas ocorre perpendicularmente à
(7) Sismógrafo
direção de propagação da onda.
(8)Abalo premonitório
(e) São ondas lentas e de grande amplitude e a sua velocidade
de propagação é constante.

6. A primeira erupção observada nos Açores ocorreu no século XV, tendo sido registadas pelo menos 28
erupções até à atualidade. Muitas destas erupções causaram vítimas humanas e perdas de bens
materiais.
Classifique como verdadeira (V) ou falsa (F) cada uma das afirmações seguintes, relativas ao
vulcanismo açoriano.
A. As lavas associadas às erupções efusivas têm origem em magmas básicos e apresentam um menor
teor em gases e elementos voláteis.
B. As escoadas lávicas são características de erupções explosivas nos Açores.
C. A lava encordoada e a lava escoriácea presentes em diversos locais das ilhas resultaram de magmas
mais ácidos.
D. A formação de agulhas e domos é comum em vulcões cujo magma associado é muito viscoso e são
frequentes nos Açores.
E. As lavas em almofada que se encontram em algumas ilhas açorianas resultaram de erupções
submarinas.
F. A existência de caldeiras vulcânicas preenchidas por lagos pode aumentar o risco vulcânico das
Açores.
G. O vulcanismo do tipo serretiano caracteriza-se por magmas contendo poucos gases e sem elementos
voláteis dissolvidos.
H. A atividade vulcânica nos Açores está limitada a fumarolas e nascentes termais.

7. Segundo os registos históricos, a maioria das erupções açorianas são submarinas. A erupção dos
Capelinhos, na ilha do Faial, em 1957 e 1958, ainda está muito presente nas recordações dos faialenses,
tendo sido uma das causas da imigração de milhares de açorianos para a América.
Apresente uma justificação para o facto de a maioria das erupções que ocorrem nos Açores serem
submarinas.
Teste 5
10.º Ano de Escolaridade
Grupo I
Compostos químicos envolvidos na fotossíntese
O estudo dos compostos químicos envolvidos no processo fotossintético pode ser realizado com
experiências simples. Na figura 1 está representada uma experiência em que foram isolados cloroplastos
que se encontravam dispersos no citoplasma com pH 7. Depois de isolados, os cloroplastos foram
colocados numa solução ácida com pH 4. Posteriormente, os cloroplastos foram transferidos para uma
solução com pH 8. Toda a experiência foi realizada no escuro, para permitir trabalhar apenas com uma
variável experimental.

Figura 1

A equipa de investigadores colocou a solução com os cloroplastos à luz e, após várias horas de exposição,
destruiu os cloroplastos. Usando técnicas de separação subcelulares obteve amostras purificadas de
proteínas, polissacarídeos e ácidos nucleicos, cuja análise química se encontra na tabela I. A amostra de
ácidos nucleicos é constituída apenas por DNA.
Tabela I - Resultados das análises químicas a três dos compostos isolados a partir dos cloroplastos.

Amostra Carbono (%) Hidrogénio (%) Oxigénio (%) Azoto (%) Enxofre (%) Fósforo (%)

A 27 49 24 0 0 0

B 29 49 13 8 1 0

C 35 21 26 14 0 4

Na resposta a cada um dos itens de 1. a 4., selecione a única opção que permite obter uma afirmação
correta.
1. Com base nos resultados, cientistas verificaram que os cloroplastos…
(A) … produziram ATP em resultado do gradiente de protões gerado pela diferença de pH entre o
interior dos cloroplastos e o meio, na presença de luz artificial.
(B) … produziram ATP no escuro, em resultado do gradiente de protões gerado pela diferença de pH
entre o interior dos cloroplastos e o meio.
(C) … precisam de uma fonte luminosa para produzirem ATP.
(D) … produzem ATP quando colocados num meio com pH inferior a 7.
2. Das amostras que constam na tabela, aquela que provavelmente diz respeito a proteínas é a…
(A) … C, pois é a única que possui fósforo, um dos constituintes dos aminoácidos.
(B) … A, uma vez que é a única que não possui azoto.
(C) … B, dado que esta amostra contém azoto e enxofre, mas não tem fósforo.
(D) … C, pois é a que possui maior percentagem de azoto, um dos constituintes dos aminoácidos.

3. Se a amostra de ácidos nucleicos fosse composta por RNA, seria possível distingui-la da amostra de
DNA por…
(A) … apresentar igual quantidade de timina e uracilo.
(B) … a molécula ser composta por duas cadeias de nucleótidos em hélice.
(C) … na sua constituição serem encontradas bases de timina.
(D) … integrar na sua constituição bases de uracilo.

4. Se marcássemos radioativamente a água do meio em que se encontram os cloroplastos com 18O, seria
esperado encontrar radioatividade ____, e a marcação radioativa do carbono presente no CO2
originaria no final radioatividade ____.
(A) no oxigénio libertado (…) na glucose – 14C6H12O6 – produzida
(B) na glucose – C6H1218O6 - (…) no oxigénio libertado
(C) no oxigénio libertado (…) no oxigénio libertado
(D) na glucose – C6H1218O6 - (…) na glucose – 14C6H12O6 – produzida

5. Mencione o processo associado à obtenção de ATP que ocorre durante a fotossíntese nas membranas
dos tilacoides.

6. Classifique como verdadeira (V) ou falsa (F) cada uma das afirmações seguintes relativas à experiência
descrita e ao processo fotossintético.
A. As proteínas que integram a membrana dos cloroplastos são biomoléculas que se formam a partir
do estabelecimento de ligações peptídicas entre aminoácidos.
B. Os cloroplastos usados na experiência podiam ter sido obtidos a partir de células do xilema de uma
planta.
C. Tal como as proteínas, os lípidos também desempenham importantes funções estruturais.
D. As células usadas na experiência são eucariontes, cujo material genético existe apenas no núcleo.
E. As biomoléculas analisadas foram extraídas a partir de um organismo decompositor, que ocupa
níveis tróficos superiores a um ser vivo heterotrófico.
F. Na fotossíntese o fluxo de eletrões ocorre na sequência: H2O→ NADPH→ Ciclo de Calvin.
G. A variável experimental da experiência corresponde às diferenças na síntese de ATP.
H. A principal conclusão da experiência é que a síntese de ATP está dependente da existência de um
gradiente de protões e que não está dependente da ação direta da luz.

7. Um dos primeiros procedimentos laboratoriais para separar as biomoléculas passa por adicionar
compostos que funcionam como detergentes e que destroem as membranas das células. Relacione este
dado com a composição das membranas celulares.

8. Faça corresponder a cada uma das descrições expressas na coluna A o respetivo organelo que consta na
coluna B. Utilize cada letra e cada número apenas uma vez.

Coluna A Coluna B

(a) Plasto onde se gera um gradiente de protões H+ associado à


(1) Mitocôndrias
fosforilação do ADP.
(2) Cloroplastos
(b) Estrutura formada por uma bicamada fosfolipídica associada
(3) Vacúolos
a hidratos de carbono e proteínas.
(4) Retículo endoplasmático
(c) Organelo que contém enzimas proteolíticas envolvidas em
(5) Complexo de Golgi
processos de digestão intracelular.
(6) Núcleo
(d) Organelo em que são adicionados novos grupos químicos às
(7) Membrana plasmática
proteínas, conferindo-lhes funções específicas.
(8) Lisossomas
(e) Têm funções de armazenamento e nas plantas possuem
grandes dimensões.
Grupo II
Absorção de glucose no intestino

A matéria obtida pelos organismos heterotróficos é essencialmente composta por moléculas de grandes
dimensões e elevada complexidade. Durante a digestão ocorre simplificação molecular, quebrando parte
das ligações químicas. As moléculas resultantes deste mecanismo são depois conduzidas às células por um
eficaz sistema de transporte.
O transporte de nutrientes do lúmen do intestino humano para a corrente sanguínea implica uma série de
transportadores transmembranares específicos, localizados na membrana das células do epitélio intestinal
(fig. 2).

Figura 2

Na resposta a cada um dos itens de 1. a 3., selecione a única opção que permite obter uma afirmação
correta.

1. A figura 2 representa uma seção de um organismo que apresenta um sistema digestivo _______, e de
um sistema circulatório duplo _______.
(A) completo (…) aberto. (C) completo (…) fechado.
(B) incompleto (…) fechado. (D) incompleto (…) aberto.

2. As microvilosidades têm uma forma semelhante a projeções de dedos, cuja principal função é…
(A) … aumentar a capacidade de absorção de proteínas do sangue para o lúmen intestinal.
(B) … diminuir o número de transportadores membranares envolvidos na absorção de glucose.
(C) … permitir o transporte de glucose para a corrente sanguínea, contra o seu gradiente de
concentração.
(D) … aumentar a superfície de absorção do epitélio intestinal do lúmen para a corrente sanguínea.

3. As enzimas no intestino catalisam os estádios finais da digestão das proteínas e dos polissacarídeos a,
respetivamente,…
(A) … péptidos e monossacarídeos.
(B) … ácidos gordos e monossacarídeos.
(C) … ácidos gordos e peptídios.
(D) … aminoácidos e ácidos gordos.
4. Faça corresponder a cada uma das afirmações identificadas pelas letras de A a H um dos números
romanos da chave que as permite avaliar.

Afirmações:
A. O transporte de glucose na membrana apical é facilitado, usando a energia que se encontra
“armazenada” no gradiente de concentração de sódio.
B. O transportador GLUT2 transporta a glucose para o sistema sanguíneo de forma passiva.
C. A bomba de sódio e potássio bombeia o sódio para o espaço extracelular, mantendo o teor de sódio
no citoplasma reduzido.
D. A existência de um sistema linfático permite o transporte de alguns compostos de forma direta para
o fígado.
E. O transporte de glucose na membrana basal implica a atividade da bomba de sódio e potássio.
F. Na membrana apical, verifica-se a entrada de uma molécula de glucose contra o gradiente de
concentração, ao mesmo tempo que entram dois iões sódio a favor do gradiente de concentração.
G. A bomba sódio-potássio existente nestas células encontra-se exclusivamente na secção apical da
membrana plasmática.
H. O transporte de glucose do intestino para as células está dependente da energia resultante da
hidrólise de ATP pela bomba sódio-potássio.

Chave:
I. Afirmação apoiada pelos dados
II. Afirmação contrariada pelos dados
III. Afirmação sem relação com os dados

5. Mencione o tipo de transporte que ocorre na passagem do sódio do lúmen intestinal para o citoplasma.

6. Explique a importância dos transportadores membranares tendo em conta as propriedades da


membrana plasmática.

7. O epitélio intestinal é considerado um tecido formado por células polarizadas, com significativas
diferenças estruturais ao nível das suas extremidades. Relacione este aspeto com a função destas
células do epitélio intestinal.
Grupo III
Glicólise nos crocodilos

A maioria dos vertebrados são seres aeróbios, dependendo do oxigénio para obter o máximo da energia que
necessitam a partir da oxidação da glucose.
Em situações pontuais, os vertebrados podem oxidar o piruvato, um composto intermediário da via de
degradação da glucose, a lactato. A produção deste composto ocorre quando o fornecimento de oxigénio
aos tecidos não é suficiente para permitir a degradação da glucose. Nestas situações, os vertebrados usam a
glucose armazenada nos tecidos, degradando-a para obter energia através da fermentação láctica.
O lactato que se acumula nos tecidos musculares passa para o sistema sanguíneo e, durante o período de
repouso, é convertido no fígado novamente a glucose, com consumo de energia. Esta via bioquímica foi
caracterizada nas décadas de 30 e 40 do século passado por Carl e Gerty Cori, sendo conhecida por ciclo de Cori.
O sistema circulatório da maioria dos pequenos vertebrados consegue transportar oxigénio de forma
eficiente, reduzindo ao máximo a necessidade de recorrer à fermentação láctica e ao ciclo de Cori. Por
exemplo, as aves conseguem voar longas distâncias e períodos sem necessitarem de descanso.
Os vertebrados maiores, nos quais se inclui o Homem, têm maior dificuldade em fornecer eficazmente
oxigénio às células nos períodos de intensa atividade física. Estes organismos tendem a deslocar-se mais
lentamente, com picos curtos de maior atividade. Os crocodilos levaram este processo ao extremo: passam
longos períodos sem se mexerem, mas são capazes de realizar movimentos rápidos e curtos, aos quais se
segue um longo período de repouso. A produção de energia nos tecidos musculares dos crocodilos depende
essencialmente da fermentação láctica.

Na resposta a cada um dos itens de 1. a 4., selecione a única opção que permite obter uma afirmação correta.

1. Os organismos _____ convertem a glucose a piruvato através da glicólise e usam o oxigénio para a
oxidação do piruvato a ______.
(A) aeróbios (…) CO2 (C) aeróbios (…) CO2 e H2O
(B) anaeróbios (…) CO2 (D) anaeróbios (…) CO2 e H2O

2. Em vertebrados como o ser humano, a fermentação láctica permite obter o máximo de energia em
condições de ____ eficácia no fornecimento de oxigénio aos tecidos, como por exemplo durante
exercício físico muito intenso, degradando a glucose que estava acumulada sob a forma de ____.
(A) grande (…) glicogénio (C) grande (…) amido
(B) reduzida (…) amido (D) reduzida (…) glicogénio

3. A regeneração do ATP a partir do ADP + Pi está associada a vias metabólicas _____ que estão ativas
nas mitocôndrias, que implicam a ______ da glucose.
(A) anabólicas (…) degradação (C) catabólicas (…) produção
(B) catabólicas (…) degradação (D) anabólicas (…) produção

4. O sistema circulatório do crocodilo distingue-se do sistema circulatório das aves e do Homem por ser…
(A) … simples e incompleto. (C) … duplo e completo.
(B) … simples e completo. (D) … duplo e incompleto.

5. Ordene as letras de A a E de modo a reconstituir a sequência cronológica de acontecimentos que dizem


respeito à degradação de glucose durante a respiração celular.
A. Ao longo do Ciclo de Krebs ocorre redução das moléculas de NAD+ e FAD.
B. Formação de piruvato e regeneração de duas moléculas de ATP.
C. Consumo de duas moléculas de ATP na degradação da glucose a gliceraldeído-3-fosfato.
D. Oxidação do piruvato e conversão em acetil-CoA.
E. O composto que corresponde ao produto final da glicólise é transportado para a mitocôndria.

6. Explique qual a importância, em períodos de repouso, da conversão do lactato a glucose ao nível do


fígado, enquadrada no ciclo de Cori.

7. As explorações do fundo marinho permitiram descobrir espécies de peixes que habitam a grandes
profundidades (por vezes a mais de 4000 m) e que dependem exclusivamente dos processos
anaeróbios. Apresente uma explicação para este facto, tendo em conta os fatores abióticos a que estes
organismos estão sujeitos.
Grupo IV
Erupção do Monte Pinatubo

O monte Pinatubo é um vulcão que se localiza numa das ilhas do arquipélago das Filipinas. No dia 15 de
junho de 1991 entrou em erupção, a segunda mais intensa do século XX, a seguir à erupção do vulcão
Katmai-Novarupta, em 1912, no Alaska.
Na figura 3 encontra-se uma representação simplificada do contexto tectónico em que o monte Pinatubo se
enquadra. A tabela II apresenta alguns dos fenómenos que ocorreram, em 1990-91, no monte Pinatubo.

Figura 3 Enquadramento tectónico do monte Pinatubo.

Tabela II – Principais acontecimentos que ocorreram no monte Pinatubo entre 1990 e 1991.
Data Acontecimento
16-07-1990 Sismo de magnitude 7,8 a 100 km NE do monte Pinatubo.
Deslizamento perto do topo do vulcão; aumento da libertação de gases, na que foi
03-08-1990 considerada a primeira atividade vulcânica em mais de 400 anos. Durante o mês de
agosto ocorreram cinco sismos muito próximos do vulcão.
Libertação de uma nuvem de gases e cinzas ao longo de uma fissura com 1,5 km de
02-04-1991
comprimento. As cinzas depositaram-se a 10 km de distância do vulcão.

A atividade sísmica manteve-se elevada até este dia, tendo aumentado dez vezes o
28-05-1991
teor de dióxido de enxofre libertado pelo vulcão.

01-06-1991 Os sismos geram-se a 5 km de profundidade, por baixo do vulcão.

Emissões de dióxido de enxofre reduzem-se abruptamente, mantendo-se elevada a


05-06-1991
atividade sísmica e registando-se modificações no relevo do vulcão.
Registo de 1500 sismos que ocorreram por baixo do vulcão; formação de uma coluna
07-06-1991 eruptiva que ascendeu a 8 km de altitude na atmosfera. A lava formou um domo,
a 1 km de distância da cratera principal.
Nova libertação de dióxido de enxofre; formação de nuvens ardentes que se
09-06-1991
deslocaram ao longo da vertente.

10-06-1991 Evacuação de 14 400 pessoas de localidades próximas do vulcão.

12 a Emissão de nuvens de gases e cinzas para a atmosfera, a uma altitude superior a


14-06-1991 20 km; nuvens ardentes devastam os principais vales em redor.

No dia 15 de junho de 1991 ocorreu a erupção principal, que durou apenas 9 horas mas libertou a maioria
do material sob a forma de uma coluna eruptiva, que atingiu os 35 km na atmosfera e deslocou-se mais de
400 km. Cerca de 740 pessoas morreram e formou-se uma caldeira com 2,5 km de diâmetro. Nas
proximidades do vulcão as florestas foram enterradas sob 50 a 200 metros de depósitos de piroclastos.
As cinzas atingiram as camadas altas da atmosfera e permaneceram mais de 12 meses em redor do nosso
planeta. Para além das cinzas, foram libertadas 17 milhões de toneladas de SO2 na estratosfera, que se
converteram rapidamente em aerossóis de ácido sulfúrico (H2SO4). Este fenómeno teve impactes no clima
da Terra. Foi estimado que muitas destas partículas permaneceram mais de dois anos na atmosfera e os
aerossóis libertados na erupção reagiram com o ozono atmosférico, consumindo cerca de 2 a 3% de ozono
entre 1992-1993.

Figura 4 Impacto da erupção vulcânica do


Pinatubo na temperatura de diferentes
níveis da atmosfera.

Na resposta a cada um dos itens de 1. a 3., selecione a única opção que permite obter uma afirmação
correta.

1. A erupção do Monte Pinatubo é predominantemente do tipo _____ e o domo vulcânico que se formou
deve ter estado associado a magmas _____.
(A) explosivo (…) basálticos
(B) efusivo (…) basálticos
(C) explosivo (…) intermédios a ácidos
(D) efusivo (…) intermédios a ácidos
2. A existência de caldeiras com água torna as erupções mais perigosas porque a água…
(A) …. reage com os constituintes químicos do magma, tornando-o mais ácido e aumentando o seu
caráter explosivo.
(B) … reage com os constituintes químicos do magma, tornando-o mais fluido e aumentando o seu
caráter explosivo.
(C) … reage com os constituintes químicos do magma, tornando-o mais básico e aumentando o seu
caráter explosivo.
(D) ... ao interagir com o magma arrefece-o, tornando-o mais viscoso e rico em voláteis, aumentando o
seu caráter explosivo.
3. O enquadramento tectónico do monte Pinatubo é particularmente complexo. Contudo, os
acontecimentos geológicos associados a este vulcão parecem estar associados aos limites litosféricos do
tipo…
(A) … convergente, em que a fricção resultante do movimento das placas origina a formação de
magmas pouco viscosos e apenas sismos pouco profundos.
(B) … divergente, que originam a formação de magmas pouco viscosos e apenas sismos pouco
profundos.
(C) … convergente, em que a fricção resultante do movimento das placas origina a fusão parcial da
placa litosférica, com a formação de magmas viscosos e sismos profundos.
(D) … divergente, que originam a formação de magmas viscosos e sismos muito profundos e
devastadores.

4. Em 2009, as fortes precipitações causadas por um tufão originaram deslizamentos de terra que
soterraram 12 pessoas e destruíram algumas localidades.
Relacione as propriedades dos depósitos piroclásticos com a elevada suscetibilidade a deslizamentos de
terra em resultado da precipitação.

5. Classifique como verdadeira (V) ou falsa (F) cada uma das afirmações seguintes relativas à atividade do
monte Pinatubo.
A. O epicentro do sismo de junho de 1991 localizou-se a 5 km de profundidade.
B. O sismo que ocorreu em julho de 1990 deve ter estado associado à subida de magma na câmara
magmática.
C. A explicação mais plausível para a repentina redução da libertação de dióxido de enxofre deverá ser
a obstrução das fumarolas e sulfataras.
D. Quanto maior o tempo de permanência do magma quente na câmara magmática do monte
Pinatubo a 12 km de profundidade, maior a probabilidade de se formarem cristais de maiores
dimensões.
E. A diminuição de cerca de 2 a 3% de ozono entre 1992-1993 evidencia uma interação entre a
atmosfera e a biosfera.
F. Depois da erupção de junho de 1991 a temperatura global à superfície terá descido cerca de 0,6 ºC.
G. Os aerossóis libertados pelo vulcão devem ter refletido parte da radiação solar, reduzindo a radiação
que atingiu a atmosfera e a superfície.
H. A temperatura na estratosfera reduziu-se em resultado da erupção, tendo depois aumentado
significativamente.

6. A erupção do Pinatubo teve profundos impactes na atmosfera e estimulou a pesquisa e elaboração de


modelos científicos para relacionar a emissão de elevadas quantidades de aerossóis para a atmosfera
com as modificações climáticas.
Explique em que medida estes dados são importantes para caracterizar os efeitos da atividade vulcânica
na biosfera, nomeadamente a possível relação entre o vulcanismo intenso e a extinção dos
dinossáurios.

7. Os cientistas consideram que o maior desastre vulcânico do século XX foi evitado devido a um
planeamento e monitorização adequado. Explique a importância dos planos de monitorização em zonas
de risco geológico.
Teste 6
10.º Ano de Escolaridade
Grupo I
Modelo do mosaico fluido
Singer e Nicolson publicaram, em 1972, um modelo da estrutura da membrana plasmática que designaram
por mosaico fluido. Era sabido na época que as proteínas e os lípidos eram os principais constituintes das
membranas plasmáticas, mas a sua distribuição e função ainda era desconhecida.
Singer e Nicolson basearam o seu modelo em dados publicados em 1970 por L. D. Frye e M. Edidin. Estes
investigadores realizaram uma experiência simples usando dois tipos de células diferentes, em que as
proteínas membranares tinham sido marcadas de forma distinta com fluorescência. Após marcarem as
proteínas membranares com fluorescência, fundiram-se as células humanas e células de ratinho,
originando células hibridas.
Após a fusão, a distribuição das proteínas membranares foi seguida ao longo de várias horas, através da
fluorescência emitida. As células que apresentavam mistura de fluorescência proveniente das células
humanas e das células do ratinho foram classificadas como células-mosaico.

L. D. Frye e M. Edidin repetiram a experiência anterior a temperaturas diferentes para estudar o efeito da
temperatura na mobilidade das proteínas.

Figura 1 (A) Variação do sinal de fluorescência nas células que foram fundidas. (B) Efeito da temperatura
na distribuição da fluorescência das células, 40 minutos após a ocorrência da fusão.
Adaptado de: L D Frye and M Edidin. The rapid intermixing of cell surface antigens after formation of
mouse-human heterokaryons. Journal of Cell Science (1970) 7. 319-335.
Na resposta a cada um dos itens de 1. a 3., selecione a única opção que permite obter uma afirmação
correta.
1. Os principais objetivos de Frye e Edidin eram…
(A) … demonstrar que as membranas plasmáticas são fluidas e que a temperatura afeta a formação de
mosaicos.
(B) … provar que as células possuem membranas plasmática e que estas podem sofrer fusão com
outras células.
(C) … provar que as membranas plasmáticas são rígidas por natureza e que o aumento da temperatura
acima das condições fisiológicas estimula a formação dos mosaicos.
(D) … demonstrar que a marcação das proteínas membranares com fluorescência permite acompanhar
a dinâmica de fusão das membranas e que o aumento da temperatura acima das condições
fisiológicas estimula a formação dos mosaicos.

2. Durante a experiência a que se reportam os resultados representados na figura 1A, as células foram
sempre mantidas em incubadoras a 37 °C, de forma a…
(A) … inibir o movimento das proteínas membranares.
(B) … desnaturar as proteínas membranares.
(C) … determinar a temperatura mínima a que ocorre o movimento das proteínas.
(D) … poder extrapolar os resultados experimentais para as condições que se verificam no organismo
humano.

3. A célula híbrida é composta por uma membrana ___ , contendo proteínas membranares originárias
___.
(A) contínua (…) apenas da célula humana
(B) contínua (…) da célula humana e da célula de ratinho
(C) descontínua (…) da célula humana e da célula de ratinho
(D) descontínua (…) apenas da célula humana

4. Com base nos dados mencione como varia a taxa de formação de mosaico com a variação da
temperatura.

5. Classifique como verdadeira (V) ou falsa (F) cada uma das seguintes afirmações relativas à experiência
e às características e comportamento das membranas plasmáticas.
A. As proteínas das células incubadas durante 40 minutos (fig. 1B) a 15 °C não estão dispersas de
forma regular pela membrana plasmática.
B. O colesterol é um glícido estrutural da membrana plasmática.
C. De acordo com o modelo do mosaico fluido, a membrana plasmática é formada por proteínas
dispersas numa bicamada lipídica fluida.
D. O incremento da temperatura reduz a fluidez das membranas celulares.
E. O modelo de mosaico fluido é caracterizado por apresentar proteínas intrínsecas e extrínsecas.
F. No instante após a fusão, a célula híbrida possuía as proteínas humanas e as do ratinho segregadas
espacialmente.
G. Os fosfolípidos são considerados moléculas anfipáticas por serem compostos polares.
H. As proteínas existentes nas membranas podem corresponder a transportadores e recetores
membranares.

6. Relacione os dados de L. D. Frye e M. Edidin com a capacidade de algumas células obterem alimentos
por fagocitose e de os digerirem em lisossomas.
Grupo II
Efeito da temperatura ambiente na taxa metabólica de um mamífero

Os animais possuem estratégias comportamentais que lhes permitem evitar os extremos de temperatura
do ambiente. Também possuem mecanismos químicos e hormonais que permitem, dentro de certos
limites, o controlo da temperatura corporal.

Figura 2

Uma das respostas dos organismos quando expostos a temperaturas reduzidas é aumentar a produção de
calor a partir do metabolismo, em que o gradiente de protões H+ é dissipado através das proteínas UCP.

Figura 3 Mecanismos de produção de ATP ou calor nas mitocôndrias.


Na resposta a cada um dos itens de 1. a 4., selecione a única opção que permite obter uma afirmação
correta.

1. Os resultados da figura 2 permitem classificar o organismo como ___, pois a sua temperatura corporal
___ num intervalo de temperaturas relativamente amplo.
(A) exotérmico (…) mantém-se constante (C) homeotérmico (…) varia significativamente
(B) homeotérmico (…) mantém-se constante (D) exotérmico (…) varia significativamente

2. Com base nos dados, é possível afirmar que à temperatura de 10 °C o organismo está a consumir
energia para produzir calor, devido às perdas deste para o meio ambiente, e quando a temperatura
ambiente ultrapassa os ____ é expectável ____ da circulação sanguínea periférica.
(A) 20 °C (…) o aumento (C) 37 °C (…) a diminuição
(B) 20 °C (…) a extinção (D) 37 °C (…) o aumento

3. De acordo com os dados, a elevada taxa metabólica do organismo quando exposto a temperaturas
reduzidas pode ser responsável por…
(A) … aumentar a taxa metabólica basal.
(B) … diminuir a temperatura corporal, aumentando a produção de ATP.
(C) … aumentar a temperatura corporal, sem aumentar a produção de ATP.
(D) … diminuir a produção de calor, aumentando a regeneração do ATP a partir do ADP + Pi.

4. O transporte de gases respiratórios no Homem ocorre por ___ uma vez que _____ dependente de um
fluido circulante.
(A) difusão indireta (…) está (C) difusão direta (…) não está
(B) difusão indireta (…) não está (D) difusão direta (…) está

5. Faça corresponder a cada uma das afirmações, de (a) a (e), uma fase da respiração indicada na chave.

Afirmações:
(a) Redução das moléculas de NAD+ e de FAD.
(b) O piruvato difunde-se para a mitocôndria e sofre oxidação.
(c) A molécula de glicose é oxidada, produzindo-se duas moléculas de piruvato e duas moléculas de
NADPH.
(d) O oxigénio é o aceitador de eletrões.
(e) Ciclo que se inicia na acetil-coA.

Chave:
(I) Fermentação
(II) Ciclo de Krebs
(III) Formação da acetil-CoA
(IV) Ciclo de Calvin
(V) Glicólise
(VI) Fase fotoquímica
(VII) Cadeia respiratória
(VIII) Fase química

6. Numa situação de exercício intenso a taxa metabólica aumenta, havendo um elevado consumo de
oxigénio. Relacione o aumento dos batimentos cardíacos numa situação de exercício intenso com a
eficácia da distribuição de oxigénio pelas células.

7. Ordene as letras de A a E de modo a reconstituir uma possível sequência cronológica dos


acontecimentos relacionados com a reação de um organismo ao aumento da temperatura.
A. Ativação das glândulas sudoríparas e vasodilatação dos vasos sanguíneos mais superficiais.
B. Deteção do aumento da temperatura pelos recetores sensoriais presentes na pele.
C. Aumento do fluxo sanguíneo com irradiação de calor nos vasos sanguíneos mais superficiais.
D. O organismo atinge a homeostasia térmica.
E. Produção de estímulos nervosos, que são conduzidos pelos nervos sensitivos até ao hipotálamo, que
recebe informação relativa ao aumento da temperatura corporal.
8. As temperaturas podem afetar o teor de água do organismo, implicando a ativação de mecanismos
osmorreguladores. Classifique como verdadeira (V) ou falsa (F) cada uma das seguintes afirmações
relativas à osmorregulação.
A. Em situação de desidratação ocorre estimulação do complexo hipotálamo-hipófise, ocorrendo
síntese e libertação de hormona antidiurética (ADH).
B. No Homem a osmorregulação baseia-se num processo hormonal regulado por uma
retroalimentação positiva.
C. A hormona ADH é libertada na corrente sanguínea, atuando ao nível dos rins, onde provoca a
diminuição da reabsorção de água ao nível dos tubos uriníferos.
D. Nos organismos osmorreguladores a pressão osmótica do meio interno é constante, não variando
face à alteração da pressão osmótica do meio externo.
E. Os peixes de água doce excretam uma grande quantidade de urina muito diluída.
F. Os organismos osmorreguladores mantêm a concentração de sais nas suas células igual à do meio
externo.
G. Para sobreviverem em ambientes de água salgada, os peixes perdem sais por transporte ativo
através das brânquias e outras superfícies corporais.
H. Os organismos que não possuem mecanismos de osmorregulação denominam-se
osmoconformantes.

Grupo III
Trocas gasosas nas plantas e hormonas vegetais

Uma das adaptações das plantas na colonização do meio terrestre foi o aparecimento de estomas, que são
pequenos poros cuja abertura pode ser regulada e que permitem as trocas gasosas, principalmente nas
folhas. Em muitas plantas, os estomas abrem nos períodos de luz para permitir a fotossíntese e fecham à
noite ou em condições de secura.
A abertura estomática é controlada por uma série de fatores abióticos, tais como a luz, a concentração de
CO2, a humidade e o teor de água do solo, que influenciam o transporte transmembranar de iões.
Quando as plantas estão sujeitas a stresse hídrico, as raízes enviam um sinal químico pelo sistema vascular
para as folhas, originando a síntese de precursores do ácido abscísico (ABA) nas folhas. Estes compostos
são novamente enviados para as raízes que sintetizam o ABA e o reencaminham para as folhas juntamente
com a água que absorveram. O ABA controla o fluxo de iões e origina o fecho dos estomas.

Figura 4

Estoma aberto Estoma fechado

Abertura estomática 8 µm 0 µm

Pressão de turgescência
4,5 MPa* 1,0 MPa*
das células-guarda

Concentração de K+ 2,5 pmol 0,3 pmol

* MPa – MegaPascal
Na resposta a cada um dos itens de 1. a 5., selecione a única opção que permite obter uma afirmação correta.

1. A abertura dos estomas permite a entrada de ___ para os tecidos foliares e permite controlar a perda
de ___ para a atmosfera.
(A) CO2 (…) iões potássio (C) CO2 (…) água
(B) glicose (…) água (D) glicose (…) iões potássio

2. Em situações de stresse hídrico nas células de guarda ocorre síntese e libertação de ABA pelas células
das raízes e o seu transporte através do ____ até às folhas, onde o ABA provoca a ____ de iões das
células de guarda e o consequente encerramento dos estomas.
(A) floema (…) saída (C) xilema (…) saída
(B) floema (…) entrada (D) xilema (…) entrada

3. A glicose e a sacarose produzidas nos tecidos fotossintéticos são transportados por ___ para os tubos
crivosos, promovendo a entrada de água nessas estruturas e consequentemente ____ da turgescência
das suas células.
(A) difusão facilitada (…) o aumento (C) transporte ativo (…) a diminuição
(B) difusão facilitada (…) a diminuição (D) transporte ativo (…) o aumento

4. A saída de vapor de água da planta por transpiração provoca ___ da pressão osmótica no mesófilo
foliar, que desencadeia a subida de uma coluna ___ de água ao longo do xilema.
(A) aumento (…) coesa (C) diminuição (…) não coesa
(B) aumento (…) não coesa (D) diminuição (…) coesa

5. Os níveis de CO2 têm vindo a aumentar nas últimas décadas em resultado da atividade humana. Neste
contexto, se uma dada planta mantiver o mesmo período de abertura dos seus estomas, é expectável
que as taxas fotossintéticas …
(A) … diminuam, caso exista água disponível para as plantas.
(B) … aumentem, caso exista água disponível para as plantas.
(C) … aumentem, independentemente da quantidade de água disponível para as plantas.
(D) … diminuam, independentemente da quantidade de água disponível para as plantas.

6. Ordene as letras de A a E de modo a reconstituir uma possível sequência cronológica dos


acontecimentos relacionados com a abertura dos estomas.
A. A água move-se por osmose para as células de guarda.
B. A concentração de solutos nas células de guarda é superior ao das células de companhia.
C. Os iões K+ movem-se através da membrana até às células de guarda.
D. Aumento da turgescência nas células de guarda.
E. Os estomas encontram-se fechados.

7. Alguns fungos parasitas de folhas de plantas segregam uma substância química que desencadeia a
acumulação de iões potássio nas células de guarda dos estomas. Explique de que modo a secreção desta
substância química facilita a infeção da planta.

8. Faça corresponder a cada uma das afirmações da coluna A uma hormona vegetal da coluna B.
Coluna A Coluna B

(a) Controla o fluxo de iões, provocando o encerramento dos


estomas em situações de carência hídrica.
(b) Promove o alongamento dos caules e o enraizamento e inibe a (1) Giberelina
abscisão foliar. (2) Citocinina
(c) Estimula a germinação das sementes, a floração e o (3) Ácido abscísico
desenvolvimento do fruto. (4)Auxina
(d)Promove o amadurecimento dos frutos e a abscisão foliar. (5) Etileno
(e) Afeta o crescimento da raiz, promove a divisão celular e inibe a
senescência.
Grupo IV
Fontes hidrotermais dos Açores

Nas últimas décadas têm sido descobertos diversos campos hidrotermais nas dorsais oceânicas,
nomeadamente na região dos Açores (fig. 5). É do interesse da Ciência estudar estes campos, pois podem
conter as respostas para o aparecimento e evolução das formas de vida mais primitiva do nosso planeta. As
fontes hidrotermais também são estudadas para compreender a formação de alguns depósitos metálicos,
que podem vir a ser exploradas como matérias-primas metálicas.
A atividade hidrotermal gera-se quando a água se infiltra na crusta oceânica e sofre aquecimento em
profundidade. As elevadas temperaturas que atinge permitem a dissolução de gases e compostos químicos,
alguns dos quais metálicos. A água ascende na crusta e, quando contacta com a água do mar, sofre
arrefecimento, provocando a precipitação dos materiais dissolvidos. A precipitação prolongada pode
originar a formação de chaminés negras.
Este ciclo complexo é responsável pela formação de depósitos com minérios, tendo originado no passado
depósitos que atualmente são explorados em Portugal (por exemplo, as minas de Neves Corvo, no
Alentejo).
Nestes campos hidrotermais, que se podem localizar a vários quilómetros de profundidade, encontram-se
muitas espécies, principalmente microrganismos, que chegam a habitar ambientes com temperaturas na
ordem dos 100 °C e com elevado teor em compostos tóxicos, como por exemplo metais pesados.

Figura 5

Na resposta a cada um dos itens de 1. a 5., selecione a única opção que permite obter uma afirmação
correta.

1. Estudos recentes na área da geologia indicam a possibilidade da instalação de uma zona de subducção
ao longo da margem este do Atlântico, próximo da costa continental portuguesa. Este fenómeno poderá
condicionar a evolução deste oceano, que…
(A) … será limitado a este e a oeste por limites convergentes.
(B) … apresentará um limite convergente na margem este.
(C) … diminuirá a sua largura, caso a taxa de subducção seja inferior à taxa de formação da crusta ao
nível do rifte.
(D) … apresentará um limite divergente na margem este.

2. A instalação da zona de subducção referida anteriormente poderá originar…


(A) … o aumento do número de sismos ao longo da margem oeste do Atlântico.
(B) … a produção de nova crusta oceânica na margem oeste.
(C) … fenómenos vulcânicos na placa Euroasiática, paralelamente à zona de subducção.
(D) … a produção de nova crusta oceânica na margem este.
3. Nos sismogramas obtidos nos Açores e na região continental, relativos a um sismo com epicentro perto
do campo hidrotermal Menez Gewen, é possível observar um maior desfasamento entre a chegada das
ondas P e das ondas S nos sismogramas registados na região continental. Esta observação deve-se ao
facto de as…
(A) … ondas P e S possuírem a mesma velocidade de propagação.
(B) … ondas P se deslocarem de forma mais rápida que as ondas S.
(C) … ondas S se propagarem de forma mais rápida que as ondas P.
(D) … ondas S não serem registadas nos sismogramas obtidos nas regiões continentais.

4. É possível encontrar vestígios de campos hidrotermais nos fundos oceânicos mais afastados das dorsais
médio-oceânicas, que não estão ativos na atualidade. Com o afastamento ao rifte, a idade destes
campos hidrotermais ___, e a espessura dos estratos sedimentares por cima será ____.
(A) diminui (…) maior
(B) diminui (…) menor
(C) aumenta (…) menor
(D) aumenta (…) maior

5. As fontes hidrotermais indicadas na figura 5A, localizam-se próximo de limites ___ onde há geração de
magmas essencialmente de composição _____.
(A) divergentes (…) básica
(B) convergentes (…) ácida
(C) convergentes (…) básica
(D) divergentes (…) ácida

6. Classifique como verdadeira (V) ou falsa (F) cada uma das seguintes afirmações relativas às fontes
hidrotermais.
A. Nas fontes hidrotermais formam-se depósitos de minerais metálicos.
B. As elevadas temperaturas da água dos oceanos nos fundos marinhos provocam a precipitação dos
metais.
C. Nas fossas oceânicas os campos hidrotermais são muito abundantes, devido à proximidade de
corpos magmáticos.
D. As chaminés negras existentes nas fontes hidrotermais resultam na solidificação de magma básico.
E. Os recursos minerais metálicos formados nas fontes hidrotermais são recursos não renováveis à
escala temporal humana.
F. Nas fontes hidrotermais a temperatura máxima da água deverá rondar os 70 °C.
G. As chaminés das fontes hidrotermais formam-se devido à deposição de materiais transportados por
águas que se infiltraram nas rochas do fundo oceânico. Ao aquecerem nas proximidades de magma
dissolvem materiais, que depositam depois de ascenderem na crusta e contactarem com a água do
oceano.
H. Nas fontes hidrotermais verifica-se deposição de lavas em almofada.

7. Relacione a distribuição das fontes hidrotermais com os fenómenos do ciclo das rochas que ocorrem
nas dorsais oceânicas.

8. Associadas às fontes hidrotermais estão organismos que realizam quimiossíntese, como por exemplo as
bactérias Nitrosomonas europaea, que obtêm energia através da seguinte reação global:
2NH4+ + 2O2 →2NO2- + 4H+ + 2H2O

Mencione o composto que funciona como fonte de energia da bactéria Nitrosomonas europaea.
Teste Global - 1.o Período
10.º Ano de Escolaridade
Grupo I

O mapa da figura representa parte do Atlântico Norte e abrange o território português. Na figura, estão
assinaladas as idades das rochas da crusta oceânica, segundo alinhamentos correspondentes a isócronas
(linhas que unem pontos do fundo oceânico com a mesma idade, em milhões de anos – M.a.).

Figura 1

1. A datação das rochas do fundo oceânico presente na figura 1 corresponde a uma datação…
(A) … absoluta, pois obtemos uma idade numérica.
(B) … relativa, dado que obtemos uma idade numérica.
(C) … absoluta, uma vez que determinamos se um segmento da crusta oceânica é mais antigo ou
mais recente do que outro, de acordo com o Princípio da Sobreposição.
(D) … relativa, pois determinamos se um segmento da crusta oceânica é mais antigo ou mais
recente do que outro, de acordo com o Princípio da Sobreposição.

2. A taxa de expansão oceânica na região representada…


(A) … foi nula nos últimos 37 M.a.
(B) … é maior para regiões mais próximas do rifte.
(C) … foi máxima entre os últimos 80 M.a. e 76 M.a.
(D) … tem sido constante desde a abertura do oceano Atlântico.

3. De acordo com os dados é possível concluir que…


(A) … o oceano Atlântico não se está a expandir.
(B) … o Atlântico é o oceano com a maior taxa de expansão.
(C) … a abertura do oceano Atlântico, na região representada, se fez de sul para norte e de forma
progressiva.
(D) … a abertura do Oceano Atlântico, na região representada, se fez de norte para sul e de forma
progressiva.
4. As linhas a tracejado presentes no mapa, com orientação aproximada W-E, correspondem a…
(A) … limites convergentes.
(B) … limites divergentes.
(C) … cadeias montanhosas submarinas.
(D) … limites transformantes ou conservativos.

5. Os sedimentos depositados nos fundos oceânicos que não tenham sofrido deformação podem ser
datados de forma…
(A) … relativa, usando o Princípio da Horizontalidade Primitiva.
(B) … absoluta, usando o Princípio da Horizontalidade Primitiva.
(C) … relativa, usando o Princípio da Sobreposição.
(D) … absoluta, usando o Princípio da Sobreposição.

6. Os investigadores podem recorrer a datações radiométricas das rochas do fundo oceânico.


Imagine que um investigador usava o sistema U-Pb, com tempo de semi-vida de 4500 M.a.
Nas rochas do fundo do oceano Atlântico, a relação isótopo-pai/isótopo-filho deverá ser…
(A) … sempre inferior a 50%.
(B) … igual a 25%.
(C) … igual a 12,5%.
(D) … inferior nas rochas mais próximas da costa de Portugal Continental e superior nas rochas
obtidas no fundo oceânico na região dos Açores.

7. Classifica como verdadeira (V) ou falsa (F) cada uma das seguintes afirmações.
A. O mapa da figura não é defendido por imobilistas.
B. A expansão dos fundos oceânicos não apoia a Teoria da Tectónica de Placas.
C. As isócronas ao nível do golfo da Biscaia sugerem a existência de um rifte.
D. As rochas do fundo oceânico são incluídas na hidrosfera.
E. O encaixe entre as plataformas continentais do norte da América e da Europa é um argumento
paleontológico da Tectónica de Placas.
F. Os gases libertados pelo vulcanismo afetam o clima, evidenciando a interação entre os
subsistemas terrestres.
G. A crusta oceânica é formada essencialmente por rochas metamórficas.
H. Os basaltos da crusta oceânica são formados a partir do arrefecimento de magmas.

8. Os magmas libertados na região dos riftes submarinos formam rochas com grãos minerais muito
pequenos ou mesmo invisíveis à vista desarmada. Explique este facto.
Grupo II

Doc 1.

Estudos sugerem a instalação de uma zona de subducção a SW da Península Ibérica


Até agora era uma suspeita de geólogos portugueses, mas um grupo internacional de investigadores, cujo
principal autor foi justamente um português, João Duarte, nesta altura a trabalhar na universidade
australiana de Monash, acaba de observar os primeiros sinais de que uma zona de subducção está a formar-
se ao largo da costa ocidental de Portugal.
Para chegar a esta conclusão, a equipa, que incluiu os portugueses Filipe Rosas, Pedro Terrinha e António
Ribeiro, da Universidade de Lisboa, além de investigadores franceses e australianos, fez o mapeamento do
fundo oceânico naquela zona. E o que verificou foi que uma fratura está ali em formação.
A ideia de que uma zona de subdução poderia estar a nascer ao largo da costa ocidental da Península Ibérica
foi publicada pela primeira vez em 1986 pelos geólogos portugueses António Ribeiro e João Cabral. Para
ambos essa era a explicação lógica para a ocorrência de um sismo tão violento como o de 1755 nesta região.
Os dados do estudo agora publicado indicam que os dois geólogos portugueses estavam certos, como nota o
principal autor, João Duarte: "Atividade sísmica significativa, incluindo o sismo de 1755 que devastou
Lisboa, indicava que poderia haver movimento tectónico convergente na região. Pela primeira vez,
conseguimos encontrar provas de que é esse o caso e de que há um mecanismo na sua base".
Segundo os investigadores, esta zona de subducção incipiente poderá indicar que uma nova fase da vida
geológica da Terra pode estar a iniciar-se, neste caso com o fechamento do Atlântico e o retorno à junção dos
continentes. O processo ainda vai durar mais 220 milhões de anos, mas também fica claro que sismos como
o de 1755 vão voltar a acontecer por cá.

http://www.dn.pt (consultado em 01/09/2015)

Doc 2.

Analise o seguinte esquema representativo da tectónica de placas.

Figura 2
1. A possibilidade de instalação de uma zona de subducção a SW da Península Ibérica implica que a
margem continental passe de ___, e a caracterizar-se por uma ___ atividade sísmica e vulcânica.
(A) ativa a passiva (…) intensa
(B) passiva a ativa (…) intensa
(C) ativa a passiva (…) menor
(D) passiva a ativa (…) menor

2. As zonas de subducção correspondem a limites tectónicos do tipo ___, com ___ de placa litosférica.
(A) convergente (…) destruição
(B) convergente (…) formação
(C) divergente (…) destruição
(D) divergente (…) formação

3. A crusta oceânica é mais antiga, fria e densa…


(A) … nos limites transformantes ou conservativos.
(B) … nas cadeias montanhosas submarinas.
(C) … nas margens passivas, afastadas das zonas de rifte.
(D) … nas zonas próximas dos riftes.

4. A região a SW da Península Ibérica pode ser representada pela letra ___ da figura 2, mas o estudo
apresentado no doc. 1 indica que poderá estar a converter-se numa margem como a assinalada pela
letra ___.
(A) D (…) B
(B) A (…) B
(C) B (…) A
(D) B (…) D

5. James Hutton foi um cientista que estudou a formação das rochas sedimentares, tendo examinado
depósitos de sedimentos fluviais e marinhos e observado o seu transporte lento e contínuo nos rios e
ambientes marinhos. Este cientista defendia o ___, ao contrário de Georges Cuvier, que apoiava o
___.
(A) Princípio do Uniformitarismo (…) Catastrofismo Geológico
(B) Catastrofismo Geológico (…) Princípio do Uniformitarismo
(C) Atualismo (…) Princípio do Uniformitarismo
(D) Princípio do Uniformitarismo (…) Atualismo

6. Relacione a sismicidade histórica elevada, nomeadamente o sismo de 1755 e o sismo de 1969


(magnitude 6.9), com a possibilidade de formação de uma zona de subducção.

7. Os sedimentos depositados nos fundos oceânicos podem ser convertidos em rochas metamórficas nas
regiões de subducção. Relacione este facto com as condições de pressão e temperatura características
das regiões de subducção.
Grupo III
Europa

Há 400 anos, o astrónomo Galileu descobriu as quatro maiores luas de Júpiter: Io, Europa, Calisto e
Ganimedes. Na atualidade, os cientistas analisam com mais detalhe a lua Europa. Em 1995, a sonda espacial
Galileu enviou dados para a Terra que indicavam a existência de um oceano por baixo da camada de gelo que
envolve Europa.
A lua Europa sofre efeitos de maré ao orbitar o planeta Júpiter, a cada três dias e meio. Como a sua órbita é
elíptica, nos pontos mais próximos de Júpiter a lua sofre contração e estende-se nos pontos em que está mais
afastada. Estes movimentos causam fricção e aquecimento das camadas internas, levando à formação de
fraturas paralelas na camada de gelo superficial.
Os dados indicam que Europa deverá possuir um oceano de água salgada no estado líquido. Tal como na
Terra, este oceano deverá estar em contacto com rochas no fundo oceânico. Pelo contrário, outras luas de
Júpiter apresentam oceanos líquidos entre duas camadas de gelo. No fundo oceânico de Europa devem
existir nascentes hidrotermais.
http://solarsystem.nasa.gov (consultado em 1/09/2015, adaptado)

Figura 3 – Estrutura interna e superfície da lua Europa.

1. As fontes de energia na lua Europa incluem…


(A) … apenas a radiação solar.
(B) … apenas os efeitos de maré.
(C) … apenas o calor interno gerado pelo decaimento radioativo.
(D) … a radiação solar e o calor interno gerado pelos efeitos de maré.

2. Europa possui uma atmosfera muito rarefeita, com algum oxigénio, uma vez que o hidrogénio se
perdeu para o espaço. Como Europa possui dimensões inferiores à Lua, a perda de gases para o
espaço pode dever-se…
(A) … ao facto de os gases não estarem sujeitos à força gravítica.
(B) … à força gravítica, que expulsa os gases para o espaço.
(C) … a não apresentar dimensões suficientes para gerar uma força gravítica capaz de reter os
gases e formar uma atmosfera.
(D) … à elevada massa deste planeta.
3. De acordo com os dados, Europa deverá…
(A) … possuir um manto rochoso e um núcleo rico em ferro.
(B) … possuir um núcleo gelado.
(C) … ser composta apenas por gases muito frios.
(D) … ter uma estrutura uniforme, com ausência de camadas internas diferenciadas.

4. A Europa e Calisto são planetas…


(A) … principais, que orbitam um planeta gigante.
(B) … secundários, que orbitam um planeta gigante.
(C) … secundários, que orbitam um planeta telúrico.
(D) … principais, que orbitam um planeta telúrico.

5. Os planetas telúricos distinguem-se dos gigantes por…


(A) … possuírem mais satélites naturais e anéis.
(B) … terem maiores dimensões, ausência de atmosfera e rotação mais rápida.
(C) … todos possuírem biosfera.
(D) … serem mais densos, possuírem uma superfície sólida e um reduzido número de satélites.

6. Classifique como verdadeira (V) ou falsa (F) cada uma das seguintes afirmações relativas à
formação do Sistema Solar.
A. A rotação da massa de gás de poeiras finas que terá estado na origem do Sistema Solar é
apoiada pelo facto de existirem planetas com sentido do movimento de translação inverso.
B. Durante a sua formação, os planetas telúricos do Sistema Solar sofreram diferenciação,
responsável pela estrutura em camadas concêntricas.
C. Um dos fatores que determina a temperatura média à superfície de um planeta é a sua
distância ao Sol.
D. Os planetas exteriores possuem uma composição rochosa.
E. Quanto mais afastado do Sol, menor é o ponto de fusão dos materiais que constituem os
corpos celestes.
F. A diferenciação da Terra só foi possível porque esta se encontrava solidificada nos seus
primórdios.
G. A ausência de atividade geológica significativa na Lua permitiu a preservação de muitas
crateras de impacto.
H. Os cometas são essenciais para o estudo da formação do Sistema Solar, pois possuem uma
composição semelhante à da nébula primitiva, em resultado de terem sofrido diferenciação
interna muito significativa.

7. Faça corresponder a cada uma das afirmações um número da chave. Utilize cada letra e cada
número apenas uma vez.
Afirmações
(a) Estrela.
(b) Satélite que apresenta crateras meteoríticas preenchidas por escoadas basálticas.
(c) Planeta caracterizado por um intenso efeito de estufa.
(d) Corpo celeste que tende a orbitar entre os planetas Júpiter e Marte.
(e) Planeta mais próximo do Sol, com o menor período de translação.
(f) Planeta gasoso mais próximo do Sol.
(g) Planeta telúrico sem atividade tectónica, mas com evidências de existência de água e
vulcanismo no passado.
(h) Corpo celeste, com órbita excêntrica, cuja dimensão é reduzida sempre que passa perto do
Sol.
Chave
(1) Lua (4) Vénus (7) Sol
(2) Terra (5) Mercúrio (8) Cometa
(3) Júpiter (6) Marte (9) Asteroide

8. Para voltar a verificar-se atividade vulcânica em Marte seria necessário o impacto meteorítico de
elevadas dimensões. Explique este facto.
Grupo IV
Vulcão Sakurajima

O Vulcão Sakurajima é um dos mais ativos no Japão, tendo ocorrido erupções constantes desde 1955. Em
2006, a atividade aumentou e passou a ser quase diária, com 500 a 1000 pequenas erupções anuais.
O aparelho vulcânico é formado pela acumulação de escoadas lávicas intercaladas com depósitos de
piroclastos, nomeadamente pomitos. As lavas mais antigas eram mais fluidas e as escoadas distribuíram-se
pelas vertentes da montanha; as lavas mais recentes são mais viscosas e acumulam-se mais próximas da
chaminé. Análises químicas a um depósito de lava permitiram determinar que o teor de SiO2 varia entre 66
e 68%.

Figura 4 – Contexto tectónico do vulcão Sakurajima.

Figura 5 – Variação do número de erupções efusivas e explosivas de 2006 a 2012.


Devido à sua perigosidade, o vulcão Sakurajima é um dos mais vigiados de todo o Japão. Foram instaladas
18 estações sismográficas, inclinómetros e dezenas de estações GPS para acompanhar as deformações do
terreno. Os investigadores determinaram que as mudanças no terreno eram devidas à injeção de magma
localizado a 4 km de profundidade.

Figura 6 – Variação na topografia do vulcão desde 1890 até 2010.

https://gbank.gsj.jp/volcano/Act_Vol/sakurajima/text/eng/exp01-1e.html
(consultado em 1/9/2015, adaptado)

1. Nas erupções mais recentes do Vulcão Sakurajima predominam as do tipo ___ e a lava deve ter um
conteúdo em sílica ___.
(A) efusivo (…) inferior
(B) explosivo (…) superior
(C) explosivo (…) inferior
(D) efusivo (…) inferior

2. Nas proximidades do vulcão Sakurajima existe o vulcão submarino Wakamiko. Se este entrar em
erupção poderá formar…
(A) … lava em almofada.
(B) … um fluxo piroclástico.
(C) … lava encordoada.
(D) … gabros.

3. De acordo com o contexto tectónico, o magma libertado pelo vulcão Sakurajima é formado…
(A) … no manto.
(B) … a partir da fusão total de crusta.
(C) … a partir da fusão parcial de crusta.
(D) … no núcleo.

4. As ___ são manifestações secundárias de vulcanismo, em que ocorre a libertação de ___.


(A) sulfataras (…) sílica
(B) mofetas (…) sílica
(C) sulfataras (…) enxofre
(D) mofetas (…) enxofre
5. Faça corresponder a cada uma das afirmações identificadas pelas letras de A a H, relativas ao vulcão
Sakurajima, um dos números romanos da chave que as permite avaliar.

Afirmações
A. Após a erupção de 1914 o vulcão abateu mais de 150 cm.
B. O número de erupções tem aumentado desde 2006.
C. A frequência de erupções é constante.
D. O vulcão localiza-se numa zona de subducção.
E. A acumulação de magma em profundidade não pode ser avaliada a partir das mudanças no
terreno.
F. Nas zonas de subducção geram-se sismos muito profundos.
G. O magma libertado pelo vulcão tem composição ácida.
H. A deformação do terreno indica que poderá estar iminente uma nova erupção.

Chave
I. Afirmação apoiada pelos dados
II. Afirmação contrariada pelos dados
III. Afirmação sem relação com os dados

6. Ordene as letras de A a E de modo a reconstituir uma possível sequência cronológica dos


acontecimentos relacionados com uma erupção e a formação de uma nuvem piroclástica no vulcão
Sakurajima.
A. O magma desloca-se da câmara magmática para a superfície através da chaminé vulcânica.
B. A diminuição da pressão perto da superfície origina a separação da fração gasosa antes da
erupção.
C. O magma e os gases são libertados pelo vulcão de forma violenta.
D. A elevada densidade faz com que lava, gases e poeiras sejam transportados ao longo das
vertentes do vulcão.
E. Formação do magma a partir da fusão de materiais pré-existentes.

7. Antes e depois da erupção de 1914 foram sentidos sismos fortes, um dos quais com magnitude 7.1.
Relacione a monitorização da atividade sísmica de um vulcão com a minimização dos seus impactes
negativos.
Teste 1
11.º Ano de Escolaridade
Grupo I
Material genético

Em 1928, o médico inglês Frederick Griffith estudava duas linhagens de bactérias patogénicas de
Diplococcus pneumoniaei, o agente causador da pneumonia humana, letal para os ratinhos que usava nas
investigações.
As linhagens foram denominadas de S e R, porque enquanto cresciam em laboratório, umas produziam
colónias lisas (do inglês smooth) e outras rugosas (do inglês rough), respetivamente. Griffith realizou a
experiência e obteve os resultados ilustrados na figura 1.

Figura 1

Um estudante do laboratório de Griffith encontrou três amostras puras de compostos químicos extraídos
de bactérias S e que estavam identificadas com as letras A, B e C. Sem saber o seu conteúdo, misturou as
amostras com bactérias R e injetou as amostras separadamente ou combinadas em diferentes ratinhos. O
estudante observou as respostas dos diferentes ratinhos após o período de incubação e extraiu amostras
sanguíneas para pesquisar células infetadas com bactérias. Os resultados estão representados na tabela I.

Tabela I
Tipo de células recolhidas
Amostra injetada Resposta dos ratinhos
dos ratinhos no final
A Morte Células S vivas
B Sem reação Células R vivas
C Sem reação Células R vivas
A+B Morte Células S vivas
A+C Morte Células R e S vivas
B+C Sem reação Células R vivas
A+B+C Morte Células S vivas
Na resposta a cada um dos itens de 1. a 4., selecione a única opção que permite obter uma afirmação
correta.

1. Griffith concluiu que as bactérias que causam a morte dos ratinhos são…
(A) … apenas as bactérias R.
(B) … apenas as bactérias S.
(C) … as bactérias S e R apenas quando misturadas.
(D) … apenas as bactérias S quando mortas pelo calor.

2. É importante assumir que as amostras A, B e C são puras, pois…


(A) …quando misturadas com células R provocam a morte dos ratinhos, tornando o estudo
conclusivo.
(B) … a mistura de duas amostras é sempre letal para os ratinhos, tornando o estudo conclusivo.
(C) … se houver mistura de amostras não sabemos qual dos compostos extraídos das bactérias S
é capaz de tornar as células R virulentas.
(D) … os compostos presentes em cada amostra só atuam de forma isolada.

3. Assumindo que as amostras A, B e C continham um único composto, é expectável que a amostra


_____ contenha polissacarídeos e a amostra C seja composta por _____.
(A) B (…) proteínas (C) B (…) DNA
(B) A (…) proteínas (D) A (…) DNA

4. Imagine-se no papel de um investigador que obteve um extrato de células S. Se destruísse apenas


______ desse extrato e o adicionasse a bactérias R, esperaria a _____ dos ratinhos quando
injetados com estas bactérias transformadas.
(A) o DNA (…) morte (C) os lípidos (…) morte
(B) o RNA (…) sobrevivência (D) os lípidos (…) sobrevivência

5. Faça corresponder a cada uma das letras, que identificam afirmações relativas às características de
algumas biomoléculas, um dos números da chave. Utilize cada letra apenas uma vez.
Afirmações:
(a) Cadeia que se liga de forma muito específica a um determinado aminoácido, transferindo-o
posteriormente para uma cadeia polipeptídica em construção nos ribossomas.
(b) Cadeia polinucleotídica cujos monómeros são constituídos por um grupo fosfato, uma pentose
e uma base azotada.
(c) Principal constituinte das membranas plasmáticas de todas as células.
(d) Forma-se por transcrição de uma cadeia dupla de nucleótidos.
(e) São usados pelos seres vivos como reservas de energia, podendo ser usados em vias catabólicas
para síntese de ATP.
(f) Molécula cuja proporção de bases azotadas pode representar-se, aproximadamente, por
(A+C)/(T+G)≈1.
Chave:
(1) DNA (3) DNA e RNA
(2) RNA (4) Lípidos

6. Mencione o tipo de replicação a que o DNA está sujeito durante o ciclo celular.

7. Classifique como verdadeira (V) ou falsa (F) cada uma das seguintes afirmações relativas às várias
etapas envolvidas no mecanismo de síntese proteica em eucariontes.
A. A partir da transcrição do DNA forma-se um mRNA pronto a ser traduzido.
B. A molécula de mRNA que migra para o citoplasma tende a ser menor do que a que resulta da
transcrição do DNA.
C. A transcrição do DNA é efetuada por uma enzima, a DNA polimerase.
D. A cadeia de mRNA é produzida por complementaridade de bases, que são adicionadas no
sentido 3’ para 5’.
E. O processamento do pré-mRNA ocorre no citoplasma.
F. Na fase do alongamento, o tRNA reconhece um codão específico na molécula de mRNA.
G. Todos os codões são traduzidos para aminoácidos.
H. Durante a tradução, o mRNA é lido pelos ribossomas no sentido 5’-3’.
8. A seguinte sequência nucleotídica pertence a uma bactéria:

CGA UCG GAA CCA CGU GAU AAG CAU

Com base no código genético apresentado em seguida, preveja as principais consequências na


síntese proteica da adição de um nucleótido de adenina na primeira posição da referida sequência.

Grupo II
Mitose

A mitose foi descoberta por Walther Flemming, que observou células extraídas das barbatanas e guelras de
uma espécie de salamandra. Flemming usou o corante azul de anilina, que cora de forma específica a
cromatina, para caracterizar as diferentes fases de divisão celular.

Figura 2 – Algumas fases de divisão mitótica. A cromatina foi marcada com azul de anilina.
Na resposta a cada um dos itens de 1. a 7., selecione a única opção que permite obter uma afirmação
correta.

1. As salamandras, tal como as rãs, possuem circulação _____ cujo coração é formado por _____
cavidades.
(A) dupla completa (…) três (C) dupla completa (…) quatro
(B) dupla incompleta (…) três (D) dupla incompleta (…) quatro

2. Durante a mitose, o material genético original da célula parental…


(A) … é duplicado e transmitido à única célula-filha resultante.
(B) … é divido pelas duas células-filhas resultantes e depois é duplicado.
(C) … é primeiro duplicado e depois dividido pelas duas células-filhas.
(D) … é divido pelas duas células -filhas, ficando estas com metade da valência nuclear.

3. A cromatina é composta por ____ e DNA, o que facilita ____ no núcleo.


(A) proteínas (…) a transcrição da dupla hélice
(B) lípidos (…) a transcrição da dupla hélice
(C) lípidos (…) o empacotamento da molécula de DNA
(D) proteínas (…) o empacotamento da molécula de DNA

4. Relativamente aos esquemas identificadas pelas letras A, B, C e D na figura 2, podemos afirmar


que…
(A) … a imagem C antecede a imagem A, e esta diz respeito à metáfase.
(B) ... B representa a anáfase que antecede a metáfase.
(C) … em A a quantidade de DNA é metade da quantidade de DNA em B.
(D) … os cromossomas são formados por dois cromatídios em D.

5. Após a conclusão da mitose, ocorre um estrangulamento do citoplasma que termina com a sua
divisão através de um processo designado por…
(A) … interfase. (C) … citocinese.
(B) … metáfase. (D) … anáfase.

6. Sendo Q a quantidade de DNA existente durante a interfase do ciclo celular, durante a prófase
podemos representar essa quantidade por _____ e os cromossomas são formados por _____.
(A) Q/2 (…) dois cromatídios (C) 2Q (…) um cromatídio
(B) 2Q (…) dois cromatídios (D) Q/2 (…) um cromatídio

7. A vimblastina é uma droga usada normalmente em quimioterapia no tratamento de cancros,


impossibilitando a agregação dos microtúbulos.
No contexto da mitose, no tratamento de um cancro num tecido composto por células somáticas, a
vimblastina deverá impedir a separação dos…
(A) … cromatídios, aumentando a divisão celular.
(B) … cromossomas homólogos, aumentando a divisão celular.
(C) … cromatídios, diminuindo a divisão celular.
(D) … cromossomas homólogos, diminuindo a divisão celular.

8. Ordene as letras de A a E de modo a reconstituir a sequência cronológica de acontecimentos que


ocorrem durante o ciclo celular.
A. Formação da membrana nuclear e divisão completa do citoplasma.
B. Formação do fuso acromático.
C. Compactação e enrolamento de cromossomas, tornando-se mais curtos e densos.
D. Rutura do centrómero, em que os cromatídios de cada cromossoma se separam.
E. Replicação do DNA com formação de cromossomas formados por dois cromatídios.

9. O crescimento, a regeneração de tecidos e a diferenciação celular têm por base divisões mitóticas de
células com o mesmo conteúdo genético. É possível, em casos particulares, reverter o processo de
diferenciação e originar células indiferenciadas.
Explique em que medida a mitose é importante para possibilitar estes processos de diferenciação e
obtenção de células indiferenciadas.
Grupo III
Mutações nas aquaporinas e diabetes

A concentração da urina dos mamíferos é regulada pela hormona antidiurética (ADH). Esta hormona é
sintetizada pelo hipotálamo e libertada pela hipófise. A ADH atua ao nível dos túbulos uriníferos,
aumentando a sua permeabilidade, o que facilita a reabsorção da água a partir do filtrado glomerular. A
reabsorção de água está dependente da ligação da hormona ADH a recetores membranares, que estimulam
a inserção de aquaporinas na membrana. As aquaporinas são proteínas que atuam como canais
membranares para a água. Indivíduos com mutações no recetor da hormona ADH podem sofrer de um tipo
específico de diabetes, em resultado do rim ser incapaz de concentrar a urina, removendo a água em
excesso, em resposta à hormona ADH.
O investigador Bernard van Cost e os seus colaboradores da Universidade de Nijmegen (Holanda)
estudaram um paciente com diabetes que possuía o gene para o recetor ADH normal, mas tinha duas
mutações num outro gene que codificava uma aquaporina.
Para determinar qual das mutações era responsável pela diabetes, os investigadores usaram células que
podiam ser geneticamente manipuladas fora do organismo humano. Selecionaram oócitos de rã, que são
recolhidos em grandes quantidades e que podem ser geneticamente manipulados.
Os investigadores sintetizaram mRNA do gene normal de aquaporina e da versão mutada, e injetaram o
mRNA diluído em água nos oócitos, que produziram proteínas normais ou mutadas, dependendo da
sequência de mRNA inicial. Para determinar se as mutações afetaram a função das proteínas, os oócitos
foram transferidos para uma solução hipotónica, e o seu volume foi medido ao microscópio. Os resultados
encontram-se na figura 4.

Resultados
Figura 3 mRNA injetado Permeabilidade (μm/s)
Aquaporina normal 196
Nenhum 20
Mutante 1 17
Mutante 2 18

Deen PM, Verdijk MA, Knoers NV, Wieringa B, Monnens LA, van Os CH, van Oost BA. (1994).
Requirement of human renal water channel aquaporin-2 for vasopressin-dependent concentration of
urine. Apr 1;264 (5155):92-5. Science
Na resposta a cada um dos itens de 1. a 4., selecione a única opção que permite obter uma afirmação
correta.

1. A principal conclusão que podemos tirar deste estudo é…


(A) … apenas uma das mutações inativa o transporte de água pela aquaporina.
(B) … as aquaporinas são essenciais ao aumento da concentração da urina em resposta ao
incremento da concentração de hormona ADH.
(C) … as aquaporinas são essenciais à diminuição da concentração da urina em resposta ao
aumento da concentração de hormonas ADH.
(D) … o aumento da concentração da urina pode dever-se às mutações que afetam a síntese de
aquaporinas.

2. O principal objetivo do controlo experimental efetuado é…


(A) … verificar que as aquaporinas mutadas não facilitam a osmose.
(B) … confirmar que as aquaporinas facilitam a osmose.
(C) … confirmar que o procedimento de injeção de solutos na célula não afeta os resultados
finais.
(D) … confirmar que o mRNA injetado é responsável pela síntese de aquaporinas.

3. O mRNA usado na experiência resultou da transcrição de um gene cujo número de nucleótidos…


(A) … é inferior ao do pré-mRNA resultante da sua transcrição.
(B) … de uracilo é igual ao de nucleótidos de adenina.
(C) … é menor do que o do pré-mRNA resultante da sua transcrição.
(D) … é superior ao número de aminoácidos da proteína resultante.

4. Em células eucarióticas animais os genes podem encontrar-se…


(A) … apenas no núcleo.
(B) … no núcleo e nas mitocôndrias.
(C) … no núcleo e em todos os compartimentos endomembranares.
(D) … no núcleo, nas mitocôndrias e nos cloroplastos.

5. Relativamente à síntese de aquaporinas foram feitas as seguintes afirmações. Selecione a opção que
as avalia corretamente.
1) Nem todos os codões que integram o mRNA injetado são traduzidos para aminoácidos.
2) No citoplasma dos oócitos, o mRNA injetado sofre um processamento a partir do qual são
removidas sequências de nucleótidos designados por intrões.
3) Após ser transportado pelo tRNA para o ribossoma do oócito, o aminoácido liga-se à
extremidade da cadeia proteica em formação por uma ligação peptídica.
Opções:
(A) A afirmação 1 é verdadeira, 2 e 3 são falsas.
(B) As afirmações 1 e 2 são verdadeiras, 3 é falsa.
(C) As afirmações 2 e 3 são verdadeiras, 1 é falsa.
(D) As afirmações 1 e 3 são verdadeiras, 2 é falsa.

6. A extração de uma molécula de mRNA de uma célula humana e a sua adição a uma célula de
bactéria Escherichia coli resulta na síntese de uma proteína muito semelhante à esperada na célula
humana.
Refira duas conclusões possíveis sobre as características do código genético a partir dos resultados.

7. Classifique em verdadeira (V) ou falsa (F) cada uma das afirmações seguintes relativas aos
mecanismos de osmorregulação nos animais.
A. Um animal é osmoconformante quando a pressão osmótica interna varia de acordo com a
pressão osmótica do meio externo.
B. Um peixe de água doce produz uma urina com elevado potencial osmótico.
C. Nos animais que vivem em ambientes de água salgada, a taxa de reabsorção de água ao nível
dos nefrónios é muito elevada.
D. A reabsorção de água nos rins é regulada por um mecanismo de retroalimentação negativa.
E. No processo de produção da urina o mecanismo de reabsorção antecede o de filtração.
F. Num organismo osmorregulador, a pressão osmótica é constante e está dependente da pressão
osmótica do meio externo.
G. Numa situação de carência de água, produz-se urina em menor volume e com maior
concentração de solutos.
H. Um consumo reduzido de água ou perdas de água por transpiração levam a uma diminuição
do volume sanguíneo, com diminuição da pressão osmótica.

8. Imagine que procedia a uma medição dos níveis de ADH em indivíduos com mutações nos genes
que codificam os recetores de ADH e em pacientes com mutações nos genes que codificam as
aquaporinas. Refira quais os resultados expectáveis nos níveis de ADH, comparativamente aos
indivíduos normais para ambas as situações.

Grupo IV
Emissões gasosas de vulcões açorianos (S. Miguel)

O estudo das emissões dos gases dissolvidos no magma é essencial para compreender as erupções
vulcânicas. Quando o magma chega mais próximo da superfície, a diminuição da pressão provoca a
libertação de gases. As interações entre a viscosidade, a temperatura e o conteúdo em gases do magma
determinam o tipo de erupção.
Os gases emitidos pelos vulcões podem ser perigosos para os seres vivos, incluindo o Homem. Para além
dos efeitos imediatos, a libertação gradual de gases vulcânicos pode ter efeitos nocivos, pois podem ser
irritantes e afetar a qualidade de vida.
O vapor de água é o principal gás libertado pelos vulcões, seguindo-se o dióxido de carbono (CO2).
O dióxido de enxofre (SO2) e o ácido sulfídrico (H2S) tendem a ser libertados em maiores quantidades em
vulcões ativos, em que existe um corpo magmático quente e próximo da superfície.
Na região dos Açores, pessoas que habitam e trabalham perto de vulcões podem estar sujeitas a níveis
elevados de CO2 e SO2. Por exemplo, na caldeira das Furnas já foram registados 0,115 ppm de SO2, muitas
vezes superior ao valor máximo recomendado, e diversas mortes podem ter ocorrido em resultado do
contacto com atmosferas ricas em CO2 (concentrações acima de 15% podem causar asfixia aos seres
humanos).

Tabela II – Difusão de CO2 em diversos aparelhos vulcânicos distribuídos pelo globo.


Fluxo de CO2 Fluxo de CO2
Área estudada
(toneladas/dia) (toneladas/km2 dia)

Caldeira do vulcão Cuicocha (Equador) 106 8

Caldeira do vulcão Pululahua (Equador) 270 10

Vulcão Satsuma Iwojma (Japão) 80 32

Vulcão Vesúvio (Itália) 193.8 35

Caldeira do vulcão Nisyros (Grécia) 84 42

Campo geotermal de Yanbajain (China) 138 43

Campo geotermal de Reykjavík (Islândia) 13.5 61

Caldeira do vulcão das Furnas (Açores) 866 148

Fumarolas próximas da Lagoa das Furnas (Açores) 14 325

Campos termais no parque de Yellowstone (EUA) 60 387

Fumarolas próximas da localidade das Furnas (Açores) 12-15 414-517

Vulcão Cerro Negro (Nicarágua) 2800 4828

Adaptado de Viveiros, F. et al. (2011). Soil CO2 emission to the atmosphere from Furnas Volcano
(São Miguel Island, Azores archipelago). Proceedings of the Global Conference on Global Warming 2011.
Do historial de erupções nas Furnas constam dois colapsos de câmaras magmáticas que terão dado origem
a caldeiras, que foram parcialmente preenchidas por água. A datação baseada em isótopos 14C mostrou que
a formação da caldeira mais recente terá ocorrido há, aproximadamente, 12 000 a 10 000 anos.

Na resposta a cada um dos itens de 1. a 4., selecione a única opção que permite obter uma afirmação
correta.

1. A partir dos dados apresentados, podemos inferir que…


(A) … a libertação de gases muito ricos em CO2 é um dos principais indicadores de uma erupção
vulcânica eminente.
(B) … na caldeira das Furnas a libertação de CO2 por unidade de área é superior às fumarolas
das Furnas.
(C) … a libertação de gases com elevadas concentrações de dióxido de enxofre é indicadora do
fim da atividade vulcânica.
(D) … as populações que habitam a localidade das Furnas podem estar sujeitas a concentrações
elevadas de CO2.

2. A determinação da idade ____ da formação das caldeiras das Furnas foi possível porque os
isótopos de carbono desintegram-se a uma taxa ____ ao longo do tempo, dando origem a isótopos-
-filhos mais estáveis.
(A) absoluta (…) variável (C) relativa (…) constante
(B) absoluta (…) constante (D) relativa (…) variável

3. As erupções do tipo ____ estão associadas a magmas ácidos, e quando ocorrem em caldeiras
preenchidas por água ____ a formação de nuvens ardentes e a emissão de piroclastos.
(A) explosivo (…) diminuem (C) explosivo (…) potenciam
(B) efusivo (…) potenciam (D) efusivo (…) diminuem

4. O enquadramento tectónico do arquipélago açoriano justifica a predominância de magmas com


composição ____ e a existência de um ____ grau geotérmico.
(A) básica (…) alto (C) ácida (…) baixo
(B) básica (…) baixo (D) ácida (..) alto

5. Explique em que medida a interação entre os subsistemas terrestres permitiu a formação de uma
atmosfera e de um oceano primitivo.

6. Ordene as letras de A a E de modo a reconstituir a sequência cronológica de acontecimentos que


levaram à formação da caldeira das Furnas.
A. Preenchimento da depressão com água da chuva ao longo do tempo.
B. Erupção vulcânica com esvaziamento significativo da câmara magmática.
C. A câmara magmática completamente preenchida com magma é capaz de sustentar o peso das
camadas superiores.
D. Por ação da força gravítica exercida pelas camadas superiores, a câmara magmática vazia
colapsa, formando uma depressão à superfície.
E. O magma ascende na crusta e preenche por completo a câmara magmática das Furnas.

7. Os riscos geológicos da atividade vulcânica podem ser minimizados com monitorização adequada.
Mencione a importância da monitorização da libertação de gases na minimização do risco geológico
em regiões dos Açores com vulcanismo ativo.

8. No vulcão do Fogo, um dos maiores na ilha de S. Miguel, existe uma caldeira com morfologia
complexa que resultou de sucessivos episódios vulcânicos e abatimentos. Este vulcão possui um
campo geotermal muito ativo no flanco norte, que tem sido explorado para produzir cerca de 35%
das necessidades energéticas de S. Miguel.
Explique a importância da exploração da geotermia no contexto do desenvolvimento sustentável.
Teste 2
11.º Ano de Escolaridade
Grupo I
A ameba como modelo biológico

Nas primeiras experiências para investigar as funções das estruturas celulares usou-se a ameba como
material biológico. Trata-se de um organismo unicelular não fotossintético, muito comum nos lagos com
água parada.
Embora seja um organismo unicelular, possui um tamanho relativamente grande, o que facilita o seu
manuseamento ao microscópio ótico. É possível separar a ameba em dois fragmentos, tal como se encontra
representado na figura 1.

Figura 1

Admita que numa investigação foi adicionado uracilo marcado radioativamente a uma cultura de amebas.
Após um curto período de incubação, as células são observadas para detetar a presença de uracilo
radioativo nas suas moléculas. O uracilo radioativo é depois removido do meio por lavagem das células, em
que as amebas são transferidas para um novo meio contendo todos os nutrientes necessários (incluindo o
uracilo não radioativo). As células foram depois observadas em dois momentos próximos para detetar a
presença do uracilo radioativo (figura 2).
Nas observações efetuadas nos minutos seguintes, foram detetadas reduzidas quantidades de moléculas
marcadas com radioatividade no núcleo e no citoplasma.

Figura 2 – Deteção de uracilo radioativo (pontos) nas células.


Na resposta a cada um dos itens de 1. a 4., selecione a única opção que permite obter uma afirmação
correta.

1. O principal motivo para o fragmento sem núcleo representado na figura 1 morrer ao fim de 7 dias
deverá ser…
(A) … perda de água por osmose.
(B) … redução da síntese proteica.
(C) … perda da fluidez da membrana plasmática.
(D) … as mitocôndrias ficarem concentradas no fragmento que contém o núcleo.

2. Relativamente à experiência a que se reporta a figura 2, é possível afirmar que…


(A) … os resultados indicam que o RNA é sintetizado no núcleo e é transportado para o
citoplasma.
(B) … o principal objetivo foi provar que o RNA é composto por uracilo.
(C) … o principal objetivo foi provar que o RNA só é sintetizado na presença de uracilo marcado
radioativamente.
(D) … os resultados demonstram claramente que o RNA é sintetizado no núcleo, a partir do
molde de DNA, e depois é usado para a síntese de proteínas.

3. Procedeu-se à marcação radioativa de uracilo e não de outro nucleótido porque…


(A) … deste modo é possível determinar os locais de transferência do DNA.
(B) … o uracilo é o nucleótido que aparece em maior frequência na molécula de RNA.
(C) … o uracilo é o nucleótido que aparece em maior frequência no núcleo da célula.
(D) … qualquer RNA sintetizado pela ameba é facilmente detetado.

4. A lavagem para remover o uracilo marcado radioativamente, que tinha sido adicionado ao meio de
cultura, foi importante porque…
(A) … à medida que o RNA se degrada, apenas os percursores não marcados estão disponíveis
para a síntese de novo RNA.
(B) … permitiu remover a radioatividade espalhada pela célula e assim garantir que o sinal
detetado correspondia exclusivamente ao RNA sintetizado anteriormente durante a
incubação com uracilo radioativo.
(C) … a presença de marcadores radioativos inibe a migração do RNA do núcleo para o
citoplasma.
(D) … permitiu remover apenas o uracilo radioativo presente no citoplasma, restringindo o sinal
ao uracilo radioativo presente no núcleo.

5. Explique em que medida os dados indicam que o RNA tem a função de intermediário com um tempo
de vida reduzido.

6. A água dos lagos pode ser usada em culturas para crescimento e reprodução das amebas. À
temperatura de 18 ºC, e com fornecimento de nutrientes em intervalos regulares, a maioria das
amebas reproduz-se a cada 50 minutos.

No item 6.1., selecione a única opção que permite obter uma afirmação verdadeira.

6.1. Se o meio de cultura for modificado para ___, é razoável admitir que as amebas demorem
____de 50 minutos para se dividir e assim reproduzirem-se.
(A) um aumento da temperatura de 18 ºC para 30 ºC (…) menos
(B) um aumento significativo da densidade das amebas (…) menos
(C) uma redução da temperatura de 18 ºC para 10 ºC (…) mais
(D) aumentar a intensidade da luz que que atinge a água (…) mais

6.2. Admita que os fatores que afetam a divisão das amebas foram investigados em separado e
que a modificação de um fator não afetou os restantes.
Explique qual a importância de modificar individualmente os fatores que afetam a divisão
das amebas.
7. Classifique como verdadeira (V) ou falsa (F) cada uma das seguintes afirmações, relativas aos
mecanismos de reprodução assexuada.
(A) Durante o processo de bipartição formam-se dois organismos com características genéticas
distintas do progenitor.
(B) A partir do processo de fragmentação típico da estrela-do-mar, o segmento gerado pode
diferenciar-se e evoluir para um novo organismo.
(C) A prófase é a primeira etapa da divisão celular das amebas.
(D) O processo de partenogénese pode ocorrer em alguns répteis e os descendentes formam-se a
partir de óvulos não fecundados.
(E) Numa levedura com n cromossomas em que ocorre gemulação forma-se uma gémula com
n/2 cromossomas.
(F) No processo de divisão múltipla, o núcleo do progenitor divide-se formando vários núcleos
com mesmo número de cromossomas.
(G) Os descendentes de um processo de reprodução assexuada designam-se por clones.
(H) A divisão do citoplasma no final de uma bipartição designa-se por citocinese.

Grupo II
Reprodução do morangueiro

Os morangueiros são plantas pequenas com um ciclo de vida relativamente complexo, que se prolonga ao
longo do ano e se repete anualmente. O ciclo de vida de uma planta inicia-se por uma semente ou por um
estolho. Cada planta pode viver cerca de 5 anos, produzindo grandes quantidade de morangos.

Figura 3

Na resposta a cada um dos itens de 1. a 4., selecione a única opção que permite obter uma afirmação
correta.

1. Os estolhos são caules finos e longos, de crescimento aéreo e horizontal, cujas divisões _____ estão
associadas ao mecanismo de reprodução _____.
(A) mitóticas (…) sexuada (C) meióticas (…) assexuada
(B) mitóticas (…) assexuada (D) meióticas (…) sexuada
2. Uma planta de morangueiro adulta produz sementes _____ que após a germinação irão dar origem
a novas plantas geneticamente _____.
(A) diploides (…) iguais (C) diploides (…) diferentes
(B) haploides (…) iguais (D) haploides (…) diferentes

3. Durante o ciclo reprodutivo do morangueiro a meiose é _____, com alternância de gerações, em


que o esporófito é uma entidade diploide que resulta de sucessivas divisões do _____.
(A) pós-zigótica (…) gametófito (C) pré-espórica (…) zigoto
(B) pós-zigótica (…) zigoto (D) pré-espórica (…) gametófito

4. Os morangueiros têm um ciclo de vida _____ em que a fase diploide tem uma duração temporal
_____ à fase haploide.
(A) haplonte (…) superior
(B) haplodiplonte (…) inferior
(C) haplonte (…) inferior
(D) haplodiplonte (…) superior

5. Mencione dois fenómenos que ocorrem na formação dos esporos responsáveis pela introdução de
variabilidade genética nos morangueiros.

6. Faça corresponder cada uma das descrições dos acontecimentos que ocorrem durante os processos
de divisão celular expressos na coluna A à respetiva designação que consta na coluna B.
Utilize cada letra e cada número apenas uma vez.

Coluna A Coluna B

(a) Os cromossomas homólogos das células precursoras dos (1) Prófase


esporos, constituído cada um por dois cromatídios, dispõem- (2) Prófase I da meiose
se na zona equatorial da célula.
(3) Prófase II da meiose
(b) Início do estrangulamento do citoplasma do zigoto, que dará
(4) Metáfase
origem a duas células diploides.
(5) Metáfase I da meiose
(c) Disposição dos cromossomas na zona equatorial de uma
célula do estolho. (6) Anáfase
(d) Separação dos cromatídios com segmentos que sofreram (7) Anáfase II da meiose
recombinação genética prévia para polos opostos da célula. (8) Telófase
(e) Entre as tétradas cromatídicas das células precursoras dos
esporos ocorre troca de segmentos dos cromossomas.

7. Classifique como verdadeira (V) ou falsa (F) cada uma das seguintes afirmações relativas à obtenção
e transporte de matéria nos morangueiros.
(A) A absorção de CO2 pelos morangueiros para a síntese de compostos orgânicos ocorre
essencialmente através de estomas.
(B) O ATP produzido durante a fase fotoquímica da fotossíntese está associado ao fluxo de
eletrões que se gera do fotossistema I para o fotossistema II.
(C) A fixação do carbono inorgânico durante a fotossíntese ocorre na segunda etapa do Ciclo de
Calvin.
(D) A glicose resultante da fotossíntese pode ser convertida noutros hidratos de carbono e serem
armazenados nos morangos.
(E) Os produtos resultantes da fotossíntese são transportados para todos os órgãos do
morangueiro através do xilema.
(F) A translocação da água ocorre através do xilema e pode ser explicada pela hipótese da
tensão-coesão-adesão.
(G) O movimento da seiva elaborada está dependente da energia produzida a partir de reações
catabólicas que ocorrem ao nível do citoplasma e das mitocôndrias.
(H) Os morangueiros, por serem autotróficos, pertencem ao segundo nível trófico de uma cadeia
alimentar.
8. Os morangos são frutos que se caracterizam por possuírem uma polpa carnuda e doce, que contém
muitas sementes pequenas à superfície. Os morangos são muito apreciados por animais, que os
ingerem, e após a digestão libertam muitas sementes viáveis nas suas fezes, por vezes em locais
muito afastados do morangueiro onde recolheram o fruto.
Explique, numa perspetiva darwinista, o aparecimento de morangos contendo polpas cada vez mais
carnudas.

Grupo III
Seleção nas borboletas

Na Europa existem borboletas da espécie Biston betularia, que apresenta duas variedades: uma de cor
clara e outra de cor escura. Esta espécie de borboletas habita árvores cobertas de líquenes de cor clara e são
presas de aves insectívoras.
Antes da Revolução Industrial, que se iniciou no final do séc. XVII, em Inglaterra, a maioria das borboletas
da espécie B. betularia eram claras e habitavam os bosques pouco poluídos. A poluição libertada em
resultado da queima de carvão muito intensa a partir da Revolução Industrial, levou ao aumento do
número de borboletas escuras. Em zonas industriais, o aumento da poluição pode conduzir ao
enegrecimento dos troncos das árvores, alterando a facilidade com que os predadores detetam cada uma
das variedades das borboletas.
O gráfico da figura 4 representa a variação da percentagem de borboletas de cor escura em zonas
industriais da Inglaterra, durante um certo período de tempo, em função do teor de poluição no ar.

Figura 4

Na resposta a cada um dos itens de 1. a 4., selecione a única opção que permite obter uma afirmação
correta.

1. Com base nos dados fornecidos, a variação da frequência de borboletas de cor escura no período
compreendido entre 1970 e 1980 pode ser explicada por…
(A) … adaptação aos baixos níveis de poluição.
(B) … aumento da população de predadores em resultado da diminuição da poluição.
(C) … facilidade na sua identificação por parte dos predadores.
(D) … migração para zonas não industrializadas.

2. Pode afirmar-se que a seleção natural que ocorreu nas borboletas se deveu…
(A) … unicamente à interação entre as diferentes condições ambientais.
(B) … unicamente às diferenças genéticas entre as borboletas de cor clara e as de cor escura.
(C) … à variabilidade genética nas borboletas e à diferente interação destas com o meio.
(D) … à diferente resistência ao fumo manifestada pelas borboletas de cor clara e de cor escura.
3. Nas borboletas, a difusão de gases entre a superfície respiratória e as células é _____ e o seu
sistema circulatório é _____.
(A) direta (…) fechado
(B) direta (…) aberto
(C) indireta (…) aberto
(D) indireta (…) fechado

4. Alguns insetos são resistentes ao inseticida DDT, pelo que a sua aplicação induz…
(A) … à transmissão de caracteres adquiridos.
(B) … ao isolamento reprodutivo.
(C) … à mutação causada pelo meio.
(D) … à sobrevivência dos mais aptos.

5. Classifique como verdadeiras (V) ou falsas (F) as seguintes afirmações respeitantes aos dados
fornecidos.
A. O fundo genético da população de borboletas alterou-se ao longo do tempo.
B. A partir de 1960, o meio ambiente exerceu uma pressão estabilizadora, selecionando as
borboletas escuras como mais adaptadas.
C. A distribuição da população de borboletas ao longo do tempo demonstra uma seleção natural do
tipo disruptivo.
D. Antes do aumento da poluição industrial, o meio ambiente exerceu uma seleção disruptiva.
E. De acordo com a teoria lamarckista, a elevada percentagem de borboletas de cor escura no
período compreendido entre 1960 e 1965 pode ser explicada por terem maior tolerância à
toxicidade dos fumos.
F. Segundo o darwinismo, uma população ancestral de borboletas brancas poderá ter aumentado a
sua pigmentação ao longo do tempo, tornando-se mais escuras devido à exposição ao fumo.
G. De acordo com Lamarck, as borboletas brancas ficaram com cor escura e transmitiram essa
característica adquirida à descendência.
H. As asas das borboletas e as asas das aves podem considerar-se resultantes de uma evolução
divergente, tratando-se de órgãos análogos.

6. Os insetos são seres eucariontes, formados por células que possuem sistemas endomembranares
bem desenvolvidos, cuja origem evolutiva pode ser explicada pelos modelos autogénico e
endossimbiótico.

As afirmações seguintes dizem respeito a estes dois modelos. Selecione a alternativa que as avalia
corretamente.
(1) No modelo autogénico, ocorre endocitose de procariontes com capacidade para conversão de
energia luminosa em energia química.
(2) O invólucro nuclear e os sistemas endomembranares associados podem ter a sua origem
evolutiva em invaginações da membrana celular.
(3) O modelo autogénico e o modelo endossimbiótico são modelos explicativos para o
desenvolvimento de células procariontes a partir de células eucariontes.

(A) 1 é verdadeira; 2 e 3 são falsas


(B) 2 é falsa; 1 e 3 são verdadeiras
(C) 2 é verdadeira; 1 e 3 são falsas
(D) 1 é falsa; 2 e 3 são verdadeiras

7. Numa perspetiva neodarwinista, explique o surgimento de um elevado número de borboletas de cor


escura a partir de uma população ancestral de borboletas de cor clara, tendo como referência dois
acontecimentos típicos da primeira divisão da meiose.
Grupo IV
Estrutura interna da Terra e de Mercúrio

A Terra e os restantes planetas telúricos partilham um passado comum. O estudo da estrutura interna
destes planetas é essencial para reconstituir o seu passado e compreender os processos que ocorrem na
atualidade.
Os modelos teóricos da estrutura interna da Terra e de Mercúrio, dois planetas telúricos, encontram-se
representados na figura 5.

Figura 5 – Estrutura interna da Terra e de Mercúrio.

Na resposta a cada um dos itens de 1. a 6., selecione a única opção que permite obter uma afirmação
correta.

1. O modelo da estrutura interna da Terra da figura 5 foi baseado em critérios _____, e com base em
métodos essencialmente _____.
(A) físicos e químicos (…) diretos
(B) físicos e químicos (…) indiretos
(C) químicos (…) indiretos
(D) físicos (…) diretos

2. É possível proceder-se à datação absoluta de rochas de Mercúrio uma vez que…


(A) … o decaimento radioativo ocorre a uma taxa constante e não é influenciado por fatores
externos.
(B) … o decaimento radioativo ocorre de igual forma à Terra, isto é, a uma taxa variável
dependendo de fatores como a temperatura.
(C) … o decaimento radioativo ocorre a uma taxa variável.
(D) … qualquer mineral pode ser usado na datação radiométrica das rochas.
3. Os planetas gigantes possuem uma estrutura interna muito distinta da representada na figura 5,
apesar de serem _____ densos e terem _____ massa.
(A) mais (…) menor
(B) menos (…) menor
(C) mais (…) maior
(D) menos (…) maior

4. Mercúrio é considerado um planeta geologicamente _____ uma vez que _____.


(A) inativo (…) não possui atmosfera
(B) ativo (…) revela manifestações vulcânicas e tectónicas
(C) inativo (…) não revela manifestações vulcânicas ou tectónicas
(D) ativo (…) possui geodinâmica externa em resultado da sua densa atmosfera

5. Se fosse gerado um sismo na crusta de Mercúrio, seria expectável que a velocidade das ondas
sísmicas…
(A) … diminuísse ao atravessarem o núcleo interno.
(B) … aumentasse ao atravessarem o núcleo interno.
(C) … aumentasse de forma constante até aos 2440 km de profundidade.
(D) … diminuísse de forma constante até aos 2440 km de profundidade.

6. O vulcanismo é um fenómeno abundante na crusta terrestre. Os magmas de origem mantélica


podem ser emitidos nos _____ e possuem uma composição _____.
(A) riftes (…) ultrabásica a básica
(B) riftes (…) ácida
(C) cratões (…) intermédia
(D) limites convergentes do tipo continente-continente (…) ácida

7. Ordene as letras de A a E de modo a reconstituir a sequência cronológica de acontecimentos que


dizem respeito à formação do Sistema Solar e dos planetas telúricos.
A. Colisão de planetesimais e formação de proto-planetas.
B. Contração de uma nuvem de gases e poeiras sob o efeito da força gravítica.
C. Condensação de gases e poeiras dando origem a corpos com massa suficiente para gerar força
gravítica.
D. Acreção e diferenciação originam planetas formados por metais e rochas.
E. Formação de um disco plano de gases e poeiras.

8. Relacione a tectónica de placas com as propriedades físicas dos materiais que constituem o manto
terrestre.
Teste 3
11.º Ano de Escolaridade
Grupo I
Experiência de Luria e Delbrück

A experiência de Luria e Delbrück, também conhecida por teste de flutuação, foi publicada em 1943 e
tornou-se um marco no estudo dos mecanismos responsáveis pelas mutações nos organismos. Em
resultado, Max Delbrück e Salvador Luria ganharam o prémio Nobel da Medicina em 1969.
Na década de 40 do século XX, pensava-se que as bactérias eram capazes de alterar o seu DNA em função
das condições do meio ambiente, mas não existiam evidências experimentais. Luria e Delbrück
implementaram uma experiência para testar se as mutações eram:
 pré-adaptativas – ocorreriam de forma aleatória, antes de as bactérias serem expostas ao agente
de seleção;
 pós-adaptativas – resultariam de pressões resultantes do agente de seleção.

Estas duas hipóteses encontram-se representadas na figura 1.

Figura 1 – Hipóteses levantadas por Luria e Delbrück.

Luria e Delbrück inocularam bactérias da espécie Escherichia coli em tubos de cultura distintos. Após o
crescimento, transferiram iguais volumes de cultura celular para placas de Petri contendo agar (meio
sólido) e repleto de bacteriófagos T1 (vírus que destroem as bactérias).
Luria e Delbrück esperavam que as mutações que causam resistência aos bacteriófagos fossem causadas
pela exposição aos mesmos, originando uma distribuição semelhante entre as placas de Petri. Os seus
resultados encontram-se representados na figura 2.

Figura 2 – Resultados da experiência de Luria e Delbrück. Os pontos nas placas de Petri correspondem a
colónias de bactérias que foram capazes de resistir aos bacteriófagos.
Na resposta a cada um dos itens de 1. a 6., selecione a única opção que permite obter uma afirmação
correta.

1. De acordo com os dados, no início da experiência Luria e Delbrück defendiam a hipótese ____, pois
esperavam que as mutações ocorressem ____ da exposição ao agente de seleção.
(A) A (…) antes
(B) A (…) em resultado
(C) B (…) antes
(D) B (…) em resultado

2. Com base nos resultados da figura 2, é possível verificar que as mutações ocorreram de forma…
(A) … aleatória e são pré-adaptativas, pois ocorreram antes do contacto das bactérias com os
bacteriófagos.
(B) … aleatória e são pós-adaptativas, pois ocorreram depois do contacto das bactérias com os
bacteriófagos.
(C) … direcionada e são pré-adaptativas, pois ocorreram antes do contacto das bactérias com os
bacteriófagos.
(D) … direcionada e são pós-adaptativas, pois ocorreram depois do contacto das bactérias com
os bacteriófagos.

3. Relativamente à experiência de Luria e Delbrück, é possível afirmar que…


(A) … nos tubos 2 e 9 os meios de cultura não tinham nutrientes suficientes para a proliferação
das bactérias, ao contrário do tubo 3.
(B) … as possíveis mutações nas bactérias do tubo 4 criaram resistência aos bacteriófagos.
(C) … nas bactérias as mutações genéticas surgem de forma independente do agente de seleção.
(D) … a seleção natural apenas pode ser aplicada em seres vivos complexos.

4. A bactéria Escherichia coli pode distinguir-se de uma célula vegetal…


(A) … por não ocorrer processamento do RNA mensageiro transcrito a partir do DNA.
(B) … pela quantidade de energia acumulada na molécula de ATP ser menor na bactéria.
(C) … por possuir um núcleo menos complexo e com menor quantidade de DNA
comparativamente à segunda.
(D) … pela primeira apresentar a capacidade de acumular mutações no seu material genético.

5. De acordo com o sistema de classificação de Whittaker modificado, o critério que permite colocar a
bactéria Escherichia coli inequivocamente no reino Monera é…
(A) … ser unicelular.
(B) … ser microconsumidor.
(C) … possuir parede celular.
(D) … ser constituída por uma célula procariótica.

6. Na designação da bactéria Escherichia coli, o termo…


(A) … Escherichia refere-se à ordem e coli ao restritivo específico.
(B) … Escherichia refere-se ao género e coli ao restritivo específico.
(C) … Escherichia refere-se à ordem e coli ao género.
(D) … Escherichia refere-se ao género e coli ao restritivo subespecífico.

7. Luria e Delbrück deixaram crescer as bactérias e depois transferiram iguais volumes de cultura
celular para placas de Petri.
Refira a importância destes dois procedimentos experimentais.

8. Explique em que medida a experiência de Luria e Delbrück constituiu um forte argumento a favor
das ideias de Darwin, em detrimento das ideias defendidas por Lamarck.

9. O mecanismo de resistência ao bacteriófago T1 está relacionado com uma mutação que ocorre ao
nível de um gene responsável pela síntese de uma proteína membranar que atua como recetor do
vírus e que permite a sua entrada na bactéria.
Explique, numa perspetiva neodarwinista, o aparecimento de novas estirpes de bacteriófagos que
são capazes de infetar as bactérias resistentes.
Grupo II
Evolução dos hominídeos

A evolução da nossa espécie é ainda pouco conhecida. Contudo, a partir dos dados obtidos através do
estudo dos fósseis encontrados por todo o globo e de dados moleculares é possível construir árvores
filogenéticas.
Na figura 3 encontra-se uma possível relação filogenética que terá conduzido à evolução da nossa espécie.

Figura 3 – Possível evolução dos hominídeos.

O DNA mitocondrial de humanos modernos foi comparado com o DNA mitocondrial de chimpanzés
(0 primata filogeneticamente mais próximo) e com amostras recolhidas de vários Neandertais, um
hominídeo que desapareceu da Europa há cerca de 28 000 anos, com resultados que podem ser avaliados
na tabela I.
Tabela I – Comparação da sequência de DNA mitocondrial de diferentes organismos. A letra X indica que
o nucleótido de DNA é igual ao da sequência humana.

Organismo Sequência de DNA mitocondrial analisado

Humano moderno AATTCCCCGACTGCAATTCACGCACCATCCT


Chimpanzé XXXXXXTXATTXXXXXACTGAAAXXXXGXXX
Neandertal 1 GGXCTTTTATTCXTCCCTGTAAGTATGCTXC
Neandertal 2 GGXXXXXXATTXATCCCCTGTAAXTATGCTT
Neandertal 3 XCXXXXXXATTXATCCCCTGTAAXTATGCTT

Na resposta a cada um dos itens de 1. a 5., selecione a única opção que permite obter uma afirmação
correta.

1. A partir da árvore filogenética representada na figura 3, podemos concluir que…


(A) … os genéros Paranthropus e Homo têm origem em ancestrais diferentes.
(B) … a espécie mais próxima da nossa é o Homo erectus.
(C) … o género Homo teve origem no género Paranthropus.
(D) … a divergência do género Australopithecus dos géneros Homo e Paranthropus ocorreu há
menos de 3,5 milhões de anos.

2. A explicação mais plausível para a elevada variabilidade no DNA mitocondrial das populações
humanas dispersas pelo continente africano é o facto de…
(A) … 0 homem moderno ter surgido em África e estar há mais tempo a evoluir neste continente.
(B) … o DNA mitocondrial ter uma taxa de mutação superior em África, quando comparado com
outros continentes.
(C) … 0 homem moderno ter surgido em África e estar há menos tempo a evoluir neste
continente.
(D) … a seleção natural não operar no DNA mitocondrial dos organismos que habitam o
continente africano.

3. Paranthropus aethiopicus, Paranthropus boisei e Homo habilis são designações de três espécies
que pertencem à família Hominidae. Com base nesta nomenclatura, podemos concluir que…
(A) … P. aethiopicus e P. boisei partilham o mesmo restritivo específico.
(B) … P. boisei e H. habilis partilham a mesma ordem.
(C) … P. aethiopicus e H. habilis pertencem ao mesmo género.
(D) … as três espécies pertencem a ordens diferentes.

4. Os hominídeos, tal como os restantes mamíferos, são homeotérmicos, ou seja, têm temperatura
corporal ____ e produzem a maioria do seu calor através do metabolismo, sendo por isso
designados ____.
(A) constante (…) ectotérmicos
(B) variável (…) endotérmicos
(C) constante (…) endotérmicos
(D) variável (…) exotérmico

5. Não constitui um argumento a favor da teoria endossimbiótica, o facto de…


(A) … o DNA mitocondrial ser circular e codificar todo o tRNA.
(B) … os complexos proteicos envolvidos na fosforilação oxidativa estarem presentes na face
interior da membrana interna da mitocôndria e na face interna da membrana plasmática das
bactérias.
(C) … alguns organismos eucariontes sem mitocôndrias possuírem genes que codificam
proteínas semelhantes às proteínas mitocondriais.
(D) … os ribossomas mitocondriais serem pequenos e semelhantes aos das bactérias.

6. Mencione o primata do género Australopithecus ancestral dos hominídeos.


7. Classifique como verdadeira (V) ou falsa (F) cada uma das afirmações seguintes tendo como base o
estudo comparativo de DNA mitocondrial (Tabela I).
A. Existem mais diferenças entre a sequência de DNA mitocondrial do homem e do chimpanzé,
do que do homem e do neandertal 1.
B. Existem mais diferenças entre as sequências de DNA mitocondrial dos neandertais 2 e 3, do
que do homem moderno e do chimpanzé.
C. Existem menos diferenças entre as sequências de DNA mitocondrial dos neandertais 2 e 3, do
que dos neandertais 1 e 2.
D. Com base na semelhança entre as sequências, os chimpanzés são mais próximos do neandertal 1
do que dos humanos modernos.
E. Se as sequências de DNA fossem transcritas e traduzidas, a sequência de aminoácidos
resultantes seria mais próxima entre os chimpanzés e o homem moderno do que entre este o
neandertal 1.
F. Embora pertençam todos à mesma espécie, o neandertal 2 e o neandertal 3 devem partilhar
um maior número de órgãos homólogos do que o neandertal 1 e o 2.
G. O RNA resultante da transcrição do DNA mitocondrial humano analisado terá menos
nucleótidos de uracilos do que o resultante da transcrição do DNA mitocondrial do
chimpanzé.
H. Uma vez que as sequências de DNA analisadas não são iguais, estes dados contrariam a teoria
da evolução a partir de um ancestral comum.

8. Faça corresponder a cada uma das letras de A a E, que correspondem a afirmações relativas à
evolução da espécie humana, um dos números romanos da chave. Utilize cada letra apenas uma vez.

Afirmações:
A. Numa população de hominídeos há características que são transmitidas à descendência e que
resultaram de modificações que os organismos sofreram para responder às variações
ambientais.
B. A espécie humana permanece imutável no tempo desde o momento da sua criação.
C. Numa população de hominídeos da mesma espécie, os indivíduos que apresentam
características mais vantajosas conseguem adaptar-se de forma mais eficaz às variações do
meio.
D. O Homo sapiens resulta de mecanismos evolutivos que atuaram ao longo do tempo.
E. Ao nível do material genético ocorrem mutações que podem promover o aparecimento de
novos genes e, consequentemente, a produção de fenótipos que permitem uma melhor
adaptação ao meio.

Chave:
I. Darwinismo
II. Fixismo
III. Fixismo e darwinismo
IV. Lamarckismo
V. Fixismo e neodarwinismo
VI. Lamarckismo, darwinismo e neodarwinismo
VII. Neodarwinismo
VIII. Lamarckismo e neodarwinismo
Grupo III
Ciclo de vida de cogumelos

Os fungos incluem um conjunto de organismos com ciclos de vida muito diversos, com formas de obtenção
de alimento muito próprias, sendo um grupo essencial na reciclagem de nutrientes nas cadeias
alimentares.
Embora muitos dos aspetos do ciclo de vida dos fungos sejam ainda desconhecidos, alguns organismos,
como os cogumelos, possuem ciclos de vida já bem caracterizados.
Os cogumelos têm a maioria da sua massa no solo, sob a forma de hifas, formando o basidiocarpo. Esta
estrutura aérea é vulgarmente designada por cogumelo apenas numa fase restrita do seu ciclo de vida, que
se encontra representado na figura 4.

Figura 4

Na resposta a cada um dos itens de 1. a 5., selecione a única opção que permite obter uma afirmação
correta.

1. Nos primeiros sistemas de classificação, o organismo representado na figura era incluído no reino
____, e na classificação de Whittaker modificada foi incluído no reino ____.
(A) Plantae (…) Monera
(B) Plantae (…) Fungi
(C) Protista (…) Fungi
(D) Fungi (…) Protista
2. No passado, alguns cientistas consideravam que todos os fungos tinham evoluído a partir de uma
alga, que teria…
(A) … perdido os cloroplastos.
(B) … ganho os cloroplastos.
(C) … perdido as mitocôndrias.
(D) … ganho as mitocôndrias.

3. Os fungos são seres ____ quanto à fonte de carbono, quanto à organização celular ____.
(A) heterotróficos (…) são todos multicelulares
(B) heterotróficos (…) podem ser multicelulares ou unicelulares
(C) autotróficos (…) são todos multicelulares
(D) autotróficos (…) podem ser multicelulares ou unicelulares

4. Todos os fungos, nos quais se inclui o cogumelo cujo ciclo está representado na figura 4, são
organismos ____ e realizam ____.
(A) procariontes (…) digestão intracorporal
(B) procariontes (…) fotossíntese
(C) eucariontes (…) digestão extracorporal
(D) eucariontes (…) fotossíntese

5. Para que ocorra a replicação do DNA nos núcleos das células de fungos é necessário…
(A) … DNA polimerase e nucleótidos contendo ribose.
(B) … glicose, ATP e mRNA.
(C) … RNA ribossómico e aminoácidos.
(D) … DNA polimerase e nucleótidos contendo desoxirribose.

6. As afirmações seguintes são respeitantes ao ciclo de vida representado na figura 4.


Utilize cada um dos termos da chave para avaliar cada uma das afirmações de A a H.

Chave:
I. Afirmação apoiada pelos dados
II. Afirmação contrariada pelos dados
III. Afirmação sem relação com os dados

Afirmações:
A. O basidiocarpo é uma estrutura cujas células são haplontes e possuem apenas um núcleo.
B. No basidiocarpo, após a união dos dois núcleos, ocorre uma divisão que não mantém o
número de cromossomas, formando esporos.
C. Após a formação dos esporos, estes são espalhados no meio ambiente pela ação da água e do
vento.
D. A germinação dos esporos depende da ocorrência de meioses sucessivas.
E. O ciclo de vida representado na figura 4 evidencia apenas mecanismos de reprodução
assexuada, com predominância de uma fase haplonte.
F. O organismo representado possui órgãos sexuais especializados.
G. Imediatamente após a fusão das hifas de organismos diferentes, ocorre a fusão dos respetivos
núcleos.
H. Os fungos obtêm os nutrientes que necessitam por absorção, sendo por isso designados por
microconsumidores.

7. Em 1928, o investigador Alexander Fleming observou que esporos libertados por fungos
decompositores do pão e da fruta impediram o crescimento de bactérias. Desde 1941 que se usa a
penicilina extraída a partir dos fungos como antibiótico, no tratamento de diversas doenças
causadas por bactérias. A penicilina interfere na síntese da parede das bactérias, cujo citoplasma é
hipertónico relativamente ao meio.
7.1. Relacione a eficácia da penicilina enquanto antibiótico com o seu modo de atuação.
7.2. Explique em que medida a produção e libertação de penicilina pelos fungos confere uma
vantagem competitiva sobre as bactérias decompositoras vizinhas.
Grupo IV
Sismologia

Os estudos na área da sismologia são essenciais para compreendermos a dinâmica interna do nosso
planeta e permitir prever a ocorrência do próximo grande sismo.
Algumas regiões da superfície terrestre possuem maior atividade que outras. Por exemplo, na zona das
ilhas Aleutas, cuja localização se encontra assinalada na figura 5, desde 1990 até ao final de 2014
registaram-se 202 sismos com magnitude superior a 5.
Com base no padrão dos sismos é possível concluir que nas ilhas Aleutas existe uma zona de subducção.

Fonte: USGS, National Earthquake Information Center

Figura 4 – (A) Principais placas litosféricas, com indicação da localização das ilhas Aleutas.
(B) Sismicidade histórica desde 1990 até 2014.
Na resposta a cada um dos itens de 1. a 5., selecione a única opção que permite obter uma afirmação
correta.

1. A partir da distribuição dos sismos, é possível concluir que na fossa das Aleutas ocorre a subducção
da placa ____ sob a placa ____.
(A) norte-americana (…) euro-asiática
(B) euro-asiática (…) norte-americana
(C) do pacífico (…) euro-asiática
(D) do pacífico (…) norte-americana

2. No contexto tectónico das ilhas Aleutas é expetável que, com o afastamento para norte da zona de
subducção, o ____ dos sismos se torne mais ____.
(A) hipocentro (…) profundo
(B) hipocentro (…) superficial
(C) epicentro (…) profundo
(D) epicentro (…) superficial

3. Nas zonas de subducção o vulcanismo tende a ser do tipo ____, com emissão de lavas cujo teor em
sílica as permite incluir no grupo das lavas com composição ____.
(A) explosivo (…) básica
(B) efusivo (…) básica
(C) explosivo (…) intermédia
(D) efusivo (…) intermédia

4. Em termos morfológicos, uma zona de subducção está habitualmente marcada por uma ____, e um
rifte submarino está no centro de uma ____.
(A) fossa oceânica (…) plataforma continental
(B) fossa oceânica (…) dorsal médio oceânica
(C) plataforma continental (…) dorsal médio oceânica
(D) planície abissal (..) dorsal médio oceânica

5. Na figura 4B está representado um limite tectónico do tipo ____, em que ocorre ____ das placas
litosféricas.
(A) convergente (…) destruição
(B) convergente (…) produção
(C) divergente (…) destruição
(D) divergente (…) produção

6. Num sismo de magnitude elevada que seja gerado na zona de subducção na região das Aleutas, não
serão registadas ondas sísmicas ____ por sismógrafos que se encontrem a uma distância angular
de, aproximadamente, ____ relativamente ao epicentro.
(A) P (…) 103º e 180º
(B) S (…) 103º e 180º
(C) P (…) 143º e 180º
(D) S (…) 43º e 180º

7. Ordene as letras de A a E de modo a reconstituir a sequência cronológica de acontecimentos que


ocorrem na propagação de ondas sísmicas.
A. Chegada das ondas P ao epicentro.
B. Propagação de ondas superficiais a partir do epicentro.
C. Propagação de ondas S e P a partir do hipocentro.
D. Chegada das ondas P a uma estação sismográfica situada 3000 km a oeste do epicentro,
seguida de ondas S.
E. Acumulação de energia nas rochas em profundidade, ao longo do tempo que antecede o sismo.

8. A maioria dos tsunamis são gerados em ambientes tectónicos semelhantes ao das ilhas Aleutas.
Relacione a formação dos tsunamis com a magnitude dos sismos e o ambiente tectónico em que se
geram.
Teste 4
11.º Ano de Escolaridade
Grupo I
Derrocada em Albufeira

No dia 21 de agosto de 2009 ocorreu um movimento em massa na praia de Maria Luísa, em Albufeira, que
vitimou 5 turistas. Este foi o acidente mais grave verificado no litoral, desde 1992, em consequência da
geodinâmica das arribas. Na praia onde ocorreu este movimento em massa existiam diversos sinais a
indicar o perigo de permanecer junto às arribas.
Uma das possibilidades para explicar a derrocada foi a ocorrência de um sismo com magnitude 4,2 alguns
dias antes, que foi sentido na região sul de Portugal, a cerca de 110 km ao largo de Faro. Uma outra
hipótese adiantada foi a existência de fortes marés e ondulação na região nos dias que antecederam a
derrocada. Não se verificaram tempestades com precipitação intensa nos dias que antecederam o acidente.
Diversos estudos efetuados por geólogos portugueses identificaram 177 movimentos em massa que
afetaram as arribas litorais, permitindo estimar as taxas de recuo da linha costeira na ordem dos 1 a 2
centímetros por ano.
Da recolha de evidências e relatos dos movimentos em massa, foi possível caracterizar com maior detalhe a
data de ocorrência dos movimentos e as causas associadas. Os dados relativos a um período de 9 anos
encontram-se na figura 1.

Figura 1 – Distribuição dos movimentos em massa ao longo do ano. Os dados compreendem o período
de julho de 1995 a junho de 2009. A precipitação apresentada corresponde a valores médios.
Fonte: Teixeira, S. B. (2009). Geodinâmica, Ocupação e Risco na Praia Maria Luísa (Albufeira):
Relatório do Departamento de Recursos Hídricos do Litoral, Faro, 25 p (adaptado).

A costa do barlavento algarvio é dominada por arribas talhadas em rochas carbonatadas Mesozoicas e
Miocénicas. Os estratos são formados por alternância de camadas formadas por calcarenitos finos e
calcarenitos bioclásticos, que se encontram perto da horizontal e com espessura de dezenas de centímetros.
Os teores de carbonato oscilam entre 60 a 75% nos calcarenitos finos e 80% nos calcarenitos bioclásticos.
As rochas da praia da Maria Luísa estão incluídas na Formação de Lagos-Portimão, e na base daquela praia
encontram-se expostas as rochas miocénicas. No topo da sequência encontram-se rochas do Quaternário,
constituídas por areias argilosas de cor vermelha. A espessura deste estrato é muito variável.
A Formação de Lagos-Portimão possui rochas carbonatadas e arenitos, contendo vestígios fósseis de
briozoários e de moluscos, típicos de ambientes pouco profundos e de condições climáticas temperadas a
quentes.

Figura 2 – Sequência estratigráfica e variação do nível médio da água do mar na


região central do litoral algarvio no Miocénio, com destaque para a Formação de
Lagos-Portimão. Os calcários encontram-se representados com uma textura
quadriculada e os arenitos correspondem aos restantes estratos. O conteúdo
fossilífero não é apresentado.
Fonte: Brachert, et al. (2003). Lowstand carbonates, highstand sandstones?
Volume 155, Issues 1–2, Sedimentary Geology (adaptado).

Na resposta a cada um dos itens de 1. a 5., selecione a única opção que permite obter uma afirmação
correta.

1. Com base nos dados da figura 1 é possível concluir que...


(A) …. há um desfasamento entre o pico de atividade dos agentes (janeiro) e o pico da frequência
dos movimentos (dezembro).
(B) … nos litorais de arriba a erosão provoca movimentos em massa, principalmente nos
períodos de forte precipitação.
(C) … a distribuição anual dos movimentos de massa registados mostra uma clara sazonalidade
das ruturas, concentradas durante o outono, acompanhando de perto a atividade dos agentes
do meio ambiente.
(D) … a praia Maria Luísa está localizada numa zona que se insere numa costa rochosa em
franco avanço devido à subida do nível das águas do mar.

2. No estudo a que se reporta a figura 1, podem ser consideradas variáveis em estudo…


(A) … a precipitação, o número de dias de tempestade e o número de movimentos em massa
entre 1995 e 2009.
(B) … a precipitação, o número de dias de tempestade entre 1995 e 2009 e a ocorrência de
sismos.
(C) … o tipo de rochas que afloram na região de Albufeira.
(D) … apenas o tempo e o número de dias de tempestade.

3. De acordo com a figura 2…


(A) ... o nível do mar tem-se mantido constante desde o Miocénico.
(B) … a Formação Lagos-Portimão possui apenas rochas detríticas, contendo sedimentos com
granulometria igual desde a base até ao topo.
(C) … ocorreram apenas regressões durante o Miocénico.
(D) … ocorreu, há 11,2 M.a, a maior regressão do Miocénico.
4. No topo da sequência das rochas que constituem as arribas da praia de Maria Luísa encontram-se
rochas do Quaternário, constituídas por areias argilosas de cor vermelha que devem a sua coloração
à meteorização…
(A) … física por oxidação.
(B) … química por abrasão.
(C) … física por abrasão.
(D) … química por oxidação.

5. Uma característica típica das arribas algarvias ricas em calcários é a elevada ____, originando uma
rede de algares e cavernas, que quando expostos à erosão marinha resulta numa paisagem recortada,
contendo diversos elementos morfológicos característicos como as grutas, os ____ e os arcos.
(A) sedimentação (…) leixões
(B) carsificação (…) leixões
(C) sedimentação (…) esporões
(D) carsificação (…) esporões

6. A Formação de Lagos-Portimão possui rochas com vestígios fósseis de organismos que habitavam
ambientes marinhos pouco profundos e com águas quentes.
Explique em que medida as características das rochas que constituem a Formação de Lagos-
Portimão indicam um paleoambiente típico de ambientes marinhos pouco profundos.

7. Uma das hipóteses iniciais levantadas pelo Centro de Investigação Marinha e Ambiental para
explicar a derrocada de Albufeira foram as vibrações sísmicas.
Relacione a ocorrência de sismos com a geração de movimentos em massa.

8. Classifique como verdadeira (V) ou falsa (F) cada uma das seguintes afirmações, relativas aos
movimentos em massa, em particular o que ocorreu em Albufeira.
A. A subida do nível médio do mar devido às alterações climáticas e a reduzida resistência das
rochas das arribas algarvias à ação do mar poderão potenciar a frequência e a intensidade das
derrocadas.
B. Todos os movimentos em massa têm origem natural.
C. Os movimentos em massa que ocorreram na praia de Maria Luísa foram provocados quando o
atrito dos materiais superou a força da gravidade.
D. Os movimentos em massa não são modeladores das paisagens geológicas.
E. Os movimentos em massa podem causar sismos e tsunamis.
F. A vegetação presente nas dunas é importante na promoção dos movimentos em massa.
G. A construção de hotéis nas arribas algarvias pode aumentar a ocorrência de movimentos de
massa.
H. As marés e a forte ondulação devem ter provocado a erosão das rochas mais recentes na base
da sequência estratigráfica e a queda posterior das rochas mais antigas que se encontravam no
topo da sequência, que deixaram de estar suportadas.
Grupo II
Formação do carvão

O carvão constitui uma das principais fontes de energia para a nossa sociedade. Enquanto combustível, o
carvão possibilitou a Revolução Industrial e o desenvolvimento rápido das sociedades.
A queima do carvão e de outros combustíveis tem originado um aumento da libertação de dióxido de
carbono para a atmosfera, cujos impactes ainda não são totalmente conhecidos.
O carvão é muito rico em energia e pode conter vestígios de minerais, tais como a caulinite, a pirite, o
quartzo, a calcopirite e a galena.
A figura 3 apresenta a sequência de formação de uma série de estratos, contendo carvão.

Tempo

Figura 3

Na resposta a cada um dos itens de 1. a 5., selecione a única opção que permite obter uma afirmação
correta.

1. Se a grafite for sujeita a elevadas pressões e temperaturas pode originar, sem ocorrerem
modificações composicionais, o diamante, que cristaliza num sistema cristalográfico distinto da
grafite. Este processo enquadra-se no ____ e permite a formação de um ____.
(A) metamorfismo (…) polimorfo
(B) magmatismo (…) polimorfo
(C) metamorfismo (…) isomorfo
(D) magmatismo (…) isomorfo

2. O carvão é essencialmente formado a partir da ____ de material de origem vegetal que evolui ao
longo de milhões de anos, com ____ em carbono.
(A) metamorfização (…) enriquecimento
(B) diagénese (…) enriquecimento
(C) metamorfização (…) empobrecimento
(D) diagénese (…) empobrecimento

3. Os carvões encontram-se frequentemente sob a forma de um estrato, que pode ser definido como
uma camada distinta…
(A) … resultante da deposição, na posição horizontal, de rochas magmáticas intrusivas.
(B) … resultante da deposição, na posição horizontal, de rochas provenientes do metamorfismo
de contacto.
(C) … de sedimentos que se depositam na posição horizontal mantendo a sua horizontalidade
sempre inalterada ao longo do tempo, sob ação de forças tectónicas.
(D) … de sedimentos que se depositam na posição horizontal, podendo sofrer alterações na sua
posição ao longo do tempo, sob ação de forças tectónicas.
4. Um mineral é um sólido ____ que possui uma estrutura interna ordenada e uma composição
química ____.
(A) inorgânico (…) variável
(B) orgânico natural (…) definida
(C) inorgânico natural (…) definida
(D) orgânico natural (…) variável

5. A dureza de um mineral refere-se à resistência que apresenta ao risco. Assim, o mineral granada,
com grau de dureza 6,5 a 7,5 …
(A) … risca e é riscado pelo diamante.
(B) … é riscado pela faca (dureza 7) e pelo vidro (dureza 5,5).
(C) … é riscado pelo corindo (dureza 9) e pela moeda (dureza 3,5).
(D) … risca a ortóclase (dureza 6) e é riscado pelo topázio (dureza 8).

6. Ordene as letras de A a E de modo a reconstituir uma possível sequência cronológica dos


acontecimentos relacionados com a formação de carvões.
A. Formação de turfa, onde ainda são visíveis restos vegetais.
B. A matéria vegetal fóssil fica sujeita a condições redutoras, próximas das anaeróbias.
C. Expulsão de elevadas quantidades de água, aumento do teor em carbono e libertação de
voláteis.
D. Acumulação, em zonas pantanosas, de matéria fóssil vegetal, formando camadas espessas.
E. A hulha é transformada na antracite, em resultado do aumento das condições de pressão e
temperatura.

7. Mencione o tipo de recurso em que se inclui o carvão.

8. Classifique como verdadeira (V) ou falsa (F) cada uma das seguintes afirmações relativas ao ciclo das
rochas.
A. No metamorfismo ocorrem alterações estruturais e composicionais dos minerais.
B. A deposição sucessiva de sedimentos provoca compactação e afundamento das camadas, que
sofrem litificação formando rochas sedimentares não consolidadas.
C. As rochas magmáticas intrusivas apresentam cristais que podem ser distinguidos à vista
desarmada, resultado do arrefecimento lento do magma.
D. O aumento da pressão e temperatura com a profundidade não provoca alterações da textura
das rochas.
E. Os minerais das rochas magmáticas intrusivas sofrem meteorização quando expostos às
condições de pressão e de temperatura da superfície terrestre.
F. Os processos de metamorfismo e magmatismo estão dependentes da energia solar e da
energia interna da Terra.
G. Na formação de rochas metamórficas ocorre recristalização de minerais no estado sólido.
H. As rochas magmáticas são sempre formadas diretamente a partir de sedimentos.

9. Explique a importância da presença de água no ambiente de formação dos carvões.


Grupo III
Seleção natural e agentes patogénicos das plantas

Os estudos de genética efetuados em populações de seres vivos têm demonstrado que quanto maior a
diversidade genética de uma população, maior o seu potencial para evoluir.
Muitos organismos sofrem evolução em resultado de variações dos fatores abióticos, mas uma parte
significativa da evolução das espécies prende-se com os fatores bióticos, que originam pressões evolutivas
seletivas.
As interações entre as plantas e fungos que as parasitam são reveladoras de pressões evolutivas seletivas. O
aparecimento de uma estirpe de fungos muito patogénica origina a seleção natural das plantas
naturalmente resistentes. Este fenómeno coloca pressão nos fungos, que deixam se ser capazes de infetar
as plantas. Só quando surge uma nova estirpe de fungos mais patogénica é que voltam a colocar-se
pressões seletivas elevadas sobre as plantas.
O Homem tem vindo a interferir com este processo, produzindo fungicidas que visam reduzir as perdas
causadas pelas infeções fúngicas. Porém, tem-se verificado que alguns fungos podem desenvolver
resistência ao fungicida.
A figura 4 demonstra a resistência do fungo Rhynchosporium secalis ao fungicida triadimenol e a figura 5
representa o ciclo de vida deste fungo.

Figura 4 – Sensibilidade de populações do


fungo Rhynchosporium secalis ao fungicida
triadimenol. O estudo foi efetuado no Reino
Unido, de 1975 a 1995.

Figura 5 – Ciclo de vida do fungo


Rhynchosporium secalis, evidenciando as
interações com as plantas, nomeadamente a
cevada. Não se conhece uma fase sexual do
ciclo de vida deste fungo.

Na resposta a cada um dos itens de 1. a 6., selecione a única opção que permite obter uma afirmação
correta.

1. As pressões seletivas causadas pelos fungos tendem a…


(A) … provocar mutações nas plantas, conferindo-lhe maior resistência.
(B) … aumentar a variabilidade genética das plantas.
(C) … selecionar as plantas naturalmente resistentes aos fungos.
(D) … diminuir o potencial de evolução das plantas.
2. De acordo com os dados da figura 4, é possível verificar que a concentração mínima de triadimenol
necessária para inibir o crescimento do fungo Rhynchosporium secalis…
(A) … aumentou durante o estudo, de 1975 até 1995.
(B) … diminuiu durante o estudo, de 1975 até 1995.
(C) … manteve-se durante o estudo, de 1975 até 1995.
(D) … é superior à concentração máxima, em que todos os fungos são exterminados.

3. Relativamente aos ciclos de vida representados na figura 5, podemos afirmar que…


(A) … a cevada e o fungo são duas espécies que só se reproduzem sexuadamente.
(B) ... os esporos, formados por meiose, infetam as sementes de cevada.
(C) … o micélio do fungo desenvolve-se por mitoses sucessivas, infetando novos tecidos da
planta a partir de fragmentos de micélio.
(D) … os fungos apenas atingem a raiz das plantas de cevada.

4. As plantas são classificadas num reino distinto dos fungos, pois…


(A) … são multicelulares.
(B) … apresentam uma parede celular composta por quitina.
(C) … são autotróficas.
(D) … apresentam uma reduzida diferenciação celular.

5. Na designação científica Rhynchosporium secalis, o termo…


(A) … Rhynchosporium corresponde ao género e secalis à espécie.
(B) … Rhynchosporium secalis corresponde à espécie.
(C) … Rhynchosporium corresponde à espécie e secalis ao género.
(D) … Rhynchosporium corresponde à ordem e secalis ao restritivo específico.

6. As afirmações seguintes dizem respeito à evolução das espécies. Selecione a alternativa que as avalia
corretamente.
1. Segundo o Darwinismo, o aparecimento de uma estirpe de fungos muito patogénica origina a
seleção natural das plantas naturalmente mais aptas.
2. Para Lamarck, as mutações são um agente de evolução, sendo transmitidas à descendência.
3. Para Lamarck e Darwin o meio ambiente é um fator basilar na evolução das espécies.

(A) 1 é verdadeira; 2 e 3 são falsas


(B) 2 é falsa; 1 e 3 são verdadeiras
(C) 3 é verdadeira; 1 e 2 são falsas
(D) 1 é falsa; 2 e 3 são verdadeiras

7. Ordene as letras de A a E de modo a reconstituir uma possível sequência cronológica dos


acontecimentos relacionados com a síntese das proteínas de defesa dos fungos quando expostos ao
triadimenol.
A. Migração do mRNA para o citoplasma
B. Ligação da RNA polimerase a um promotor do gene e início da transcrição
C. Adição do aminoácido transportado pelo tRNA à cadeia peptídica em formação
D. Excisão dos intrões e união dos exões
E. Ligação do anticodão ao codão respetivo do tRNA

8. No rótulo de um frasco contendo uma solução comercial do fungicida triadimenol é possível ler:
“Alguns fungos individuais podem apresentar resistência ao produto, em resultado da variação
genética natural. Estes indivíduos podem dominar a população de fungos se o fungicida for usado
repetidamente.”
Explique, numa perspetiva neodarwinista, a relação entre a diversidade genética de uma população
de fungos com o aumento da sua capacidade de se adaptar ao ambiente em que se adiciona
triadimenol.
Grupo IV
Evolução de alguns mamíferos aquáticos

A figura 6 ilustra uma possível relação filogenética entre diferentes vertebrados: um tubarão, um
ictiossauro (réptil extinto) e um golfinho.

Figura 6

Na resposta a cada um dos itens de 1. a 7., selecione a única opção que permite obter uma afirmação
correta.

1. Relativamente aos dados da figura 6, é possível afirmar que…


(A) … o ictiossauro pode ser considerado um fóssil de transição entre Peixes e Mamíferos.
(B) … de acordo com Cuvier, a extinção do ictiossauro pode ser explicada pela incapacidade de
adaptação da espécie, perante uma mudança do ambiente.
(C) … as barbatanas peitorais do tubarão e os membros anteriores do ictiossauro desempenham
idêntica função, sendo consideradas estruturas análogas.
(D) … a evolução de vários grupos de Vertebrados a partir de uma espécie ancestral é um
exemplo de evolução convergente.

2. De acordo com a classificação dos organismos de Whittaker modificada, o reino Animalia distingue-
-se dos restantes reinos por…
(A) … todos os indivíduos que o integram serem eucariontes multicelulares.
(B) … poder englobar organismos que obtêm alimento por ingestão.
(C) … todos os organismos desempenharem o papel de macroconsumidores nos ecossistemas.
(D) … todos os indivíduos apresentarem tecidos muito especializados.
3. Os estudos científicos permitiram reunir um elevado conjunto de provas a favor da ocorrência da
evolução. Constitui um argumento a favor do evolucionismo a…
(A) … lei da herança dos carateres adquiridos.
(B) … semelhança anatómica entre estruturas de seres de espécies diferentes.
(C) … existência de plantas e animais aquáticos e terrestres.
(D) … exploração de ambientes semelhantes por grupos taxonómicos distintos.

4. A circulação nos mamíferos é dupla e…


(A) … completa, permitindo uma menor eficiência na oxigenação dos tecidos.
(B) … completa, permitindo uma maior eficiência na oxigenação dos tecidos.
(C) … incompleta, permitindo uma maior eficiência na oxigenação dos tecidos.
(D) … incompleta, permitindo uma menor eficiência na oxigenação dos tecidos.

5. Com base nos dados da figura 6, é expectável considerar que o sistema de trocas gasosas evoluiu, do
organismo mais primitivo, de uma hematose…
(A) … branquial sem oxigenação do sangue para um hematose pulmonar nos golfinhos.
(B) … pulmonar para uma hematose traqueal típica dos répteis.
(C) … branquial para um hematose pulmonar nos golfinhos.
(D) … cutânea para uma hematose traqueal típica dos répteis.

6. Na maioria dos Répteis e dos Mamíferos…


(A) … a hematose traqueal contribui para uma eficiente oxigenação das células.
(B) … o revestimento do corpo contribui para a manutenção da temperatura corporal constante.
(C) … o predomínio de ácido úrico como produto de excreção azotado permite a economia de
água.
(D) … a fecundação interna permite a reprodução em ambiente terrestre.

7. No processo de excreção dos tubarões…


(A) … a urina formada é muito concentrada em sais.
(B) … ocorre libertação de amónia e ácido úrico.
(C) … ocorre excreção de elevadas quantidades de água, formando uma urina diluída.
(D) … não ocorre reabsorção de água.

8. O estudo comparativo de embriões de diferentes organismos levou diversos cientistas apoiantes do


evolucionismo a defenderem as seguintes hipóteses:
• Karl Von Baer: “Os embriões passam por fases em que se assemelham a embriões de animais
considerados degraus inferiores da Scala Naturae.”
• Thomas Huxley: “Todo o animal, no decurso do seu desenvolvimento, trepa a sua árvore
filogenética.”
Explique em que medida as duas explicações são muito diferentes, referindo a explicação
cientificamente aceite na atualidade.
Teste 5
11.º Ano de Escolaridade
Grupo I
Vulcanismo dos Açores

O estudo da composição dos materiais expelidos pelo vulcão das Sete Cidades, na ilha de S. Miguel
(Açores), permitiu compreender melhor os processos magmáticos que ocorrem neste vulcão.
Uma equipa de investigadores, liderada por Christoph Beier, analisou amostras de materiais expelidos nos
últimos 210 000 anos, tendo concluído que a composição e a textura dos materiais vulcânicos têm sofrido
variações significativas ao longo do tempo. Os seus dados também indicam a existência de dois
reservatórios de magma na crusta oceânica.
A maioria do material vulcânico recolhido na Caldeira das Sete Cidades correspondia a traquitos. Estas
rochas têm uma textura afanítica a porfírica, possuindo um teor de sílica entre 60 a 65%. Os traquitos são
ricos em feldspatos potássicos, contendo plagióclases, quartzo, biotite e olivinas como minerais acessórios.
Entre os 210 000 e os 36 000 anos atrás, a acumulação de traquitos permitiu formar o cone vulcânico, e
entre 36 000 e 16 000 anos atrás, ocorreram diversas erupções que emitiram essencialmente piroclastos
que formaram o rebordo da caldeira.
As emissões de lava com composição traquítica ocorreram dentro da caldeira. Nos cones secundários nos
flancos dos vulcões foram emitidos materiais vulcânicos de composição basáltica. Este magma de
composição basáltica deve ter ascendido rapidamente na crusta.
Os complexos dados geoquímicos analisados por Christoph Beier permitiram concluir que os magmas
evoluíram essencialmente a partir da cristalização fracionada, complementada por fusão parcial dos
materiais e mistura de magma de origem mantélica, num ambiente tectónico complexo nos dois
reservatórios profundos. Os dados indicam que o manto deve ser a fonte dos magmas, porém estes
magmas possuem uma composição diferente do vulcão mais próximo, o Água de Pau, que se encontra
a 20 km para este. Contudo, é admitida a hipótese que ao nível do manto superior haja a possibilidade de
mistura de magmas entre as câmaras associadas ao sistema das Sete Cidades e da Água de Pau.

Figura 1 – Representação esquemática da estrutura do vulcão das Sete Cidades, compreendendo dois
reservatórios magmáticos em profundidade.
Adaptado de Beier et al. (2006). Magma Evolution of the Sete Cidades Volcano, São Miguel, Azores. J.
Petrology, 47 (7): 1375-1411.
Na resposta a cada um dos itens de 1. a 5., selecione a única opção que permite obter uma afirmação
correta.

1. O magma que se encontra no Vulcão das Setes Cidades corresponde a uma substância fundida com
gases dissolvidos e cristais em suspensão, resultante da…
(A) … fusão das rochas do manto e do núcleo.
(B) … solidificação das rochas do manto e do núcleo.
(C) … fusão das rochas da crusta ou do manto.
(D) … solidificação das rochas da crusta ou do manto.

2. A crusta na região dos Açores distingue-se da crusta em Portugal continental por…


(A) …apresentar uma maior espessura.
(B) …ter uma idade superior.
(C) …ser predominantemente formada por riólitos.
(D) …apresentar uma constituição menos rica em sílica.

3. As lavas traquíticas expelidas nos vulcões representados na figura 1 devem ser originárias da
diferenciação de magmas ___ , possuindo um teor de SiO2 ___ aos basaltos.
(A) ultrabásicos a básicos (...) superior
(B) ultrabásicos a básicos (…) inferior
(C) ácidos (...) superior
(D) ácidos (…) inferior

4. As olivinas que estão presentes em alguns traquitos como minerais acessórios formaram-se nas fases
___ de cristalização magmática, pertencendo à série ___ de Bowen.
(A) iniciais (…) descontínua
(B) iniciais (…) contínua
(C) finais (…) descontínua
(D) finais (…) contínua

5. Os minerais de feldspato potássico observados nos materiais expelidos pelo vulcão das Sete Cidades
podem ser identificados com base…
(A) … na sua elevada densidade, em resultado de serem ricos em elementos metálicos.
(B) … na cor da sua risca, que corresponde à cor do mineral quando reduzido a pó numa placa de
cerâmica.
(C) … no magnetismo, pois o potássio presente na sua estrutura cristalina faz com que o feldspato
potássico seja atraído por um íman.
(D) … na reação ao ácido clorídrico, que se traduz por uma efervescência.

6. Classifique como verdadeira (V) ou falsa (F) cada uma das seguintes afirmações relativas às
consequências do vulcanismo açoriano, tendo em conta os dados fornecidos.
A. As erupções no vulcão das Sete Cidades são compostas essencialmente por emissões de materiais
piroclásticos, sendo classificadas como efusivas.
B. A textura porfírica indica que ocorreu uma fase com arrefecimento lento, que permitiu formar os
cristais de grandes dimensões, e uma fase rápida de arrefecimento, que originou a matriz
formada por cristais não observáveis à vista desarmada.
C. Na câmara magmática mais profunda o arrefecimento do magma é mais rápido do que na
câmara magmática mais próxima da superfície.
D. Os traquitos devem possuir uma cor mais clara que os basaltos.
E. O equivalente plutónico do traquito deve possuir cristais com menores dimensões.
F. Nos processos de diferenciação magmática, o magma torna-se mais rico em elementos voláteis e
menos rico em ferro, magnésio e cálcio.
G. Na cristalização fracionada, os primeiros cristais que se formam num magma em arrefecimento
podem ser separados da fração líquida pela migração desta fração devido a movimentos
tectónicos.
H. A mistura de magmas que terá ocorrido na câmara magmática do vulcão das Sete Cidades deve
ter aumentado o caráter básico do magma, aumentando a sua viscosidade.
7. No dia 22 de Outubro de 1522 ocorreu, em Vila Franca do Campo (S. Miguel, Açores), um movimento
em massa que provocou a morte a mais de 5000 pessoas, sendo o mais devastador da história
portuguesa. Este movimento em massa ocorreu após um sismo e caracterizou-se pelo transporte de
solo e depósitos piroclásticos. O movimento foi iniciado em vertentes com 20º de inclinação e
finalizado numa área de acumulação com 5º de pendor. A velocidade de deslocação variou entre
1 e 3 m/s, tendo soterrado Vila Franca do Campo, a antiga capital da ilha.

Na resposta a cada um dos itens de 7.1. a 7.2., selecione a única opção que permite obter uma
afirmação correta.

7.1. Os fatores envolvidos no movimento em massa de Vila Franca foram…


(A) … a elevada consolidação dos materiais movimentados.
(B) … o elevado pendor das vertentes na origem do movimento em massa, em que o atrito dos
materiais acumulados é superior à gravidade.
(C) … o elevado pendor das vertentes na origem do movimento em massa, em que a gravidade
supera o atrito dos materiais depositados.
(D) … a elevada ocupação antrópica das vertentes com maior declive.

7.2. As rochas de composição basáltica são muito suscetíveis à meteorização pois…


(A) … os minerais ferromagnesianos são mais estáveis que os restantes minerais das rochas
basálticas.
(B) … as rochas encontram-se expostas a condições ambientais mais adversas que outras rochas
magmáticas de composição distinta.
(C) … possuem minerais mais estáveis a condições de temperatura , humidade e pressão
superficiais.
(D) … os minerais formados a elevadas temperaturas sofrem modificações químicas e mecânicas
de forma mais intensa.

7.3. Explique em que medida os estudos sobre a ocupação antrópica e os problemas de ordenamento
são essenciais na prevenção e minimização dos impactes associados à ocupação de zonas de risco
geológico, em especial nos Açores.

Grupo II
Geologia do vale do Tejo

A compressão tectónica que ocorreu no Cenozoico originou a formação de cadeias montanhosas.


Destacam-se os Pirenéus, que se formaram em resultado do choque da microplaca ibérica com a placa
euroasiática. Simultaneamente, iniciou-se a formação de diversas bacias sedimentares, destacando-se em
Portugal a do Tejo e a do Sado.
As bacias do Tejo e do Sado correspondem a riftes embrionários, cuja abertura se iniciou no início do
Cenozoico. A sedimentação nas bacias do Tejo e Sado foi essencialmente detrítica continental, mas em
algumas regiões é possível detetar sedimentos de origem marinha.
Na bacia do Tejo os sedimentos podem atingir 1400 metros de espessura, com deposição próxima da
horizontal. Num dos bordos da bacia do Tejo os sedimentos depositaram-se sobre as rochas graníticas e
metamórficas, no outro bordo os sedimentos depositaram-se por cima das rochas sedimentares
mesozoicas.
Figura 2 – Corte da bacia do Tejo evidenciando as principais formações geológicas.

Na resposta a cada um dos itens de 1. a 5., selecione a única opção que permite obter uma afirmação
correta.

1. A dobra que foi cortada pelo rio Tejo pode ser classificada como ___ ,e possui uma direção___.
(A) sinclinal (…) NE-SW
(B) sinclinal (…) NW-SE
(C) anticlinal (…) NE-SW
(D) anticlinal (…) NW-SE

2. A deteção de sedimentos de origem marinha em séries estratigráficas constituídas essencialmente por


depósitos continentais depositados pelo rio Tejo, indica a ocorrência de uma ___ marinha causada
pela ___ do nível da água do mar.
(A) transgressão (…) subida
(B) regressão (…) subida
(C) transgressão (…) descida
(D) regressão (…) subida

3. Nas bacias de sedimentação, como a do Tejo e do Sado, com o aumento da profundidade pode ocorrer
diagénese, que se caracteriza por…
(A) … recristalização de minerais estáveis em novos minerais instáveis.
(B) … aumento do teor de água nos poros dos sedimentos.
(C) … dissolução dos minerais mais insolúveis.
(D) … formação de novos minerais ou adição de minerais já existentes.
4. A estrutura profunda da bacia do Tejo é pouco conhecida, pois existem poucos dados ___ obtidos por
sondagens profundas e é necessário usar métodos ___, tais como a análise de dados sismológicos,
para caracterizar as rochas em profundidade.
(A) diretos (…) indiretos
(B) diretos (…) indiretos
(C) indiretos (…) diretos
(D) indiretos (…) diretos

5. Ao contrário das rochas detríticas, os calcários…


(A) … são classificados em função da sua granulometria.
(B) … podem formar-se por precipitação química ou ter origem biológica.
(C) … podem ter origem em qualquer tipo de rocha preexistente.
(D) … formam-se em bacias de sedimentação.

6. Classifique como verdadeira (V) ou falsa (F) cada uma das seguintes afirmações relativas aos dados
apresentados.
A. Como os estratos se depositaram por cima das intrusões magmáticas, estas possuem uma idade
inferior aos estratos.
B. Os estratos na bacia do Tejo encontram-se sempre na posição horizontal, sendo o mais recente o
que está na base da sequência.
C. As rochas detríticas da bacia do Tejo são mais recentes do que os fragmentos de rocha que as
compõem.
D. A xistosidade é a principal característica textural dos gnaisses presentes na região.
E. A falha identificada com a letra A instalou-se depois dos estratos anteriores ao Plistocénico-
Pleistocénico.
F. Os granitos que se encontram na bacia do Tejo podem ter sido formados por processos de
diferenciação magmática, em que o magma inicial podia ter um maior teor de minerais
ferromagnesianos.
G. A falha A pode ser classificada como normal, e deve ter-se instalado num regime de forças
distensivo.
H. A dobra que se encontra no extremo SW do corte da figura 2 é mais antiga que a falha A.

7. Faça corresponder a cada uma das características das rochas, expressas na coluna A, uma rocha da
coluna B. Utilize cada letra e cada número apenas uma vez.

Coluna A Coluna B

A. Rocha sedimentar não consolidada, com elevada 1. Calcário biogénico


permeabilidade e porosidade. 2. Basalto
B. Rocha sedimentar detrítica, plástica e impermeável quando 3. Areia
saturada em água. 4. Mármore
C. Rocha que evidencia a segregação dos minerais em bandas 5. Granito
originando uma foliação. 6. Gabro
D. Rocha magmática extrusiva, agranular e melanocrata. 7. Argila
E. Rocha com origem quimiobiogénica, com restos de seres 8. Gnaisse
vivos na sua constituição.

8. Explique de que modo a instalação de um corpo magmático pode provocar o metamorfismo das rochas
encaixantes, em resultado das modificações nos principais fatores de metamorfismo.
Grupo III
Inibidores mitocondriais

O 2,4-dinitrofenol (DNP`) é um composto orgânico que afeta a atividade das mitocôndrias. Quanto maior
a sua concentração, maiores os seus efeitos tóxicos, pois o DNP` dissipa o gradiente de protões H+,
permitindo o seu transporte através da membrana mitocondrial. Este processo origina a produção de calor.
Todavia, o DNP` não afeta o transporte de eletrões na cadeia transportadora de eletrões.
Uma investigadora pretendia estudar a respiração celular em células de inseto, usando DNP`. Para tal,
usou uma cultura de células musculares de Teleogryllus oceanicus, um grilo que pertence à ordem
Orthoptera, família Gryllidae. Após os ovos eclodirem na primavera, os grilos comem plantas, sementes e
por vezes pequenos insetos, crescendo rapidamente.
Os resultados obtidos pela investigadora encontram-se na tabela I. As medições de temperatura em cada
uma das experiências foram realizadas nos mesmos intervalos de tempo. Parte dos resultados da situação
B, em que foi adicionado o dobro da quantidade de DNP´, foram propositadamente omitidos.

Tabela I – Resultados experimentais obtidos.

Temperatura (°C)
Observações realizadas
nos mesmos intervalos Experiência controlo Situação A Situação B
de tempo (minutos)
(sem DNP`) (com DNP`) (com DNP`)

1 (início) 28 28 28

2 27 28 29

3 28 29 31

4 29 31 …

5 28 36 …

6 28 23 …

7 27 21 …

Na resposta a cada um dos itens de 1. a 7., selecione a única opção que permite obter uma afirmação
correta.

1. Relativamente à experiência, é possível afirmar que…


(A) … a variável dependente é a quantidade de energia absorvida pelas células musculares de
Teleogryllus oceanicus.
(B) … existe um controlo no qual a cultura de células musculares de Teleogryllus oceanicus não
produz calor.
(C) … a variável experimental (independente) é a presença ou ausência de DNP` no meio de cultura.
(D) … esta foi realizada no ambiente natural, sem controlo de variáveis.

2. Com base nos dados experimentais, verifica-se que o DNP`…


(A) … impede a fosforilação oxidativa, originando um rápido consumo de energia, sem a produção de
ATP e com a dissipação do gradiente de protões, conduzindo a um aumento da temperatura.
(B) … estimula a fosforilação oxidativa, originando um rápido consumo de energia, com a produção
de ATP e com a dissipação do gradiente de protões, provocando um aumento da temperatura.
(C) … impede a fosforilação oxidativa, reduzindo o consumo de energia e diminuindo a dissipação do
gradiente de protões, o que conduz à diminuição da temperatura.
(D) … estimula a fosforilação oxidativa, aumentando o consumo de energia e diminuindo a dissipação
do gradiente de protões, provocando a diminuição da temperatura.
3. Na situação B foi adicionado o dobro de DNP` à cultura celular, sendo expectável que…
(A) … na sexta medição a temperatura seja superior na situação B.
(B) … a dissipação do gradiente de protões tenha atingido o pico na quarta medição.
(C) ... os valores sejam semelhantes aos da situação A a partir da terceira medição.
(D) … as temperaturas sejam sempre mais baixas que na situação A.

4. A investigação com o DNP` e as células de inseto possui interesse comercial e pode ser patrocinada
por uma empresa na área da agricultura, pois aquele composto possui potencial para ser usado como
inseticida uma vez que…
(A) … inibe a produção de ATP nos insetos, cujo transporte de O2 para as células é garantido pelo
sangue.
(B) … inibe a produção de ATP nos insetos, cuja difusão de gases ocorre por hematose cutânea.
(C) … provoca a morte dos insetos, cuja difusão de gases para o sangue ocorre através de um sistema
de traqueias.
(D) … é capaz de eliminar insetos, cujo transporte de O2 às células está associado a um sistema
circulatório duplo e completo.

5. Segundo o modelo endossimbiótico, os cloroplastos e as mitocôndrias podem ter evoluído a partir de


ancestrais ___ e procariontes ___, respetivamente.
(A) eucariontes heterotróficos (…) fotossintéticos
(B) eucariontes fotossintéticos (…) heterotróficos
(C) procariontes heterotróficos (…) fotossintéticos
(D) procariontes fotossintéticos (…) heterotróficos

6. A cultura de células obtidas a partir de um inseto mantém-se em constante divisão ___, mantendo o
património genético das células iniciais, mas podem ocorrer mutações na fase ___ do ciclo celular que
originam células com informação genética distinta.
(A) mitótica (…) G1
(B) meiótica (…) S
(C) mitótica (…) S
(D) meiótica (…) G1

7. Para além da espécie Teleogryllus oceanicus usada na experiência, os grilos também podem pertencer
às espécies Gryllus assimilis ou Gryllus rubens. Segundo estes dados, é possível afirmar que…
(A) … estas espécies pertencem a diferentes ordens e famílias.
(B) … a espécie usada na experiência pertence ao mesmo género das duas outras espécies.
(C) … a Teleogryllus oceanicus deverá possuir maiores diferenças genéticas com as espécies Gryllus
assimilis ou Gryllus rubens, do que estas entre si.
(D) … a diversidade genética diminui do género Gryllus para a ordem Orthoptera.

8. Mencione o processo metabólico que permite às plantas produzir ATP mesmo na presença de DNP´.

9. Relacione, com base nos dados, a redução da temperatura que se verifica a partir da quinta medição na
situação A com os processos que ocorrem ao nível do metabolismo mitocondrial.
Grupo IV
Evolução

Foi feita a comparação das sequências de aminoácidos da α-globina, um dos péptidos que compõe a
hemoglobina, entre o Homem e diferentes organismos, que se encontram representados na tabela II.
Tabela II

Organismo Tubarão Canguru Carpa Vaca Cobra

Diferenças na sequência de
79 27 68 17 62
aminoácidos relativamente ao Homem

A partir da análise anterior, foi estabelecida uma relação evolucionária entre os vertebrados abrangidos no
estudo e elaborada a árvore filogenética da figura 3.

Figura 3

Uma parte da molécula analisada possui a seguinte sequência de aminoácidos:


Ala-Cis-Lis-Ile-Asn
Os codões que codificam os aminoácidos anteriores são:
Ala GCA GCC GCG GCU
Cys UGC UGU
Lis AAA AAG
Ile AUU AUC AUA
Asn AAC AAU

Na resposta a cada um dos itens de 1. a 5., selecione a única opção que permite obter uma afirmação
correta.

1. Com base na informação fornecida, a distribuição correta dos organismos na árvore filogenética será…
(A) … V – vaca; W – canguru; X – cobra; Y – carpa; Z – tubarão.
(B) … V – tubarão; W – carpa; X – cobra; Y – canguru; Z – vaca.
(C) … V – tubarão; W – carpa; X – canguru; Y – cobra; Z – vaca.
(D) … V – canguru; W – vaca; X – cobra; Y – tubarão; Z – carpa.

2. A sequência de DNA que codifica o fragmento Ala-Cys-Lis-Ile-Asn pode ser:


(A) CGTACATTTTATTTG (C) CGTACTTTTTACTTG
(B) CGTTCGTTTTATTTG (D) CGAACATTCTATTTT
3. A estrutura ___ da hemoglobina é formada por quatro péptidos, possuindo esta molécula uma
função___.
(A) terciária (…) de transporte (C) terciária (…) estrutural
(B) quaternária (…) estrutural (D) quaternária (…) de transporte

4. Relativamente aos organismos estudados podemos afirmar que…


(A) … todos apresentam digestão intracorporal e extracelular e um sistema circulatório duplo e
completo.
(B) … todos apresentam digestão intracorporal e extracelular, mas apenas o canguru, a vaca e o
homem apresentam circulação dupla e completa.
(C) … a cobra apresenta digestão intracelular e circulação dupla e completa.
(D) … a digestão da carpa é intracelular e a circulação é simples.

5. Os répteis são animais ___ pois a sua temperatura corporal ___.


(A) exotérmicos (…) é constante.
(B) endotérmicos (…) depende da temperatura ambiente.
(C) exotérmicos (…) depende da temperatura ambiente.
(D) endotérmicos (…) é constante.

6. Foram feitas as seguintes observações em relação à evolução biológica:

I. O tubarão teria evoluído de ancestrais sem barbatanas dorsais, as quais se desenvolveram


gradativamente pelo esforço do animal para alcançar as presas que se movimentavam melhor na água.
II. Os ancestrais do tubarão apresentavam barbatanas dorsais de tamanho variável; após várias gerações,
o grupo evidenciou aumento no número de indivíduos com barbatanas dorsais mais aerodinâmicas
devido à seleção natural.
III. As cobras que se encontram melhor adaptadas às condições ambientais deixam um maior número de
descendentes em relação às cobras que não se conseguem adaptar ao ambiente em mudança.
IV. As características das carpas que se desenvolvem pelo uso são transmitidas de geração em geração.

Selecione a única opção que permite obter uma afirmação correta.

As afirmações…
(A) … I e II estão de acordo com Lamarck e III e IV com Darwin.
(B) … I e IV estão de acordo com Lamarck e II e III com Darwin.
(C) … I e II estão de acordo com Lamarck e III e IV com Darwin.
(D) … I, II, III e IV estão de acordo com Darwin.

7. Ordene as letras de A a E de modo a reconstituir uma possível sequência cronológica dos


acontecimentos reativos à síntese da α-globina.
A. A molécula de pré-mRNA sofre processamento, ocorrendo excisão dos intrões.
B. Estabelecimento de ligações peptídicas entre os aminoácidos que formam a α-globina.
C. O mRNA migra do núcleo para o citoplasma.
D. A RNA polimerase desenrola a dupla hélice de DNA, ocorrendo a transcrição da cadeia molde do
gene que codifica a α-globina na direção 3´para 5´.
E. O tRNA transporta o aminoácido específico até ao ribossoma, onde ocorre a ligação entre o codão
e anticodão complementar.

8. A cobra piton apresenta na parte posterior do seu esqueleto dois pequenos ossos não funcionais
(pélvis e o fémur) que estão associados à locomoção noutros grupos de animais.
Explique em que medida este facto apoia a hipótese evolucionista relativamente às cobras.
Teste 6
11.º Ano de Escolaridade
Grupo I
Geologia das Portas de Ródão

As Portas de Ródão constituem um geomonumento de grande beleza, que resulta da interação do rio Tejo
com as rochas que atravessa nesta região. Caracteriza-se por um relevo estreito e alongado (mais de 50 km
de comprimento), que se destaca na paisagem, em especial a crista quartzítica.
Algumas das principais formações rochosas que existem nesta região caracterizam-se, de forma
simplificada por:
• Grupo das Beiras – é a unidade litostratigráfica mais antiga da região (pré-Câmbrico e
Câmbrico inferior). É formada predominantemente por filitos e metagrauvaques. Estes são os
equivalentes dos grauvaques (rochas clásticas, formadas por fragmentos de outras rochas), mas
que sofreram diagénese no limite do metamorfismo.
• Formação do Quartzito Armoricano – possui cerca de 80 metros de espessura e no topo
pode conter marcas de bioturbação, nomeadamente icnofósseis de Skolithos (pequenos cilindros
verticais) e Cruziana (rastos deixados pela deslocação de trilobites no fundo marinho);
• Ordovícico–Silúrico indiferenciado – inclui rochas variadas muito deformadas, onde se
incluem pelitos escuros e que constitui a Formação do Brejo Fundeiro. Os pelitos são rochas
sedimentares detríticas formadas por argilas e siltes, com origem na litificação de lamas. O
ambiente de deposição correspondia a uma plataforma marinha pouco profunda.

Figura 1 – Enquadramento geológico e corte na região de Vila Velha de Rodão (Fm – formação).

Adaptado de: Metodiev, D., et al. (2009) – Sinclinal de Vila Velha de Ródão (Zona Centro-Ibérica,
Portugal): litostratigrafia, estrutura e modelo de evolução da tectónica Varisca. Comun. Geol., 96, pp. 5-17.
As forças tectónicas deformaram as rochas anteriores durante a orogenia Varisca (Hercínica), originando
uma série de dobramentos em resultado do fecho de um oceano primitivo e a formação do supercontinente
Pangeia.

Na resposta a cada um dos itens de 1. a 6., selecione a única opção que permite obter uma afirmação
correta.

1. Com base na carta geológica, a dobra de Vila Velha de Rodão pode ser classificada como ___, pois no
seu centro encontram-se as rochas mais ___ da sequência estratigráfica.
(A) anticlinal (…) recentes
(B) anticlinal (…) antigas
(C) sinclinal (…) recentes
(D) sinclinal (…) antigas

2. A dobra da figura 1 possui uma direção ___, resultante de forças de ___ com direção NE-SW.
(A) NW-SE (…) distensão
(B) NW-SE (…) compressão
(C) NE-SW (…) distensão
(D) NE-SW (…) compressão

3. Os icnofósseis e os estratos quartzíticos formaram-se em resultado de uma transgressão marinha,


num ambiente…
(A) … lacustre.
(B) … aluvial-lagunar.
(C) … desértico.
(D) … de plataforma litoral.

4. O contacto entre as rochas do Grupo das Beiras e a Formação do Quartzito Armoricano a NE revela
uma discordância angular, resultante…
(A) … da interseção de um filão quartzítico.
(B) … da ação de seres vivos como, por exemplo, as trilobites.
(C) … das modificações das condições de sedimentação e um evento erosivo.
(D) … de um cavalgamento.

5. A formação da dobra decorreu num ambiente ___, em que as rochas estavam sujeitas a condições de
pressão e temperatura ___ às do momento em que o cavalgamento representado no corte geológico
se instalou.
(A) dúctil (…) superiores
(B) dúctil (…) inferiores
(C) frágil (…) inferiores
(D) frágil (…) superiores

6. Algumas formações rochosas detetadas na dobra de Vila Velha do Ródão foram correlacionadas com
a sucessão estratigráfica da sinforma Amêndoa-Carvoeiro, que já tinha sido caracterizada noutro
estudo científico.
Nestes estudos é possível estabelecer uma correlação estratigráfica, com base numa datação…
(A) … relativa, baseada no decaimento radioativo dos minerais e no conteúdo fossilífero.
(B) … absoluta, baseada na litologia e no conteúdo fossilífero.
(C) … absoluta, baseada apenas no conteúdo fossilífero.
(D) … relativa, baseada na litologia e no conteúdo fossilífero.
7. Classifique como verdadeira (V) ou falsa (F) cada uma das seguintes afirmações relativas aos dados.
A. O Grupo das Beiras é constituído essencialmente por rochas magmáticas.
B. A região estudada corresponde atualmente a um limite convergente.
C. Na zona onde o rio Tejo interseta o eixo da dobra, encontram-se rochas do Ordovícico-Silúrico
indiferenciado à superfície.
D. O metamorfismo regional que afetou as rochas de Vila Velha de Ródão ocorreu num limite
convergentes de placas, provocando alterações profundas na textura e mineralogia das rochas.
E. Na região existem evidências de metamorfismo de contacto, em resultado do aumento da pressão
com a profundidade.
F. Nas cristas quartzíticas é possível encontrar quartzitos com textura não foliada.
G. Os depósitos de cobertura quaternários devem ter-se formado em condições de deposição
marinha mais profunda.
H. O cavalgamento de Vinagra-Foz do Cobrão não afeta o uso do Princípio da Sobreposição na
datação relativa das rochas afetadas pelo cavalgamento.

8. As cristas quartzíticas são o relevo que mais se destaca na paisagem de Vila Velha de Ródão.
Relacione este aspeto com as propriedades litológicas dos quartzitos e o seu ambiente de formação.

Grupo II
Contaminação dos aquíferos

Embora a maioria das lixeiras ilegais existentes no território nacional tenham sido fechadas, ainda existem
alguns focos de poluição, aos quais se juntam as escombreiras das explorações mineiras e os aterros
sanitários com problemas ao nível da selagem dos contaminantes.
Os esquemas I e II da figura 2 permitem relacionar, em duas situações distintas, a existência de depósitos
de lixo com as condições hidrogeológicas dos locais onde estão instalados.
Os pontos F1, F2, F3 e F4 são furos de prospeção de água realizados em épocas diferentes (F1 anterior a F2,
e F3 anterior a F4). Sabe-se que só um deles nunca forneceu água.

Figura 2
Na resposta a cada um dos itens de 1. a 6., selecione a única opção que permite obter uma afirmação
correta.

1. A água subterrânea é um recurso ___, cujas reservas potáveis têm vindo a ___.
(A) renovável (…) aumentar
(B) não renovável (…) a diminuir
(C) não renovável (…) aumentar
(D) renovável (…) diminuir

2. Com base nos dados, é provável que o furo…


(A) … F3 nunca tenha fornecido água, pois a camada rochosa é muito porosa.
(B) … F3 nunca tenha fornecido água, pois a água desloca-se a reduzida velocidade.
(C) … F4 nunca tenha fornecido água, pois a água desloca-se a reduzida velocidade.
(D) … F4 nunca tenha fornecido água, pois a camada rochosa é muito porosa.

3. Nas condições atuais, o furo que tem maior probabilidade de fornecer água contaminada pelo depósito
de lixo é o…
(A) … F2, pois está associado a um aquífero cujo teto é poroso e permeável.
(B) … F1, pois está mais próximo da fonte de contaminação.
(C) … F3, pois está associado a uma formação rochosa muito porosa e suscetível à contaminação.
(D) … F4, pois está associado a um aquífero cujo teto facilita a circulação de água.

4. O aquífero I é livre, e o aquífero II pode ser ___, pois este aquífero está limitado por rochas___.
(A) confinado (…) impermeáveis no teto e na base
(B) livre (…) impermeáveis no teto e na base
(C) confinado (…) impermeáveis no teto e permeáveis na base
(D) livre (…) permeáveis no teto e impermeáveis na base

5. A sobre-exploração de águas subterrâneas pode levar…


(A) … à formação de grabens.
(B) … a abatimentos da superfície topográfica.
(C) … a uma maior disponibilidade de água nas nascentes.
(D) … a um aumento de espessura da zona saturada dos aquíferos.

6. Faça corresponder a cada uma das afirmações, de A a E, a respetiva rocha, indicada na chave.

Afirmações:
A. Rocha metamórfica não foliada, formada a partir de rochas sedimentares carbonatadas.
B. Rocha magmática extrusiva leucocrata, constituída essencialmente por quartzo, feldspato
potássico e plagióclase sódica.
C. Rocha sedimentar consolidada formada por fragmentos de rochas preexistentes com dimensões
superiores a 2 mm de diâmetro.
D. Rocha sedimentar formada a partir da precipitação de carbonato de cálcio ou da acumulação
de restos carbonatados de organismos.
E. Rocha sedimentar não consolidada cujas partículas apresentam diâmetros inferiores
a 0,0039 mm.

Chave:
I. Conglomerado
II. Argila
III. Arenito
IV. Calcário
V. Granito
VI. Riólito
VII. Basalto
VIII. Mármore
7. Classifique como verdadeira (V) ou falsa (F) cada uma das seguintes afirmações relativas aos recursos
naturais.
A. Os recursos geológicos são todos os depósitos minerais e rochosos que são economicamente
viáveis para serem explorados.
B. As mudanças ao nível tecnológico podem permitir transformar recursos em reservas.
C. O petróleo é considerado um recurso não renovável porque atualmente não se encontra em
formação.
D. As fontes de energia renovável constituem uma alternativa ao uso de combustíveis fósseis.
E. O decaimento radioativo e a energia acumulada durante a acreção a que a Terra esteve sujeita ao
longo do tempo são fontes de energia geotérmica.
F. Na energia geotérmica de alta entalpia o fluido circulante é aquecido a temperaturas entre
os 50 ºC e os 100 ºC, sendo possível o seu aproveitamento para a produção de energia elétrica
em locais como S. Miguel (Açores).
G. Os minerais são recursos renováveis, dada a dinâmica existente ao nível do ciclo das rochas,
onde há reciclagem e formação contínua de rochas.
H. O petróleo existente ao largo de Portugal constitui atualmente uma reserva.

8. Explique em que medida a compactação dos terrenos que constituem a base dos depósitos de lixo e o
uso de camadas de argilas são medidas de proteção dos aquíferos.

Grupo III
Evolução dos mamíferos de Madagáscar

Madagáscar fazia parte do supercontinente Gondwana, tendo-se separado de África há 165 M.a. e da Índia
há cerca de 88 M.a.
A ilha de Madagáscar possui uma grande variedade de mamíferos, cujas formas são muito distintas dos
mamíferos presentes em África ou noutras ilhas do oceano índico. Os lémures são o grupo de mamíferos
mais associados a Madagáscar, mas muitos outros animais são endémicos desta ilha.
Existem oito espécies de carnívoros em Madagáscar, sendo 7 endémicas desta ilha. Destacam-se o
Cryptoprocta ferox, conhecido por fossa, o Eupleres goudotii e os mangustos com as suas caudas felpudas
e às riscas.
Tradicionalmente, o C. ferox e o E. goudotii eram incluídos na família Viverridae, composta por pequenos
mamíferos, maioritariamente arborícolas, que incluem as ginetas e as civetas. Por sua vez, os mangustos
eram incluídos na família Herpestidae.
Estudos evolutivos baseados na sequenciação do DNA dos carnívoros de Madagáscar, bem como outros
carnívoros de África e da Índia, permitiram obter novos dados sobre a evolução destes organismos
endémicos, que são agora todos incluídos na família Eupleridae, que inclui:

Subfamília Euplerinae Subfamília Galidiinae


 Cryptoprocta ferox  Galidia elegans
 Cryptoprocta spelea (extinto)  Galidictis fasciata
 Eupleres goudotii  Galidictis grandidieri
 Eupleres major  Mungotictis decemlineata
 Fossa fossana  Salanoia concolor
 Salanoia durrelli
Os resultados da investigadora Yoder permitem determinar o grau de parentesco das espécies pertencente
à família Eupleridae, e há quanto tempo se encontram a evoluir separadamente.
A determinação da sequência de DNA de diferentes genes e o uso de relógios moleculares adequados,
permitiram estabelecer a idade de aparecimento dos carnívoros e dos lémures de Madagáscar (tabela I).

Tab. I – Estimativa da idade de aparecimento dos diferentes grupos de organismos com base em diversos
marcadores moleculares.
Genes usados como
Carnívoros de Madagáscar Primatas de Madagáscar
relógios moleculares

Citocromo b 23 M.a. 64 M.a.

IRBP 20 M.a. 62 M.a.

ND2 24 M.a. Não se aplica

Figura 3 – Possível filogenia dos carnívoros de Madagáscar.


Adaptado de: Yoder et al. (2003). Single origin of Malagasy Carnivora from an African ancestor. Nature
421, 734-737.
Na resposta a cada um dos itens de 1. a 7., selecione a única opção que permite obter uma afirmação
correta.

1. O ancestral das oito espécies carnívoras que migrou para Madagáscar encontrou um ambiente com
___ diferentes da região de onde partiu, ocorrendo uma adaptação ___.
(A) pressões seletivas (…) convergente
(B) mutações (…) convergente
(C) mutações (…) radiativa
(D) pressões seletivas (…) radiativa

2. Pelo facto de os Euplerinae possuírem regiões auditivas semelhantes aos Viverridae, foram incluídos
nesta família, em resultado de uma classificação ___, baseada em dados ___.
(A) filética (…) morfológicos e anatómicos
(B) fenética (…) morfológicos e anatómicos
(C) fenética (…) embriológicos e bioquímicos
(D) filética (…) embriológicos e bioquímicos

3. A evolução dos Euplerinae em Madagáscar esteve associada à…


(A) … especiação resultante da acumulação de mutações nos diferentes indivíduos, que terão ocorrido
a uma taxa relativamente constante ao longo do tempo.
(B) … evolução separada de diferentes ancestrais que migraram em momentos distintos de África
para Madagáscar.
(C) … adaptação dos organismos às novas condições ambientais em resultado do uso e desuso de
determinados órgãos.
(D) … ocorrência de catástrofes que aniquilaram as formas de vida existentes em Madagáscar, com o
aparecimento de novas espécies por intervenção divina.

4. A classificação de Yoder foi feita com bases num sistema racional ___ com base em critérios ___.
(A) vertical (…) bioquímicos
(B) vertical (…) morfológicos
(C) horizontal (…) bioquímico
(D) horizontal (…) morfológico

5. Os carnívoros estudados por Yoder possuem um sistema digestivo ___, em que ocorre a digestão
interna, sendo os nutrientes posteriormente transportados por um sistema circulatório ___.
(A) incompleto (…) duplo e completo
(B) completo (…) duplo e completo
(C) completo (…) simples
(D) incompleto (…) simples

6. Os pulmões presentes em alguns animais da figura 3 constituem uma superfície respiratória eficiente
porque…
(A) … se encontram ligados a uma extensa rede de finos capilares.
(B) … possuem um reduzido número de ramificações.
(C) … a circulação do sangue ocorre a elevada velocidade nos capilares pulmonares.
(D) … permitem manter reduzidas pressões de oxigénio nos alvéolos pulmonares, facilitando a sua
difusão para o sangue.

7. De acordo com a classificação modificada de Whittaker, os carnívoros estudados por Yoder devem
ser…
(A) … eucariontes e heterotróficos por absorção.
(B) … eucariontes e microconsumidores.
(C) … procariontes e autotróficos.
(D) … eucariontes e heterotróficos por ingestão.
8. Classifique como verdadeira (V) ou falsa (F) cada uma das seguintes afirmações relativas aos dados
fornecidos.
A. A árvore produzida por Yoder é do tipo filético, pois inclui o fator tempo.
B. Com base nos dados, o ancestral mais próximo dos Eupleridae é o mangusto africano, tendo a
separação dos dois grupos ocorrido há cerca de 18 a 24 M.a.
C. A família Eupleridae inclui atualmente 10 espécies que pertencem a 6 géneros distintos.
D. Os dados obtidos por Yoder e a sua equipa foram inconclusivos.
E. A família Eupleridae resultou de diversas migrações a partir de África, separadas temporalmente.
F. Os carnívoros e os lémures de Madagáscar devem ter resultado de diferentes ancestrais, que
colonizaram a ilha usando o mesmo evento de dispersão (p. ex., uma ponte continental que
permaneceu ativa um curto espaço de tempo).
G. O isolamento a que os organismos de Madagáscar estiveram expostos nos últimos milhões de ano
tornou-os mais resistentes a espécies invasoras introduzidas pelo Homem.
H. De acordo com os dados verifica-se a evolução dos animais de diferentes famílias.

9. Existem poucos vestígios fósseis, na ilha de Madagáscar, não tendo sido encontrados fósseis dos
primeiros carnívoros.
Explique em que medida as conclusões de Yoder devem ser confirmadas no futuro com evidências
fósseis dos primeiros carnívoros que venham a ser encontradas.

Grupo IV
Trocas gasosas nas plantas

As