Escolar Documentos
Profissional Documentos
Cultura Documentos
MANAUS
2015
i
MANAUS
2015
ii
Ficha Catalográfica
in Manaus Amazon.
Ficha Catalográfica elaborada pela Bibliotecária Maria Eliana N Silva,lotada na Escola Superior de
1.VZV 2 Varicela. 3.Genótipo 4. Manaus Título.
Ciências da Saúde - UEA
CDU: 616.9(811.3)(043)
iii
Banca Julgadora:
RajendranathRamasawmy
Membro
AGRADECIMENTOS
Muito obrigada !
vi
RESUMO
ABSTRACT
VZV belongs to the Herpesviridae family, its kind is known as human - 3 (HHV-3) and
causes two distinct diseases known: chicken pox (varicella) and shingles. In most
countries, between 2 and 4% of children are hospitalized for complications of
varicela.O VZV can cause some complications in the central nervous system (CNS),
in AIDS patients there is a total of 71% of cases, and its Most cause encephalitis.
The VZV was initially classified as a neurotropic but ultilizando T cell experiments on
animals show tropism for T cells important for replication and release of virions.
Epidemics are more prevalent in temperate climates, which occurs most often during
the winter and spring. sample isolatedof chickenpox and HZ can be studied in five
different genotypes of VZV specific geographic areas, the regional domain specific
genotypes may have been set by the climate and other factors. The objective of this
project is to conduct study of molecular characterization of the Varicella Zoster virus
detected in clinical samples from patients treated in a tertiary health unit in the
Amazon. Specifics are to identify the current VZV genotype in Manaus, make
comparison study with viral strains from other regions and determine whether there is
a relationship with severe disease according to genotype identify and differentiate the
strains of wild-type and vaccine .Included were 12 samples, Included 12 samples
were identified in the period 2010 to 2014 , at the Fundação de Medicina Tropical Dr.
Heitor Vieira Dourado( FMT - HVD ) for screening DNA samples were amplified using
the ORF8 region and the sequencing was amplified the regions Orf22 38 and 54. All
samples were sequenced and made phylogenetic analysis. Six samples of the wild
strains of VZV have been identified. In the region of ORF54 in one of the samples
was observed changes in position 95241 which does not rule out the possibility of
mutations. Clade 5 and has been suggested for the two samples ORF22 region.
RESUMO LEIGO
O Virus varicela zoster (VZV) pertence a família Herpesviridae, que pode ser de
origem selvgem (vírus VZV) ou vacinal (Oka vacina) humano - 3 (HHV-3) e causa
duas doenças conhecidas como catapora e herpes zoster. Na maioria dos países,
entre 2 e 4% das crianças são hospitalizadas por complicações da varicela. Esse
vírus pode causar algumas complicações no Sistema Nervoso Central (SNC), sendo
as mais comuns a inflamação e a infecção no cérebro. É um virus que apresenta
propensão para infectar células que são importantes para processo de duplicação do
DNA e liberação de outros vírus. Epidemias são mais prevalentes em lugares de
clima temperados. O VZV pode ser estudado em cinco genótipos distintos, conforme
as áreas geográficas específicas, o domínio regional de genótipo, que são os genes
específicos, pode ter sido estabelecido pelo clima e outros fatores. O objetivo dessa
dissertação foi realizar estudo de caracterização molecular do vírus Varicela Zoster
detectado em amostras de vesíscula de pacientes atendidos em uma unidade
terciaria de saúde no Amazonas. Foram incluidas 12 amostras identificadas no
período de 2010 a 2014, na Fundação de Medicina Tropical Dr. Heitor Vieira
Dourado(FMT-HVD); para a triagem foi extraído o DNA e aplicadas técnica
biomoleculares, e para o sequenciamento e feita análise filogenética. Em 6/12 (50%)
das amostras identificou-se as cepas do vírus VZV. Na região da ORF54 em umas
das amostras foi observado mudanças na posição 95241 o que evidencia a
possibilidade de mutações. E duas amostras 5 e 7 da região ORF22 teve um
agrupamento que inclui um ancestral comum classificado nos genótipos do VZV
como clado 5.
LISTA DE FIGURAS
Imagem do gel de agarose dos fragmentos de 447, 350 e 222pb das egiões
Figura 8 ORF22, 38 e 54 respectivamente do VZV................................................................... 34
Imagem do gel de agarose do resultado da purificação com Polietilenoglicol
Figura 9 (PEG).......................................................................................................................... 35
Figura 10 Imagem do gel de agarose do resultado da purificação com KIT.............................. 35
Representação do resultados das sequencias das regiões ORF 22, 38 e 54 alinhadas
Figura 11 com a cepaDumas...................................................................................................... 37
Figura 12 Representação do ORF38 analizadas pela enzima de restrição PstI........................ 38
Representação do ORF54 analizadas pela enzima de restrição BglII. O (Y) significa
Figura 13 a presença de (C) ou (T )............................................................................................. 39
Figura 14 Arvore filogenética do VZV baseada na incluindo as amostras 05 e 07....................... 41
x
˚C Graus Celsius
A Adenina
AIDS Síndrome da Imunodeficiência Adquirida
C Citosina
CEP Comitê de Ética e Pesquisa
CMV Citomegalovírus
DNA Ácido desoxirribonucleico
EBV Epstein-Barr
EUA Única Região Curta
FAPEAM Fundação de Amparo a Pesquisa do Estado do Amazonas
FMT-
HVD Fundação de Medicina Tropical Doutor Heitor Vieira Dourado
G Guanina
HHV Herpes Vírus Humano
HIV Vírus da Imunodeficiência Humana
HSV Herpes Simples Vírus
HZ Herpes Zoster
ICTV International Committee on Taxonomy of Viruses
IRL Repetições Internas Longas
IRS Repetições Internas Curtas
KSHV Herpes Vírus Humano associado ao sarcoma de Kaposi
Nm Nanômetro
Nº Número
ORF Open Reading Frame(Fase de leitura aberta)
PCR Polymerase chain reaction (Reação em cadeia da polimerase)
Pb Base-pair
R Região
RFLP Restriction Fragment Length Polymorphism
SNC Sistema Nervoso Central
SNP Single Nucleotide Polymorphism
T Timina
(T) Triangulação
TRL Terminais Longos
TRS Terminais Curtos
UL Região Longa
VZV Vírus de Varicela Zoster
Α Alfa
Β Beta
Γ Gama
xii
SUMÁRIO
1 INTRODUÇÃO.......................................................................................................... 14
1.1A família Herpesviridae.......................................................................................... 14
1.2 Varicela Zoster..................................................................................................... 15
1.2.1 Estrutura do virion VZV..................................................................................... 16
1.2.1.1 Proteínas do virion........................................................................................... 17
1.2.1.2 Tegumento....................................................................................................... 18
1.2.1.3 Capsídeo.......................................................................................................... 18
1.2.1.4 Envelope.......................................................................................................... 18
1.2.1.5 Core.................................................................................................................. 19
1.2.2 Genoma do VZV.................................................................................................. 19
1.2.2.1 Genes do VZV.................................................................................................. 20
1.2.2.2 Filogenia e Genótipos VZV.............................................................................. 21
1.3 Complicações no Sistema Nervoso Central (SNC) do VZV................................... 22
1.4 Tropismo..................................................................................................................
23
1.5 Vacina Contra Varicela............................................................................................
25
1.6 Epidemiologia..........................................................................................................
26
1.7 Epidemiologia Molecular.......................................................................................
26
2 OBJETIVOS............................................................................................................ 29
2.1 Geral ......................................................................................................................
29
2.2 Específicos ............................................................................................................ 29
3 MATERIAIS E MÉTODOS.........................................................................................
30
3.1 Modelo de Estudo...................................................................................................
37
3.2 Seleção das amostras...........................................................................................
37
3.3 Método de diagnóstico molecular..........................................................................
30
3.3.1 Detecção do genoma viral da família Herpesviridae...........................................
30
3.3.1.1 Extração de DNA.............................................................................................
30
3.3.1.2 Amplificação do DNA PCR..............................................................................
30
3.3.2 Sequenciamento de nucleotídeo.......................................................................
31
3.3.2.1 Amplificação do DNA PCR...............................................................................
31
3.3.2.1.1 Purificação do produto da PCR.....................................................................
32
xiii
4 RESULTADOS..........................................................................................................
34
4.1 Seleção de amostra e identificação do VZV..........................................................
34
4.2 Amplificação do DNA para sequenciamento ........................................................
34
4.3 Cronograma de Execução....................................................................................
35
5DISCUSSÃO.............................................................................................................
42
6CONCLUSÃO............................................................................................................
44
7 REFERÊNCIAS.........................................................................................................
45
8 ANEXOS....................................................................................................................
55
1
1 INTRODUÇÃO
1.2.1.2 Tegumento
1.2.1.3 Capsídeo
6
1.2.1.4 Envelope
1.2.1.5 Core
O Core do VZV contém DNA genômico de fita dupla linear17, que tem uma
forma toróide38-39.A baixa frequência de virions que apresentam essa morfologia
pode-se considerar suaconfiguração espacial do core no interior docapsídeo15.O
core pode também explicar a variação na forma do núcleo eminúmeros estudos40-41.
Como todos os herpesvírus, oVZV tem um DNA linear de fita dupla, o genoma
é de tamanho variável, mas a sequência que foi obtida compreende 124.884 pb e
7
contem pelo menos 72 estrutura de leituras abertas (open reading frame ORF) que
contém 70 genes distribuídos igualmente entre as duas cadeias de DNA12,.
Os genes que foram identificados, em sua maioria, por analogia com o HSV 1,
encontram-se listados com todos os 70 genes35. Apêndice A.
Figura 4– Árvore filogenética mostrando os cinco grandes clades VZV.Arvore filogenética do VZV
baseada em sequencias completas. Clado 1 Incluem 10 cepas: referencia Dumas (NC001348), Netherlands;
BC(AY548171), British Columbia, Canada; 36 (DQ479958), New Brunswick, Canada;49 (DQ479959), New
Brunswick, Canada; referencia cepa MSP (AY548170),Minnesota, EUA; 32p5 (DQ479961), Texas, EUA; Kel
(DQ479954), Iowa, EUA; SD(DQ479953), South Dakota, EUA; NH293 (DQ674250), EUA; SVETA
(EU154348),Russia; clado 3 incluem 4 cepas: referencia 03-500 (DQ479957), Alberta,Canada; 11 (DQ47995),
New Brunswick, Canada; 22 (DQ479956), New Brunswick,Canada; reference strain HJO (AJ871403), Germany;
clado 2 incluem um cepa: referencia strain pOka (AB097933), Japão; clado 5 incluem 5 cepas referência
CA123strain (DQ457052), California, USA; clado4 incluem 2 cepas: referencia 8(DQ479960), New Brunswick,
Canada and referencia DR (DQ452050), EUA.Fonte: JONAS SCHMIDT-CHANASIT et al.,201144.
1.4 Tropismo
Takahashi et. al. em 1970 foi o primeiro a desenvolver e testar a vacina contra
varicela a partir de vírus atenuados de estirpes Oka de VZV. Essa reprodução foi
feita a partir do métodopadrão da época:o víru foi isolado e passado em fibroblastos
13
1.6 Epidemiologia
VZV pode ser transmitido diretamente após contato com as lesões na pele de
pessoas infectadas, o vírus propaga-se rapidamente a outros indivíduos
susceptíveis. O índice de HZ aumenta com a idade, apontando com uma idade por
volta de 50 anos o índice é de aproximadamente 3 casos / 1000 pessoa-ano. Com
80 anos de idade o índice alcança 10 casos / 1000 pessoa-ano4,45.
2 OBJETIVOS
2.1 Geral
2.2 Específicos
3 MATERIAIS E MÉTODOS
3.3.1.1Extração de DNA.
O DNA viral foi extraído utilizando QIAamp Viral DNA Mini Kit (QIAamp Blood
DNA Mini Kit, Qiagen), seguindo-se as instruções do fabricante.
3.3.2Sequenciamento de nucleotídeo
Nla GGAACCCCTGCACCATTAAA
222 54
Fok TCCCTTCATGCCCGTTACAT
Pst A TTGAA CAATCACGAACCGTT
350 38
Pst B CGGGTGAACCGTATTCTG AG
p22R1f GGG TTT TGT ATG AGC GTT GG
447 22
p22R1r CCC CCG AGG TTC GTA ATA TC
20
ultilizando o programa (Model test 2.1.7), metodo AIC para escolher o modelo.
3.5 Financiamento
4 RESULTADOS
275 pb
1 2 3 4 B 1 2 3 4 B M 1 2 3 4 B
447 pb
350 pb
222pb
Figura 8- Imagem do gel de agarose para os fragmentosde 447, 350 e 222pb das regiões
ORF22, 38 e 54 respectivamente do VZV.
23
5 6 7 8 9 10 11 12 B M 5 6 7 8 9 10 11 12 B M
350 pb
222 pb
5 6 7 8 9 10 11 12 B M
447 pb
encontra em todas as cepas japonesas e que está ausente na maioria dos VZV
isolado no EUA (Figura 12 e 13).
Figura 11- Representação do resultados das sequencias das regiões ORF 22, 38 e 54 alinhadas com a cepa Dumas12.
26
Figura 13.Representação daORF54 analizadas pela enzima de restrição BglII. O (Y) significa a presença de (C) ou (T ).
28
Figura 14.Arvore filogenética do VZV baseada na incluindo as amostras 05 e 07. Clado 1 Incluem 10 cepas:
referencia Dumas (NC001348), Netherlands; BC (AY548171), British Columbia, Canada; 36 (DQ479958), New
Brunswick, Canada; 49 (DQ479959), New Brunswick, Canada; referencia cepa MSP (AY548170), Minnesota,
EUA; 32p5 (DQ479961), Texas, EUA; Kel (DQ479954), Iowa, EUA; SD (DQ479953), South Dakota, EUA; NH293
(DQ674250), EUA; SVETA (EU154348), Russia; clado 3 incluem 4 cepas: referencia 03-500 (DQ479957),
Alberta, Canada; 11 (DQ47995), New Brunswick, Canada; 22 (DQ479956), New Brunswick, Canada; reference
strain HJO (AJ871403), Germany; clado 2 incluem 4 cepas: referencia strain pOka (AB097933), Japão, VariVax
(DQ008355), VariVax (DQ008354), Oka, sustrain pOka (AB097932); clado 5 incluem 1 cepa referência CA123
strain (DQ457052), California, USA; clado 4 incluem 2 cepas: referencia 8 (DQ479960), New Brunswick, Canada
and referencia DR (DQ452050), EUA.
30
5 DISCUSSÃO
países de origem de imigrantes do Brasil, mostrando que entre 2015 a 2010, 25%
são dos Estados Unidos e 6% do Reino Unido105.
6 CONCLUSÃO
7 REFERÊNCIAS BIBLIOGRAFICAS
1. Arie jz, jangu eb, john rp, paul dg, barry ds. Principles and practice of clinical
virology. 5ed. Englad:john wiley & sons ltd.:2004.
6. Tsolia m, gershon a a., steiberg sp, gelb l. Live attenuated varicella vaccine:
evidence that the virus is attenuated and the importance of skin lesions in
transmission of varicella-zoster virus. J pediatr [internet]. 1990 feb;116(2):184–
9. Available from:
http://linkinghub.elsevier.com/retrieve/pii/s0022347605828720
9. Davison aj. Evolution of the herpesviruses. Vet microbiol [internet]. 2002 apr
22;86(1-2):69–88. Available from:
http://www.ncbi.nlm.nih.gov/pubmed/11888691
11. Viralzone [internet]; acids res. 2011 jan;39 [acesso em 04 abril 2014].
Disponível em: viralzone.expasy.org/all_by_species/179.html
12. Davison a j, scott je. The complete dna sequence of varicella-zoster virus. J
gen virol [internet]. 1986 sep;67 ( pt 9):1759–816. Available
from:http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=421634&tool=p
mcentrez&rendertype=abstract
34
13. King amq, adams mj, carstens eb, lefkowitz ej. Virus taxonomy.
14. Barnes dw, whitley rj. Cns diseases associated with varicella zoster virus and
herpes simplex virus infection. Pathogenesis and current therapy. Neurol clin
1986;4(1):265–83.
15. Poultry r. Dna configuration in the core of marek ’ s disease virus mjr *.
1974;13(5):1148–50.
17. Cohen, j. I., and s. E. Straus. 1995. Varicella-zoster virus and its replication, p.
2525–2546. In b. Fields (ed.), virology, 3rd ed. Raven press, new york.
19. Ambagala apn, cohen ji. Varicella-zoster virus ie63, a major viral latency
protein, is required to inhibit the alpha interferon-induced antiviral response. J
virol [internet]. 2007 aug [cited 2014 apr 2];81(15):7844–51. Available from:
http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1951283&tool=pmce
ntrez&rendertype=abstract
22. Edson cm, hosler ba, respess ra, waters dj. Cross-reactivity between herpes
simplex virus glycoprotein b and a 63 , 000-dalton varicella-zoster virus
envelope glycoprotein. 1985;
35
23. Keller pm, neff bj, ellis rw. Three major glycoprotein genes of varicella-zoster
virus whose products have neutralization epitopes. 1984;52(1).
26. Weigle, k. A., and c. Grose. 1983. Common expression of varicella-zoster viral
glycoproteins in vitro and in chickenpox and zoster vesicles. J. Infect. Dis.
148:630-638.
27. Forghani b, dupuis kw, schmidt nj. With monoclonal antibodies . Varicella-
zoster viral glycoproteins analyzed with monoclonal antibodies. 1984;52(1).
29. Grose c, edwards dp, friedrichs we, mcguire wl. Monoclonal antibodies against
three major glycoproteins of monoclonal antibodies against three major
glycoproteins of varicella-zoster virus. 1983;
31. Davison a j, waters dj, edson cm. Identification of the products of a varicella-
zoster virus glycoprotein gene. J gen virol [internet]. 1985 oct;66 ( pt 10:2237–
42. Available from: http://www.ncbi.nlm.nih.gov/pubmed/2995558
32. Mettenleiter tc, klupp bg, granzow h. Herpesvirus assembly: an update. Virus
res [internet]. 2009 aug [cited 2014 mar 21];143(2):222–34. Available from:
http://www.ncbi.nlm.nih.gov/pubmed/19651457
33. Roizman b, knipe dm, whitley rj. 2007. Herpes simplex viruses, p 2501–
2601.inknipe dm, howley pm, griffin de, lamb ra, martin ma, roizman b, straus
se (ed), fields virology, 5th ed. Lippincott williams & wilkins, philadelphia, pa.
34. Kelly bj, fraefel c, cunningham al, diefenbach rj. Functional roles of the
tegument proteins of herpes simplex virus type 1. Virus res [internet]. 2009 nov
[cited 2014 apr 2];145(2):173–86. Available from:
http://www.ncbi.nlm.nih.gov/pubmed/19615419
39. Nazerian k. Dna configuration in the core of marek ’ s disease virus dna
configuration in the core of marek ' s disease virus. 1974;13(5).
37
41. Roizman, b., s. B. Spring, and j. Schwartz. 1969. The herpes virion and its
precursors made in productively and in abortively infected cells. Proc. Nat.
Acad. Sci. U.s.a. 28: 1890-1898.
42. Quinlivan m, breuer j. Molecular studies of varicella zoster virus. Rev med virol
[internet]. 2006;16(4):225–50. Available from:
http://www.ncbi.nlm.nih.gov/pubmed/16791838
43. Breuer j, grose c, norberg p, tipples g, schmid ds. A proposal for a common
nomenclature for viral clades that form the species varicella-zoster virus:
summary of vzv nomenclature meeting 2008, barts and the london school of
medicine and dentistry, 24-25 july 2008. J gen virol [internet]. 2010 apr [cited
2014 apr 2];91(pt 4):821–8. Available from:
http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2888159&tool=pmce
ntrez&rendertype=abstract
45. Gershon a a, gershon md, breuer j, levin mj, oaklander al, griffiths pd.
Advances in the understanding of the pathogenesis and epidemiology of
herpes zoster. J clin virol [internet]. Elsevier b.v.; 2010 may [cited 2014 apr
2];48 suppl 1:s2–7. Available from:
http://www.ncbi.nlm.nih.gov/pubmed/20510263
46. Mehta sk, tyring sk, gilden dh, cohrs rj, leal mj, castro v a, et al. Varicella-zoster
virus in the saliva of patients with herpes zoster. J infect dis [internet]. 2008
mar 1 [cited 2014 apr 2];197(5):654–7. Available from:
http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2938732&tool=pmce
ntrez&rendertype=abstract
38
51. Massad, e.; azevedo-neto, r.s.; burattini, m.n. Et al. - assessing the efficacy of
a mixed vaccination strategy against rubella in são paulo, brazil. Int. J.
Epidem., 24: 842-850, 1995.
52. In v, paulo são, lúcia a, yu f, costa jm, amaku m, et al. Three year
seroepidemiological study of varicella-zoster. 2000;42(3):125–8.
54. Loparev vn, gonzalez a, tipples g, fickenscher h, torfason g, schmid ds, et al.
Global identification of three major genotypes of varicella-zoster virus :
longitudinal clustering and strategies for genotyping global identification of
three major genotypes of varicella-zoster virus : longitudinal clustering and
strategies for genotypi. 2004;
56. Roizman b, sears ae. Herpes simplex viruses and their replication. In: fields bn,
knipe dm, editors. Virology. 2nd edition. New york: raven; 1990. P. 1795–841.
39
58. Palu g, benetti l, calistri a. Molecular basis of the interactions between herpes
simplex viruses and hiv-1. Herpes 2001;8(2):50–5.
62. Oxman mn. Clinical manifestations of herpes zoster. In: arvin am, gershon aa,
editors. Varicella-zoster virus virology and clinical management. Cambridge,
uk: cambridge university press; 2002. P. 246-75.
64. Davison aj, edson cm, ellis rw, forghani b. New common nomenclature for
glycoprotein genes of varicella- zoster virus and their glycosylated products.
1986;57(3):1195–7.
70. Ha, k., baba, k., ikeda, t., nishida, m. & yabuuchi, h. Application of live varicella
vaccine to children with acute leukemia or other malignancies without
suspension of anticancer therapy the world wide web at : application of live
varicella vaccine to children with acute leukemia or other malignancies without
suspension of anticancer therapy. (1980).
71. Krause, p. R. & klinman, d. M. Efficacy, immunogenicity, safety, and use of live
attenuated chickenpox vaccine. J. Pediatr. 127, 518–25 (1995).
72. Annunziato pa, gershon aa. Primary immunization against varicella. In: arvin
am, gershon aa, eds. Varicella-zoster virus: virology and clinical management.
Cambridge, united kingdom: cambridge university press, 2000:460-76
73. Vazquez m. Varicella zoster virus infections in children after the introduction of
live attenuated varicella vaccine. Curr opin pediatr 2004;161:80–4.
74. Takahashi, m. Et al. Development of varicella vaccine. J. Infect. Dis. 197 suppl
2, s41–4 (2008).
75. The new england journal of medicine downloaded from nejm.org at uea on april
10, 2014. For personal use only. No other uses without permission. Copyright
© 1991 massachusetts medical society. All rights reserved. 1991;
78. Vázquez m, shapiro ed. Varicella vaccine and infection with varicella-zoster
virus. N engl j med [internet]. 2005 feb 3;352(5):439–40. Available from:
http://www.ncbi.nlm.nih.gov/pubmed/15689581.
79. Village eg. Varicella vaccine stanley a . Plotkin the online version of this article
, along with updated information and services , is located on the world wide
web at : illinois , 60007 . Copyright © 1996 by the american academy of
pediatrics . All rights reserved . Print varicella vaccine. 1996;
80. Village eg. Recommendations for the use of live attenuated varicella vaccine
committee on infectious diseases the online version of this article , along with
updated information and services , is located on the world wide web at : illinois ,
41
82. Arvin, am.; gilden, d. Fields virology. 6. Knipe, d.; howley, p., editors. Lippincott
williams&wilkins; 2013. P. 2015-2057.
84. moffat jf, et al. The orf47 and orf66 putative protein kinases of varicella-zoster
virus determine tropism for human t cells and skin in the scid-hu ouse. Proc
natl acad sci usa. 1998; 95:11969–11974. [pubmed: 9751774].
85. moffat jf, et al. Attenuation of the vaccine oka strain of varicella-zoster virus
and role of glycoprotein c in alphaherpesvirus virulence demonstrated in the
scid-hu mouse. J virol. 1998; 72:965–974. This study is the first report to model
vzv pathogenesis using t cell and skinxenografts in scid mice. [pubmed:
9444989].
86. Ku cc, et al. Tropism of varicella-zoster virus for human tonsillar cd4+ t
lymphocytes that express activation, memory and skin homing markers. J virol.
2002; 76:11425–11433. [pubmed:12388703]
87. Moffat jf, et al. The orf47 and orf66 putative protein kinases of varicella-zoster
virus determine tropism for human t cells and skin in the scid-hu mouse. Proc
natl acad sci usa.1998; 95:11969–11974. [pubmed: 9751774].
88. Schaap a, et al. T-cell tropism and the role of orf66 protein in pathogenesis of
varicella-zostervirus infection. J virol. 2005; 79:12921–12933. [pubmed:
16188994].
91. Arvin am, et al. Varicella-zoster virus t cell tropism and the pathogenesis of
skin infection. Currtop microbiol immunol. 2010; 342:189–209. [pubmed:
20397071].
92. Loparev, v.n., argaw, t., krause, p.r., takayama, m., schmid, d.s., 2000.
Improved identification and differentiation of varicella–zoster virus (vzv) wild-
type strains and an attenuated varicella vaccine strain using a vzv open
readingframe 62-based pcr. J. Clin. Microbiol. 38, 3156–3160.
42
94. Larussa, p.s., gershon, a.a., 2001. Biologic and geographic differences
betweenvaccine and clinical varicella–zoster virus isolates. Arch. Virol. Suppl.
41–48.
96. Cone, r., m. L. Huang, r. C. Ackman, and l. Corey. 1996. Coinfection with
human herpesvirus 6 variants a and b in lung tissue. J. Clin. Microbiol.34:877–
881.
98. Franti, m., j.-t. Aubin, l. Poirel, a. Gautheret-dejean, d. Candotti, j.-m. Huraux,
and h. Agut. 1998. Definition and distribution analysis of glycoproteinb gene
alleles of human herpes virus 7. J. Virol. 72:8725–8730.
100. Norberg, p., liljeqvist, j.a., bergstro¨m, t., sammons, s., schmid, d.s., loparev,
v.n., 2006. Complete-genome phylogenetic approach to varicella–zoster virus
evolution: genetic divergence and evidence for recombination. J. Virol. 80,
9569– 9576.
101. Peters, g.a., tyler, s.d., grose, c., severini, a., gray, m.j., upton, c., tipples, a.,
2006. A full-genome phylogenetic analysis of varicella–zoster virus reveals a
novel origin of replication-based genotyping scheme and evidence of
recombinationbetween major circulating clades. J. Virol. 80, 9850–9860.
102. Schmidt-chanasit, j., olschla¨ger, s., gu¨ nther, s., jaeger, g., bleymehl, k.,
scha¨d, s.g., heckel, g., ulrich, r.g., doerr, h.w., 2008b. Molecular analysis of
varicella– zoster virus strains circulating in tanzania demonstrating the
presence ofgenotype m1. J. Clin. Microbiol. 46, 3530–3533.
103. Mcgeoch, d.j., 2009. Lineages of varicella–zoster virus. J. Gen. Virol. 90,
963–969.
8 ANEXOS
GENES VZV
67 US7 (Gi) Gi
68 US8 (Ge) Ge
S/L None Cytoplasmic protein (also referred to as ORF0)
Fonte: ANDREW J. DAVISON et al.,1986.