Você está na página 1de 83

Ferramentas genmicas aplicadas no melhoramento gentico animal: progressos recentes e perspectivas futuras

Workshop Internacional para Seleo Genmica em Bovinos de Corte


Alexandre Rodrigues Caetano, Ph.D.

Embrapa Recursos Genticos e Biotecnologia

Resumo
Melhoramento animal Prospeco de genes de interesse econmico Seleo genmica Sequenciamento de genomas

Perspectivas futuras

Antes da Genomica

1920: 5.300 kg / Lactao 17.4 kg / Dia

O melhoramento animal tradicional teve um impacto significativo sobre as cadeias de produo animal Presente: >16.000 kg / Lactao
>50 kg/ Dia Aumento de ~200%

Melhoramento Animal

~10.000 anos

200 anos

~70 anos

~60 anos

Teste de Prognie
Fentipo medido nas filhas Tempo Necessrio: Nascimento do bezerro Smen = ~1 a 1,5 anos Gestao = 9 meses Primeiro cio da filha = ~1 a 1,5 anos Gestao = 9 meses Primeiro controle leiteiro = 1ms TOTAL = ~5 (8) anos

Melhoramento Animal
Resultados obtidos extremante importantes para a produo animal
Aumento na produtividade/eficincia Melhoria na qualidade dos produtos

Processo no gera informao sobre mecanismos biolgicos envolvidos Maiores dificuldades com caractersticas de difcil mensurao / baixa herdabilidade

Avaliao Gentica

Deciso

Sumrio

Aplicao de Ferramentas Moleculares no Melhoramento

O primeiro captulo.... (1980s - ~2005) :

Mapeamento de QTL e identificao de genes que controlam caractersticas de interesse

Mapeamento de Genes que Controlam Caractersticas Quantitativas


QQ qq
X

P F1
Qq

Qq

F2

5 LOD 4 3 2 1 * * * *

QTL

* * *

Identificao do Gene / Mutao


* * QTL ** * *
5 4 3 2 1

**

Desenvolvimento de mais marcadores

AA

AGATCAGGCATCTAGCTCTCT AGATCAGGCATCTAGCTCTCT AGATCAGGCGTCTAGCTCTCT AGATCAGGCGTCTAGCTCTCT

Sequenciamento de Genes Candidatos

GG

TESTE DIAGNSTICO

Bovinos de Corte GDF8 Calpana Calpastatina Leptina DGAT Etc.

Bovinos Leiteiros BLAD -casena -lactoglobulina DGAT Etc.

Sunos
ESR HAL Rendement Napole (RN) Etc.

Equinos
HYPP Hair color SCID White foal sindrome Etc.

Painis de Marcadores No Mercado


Merial Igenity
Quantos Genes/SNPs? % da a2 explicada? Correlao com o verdadeiro valor gentico do animal?

Pfizer
GeneSTAR GeneSTAR MVPs (Molecular Value Predictions) Quantos Genes/SNPs? % da a2 explicada? Correlao com o verdadeiro valor gentico do animal?

Qual o valor REAL dessas ferramentas para o melhoramento?

Aplicao de Ferramentas Moleculares no Melhoramento


O segundo captulo - a era ps sequenciamento genmico (2008) : Novas tecnologias de genotipagem impactaram significativamente a integrao da genmica com o melhoramento animal!

Genotipagem de SNPs com Chips de DNA

SNP Chips
Eficincia
Dezenas, centenas de milhares de marcadores genotipados em um nico ensaio

Acurcia Abundancia / distribuio de marcadores pelo genoma Custo

Microsatlites vs SNPs
Mapa tpico com microsatlites
1 marcador a cada 20cM = 150 marcadores Custo = ~US$10 x marcador = US$1500 / individuo

Bovine 50K
1 marcador a cada 0,05cM = ~60K marcadores Custo = US$215$180$150$130$75$65 por indivduo (terceirizado)

SNP Chips
Bovinos
Illumina HD, 50K, 3K (6K) Affymetrix 600K

Equinos
Illumina 50K

Sunos
Illumina 60K

Ovinos
Illumina 60k

Impactos das novas ferramentas

Perspectivas para o PRESENTE

Impacto das novas tecnologias


Programas de avaliao e melhoramento animal
Seleo genmica

Identificao de genes que afetam caractersticas de interesse econmico

Seleo Genmica
Caracterstica: Peso aos 2anos
Parmetros Genticos = 450kg Ga = 8 kg 40kg de efeito GA

-20kg

+20kg

40kg de efeito gentico aditivo 400 genes controlam a caracterstica? 60 mil marcadores (1 marcador / 50kbp) Estimativa do efeito de cada marcador/gene na caracterstica com uma populao controlada

Avaliao Gentica
450kg 550kg

-10 0 +50 +30 +20 -50 -30

+5 0 -10

DEP= BV = pop - prog = +18kg

DEP= BV = pop - prog = -17kg

100g

50g

5g 50g

50g

5g

75g
5g

100g

5g

5g

75g

100g

75g 100g

100g 50g

etc . . .

5g

50g

100g

50g

100g

Identificao dos marcadores em regies que afetam a caracterstica Diviso do efeito gentico em cada regio do genoma

AA

ii

Pp Qq

bb

Jj

Cc

KK

Rr

DD

ll

SS

ee

MM NN

TT uu

etc . . .

Ff

Gg

oo

vv

HH

Genotipagem de qualquer indivduo da populao

+100g

-50g

-5g -50g

-50g

+5g

+75g

+100g

+5g

+5g -100g

-5g

+75g

+75g +100g

+100g -50g

etc . . .

-5g

-50g

-100g

-50g

+100g

Estimativa da DEP molecular % da a2 explicada ??, acurcia?

= +10kg

+
Avaliao Gentica

Deciso

Sumrio

Avaliao Genmica

e /ou

+
Avaliao Genmica

Fazendo as Contas
Custo de testar um touro (leite) = US$50K nessrio testar 10 touros para selecionarmos um = US$500K Custo de genotipagem com o 50K chip = US$70 Genotipagem de 10 touros, teste dos 5 superiores = (5 x $50 000) - (10 x $70) =
= Economia = $249 300 +

TEMPO

Acurcia da GEBV? Corr (EBV, GEBV) ?

Progeny Tested Bull


O-Man

Doses de smen ~200,000 unidades/ ano Preo: US$40 / unidade Faturamento > US$5 milhes / ano
40,144 filhas em lactao
9th WCGALP, August 2010 (42)

Van Tassell and Cole

USDA-ARS-AIPL: animais da raa holandesa genotipados


Date 04-10 08-10 12-10 04-11 05-11 06-11 07-11 08-11 09-11 10-11 11-11 12-11 Bulls* 9,770 10,430 11,293 12,152 12,429 15,379 15,386 16,519 16,812 16,832 16,834 17,288 Cows* 7,415 9,372 12,825 11,224 11,834 12,098 12,219 14,380 14,415 14,573 14,716 17,236 Young animals** Bulls Heifers 16,007 8,630 18,652 11,021 21,161 18,336 25,202 36,545 26,139 40,996 27,508 45,632 28,456 50,179 29,090 52,053 30,185 56,559 31,865 61,045 32,975 65,330 33,861 68,051 All animals 41,822 49,475 63,615 85,123 91,398 100,617 106,240 112,042 117,971 124,315 129,855 136,436

*Traditional evaluation **No traditional evaluation


John Cole, 2012
2011

Ganhos em Acurcia1 por Raa


Produo e Mrito Lquido(NM$) de touros jovens
Trait Net merit Milk Fat
Protein Fat % Protein %
1Mdia

HO 23 23 33
22 43 34

JE 9 11 15
4 41 29

BS 3 0 5
1 10 5

de ganho sobre a mdia dos pais ~35%


Paul VanRaden
2009

Gordon Conference on Quantitative Genetics, Feb. 2009 (44)

Acurcias Estimas para Touros Jovens da Raa Holandesa

*Animais sem avaliao tradicional em Abril de 2011


John Cole, 2012
2011

Efeito do tamanho da populao de treinamento

Quanto vale um SNP?


Informao de pedigree: ~7 filhas

Avaliao com painel de SNP: ~34 filhas (produo de protena, h2 = 0,30)

Avaliao com painel de SNP: ~131 filhas (taxa de prenhes, h2 = 0,04)

Van tassel 2011

Impacto das novas tecnologias


Programas de avaliao e melhoramento animal
Seleo genmica

Identificao de genes que afetam caractersticas de interesse econmico

Clonagem Posicional
1988 Fibrose Cstica em humanos (10 anos) 1997 Musculatura dupla (GDF8) em bovinos (2 anos) 2008 - Curly Calf Sindrome (Artrogripose Multiplex) (2 semanas)

Net Merit VanRaden et al. 2009

Resistncia ao carrapato

Cardoso et al. 2012

2011

O que est em andamento na Embrapa?

Rede Genmica Animnal


PC4
Projeto de pesquisa a
Projeto de pesquisa b Projeto de pesquisa z

PC6 PRODUTOS
Acesso a novas plataformas tecnolgicas e metodologias Obteno de resultados e conhecimentos estratgicos para experimentos de alta complexidade j em andamento Estabelecimento de uma rede de competncias para execuo de novos projetos

INPUT
Expertise multidisciplinar para construo e utilizao de ferramentas e metodologias centrais Experimentos de alta complexidade com dados e amostras j coletados Novas tecnologias e metodologias a serem internalizadas e incorporadas a atividades em andamento

Projeto de pesquisa c

Ferramentas de Bioinfmatica e Estatsticas PC2 e 3

Projeto de pesquisa ..

Projeto de pesquisa d Projeto de pesquisa e

Projeto de pesquisa f

PC5

Instituies Participantes
1. Embrapa Gado de Corte 2. Embrapa Gado de Leite 3. Embrapa Pecuria Sudeste 4. Embrapa Pecuria Sul 5. Embrapa Informtica Agropecuria 6. Embrapa Recursos Genticos e Biotecnologia 7. Embrapa Meio-Norte 8. Embrapa Caprinos 9. EmbrapaTabuleiros Costeiros
10. UFV 11.UFJF 12.UFMS 13.UnB 14.UNESP Botucatu 15.UESB Universidade Estadual do Sudoeste da Bahia 16.UNESP Jaboticabal 17.APTA Agncia Paulista de Tecnologia do Agronegcio 18.UFSCAR 19.USP-ESALQ

Participao de 78 pesquisadores

Rede Genmica Animnal

http://www.macroprograma1.cnptia.embrapa.br/GenomicaAnimal

MP2 Seleo Genmica para Resistncia ao Carrapato


Lder: Fernando Cardoso, CPPSUL

Contagem de carrapatos em mais de 4.000 animais (>8000 contagens) DNA coletado e processado Genotipagem de 2000 animais em 2011

Resultados

SNPs effects for tick resistance (GWAS)

MP2 Seleo Genmica em Sunos


Lder: Monica Ledur

MP2 Seleo Genmica em Sunos


Genotipagem de 2500 animais Captao de recursos: CNPq/GENOPROT Dados:
Crescimento Eficincia Alimentar Qualidade de carne e carcaa Reproduo

Desenvolvimento conjunto / Transferncia

MP2 Seleo Genmica em Raas Leiteiras


Lder: Marcos Vincius Silva

Avaliao gentica de raas leiteiras


Holands, Gir, Girolando, Guzerat

Implementao da SG nos programas


Gir Girolando Guzer

Genotipagem de 5,000-10,000 animais

MP2 Seleo Genmica Nelore


Lder: Luiz Otvio Campos da Silva

Implementao da Seleo Genmica no programa de avaliao do Nelore liderado pelo CNPGC

Foco em caracterscas reprodutivas e de qualidade de carne e carcaa Genotipagem de 5 a 10.000 animais

Laboratrio Multiusurio de Bioninformtica

http://www.agropediabrasilis.cnptia.embrapa.br/web/lmb/home

Aplicao de Ferramentas Moleculares no Melhoramento

O terceiro captulo: a utilizao de painis de SNP de baixa densidade para imputao

Illumina chips are [mostly] nested


Bovine HD (700K)

~$200
Missing 5,264 V2 markers

Missing 7,352 SNP50 markers

Bovine SNP50 (50K)

~$70
Missing 76 3K markers

50K is missing 14 3K markers

Bovine LD (3K)

~$20
Van Tassell and Cole

9th WCGALP, August 2010 (68)

Como Funciona a Imputao?


Identificao dos hapltipos existentes na populao utilizando o nmero mximo de marcadores Rastrear os hapltipos identificados utlizando um conjunto mnimo de marcadores
Exemplo: usando 5 SNPs para reastrear 25 SNP
5 SNP: 22121

25 SNP: 2122121112112112111212211

Chip HD chip / Sequencia Touros

Animais Avaliados

90-50k chip / HD chip

Animais sem avaliao e vacas

3-10K chip

6K SNPs

Aplicao de Ferramentas Moleculares no Melhoramento

O quarto captulo: perspectivas futuras

1950: Previso do que seria um PC...

10.000 anos

200 anos

~70 anos

~60 anos

~60 anos

Abril 2003

2009 SEQUENCIAMENTO DE NOVA GERACAO

Perspectivas Futuras
Sequenciamento de genomas
Custo atual: US$5.000 Genoma por US$1.000? $100?

Possibilidade de utilizar as mutaes causativas vs SNPs em L.D.

Re-Sequenciamento de Genomas
2009

2011

2012

e vrios outros a caminho

No Brazil

Genoma Minas: Guzerat e Gir

No Brazil

Brasil, EUA e Itlia: Unesp conclui o genoma do Nelore ABCZ - Laura Pimenta (editado por Melissa Miziara - CIGB)

Agosto 2011

MP2 - Rede de Seqenciamento de Genomas


Desenvolvimento de capacidade para sequenciar, montar e analisar genomas
Genotipagem por sequenciamento Integrao com os programas de avaliao e melhoramento da Embrapa

Genotipagem por Sequenciamento


Vrios mtodos em desenvolvimento Seleo especfica de enzima/tamanho de fragmento Baixo custo e automatizvel Descoberta e genotipagem de SNPs Amostragem de 1-20% do genoma = 10-500K SNPs Cobertura varivel Custo compatvel com painis fixos?
Elshire et al. 2011 Plos

Perspectivas Futuras
Transio de chips genricos para chips customizados
Custo Otimizao para uso em raas especficas Novas tecnologias

Testes de Confirmao de Paternidade com SNPs


Tecnologia padro at o momento: microssatlites ~150 SNPs so suficientes para realizar o teste Minimizar custos para o produtor
Microssatlites + 50K SNPs?

Converso dos Testes de Confirmao de Paternidade

Perspectivas Futuras
A avaliao genmica apenas uma ferramenta!
Encurta intervalo de geraes Aumenta acurcia das estimativas do VG MAS, aumenta tambm potencial de problemas se voc escolher os objetivos incorretos

No fez sentido implementar o processo se o setor no fizer uso correto da ferramenta Integrao dos resultados das avaliaes nos programas de melhoramento (com objetivos bem definidos) Refinamento de modelos de avaliao (BLUP, Mtodos Bayesianos)

Perspectivas Futuras
No Brasil Boas perspectivas de implementao de avaliaes genmicas nos programas de avaliao Necessidade de melhor integrao da ferramenta com os programas de melhoramento
Demanda para ndices econmicos

Melhor alinhamento dos objetivos de seleo com a estrutura da cadeia produtiva


Carne: maciez? Leite: volume total vs slidos?

OBRIGADO !!!

alexandre.caetano@embrapa.br